Whole-exome sequencing reveals a rare interferon gamma receptor 1 mutation associated with myasthenia gravis.

PubMed

Qi, Guoyan; Liu, Peng; Gu, Shanshan; Yang, Hongxia; Dong, Huimin; Xue, Yinping

2018-04-01

Our study is aimed to explore the underlying genetic basis of myasthenia gravis. We collected a Chinese pedigree with myasthenia gravis, and whole-exome sequencing was performed on the two affected siblings and their parents. The candidate pathogenic gene was identified by bioinformatics filtering, which was further verified by Sanger sequencing. The homozygous mutation c.G40A (p.V14M) in interferon gamma receptor 1was identified. Moreover, the mutation was also detected in 3 cases of 44 sporadic myasthenia gravis patients. The p.V14M substitution in interferon gamma receptor 1 may affect the signal peptide function and the translocation on cell membrane, which could disrupt the binding of the ligand of interferon gamma and antibody production, contributing to myasthenia gravis susceptibility. We discovered that a rare variant c.G40A in interferon gamma receptor 1 potentially contributes to the myasthenia gravis pathogenesis. Further functional studies are needed to confirm the effect of the interferon gamma receptor 1 on the myasthenia gravis phenotype.

(PCG) Protein Crystal Growth Gamma-Interferon

NASA Technical Reports Server (NTRS)

1989-01-01

(PCG) Protein Crystal Growth Gamma-Interferon. Stimulates the body's immune system and is used clinically in the treatment of cancer. Potential as an anti-tumor agent against solid tumors as well as leukemia's and lymphomas. It has additional utility as an anti-ineffective agent, including antiviral, anti-bacterial, and anti-parasitic activities. Principal Investigator on STS-26 was Charles Bugg.

The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis

DTIC Science & Technology

2017-09-01

AWARD NUMBER: W81XWH-16-1-0537 TITLE: The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis PRINCIPAL INVESTIGATOR: Stanley...Sep 2016 - 31 Aug 2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis 5b...subsets that likely counteracts IL-2 regulator activity and contribute to the pathogenesis of RA. 15. SUBJECT TERMS Rheumatoid arthritis ; Autoimmunity; T

Interferon-alpha and interferon-gamma sensitize human tenon fibroblasts to mitomycin-C.

PubMed

Wang, Xiao Yang; Crowston, Jonathan G; Zoellner, Hans; Healey, Paul R

2007-08-01

To investigate the effect of interferon (IFN)-alpha and IFN-gamma pretreatment on mitomycin C (MMC)-induced cell death in human Tenon fibroblasts (HTFs) and the mechanisms by which IFN-alpha and IFN-gamma modulate the susceptibility of HTFs to MMC. HTFs were pretreated with IFN-alpha and IFN-gamma for 48 hours before 5-minute application of 0.4 mg/mL MMC. Cell death after 48 hours was determined by Annexin V/propidium iodide (PI) staining and lactate dehydrogenase (LDH) release assay. Fas, Fas-ligand, and Bcl-2 expression were determined by flow cytometry. Fas associated death domain (FADD), Bax, cytochrome c, and caspase expression were determined by Western blot analysis and immunofluorescence staining. MMC treatment increased cell death and upregulated Fas and FADD expression, but had no effect on Fas-Ligand, Bax, Bcl-2, or cytochrome c. Neither IFN-alpha nor IFN-gamma alone induced HTF death, but each increased cell death 2 days after MMC treatment in a dose-dependent fashion. Combination IFN-alpha and IFN-gamma had a synergistic effect. IFN-alpha and IFN-gamma pretreatment increased Fas expression. Fas upregulation was associated with increased sensitivity to MMC. IFN pretreatment increased procaspase-8, procaspase-9, and procaspase-3 expression, and caspase-3 activation. Caspase-8, caspase-3, and broad caspase inhibitors, but not caspase-9 inhibitor, inhibited MMC-induced cell death in nonpretreated and IFN-pretreated cells. IFN-alpha and IFN-gamma enhance the susceptibility of HTFs to MMC-induced cell death through a Fas-mediated and a caspase-3-dependent pathway. Pretreatment with IFN primed HTFs to MMC, providing a potential means for initially slowing the healing response with IFN and subsequently terminating fibroblast activity through MMC-induced cell death.

Comparison of Tuberculin Skin Test result and interferon gamma response to human PPD in BCG scar positive and negative children.

PubMed

Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza

2014-03-01

The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.

Interferon-gamma induces apoptosis and augments the expression of Fas and Fas ligand by microglia in vitro.

PubMed

Badie, B; Schartner, J; Vorpahl, J; Preston, K

2000-04-01

Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.

Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research

Cancer.gov

Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study suggests that interferon-gamma, which has been thought to contribute to an innate defense system against cancer, under some circumstances, may instead promote melanoma and incite the development of tumors.

Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.

PubMed Central

Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G

1996-01-01

The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817

Effect of gamma interferon on resolution of murine chlamydial genital infection.

PubMed Central

Rank, R G; Ramsey, K H; Pack, E A; Williams, D M

1992-01-01

Mice infected in the genital tract with the Chlamydia trachomatis agent of mouse pneumonitis were treated with monoclonal rat anti-gamma interferon (anti-IFN-gamma) antibody to determine whether IFN-gamma participated in the resolution of the infection. In two experiments, anti-IFN-gamma antibody treatment resulted in significantly prolonged infections. In support of these data, passive administration of recombinant IFN-gamma to chronically infected nu/nu mice was able to bring about resolution of the infection in some animals. PMID:1398955

Review of the recombinant human interferon gamma as an immunotherapeutic: Impacts of production platforms and glycosylation.

PubMed

Razaghi, Ali; Owens, Leigh; Heimann, Kirsten

2016-12-20

Human interferon gamma is a cytokine belonging to a diverse group of interferons which have a crucial immunological function against mycobacteria and a wide variety of viral infections. To date, it has been approved for treatment of chronic granulomatous disease and malignant osteopetrosis, and its application as an immunotherapeutic agent against cancer is an increasing prospect. Recombinant human interferon gamma, as a lucrative biopharmaceutical, has been engineered in different expression systems including prokaryotic, protozoan, fungal (yeasts), plant, insect and mammalian cells. Human interferon gamma is commonly expressed in Escherichia coli, marketed as ACTIMMUNE ® , however, the resulting product of the prokaryotic expression system is unglycosylated with a short half-life in the bloodstream; the purification process is tedious and makes the product costlier. Other expression systems also did not show satisfactory results in terms of yields, the biological activity of the protein or economic viability. Thus, the review aims to synthesise available information from previous studies on the production of human interferon gamma and its glycosylation patterns in different expression systems, to provide direction to future research in this field. Copyright © 2016 Elsevier B.V. All rights reserved.

Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.

PubMed

Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y

2017-10-01

Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.

Recent considerations in the use of recombinant interferon gamma for biological therapy of atopic dermatitis.

PubMed

Brar, Kanwaljit; Leung, Donald Y M

2016-01-01

Atopic dermatitis (AD) is the most common inflammatory skin disease in the general population. There are different endophenotypes of AD that likely have a unique immune and molecular basis, such as those who are predisposed to eczema herpeticum, or Staphylococcus aureus infections. In this review, we highlight the endophenotypes of AD where reduced interferon gamma expression may be playing a role. Additionally, we review the potential role of recombinant interferon gamma therapy in the treatment of atopic dermatitis and the particular phenotypes that may benefit from this treatment. Recombinant interferon gamma treatment will likely benefit the pediatric population with AD, as well as those with susceptibilities for skin infections. Future studies are needed to elucidate whether IFN-γ may reduce the prevalence of skin infection in AD.

Production of interferon-gamma by in vivo tumor-sensitized T cells: Association with active antitumor immunity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bursuker, I.; Pearce, M.T.

1990-02-01

The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less

The role of interferon gamma release assays in the monitoring of response to anti-tuberculosis treatment in children.

PubMed

Shaik, Junaid; Pillay, Manormoney; Jeena, Prakash

2014-09-01

Successful control of childhood TB requires early diagnosis, effective chemotherapy and a method of evaluating the response to therapy. Identification of suitable biomarkers that predict the response to anti-TB therapy may allow the duration of treatment to be shortened. The majority of biomarker studies in paediatric TB have focused on the role of T cell-based interferon-gamma (IFN-γ) release assays (IGRAs) in the diagnosis of either latent or active disease. Little has been published on the role of IGRAs in the monitoring response to therapy in children. We reviewed the available literature to ascertain the value of IGRAs in the monitoring of response to anti-TB therapy in children. We explored the results of the few studies that have investigated the role of IGRAs as markers of response to anti-TB treatment in children. We conclude that the role of IGRAs as surrogate markers appears promising. Robust clinical trials are, however, needed to entrench the value of IGRAs as surrogate biomarkers of response to anti-TB therapy in children. Copyright © 2013 Elsevier Ltd. All rights reserved.

Interferon-gamma of the giant panda (Ailuropoda melanoleuca): complementary DNA cloning, expression, and phylogenetic analysis.

PubMed

Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong

2010-01-01

Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.

Inhibited interferon-gamma but normal interleukin-3 production from rats flown on the Space Shuttle

NASA Technical Reports Server (NTRS)

Gould, Cheryl L.; Lyte, Mark; Williams, Joann; Mandel, Adrian D.; Sonnenfeld, Gerald

1987-01-01

Rats were flown on Space Shuttle SL-3 for one week. When spleen cells were removed from these rats and challenged with concanavalin-A, interferon-gamma production was severely inhibited, while interleukin-3 production was unaffected compared to ground-based control rats. These data indicate that there is a defect in interferon-gamma production in rats that have been exposed to spaceflight. This defect could contribute to, and be one reason for, immunosuppression observed after spaceflight.

[Fish interferon response and its molecular regulation: a review].

PubMed

Zhang, Yibing; Gui, Jianfang

2011-05-01

Interferon response is the first line of host defense against virus infection. Recent years have witnessed tremendous progress in understanding of fish innate response to virus infection, especially in fish interferon antiviral response. A line of fish genes involved in interferon antiviral response have been identified and functional studies further reveal that fish possess an IFN antiviral system similar to mammals. However, fish virus-induced interferon genes contain introns similar to mammalian type III interferon genes although they encode proteins similar to type I interferons, which makes it hard to understand the evolution of vertebrate interferon genes directly resulting in a debate on nomenclature of fish interferon genes. Actually, fish display some unique mechanisms underlying interferon antiviral response. This review documents the recent progress on fish interferon response and its molecular mechanism.

Interferon Gamma as a Biomarker of Exposure to Enteric Viruses

EPA Science Inventory

Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...

The tuberculin skin test increases the responses measured by T cell interferon-gamma release assays.

PubMed

Vilaplana, C; Ruiz-Manzano, J; Gil, O; Cuchillo, F; Montané, E; Singh, M; Spallek, R; Ausina, V; Cardona, P J

2008-06-01

RUTI is a vaccine consisting of Mycobacterium tuberculosis bacilli grown in stress conditions that is fragmented, detoxified and liposomed. RUTI was designed to shorten the treatment of latent tuberculosis infection (LTBI) with isoniazid from 9 months to just 1 month, by additional treatment with two inoculations of RUTI 4 weeks apart. During the validation process for monitoring the immunogenicity of administration of RUTI in a Phase I clinical trial, the question arose whether to introduce the tuberculin skin test (TST) in the screening of non-LTBI volunteers. This study was designed to evaluate the effect of TST on subsequent different T-cell interferon-gamma release assay (TIGRA) responses, using a spectrum of M. tuberculosis-related antigens (ESAT-6, CFP-10, 16 kDa, 19 kDa, MPT64, Ag 85B, 38 kDa, hsp65, PPD and BCG). The results showed an increase in post-TST response even in non-LTBI subjects for most antigens tested, as measured both by whole blood assay (WBA) and ELISPOT. Increased ELISPOT response decreased toward pre-TST levels within 1 month whereas the WBA response did not. Taking into account that there is no definitive correlation between TST and TIGRA tests to diagnose LTBI and the feasibility that TST might alter the immune monitoring included in clinical trials, these data suggest that TST determination should be carefully planned to avoid any interference with TIGRA.

Persistently retained interferon-gamma responsiveness in individuals with a history of pulmonary tuberculosis.

PubMed

Seo, Kwang Won; Ahn, Jong-Joon; Ra, Seung Won; Kwon, Woon-Jung; Jegal, Yangjin

2014-06-01

The interferon gamma (IFN-γ) release assays (IGRAs) are the best method of detecting Mycobacterium tuberculosis infection. However, reports on IGRAs results obtained during and right after the treatment of tuberculosis (TB) have presented differing results. Some studies have shown declining responses, whereas other reports described persistent, fluctuating, or increasing responses. We postulated that the IGRA-positivity will decrease or revert long time after treatment of TB, and thus, evaluated the response of IGRA in subjects with a history of pulmonary TB. Seventy subjects (M:F = 51:19; age = 53.2 ± 11.8 years) underwent tuberculin skin tests (TSTs) and IGRA. The interval of time elapsed after the completion of anti-TB treatment was < 10 years for 16 subjects, 10-20 years for 13 subjects, 20-30 years for 16 subjects, and ≥ 30 years for 25 subjects. The TST was positive in 49 subjects (74%) and negative in 17 subjects (26%). The IGRA was positive in 52 subjects (74%) and negative in 18 subjects (26%). The IFN-γ level and the size of induration showed good correlation (r = 0.525, P < 0.001). However, the correlation between time elapsed after the completion of anti-TB treatment and the size of induration or that between time and the IFN-γ level was not significant. The TST and IGRA were positive in 72.7% and 68.0% of subjects ≥ 30 years after the treatment of pulmonary TB. In conclusion, majority of subjects with a history of pulmonary TB are IGRA-positive, even a few decades after the completion of anti-TB treatment.

Production and characterization of guinea pig recombinant gamma interferon and its effect on macrophage activation.

PubMed

Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N

2006-01-01

Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.

Equine interferon gamma synthesis in lymphocytes after in vivo infection and in vitro stimulation with EHV-1.

PubMed

Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H

2005-08-22

Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.

Ionizing radiation potentiates the induction of nitric oxide synthase by interferon-gamma (Ifn-gamma) or Ifn-gamma and lipopolysaccharide in bnl cl.2 murine embryonic liver cells: role of hydrogen peroxide.

PubMed

Yoo, J C; Pae, H O; Choi, B M; Kim, W I; Kim, J D; Kim, Y M; Chung, H T

2000-02-01

The effects of ionizing irradiation on the nitric oxide (NO) production in murine embryonic liver cell line, BNL CL.2 cells, were investigated. Various doses (5-40 Gy) of radiation made BNL CL.2 cells responsive to interferon-gamma alone for the production of NO in a dose-dependent manner. Small amounts of lipopolysaccharide (LPS) or tumor necrosis factor-alpha (TNF-alpha) synergized with IFN-gamma in the production of NO from irradiated BNL CL.2 cells, even though LPS or TNF-alpha alone did not induce NO production from the same cells. Immunoblots showed parallel induction of inducible nitric oxide synthase (iNOS). NO production in irradiated BNL CL.2 cells by IFN-gamma or IFN-gamma plus LPS was decreased by the addition of catalase, suggesting that H(2)O(2) produced by ionizing irradiation primed the cells to trigger NO production in response to IFN-gamma or IFN-gamma plus LPS. Furthermore, the treatment of nongamma-irradiated BNL CL.2 cells with H(2)O(2) made the cells responsive to IFN-gamma or IFN-gamma plus LPS for the production of NO. This study shows that ionizing irradiation has the ability to induce iNOS gene expression in responsive to IFN-gamma via the formation of H(2)O(2) in BNL CL.2 murine embryonic liver cells.

Interferon-γ Inhibits Ebola Virus Infection.

PubMed

Rhein, Bethany A; Powers, Linda S; Rogers, Kai; Anantpadma, Manu; Singh, Brajesh K; Sakurai, Yasuteru; Bair, Thomas; Miller-Hunt, Catherine; Sinn, Patrick; Davey, Robert A; Monick, Martha M; Maury, Wendy

2015-01-01

Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.

Interferon system in women with genital papillomavirus infection receiving immunomodulatory therapy.

PubMed

Rogovskaya, S I; Zhdanov, A V; Loginova, N S; Faizullin, L Z; Prilepskaya, V N; Van'ko, L V; Sukhikh, G T

2002-11-01

The interferon system was studied in women with genital papillomavirus infection. In most patients the interferon system was activated, while the ability of lymphocytes to respond to inductors decreased. Laserotherapy and immunomodulatory therapy with larifan, ridostin, and viferon for 1 month normalized blood interferon concentration (39.4% patients) and interferon-gamma production by lymphocytes in response to inductors (87.9% patients). After laser monotherapy these parameters returned to normal only in 13.2 and 7.6% patients, respectively. Correlation and regression analyses showed that changes in the interferon system were synchronized after immunomodulatory therapy. These data indicate that immunomodulatory therapy produces a complex effect on the interferon system. Measurements of blood interferon level can be used to predict the effect of further treatment with interferon-gamma inductors.

Protective Role of Gamma Interferon during the Recall Response to Influenza Virus

PubMed Central

Bot, Adrian; Bot, Simona; Bona, Constantin A.

1998-01-01

During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110

Dysregulation of Serum Gamma Interferon Levels in Vascular Chronic Q Fever Patients Provides Insights into Disease Pathogenesis

PubMed Central

Kremers, Marjolein N. T.; Hodemaekers, Hennie M.; Hagenaars, Julia C. J. P.; Koning, Olivier H. J.; Renders, Nicole H. M.; Hermans, Mirjam H. A.; de Klerk, Arja; Notermans, Daan W.; Wever, Peter C.; Janssen, Riny

2015-01-01

A large community outbreak of Q fever occurred in the Netherlands in the period 2007 to 2010. Some of the infected patients developed chronic Q fever, which typically includes pathogen dissemination to predisposed cardiovascular sites, with potentially fatal consequences. To identify the immune mechanisms responsible for ineffective clearance of Coxiella burnetii in patients who developed chronic Q fever, we compared serum concentrations of 47 inflammation-associated markers among patients with acute Q fever, vascular chronic Q fever, and past resolved Q fever. Serum levels of gamma interferon were strongly increased in acute but not in vascular chronic Q fever patients, compared to past resolved Q fever patients. Interleukin-18 levels showed a comparable increase in acute as well as vascular chronic Q fever patients. Additionally, vascular chronic Q fever patients had lower serum levels of gamma interferon-inducible protein 10 (IP-10) and transforming growth factor β (TGF-β) than did acute Q fever patients. Serum responses for these and other markers indicate that type I immune responses to C. burnetii are affected in chronic Q fever patients. This may be attributed to an affected immune system in cardiovascular patients, which enables local C. burnetii replication at affected cardiovascular sites. PMID:25924761

Assessment of safety and interferon gamma responses of Mycobacterium bovis BCG vaccine in goat kids and milking goats.

PubMed

Pérez de Val, Bernat; Vidal, Enric; López-Soria, Sergio; Marco, Alberto; Cervera, Zoraida; Martín, Maite; Mercader, Irene; Singh, Mahavir; Raeber, Alex; Domingo, Mariano

2016-02-10

Vaccination of domestic animals has emerged as an alternative long-term strategy for the control of tuberculosis (TB). A trial under field conditions was conducted in a TB-free goat herd to assess the safety of the Mycobacterium bovis BCG vaccine. Eleven kids and 10 milking goats were vaccinated with BCG. Bacterial shedding and interferon gamma (IFN-γ) responses were monitored throughout the study. Comprehensive pathological examination and mycobacterial culture of target tissues were performed. BCG vaccine strain was only isolated from the draining lymph node of the injection site of a kid euthanized at week 8 post-vaccination. The remaining animals were euthanized at week 24. Six out of 20 showed small granulomas at the injection site. BCG shedding was not detected in either faeces or in milk throughout the study. All vaccinated kids showed BCG-induced IFN-γ responses at week 8 post-vaccination. BCG vaccination of goats showed no lack of biological safety for the animals, environment and public health, and local adverse reactions were negligible. Copyright © 2016 Elsevier Ltd. All rights reserved.

Human Atopic Dermatitis Complicated by Eczema Herpeticum is Associated with Abnormalities in Gamma Interferon Response

PubMed Central

Leung, Donald YM; Gao, Pei-Song; Grigoryev, Dmitry N; Rafaels, Nicholas M; Streib, Joanne E; Howell, Michael D; Taylor, Patricia A; Boguniewicz, Mark; Canniff, Jennifer; Armstrong, Brian; Zaccaro, Daniel J; Schneider, Lynda C; Hata, Tissa R; Hanifin, Jon M; Beck, Lisa A; Weinberg, Adriana; Barnes, Kathleen C

2011-01-01

Background The basis for increased susceptibility of atopic dermatitis (AD) patients to develop disseminated viral skin infections such as eczema herpeticum (ADEH+) is poorly understood. Objective We sought to determine whether atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Methods GeneChip profiling was used to identify differences in gene expression of peripheral blood mononuclear cells (PBMC) from patients with a history of ADEH+ as compared to ADEH− and non-atopic controls. Key differences in protein expression were verified by ELISPOT and/or ELISA. Clinical relevance was further demonstrated by a mouse model of disseminated viral skin infection and genetic association analysis for genetic variants in IFNG and IFNGR1 and ADEH among 435 cases and controls. Results We demonstrate by global gene expression analysis selective transcriptomic changes within the interferon (IFN) superfamily of PBMCs from ADEH+ subjects reflecting low IFNγ and IFNγ receptor gene expression. IFNγ protein production was also significantly lower in ADEH+ (N=24) compared to ADEH− (N=20) and non-atopic (NA; N=20) controls. IFNγ receptor knockout (KO) mice developed disseminated viral skin infection after epicutaneous challenge with vaccinia virus (VV). Genetic variants in IFNG and IFNGR1 SNPs were significantly associated with ADEH (112 cases, 166 controls) and IFNγ production: a 2-SNP (A–G) IFNGR1 haplotype (rs10457655 and rs7749390) showed the strongest association with a reduced risk of ADEH+ ((13.2% ADEH+ vs 25.5% ADEH−, P = 0.00057). Conclusions ADEH+ patients have reduced IFNγ production, and IFNG and IFNGR1 SNPs are significantly associated with ADEH+ and may contribute to an impaired immune response to herpes simplex virus (HSV). Clinical Implications Atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Capsule summary Using genomic

Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels

NASA Technical Reports Server (NTRS)

Pierangeli, Silvia S.; Sonnenfeld, Gerald

1989-01-01

Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.

Interferon Gamma in African Trypanosome Infections: Friends or Foes?

PubMed

Wu, Hui; Liu, Gongguan; Shi, Meiqing

2017-01-01

African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.

COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?

PubMed Central

Levick, Scott P.; Goldspink, Paul H.

2013-01-01

The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353

Mice with Pulmonary Tuberculosis Treated with Mycobacterium vaccae Develop Strikingly Enhanced Recall Gamma Interferon Responses to M. vaccae Cell Wall Skeleton▿

PubMed Central

Rodríguez-Güell, Elisabeth; Agustí, Gemma; Corominas, Mercè; Cardona, Pere-Joan; Luquin, Marina; Julián, Esther

2008-01-01

Whole heat-killed Mycobacterium vaccae is used as an immunotherapeutic agent in tuberculosis (TB), but the compound(s) that triggers its immunostimulatory ability is not known. Here, we show that among different subcellular fractions, the cell wall skeleton induced a prominent expression of gamma interferon in splenocytes from both non-TB and TB M. vaccae-treated mice. PMID:18337379

Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.

PubMed

Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F

2003-01-01

A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.

Complementation of a mutant cell line: central role of the 91 kDa polypeptide of ISGF3 in the interferon-alpha and -gamma signal transduction pathways.

PubMed Central

Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M

1993-01-01

Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454

CD4 T lymphocytes from patients with chronic fatigue syndrome have decreased interferon-gamma production and increased sensitivity to dexamethasone.

PubMed

Visser, J; Blauw, B; Hinloopen, B; Brommer, E; de Kloet, E R; Kluft, C; Nagelkerken, L

1998-02-01

A disturbed hypothalamus-pituitary-adrenal gland axis and alterations at the immune system level have been observed in patients with chronic fatigue syndrome (CFS). Glucocorticoids are known to modulate T cell responses; therefore, purified CD4 T cells from CFS patients were studied to determine whether they have an altered sensitivity to dexamethasone (DEX). CD4 T cells from CFS patients produced less interferon-gamma than did cells from controls; by contrast, interleukin-4 production and cell proliferation were comparable. With CD4 T cells from CFS patients (compared with cells from controls), a 10- to 20-fold lower DEX concentration was needed to achieve 50% inhibition of interleukin-4 production and proliferation, indicating an increased sensitivity to DEX in CFS patients. Surprisingly, interferon-gamma production in patients and controls was equally sensitive to DEX. A differential sensitivity of cytokines or CD4 T cell subsets to glucocorticoids might explain an altered immunologic function in CFS patients.

Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research

Cancer.gov

Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study

Double-blind trial of recombinant gamma-interferon versus placebo in the treatment of rheumatoid arthritis. 1989.

PubMed

Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D

2008-02-01

One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.

Stress-induced alterations in interferon production and class II histocompatibility antigen expression

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Cunnick, J. E.; Armfield, A. V.; Wood, P. G.; Rabin, B. S.

1992-01-01

Mild electric foot-shock has been shown to be a stressor that can alter immune responses. Male Lewis rats were exposed to one session of 16 5.0-s 1.6-mA foot-shocks. Production of interferon-gamma by splenocytes in response to concanavalin-A was decreased in spleens from the shocked rats compared to control spleens. Spleen cells from rats treated with nadolol, a peripherally acting beta-adrenergic receptor antagonist, and then shocked, showed dose-dependent attenuation of the suppression of interferon-gamma production. This suggests that catecholamines mediate shock-induced suppression of interferon-gamma production. The percentage of splenic mononuclear cells expressing class II histocompatibility (Ia) antigens on their surfaces from spleens of shocked rats was determined by flow cytometry. Significantly decreased class II positive mononuclear cells were present in the spleens of shocked rats in comparison to the spleens of control rats. This may reflect an alteration of cell trafficking or decreased production of class II antigens.

Monoclonal antibody against interferon gamma can prevent experimental cerebral malaria and its associated overproduction of tumor necrosis factor.

PubMed Central

Grau, G E; Heremans, H; Piguet, P F; Pointaire, P; Lambert, P H; Billiau, A; Vassalli, P

1989-01-01

Experimental cerebral malaria (ECM), a lethal hyperacute neurological syndrome associated with high blood levels of tumor necrosis factor, develops in genetically susceptible (CBA/Ca) mice 7 days after infection with Plasmodium berghei ANKA strain. Injections of neutralizing monoclonal antibody against recombinant murine interferon gamma, not later than 4 days after infection, markedly reduced the incidence of ECM and the elevation in serum levels of tumor necrosis factor. This treatment prevented the cerebral lesions (plugging of brain vessels by monocytes, lymphocytes, and parasitized erythrocytes). In contrast, the extent of macrophage infiltration in lymphoid organs (which is a characteristic feature of mice developing ECM), as well as the course of infection, remained unaffected by the antibody treatment. Protected mice died at a later time of severe anemia and overwhelming parasitemia, the usual outcome of P. berghei infection in mice that are not susceptible to ECM. The present data indicate that interferon gamma constitutes an important link in the cytokine network that leads to brain vessel inflammation in experimental malaria. It is proposed that interferon gamma released by activated CD4+ T cells acts by augmenting both production and action of tumor necrosis factor. PMID:2501793

Graft-versus-host disease causes failure of donor hematopoiesis and lymphopoiesis in interferon-gamma receptor-deficient hosts.

PubMed

Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude

2008-09-01

The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.

Interferon-gamma enhances radiation-induced cell death via downregulation of Chk1

PubMed Central

Kim, Kwang Seok; Choi, Kyu Jin; Bae, Sangwoo

2012-01-01

Interferon-gamma (IFNγ) is a cytokine with roles in immune responses as well as in tumor control. Interferon is often used in cancer treatment together with other therapies. Here we report a novel approach to enhancement of cancer cell killing by combined treatment of IFNγ with ionizing radiation. We found that IFNγ treatment alone in HeLa cells induced phosphorylation of Chk1 in a time- and dose-dependent manner, and resulted in cell arrest. Moreover IFNγ treatment was correlated with attenuation of Chk1 as the treatment shortened protein half-life of Chk1. As Chk1 is an essential cell cycle regulator for viability after DNA damage, attenuation of Chk1 by IFNγ pre-treatment in HeLa cells resulted in increased cell death following ionizing radiation about 2-folds than ionizing radiation treatment alone whereas IFNγ treatment alone had little effect on cell death. X-linked inhibitor of apoptosis-associated factor 1 (XAF1), an IFN-induced gene, seems to partly regulate IFNγ-induced Chk1 destabilization and radiation sensitivity because transient depletion of XAF1 by siRNA prevented IFNγ-induced Chk1 attenuation and partly protected cells from IFNγ-enhanced radiation cell killing. Therefore the results provide a novel rationale to combine IFNγ pretreatment and DNA-damaging anti-cancer drugs such as ionizing radiation to enhance cancer cell killing. PMID:22825336

[Gamma interferon: basics aspects, clinic significance and terapeutic uses].

PubMed

Mata-Espinosa, Dulce A; Hernández-Pando, Rogelio

2008-01-01

Interferons are a family of pleiotropic cytokines, their name was assigned because of their anti-replicative viral activity. IFNgamma or immune type II interferon does not share receptors with the type I interferon, its structure is different and its gene is located in different chromosome, although its biologic effects are similar. Along of several years of research, it has been found that IFNgamma enhances the transcription of genes involved in immunomodulation, antiviral responses and antitumoral activities. Regarding to the immune system, IFNgamma increases the cytotoxic and phagocytic activity of macrophages and upregulates the expression of major histocompatibility complex (MHC) class I and class II molecules in dendritics cells and other antigen presenting cells. IFNgamma also promotes the development and differentiation of naive CD4+ T lymphocytes to Th1 helper subset. Indeed, this cytokine has a key role in the control of bacterial, micotic, viral and parasitic infections. Depending of the micro-environment, IFNgamma has a dual role as pro or anti inflammatory cytokine. Novel therapeutic strategies are currently being developed with the aim to enhance the immune response or replace IFNgamma gene abnormal expression with beneficial results in humans, being recombinant IFNgamma safe and well tolerated.

Inhibited interferon production after space flight

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Gould, C. L.; Williams, J.; Mandel, A. D.

1988-01-01

Several studies have been performed in our laboratories indicating that interferon production may be impaired in rodents after space flight. Using an antiorthostatic suspension model that simulates some of the effects of microgravity seen during space flight, we have shown that interferon-alpha/beta production was inhibited. The inhibition was not due solely to the stress of suspension. The inhibited interferon production was transient, as suspended animals returned to normal caging recovered the ability to produce interferon. Antiorthostatic suspension of mice also resulted in a loss of resistance to infection with the diabetogenic strain of encephalomyocarditis virus, which correlated with the drop in interferon production. In rats flown in US Space Shuttle mission SL-3, interferon-gamma production was inhibited severely when spleen cells were challenged with concanavalin-A upon return to earth. In contrast, interleukin-3 production by these cells was normal. These results suggest that immune responses may be altered after antiorthostatic modeling or space flight, and the resistance to viral infections may be especially affected.

Disseminated Penicilliosis, Recurrent Bacteremic Nontyphoidal Salmonellosis, and Burkholderiosis Associated with Acquired Immunodeficiency Due to Autoantibody against Gamma Interferon ▿

PubMed Central

Tang, Bone Siu-Fai; Chan, Jasper Fuk-Woo; Chen, Min; Tsang, Owen Tak-Yin; Mok, M. Y.; Lai, Raymond Wai-Man; Lee, Rodney; Que, Tak-Lun; Tse, Herman; Li, Iris Wai-Sum; To, Kelvin Kai-Wang; Cheng, Vincent Chi-Chung; Chan, Eric Yuk-Tat; Zheng, Bojian; Yuen, Kwok-Yung

2010-01-01

Acquired immunodeficiency due to autoantibody against gamma interferon has recently been associated with opportunistic nontuberculous mycobacteriosis, especially among Southeast Asians. We report another 8 cases, all except one apparently immunocompetent hosts who suffered from concomitant or sequential infections by other intracellular pathogens causing penicilliosis, extraintestinal nontyphoidal salmonellosis, and burkholderiosis. The only case with an underlying immunodeficiency syndrome had systemic lupus erythematosus that was quiescent throughout the multiple infective episodes. Eight out of 10 (80.0%) patients with serological evidence of penicilliosis, 5 out of 7 (71.4%) with culture-positive extraintestinal nontyphoidal salmonellosis, 5 out of 28 (17.9%) with serological evidence of melioidosis, and 7 out of 13 (53.8%) with culture-positive nontuberculous mycobacteriosis possessed autoantibody against gamma interferon, whereas only 1 out of 100 patients with systemic lupus erythematosus did. Our study represents the first and largest case series linking this emerging immunodeficiency syndrome with these atypical infections in apparently immunocompetent hosts. Thus, we advocate that any patient with unexplained recurrent or polymicrobial infections due to these intracellular pathogens should be screened for acquired immunodeficiency due to autoantibody against gamma interferon. PMID:20445006

Utility of an interferon-gamma release assay for latent tuberculosis diagnosis in a case of bullous pemphigoid.

PubMed

Goodfellow, Alfred; Keeling, Douglas N; Hayes, Robert C; Webster, Duncan

2009-01-01

With increasing use of immunosuppressive therapy, including tumor necrosis factor alpha inhibitors, there is concern about infectious complications, including reactivation of latent Mycobacterium tuberculosis infection. Routine testing prior to administration of systemic immunosuppression includes the tuberculin skin test, which lacks sensitivity and specificity and may be difficult to interpret in the presence of extensive cutaneous disease. Treatment of individuals with latent tuberculosis infection is recommended when immunosuppressive medications are to be employed. We report a case in which a diagnosis of latent tuberculosis infection in a patient with extensive bullous pemphigoid was clarified by the use of an interferon-gamma release assay after equivocal tuberculin skin test results. Interferon-gamma release assays are useful adjuncts to the tuberculin skin test in the diagnosis of latent tuberculosis infection in the setting of extensive cutaneous disease.

[Aerosolized recombinant interferon-gamma prevent antigen-induced eosinophil recruitment in guinea pig trachea].

PubMed

Gao, Y; Chenping; Lin, X P

1997-10-01

In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.

Development of an aptamer beacon for detection of interferon-gamma.

PubMed

Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

2010-03-01

Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

Effect of gamma interferon on lung function of mustard gas exposed patients, after 15 years.

PubMed

Ghanei, Mostafa; Panahi, Yoones; Mojtahedzadeh, Mojtaba; Khalili, Ali Reza Hosseini; Aslani, Jafar

2006-01-01

Bronchiolitis has been known to be among the main the pathological features of lung lesions in Mustard Gas (MG) exposed patients. The purpose of this research was to evaluate the efficacy of interferon gamma-1b on the lung function in MG exposed patients with bronchiolitis. Thirty-six bronchiolitis patients, whose lung lesion had been diagnosed through High Resolution Computerized Tomography (HRCT) of the chest and also pathological study, were divided into two 18-member case and control groups. Both groups were receiving their conventional treatment (inhaled Felixotide and Servent). The case group were treated for 6 months with a combination of 200 microg of interferon gamma-1b (given three times per week subcutaneously) plus 7.5 mg of prednisolone (given once a day), while the control group received their previous conventional medications. Lung function was measured at base line and after 1, 3 and 6 months of treatment. In case and control groups, Forced Expiratory Volume in first second (FEV1) did not have statistical differences at the base line (49.3 +/- 2.9 and 48.7 +/- 4.1, respectively = 0.6), whereas a significant increase was seen in the case group (66.3 +/- 5.4) compared control group (57.3 +/- 8.6) at the subsequent months (P = 0.001 for the difference between the groups). Similar pattern of increase was observed in Forced Vital Capacity (FVC). The findings of this study indicate that a 6-month treatment with interferon gamma-1b plus a low-dose prednisolone is associated with an improvement in the lung function in mustard-gas exposed patients with bronchiolitis.

Interferon-gamma alone triggers the production of nitric oxide from serum-starved BNL CL.2, murine embryonic liver cells.

PubMed

Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T

1999-01-01

A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

PubMed

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

Cloning, sequencing and expression of white rhinoceros (Ceratotherium simum) interferon-gamma (IFN-gamma) and the production of rhinoceros IFN-gamma specific antibodies.

PubMed

Morar, D; Tijhaar, E; Negrea, A; Hendriks, J; van Haarlem, D; Godfroid, J; Michel, A L; Rutten, V P M G

2007-01-15

Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-gamma) assay is used as a routine diagnostic tool to determine infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop reagents to set up a rhinoceros IFN-gamma (RhIFN-gamma) assay. The white rhinoceros IFN-gamma gene was cloned, sequenced and expressed as a mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-gamma shares a homology of 90% with equine IFN-gamma. Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant RhIFN-gamma were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that recombinant as well as native white rhinoceros IFN-gamma was recognised. This preliminary IFN-gamma enzyme-linked immunosorbent assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.

Gamma Interferon Release Assays for Detection of Mycobacterium tuberculosis Infection

PubMed Central

Denkinger, Claudia M.; Kik, Sandra V.; Rangaka, Molebogeng X.; Zwerling, Alice; Oxlade, Olivia; Metcalfe, John Z.; Cattamanchi, Adithya; Dowdy, David W.; Dheda, Keertan; Banaei, Niaz

2014-01-01

SUMMARY Identification and treatment of latent tuberculosis infection (LTBI) can substantially reduce the risk of developing active disease. However, there is no diagnostic gold standard for LTBI. Two tests are available for identification of LTBI: the tuberculin skin test (TST) and the gamma interferon (IFN-γ) release assay (IGRA). Evidence suggests that both TST and IGRA are acceptable but imperfect tests. They represent indirect markers of Mycobacterium tuberculosis exposure and indicate a cellular immune response to M. tuberculosis. Neither test can accurately differentiate between LTBI and active TB, distinguish reactivation from reinfection, or resolve the various stages within the spectrum of M. tuberculosis infection. Both TST and IGRA have reduced sensitivity in immunocompromised patients and have low predictive value for progression to active TB. To maximize the positive predictive value of existing tests, LTBI screening should be reserved for those who are at sufficiently high risk of progressing to disease. Such high-risk individuals may be identifiable by using multivariable risk prediction models that incorporate test results with risk factors and using serial testing to resolve underlying phenotypes. In the longer term, basic research is necessary to identify highly predictive biomarkers. PMID:24396134

Interferon-gamma: biologic functions and HCV therapy (type I/II) (1 of 2 parts).

PubMed

Gattoni, A; Parlato, A; Vangieri, B; Bresciani, M; Derna, R

2006-01-01

This review is aimed at exhaustively presenting and discussing the interferon-gamma (IFN-gamma), a cytokine that plays an important role in inducing and modulating an array of immune responses. A review of the most significant and recent clinical trials was performed. Although IFN-gamma has some antiviral activity, it is much less active in this regard than type I IFNs. IFN-gamma is involved in the regulation of nearly all phases of the immune and inflammatory responses, including the activation and differentiation of T cells, B cells, NK cells, macrophages, and others. It is therefore best regarded as a distint immunoregulatory cytokine. IFN-gamma secretion is a hallmark of Th1 lymphocytes. It is also secreted by nearly all CD8 T cells, by some Th0 cells, and by NK cells. Each of these cell types secretes IFN-gamma only when activated, usually as part of immune response and especially in response to IL-2 and IL-12. IFN-gamma production is inhibited by IL-4, IL-10, TGFbeta, glucocorticoids, cyclosporin A and FK506. Nearly all cell types express the heterodimeric receptor for IFN-beta and respond to this cytokine by increasing the surface expression of class I MHC proteins. As a result, virtually any cell in the vicinity of an IFN-beta-secreting cell becomes more efficient at presenting endogenous antigens and hence a better target for cytotoxic killing if it harbors an intracellular pathogen. Unlike the type I IFNs, IFN-gamma also increases the expression of class II MHC proteins on professional APCs, and so promotes antigen presentation to helper T cells as well. It also induces de novo expression of class II MHC proteins on venular endothelial cells and on some other epithelial and connective tissue cells that do not otherwise express them, thus enabling these cell types to function as temporary APCs at sites of intense immune reactions. The effector functions of NK cells are to lyse virus-infected cells and to secrete IFN-gamma, which activates macrofages to

Sphingosine kinase inhibitor suppresses IL-18-induced interferon-gamma production through inhibition of p38 MAPK activation in human NK cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung

2008-09-12

Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less

Effect of interferon-gamma on complement gene expression in different cell types.

PubMed

Lappin, D F; Guc, D; Hill, A; McShane, T; Whaley, K

1992-01-15

We have studied the expression of the complement components C2, C3, factor B, C1 inhibitor (C1-inh), C4-binding protein (C4-bp) and factor H in human peripheral blood monocytes, skin fibroblasts, umbilical vein endothelial cells (HUVEC) and the human hepatoma cell line G2 (Hep G2) in the absence and the presence of interferon-gamma (IFN-gamma). E.l.i.s.a. performed on culture fluids, run-on transcription assays, Northern blot and double-dilution dot-blot techniques confirmed that monocytes expressed all six components, whereas fibroblasts, HUVEC and HepG2 each expressed five of the six components. Fibroblasts and HUVEC did not synthesize C4-bp, and Hep G2 did not produce factor H. In addition to these differences, the synthesis rates of C3, C1-inh and factor H were not the same in all cell types. However, the synthesis rates of C2 and factor B were similar in all four cell types. The half-lives of the mRNAs were shorter in monocytes than in other cell types. Monocyte factor H mRNA had a half-life of 12 min in monocytes, compared with over 3 h in fibroblasts and HUVEC. The instability of factor H mRNA in monocytes may contribute to their low factor H secretion rate. IFN-gamma produced dose-dependent stimulation of C2, factor B, C1-inh, C4-bp and factor H synthesis by all cell types expressing these proteins, but decreased C3 synthesis in all four cell types. Cell-specific differences in the response to IFN-gamma were observed. The increased rates of transcription of the C1-inh and factor H genes in HUVEC were greater than in other cell types, while the increased rate of transcription of the C2, factor B and C1-inh genes in Hep G2 cells was less than in other cell types. IFN-gamma did not affect the stability of C3, factor H or C4 bp mRNAs, but increased the stability of factor B and C1-inh mRNAs and decreased the stability of C2 mRNA. Although these changes occurred in all four cell types studied, the half-life of C1-inh mRNA in monocytes was increased almost 4-fold

Interleukin-4 but not gamma interferon production correlates with the severity of murine cutaneous leishmaniasis.

PubMed Central

Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T

1993-01-01

For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376

Role of interferon in resistance and immunity to protozoa

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Degee, A. L. W.; Mansfield, J. M.; Newsome, A. L.; Arnold, R. R.

1985-01-01

Production of interferon (I) in response to protozoan infection, and the interferon-mediated inhibition of parasite replication were studied in order to determine if these effects may be related to immunologic-mediated resistance of the hosts. Two extracellular parasites-Trypanosoma brucei rhodesiense and Naegleria fowlei were used. Upon infection with the trypanosome, only resistant strains of mice produced I. An early peak of alpha/beta I is followed by appearance of gamma I, which coincided with antibody production and a drop in parasitemia. In case of the amoeba, pretreatment of its suspension with alpha/beta I inhibits its replication in vitro, and appears to protect mice from the infection and the disease. It is proposed that production of interferon, with its regulatory effect on the immune responses, may play a major role in regulating the processes of protozoan-caused diseases.

Annexin V Incorporated into Influenza Virus Particles Inhibits Gamma Interferon Signaling and Promotes Viral Replication

PubMed Central

Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten

2014-01-01

ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID

[Allergic asthma and interleukins 2, 4, 5, 6 and 12 and gamma interferon levels].

PubMed

Bastida Segura, Diana Lyzbeth; López Velásquez, Benjamin; Castrejón Vázquez, María Isabel; Galicia Tapía, Jorge; Cano Altamirano, Silvia; Miranda Feria, Alfonso Javier

2004-01-01

Asthma is an inflammatory chronic illness, in which mastocyt cells, basophils, T lymphocytes, eosinophils and cytokines play a role. Its association with the production of TH2 cytokines is not well known, but it is considered an aberrant immune response, yielding the activation and recruitment of a number of effector cells (mastocyts/eosinophils) and the appearance of clinical symptoms. To determine the serum values of the interleukins 2, 4, 5, 6 and 12 and gamma interferon in relation to the severity degree of asthma and the time of immunotherapy in patients with stable chronic allergic bronchial asthma. Clinical records of allergic asthmatic patients from the external consultation at Servicio de Alergia e Immunología Clínica were reviewed in a period of 12 months (1st January 2002 to 1st January 2003) and those of healthy volunteers, forming three groups: Group 1, allergic asthmatics with immunotherapy less than 24 months; Group 2, allergic asthmatics with more than 24 months of immunotherapy, and Group 3, healthy volunteers (control group). Previous informed consent, a serum sample was taken of all subjects. Ninety-two subjects were included: 41 (45%) allergic asthmatics and 51 (55%) healthy volunteers. Significant differences were found in interleukins 2, 4, 5, 6 and 12 levels between healthy volunteers and asthmatics without relating the immunotherapy time. In the total group gamma interferon levels were not found. A relation of interleukins Th2 levels with the severity degree of asthma was not found. Differences of serum interleukins Th1 and Th2 in allergic patients related to immunotherapy time were not significant; even though, irrespective of immunotherapy time, IgG levels were always high. Patients with allergic asthma have a predominance of serum interleukins Th2 and, despite of the immunotherapy, in the maintaining phase, these continue high, which may be due to an immune system dysregulation maybe including other factors. Immunotherapy continues

Interferon-gamma interferes with transforming growth factor-beta signaling through direct interaction of YB-1 with Smad3.

PubMed

Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao

2003-10-31

Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF

Interferon-gamma and T-bet expression in a patient with toxoplasmic lymphadenopathy.

PubMed

Jöhrens, Korinna; Moos, Verena; Schneider, Thomas; Stein, Harald; Anagnostopoulos, Ioannis

2010-04-01

Infection with Toxoplasma gondii (TG) presents in some individuals as a self-limited disease with a predominant lymphadenopathy characterized by prominent B-cell activation. As this is in contrast to the in vitro based concept of a T(h)1-immune response against TG, we investigated native lymphoid tissue and peripheral blood of a patient with serologic evidence of toxoplasmosis to verify which cells show T(h)1-response features. High-level expression of T-bet in monocytoid B-cells, in germinal center B-cells, and in a lesser amount in T cells could be demonstrated by immunohistochemistry. In vitro stimulation of lymph node cells with either TG, staphylococcus enterotoxin B, or phorbol 12-myristate 13-acetate/ionomycin revealed an interferon-gamma expression in T-bet(+) B cells only in the patient and not in controls. Similar results were found for T-bet(+) T cells which were also present in controls. CD4(+) peripheral blood cells stimulated with TG antigens showed a TG-specific but attenuated T(h)1-reactivity in the patient associated with a reduced expression of IL-2 when compared with controls. We conclude that the pathogenesis and course of toxoplasmic lymphadenopathy is based on a T(h)1-cell defect, which becomes compensated by the B cells mounting a T(h)1-like immune response.

A mutation in the interferon regulatory element of HBV may influence the response of interferon treatment in chronic hepatitis B patients.

PubMed

Lu, Jia-Jie; Chen, En-Qiang; Yang, Jia-Hong; Zhou, Tao-You; Liu, Li; Tang, Hong

2012-01-10

A functional interferon regulatory element (IRE) has been found in the EnhI/X promoter region of hepatitis B virus (HBV) genome. The purpose of this study is to compare the gene order of responder and non-responder to interferon therapy in patients with chronic hepatitis B (CHB), so as to evaluate the relationship between IRE mutation and the response to interferon treatment for CHB patients. Synthetic therapeutic effect is divided into complete response (CR), partial response (PR) and non-response (NR). Among the 62 cases included in this study, 40 cases (64.5%) were in the response group (CR and PR) and 22 (35.5%) cases were in the NR group. Wild type sequence of HBV IRE TTTCACTTTC were found in 35 cases (56.5%), and five different IRE gene sequences. included TTTtACTTTC, TTTCAtTTTC, TTTtAtTTTC, TTTtACTTTt and cTTtACcTTC, were found in 22 cases (35.5%), 1 case (1.6%), 1 case (1.6%), 2 cases (3.2%) and 1 case (1.6%) respectively. There were 41.9%cases (26/62) with forth base C→T mutation, consisted of 32.5% (13/40) cases in response group and 59.1% (13/22) cases in NR group. Among the 35 cases with IRE sequences, there were 67.5% (27/40) cases in response group and 36.4% (8/22) in NR group, and the difference in IRE sequences between two groups was statistic significantly (P = 0.027). The result suggested that there is likely relationship between the forth base mutation (C→T) of IRE region and the response of HBV to Interferon therapy, and this mutation may partially decrease the inhibition effect of interferon on HBV. The forth base C→T mutation in IRE element of HBV may partially influence the response of Interferon treatment in CHB patients.

Respiratory Francisella tularensis live vaccine strain infection induces Th17 cells and prostaglandin E2, which inhibits generation of gamma interferon-positive T cells.

PubMed

Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A

2008-06-01

Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).

Potential mechanisms of cytosolic calcium modulation in interferon-gamma treated U937 cells

NASA Technical Reports Server (NTRS)

Klein, Jon B.; Mcleish, Kenneth R.; Sonnenfeld, Gerald; Dean, William L.

1987-01-01

The ability of interferon-gamma (IFN-gamma) to alter cytoplasmic Ca(2+) content in the monocytelike cell line U937 was investigated, using a slow Ca-channel blocker, diltiazem. In addition, the Ca-ATPase and the Ca-uptake activities were measured in isolated U937 membranes, together with the effect of inositol trisphosphate (IP3) upon the Ca(2+) release from Ca-loaded membranes. The addition of 50 U/ml INF-gamma to U937 cultures was found to increase internal Ca(2+) by about 100 percent within 3 min. The increase was significantly reduced by incubation in Ca-free buffer or by the addition of diltiazem. A crude membrane preparation from U937 cells was found to contain significant amounts of Ca-ATPase activity and to sequester Ca(2+) to a level of 8 nmol/mg in 30 sec; the addition of IP3 induced release of a portion of the sequestered Ca(2+) which was then resequestered. The results suggest that IFN-gamma causes an increase of cytoplasmic Ca(2+), in part, by the IP3-induced release from the internal storage sites and, in part, from the entry of extracellular Ca through slow channels.

Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity

PubMed Central

1984-01-01

Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN

A short 2 week dose titration regimen reduces the severity of flu-like symptoms with initial interferon gamma-1b treatment.

PubMed

Devane, John G; Martin, Mary L; Matson, Mark A

2014-06-01

Flu-like symptoms (FLS) are commonly experienced by patients receiving interferon gamma-1b which may cause discontinuation or disruption of dosing during initial therapy or on re-initiation following a break in therapy. In contrast to Type I interferons, the impact of dose-titration on FLS has not been reported and is not a practice described or included in the approved prescribing information for interferon gamma-1b.The objective of this study was to assess the effect of a 2 week titration regimen on the severity of FLS during the initial 3 weeks of therapy with three times weekly subcutaneous injections of interferon gamma-1b. Healthy men and women were randomized into a double-blind, two-period, crossover study. Each study period was 3 weeks in duration and there was a minimum 15 day washout between treatment periods. Two treatment regimens were compared: No Titration dosing (full 50 mcg/m(2) subcutaneously [s.c.] three times weekly for 3 weeks) and Titration (15 mcg/m(2) s.c. three times weekly during week 1, 30 mcg/m(2) s.c. three times weekly during week 2 followed by the full dose of 50 mcg/m(2) s.c. three times weekly during week 3). Subjects remained in the clinic for at least 12 hours following each injection. FLS was based on a composite score for fever, chills, tiredness and muscle aches assessed at baseline and 4, 8 and 12 hours following each injection. Acetaminophen was allowed at the discretion of the PI. The primary endpoint was the change from baseline in FLS severity at 8 hours averaged over the 3 weeks of treatment. Additional endpoints included FLS at 4 and 12 hours, individual flu-like symptoms, rates of discontinuation, incidence of FLS and acetaminophen use. NCT 01929382. Of the 40 subjects randomized, there were 15 (37.5%) discontinuations. Titration resulted in a significant reduction in FLS severity at 8 hours (p = 0.023) averaged over the 3 week treatment period. The difference in 3 week FLS severity reflects differences

Pregnancy IFN-gamma responses to foetal alloantigens are altered by maternal allergy and gravidity status.

PubMed

Breckler, L A; Hale, J; Taylor, A; Dunstan, J A; Thornton, C A; Prescott, S L

2008-11-01

During pregnancy, variations in maternal-foetal cellular interactions may influence immune programming. This study was carried out to determine if maternal responses to foetal alloantigens are altered by maternal allergic disease and/or previous pregnancies. For this cohort study, peripheral blood was collected from allergic (n = 69) and nonallergic (n = 63) pregnant women at 20, 30, 36-week gestation and 6-week postpartum (pp). Cord blood was collected at delivery. Mixed lymphocyte reactions were used to measure maternal cytokine responses [interleukin-6 (IL-6), IL-10, IL-13 and (interferon-gamma) IFN-gamma] at each time point towards foetal mononuclear cells. Maternal cytokine responses during pregnancy (20, 30 and 36 weeks) were suppressed compared to the responses at 6-week pp. The ratio of maternal IFN-gamma/IL-13 and IFN-gamma/IL-10 responses were lower during pregnancy. Allergic mothers had lower IFN-gamma responses at each time-point during pregnancy with the greatest difference in responses observed at 36-week gestation. When allergic and nonallergic women were further stratified by gravidity group, IFN-gamma responses of allergic multigravid mothers were significantly lower than nonallergic multigravid mothers during pregnancy. During normal pregnancy, peripheral T-cell cytokine responses to foetal alloantigens may be altered by both allergic status of the mother and previous pregnancies. These factors could influence the cytokine milieu experienced by the foetus and will be further explored in the development of allergic disease during early life.

Executive Summary of the Guidelines for the Use of interferon-gamma Release Assays in the Diagnosis of Tuberculosis Infection.

PubMed

Santin, Miguel; García-García, José-María; Rigau, David; Altet, Neus; Anibarro, Luis; Casas, Irma; Díez, Nuria; García-Gasalla, Mercedes; Martínez-Lacasa, Xavier; Penas, Antón; Pérez-Escolano, Elvira; Sánchez, Francisca; Domínguez, José

2016-09-01

Interferon-gamma release assays are widely used for the diagnosis of tuberculosis infection in Spain. However, there is no consensus on their application in specific clinical scenarios. To develop a guide-line for their use, a panel of experts comprising specialists in infectious diseases, respiratory diseases, microbiology, pediatrics and preventive medicine, together with a methodologist, conducted a systematic literature search, summarized the findings, rated the quality of the evidence, and formulated recommendations following the Grading of Recommendations of Assessment Development and Evaluations methodology. This document provides evidence-based guidance on the use of interferon-gamma release assays for the diagnosis of tuberculosis infection in patients at risk of tuberculosis or suspected of having active disease. The guidelines will be applicable to specialist and primary care, and public health. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

Evasion of interferon responses by Ebola and Marburg viruses.

PubMed

Basler, Christopher F; Amarasinghe, Gaya K

2009-09-01

The filoviruses, Ebola virus (EBOV) and Marburg virus (MARV), cause frequently lethal viral hemorrhagic fever. These infections induce potent cytokine production, yet these host responses fail to prevent systemic virus replication. Consistent with this, filoviruses have been found to encode proteins VP35 and VP24 that block host interferon (IFN)-alpha/beta production and inhibit signaling downstream of the IFN-alpha/beta and the IFN-gamma receptors, respectively. VP35, which is a component of the viral nucleocapsid complex and plays an essential role in viral RNA synthesis, acts as a pseudosubstrate for the cellular kinases IKK-epsilon and TBK-1, which phosphorylate and activate interferon regulatory factor 3 (IRF-3) and interferon regulatory factor 7 (IRF-7). VP35 also promotes SUMOylation of IRF-7, repressing IFN gene transcription. In addition, VP35 is a dsRNA-binding protein, and mutations that disrupt dsRNA binding impair VP35 IFN-antagonist activity while leaving its RNA replication functions intact. The phenotypes of recombinant EBOV bearing mutant VP35s unable to inhibit IFN-alpha/beta demonstrate that VP35 IFN-antagonist activity is critical for full virulence of these lethal pathogens. The structure of the VP35 dsRNA-binding domain, which has recently become available, is expected to provide insight into how VP35 IFN-antagonist and dsRNA-binding functions are related. The EBOV VP24 protein inhibits IFN signaling through an interaction with select host cell karyopherin-alpha proteins, preventing the nuclear import of otherwise activated STAT1. It remains to be determined to what extent VP24 may also modulate the nuclear import of other host cell factors and to what extent this may influence the outcome of infection. Notably, the Marburg virus VP24 protein does not detectably block STAT1 nuclear import, and, unlike EBOV, MARV infection inhibits STAT1 and STAT2 phosphorylation. Thus, despite their similarities, there are fundamental differences by which

Differential effects of human interferon alpha and interferon gamma on xenografted human thyroid tissue in severe combined immunodeficient mice and nude mice.

PubMed

Kawai, K; Enomoto, T; Fornasier, V; Resetkova, E; Volpé, R

1997-03-01

We have studied the in vivo effects of human interferon alpha (IFN-alpha) and interferon gamma (IFN-gamma) administration on human thyroid tissue xenografted into two mouse strains: severe combined immunodeficient (SCID) mice and nude mice. Human lymphocytes survive in SCID mice but are lysed in nude mice. Thyroid tissues from Graves' disease or Hashimoto's thyroiditis, or paranodular [normal, (N)] tissue was xenografted into SCID mice (0.8 g/mouse) pretreated with anti-asialo GM-1 antiserum and radiation and also into nude mice. One week after xenografting, SCID and nude mice were divided into three groups. Group A was treated with IFN-alpha intraperitoneally (2,000 units/mouse) three times weekly; group B was treated with IFN-gamma similarly; group C was treated with phosphate buffered saline (PBS) only (control). Autologous human peripheral blood mononuclear cells (PBMCs) were added to mice receiving N xenografts. Blood was taken every 2 weeks for levels of IgG and thyroid antibodies (TAb). After 6 weeks of treatment, mice were sacrificed, and xenograft thyrocyte histocompatibility leukocyte antigen (HLA-DR) and intercellular adhesion molecule (ICAM-1) expression were measured. In addition, thyrocyte cultures were stimulated in vitro with 200 units/ml of either IFN-alpha or IFN-gamma or PBS (control). SCID mice xenografted with autoimmune thyroid disease (AITD) in group A showed a significantly higher TAb production than group C, whereas in group B, TAb production was not statistically increased compared to control (group C). SCID mice xenografted with N did not produce TAb in any group, nor did nude mice xenografted with AITD. Thyrocyte HLA-DR expression was markedly increased in group A and B in SCID mice xenografted with Graves' disease, Hashimoto's thyroiditis, and N tissue compared to group C. In contrast, only group B (IFN-gamma) showed an increase in thyrocyte HLA-DR in nude mice. In the in vitro studies, only IFN-gamma (not IFN-alpha) stimulated

Dual specific oral tolerance induction using interferon gamma for IgE-mediated anaphylactic food allergy and the dissociation of local skin allergy and systemic oral allergy: tolerance or desensitization?

PubMed

Noh, G; Jang, E H

2014-01-01

Specific oral tolerance induction (SOTI) for IgE-mediated food allergy (IFA) can be successfully achieved using interfero gamma (classic SOTI). In this study, a tolerable dose was introduced during tolerance induction with interferon gamma (dual SOTI), and its effectiveness was evaluated. The study population comprised 25 IFA patients. Blood samples were taken for analysis, including complete blood count with differential counts of eosinophils, serum total IgE levels, and specific IgE for allergenic foods. Skin prick tests were conducted with the allergens. Oral food challenges were performed to diagnose IFA. Ten patients received dual SOTI, 5 received classic SOTI, 5 received SOTI without interferon gamma (original SOTI), and 5 were not treated (controls). Patients treated with dual SOTI and classic SOTI using interferon gamma became tolerant to the allergenic food. The tolerable dose was introduced successfully in dual SOTI. It was difficult to proceed with the same dosing protocol used for classic SOTI in cases treated with original SOTI. Following dual SOTI, the systemic reaction to oral intake subsided, but the local skin reaction to contact with the allergenic food persisted. Dual SOTI is an improved protocol for SOTI using interferon gamma for IFA.The local skin reaction and systemic reaction to oral intake were dissociated following dual SOTI. In cases of food allergy, tolerance appears to result from desensitization to allergens.

Vertebral osteomyelitis due to Aspergillus fumigatus in a patient with chronic granulomatous disease successfully treated with antifungal agents and interferon-gamma.

PubMed

Al-Tawfiq, Jaffar A; Al-Abdely, Hail M

2010-05-01

We report a case of invasive aspergillosis due to Aspergillus fumigatus involving the cervical and thoracic vertebrae and upper mediastinum of a 17 year-old Saudi male with chronic granulomatous disease (CGD). The patient did not respond to a long course of liposomal amphotericin B but did to surgical drainage and a combination of caspofungin and itraconazole with subsequent suppression with oral voriconazole. Fourteen months after the start of therapy, the patient had anterior dislocation of T2 thoracic vertebra with cord transection and quadriplegia. He was then treated intravenously with liquid itraconazole and interferon-gamma. The patient made a remarkable recovery over a 2-year period and was eventually able to walk independently. Thus, a combination of antifungals and interferon-gamma may have resulted in the positive outcome in this case.

Interleukin-12- and interferon-gamma-mediated natural killer cell activation by Agaricus blazei Murill.

PubMed

Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko

2007-06-01

Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.

Inhibition of Interferon-beta Responses in Multiple Sclerosis Immune Cells Associated With High-Dose Statins

PubMed Central

Feng, Xuan; Han, Diana; Kilaru, Bharat K.; Franek, Beverly S.; Niewold, Timothy B.; Reder, Anthony T.

2014-01-01

Objective To determine whether statins affect type 1 interferon responses in relapsing-remitting multiple sclerosis (RRMS). Design Study effects of atorvastatin on type 1 interferon responses in Jurkat cells, mononuclear cells (MNCs) from therapy-naive patients with RRMS in vitro, and MNCs from interferon-treated RRMS patients in vivo in 4 conditions: no drug, statin only, interferon-beta only, and statin added on to interferon-beta therapy. Patients The study examined clinically stable patients with RRMS: 21 therapy-naive patients and 14 patients receiving interferon-beta with a statin. Interventions Statin effects on in vitro and in vivo interferon-beta–induced STAT1 transcription factor activation, expression of interferon-stimulated proteins in MNCs, and serum type 1 interferon activity. Results In vitro, atorvastatin dose dependently inhibited expression of interferon-stimulated P-Y-STAT1 by 44% (P< .001), interferon regulatory factor 1 protein by 30% (P= .006), and myxovirus resistance 1 protein by 32% (P=.004) compared with no-statin control in MNCs from therapy-naive RRMS patients. In vivo, 9 of 10 patients who received high-dose statins (80 mg) had a significant reduction in interferon-beta therapy–induced serum interferon-α/β activity, whereas only 2 of 4 patients who received medium-dose statins (40 mg) had reductions. High-dose add-on statin therapy significantly blocked interferon-beta function, with less P-Y-STAT1 transcription factor activation, and reduced myxovirus resistance 1 protein and viperin protein production. Medium doses of statins did not change STAT1 activation. Conclusions High-dose add-on statin therapy significantly reduces interferon-beta function and type 1 interferon responses in RRMS patients. These data provide a putative mechanism for how statins could counteract the beneficial effects of interferon-beta and worsen disease. PMID:22801747

Continuous in vivo infusion of interferon-gamma (IFN-gamma) enhances engraftment of syngeneic wild-type cells in Fanca-/- and Fancg-/- mice.

PubMed

Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade

2006-12-15

Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.

Interferon-gamma promotes the survival and Fc epsilon RI-mediated histamine release in cultured human mast cells.

PubMed Central

Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T

1996-01-01

We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819

Effects of tumor necrosis factor-alpha and interferon-gamma on expressions of matrix metalloproteinase-2 and -9 in human bladder cancer cells.

PubMed

Shin, K Y; Moon, H S; Park, H Y; Lee, T Y; Woo, Y N; Kim, H J; Lee, S J; Kong, G

2000-10-31

We have investigated the effects of tumor necrosis factor-alpha (TNF-alpha) and interferon (INF-gamma), the potent Bacillus Calmette-Guerin (BCG)-induced cytokines on the production of MMP-2, MMP-9, TIMP-1, TIMP-2 and MT1-MMP in high grade human bladder cancer cell lines, T-24, J-82 and HT-1376 cell lines. MMP-2 expression and activity were decreased in T-24 cells treated with both cytokines in a dose dependent manner. However, J-82 cells treated with TNF-alpha and INF-gamma revealed dose dependent increases of MMP-9 expression and activity with similar baseline expression and activity of MMP-2. HT-1376 cells after exposure to TNF-alpha only enhanced the expression and activity of MMP-9. These results indicate that TNF-alpha and INF-gamma could regulate the production of MMP-2 or MMP-9 on bladder cancer cells and their patterns of regulation are cell specific. Furthermore, this diverse response of bladder cancer cells to TNF-alpha and INF-gamma suggests that BCG immunotherapy may enhance the invasiveness of bladder cancer in certain conditions with induction of MMPs.

Effects of Chicken Interferon Gamma on Newcastle Disease Virus Vaccine Immunogenicity

PubMed Central

Cardenas-Garcia, Stivalis; Dunwoody, Robert P.; Marcano, Valerie; Diel, Diego G.; Williams, Robert J.; Gogal, Robert M.; Brown, Corrie C.; Miller, Patti J.; Afonso, Claudio L.

2016-01-01

More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFNγ) during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFNγ with Newcastle disease virus (NDV) antigens were evaluated for their ability to enhance the avian immune response and their protective capacity upon challenge with virulent NDV. These systems consisted of: 1) a DNA vaccine expressing the Newcastle disease virus fusion (F) protein co-administered with a vector expressing the chIFNγ gene for in ovo and booster vaccination, 2) a recombinant Newcastle disease virus expressing the chIFNγ gene (rZJ1*L/IFNγ) used as a live vaccine delivered in ovo and into juvenile chickens, and 3) the same rZJ1*L/IFNγ virus used as an inactivated vaccine for juvenile chickens. Co-administration of chIFNγ with a DNA vaccine expressing the F protein resulted in higher levels of morbidity and mortality, and higher amounts of virulent virus shed after challenge when compared to the group that did not receive chIFNγ. The live vaccine system co-delivering chIFNγ did not enhanced post-vaccination antibody response, nor improved survival after hatch, when administered in ovo, and did not affect survival after challenge when administered to juvenile chickens. The low dose of the inactivated vaccine co-delivering active chIFNγ induced lower antibody titers than the groups that did not receive the cytokine. The high dose of this vaccine did not increase the antibody titers or antigen-specific memory response, and did not reduce the amount of challenge virus shed or mortality after challenge. In summary, regardless of the delivery system, chIFNγ, when administered simultaneously with the vaccine antigen, did not enhance Newcastle disease virus vaccine immunogenicity. PMID:27409587

Predictive Factors for Beneficial Response to Interferon-alfa Therapy in Chronic Hepatitis C

PubMed Central

Yoon, Seung-Kew; Kim, Sung Soo; Park, Young Min; Shim, Kyu Sik; Lee, Chang Don; Sun, Hee Sik; Park, Doo Ho; Kim, Boo Sung; Ryu, Wang Shick; Cho, Joong Myung

1995-01-01

Objectives: Interferon is the only established teatment for chronic hepatitis C but the host-dependent or virus-related factors affecting the response rate to interferon therapy are not yet dear. The purpose of this study was to investigate the factors predictive of response to interferon-alfa therapy in chronic hepatitis C. Methods: Twenty-five consecutive patients with chronic hepatitis C were randomized to three regimens of interferon-alfa: group A (n=7, 3MU every day for 3 months), group B (n=8, 3MU every other day for 3 months) and group C (n=10, 3MU every other day for 6 months), We quantified serum HC RNA levels by competitive reverse transcription-polymerase chain reaction (RT-PCR)and performed HCV genotyping using type-specific primers deduced from the NS5 region of the HCV genome. We also attempted to identify which demographic, biochemical and histologic factors in addition to virus-related factors would significantly predict beneficial response to interferon by multivariate analysis. Results: Sustained responders were 8 (36.4%), nonsustained responders were 2 (9.1%) and nonresponders were 12 (54.5%) of 22 patients who had received complete therapy. The initial HCV RNA level (logarithmic transformed copy numbers per ml of serum)in sustained responders (5.75±0.39) was significantly lower than that of nonsustained responders (6.80±0.71)and nonresponders (6.70±0.52) (p<0.05). In multivariate multiple logistic regression analysis, the serum HCV RNA level before therapy was only the independent predictor of a sustained response to interferon-alfa therapy (p=0.001). Conclusions: Serum HCV RNA level before therapy was the most useful predictor of a sustained response to interferon-alfa therapy for chronic hepatitis C. PMID:7495780

Establishment of a novel endothelial target mouse model of a typhus group rickettsiosis: evidence for critical roles for gamma interferon and CD8 T lymphocytes.

PubMed

Walker, D H; Popov, V L; Feng, H M

2000-09-01

A mouse model of typhus rickettsiosis that reproduces the hematogenous dissemination to the critical target organs, including brain, lungs, heart, and kidneys, primary endothelial and, to a lesser degree, macrophage intracellular rickettsial infection, and typical vascular-based lesions of louse-borne typhus and murine typhus was established. Intravenous inoculation of C3H/HeN mice with Rickettsia typhi caused disease with a duration of the incubation period and mortality rate that were dependent on the infective dose of rickettsiae. Lethal infection was associated with high concentrations of R. typhi in the lungs and brain, despite a brisker humoral immune response to the rickettsiae than in the sublethal infection. Gamma interferon and CD8 T lymphocytes were demonstrated to be crucial to clearance of the rickettsiae and recovery from infection in experiments in which specific monoclonal antibodies were administered to deplete these components. Death of animals depleted of gamma interferon or CD8 T lymphocytes was associated with overwhelming rickettsial infection demonstrated by titers of infectious rickettsiae and by immunohistochemistry. An effective antirickettsial immune response was associated with elevated serum concentrations of IL-12 on Day 5 and increased secretion of IL-12 by concanavalin-A-stimulated spleen cells on Day 5. Evidence for transient suppression of the immune response consisted of marked reduction in the secretion of IL-2 and IL-12 by concanavalin-A-stimulated spleen cells on Days 10 and 15. This model offers excellent opportunities for study of attenuation and pathogenetic mechanisms of typhus rickettsiae, which are established biologic weapons of potential use in bioterrorism.

Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies

PubMed Central

Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D

2014-01-01

Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250

Development of a lion-specific interferon-gamma assay.

PubMed

Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G

2012-10-15

The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.

Important role of interferon regulatory factor (IRF)-3 in the interferon response of mouse macrophages upon infection by Newcastle disease virus.

PubMed

Wilden, Holger; Schirrmacher, Volker; Fournier, Philippe

2011-08-01

Newcastle disease virus (NDV) is an interesting agent for activating innate immune activity in macrophages including secretion of TNF-α and IFN-α, upregulation of TRAIL and activation of NF-κB and iNOS. However, the molecular mechanism of such cellular activities remains largely unknown. Tumor selectivity of replication of NDV has been described to be linked to deviations in tumor cells of the type I interferon response. We therefore focused on the interferon response to NDV of macrophages as part of innate anti-viral and anti-tumor activity. In particular, we investigated the functional significance of the interferon regulatory factor genes (IRF)-3 and IRF-7. Deletion of the IRF-3 or IRF-7 gene was found to increase susceptibility of mouse macrophages to virus infection. Surprisingly, NDV replicated better in IRF-3 KO than in IRF-7 KO macrophages. Further analysis showed that IRF-3 KO macrophages have a lower basal and NDV-induced RIG-I expression in comparison to IRF-7 KO macrophages. This might explain why, in IRF-3 KO macrophages, the secretion of type I interferons after NDV infection is delayed, when compared to IRF-7 KO and wild-type macrophages. In addition, IRF-3 KO cells showed reduced NDV-induced levels of IRF-7. This effect could be prevented by priming the cells first by interferon-α. Further results indicated that an early production of type I interferon rather than high maximal levels at later time points are important for resistance to infection by NDV. In conclusion, these results demonstrate an important role of IRF-3 for the innate anti-viral response to NDV of mouse macrophages.

The Effectiveness of Screening with Interferon-Gamma Release Assays in a University Health Care Setting with a Diverse Global Population

ERIC Educational Resources Information Center

Birch, Samantha J.; Golbeck, Amanda L.

2015-01-01

Objective: This analysis examined the effectiveness of utilizing interferon-gamma release assay (IGRA) technology in a TB (TB) screening program at a university. Participants: Participants were 2299 students at a Montana university who had presented to the university health center for TB screening during 2012 and 2013. Methods: A retrospective…

Intact Pneumococci Trigger Transcription of Interferon-Related Genes in Human Monocytes, while Fragmented, Autolyzed Bacteria Subvert This Response

PubMed Central

Nordén, Rickard; Martner, Anna; Samuelsson, Ebba; Hynsjö, Lars; Wold, Agnes E.

2017-01-01

ABSTRACT A peculiar trait of pneumococci (Streptococcus pneumoniae) is their propensity to undergo spontaneous lysis during stationary growth due to activation of the enzyme autolysin (LytA), which fragments the peptidoglycan cell wall. The fragments that are generated upon autolysis impair phagocytosis and reduce production of interleukin-12 (IL-12) and gamma interferon (IFN-γ) by human leukocytes in response to intact pneumococci, thereby impeding crucial host defenses. The objective was to identify additional monocyte genes whose transcription is induced by intact pneumococci and subverted by autolyzed bacteria. Monocytes were isolated from healthy blood donors and stimulated for 3 h with UV-inactivated S. pneumoniae (Rx1PLY− LytA+ strain), which is capable of autolyzing, its LytA− isogenic autolysin-deficient mutant, or a mixture of the two (containing twice the initial bacterial concentration). Gene expression was assessed by Illumina microarray, and selected findings were confirmed by reverse transcription-quantitative real-time PCR (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and flow cytometry. In all, we identified 121 genes that were upregulated to a significantly higher degree by intact than autolyzed pneumococci. These included IFNB1 and a large set of interferon-induced genes, such as IFIT3, RSAD2, CFCL1, and CXCL10 genes, as well as IL12B and CD40 genes. RT-qPCR revealed that transcription of these genes in response to intact pneumococci diminished when autolyzed pneumococci were admixed and that this pattern was independent of pneumolysin. Thus, transcription of interferon-related genes is triggered by intact pneumococci and subverted by fragments generated by spontaneous bacterial autolysis. We suggest that interferon-related pathways are important for elimination of pneumococci and that autolysis contributes to virulence by extinguishing these pathways. PMID:28223347

Gamma-interferon causes a selective induction of the lysosomal proteases, cathepsins B and L, in macrophages

NASA Technical Reports Server (NTRS)

Lah, T. T.; Hawley, M.; Rock, K. L.; Goldberg, A. L.

1995-01-01

Previous studies have indicated that acid-optimal cysteine proteinase(s) in the endosomal-lysosomal compartments, cathepsins, play a critical role in the proteolytic processing of endocytosed proteins to generate the antigenic peptides presented to the immune system on major histocompatibility complex (MHC) class II molecules. The presentation of these peptides and the expression of MHC class II molecules by macrophages and lymphocytes are stimulated by gamma-interferon (gamma-IFN). We found that treatment of human U-937 monocytes with gamma-IFN increased the activities and the content of the two major lysosomal cysteine proteinases, cathepsins B and L. Assays of protease activity, enzyme-linked immunosorbant assays (ELISA) and immunoblotting showed that this cytokine increased the amount of cathepsin B 5-fold and cathepsin L 3-fold in the lysosomal fraction. By contrast, the aspartic proteinase, cathepsin D, in this fraction was not significantly altered by gamma-IFN treatment. An induction of cathepsins B and L was also observed in mouse macrophages, but not in HeLa cells. These results suggest coordinate regulation in monocytes of the expression of cathepsins B and L and MHC class II molecules. Presumably, this induction of cysteine proteases contributes to the enhancement of antigen presentation by gamma-IFN.

Electrochemical impedance spectroscopy based-on interferon-gamma detection

NASA Astrophysics Data System (ADS)

Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung

2014-03-01

Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.

Interferon-gamma and interleukin-10 profile of children with tuberculosis in North Sumatera, Indonesia

NASA Astrophysics Data System (ADS)

Daulay, R. S.; Daulay, R. M.

2018-03-01

Cellular immunity was mediated the host immune response against Mycobacterium tuberculosis, in which cytokine and T-helper (Th) 1 cells play an important role. Interferon-gamma (IFN-γ) is a leading cytokine involved in the immune response of tuberculosis (TB).The primary function of IFN-γ is to activate macrophages in opposition Mycobacterium tuberculosis. Contrast from IFN-γ, interleukin-10 (IL-10) is considered inhibitory cytokine, important to an adequate balance between inflammatory responses. To analyze cytokine profile, particularly IFN-γ and IL-10 of the children with TB in Indonesia, a cross-sectional study was conducted at two general hospitals and seven primary health care located in Medan and Batubara, North Sumatera, Indonesia. Among 51 children with TB disease and 51 healthy children, found that IFN-γ and IL-10 levels were lower in TB patients compared to healthy children. Statistically significant decreased production of the IFN-γ levels (p=0.042) were found in TB patients 9.41 (1.10-28.06) pg/ml contrast to healthy children 6.30 (1.30-89.76) pg/ml. Homologue finding of the IL-10 levels were also found in TB patients 4.93 (0.22-48.01) pg/ml and 4.93 (0.07-81.60) pg/ml in healthy children, but not statistically significant (p=0.784). High levels of IL-10 were not proven to suppress the levels production of IFN-γ in TB patients.

Effect of leukocyte therapy on tumor necrosis factor-alpha and interferon-gamma production in patients with recurrent spontaneous abortion.

PubMed

Gharesi-Fard, Behrouz; Zolghadri, Jaleh; Kamali-Sarvestani, Eskandar

2008-03-01

Considering the deleterious role of T helper1 (Th1) cells in pregnancy outcome, a successful treatment for recurrent spontaneous abortion (RSA) should be able to make a significant shift away from Th1 responses. Although paternal leukocyte immunization has been used for treatment of RSA for years, because of methodological differences there is no consensus on the mechanism of action and effectiveness of this method. Twenty-five Iranian non-pregnant women with RSA and 16 non-pregnant control women with at least two successful pregnancies were included in this study. All cases were followed up after leukocyte therapy for pregnancy outcome. Mononuclear cells from women were co-cultured with the husband's mononuclear cells before and after immunotherapy. The levels of tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) were checked on culture supernatant by enzyme-linked immunosorbent assay method. The mean concentration of TNF-alpha was significantly higher in patients compared with that in normal controls (P=0.0001). After immunotherapy, the TNF-alpha level was only significantly decreased in women with successful outcome (P=0.0001). Immunotherapy also induced a significant reduction in the IFN-gamma level (P=0.009). The results of this investigation confirm the role of TNF-alpha in RSA and propose the assessment of TNF-alpha production as a valuable prognostic parameter for the prediction of abortion after leukocyte therapy.

The Jak-STAT pathway stimulated by interferon alpha or interferon beta.

PubMed

Horvath, Curt M

2004-11-23

Type I interferons, such as interferon alpha and interferon beta (IFN-alpha and beta), signal through a Janus kinase (Jak) to signal transduction and activator of transcription (STAT) pathway to stimulate gene expression. In response to ligand binding, the receptors dimerize, Jaks phosphorylate STAT1 and STAT2, which then dimerize and interact with a third transcriptional regulator IFN regulatory factor 9 (IRF9) to stimulate gene expression. IFN-alpha is the main innate antiviral cytokine and is essential for effective immune response to viral infection. The animation shows activation of STAT-responsive gene expression in response to type I IFNs.

Effect of interferons and other biological response modifiers (BRMS) on macrophage-mediated inhibition of Listeria monocytogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badger, A.M.; Swift, B.; Sung, C.P.

1986-03-05

Recombinant murine gamma interferon (IFN-..gamma..) activates oil elicited C57BL/6 peritoneal macrophages to inhibit the growth of Listeria. Maximum activity is obtained with 10-20 units/ml, can be demonstrated in the absence of antibiotics and is not due to LPS contamination. Studies of the kinetics of this phenomenon demonstrate that a 30 minute incubation with IFN-..gamma.. is sufficient to initiate the antiproliferative state and full activity can be obtained with a 4 hour incubation. Alpha/beta interferon (IFN-..cap alpha../..beta..) is also active but requires 100X more units to obtain equivalent activity. The evaluation of a number of other BRMS demonstrated that MDP andmore » LPS could stimulate phagocytosis of Listeria but could not inhibit their growth. Bestatin, tuftsin, Con A, A23187 and Poly I:C did not stimulate either phagocytosis or growth inhibitory activity. These compounds were also tested for their ability to enhance the release of superoxide anion from PMA stimulated macrophages. With the exception of tuftsin and bestatin all of the BRMS tested were able to enhance the production of oxidative burst products confirming the findings of others of the dissociation between the two functions.« less

Interferon gamma, an important marker of response to immune checkpoint blockade in non-small cell lung cancer and melanoma patients

PubMed Central

Karachaliou, Niki; Gonzalez-Cao, Maria; Crespo, Guillermo; Drozdowskyj, Ana; Aldeguer, Erika; Gimenez-Capitan, Ana; Teixido, Cristina; Molina-Vila, Miguel Angel; Viteri, Santiago; De Los Llanos Gil, Maria; Algarra, Salvador Martin; Perez-Ruiz, Elisabeth; Marquez-Rodas, Ivan; Rodriguez-Abreu, Delvys; Blanco, Remedios; Puertolas, Teresa; Royo, Maria Angeles; Rosell, Rafael

2018-01-01

Background: Programmed death-ligand 1 (PD-L1) may be induced by oncogenic signals or can be upregulated via interferon gamma (IFN-γ). We have explored whether the expression of IFNG, the gene encoding IFN-γ, is associated with clinical response to the immune checkpoint blockade in non-small cell lung cancer (NSCLC) and melanoma patients. The role of inflammation-associated transcription factors STAT3, IKBKE, STAT1 and other associated genes has also been examined. Methods: Total RNA from 17 NSCLC and 21 melanoma patients was analyzed by quantitative reverse transcription PCR. STAT3 and Rantes, YAP1 and CXCL5, DNMT1, RIG1 and TET1, EOMES, IFNG, PD-L1 and CTLA4, IKBKE and NFATC1 mRNA were examined. PD-L1 protein expression in tumor and immune cells and stromal infiltration of CD8+ T-cells were also evaluated. Progression-free survival and overall survival were estimated. Results: A total of 17 NSCLC patients received nivolumab and 21 melanoma patients received pembrolizumab. Progression-free survival with nivolumab was significantly longer in NSCLC patients with high versus low IFNG expression (5.1 months versus 2 months, p = 0.0124). Progression-free survival with pembrolizumab was significantly longer in melanoma patients with high versus low IFNG expression (5.0 months versus 1.9 months, p = 0.0099). Significantly longer overall survival was observed for melanoma patients with high versus low IFNG expression (not reached versus 10.2 months p = 0.0183). There was a trend for longer overall survival for NSCLC patients with high versus low IFNG expression. Conclusions: IFN-γ is an important marker for prediction of response to immune checkpoint blockade. Further research is warranted in order to validate whether IFNG is more accurate than PD-L1. PMID:29383037

Heterogeneity within populations of recombinant Chinese hamster ovary cells expressing human interferon-gamma.

PubMed

Coppen, S R; Newsam, R; Bull, A T; Baines, A J

1995-04-20

The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.

[The usefulness of in vitro interferon-gamma assay for differential diagnosis between intestinal tuberculosis and Crohns disease].

PubMed

Lee, Jung Nam; Ryu, Dong Yup; Park, Sung Han; You, Hyun Seok; Lee, Bong Eun; Kim, Dong Uk; Kim, Tae Oh; Heo, Jeong; Kim, Gwang Ha; Song, Geun Am; Kim, Suk; Park, Do Youn

2010-06-01

It is difficult to clinically and endoscopically differentiate intestinal tuberculosis (ITB) and Crohns disease (CD). The aim of this study was to evaluate the usefulness of in vitro interferon-gamma (INF-gamma) assay for differential diagnosis between ITB and CD. Sixty patients for whom differential diagnosis between ITB and CD was difficult were enrolled between January 2007 and January 2009. The INF-gamma-producing T-cell response to early secreted antigenic target 6 and culture filtrate protein 10 were measured by T-SPOT.TB blood test in vitro. We evaluated the usefulness of T-SPOT.TB blood test by comparing its results with the final diagnosis. Twenty and forty patients were revealed to be positive and negative in T-SPOT.TB blood test, respectively. Of the 20 patients found to be positive, 12 patients (60%) were finally diagnosed as ITB, 6 patients as CD, and 2 patients as Behcets enterocolitis. Of the 40 patients with negative results, 38 patients (95%) were diagnosed as CD; one as Behcets enterocolitis; one as nonspecific colitis; none as ITB. The sensitivity and specificity of T-SPOT.TB blood test for ITB were 100% and 83.3%, respectively. Positive and negative predictive values of T-SPOT.TB blood test for ITB were 60.0% and 100%, respectively. When differential diagnosis between ITB and CD is difficult, T-SPOT.TB blood test may be a helpful and rapid diagnostic tool to exclude ITB. Prospective large-scaled studies are required for further evaluation of the usefulness of T-SPOT.TB blood test for differential diagnosis between ITB and CD.

Structural analysis and localization of the carbohydrate moieties of a soluble human interferon gamma receptor produced in baculovirus-infected insect cells.

PubMed Central

Manneberg, M.; Friedlein, A.; Kurth, H.; Lahm, H. W.; Fountoulakis, M.

1994-01-01

A soluble form of the human interferon gamma receptor that is required for the identification of interferon gamma antagonists was expressed in baculovirus-infected insect cells. The protein carried N-linked carbohydrate and showed a heterogeneity on denaturing polyacrylamide gels. We investigated the utilization of the potential sites for N-linked glycosylation and the structure of the carbohydrate moieties of this soluble receptor. Amino acid sequence analysis and ion spray mass spectrometry revealed that of the five potential sites for N-linked glycosylation, Asn17 and Asn69 were always utilized, whereas Asn62 and Asn162 were utilized in approximately one-third of the protein population. Asn223 was never found to be glycosylated. The soluble receptor was treated with N-glycosidase F and the oligosaccharides released were analyzed by matrix-assisted laser desorption mass spectrometry, which showed that the protein carried six types of short carbohydrate chains. The predominant species was a hexasaccharide of molecular mass 1,039, containing a fucose subunit linked to the proximal N-acetylglucosamine residue: [formula: see text] PMID:8142896

Axonal interferon responses and alphaherpesvirus neuroinvasion

NASA Astrophysics Data System (ADS)

Song, Ren

Infection by alphaherpesviruses, including herpes simplex virus (HSV) and pseudorabies virus (PRV), typically begins at a peripheral epithelial surface and continues into the peripheral nervous system (PNS) that innervates this tissue. Inflammatory responses are induced at the infected peripheral site prior to viral invasion of the PNS. PNS neurons are highly polarized cells with long axonal processes that connect to distant targets. When the peripheral tissue is first infected, only the innervating axons are exposed to this inflammatory milieu, which include type I interferon (e.g. IFNbeta) and type II interferon (i.e. IFNgamma). IFNbeta can be produced by all types of cells, while IFNgamma is secreted by some specific types of immune cells. And both types of IFN induce antiviral responses in surrounding cells that express the IFN receptors. The fundamental question is how do PNS neurons respond to the inflammatory milieu experienced only by their axons. Axons must act as potential front-line barriers to prevent PNS infection and damage. Using compartmented cultures that physically separate neuron axons from cell bodies, I found that pretreating isolated axons with IFNbeta or IFNgamma significantly diminished the number of HSV-1 and PRV particles moving from axons to the cell bodies in an IFN receptor-dependent manner. Furthermore, I found the responses in axons are activated differentially by the two types of IFNs. The response to IFNbeta is a rapid, axon-only response, while the response to IFNgamma involves long distance signaling to the PNS cell body. For example, exposing axons to IFNbeta induced STAT1 phosphorylation (p-STAT1) only in axons, while exposure of axons to IFNgamma induced p-STAT1 accumulation in distant cell body nuclei. Blocking transcription in cell bodies eliminated IFNgamma-, but not IFNbeta-mediated antiviral effects. Proteomic analysis of IFNbeta- or IFNgamma-treated axons identified several differentially regulated proteins. Therefore

Identification and Characterization of Neospora caninum Cyclophilin That Elicits Gamma Interferon Production

PubMed Central

Tuo, Wenbin; Fetterer, Raymond; Jenkins, Mark; Dubey, J. P.

2005-01-01

Gamma interferon (IFN-γ) response is essential to the development of a host protective immunity in response to infections by intracellular parasites. Neosporosis, an infection caused by the intracellular protozoan parasite Neospora caninum, is fatal when there is a complete lack of IFN-γ in the infected host. However, the mechanism by which IFN-γ is elicited by the invading parasite is unclear. This study has identified a microbial protein in the N. caninum tachyzoite N. caninum cyclophilin (NcCyP) as a major component of the parasite responsible for the induction of IFN-γ production by bovine peripheral blood mononuclear cells (PBMC) and antigen-specific CD4+ T cells. NcCyP has high sequence homology (86%) with Toxoplasma gondii 18-kDa CyP with a calculated molecular mass of 19.4 kDa. NcCyP is a secretory protein with a predicted signal peptide of 17 amino acids. Abundant NcCyP was detected in whole-cell N. caninum tachyzoite lysate antigen (NcAg) and N. caninum tachyzoite culture supernatant. In N. caninum tachyzoite culture supernatant, three NcCyP bands of 19, 22, and 24 kDa were identified. NcAg stimulated high levels of IFN-γ production by PBMC and CD4+ T cells. The IFN-γ-inducing effect of NcAg was blocked by cyclosporine, a specific ligand for CyP, in a dose-dependent manner. Furthermore, cyclosporine abolished IFN-γ production by PBMC from naïve cows as well as PBMC and CD4+ T cells from infected/immunized cows. These results indicate that the N. caninum tachyzoite naturally produces a potent IFN-γ-inducing protein, NcCyP, which may be important for parasite survival as well as host protection. PMID:16041025

Gamma Interferon-Induced T-Cell Loss in Virulent Mycobacterium avium Infection

PubMed Central

Flórido, Manuela; Pearl, John E.; Solache, Alejandra; Borges, Margarida; Haynes, Laura; Cooper, Andrea M.; Appelberg, Rui

2005-01-01

Infection by virulent Mycobacterium avium caused progressive severe lymphopenia in C57BL/6 mice due to increased apoptosis rates. T-cell depletion did not occur in gamma interferon (IFN-γ)-deficient mice which showed increased T-cell numbers and proliferation; in contrast, deficiency in nitric oxide synthase 2 did not prevent T-cell loss. Although T-cell loss was IFN-γ dependent, expression of the IFN-γ receptor on T cells was not required for depletion. Similarly, while T-cell loss was optimal if the T cells expressed IFN-γ, CD8+ T-cell depletion could occur in the absence of T-cell-derived IFN-γ. Depletion did not require that the T cells be specific for mycobacterial antigen and was not affected by deficiencies in the tumor necrosis factor receptors p55 or p75, the Fas receptor (CD95), or the respiratory burst enzymes or by forced expression of bcl-2 in hematopoietic cells. PMID:15908387

Evaluation of Gamma Interferon and Antibody Tuberculosis Tests in Alpacas

PubMed Central

Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

2012-01-01

We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a “test package,” although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations. PMID:22914362

Evaluation of gamma interferon and antibody tuberculosis tests in alpacas.

PubMed

Rhodes, Shelley; Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

2012-10-01

We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a "test package," although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations.

[Regulating human interferon-gamma gene expression in marrow stromal cells in mice by Tet-off system].

PubMed

Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong

2008-01-01

We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.

The effect of fermented milk on interferon production in malnourished children and in anorexia nervosa patients undergoing nutritional care.

PubMed

Solis, B; Nova, E; Gómez, S; Samartín, S; Mouane, N; Lemtouni, A; Belaoui, H; Marcos, A

2002-12-01

For several years cytokine production has been associated with infections but it was not suspected that some types of food could also induce cytokines, even in a state of non-infection. Lactic bacteria can induce interferon (IFN) production in human healthy subjects, thus, a better protection against infections would be expected. Therefore, we planned to evaluate the effect of two diets including yoghurt or milk on IFN-gamma production during nutritional recovery in two different situations of malnutrition: (1) children with diarrhoea; and (2) patients with anorexia nervosa (AN). Both the diet including yoghurt of that including milk seemed to increase IFN-gamma production at the end of nutritional recovery in the malnourished children with diarrhoea. The significance of interferon production and the lymphocyte subset increase should be explored to know if a better resistance against pathogens is related to them. Regulation of intestinal absorption and moderate stimulation of interferon production make the yoghurt-based diet a good choice in the nutritional care of children. In the same way, an increase in the IFN-gamma production was observed in AN patients consuming yoghurt. This increase of IFN-gamma production could be considered a biological marker to detect the effect of probiotics on the immune response, especially in the improvement of a deficient nutritional status.

Interferon-gamma regulates nucleoside transport systems in macrophages through signal transduction and activator of transduction factor 1 (STAT1)-dependent and -independent signalling pathways.

PubMed Central

Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio

2003-01-01

The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960

Effects of interferon-gamma and lipopolysaccharide on macrophage iron metabolism are mediated by nitric oxide-induced degradation of iron regulatory protein 2.

PubMed

Kim, S; Ponka, P

2000-03-03

Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.

Partial interferon-gamma receptor 1 deficiency in a child with tuberculoid bacillus Calmette-Guérin infection and a sibling with clinical tuberculosis.

PubMed Central

Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L

1997-01-01

Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728

Correlations between endotoxin, interferon-gamma, biopterin and serum phospholipase A2-activities during lethal gram negative sepsis in rats.

PubMed

Hunsicker, A; Kullich, W; Weissenhofer, W; Lorenz, D; Petermann, J; Rokos, H; Schwesinger, G

1997-05-01

To establish a standardised reproducible animal model of intraperitoneal sepsis, and to investigate early immunoserological responses to find a mediator-based system for evaluation and grading of diffuse peritonitis in patients Prospective experimental study 4 Teaching hospitals, Germany and Austria 42 LEW. 1W rats, 12 of which acted as controls Gram negative sepsis was induced by intraperitoneal injection of 6 ml of a mixture of Escherichia coli (K1:H+) 10(10) organisms/ml, autogenous haemoglobin 2.9 ml (haemoglobin concentration 3%), 0.9% sodium chloride 3 ml, and suspension 0.1 ml. Control rats were given physiological saline 6 ml alone. Concentrations of endotoxin, interferon gamma (IFN-gamma), and biopterin, and serum phospholipase A2 (PLA2) activity. There were significant differences between the septic and control rats in concentrations of endotoxin (EU/ml) (median (interquartile range) 21.85 (2.02-159.5) compared with 0, p < 0.0001; IFN-gamma (pg/ml) 1263.0 (271.0-7575.0) compared with 101.0 (89.0-141.0), p < 0.0001; biopterin (nmol/L) 111.0 (66.4-156.3) compared with 53.7 (38.3-67.6), p < 0.001; and PLA2 (U/L) 163.0 (125.8-209.0) compared with 112.5 (88.5-126.5) p < 0.01. Measurements of concentrations of endotoxin, IFN-gamma, pteridines, and PLA2 activity may well be adequate markers for early recognition of sepsis, and perhaps for grading it during the first 6 hours after induction. The allow a clear distinction to be made between septic and non-septic disorders in 87% of cases.

Household food insecurity is associated with low interferon-gamma levels in pregnant Indian women.

PubMed

Vaidya, A; Bhosale, R; Sambarey, P; Suryavanshi, N; Young, S; Mave, V; Kanade, S; Kulkarni, V; Deshpande, P; Balasubramanian, U; Elf, J; Gupte, N; Gupta, A; Mathad, J S

2017-07-01

Over 20% of tuberculosis (TB) cases during pregnancy occur in India. To determine the association between household food insecurity and interferon-gamma (IFN-γ) levels in pregnancy. Pregnant women in India were administered the Household Food Insecurity Access Scale (HFIAS) questionnaire and underwent an IFN-γ release assay. Logistic regression was used to identify factors associated with food insecurity. Of 538 women, 60 (11%) had household food insecurity, 47 (78%) of which were moderate or severe food insecure. After mitogen stimulation, moderate or severe food insecure women had a median IFN-γ concentration of 4.2 IU/ml (IQR 2.2-9.8) vs. 8.4 IU/ml (IQR 3.0-10) in women with no or mild food insecurity (P = 0.03). In multivariate analysis, higher IFN-γ concentrations were associated with human immunodeficiency virus infection (OR 1.3, 95%CI 0.51-2.1, P = 0.001), and inversely associated with moderate or severe food insecurity (OR -1.6, 95%CI -2.9 to -0.27, P = 0.02) and the number of adults in the household (OR -0.08, 95%CI -0.16 to -0.01, P = 0.03). There was no association between food insecurity and IFN-γ response to Mycobacterium tuberculosis antigen. Food insecurity in pregnancy is associated with low IFN-γ levels. There was no association between food insecurity and IFN-γ response to M. tuberculosis antigen, but our study was underpowered to detect this outcome.

Biosynthesis and N-glycosylation of human interferon-gamma. Asn25 and Asn97 differ markedly in how efficiently they are glycosylated and in their oligosaccharide composition.

PubMed

Sareneva, T; Mørtz, E; Tölö, H; Roepstorff, P; Julkunen, I

1996-12-01

Interferon-gamma (IFN-gamma) is a secretory glycoprotein produced by T cells in response to antigenic or mitogenic stimuli. We studied the kinetics of the synthesis, N-glycosylation, and secretion of IFN-gamma in human CD8+ T lymphocytes stimulated via T-cell receptor. Highly elevated IFN-gamma mRNA levels were found as early as 1 h after stimulation. Maximal IFN-gamma protein synthesis was observed 2-4 h after induction and appeared to correlate to steady-state IFN-gamma mRNA levels. As analyzed by pulse/chase experiments, the secretion of IFN-gamma from T cells was very rapid, the secretion half-time being approximately 20-25 min. Inhibition of N-glycosylation by tunicamycin dramatically reduced the expression of IFN-gamma, but did not block its secretion. Natural IFN-gamma is heterogeneously glycosylated and doubly, singly, and unglycosylated forms exist. Experiments performed in a cell-free translation/glycosylation system with mutated IFN-gamma constructs lacking either one of the potential glycosylation sites suggested that Asn25 is more efficiently glycosylated than Asn97. Site-specific oligosaccharide analysis of natural IFN-gamma by glycosidase treatment followed by matrix-assisted-laser-desorption-ionization mass spectrometry revealed considerable variation in the carbohydrate structures, with more than 30 different forms. The glycans at Asn25 consisted of fucosylated, mainly complex-type oligosaccharides, whereas the glycans at Asn97 were more heterogeneous, with hybrid and high-mannose structures. Our results emphasize the essential role of N-linked glycans in the biology of IFN-gamma and show that there is a considerable heterogeneity in the individual sugar chains of this important human cytokine.

Histaminergic regulation of interferon-gamma (IFN-gamma) production by human natural killer (NK) cells.

PubMed

Asea, A; Hansson, M; Czerkinsky, C; Houze, T; Hermodsson, S; Strannegård, O; Hellstrand, K

1996-08-01

Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-gamma by CD3-/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-gamma production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-gamma production was operating on a pretranslational level, as indicated by the inability of enriched NK cells to accumulate IFN-gamma mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-gamma production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-gamma production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-gamma in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-gamma mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-gamma production by preventing monocyte-induced oxidative damage to NK cells.

MOLECULAR CLONING, SEQUENCING, EXPRESSION AND BIOLOGICAL ACTIVITY OF GIANT PANDA (AILUROPODA MELANOLEUCA) INTERFERON-GAMMA.

PubMed

Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun

2012-06-29

The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.

Treatment of trypanosome-infected mice with exogenous interferon, interferon inducers, or antibody to interferon

NASA Technical Reports Server (NTRS)

Degee, Antonie L. W.; Mansfield, John M.; Sonnenfeld, Gerald

1986-01-01

Earlier studies have demonstrated that mice resistant to Trypanosoma brucei rhodesiense (the B10.BR/SgSnJ strain) produces, upon infection by this parasite, two peaks of serum interferon (IFN), while the susceptible mice (C3HeB/FeJ) produces no IFN. In the present study, survival times were compared for B10.BR/SgSnJ, C3HeB/FeJ, and CBA/J (an intermediately resistant strain) mice that were injected, prior to infection with the parasite, with either of the following three preparations (1) IFN-gamma, (2) an antibody to IFN-gamma and (3) polyriboinosinic-polyribocytidylic acid (to induce IFN-alpha/beta). No effect on the survival times of mice by any of these preparations could be demonstrated, contrary to some previous reports.

CD8+ T Cell Exhaustion, Suppressed Gamma Interferon Production, and Delayed Memory Response Induced by Chronic Brucella melitensis Infection

PubMed Central

Durward-Diioia, Marina; Harms, Jerome; Khan, Mike; Hall, Cherisse; Smith, Judith A.

2015-01-01

Brucella melitensis is a well-adapted zoonotic pathogen considered a scourge of mankind since recorded history. In some cases, initial infection leads to chronic and reactivating brucellosis, incurring significant morbidity and economic loss. The mechanism by which B. melitensis subverts adaptive immunological memory is poorly understood. Previous work has shown that Brucella-specific CD8+ T cells express gamma interferon (IFN-γ) and can transition to long-lived memory cells but are not polyfunctional. In this study, chronic infection of mice with B. melitensis led to CD8+ T cell exhaustion, manifested by programmed cell death 1 (PD-1) and lymphocyte activation gene 3 (LAG-3) expression and a lack of IFN-γ production. The B. melitensis-specific CD8+ T cells that produced IFN-γ expressed less IFN-γ per cell than did CD8+ cells from uninfected mice. Both memory precursor (CD8+ LFA1HI CD127HI KLRG1LO) and long-lived memory (CD8+ CD27HI CD127HI KLRG1LO) cells were identified during chronic infection. Interestingly, after adoptive transfer, mice receiving cells from chronically infected animals were able to contain infection more rapidly than recipients of cells from acutely infected or uninfected donors, although the proportions of exhausted CD8+ T cells increased after adoptive transfer in both challenged and unchallenged recipients. CD8+ T cells of challenged recipients initially retained the stunted IFN-γ production found prior to transfer, and cells from acutely infected mice were never seen to transition to either memory subset at all time points tested, up to 30 days post-primary infection, suggesting a delay in the generation of memory. Here we have identified defects in Brucella-responsive CD8+ T cells that allow chronic persistence of infection. PMID:26416901

Effect of treatment with interferon-gamma and concanavalin A on the course of infection of mice with Salmonella typhimurium strain LT-2

NASA Technical Reports Server (NTRS)

Gould, Cheryl L.; Sonnenfeld, Gerald

1987-01-01

The effect of pretreatment of mice with 34 units/day, for five days, of interferon-gamma (IFN-gamma) on the course of infection with LD50 of Salmonella typhimurium strain LT-2 was assessed, using two IFN preparations: (1) a hybridoma supernatant fluid containing concanavalin-A-induced IFN-gamma activity and (2) pure murine IFN-gamma produced by recombinant DNA technology. The hybridoma supernatant-treated Salmonella-infected mice were found to die faster than mice treated only with Salmonella. Pure murine IFN-gamma was found to protect infected mice significantly, with 95 percent of mice surviving LD50 infection. In contrast, the Salmonella-infected mice treated with hybridoma supernatant were found to die faster than the Salmonella-infected untreated controls. Mice treated with concanavalin A alone prior to infection with S. typhimurium died more quickly than the untreated infected controls, suggesting that contamination with concanavalin A had a detrimental effect on mice survival.

Use of interferon-gamma release assays in a health care worker screening program: experience from a tertiary care centre in the United States.

PubMed

Joshi, Manish; Monson, Thomas P; Woods, Gail L

2012-01-01

Interferon-gamma release assays including the QuantiFERON-TB Gold In-Tube test (QFT-GIT [Cellestis Ltd, Australia]) may be used in place of the tuberculin skin test (TST) in surveillance programs for Mycobacterium tuberculosis infection control. However, data on performance and practicality of the QFT-GIT in such programs for health care workers (HCWs) are limited. To assess the performance, practicality and reversion rate of the QFT-GIT among HCWs at a tertiary health care institution in the United States. Retrospective chart review of HCWs at Central Arkansas Veterans Healthcare System (Arkansas, USA) who underwent QFT-GIT testing as a part of their employee screening between November 1, 2008 and October 31, 2009. QFT-GIT was used to screen 3290 HCWs. The initial QFT-GIT was interpreted as positive for 129 (3.9%) HCWs, negative for 3155 (95.9%) and indeterminate for six (0.2%). Testing with QFT-GIT was repeated in 45 HCWs who had positive results on the initial test. The QFT-GIT reverted to negative in 18 (40.0%) HCWs, all of whom had negative TST status and initial interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL. The QFT-GIT test is feasible in large health care setting as an alternative to TST for M tuberculosis infection screening in HCWs but is not free from challenges. The major concerns are the high number of positive test results and high reversion rates on repeat testing, illustrating poor short-term reproducibility of positive QFT-GIT test results. These results suggest adopting a borderline zone between interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL, and cautious clinical interpretation of values in this range.

Use of Piezoelectric Immunosensors for Detection of Interferon-Gamma Interaction with Specific Antibodies in the Presence of Released-Active Forms of Antibodies to Interferon-Gamma

PubMed Central

Don, Elena; Farafonova, Olga; Pokhil, Suzanna; Barykina, Darya; Nikiforova, Marina; Shulga, Darya; Borshcheva, Alena; Tarasov, Sergey; Ermolaeva, Tatyana; Epstein, Oleg

2016-01-01

In preliminary ELISA studies where released-active forms (RAF) of antibodies (Abs) to interferon-gamma (IFNg) were added to the antigen-antibody system, a statistically significant difference in absorbance signals obtained in their presence in comparison to placebo was observed. A piezoelectric immunosensor assay was developed to support these data and investigate the effects of RAF Abs to IFNg on the specific interaction between Abs to IFNg and IFNg. The experimental conditions were designed and optimal electrode coating, detection circumstances and suitable chaotropic agents for electrode regeneration were selected. The developed technique was found to provide high repeatability, intermediate precision and specificity. The difference between the analytical signals of RAF Ab samples and those of the placebo was up to 50.8%, whereas the difference between non-specific controls and the placebo was within 5%–6%. Thus, the piezoelectric immunosensor as well as ELISA has the potential to be used for detecting the effects of RAF Abs to IFNg on the antigen-antibody interaction, which might be the result of RAF’s ability to modify the affinity of IFNg to specific/related Abs. PMID:26791304

A strong interferon response correlates with a milder dengue clinical condition.

PubMed

De La Cruz Hernández, Sergio Isaac; Puerta-Guardo, Henry; Flores-Aguilar, Hilario; González-Mateos, Silvia; López-Martinez, Irma; Ortiz-Navarrete, Vianney; Ludert, Juan E; Del Angel, Rosa María

2014-07-01

Type 1 interferon (IFNα/β) has a significant role in establishing protection against virus infections. It has been well documented by in vitro studies that dengue virus (DENV) activates a robust IFNα/β response. However, DENV also induces a down-regulation of the JAK/STAT pathway, inhibiting the induction of interferon regulated genes. As a consequence, the role played by the IFN type 1 response in the protection of dengue patients is not fully understood. To compare IFN-α levels in dengue patients with dengue fever (DF) or dengue hemorrhagic fever (DHF) undergoing primary or secondary infections. Two hundred and four serum samples were analyzed for IFN-α level by cytometric bead array. Patients' clinical condition was assigned following the WHO 1997 criteria and specific IgG and IgM antibodies were measured using commercial assays to determine primary and secondary infections. The infecting serotype was determined by qRT-PCR. The IFN-α levels were found significantly higher in DF than DHF patients irrespective of the infecting serotype (DENV1 or 2), and were found to decline rapidly at day 3 after fever onset. For DENV2 infections, higher IFN-α level was found during primary than secondary infections. These results suggest that an early strong interferon response correlates with a better clinical condition. Copyright © 2014 Elsevier B.V. All rights reserved.

Effects of interferon on antibody formation

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.

1984-01-01

Studies of the effects of interferon on primary and secondary antibody responses and of the relationship of interferon to other cytokines, or cell products, are presented. Dosage- and timing-dependent immunoenhancing and immunosuppressive activities of interferon are documented for mouse spleen cell cultures and for mice infected with murine hepatitis virus (MHV-3). A possibility that altered interferon production might lead to immunopathological disorders, such as lupus erythematosus, AIDS, arthritis, etc., is discussed. Latest technological developments are presented that indicate that interferon does apparently play a major role in the regulation of antibody responses.

Cold activation of complement for monitoring the response to interferon in patients with chronic hepatitis C.

PubMed

Akahane, Y; Miyazaki, Y; Naitoh, S; Takeda, K; Tsuda, F; Okamoto, H; Itoh, K; Miyakawa, Y; Mayumi, M

1996-02-01

Because of its specific association with hepatitis C virus (HCV) infection, the cold activation of complement is an easy and inexpensive indicator of HCV viremia. It was evaluated for eligibility as a marker of response to interferon in patients with hepatitis C. The cold activation of complement was determined by the loss or decrease of hemolytic activity with the microtitration method in sera that had been stored at 4 degrees C overnight. We observed the loss of hemolytic activity by the cold activation of complement in 236 (72%) and a decrease in 56 (17%) of 327 sera from patients with HCV-associated chronic liver disease, which was much more (p < 0.001) that in 1 (1%) and 13 (14%), respectively, of 49 sera from patients with chronic liver disease associated with hepatitis B virus infection. Interferon-alpha (total dose 516 x 10(6) units) or interferon-alpha 2b (774 x 10(6) units) was given to 67 patients with chronic hepatitis C, of whom 56 had the cold activation of complement. The response to interferon was evaluated by the clearance of serum HCV RNA at 6 months after the completion of therapy. The cold activation of complement disappeared in 18 patients, of whom 15 (86%) responded. It persisted or fluctuated in the remaining 38 patients, only six (16%) of whom responded to interferon (p < 0.001). The cold activation of complement once disappeared at the completion of interferon and then reappeared in patients who relapsed after completing interferon therapy. These results indicate that the cold activation of complement may be associated with the presence of HCV in blood and a lower rate of durable response after completion of interferon therapy.

The effect of co-administration of DNA carrying chicken interferon-gamma gene on protection of chickens against infectious bursal disease by DNA-mediated vaccination.

PubMed

Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long

2006-11-17

The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.

Interferon-gamma exerts its negative regulatory effect primarily on the earliest stages of murine erythroid progenitor cell development.

PubMed

Wang, C Q; Udupa, K B; Lipschitz, D A

1995-01-01

Interferon-gamma (INF-gamma) has been shown to suppress erythropoiesis and perhaps to contribute to the anemia of chronic disease. In this study we demonstrated that the concentration of INF gamma required to suppress murine burst forming unit-erythroid (BFU-E) growth was significantly less than that required to suppress colony forming unit-erythroid (CFU-E) growth. INF gamma acted at the most primitive step in erythroid progenitor cell differentiation and proliferation, as inhibition was maximal when added at the time of BFU-E culture initiation. Inhibition was progressively less if INF gamma addition was delayed after culture initiation. The effects of INF gamma on BFU-E did not require the presence of interleukin-1 alpha (IL-1 alpha), tumor necrosis factor-alpha (TNF alpha), or granulocyte macrophage colony stimulating factor (GM-CSF), as its effects were not neutralized by monoclonal antibodies against IL-1 alpha, TNF alpha, or GM-CSF. This applied whether INF gamma was added to culture with individual antibodies or with a combination of all three antibodies. INF gamma was not required for IL-1 alpha- or TNF alpha-induced suppression of BFU-E, as their effects were not neutralized by a monoclonal anti-INF gamma antibody. In contrast, GM-CSF-induced suppression of BFU-E was negated by the simultaneous addition of anti-INF gamma. We have previously shown that the addition of TNF alpha does not suppress BFU-E growth in cultures from marrow depleted of macrophages. Suppression did occur, however, if a small concentration of INF gamma that does not inhibit and increasing concentration of TNF alpha were added to culture, suggesting a synergistic effect between INF-gamma and TNF alpha. These observations suggest that INF gamma is a potent direct inhibitor of erythroid colony growth in vitro. It exerts its negative regulatory effect primarily on the earliest stages of erythroid progenitor cell differentiation and proliferation, as much higher doses are required to

Role of Gamma Interferon in the Pathogenesis of Severe Schistosomiasis in Interleukin-4-Deficient Mice

PubMed Central

La Flamme, Anne Camille; Patton, Elisabeth A.; Pearce, Edward J.

2001-01-01

In the absence of interleukin-4 (IL-4), infection with Schistosoma mansoni leads to a severe fatal disease rather than the chronic survivable condition that occurs in wild-type (WT) mice. Because the sustained production of NO most closely correlates to weight loss and fatality in infected IL-4−/− mice and because gamma interferon (IFN-γ) is an important inducer of inducible NO synthase, infected IL-4−/− mice were treated with anti-IFN-γ antibodies to determine the role of IFN-γ during schistosomiasis in WT and IL-4−/− animals. When IFN-γ was neutralized, Th2 responses were enhanced and NO production was reduced in both WT and IL-4−/− mice. The decreased NO production correlated with a rescue of proliferation in splenocytes from infected IL-4−/− mice. Furthermore, the neutralization of IFN-γ in vivo improved the gross appearance of the liver and led to a reduction in granuloma size in infected IL-4−/− but not WT mice. However, the neutralization of IFN-γ in vivo did not affect the development of severe disease in infected IL-4−/− mice. These results suggest that while the increased production of IFN-γ does lead to some of the pathology observed in infected IL-4−/− mice, it is not ultimately responsible for cachexia and death. PMID:11705919

Reproducibility of Interferon Gamma (IFN-γ) Release Assays. A Systematic Review

PubMed Central

Tagmouti, Saloua; Slater, Madeline; Benedetti, Andrea; Kik, Sandra V.; Banaei, Niaz; Cattamanchi, Adithya; Metcalfe, John; Dowdy, David; van Zyl Smit, Richard; Dendukuri, Nandini

2014-01-01

Rationale: Interferon gamma (IFN-γ) release assays for latent tuberculosis infection result in a larger-than-expected number of conversions and reversions in occupational screening programs, and reproducibility of test results is a concern. Objectives: Knowledge of the relative contribution and extent of the individual sources of variability (immunological, preanalytical, or analytical) could help optimize testing protocols. Methods: We performed a systematic review of studies published by October 2013 on all potential sources of variability of commercial IFN-γ release assays (QuantiFERON-TB Gold In-Tube and T-SPOT.TB). The included studies assessed test variability under identical conditions and under different conditions (the latter both overall and stratified by individual sources of variability). Linear mixed effects models were used to estimate within-subject SD. Measurements and Main Results: We identified a total of 26 articles, including 7 studies analyzing variability under the same conditions, 10 studies analyzing variability with repeat testing over time under different conditions, and 19 studies reporting individual sources of variability. Most data were on QuantiFERON (only three studies on T-SPOT.TB). A considerable number of conversions and reversions were seen around the manufacturer-recommended cut-point. The estimated range of variability of IFN-γ response in QuantiFERON under identical conditions was ±0.47 IU/ml (coefficient of variation, 13%) and ±0.26 IU/ml (30%) for individuals with an initial IFN-γ response in the borderline range (0.25–0.80 IU/ml). The estimated range of variability in noncontrolled settings was substantially larger (±1.4 IU/ml; 60%). Blood volume inoculated into QuantiFERON tubes and preanalytic delay were identified as key sources of variability. Conclusions: This systematic review shows substantial variability with repeat IFN-γ release assays testing even under identical conditions, suggesting that reversions

A randomized phase II trial comparing two different sequence combinations of autologous vaccine and human recombinant interferon gamma and human recombinant interferon alpha2B therapy in patients with metastatic renal cell carcinoma: clinical outcome and analysis of immunological parameters.

PubMed

Schwaab, T; Heaney, J A; Schned, A R; Harris, R D; Cole, B F; Noelle, R J; Phillips, D M; Stempkowski, L; Ernstoff, M S

2000-04-01

The clinical observation of spontaneous regression in patients with renal cell carcinoma (RCC) and the response to various immunotherapeutic therapies strongly suggest a role for the host immune system in this disease. Prior studies showed that sequential administration of interferon (IFN) gamma and IFN alpha to RCC patients was safe. Clinical responses as well as immune changes in the peripheral blood mononuclear cell compartment were observed. Autologous tumor cell vaccines (AV) have also demonstrated activity in renal cell carcinoma. We hypothesize that the addition of AV to sequential IFN gamma and a therapy might improve the tumor-specific immune response by providing an appropriate source of antigen in the appropriate cytokine environment. To our knowledge, this is the first trial using AV combined with IFN alpha and IFN gamma. The purpose of this study was to evaluate the feasibility of manufacturing and administering (AV) from resected tumor samples, and administration of AV with combination IFN gamma and IFN alpha therapy. Finally, the impact on immunological parameters of these treatment options was assessed. Patients with metastatic RCC were randomly assigned to receive AV plus bCG along with a sequential administration of IFN gamma and a either together or after initiation of vaccine. Toxicity and clinical responses were evaluated. Modulations of the immune system were investigated by analyzing phenotype, cytokine mRNA expression, T cell proliferation and cytotoxicity in the peripheral blood mononuclear cell compartment. Fourteen patients with metastatic renal cell carcinoma were enrolled in this study; 9 were available for response evaluation. In a 70 day period, 3 (33%) showed mixed responses, 5 (56%) stable disease and 1 (11%) progression of disease. Toxicities were consistent with previous clinical reports. In the flow-cytometry phenotype analysis, stimulation of distinct subsets of circulating T-lymphocytes and a decrease of CD8+ T cell subsets was

Mycobacterium tuberculosis infection in health care workers in rural India: comparison of a whole-blood interferon gamma assay with tuberculin skin testing.

PubMed

Pai, Madhukar; Gokhale, Kaustubh; Joshi, Rajnish; Dogra, Sandeep; Kalantri, Shriprakash; Mendiratta, Deepak K; Narang, Pratibha; Daley, Charles L; Granich, Reuben M; Mazurek, Gerald H; Reingold, Arthur L; Riley, Lee W; Colford, John M

2005-06-08

Mycobacterium tuberculosis infection in health care workers has not been adequately studied in developing countries using newer diagnostic tests. To estimate latent tuberculosis infection prevalence in health care workers using the tuberculin skin test (TST) and a whole-blood interferon gamma (IFN-gamma) assay; to determine agreement between the tests; and to compare their correlation with risk factors. A cross-sectional comparison study of 726 health care workers aged 18 to 61 years (median age, 22 years) with no history of active tuberculosis conducted from January to May 2004, at a rural medical school in India. A total of 493 (68%) of the health care workers had direct contact with patients with tuberculosis and 514 (71%) had BCG vaccine scars. Tuberculin skin testing was performed using 1-TU dose of purified protein derivative RT23, and the IFN-gamma assay was performed by measuring IFN-gamma response to early secreted antigenic target 6, culture filtrate protein 10, and a portion of tuberculosis antigen TB7.7. Agreement between TST and the IFN-gamma assay, and comparison of the tests with respect to their association with risk factors. A large proportion of the health care workers were latently infected; 360 (50%) were positive by either TST or IFN-gamma assay, and 226 (31%) were positive by both tests. The prevalence estimates of TST and IFN-gamma assay positivity were comparable (41%; 95% confidence interval [CI], 38%-45% and 40%; 95% CI, 37%-43%, respectively). Agreement between the tests was high (81.4%; kappa = 0.61; 95% CI, 0.56-0.67). Increasing age and years in the health profession were significant risk factors for both IFN-gamma assay and TST positivity. BCG vaccination had little impact on TST and IFN-gamma assay results. Our study showed high latent tuberculosis infection prevalence in Indian health care workers, high agreement between TST and IFN-gamma assay, and similar association between positive test results and risk factors. Although TST and

Differential co-promoting activities of alpha, beta and gamma interferons in the murine skin two-stage carcinogenesis model.

PubMed

Reiners, J J; Cantu, A; Thai, G; Pavone, A

1993-03-01

SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.

Effects of type I/type II interferons and transforming growth factor-beta on B-cell differentiation and proliferation. Definition of costimulation and cytokine requirements for immunoglobulin synthesis and expression.

PubMed

Estes, D M; Tuo, W; Brown, W C; Goin, J

1998-12-01

In this report, we sought to determine the role of selected type I interferons [interferon-alpha (IFN-alpha) and interferon-tau (IFN-tau)], IFN-gamma and transforming growth factor-beta (TGF-beta) in the regulation of bovine antibody responses. B cells were stimulated via CD40 in the presence or absence of B-cell receptor (BCR) cross-linking. IFN-alpha enhanced IgM, IgG2 and IgA responses but did not enhance IgG1 responses. BCR signalling alone was more effective at inducing IgG2 responses with IFN-alpha than dual cross-linking with CD40. Recombinant ovine IFN-tau was less effective at inducing IgG2 responses when compared with IFN-alpha, though IgA responses were similar in magnitude following BCR cross-linking. At higher concentrations, IFN-tau enhanced IgA responses greater than twofold over the levels observed with IFN-alpha. Previous studies have shown that addition of IFN-gamma to BCR or pokeweed mitogen-activated bovine B cells stimulates IgG2 production. However, following CD40 stimulation alone, IFN-gamma was relatively ineffective at stimulating high-rate synthesis of any non-IgM isotype. Dual cross-linking via CD40 and the BCR resulted in decreased synthesis of IgM with a concomitant increase in IgA and similar levels of IgG2 production to those obtained via the BCR alone. We also assessed the effects of endogenous and exogenous TGF-beta on immunoglobulin synthesis by bovine B cells. Exogenous TGF-beta stimulates both IgG2 and IgA production following CD40 and BCR cross-linking in the presence of IL-2. Blocking endogenous TGF-beta did not inhibit the up-regulation of IgG2 or IgA by interferons.

Identifying Mechanisms by Which Escherichia coli O157:H7 Subverts Interferon-γ Mediated Signal Transducer and Activator of Transcription-1 Activation

PubMed Central

Ho, Nathan K.; Crandall, Ian; Sherman, Philip M.

2012-01-01

Enterohemorrhagic Escherichia coli serotype O157:H7 is a food borne enteric bacterial pathogen that causes significant morbidity and mortality in both developing and industrialized nations. E. coli O157:H7 infection of host epithelial cells inhibits the interferon gamma pro-inflammatory signaling pathway, which is important for host defense against microbial pathogens, through the inhibition of Stat-1 tyrosine phosphorylation. The aim of this study was to determine which bacterial factors are involved in the inhibition of Stat-1 tyrosine phosphorylation. Human epithelial cells were challenged with either live bacteria or bacterial-derived culture supernatants, stimulated with interferon-gamma, and epithelial cell protein extracts were then analyzed by immunoblotting. The results show that Stat-1 tyrosine phosphorylation was inhibited by E. coli O157:H7 secreted proteins. Using sequential anion exchange and size exclusion chromatography, YodA was identified, but not confirmed to mediate subversion of the Stat-1 signaling pathway using isogenic mutants. We conclude that E. coli O157:H7 subverts Stat-1 tyrosine phosphorylation in response to interferon-gamma through a still as yet unidentified secreted bacterial protein. PMID:22253910

Siglec-1 inhibits RSV-induced interferon gamma production by adult T cells in contrast to newborn T cells.

PubMed

Jans, Jop; Unger, Wendy W J; Vissers, Marloes; Ahout, Inge M L; Schreurs, Inge; Wickenhagen, Arthur; de Groot, Ronald; de Jonge, Marien I; Ferwerda, Gerben

2018-04-01

Interferon gamma (IFN-γ) plays an important role in the antiviral immune response during respiratory syncytial virus (RSV) infections. Monocytes and T cells are recruited to the site of RSV infection, but it is unclear whether cell-cell interactions between monocytes and T cells regulate IFN-γ production. In this study, micro-array data identified the upregulation of sialic acid-binding immunoglobulin-type lectin 1 (Siglec-1) in human RSV-infected infants. In vitro, RSV increased expression of Siglec-1 on healthy newborn and adult monocytes. RSV-induced Siglec-1 on monocytes inhibited IFN-γ production by adult CD4 + T cells. In contrast, IFN-γ production by RSV in newborns was not affected by Siglec-1. The ligand for Siglec-1, CD43, is highly expressed on adult CD4 + T cells compared to newborns. Our data show that Siglec-1 reduces IFN-γ release by adult T cells possibly by binding to the highly expressed CD43. The Siglec-1-dependent inhibition of IFN-γ in adults and the low expression of CD43 on newborn T cells provides a better understanding of the immune response against RSV in early life and adulthood. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effect of recombinant human gamma interferon on intracellular activities of antibiotics against Listeria monocytogenes in the human macrophage cell line THP-1.

PubMed Central

Scorneaux, B; Ouadrhiri, Y; Anzalone, G; Tulkens, P M

1996-01-01

Listeria monocytogenes is a facultative intracellular pathogen which enters cells by endocytosis and reaches phagolysosomes from where it escapes and multiplies in the cytosol of untreated cells. Exposure of macrophages to gamma interferon (IFN-gamma) restricts L. monocytogenes to phagosomes and prevents its intracellular multiplication. We have tested whether IFN-gamma also modulates the susceptibility of L. monocytogenes to antibiotics. We selected drugs from three different classes displaying marked properties concerning their cellular accumulation and subcellular distribution, namely, ampicillin (not accumulated by cells but present in cytosol), azithromycin (largely accumulated by cells but mostly restricted to lysosomes), and sparfloxacin (accumulated to a fair extent but detected only in cytosol). We used a continuous line of myelomonocytic cells (THP-1 macrophages), which display specific surface receptors for IFN-gamma, and examined the activity of these antibiotics against L. monocytogenes Hly+ (virulent variant) and L. monocytogenes Hly- (a nonvirulent variant defective in hemolysin production). Untreated THP-1 and phorbol myristate acetate-differentiated THP-1 were permissive for infection and multiplication of intracellular L. monocytogenes Hly+ (virulent variant). All three antibiotics tested were bactericidal against this Listeria strain when added to an extracellular concentration of 10x their MIC. After preexposure of THP-1 to IFN-gamma, L. monocytogenes Hly+ was still phagocytosed but no longer grew intracellularly. The activity of ampicillin became almost undetectable (antagonistic effect), and that of azithromycin was unchanged (additive effect with that of IFN-gamma), whereas that of sparfloxacin was markedly enhanced (synergy). A similar behavior (lack of bacterial growth, associated with a loss of activity of ampicillin, an enhanced activity of sparfloxacin, and unchanged activity of azithromycin) was observed in cells infected with L

Interferon-gamma inhibits intestinal restitution by preventing gap junction communication between enterocytes.

PubMed

Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J

2007-06-01

Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.

Delayed translational silencing of ceruloplasmin transcript in gamma interferon-activated U937 monocytic cells: role of the 3' untranslated region

NASA Technical Reports Server (NTRS)

Mazumder, B.; Fox, P. L.

1999-01-01

Ceruloplasmin (Cp) is an acute-phase protein with ferroxidase, amine oxidase, and pro- and antioxidant activities. The primary site of Cp synthesis in human adults is the liver, but it is also synthesized by cells of monocytic origin. We have shown that gamma interferon (IFN-gamma) induces the synthesis of Cp mRNA and protein in monocytic cells. We now report that the induced synthesis of Cp is terminated by a mechanism involving transcript-specific translational repression. Cp protein synthesis in U937 cells ceased after 16 h even in the presence of abundant Cp mRNA. RNA isolated from cells treated with IFN-gamma for 24 h exhibited a high in vitro translation rate, suggesting that the transcript was not defective. Ribosomal association of Cp mRNA was examined by sucrose centrifugation. When Cp synthesis was high, i.e., after 8 h of IFN-gamma treatment, Cp mRNA was primarily associated with polyribosomes. However, after 24 h, when Cp synthesis was low, Cp mRNA was primarily in the nonpolyribosomal fraction. Cytosolic extracts from cells treated with IFN-gamma for 24 h, but not for 8 h, contained a factor which blocked in vitro Cp translation. Inhibitor expression was cell type specific and present in extracts of human cells of myeloid origin, but not in several nonmyeloid cells. The inhibitory factor bound to the 3' untranslated region (3'-UTR) of Cp mRNA, as shown by restoration of in vitro translation by synthetic 3'-UTR added as a "decoy" and detection of a binding complex by RNA gel shift analysis. Deletion mapping of the Cp 3'-UTR indicated an internal 100-nucleotide region of the Cp 3'-UTR that was required for complex formation as well as for silencing of translation. Although transcript-specific translational control is common during development and differentiation and global translational control occurs during responses to cytokines and stress, to our knowledge, this is the first report of translational silencing of a specific transcript following cytokine

TNF blockade induces a dysregulated type I interferon response without autoimmunity in paradoxical psoriasis.

PubMed

Conrad, Curdin; Di Domizio, Jeremy; Mylonas, Alessio; Belkhodja, Cyrine; Demaria, Olivier; Navarini, Alexander A; Lapointe, Anne-Karine; French, Lars E; Vernez, Maxime; Gilliet, Michel

2018-01-02

Although anti-tumor necrosis factor (TNF) agents are highly effective in the treatment of psoriasis, 2-5% of treated patients develop psoriasis-like skin lesions called paradoxical psoriasis. The pathogenesis of this side effect and its distinction from classical psoriasis remain unknown. Here we show that skin lesions from patients with paradoxical psoriasis are characterized by a selective overexpression of type I interferons, dermal accumulation of plasmacytoid dendritic cells (pDC), and reduced T-cell numbers, when compared to classical psoriasis. Anti-TNF treatment prolongs type I interferon production by pDCs through inhibition of their maturation. The resulting type I interferon overexpression is responsible for the skin phenotype of paradoxical psoriasis, which, unlike classical psoriasis, is independent of T cells. These findings indicate that paradoxical psoriasis represents an ongoing overactive innate inflammatory process, driven by pDC-derived type I interferon that does not lead to T-cell autoimmunity.

Recombinant interferon-α in myelofibrosis reduces bone marrow fibrosis, improves its morphology and is associated with clinical response.

PubMed

Pizzi, Marco; Silver, Richard T; Barel, Ariella; Orazi, Attilio

2015-10-01

Recombinant interferon-α represents a well-established therapeutic option for the treatment of polycythemia vera and essential thrombocythemia. Recent studies also suggest a role for recombinant interferon-α in the treatment of 'early stage' primary myelofibrosis, but few studies have reported the bone marrow changes after clinically successful interferon therapy. The aim of the present study is to detail the histological responses to recombinant interferon-α in primary myelofibrosis and post-polycythemia vera/post-essential thrombocythemia myelofibrosis and to correlate these with clinical findings. We retrospectively studied 12 patients with primary myelofibrosis or post-polycythemia vera/post-essential thrombocythemia myelofibrosis, who had been treated with recombinant interferon-α. Six patients had received other prior cytoreductive therapies. Bone marrow biopsy was assessed for the following histological parameters: (i) cellularity; (ii) myeloid-to-erythroid ratio; (iii) megakaryocyte tight clusters; (iv) megakaryocyte and naked nuclei density; (v) megakaryocytic atypia; (vi) fibrosis; and (vii) the percentage of blasts. Clinical and laboratory data were included: (i) constitutional symptoms; (ii) splenomegaly, if present; and (iii) complete cell blood count. The clinical response to therapy was evaluated using the International Working Group for Myelofibrosis Research and Treatment/European LeukemiaNet response criteria. The Dynamic International Prognostic Scoring System (DIPSS) score was calculated before and after recombinant interferon-α administration. Successful interferon therapy for myelofibrosis was associated with a significant reduction of marrow fibrosis, cellularity, megakaryocyte density and naked nuclei density. The presence of JAK2(V617F) mutation correlated with improved DIPSS score. JAK2(V617F)-negative cases showed worsening of such score or evolution to acute myeloid leukemia. Cytogenetic analysis documented a normal karyotype in all

Association of monoclonal expansion of Epstein-Barr virus-negative CD158a+ NK cells secreting large amounts of gamma interferon with hemophagocytic lymphohistiocytosis.

PubMed

López-Alvarez, María R; Martínez-Sánchez, María V; Salgado-Cecilia, María G; Campillo, José A; Heine-Suñer, Damian; Villar-Permuy, Florentina; Fuster, José L; Bas, Agueda; Gil-Herrera, Juana; Muro, Manuel; García-Alonso, Ana M; Alvarez-López, María R; Minguela, Alfredo

2009-01-01

We report the first case of hemophagocytic lymphohistiocytosis (HLH) induced by the monoclonal expansion of Epstein-Barr virus (EBV)-negative NK cells. Consanguinity of the patient's parents made it necessary to discard familial HLH in the patient and her sister with identical HLA markers and demonstrate that no cause other than the expansion of NK cells, which secrete high levels of gamma interferon, was inducing HLH in this patient.

Comparison of Cytomegalovirus (CMV) Enzyme-Linked Immunosorbent Spot and CMV Quantiferon Gamma Interferon-Releasing Assays in Assessing Risk of CMV Infection in Kidney Transplant Recipients

PubMed Central

Saldan, Alda; Mengoli, Carlo; Fiscon, Marta; Silvestre, Cristina; Fallico, Loredana; Peracchi, Marta; Furian, Lucrezia; Cusinato, Riccardo; Bonfante, Luciana; Rossi, Barbara; Marchini, Francesco; Sgarabotto, Dino; Rigotti, Paolo; Palù, Giorgio

2013-01-01

Assessing cytomegalovirus (CMV)-specific cell-mediated immunity (CMI) represents an appealing strategy for identifying transplant recipients at risk of infection. In this study, we compared two gamma interferon-releasing assays (IGRAs), Quantiferon-CMV and CMV enzyme-linked immunosorbent spot (ELISPOT), to determine the ability of each test to predict protective CMV-specific T-cell responses. Two hundred twenty-one Quantiferon-CMV and ELISPOT tests were conducted on 120 adult kidney transplant recipients (KTRs), including 100 CMV-seropositive transplant recipients (R+) and 20 CMV-seronegative transplant recipients of a CMV-positive donor (D+/R−). As a control cohort, 39 healthy adult subjects (including 33 CMV-seropositive and 6 CMV-seronegative subjects) were enrolled. CMV IgG serology was used as a reference for both tests. In the CMV-seropositive individuals, the ELISPOT and Quantiferon-CMV assays provided 46% concordance with the serology, 12% discordance, 18% disagreement between ELISPOT or Quantiferon-CMV and the serology, and 24% gray areas when one or both tests resulted in weak positives. None of the CMV-seronegative subjects showed detectable responses in the ELISPOT or the Quantiferon-CMV test. In transplant recipients, both the ELISPOT and Quantiferon-CMV assays positively correlated with each other and negatively correlated with CMV DNAemia in a significant way (P < 0.05). During the antiviral prophylaxis, all 20 D+/R− KTRs we examined displayed undetectable Quantiferon-CMV and ELISPOT results, and there was no evidence of CMV seroconversion. The receiving operator curve (ROC) statistical analysis revealed similar specificities and sensitivities in predicting detectable viremia (areas under the curve [AUC], 0.66 and 0.62 for Quantiferon-CMV and ELISPOT, respectively). ELISPOT and Quantiferon-CMV values of >150 spots/200,000 peripheral blood mononuclear cells (PBMCs) and >1 to 6 IU gamma interferon (IFN-γ) were associated with protection from CMV

Contradictory results in interferon research

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.

1984-01-01

Several reports on immunologically related interferon research, both in the areas of basic science and clinical research, are briefly reviewed, and it is noted that in many cases the results obtained are contradictory. It is argued, however, that the contradictory results are not surprising since interferon is a biological response modifier and has been known to produce opposite results even when the same interferon prepartion is used. It is emphasized that dosage, timing, route, and other experimental conditions are essential factors in planning immunological studies with interferon. Careful planning of future experiments with interferon should be required to prevent the possible generation of effects that are opposite to those expected.

Autonomous parvoviruses neither stimulate nor are inhibited by the type I interferon response in human normal or cancer cells.

PubMed

Paglino, Justin C; Andres, Wells; van den Pol, Anthony N

2014-05-01

Members of the genus Parvovirus are small, nonenveloped single-stranded DNA viruses that are nonpathogenic in humans but have potential utility as cancer therapeutics. Because the innate immune response to parvoviruses has received relatively little attention, we compared the response to parvoviruses to that of several other types of viruses in human cells. In normal human glia, fibroblasts, or melanocytes, vesicular stomatitis virus evoked robust beta interferon (IFN-β) responses. Cytomegalovirus, pseudorabies virus, and Sindbis virus all evoked a 2-log-unit or greater upregulation of IFN-β in glia; in contrast, LuIII and MVMp parvoviruses did not evoke a detectable IFN-β or interferon-stimulated gene (ISG; MX1, oligoadenylate synthetase [OAS], IFIT-1) response in the same cell types. The lack of response raised the question of whether parvoviral infection can be attenuated by IFN; interestingly, we found that IFN did not decrease parvovirus (MVMp, LuIII, and H-1) infectivity in normal human glia, fibroblasts, or melanocytes. The same was true in human cancers, including glioma, sarcoma, and melanoma. Similarly, IFN failed to attenuate transduction by the dependovirus vector adeno-associated virus type 2. Progeny production of parvoviruses was also unimpaired by IFN in both glioma and melanoma, whereas vesicular stomatitis virus replication was blocked. Sarcoma cells with upregulated IFN signaling that show high levels of resistance to other viruses showed strong infection by LuIII. Unlike many other oncolytic viruses, we found no evidence that impairment of innate immunity in cancer cells plays a role in the oncoselectivity of parvoviruses in human cells. Parvoviral resistance to the effects of IFN in cancer cells may constitute an advantage in the virotherapy of some tumors. Understanding the interactions between oncolytic viruses and the innate immune system will facilitate employing these viruses as therapeutic agents in cancer patients. The cancer

Autonomous Parvoviruses neither Stimulate nor Are Inhibited by the Type I Interferon Response in Human Normal or Cancer Cells

PubMed Central

Paglino, Justin C.; Andres, Wells

2014-01-01

ABSTRACT Members of the genus Parvovirus are small, nonenveloped single-stranded DNA viruses that are nonpathogenic in humans but have potential utility as cancer therapeutics. Because the innate immune response to parvoviruses has received relatively little attention, we compared the response to parvoviruses to that of several other types of viruses in human cells. In normal human glia, fibroblasts, or melanocytes, vesicular stomatitis virus evoked robust beta interferon (IFN-β) responses. Cytomegalovirus, pseudorabies virus, and Sindbis virus all evoked a 2-log-unit or greater upregulation of IFN-β in glia; in contrast, LuIII and MVMp parvoviruses did not evoke a detectable IFN-β or interferon-stimulated gene (ISG; MX1, oligoadenylate synthetase [OAS], IFIT-1) response in the same cell types. The lack of response raised the question of whether parvoviral infection can be attenuated by IFN; interestingly, we found that IFN did not decrease parvovirus (MVMp, LuIII, and H-1) infectivity in normal human glia, fibroblasts, or melanocytes. The same was true in human cancers, including glioma, sarcoma, and melanoma. Similarly, IFN failed to attenuate transduction by the dependovirus vector adeno-associated virus type 2. Progeny production of parvoviruses was also unimpaired by IFN in both glioma and melanoma, whereas vesicular stomatitis virus replication was blocked. Sarcoma cells with upregulated IFN signaling that show high levels of resistance to other viruses showed strong infection by LuIII. Unlike many other oncolytic viruses, we found no evidence that impairment of innate immunity in cancer cells plays a role in the oncoselectivity of parvoviruses in human cells. Parvoviral resistance to the effects of IFN in cancer cells may constitute an advantage in the virotherapy of some tumors. IMPORTANCE Understanding the interactions between oncolytic viruses and the innate immune system will facilitate employing these viruses as therapeutic agents in cancer patients

Interaction of SARS and MERS Coronaviruses with the Antiviral Interferon Response.

PubMed

Kindler, E; Thiel, V; Weber, F

2016-01-01

Severe Acute Respiratory Syndrome (SARS) and Middle East Respiratory Syndrome (MERS) are the most severe coronavirus (CoV)-associated diseases in humans. The causative agents, SARS-CoV and MERS-CoV, are of zoonotic origin but may be transmitted to humans, causing severe and often fatal respiratory disease in their new host. The two coronaviruses are thought to encode an unusually large number of factors that allow them to thrive and replicate in the presence of efficient host defense mechanisms, especially the antiviral interferon system. Here, we review the recent progress in our understanding of the strategies that highly pathogenic coronaviruses employ to escape, dampen, or block the antiviral interferon response in human cells. © 2016 Elsevier Inc. All rights reserved.

AN ORIENTATIONAL RESPONSE TO WEAK GAMMA RADIATION

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, F.A. Jr.

1963-10-01

The common planarian worm, Duesia dorotocephsla, displays a significant orientational response to increase in Cs/sup 137/ gamma radiation when the increase is no greater than six times background. The worms are able to distinguish the direction of the weak gamma source, turning away from it, whether it is presented on the right or left side. The response sign is, therefore, the same as that of the response of these negatively phototactic worms to visible light. There is a clear compass-directional relationship of the responsiveness to the experimental gamma radiation. A conspicuous negative response is present when the worms are travelingmore » northward or southward in the earth's field with the gamma change in an east-west axis. No statistically significant mean turning response to the gamma radiation is found when the worms are traveling eastward or westward in the earth's field with the gamma change in a north-south axis. The previously observed annual fluctuation in the character of the monthly orientational rhythm of north-directed worms has been confirmed in an additional year of study. During colder months, the rhythm is monthly; during warmer months it is semi-monthly. There is a semi-monthly fluctuation in the response of Dugesia to weak gamma radiation during mid-morning hours, the worms turning away from the source for four days prior to new end full moon, and toward it for two days following new and full moon. The stronger the field strength, up to 9 times backgound, the larger the amplitude of the rhythm. There is a direct relationship between intensities of gamma radiation between that of background and nine times backgound, and the strength of the negative response of the worms. Evidence suggests that the negative response of Dugesia to a gamma source may be modified by experimental alteration of the natural ambient electrostatic field. Some possible biological significances of this remarkable responsiveness to gamma radiation, and its particular

Immune Response Following Photodynamic Therapy For Bladder Cancer

NASA Astrophysics Data System (ADS)

Raymond K.

1989-06-01

This study was undertaken to determine if photodynamic therapy (PDT) produces an immunologic response in patients treated for bladder cancer. Gamma interferon, interleukin 1-beta, interleukin 2 and tumor necrosis factor-alpha were assayed in the urine of four patients treated with photodynamic therapy for bladder cancer, in seven patients undergoing transurethral procedures, and in five healthy control subjects. Quantifiable concentrations of all cytokines, except gamma interferon, were measured in urine samples from the PDT patients treated with the highest light energies, while no urinary cytokines were found in the PDT patient who received the lowest light energy or in the control subjects. These findings suggest that a local immunologic response may occur following PDT for bladder cancer. Such an immunologic response activated by PDT may be an additional mechanism involved in bladder tumor destruction.

The evolution of the major hepatitis C genotypes correlates with clinical response to interferon therapy.

PubMed

Pang, Phillip S; Planet, Paul J; Glenn, Jeffrey S

2009-08-11

Patients chronically infected with hepatitis C virus (HCV) require significantly different durations of therapy and achieve substantially different sustained virologic response rates to interferon-based therapies, depending on the HCV genotype with which they are infected. There currently exists no systematic framework that explains these genotype-specific response rates. Since humans are the only known natural hosts for HCV-a virus that is at least hundreds of years old-one possibility is that over the time frame of this relationship, HCV accumulated adaptive mutations that confer increasing resistance to the human immune system. Given that interferon therapy functions by triggering an immune response, we hypothesized that clinical response rates are a reflection of viral evolutionary adaptations to the immune system. We have performed the first phylogenetic analysis to include all available full-length HCV genomic sequences (n = 345). This resulted in a new cladogram of HCV. This tree establishes for the first time the relative evolutionary ages of the major HCV genotypes. The outcome data from prospective clinical trials that studied interferon and ribavirin therapy was then mapped onto this new tree. This mapping revealed a correlation between genotype-specific responses to therapy and respective genotype age. This correlation allows us to predict that genotypes 5 and 6, for which there currently are no published prospective trials, will likely have intermediate response rates, similar to genotype 3. Ancestral protein sequence reconstruction was also performed, which identified the HCV proteins E2 and NS5A as potential determinants of genotype-specific clinical outcome. Biochemical studies have independently identified these same two proteins as having genotype-specific abilities to inhibit the innate immune factor double-stranded RNA-dependent protein kinase (PKR). An evolutionary analysis of all available HCV genomes supports the hypothesis that immune

Cellular immune responses in patients with hepatitis B surface antigen seroclearance induced by antiviral therapy

PubMed Central

2011-01-01

Background The mechanisms by which chronic hepatitis B is completely resolved through antiviral therapy are unknown, and the contribution of acquired T cell immunity to hepatitis B surface antigen (HBsAg) seroclearance has not been investigated. Therefore, we measured the T-cell responses to core and envelope antigens in patients with HBsAg seroclearance. Methods Fourteen subjects with HBsAg seroclearance following antiviral treatment for chronic hepatitis B, 7 HBeAg-positive immunotolerant HBV carriers and 9 HBeAg-negative inactive HBsAg carriers were recruited. HBV-specific T-cell responses to recombinant HBV core (rHBcAg) and envelope (rHBsAg) proteins and pools of core and envelope peptides were measured using an ELISPOT assay detecting interferon-gamma and intracellular cytokine staining (ICS) assays detecting interferon-gamma or interleukin 2. Results Interferon-gamma ELISPOT assays showed a low frequency of weak responses to the rHBsAg and S peptide pool in the HBsAg seroclearance group, and the response frequency to the rHBcAg and the C peptide pool was higher than to the rHBsAg (P < 0.001) and S peptide pool (P = 0.001) respectively. A higher response frequency to C than S peptide pools was confirmed in the interferon-gamma ICS assays for both CD4+ (P = 0.033) and CD8+ (P = 0.040) T cells in the HBsAg seroclearance group. The responses to C and S antigens in the inactive carriers were similar. Conclusions There was a low frequency of CD4+ and CD8+ T cell immune responses to envelope antigens in Chinese subjects with HBsAg seroclearance following antiviral therapy. It is unlikely that these immune responses are responsible for HBsAg seroclearance in these subjects. PMID:21320337

Interferon-γ-inducible protein-10 in chronic hepatitis C: Correlations with insulin resistance, histological features & sustained virological response.

PubMed

Crisan, Dana; Grigorescu, Mircea Dan; Radu, Corina; Suciu, Alina; Grigorescu, Mircea

2017-04-01

One of the multiple factors contributing to virological response in chronic hepatitis C (CHC) is interferon-gamma-inducible protein-10 (IP-10). Its level reflects the status of interferon-stimulated genes, which in turn is associated with virological response to antiviral therapy. The aim of this study was to evaluate the role of serum IP-10 levels on sustained virological response (SVR) and the association of this parameter with insulin resistance (IR) and liver histology. Two hundred and three consecutive biopsy proven CHC patients were included in the study. Serum levels of IP-10 were determined using ELISA method. IR was evaluated by homeostasis model assessment-IR (HOMA-IR). Histological features were assessed invasively by liver biopsy and noninvasively using FibroTest, ActiTest and SteatoTest. Predictive factors for SVR and their interrelations were assessed. A cut-off value for IP-10 of 392 pg/ml was obtained to discriminate between responders and non-responders. SVR was obtained in 107 patients (52.70%). Area under the receiver operating characteristic curve for SVR was 0.875 with a sensitivity of 91.6 per cent, specificity 74.7 per cent, positive predictive value 80.3 per cent and negative predictive value 88.7 per cent. Higher values of IP-10 were associated with increasing stages of fibrosis (P<0.01) and higher grades of inflammation (P=0.02, P=0.07) assessed morphologically and noninvasively through FibroTest and ActiTest. Significant steatosis and IR were also associated with increased levels of IP-10 (P=0.01 and P=0.02). In multivariate analysis, IP-10 levels and fibrosis stages were independently associated with SVR. Our findings showed that the assessment of serum IP-10 level could be a predictive factor for SVR and it was associated with fibrosis, necroinflammatory activity, significant steatosis and IR in patients with chronic HCV infection.

Secretion of interferon gamma from human immune cells is altered by exposure to tributyltin and dibutyltin.

PubMed

Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret

2015-05-01

Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h, and 6 day exposures to TBT (200 - 2.5 nM) and DBT (5 - 0.05 µM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from immune cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. © 2013 Wiley Periodicals, Inc.

A novel mechanism of skin tumor promotion involving interferon-gamma (IFNγ)/signal transducer and activator of transcription-1 (Stat1) signaling.

PubMed

Bozeman, Ronald; Abel, Erika L; Macias, Everardo; Cheng, Tianyi; Beltran, Linda; DiGiovanni, John

2015-08-01

The current study was designed to explore the role of signal transducer and activator of transcription 1 (Stat1) during tumor promotion using the mouse skin multistage carcinogenesis model. Topical treatment with both 12-O-tetradecanoylphorbol-13-acetate (TPA) and 3-methyl-1,8-dihydroxy-9-anthrone (chrysarobin or CHRY) led to rapid phosphorylation of Stat1 on both tyrosine (Y701) and serine (S727) residues in epidermis. CHRY treatment also led to upregulation of unphosphorylated Stat1 (uStat1) at later time points. CHRY treatment also led to upregulation of interferon regulatory factor 1 (IRF-1) mRNA and protein, which was dependent on Stat1. Further analyses demonstrated that topical treatment with CHRY but not TPA upregulated interferon-gamma (IFNγ) mRNA in the epidermis and that the induction of both IRF-1 and uStat1 was dependent on IFNγ signaling. Stat1 deficient (Stat1(-/-) ) mice were highly resistant to skin tumor promotion by CHRY. In contrast, the tumor response (in terms of both papillomas and squamous cell carcinomas) was similar in Stat1(-/-) mice and wild-type littermates with TPA as the promoter. Maximal induction of both cyclooxygenase-2 and inducible nitric oxide synthase in epidermis following treatment with CHRY was also dependent on the presence of functional Stat1. These studies define a novel mechanism associated with skin tumor promotion by the anthrone class of tumor promoters involving upregulation of IFNγ signaling in the epidermis and downstream signaling through activated (phosphorylated) Stat1, IRF-1 and uStat1. © 2014 Wiley Periodicals, Inc.

Glycosaminoglycans mediate retention of the poxvirus type I interferon binding protein at the cell surface to locally block interferon antiviral responses

PubMed Central

Montanuy, Imma; Alejo, Ali; Alcami, Antonio

2011-01-01

Eradication of smallpox was accomplished 30 yr ago, but poxviral infections still represent a public health concern due to the potential release of variola virus or the emergence of zoonotic poxviruses, such as monkeypox virus. A critical determinant of poxvirus virulence is the inhibition of interferons (IFNs) by the virus-encoded type I IFN-binding protein (IFNα/βBP). This immunomodulatory protein is secreted and has the unique property of interacting with the cell surface in order to prevent IFN-mediated antiviral responses. However, the mechanism of its attachment to the cell surface remains unknown. Using surface plasmon resonance and cell-binding assays, we report that the IFNα/βBP from vaccinia virus, the smallpox vaccine, interacts with cell surface glycosaminoglycans (GAGs). Analysis of the contribution of different regions of the protein to cell surface binding demonstrated that clusters of basic residues in the first immunoglobulin domain mediate GAG interactions. Furthermore, mutation of the GAG-interaction motifs does not affect its IFN-binding and -blocking capacity. Functional conservation of GAG-binding sites is demonstrated for the IFNα/βBP from variola and monkeypox viruses, extending our understanding of immune modulation by the most virulent human poxviruses. These results are relevant for the design of improved vaccines and intervention strategies.—Montanuy, I., Alejo, A., Alcami, A. Glycosaminoglycans mediate retention of the poxvirus type I interferon binding protein at the cell surface to locally block interferon antiviral responses. PMID:21372110

ATL response to arsenic/interferon therapy is triggered by SUMO/PML/RNF4-dependent Tax degradation.

PubMed

Dassouki, Zeina; Sahin, Umut; El Hajj, Hiba; Jollivet, Florence; Kfoury, Youmna; Lallemand-Breitenbach, Valérie; Hermine, Olivier; de Thé, Hugues; Bazarbachi, Ali

2015-01-15

The human T-cell lymphotropic virus type I (HTLV-1) Tax transactivator initiates transformation in adult T-cell leukemia/lymphoma (ATL), a highly aggressive chemotherapy-resistant malignancy. The arsenic/interferon combination, which triggers degradation of the Tax oncoprotein, selectively induces apoptosis of ATL cell lines and has significant clinical activity in Tax-driven murine ATL or human patients. However, the role of Tax loss in ATL response is disputed, and the molecular mechanisms driving degradation remain elusive. Here we demonstrate that ATL-derived or HTLV-1-transformed cells are dependent on continuous Tax expression, suggesting that Tax degradation underlies clinical responses to the arsenic/interferon combination. The latter enforces promyelocytic leukemia protein (PML) nuclear body (NB) formation and partner protein recruitment. In arsenic/interferon-treated HTLV-1 transformed or ATL cells, Tax is recruited onto NBs and undergoes PML-dependent hyper-sumoylation by small ubiquitin-like modifier (SUMO)2/3 but not SUMO1, ubiquitination by RNF4, and proteasome-dependent degradation. Thus, the arsenic/interferon combination clears ATL through degradation of its Tax driver, and this regimen could have broader therapeutic value by promoting degradation of other pathogenic sumoylated proteins. © 2015 by The American Society of Hematology.

Borrelia-primed and -infected mice deficient of interleukin-17 develop arthritis after neutralization of gamma-interferon.

PubMed

Kuo, Joseph; Warner, Thomas F; Schell, Ronald F

2017-03-01

The immune mechanisms responsible for development of Lyme arthritis are partially understood with interleukin-17 (IL-17) and gamma-interferon (IFN-γ) playing a generally accepted role. Elevated levels of IL-17 and/or IFN-γ have been reported in samples from human Lyme arthritis patients and experimental mice. In addition, IL-17 and IFN-γ have been implicated in the onset of arthritis in Borrelia-primed and -infected C57BL/6 mice. Recently, we showed that IL-17-deficient mice developed swelling and histopathological changes consistent with arthritis in the presence of high levels of IFN-γ. We hypothesized that neutralization of IFN-γ in IL-17-deficient mice would inhibit Borrelia-induced arthritis. Our results, however, showed that swelling of the hind paws and histopathological changes of arthritis did not differ between Borrelia-primed and -infected IL-17-deficient and wild-type mice with or without neutralization of IFN-γ. We also found higher levels of tumor necrosis factor alpha (TNF-α) and IL-6 in the popliteal lymph node cells of Borrelia-primed and -infected IL-17-deficient mice after neutralization of IFN-γ. These results suggest that multiple cytokines interact in the development of Borrelia-induced arthritis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Effects of positive results for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA on results of caudal fold tuberculin test and interferon-gamma assay for tuberculosis in cattle.

PubMed

Dunn, John R; Kaneene, John B; Grooms, Daniel L; Bolin, Steven R; Bolin, Carole A; Bruning-Fann, Colleen S

2005-02-01

To determine whether cattle testing positive for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA were more likely to have false-positive responses on the caudal fold tuberculin (CFT) test or interferon-gamma (IFN-gamma) assay for Mycobacterium bovis than cattle testing negative for M paratuberculosis. 1043 cattle from 10 herds in Michigan. Feces and blood samples for plasma were collected from cattle > or =24 months old on the day the CFT test was read. Fecal samples were submitted for microbial culture for M paratuberculosis. Plasma samples were tested for antibody against M paratuberculosis, and IFN-gamma after stimulation with purified protein derivative tuberculin from M bovis or M avium. Of 1043 cattle, 180 (17.3%) had positive CFT test results (suspects) and 8 (0.8%) had positive IFN-gamma assay results after stimulation with purified protein derivative tuberculin from M bovis. Forty-five (4.3%) and 115 (11.0%) cattle tested positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA, respectively. Cattle with positive responses for M paratuberculosis appeared to have an increased likelihood of false-positive results on the CFT test, although this association was not significant. No significant association was detected among cattle testing positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA and positive CFT test and IFN-gamma assay results for M bovis.

Immunomodulatory intervention with Gamma interferon in mice with sepsis.

PubMed

Wang, Yu; Kong, Bing-Bing; Yang, Wen-Ping; Zhao, Xin; Zhang, Rong

2017-09-15

Sepsis-triggered immune paralysis including T-cell dysfunction increase susceptibility to infection. Gamma interferon (IFNg) exert beneficial effects in patients with sepsis. Herein, we speculated that IFNg may attenuate T-cell dysfunction induced by sepsis, although the mechanisms remain elusive. To test this hypothesis, we used a model based on cecal ligation and puncture (CLP) to induce sepsis in mice. Male C57BL/6 mice were pretreated with recombinant human IFNg (0.01μg/g of body weight) before CLP. The immunophenotyping of cell surface receptor expression, and regulatory T cells (CD4+CD25+Foxp3+) were quantified by flow cytometry. Immunohistochemical staining was performed to evaluate the loss of immune effector cells. Formation of IFNg and interleukin 4 (IL-4) in the spleen and plasma levels of TNF-α, IL-6, high-mobility group box 1 (HMGB1) were determined using enzyme-linked immunosorbent assay. IFNg markedly inhibited the reduction in cytokine secretion from lipopolysaccharide (LPS)-stimulated splenocytes. IFNg-treated mices had significantly decreased percentages of programmed cell death 1 (PD-1) receptors, increased the percentages of positive costimulatory receptor CD28 on CD4 T cells expressing. IFNg markedly reduced T-cell apoptosis through upregulating the expression of Bcl-2. CLP-induced formation of regulatory T cells in the spleen was abolished in IFNg -treated mices. Moreover, IFNg treatment reduced plasma levels of TNF-α, IL-6, HMGB1. IFNg can be a powerful regulator of immune function under sepsis conditions. Therefore, targeted immune-enhancement with IFNg may be a valid therapeutic approach in sepsis. Copyright © 2017 Elsevier Inc. All rights reserved.

Polyfunctional CD4 T cells in the response to bovine tuberculosis

USDA-ARS?s Scientific Manuscript database

Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), interleukin-2 (IL-2) and tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB and HIV. However, the assessment of this response in bovine infections was not fe...

Exacerbated type II interferon response drives hypervirulence and toxic shock by an emergent epidemic strain of Streptococcus suis.

PubMed

Lachance, Claude; Gottschalk, Marcelo; Gerber, Pehuén P; Lemire, Paul; Xu, Jianguo; Segura, Mariela

2013-06-01

Streptococcus suis, a major porcine pathogen, can be transmitted to humans and cause severe symptoms. A large human outbreak associated with an unusual streptococcal toxic shock-like syndrome (STSLS) was described in China. Albeit an early burst of proinflammatory cytokines following Chinese S. suis infection was suggested to be responsible for STSLS case severity, the mechanisms involved are still poorly understood. Using a mouse model, the host response to S. suis infection with a North American intermediately pathogenic strain, a European highly pathogenic strain, and the Chinese epidemic strain was investigated by a whole-genome microarray approach. Proinflammatory genes were expressed at higher levels in mice infected with the Chinese strain than those infected with the European strain. The Chinese strain induced a fast and strong gamma interferon (IFN-γ) response by natural killer (NK) cells. In fact, IFN-γ-knockout mice infected with the Chinese strain showed significantly better survival than wild-type mice. Conversely, infection with the less virulent North American strain resulted in an IFN-β-subjugated, low inflammatory response that might be beneficial for the host to clear the infection. Overall, our data suggest that a highly virulent epidemic strain has evolved to massively activate IFN-γ production, mainly by NK cells, leading to a rapid and lethal STSLS.

Dynamic Changes in Pro- and Anti-Inflammatory Cytokine Profiles and Gamma Interferon Receptor Signaling Integrity Correlate with Tuberculosis Disease Activity and Response to Curative Treatment▿

PubMed Central

Sahiratmadja, Edhyana; Alisjahbana, Bachti; de Boer, Tjitske; Adnan, Iskandar; Maya, Anugrah; Danusantoso, Halim; Nelwan, Ronald H. H.; Marzuki, Sangkot; van der Meer, Jos W. M.; van Crevel, Reinout; van de Vosse, Esther; Ottenhoff, Tom H. M.

2007-01-01

Pro- and anti-inflammatory cytokines and their signaling pathways play key roles in protection from and pathogenesis of mycobacterial infection, and their balance and dynamic changes may control or predict clinical outcome. Peripheral blood cells' capacity to produce proinflammatory (tumor necrosis factor alpha [TNF-α], interleukin-12/23p40 [IL-12/23p40], and gamma interferon [IFN-γ]) and anti-inflammatory (IL-10) cytokines in response to Mycobacterium tuberculosis or unrelated stimuli (lipopolysaccharide, phytohemagglutinin) was studied in 93 pulmonary tuberculosis (TB) patients and 127 healthy controls from Indonesia. Their cells' ability to respond to IFN-γ was examined to investigate whether M. tuberculosis infection can also inhibit IFN-γ receptor (IFN-γR) signaling. Although there was interindividual variability in the observed responses, the overall results revealed that M. tuberculosis-induced TNF-α and IFN-γ levels showed opposite trends. Whereas TNF-α production was higher in active-TB patients than in controls, IFN-γ production was strongly depressed during active TB, correlated inversely with TB disease severity, and increased during therapy. By contrast, mitogen-induced IFN-γ production, although lower in patients than in controls, did not change during treatment, suggesting an M. tuberculosis-specific and reversible component in the depression of IFN-γ. Depressed IFN-γ production was not due to decreased IL-12/IL-23 production. Importantly, IFN-γ-inducible responses were also significantly depressed during active TB and normalized during treatment, revealing disease activity-related and reversible impairment in IFN-γR signaling in TB. Finally, IFN-γ/IL-10 ratios significantly correlated with TB cure. Taken together, these results show that M. tuberculosis-specific stimulation of IFN-γ (but not TNF-α) production and IFN-γR signaling are significantly depressed in active TB, correlate with TB disease severity and activity, and

Fish oil feeding delays influenza virus clearance and impairs production of interferon-gamma and virus-specific immunoglobulin A in the lungs of mice.

PubMed

Byleveld, P M; Pang, G T; Clancy, R L; Roberts, D C

1999-02-01

Ingestion of fish oil can suppress the inflammatory response to injury and may impair host resistance to infection. To investigate the effect of a diet containing fish oil on immunity to viral infection, 148 BALB/c mice were fed diets containing 3 g/100 g of sunflower oil with either 17 g/100 g of fish oil or beef tallow for 14 d before intranasal challenge with live influenza virus. At d 1 and d 5 after infection, the mice fed fish oil had higher lung viral load and lower body weight (P < 0.05). In addition to the greater viral load and weight loss at d 5 after infection, the fish oil group consumed less food (P < 0.05) while the beef tallow group was clearing the virus, had regained their preinfection weights and was returning to their preinfection food consumption. The fish oil group had impaired production of lung interferon-gamma (IFN-gamma), serum immunoglobulin (Ig) G and lung IgA-specific antibodies (all P < 0. 05) although lung IFN-alpha/beta and the relative proportions of bronchial lymph node CD4+ and CD8+ T lymphocytes did not differ between groups after infection. The present study demonstrates a delay in virus clearance in mice fed fish oil associated with reduced IFN-gamma and antibody production and a greater weight loss and suppression of appetite following influenza virus infection. However, differences observed during the course of infection did not affect the ultimate outcome as both groups cleared the virus and returned to preinfection food consumption and body weight by d 7.

STING-Dependent Interferon-λ1 Induction in HT29 Cells, a Human Colorectal Cancer Cell Line, After Gamma-Radiation.

PubMed

Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J

2018-05-01

To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.

Effects of peritoneal fluid from endometriosis patients on interferon-gamma-induced protein-10 (CXCL10) and interleukin-8 (CXCL8) released by neutrophils and CD4+ T cells.

PubMed

Kim, Ji-Yeon; Lee, Dong-Hyung; Joo, Jong-Kil; Jin, Jun-O; Wang, Ji-Won; Hong, Young-Seoub; Kwak, Jong-Young; Lee, Kyu-Sup

2009-09-01

Intraperitoneal immuno-inflammatory changes may be associated with the pathogenesis of endometriosis. We evaluated the effects of peritoneal fluid obtained from patients with endometriosis (ePF) on the release of interferon-gamma-induced protein-10 (IP-10/CXCL10) and interleukin-8 (IL-8/CXCL8) by neutrophils, CD4(+) T cells, and monocytes. Neutrophils, CD4(+) T cells, and monocytes were cultured with ePF and the chemokine levels in the supernatants were then measured using enzyme-linked immunosorbent assay. The addition of ePF to cultures of CD4(+) T cells led to a significant increase in the release of IP-10 when compared with control PF without endometriosis (cPF). There was a positive correlation between the levels of IL-8 and IP-10 in ePF (R = 0.89, P = 0.041), but not between the levels of IP-10 and IL-8 released by neutrophils, CD4(+) T cells, and monocytes. The levels of IP-10 in ePF were positively correlated with the release of IP-10 by ePF-treated neutrophils (R = 0.89, P < 0.001), CD4(+) T cells (R = 0.93, P < 0.001), and monocytes (R = 0.70, P = 0.01). Moreover, the addition of ePF significantly enhanced the interferon-gamma-induced release of IP-10 by nuetrophils and CD4(+) T cells. These findings suggest that neutrophils and T cells release differential levels of IP-10 and IL-8 in response to stimulation with ePF, and that these cells are a major source of IP-10 in the PF of endometriosis patients.

Human Papilloma Virus Infection Does Not Predict Response to Interferon Therapy in Ocular Surface Squamous Neoplasia.

PubMed

Galor, Anat; Garg, Nisha; Nanji, Afshan; Joag, Madhura; Nuovo, Gerard; Palioura, Sotiria; Wang, Gaofeng; Karp, Carol L

2015-11-01

To identify the frequency of human papilloma virus (HPV) in ocular surface squamous neoplasia (OSSN) and to evaluate differences in clinical features and treatment response of tumors with positive versus negative HPV results. Retrospective case series. Twenty-seven patients with OSSN. Ocular surface squamous neoplasia specimens were analyzed for the presence of HPV. Clinical features and response to interferon were determined retrospectively and linked to the presence (versus absence) of HPV. Clinical characteristics of OSSN by HPV status. Twenty-one of 27 tumors (78%) demonstrated positive HPV results. The HPV genotypes identified included HPV-16 in 10 tumors (48%), HPV-31 in 5 tumors, HPV-33 in 1 tumor, HPV-35 in 2 tumors, HPV-51 in 2 tumors, and a novel HPV in 3 tumors (total of 23 tumors because 1 tumor had 3 identified genotypes). Tumors found in the superior limbus were more likely to show positive HPV results (48% vs. 0%; P=0.06, Fisher exact test). Tumors with positive HPV-16 results were larger (68 vs. 34 mm2; P=0.08, Mann-Whitney U test) and were more likely to have papillomatous morphologic features (50% vs. 12%; P=0.07, Fisher exact test) compared with tumors showing negative results for HPV-16. Human papilloma virus status was not found to be associated with response to interferon therapy (P=1.0, Fisher exact test). Metrics found to be associated with a nonfavorable response to interferon were male gender and tumors located in the superior conjunctivae. The presence of HPV in OSSN seems to be more common in lesions located in the nonexposed, superior limbus. Human papilloma virus presence does not seem to be required for a favorable response to interferon therapy. Copyright © 2015 American Academy of Ophthalmology. All rights reserved.

Enhancing effects of gamma interferon on phagocytic cell association with and killing of Trypanosoma cruzi

NASA Technical Reports Server (NTRS)

Wirth, J. J.; Kierszenbaum, F.; Sonnenfeld, G.; Zlotnik, A.

1985-01-01

Results are reported from a study of the influence gamma interferon (GIFN) and interleukin 2 (IL2) have on the capability of P388D1 cells and mouse resident peritoneal macrophages (MPM) to attach to the blood-resident parasites Trypanosoma cruzi and kill them. Cultures of trypomastigote forms of the Tulahuen strain of T. cruzi grown in bovine serum were introduced into peritoneal cells of mice, along with P388D1 cells incubated with GIFN, IL2 and both. Control cells were also maintained. Statistical analysis were then performed on data on counts of the number of dead T. Cruzi cells. The GIFN enhanced the interaction of MPM and P388D1 cells with the surface of T. Cruzi, provided the interaction was given over 12 hr to take place. A depression of the cytotoxicity of P388D1 cells was attributed to mediation by H2O2, an effect partially offset by incubation with the lymphokine GIFN.

Human B cells fail to secrete type I interferons upon cytoplasmic DNA exposure.

PubMed

Gram, Anna M; Sun, Chenglong; Landman, Sanne L; Oosenbrug, Timo; Koppejan, Hester J; Kwakkenbos, Mark J; Hoeben, Rob C; Paludan, Søren R; Ressing, Maaike E

2017-11-01

Most cells are believed to be capable of producing type I interferons (IFN I) as part of an innate immune response against, for instance, viral infections. In macrophages, IFN I is potently induced upon cytoplasmic exposure to foreign nucleic acids. Infection of these cells with herpesviruses leads to triggering of the DNA sensors interferon-inducible protein 16 (IFI16) and cyclic GMP-AMP (cGAMP) synthase (cGAS). Thereby, the stimulator of interferon genes (STING) and the downstream molecules TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3) are sequentially activated culminating in IFN I secretion. Human gamma-herpesviruses, such as Epstein-Barr virus (EBV), exploit B cells as a reservoir for persistent infection. In this study, we investigated whether human B cells, similar to macrophages, engage the cytoplasmic DNA sensing pathway to induce an innate immune response. We found that the B cells fail to secrete IFN I upon cytoplasmic DNA exposure, although they express the DNA sensors cGAS and IFI16 and the signaling components TBK1 and IRF3. In primary human B lymphocytes and EBV-negative B cell lines, this deficiency is explained by a lack of detectable levels of the central adaptor protein STING. In contrast, EBV-transformed B cell lines did express STING, yet both these lines as well as STING-reconstituted EBV-negative B cells did not produce IFN I upon dsDNA or cGAMP stimulation. Our combined data show that the cytoplasmic DNA sensing pathway is dysfunctional in human B cells. This exemplifies that certain cell types cannot induce IFN I in response to cytoplasmic DNA exposure providing a potential niche for viral persistence. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Parasite-mediated upregulation of NK cell-derived gamma interferon protects against severe highly pathogenic H5N1 influenza virus infection.

PubMed

O'Brien, Kevin B; Schultz-Cherry, Stacey; Knoll, Laura J

2011-09-01

Outbreaks of influenza A viruses are associated with significant human morbidity worldwide. Given the increasing resistance to the available influenza drugs, new therapies for the treatment of influenza virus infection are needed. An alternative approach is to identify products that enhance a protective immune response. In these studies, we demonstrate that infecting mice with the Th1-inducing parasite Toxoplasma gondii prior to highly pathogenic avian H5N1 influenza virus infection led to decreased lung viral titers and enhanced survival. A noninfectious fraction of T. gondii soluble antigens (STAg) elicited an immune response similar to that elicited by live parasites, and administration of STAg 2 days after H5N1 influenza virus infection enhanced survival, lowered viral titers, and reduced clinical disease. STAg administration protected H5N1 virus-infected mice lacking lymphocytes, suggesting that while the adaptive immune response was not required for enhanced survival, it was necessary for STAg-mediated viral clearance. Mechanistically, we found that administration of STAg led to increased production of gamma interferon (IFN-γ) from natural killer (NK) cells, which were both necessary and sufficient for survival. Further, administration of exogenous IFN-γ alone enhanced survival from H5N1 influenza virus infection, although not to the same level as STAg treatment. These studies demonstrate that a noninfectious T. gondii extract enhances the protective immune response against severe H5N1 influenza virus infections even when a single dose is administered 2 days postinfection.

Association between level of interferon gamma and acid-fast bacillipositivity in pulmonary tuberculosis

NASA Astrophysics Data System (ADS)

Priwahyuningtyas, N. B.; Sinaga, B. Y. M.; Pandia, P.; Eyanoer, P. C.

2018-03-01

Tuberculosis is an infectious disease which caused by Mycobacterium tuberculosis (M. tuberculosis) that infected numerous organ especially the lung. A person’s immunity is very affecting for a person exposed to pulmonary tuberculosis. T-helper-1 cell (Th1) is very influential in the immune system especially in interfering intracellular bacterial infection. One of the cytokines known produced by Th1 cell is interferon gamma (IFN-γ) which is in eliminating M. tuberculosis. The study aims to identify the association between level of IFN-γ and AFB positivity in pulmonary tuberculosis patients in Medan. It is a case-control study. The subjects of the study were 60 new cases of pulmonary tuberculosis with AFB sputum smear- positive that never received ATT consisting 20 cases AFB (+1), 20 cases AFB (+2) and 20 cases AFB (+3).Samples were plasma collected from the venous blood of pulmonary tuberculosis patients. The plasma then underwent laboratory assay with ELISA techniques. Independent t-test was p<0.05 considered significant. Level of IFN-γ in TB AFB (+1) is higher than TB AFB (+2) and (+3), with thesignificant statistical result (p=0.001).

Interferon-gamma promoter hypomethylation and increased expression in chronic periodontitis

PubMed Central

Zhang, Shaoping; Crivello, Antonino; Offenbacher, Steven; Moretti, Antonio; Paquette, David W.; Barros, Silvana P.

2011-01-01

Aim The goal of this investigation was to determine whether epigenetic modifications in the IFNG promoter are associated with an increase of IFNG transcription in different stages of periodontal diseases. Materials and Methods DNA was extracted from gingival biopsy samples collected from 47 total sites from 47 different subjects: 23 periodontally healthy sites, 12 experimentally induced gingivitis sites and 12 chronic periodontitis sites. Levels of DNA methylation within the IFNG promoter containing six CpG dinucleotides were determined using pyrosequencing technology. Interferon gamma mRNA expression was analysed by quantitative polymerase chain reactions using isolated RNA from part of the biological samples mentioned above. Results The methylation level of all six analysed CpG sites within the IFNG promoter region in the periodontitis biopsies {52% [interquartile range, IQR (43.8%, 63%)]} was significantly lower than periodontally healthy samples {62% [IQR (51.3%, 74%)], p =0.007} and gingivitis biopsies {63% [IQR (55%, 74%)], p =0.02}. The transcriptional level of IFNG in periodontitis biopsies was 1.96-fold and significantly higher than tissues with periodontal health (p =0.04). Although the mRNA level from experimental gingivitis samples exhibited an 8.5-fold increase as compared with periodontally healthy samples, no significant methylation difference was observed in experimental gingivitis sample. Conclusions A hypomethylation profile within IFNG promoter region is related to an increase of IFNG transcription present in the chronic periodontitis biopsies, while such an increase of IFNG in experimentally induced gingivitis seems independent of promoter methylation alteration. PMID:20958339

Bisensory stimulation increases gamma-responses over multiple cortical regions.

PubMed

Sakowitz, O W; Quiroga, R Q; Schürmann, M; Başar, E

2001-04-01

In the framework of the discussion about gamma (approx. 40 Hz) oscillations as information carriers in the brain, we investigated the relationship between gamma responses in the EEG and intersensory association. Auditory evoked potentials (AEPs) and visual evoked potentials (VEPs) were compared with bisensory evoked potentials (BEPs; simultaneous auditory and visual stimulation) in 15 subjects. Gamma responses in AEPs, VEPs and BEPs were assessed by means of wavelet decomposition. Overall maximum gamma-components post-stimulus were highest in BEPs (P < 0.01). Bisensory evoked gamma-responses also showed significant central, parietal and occipital amplitude-increases (P < 0.001, P < 0.01, P < 0.05, respectively; prestimulus interval as baseline). These were of greater magnitude when compared with the unisensory responses. As a correlate of the marked gamma responses to bimodal stimulation we suggest a process of 'intersensory association', i.e. one of the steps between sensory transmission and perception. Our data may be interpreted as a further example of function-related gamma responses in the EEG.

Evaluation of pre- and posttransplantation serum interferon-gamma and soluble CD30 for predicting liver allograft rejection.

PubMed

Kim, K H; Oh, E-J; Jung, E-S; Park, Y-J; Choi, J Y; Kim, D-G; Lee, K Y; Kang, C S

2006-06-01

The aim of the present study was to identify whether the serum interferon-gamma (IFNgamma), a Th1 cytokine, or soluble CD30 (sCD30), a marker for activation of Th2 cytokine-producing T cells, predict acute cellular rejection episodes among liver graft patients. Pretransplant and posttransplant sera from 32 living donor liver transplant recipients obtained on days 1, 3, and 7 after surgery were tested for serum IFNgamma and sCD30 concentrations using commercial enzyme-linked immunosorbent assay kits. Recipients with an acute rejection episode (ARE) (n=14) displayed significantly higher IFNgamma concentrations pretransplant than did the patients with no ARE (n=18) (P<.05). The pretransplant serum levels of sCD30 were not different between the non-ARE and ARE groups. However, in comparison with the non-ARE group, who showed steadily decreasing serum sCD30 levels after transplantation, 12 among the 14 patients in the ARE group showed increasing sCD30 levels from day 1 to day 3 after transplantation (P<.05). These results suggest that the sCD30 increment during the early period after liver transplantation affects the immune response of rejection. This observation emphasizes the clinical relevance of serum sCD30, in addition to serum IFNgamma, as predictive markers for acute liver graft rejection.

Inhibition of human mast cell growth and differentiation by interferon gamma-1b.

PubMed

Kirshenbaum, A S; Worobec, A S; Davis, T A; Goff, J P; Semere, T; Metcalfe, D D

1998-03-01

In an effort to identify cytokines that inhibit human mast cell growth, we cultured HMC-1 cells and recombinant human stem cell factor (rhSCF)-dependent human bone marrow-derived mast cells (HBMCs) in the presence of interferon gamma (IFNgamma)-1b and interferon alpha (IFNalpha)-2b. HMC-1 cell numbers decreased in the presence of 1000 U/mL IFNgamma-1b but were unaffected by 1000 U/mL of IFNalpha-2b. HBMCs were then cultured for 0 to 7 days with 100 ng/mL rhSCF and 10 ng/mL recombinant human IL-3 (rhIL-3), followed by culture in rhSCF and administration of either 1000 U/mL IFNalpha-2b or 1000 U/mL IFNgamma-1b. HBMCs appearing in cultures with rhSCF alone or in combination with IFNalpha-2b were virtually identical in number through 8 weeks of culture. In cultures supplemented with IFNgamma-1b, HBMCs significantly decreased in number and incidence of granular metachromasia by 4 to 5 weeks (p<0.001). Similar results were obtained when human marrow was cultured from day 0 with rhSCF and IFNgamma-1b. Mature rhSCF-dependent HBMCs were also cultured at 5 weeks with rhSCF alone or in combination with IFNgamma-1b. Compared with cells cultured in rhSCF, mature 5-week HBMC cultures treated with rhSCF plus IFNgamma-1b revealed a decrease in mast cells, and those mast cells that remained had fewer toluidine blue- and tryptase-positive granules after 5 to 8 weeks. FACS analysis of rhSCF plus IFNgamma-1b-treated mature HBMCs revealed increased c-kit and Fc(epsilon)RI expression. Mast cell releasibility was not increased. IFNgamma-lb was thus able to suppress mast cell growth from CD34+ cells, suggesting that this agent should be considered as a candidate cytokine for the treatment of disorders of mast cell proliferation.

Monitoring interferon β treatment response with magnetic resonance spectroscopy in relapsing remitting multiple sclerosis.

PubMed

Yetkin, Mehmet Fatih; Mirza, Meral; Dönmez, Halil

2016-09-01

The aim of this study is to compare the white matter of multiple sclerosis (MS) patients with healthy controls and to monitor the response to the treatment with magnetic resonance spectroscopy (MRS).Fifteen healthy controls and 36 recently diagnosed MS patients never treated with interferon β were included in this study. In the patient group, MRS was performed before treatment, at 6th and 12th month after the initiation of treatment and once in control group. Patient group was divided into 3 interferon groups randomly. Physical examination findings were recorded as Expanded Disability Status Scale scores before treatment, at 6th and 12th month of interferon treatment.At the end of 1 year follow up, 26 of 36 patients completed the study. In patients' white matter lesions, N-acetylaspartate/creatine (NAA/Cr) ratios were lower than control group's white matters. NAA/Cr ratios were higher in control group's white matter than patient's normal appearing white matter but this difference was not statistically significant. There was no difference in choline/creatine (Cho/Cr) ratios between 2 groups. In follow-up period, NAA/Cr and Cho/Cr ratios obtained from patients' white matter lesions and normal appearing white matter did not change statistically.This study showed that in MS patients' white matters, especially in white matter lesions, neuron viability is reduced compared with healthy controls' normal white matter; and in the patients treated with interferon β NAA/Cr ratios remained stable. These stable levels of metabolite ratios in the patients who received interferon β therapy can be explained with either the shortness of the follow-up period post-treatment or may reflect a positive effect of the beta interferon therapy on the progress of MS.

Myxoma virus M-T7, a secreted homolog of the interferon-gamma receptor, is a critical virulence factor for the development of myxomatosis in European rabbits.

PubMed

Mossman, K; Nation, P; Macen, J; Garbutt, M; Lucas, A; McFadden, G

1996-01-01

little, if any, cellular activation of germinal centers of spleen and lymph node by Day 4. We conclude that M-T7 functions early in infection to (1) retard inflammatory cell migration into infected tissues and (2) disrupt the communication between sentinel immune cells at the site of primary virus infection in the subdermis and lymphocytes in the secondary lymphoid organs, thereby disabling the host from mounting an effective cellular immune response. To summarize, in addition to neutralizing host interferon-gamma at infected sites, we propose that M-T7 protein also modifies leukocyte traffic in the vicinity of virus lesions, thus effectively severing the link between antigen presenting cells of the infected tissue and the effector lymphocytes of the peripheral immune organs.

Myeloid interferon-γ receptor deficiency does not affect atherosclerosis in LDLR(-/-) mice.

PubMed

Boshuizen, Marieke C S; Neele, Annette E; Gijbels, Marion J J; van der Velden, Saskia; Hoeksema, Marten A; Forman, Ruth A; Muller, Werner; Van den Bossche, Jan; de Winther, Menno P J

2016-03-01

Atherosclerosis is a chronic lipid-driven inflammatory disease of the arterial wall. Interferon gamma (IFNγ) is an important immunomodulatory cytokine and a known pro-atherosclerotic mediator. However, cell-specific targeting of IFNγ or its signaling in atherosclerosis development has not been studied yet. As macrophages are important IFNγ targets, we here addressed the involvement of myeloid IFNγ signaling in murine atherosclerosis. Bone marrow was isolated from interferon gamma receptor 2 chain (IFNγR2) wildtype and myeloid IFNγR2 deficient mice and injected into lethally irradiated LDLR(-/-) mice. After recovery mice were put on a high fat diet for 10 weeks after which atherosclerotic lesion analysis was performed. In addition, the accompanying liver inflammation was assessed. Even though absence of myeloid IFNγ signaling attenuated the myeloid IFNγ response, no significant differences in atherosclerotic lesion size or phenotype were found. Also, when examining the liver inflammatory state no effects of IFNγR2 deficiency could be observed. Overall, our data argue against a role for myeloid IFNγR2 in atherosclerosis development. Since myeloid IFNγ signaling seems to be nonessential throughout atherogenesis, it is important to understand the mechanisms by which IFNγ acts in atherogenesis. In the future new studies should be performed considering other cell-specific targets. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Hydroxychloroquine augments early virological response to pegylated interferon plus ribavirin in genotype-4 chronic hepatitis C patients.

PubMed

Helal, Gouda Kamel; Gad, Magdy Abdelmawgoud; Abd-Ellah, Mohamed Fahmy; Eid, Mahmoud Saied

2016-12-01

The therapeutic effect of pegylated interferon (peg-IFN) alfa-2a combined with ribavirin (RBV) on chronic hepatitis C Egyptian patients is low and further efforts are required to optimize this therapy for achievement of higher rates of virological response. This study aimed to evaluate the safety and efficacy of hydroxychloroquine (HCQ) in combination with pegylated interferon plus ribavirin on early virological response (EVR) in chronic hepatitis C Egyptian patients. Naïve 120 Egyptian patients with chronic hepatitis C virus infection were divided into two groups. Group 1 have administered the standard of care therapy (pegylated interferon alfa-2a plus ribavirin) for 12 weeks, (n = 60). Group 2 have administered hydroxychloroquine plus standard of care therapy for 12 weeks, (n = 60). Therapeutics included hydroxychloroquine (200 mg) oral twice daily, peginterferon alfa-2a (160 μg) subcutaneous once weekly and oral weight-based ribavirin (1000-1200 mg/day). Baseline characteristics were similar in the two groups. The percentage of early virological response was significantly more in patients given the triple therapy than in patients given the standard of care [54/60 (90%) vs. 43/60 (71.7%); P = 0.011; respectively]. Biochemical response at week 12 was also significantly higher in patients given the triple therapy compared with the standard of care [58/60 (96.7%) vs. 42/60 (70%); P < 0.001; respectively]. Along the study, the observed adverse events were mild and similar across treatment groups. Addition of hydroxychloroquine to pegylated interferon plus ribavirin improves the rate of early virological and biochemical responses in chronic hepatitis C Egyptian patients without an increase in adverse events. J. Med. Virol. 88:2170-2178, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Interferon Gamma potentiates the injury caused by MPP(+) on SH-SY5Y cells, which is attenuated by the nitric oxide synthases inhibition.

PubMed

Titze-de-Almeida, Simoneide S; Lustosa, Cátia Faria; Horst, Camila Hillesheim; Bel, Elaine Del; Titze-de-Almeida, Ricardo

2014-12-01

This study examined whether the cytokine interferon (IFN) gamma plays a role in the injury of SH-SY5Y cells caused by MPP(+) (1-methyl-4-phenylpyridinium). First of all, IFN-gamma sensitized cells to the neurotoxin MPP(+), as determined by MTT (3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyltetrazolium bromide) assay. MPP(+)-injured cells showed higher reactive oxygen species (ROS) levels, which was reinforced by IFN-gamma. The injury triggered a marked expression of the neuronal NOS (nNOS) enzyme. L-NAME [N(ω)-nitro-L-arginine methyl ester, a non-specific NOS inhibitor] reestablished the cell viability after IFN-gamma challenging, and recovered cells from MPP(+) injury (95.0 vs. 84.7 %; P < 0.05). Seven-NI (7-nitroindazole, a nNOS inhibitor) protected cells against the injury by MPP(+) co-administered with IFN-gamma. Both inhibitors restrained the apoptosis of SH-SY5Y cells caused by MPP(+)/IFN-gamma. Regarding oxidative stress, L-NAME and 7-NI attenuated the increase in ROS levels caused by MPP(+) (45.3 or 48.4 vs. 87.9 %, P < 0.05). Indeed, L-NAME was more effective than 7-NI for reducing oxidative stress caused by MPP(+) under IFN-gamma exposition. The nNOS gene silencing by small-interfering RNAs recovered cells challenged by IFN-gamma (24 h), or MPP(+) (8 h). In conclusion, IFN-gamma sensitizes cells to MPP(+)-induced injury, also causing an increase in ROS levels. Pretreating cells with L-NAME or 7-NI reverts both the oxidative stress and apoptosis triggered by the neurotoxin MPP(+). Taking together, our data reinforce that IFN-gamma and NOS enzymes play a role in oxidative stress and dopaminergic cell death triggered by MPP(+).

Effect of carprofen administration during banding or burdizzo castration of bulls on plasma cortisol, in vitro interferon-gamma production, acute-phase proteins, feed intake, and growth.

PubMed

Pang, W Y; Earley, B; Sweeney, T; Crowe, M A

2006-02-01

The objective of this study was to determine the effect of carprofen (C) administration before banding or burdizzo castration of bulls on cortisol, in vitro interferon-gamma (IFN-gamma) production, acute-phase proteins, feed intake, and growth. Fifty Holstein Friesian bulls (5.5 mo old; 191 +/- 3.7 kg) were blocked by weight and assigned randomly to 1 of 5 treatments (n = 10/treatment): 1) untreated control (2) banding castration at 0 min (Band); 3) Band following an i.v. injection of 1.4 mg/kg of BW of C at -20 min (Band+C); 4) Burdizzo castration at 0 min (Burd); or 5) Burd following 1.4 mg/kg of BW of C at -20 min (Burd+C). Castration acutely increased plasma cortisol concentrations compared with control; no significant differences occurred in peak and interval to peak cortisol responses between Band and Band+C or Burd and Burd+C groups. The administration of C in Band+C reduced (P < 0.05) the cortisol concentration between 6 and 12 h postcastration compared with Band animals. Overall, the integrated cortisol response was greater (P < 0.05) in the castrates than in control, whereas C treatments tended to reduce this response compared with Band (P = 0.08) and Burd (P = 0.07), respectively. Plasma fibrinogen was elevated in Band animals on d 14 and in Burd animals on d 3 and 14. Carprofen administration reduced Band- and Burd-induced fibrinogen production on d 14 and 3, respectively. Plasma haptoglobin was elevated in Band animals on d 3 and 35 compared with control, and C administration was effective in reducing the haptoglobin elevation on d 35 in Band+C compared with Band. There were no differences among treatments in in vitro IFN-gamma production induced by concanavalin A and phytohemagglutinin on d 1 and 2. Overall from d -1 to 16, there were no DMI differences among treatments. From d -1 to 35, there were no ADG differences among treatments. In conclusion, banding and burdizzo castration increased plasma cortisol with no change in in vitro IFN-gamma

Autophagy diminishes the early interferon-β response to influenza A virus resulting in differential expression of interferon-stimulated genes.

PubMed

Perot, Brieuc P; Boussier, Jeremy; Yatim, Nader; Rossman, Jeremy S; Ingersoll, Molly A; Albert, Matthew L

2018-05-10

Influenza A virus (IAV) infection perturbs metabolic pathways such as autophagy, a stress-induced catabolic pathway that crosstalks with cellular inflammatory responses. However, the impact of autophagy perturbation on IAV gene expression or host cell responses remains disputed. Discrepant results may be a reflection of in vivo studies using cell-specific autophagy-related (Atg) gene-deficient mouse strains, which do not delineate modification of developmental programmes from more proximal effects on inflammatory response. In vitro experiments can be confounded by gene expression divergence in wild-type cultivated cell lines, as compared to those experiencing long-term absence of autophagy. With the goal to investigate cellular processes within cells that are competent or incompetent for autophagy, we generated a novel experimental cell line in which autophagy can be restored by ATG5 protein stabilization in an otherwise Atg5-deficient background. We confirmed that IAV induced autophagosome formation and p62 accumulation in infected cells and demonstrated that perturbation of autophagy did not impact viral infection or replication in ATG5-stablized cells. Notably, the induction of interferon-stimulated genes (ISGs) by IAV was diminished when cells were autophagy competent. We further demonstrated that, in the absence of ATG5, IAV-induced interferon-β (IFN-β) expression was increased as compared to levels in autophagy-competent lines, a mechanism that was independent of IAV non-structural protein 1. In sum, we report that induction of autophagy by IAV infection reduces ISG expression in infected cells by limiting IFN-β expression, which may benefit viral replication and spread.

Mitochondria-dependent and -independent mechanisms in tumour necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis are both regulated by interferon-gamma in human breast tumour cells.

PubMed Central

Ruiz-Ruiz, Carmen; López-Rivas, Abelardo

2002-01-01

Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL/APO-2L) induces apoptosis in a variety of tumour cells upon binding to death receptors TRAIL-R1 and TRAIL-R2. Here we describe the sensitization by interferon (IFN)-gamma to TRAIL-induced apoptosis in the breast tumour cell lines MCF-7 and MDA-MB231. IFN-gamma promoted TRAIL-mediated activation of caspase-8, Bcl-2 interacting domain death agonist (Bid) degradation, Bcl-2-associated X protein (Bax) translocation to mitochondria, cytochrome c release to the cytosol and activation of caspase-9 in these cell lines. No changes in the expression of TRAIL receptors were observed upon IFN-gamma treatment. Overexpression of Bcl-2 in MCF-7 cells completely inhibited IFN-gamma-induced sensitization to TRAIL-mediated cell death. Interestingly, TRAIL-induced apoptosis was also clearly enhanced by IFN-gamma in caspase-3-overexpressing MCF-7 cells, in the absence of Bax translocation to mitochondria and cytochrome c release to the cytosol. In summary, our results suggest that IFN-gamma facilitates TRAIL-induced activation of mitochondria-regulated as well as mitochondria-independent apoptotic pathways in breast tumour cells. PMID:11936954

No Love Lost Between Viruses and Interferons.

PubMed

Fensterl, Volker; Chattopadhyay, Saurabh; Sen, Ganes C

2015-11-01

The interferon system protects mammals against virus infections. There are several types of interferons, which are characterized by their ability to inhibit virus replication and resultant pathogenesis by triggering both innate and cell-mediated immune responses. Virus infection is sensed by a variety of cellular pattern-recognition receptors and triggers the synthesis of interferons, which are secreted by the infected cells. In uninfected cells, cell surface receptors recognize the secreted interferons and activate intracellular signaling pathways that induce the expression of interferon-stimulated genes; the proteins encoded by these genes inhibit different stages of virus replication. To avoid extinction, almost all viruses have evolved mechanisms to defend themselves against the interferon system. Consequently, a dynamic equilibrium of survival is established between the virus and its host, an equilibrium that can be shifted to the host's favor by the use of exogenous interferon as a therapeutic antiviral agent.

CMOS image sensor for detection of interferon gamma protein interaction as a point-of-care approach.

PubMed

Marimuthu, Mohana; Kandasamy, Karthikeyan; Ahn, Chang Geun; Sung, Gun Yong; Kim, Min-Gon; Kim, Sanghyo

2011-09-01

Complementary metal oxide semiconductor (CMOS)-based image sensors have received increased attention owing to the possibility of incorporating them into portable diagnostic devices. The present research examined the efficiency and sensitivity of a CMOS image sensor for the detection of antigen-antibody interactions involving interferon gamma protein without the aid of expensive instruments. The highest detection sensitivity of about 1 fg/ml primary antibody was achieved simply by a transmission mechanism. When photons are prevented from hitting the sensor surface, a reduction in digital output occurs in which the number of photons hitting the sensor surface is approximately proportional to the digital number. Nanoscale variation in substrate thickness after protein binding can be detected with high sensitivity by the CMOS image sensor. Therefore, this technique can be easily applied to smartphones or any clinical diagnostic devices for the detection of several biological entities, with high impact on the development of point-of-care applications.

Delayed growth of EL4 lymphoma in SR-A-deficient mice is due to upregulation of nitric oxide and interferon-gamma production by tumor-associated macrophages.

PubMed

Komohara, Yoshihiro; Takemura, Kenichi; Lei, Xiao Feng; Sakashita, Naomi; Harada, Mamoru; Suzuki, Hiroshi; Kodama, Tatsuhiko; Takeya, Motohiro

2009-11-01

Class A scavenger receptors (SR-A, CD204) are highly expressed in tumor-associated macrophages (TAM). To investigate the function of SR-A in TAM, wild-type and SR-A-deficient (SR-A(-/-)) mice were injected with EL4 cells. Although these groups of mice did not differ in the numbers of infiltrating macrophages and lymphocytes and in neovascularization, SR-A(-/-) mice had delayed growth of EL4 tumors. Expression of inducible nitric oxide (NO) synthase and interferon (IFN)-gamma mRNA increased significantly in tumor tissues from SR-A(-/-) mice. Engulfment of necrotic EL4 cells induced upregulation of NO and IFN-gamma production by cultured macrophages, and production of NO and IFN-gamma increased in SR-A(-/-) macrophages in vitro. IFN-beta production by cultured macrophages was also elevated in SR-A(-/-) macrophages in vitro. These results suggested that the antitumor activity of macrophages increased in SR-A(-/-) mice because of upregulation of NO and IFN-gamma production. These data indicate an important role of SR-A in regulating TAM function by inhibiting toll-like receptor (TLR)4-IFN-beta signaling.

The Predominant CD4+ Th1 Cytokine Elicited to Chlamydia trachomatis Infection in Women Is Tumor Necrosis Factor Alpha and Not Interferon Gamma

PubMed Central

Gupta, Kanupriya; Ogendi, Brian M. O.; Bakshi, Rakesh K.; Kapil, Richa; Press, Christen G.; Sabbaj, Steffanie; Lee, Jeannette Y.

2017-01-01

ABSTRACT Chlamydia trachomatis infection is the most prevalent bacterial sexually transmitted infection and can cause significant reproductive morbidity in women. There is insufficient knowledge of C. trachomatis-specific immune responses in humans, which could be important in guiding vaccine development efforts. In contrast, murine models have clearly demonstrated the essential role of T helper type 1 (Th1) cells, especially interferon gamma (IFN-γ)-producing CD4+ T cells, in protective immunity to chlamydia. To determine the frequency and magnitude of Th1 cytokine responses elicited to C. trachomatis infection in humans, we stimulated peripheral blood mononuclear cells from 90 chlamydia-infected women with C. trachomatis elementary bodies, Pgp3, and major outer membrane protein and measured IFN-γ-, tumor necrosis factor alpha (TNF-α)-, and interleukin-2 (IL-2)-producing CD4+ and CD8+ T-cell responses using intracellular cytokine staining. The majority of chlamydia-infected women elicited CD4+ TNF-α responses, with frequency and magnitude varying significantly depending on the C. trachomatis antigen used. CD4+ IFN-γ and IL-2 responses occurred infrequently, as did production of any of the three cytokines by CD8+ T cells. About one-third of TNF-α-producing CD4+ T cells coproduced IFN-γ or IL-2. In summary, the predominant Th1 cytokine response elicited to C. trachomatis infection in women was a CD4+ TNF-α response, not CD4+ IFN-γ, and a subset of the CD4+ TNF-α-positive cells produced a second Th1 cytokine. PMID:28100498

T helper cell-mediated interferon-gamma expression after human parvovirus B19 infection: persisting VP2-specific and transient VP1u-specific activity

PubMed Central

Franssila, R; Auramo, J; Modrow, S; Möbs, M; Oker-Blom, C; Käpylä, P; Söderlund-Venermo, M; Hedman, K

2005-01-01

Human parvovirus B19 is a small non-enveloped DNA virus with an icosahedral capsid consisting of proteins of only two species, the major protein VP2 and the minor protein VP1. VP2 is contained within VP1, which has an additional unique portion (VP1u) of 227 amino acids. We determined the ability of eukaryotically expressed parvovirus B19 virus-like particles consisting of VP1 and VP2 in the ratio recommended for vaccine use, or of VP2 alone, to stimulate, in an HLA class II restricted manner, peripheral blood mononuclear cells (PBMC) to proliferate and to secrete interferon gamma (IFN-γ) and interleukin (IL)-10 cytokines among recently and remotely B19 infected subjects. PBMC reactivity with VP1u was determined specifically with a prokaryotically expressed VP1u antigen. In general, B19-specific IFN-γ responses were stronger than IL-10 responses in both recent and remote infection; however, IL-10 responses were readily detectable among both groups, with the exception of patients with relapsed or persisting symptoms who showed strikingly low IL-10 responses. Whereas VP1u-specific IFN-γ responses were very strong among the recently infected subjects, the VP1u-specific IFN-γ and IL-10 responses were virtually absent among the remotely infected subjects. The disappearance of VP1u-specific IFN-γ expression is surprising, as B-cell immunity against VP1u is well maintained. PMID:16178856

Delay of cognitive gamma responses in Alzheimer's disease

PubMed Central

Başar, Erol; Emek-Savaş, Derya Durusu; Güntekin, Bahar; Yener, Görsev G.

2016-01-01

Event-related oscillations (EROs) reflect cognitive brain dynamics, while sensory-evoked oscillations (SEOs) reflect sensory activities. Previous reports from our lab have shown that those with Alzheimer's disease (AD) or mild cognitive impairment (MCI) have decreased activity and/or coherence in delta, theta, alpha and beta cognitive responses. In the current study, we investigated gamma responses in visual SEO and ERO in 15 patients with AD and in 15 age-, gender- and education-matched healthy controls. The following parameters were analyzed over the parietal-occipital regions in both groups: (i) latency of the maximum gamma response over a 0–800 ms time window; (ii) the maximum peak-to-peak amplitudes for each participant's averaged SEO and ERO gamma responses in 3 frequency ranges (25–30, 30–35, 40–48 Hz); and (iii) the maximum peak-to-peak amplitudes for each participant's averaged SEO and ERO gamma responses over a 0–800 ms time block containing four divided time windows (0–200, 200–400, 400–600, and 600–800 ms). There were main group effects in terms of both latency and peak-to-peak amplitudes of gamma ERO. However, peak-to-peak gamma ERO amplitude differences became noticeable only when the time block was divided into four time windows. SEO amplitudes in the 25–30 Hz frequency range of the 0–200 ms time window over the left hemisphere were greater in the healthy controls than in those with AD. Gamma target ERO latency was delayed up to 138 ms in AD patients when compared to healthy controls. This finding may be an effect of lagged neural signaling in cognitive circuits, which is reflected by the delayed gamma responses in those with AD. Based on the results of this study, we propose that gamma responses should be examined in a more detailed fashion using multiple frequency and time windows. PMID:26937378

Interferon-based treatment of chronic hepatitis C.

PubMed

Souvignet, Claude; Lejeune, Olivier; Trepo, Christian

2007-01-01

The treatment of patients with chronic hepatitis C has rapidly evolved in the past 10 years centered on the use of interferon alpha 2 as an antiviral and immunomodulatory agent against hepatitis C virus. Firstly used as a monotherapy associated with a deceiving long-term efficacy, interferon alpha was then combined with ribavirin, a nucleoside analog with large antiviral properties. Combination of both drugs dramatically improved the efficacy of treatment with 50% of patients reaching a sustained viral response, characterized by the final eradication of the virus from the infected individual. Surprisingly, this synergistic effect remains greatly unexplained. The third step consisted in the use of pegylated interferon in order to adapt its pharmacokinetics and to allow a better efficacy with a more tolerable dosing schedule: once weekly subcutaneous injection instead of thrice weekly. Pegylated interferon combined with ribavirin during 24-48 weeks of treatment is the current standard of care with nearly 60% of sustained virologic response, overall. Development of new forms of interferon alpha are on the way with promising preliminary results.

Application of genetically engineered Salmonella typhimurium for interferon-gamma-induced therapy against melanoma.

PubMed

Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo

2017-01-01

Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

Coexposure of mice to trovafloxacin and lipopolysaccharide, a model of idiosyncratic hepatotoxicity, results in a unique gene expression profile and interferon gamma-dependent liver injury.

PubMed

Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A

2009-01-01

The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.

Effects of isolation on interferon production and hematological and immunological parameters

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Measel, J.; Loken, M. R.; Degioanni, J.; Follini, S.; Galvagno, A.; Montalbini, M.

1992-01-01

A 27-year-old woman was maintained in an isolated state for 131 days in Carlsbad Caverns, New Mexico. Her diet was vitamin D-depleted. Determinations on the effects of such isolation on levels and activities of peripheral blood cells that are important for hematological homeostasis and immunological function were carried out. Throughout the duration of the study, the percentage of lymphoid cells that expressed CD3, CD4, CD8, CD19, Leu 8, and other markers remained relatively constant although the absolute numbers of these cells varied. Although the percentage of natural killer (NK) cells did not vary, the activity of these cells did change. NK cell activity became elevated as the isolation study progressed. Production of interferon-gamma (IFN-gamma) in response to mitogen stimulation was higher than expected throughout the isolation periods, but returned to the normal range after termination of the isolation. Red and white cell counts dropped significantly upon entering isolation, but soon returned to normal.

USP15 regulates type I interferon response and is required for pathogenesis of neuroinflammation.

PubMed

Torre, Sabrina; Polyak, Maria J; Langlais, David; Fodil, Nassima; Kennedy, James M; Radovanovic, Irena; Berghout, Joanne; Leiva-Torres, Gabriel A; Krawczyk, Connie M; Ilangumaran, Subburaj; Mossman, Karen; Liang, Chen; Knobeloch, Klaus-Peter; Healy, Luke M; Antel, Jack; Arbour, Nathalie; Prat, Alexandre; Majewski, Jacek; Lathrop, Mark; Vidal, Silvia M; Gros, Philippe

2017-01-01

Genes and pathways in which inactivation dampens tissue inflammation present new opportunities for understanding the pathogenesis of common human inflammatory diseases, including inflammatory bowel disease, rheumatoid arthritis and multiple sclerosis. We identified a mutation in the gene encoding the deubiquitination enzyme USP15 (Usp15 L749R ) that protected mice against both experimental cerebral malaria (ECM) induced by Plasmodium berghei and experimental autoimmune encephalomyelitis (EAE). Combining immunophenotyping and RNA sequencing in brain (ECM) and spinal cord (EAE) revealed that Usp15 L749R -associated resistance to neuroinflammation was linked to dampened type I interferon responses in situ. In hematopoietic cells and in resident brain cells, USP15 was coexpressed with, and functionally acted together with the E3 ubiquitin ligase TRIM25 to positively regulate type I interferon responses and to promote pathogenesis during neuroinflammation. The USP15-TRIM25 dyad might be a potential target for intervention in acute or chronic states of neuroinflammation.

Pre-immune state induced by chicken interferon gamma inhibits the replication of H1N1 human and H9N2 avian influenza viruses in chicken embryo fibroblasts.

PubMed

Yuk, Seong-Su; Lee, Dong-Hun; Park, Jae-Keun; Tseren-Ochir, Erdene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon

2016-04-27

Interferon gamma (IFN-γ), an immunoregulatory cytokine, is known to control many microbial infections. In a previous study, chicken interferon gamma (chIFN-γ) was found to be up-regulated following avian influenza virus (AIV) infection in specific pathogen-free chickens. We aimed to investigate whether the pre-immune state induced by chIFN-γ could generate an antiviral response against influenza virus. We generated a chIFN-γ-expressing plasmid and transfected it into chicken embryo fibroblasts (CEFs) and then infected the cells with human origin H1N1 or avian origin H9N2 influenza viruses. Viral titers of culture medium were evaluated in MDCK cell and the viral RNA and IFN-stimulated genes (ISGs) were then quantified by real-time reverse transcriptase polymerase. To further evaluate the role of the antiviral effect of chIFN-γ by using a backward approach, synthetic small interfering RNAs (siRNA) targeting chIFN-γ were used to suppress chIFN-γ. The chIFN-γ-stimulated CEFs inhibited the replication of viral RNA (vRNA) and showed a mild decrease in the infectious virus load released in the culture medium. Compared to the mock-transfected control, the messenger RNA (mRNA) levels of type I IFNs and IFN-stimulated genes were up-regulated in the cells expressing chIFN-γ. After treatment with the siRNA, we detected a higher expression of viral genes than that observed in the mock-transfected control. Our results suggest that apart from the important role played by chIFN-γ in the antiviral state generated against influenza virus infection, the pre-immune state induced by chIFN-γ can be helpful in mitigating the propagation of influenza virus.

Interferon effects on protozoan infections

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Wirth, J.; Kierszenbaum, F.; Degee, A. L. W.; Mansfield, J. M.

1985-01-01

The effects of interferon (IFN) on mice infected with two different parasitic protozoans, Trypanosoma cruzi and Trypanosoma brucei rhodesiense, are investigated experimentally. The preparation of the cell cultures, IFN and assays, antibody, and the experimental procedures are described. It is observed that in cells treated with IFN-gamma there is an increased association of T. cruzi with murine macrophages and an increase in the killing of T. cruzi by IFN-gamma-treated murine macrophages. For spleen cells infected with T.b. rhodesiense in vitro, it is detected that live trypanosomes cannot induce IFN in cells from normal mice, but can in cells from immunized mice; and that trypanosome-lysates induce IFN in vitro in cells from normal mice. The data suggest that there is a two-step mechanism for mice against T. cruzi and T.b. rhodesiense.

Interferon for the treatment of genital warts: a systematic review

PubMed Central

2009-01-01

Background Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. Methods We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis Results 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the

Interferon for the treatment of genital warts: a systematic review.

PubMed

Yang, Jin; Pu, Yu-Guo; Zeng, Zhong-Ming; Yu, Zhi-Jian; Huang, Na; Deng, Qi-Wen

2009-09-21

Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the recurrence rate of the two

Cerebrospinal fluid interferon-gamma-inducible protein 10 (IP-10, CXCL10) in HIV-1 infection.

PubMed

Cinque, Paola; Bestetti, Arabella; Marenzi, Roberta; Sala, Serena; Gisslen, Magnus; Hagberg, Lars; Price, Richard W

2005-11-01

Interferon-gamma-inducible protein (IP-10 or CXCL10) is a potent chemoattractant and has been suggested to enhance retrovirus infection and mediate neuronal injury. In order to assess this chemokine in central nervous system (CNS) HIV infection, we measured the cerebrospinal fluid (CSF) and plasma concentrations of CXCL10 by immunoassay in samples derived from 97 HIV-infected subjects across a spectrum of immunological progression and CNS complications and from 16 HIV seronegative control subjects studied at three clinical centers between 1994 and 2001. We also examined changes in the CSF and plasma CXCL10 concentrations in 30 subjects starting and three stopping antiretroviral therapy. CSF CXCL10 concentrations: (1) correlated with CSF HIV RNA and white blood cell (WBC) counts, but not with blood CXCL10, HIV RNA, or CD4 counts; (2) were increased in subjects with primary and asymptomatic HIV infections and AIDS dementia complex, but less frequently in those with more advanced infection, with or without CNS opportunistic diseases except cytomegalovirus encephalitis; (3) decreased in subjects starting antiretroviral in association with decreases in CSF and plasma HIV RNA and CSF WBCs; and (4) conversely, increased in subjects stopping treatment in parallel with CSF HIV RNA and WBCs. These results confirm that CSF CXCL10 associates closely with both CSF HIV and WBCs and suggest that this chemokine may be both a response to and contributing determinant of local infection. High CSF levels may be useful in the diagnosis of ADC in subjects with advanced immunosuppression in whom CMV encephalitis has been ruled out, though this issue requires further study.

Designing of interferon-gamma inducing MHC class-II binders

PubMed Central

2013-01-01

Background The generation of interferon-gamma (IFN-γ) by MHC class II activated CD4+ T helper cells play a substantial contribution in the control of infections such as caused by Mycobacterium tuberculosis. In the past, numerous methods have been developed for predicting MHC class II binders that can activate T-helper cells. Best of author’s knowledge, no method has been developed so far that can predict the type of cytokine will be secreted by these MHC Class II binders or T-helper epitopes. In this study, an attempt has been made to predict the IFN-γ inducing peptides. The main dataset used in this study contains 3705 IFN-γ inducing and 6728 non-IFN-γ inducing MHC class II binders. Another dataset called IFNgOnly contains 4483 IFN-γ inducing epitopes and 2160 epitopes that induce other cytokine except IFN-γ. In addition we have alternate dataset that contains IFN-γ inducing and equal number of random peptides. Results It was observed that the peptide length, positional conservation of residues and amino acid composition affects IFN-γ inducing capabilities of these peptides. We identified the motifs in IFN-γ inducing binders/peptides using MERCI software. Our analysis indicates that IFN-γ inducing and non-inducing peptides can be discriminated using above features. We developed models for predicting IFN-γ inducing peptides using various approaches like machine learning technique, motifs-based search, and hybrid approach. Our best model based on the hybrid approach achieved maximum prediction accuracy of 82.10% with MCC of 0.62 on main dataset. We also developed hybrid model on IFNgOnly dataset and achieved maximum accuracy of 81.39% with 0.57 MCC. Conclusion Based on this study, we have developed a webserver for predicting i) IFN-γ inducing peptides, ii) virtual screening of peptide libraries and iii) identification of IFN-γ inducing regions in antigen (http://crdd.osdd.net/raghava/ifnepitope/). Reviewers This article was reviewed by Prof Kurt

Interferon-alpha in the treatment of multiple myeloma.

PubMed

Khoo, Teh Liane; Vangsted, Annette Juul; Joshua, Douglas; Gibson, John

2011-03-01

Interferons are soluble proteins produced naturally by cells in response to viruses. It has both anti-proliferative and immunomodulating properties and is one of the first examples of a biological response modifier use to treat the haematological malignancy multiple myeloma. Interferon has been used in this clinical practice for over thirty years. However, despite considerable efforts, numerous clinical trials and two large meta-analysis, its exact role in the management of multiple myeloma still remains unclear. Its role in the treatment of multiple myeloma has been as a single induction agent, a co-induction agent with other chemotherapy regimens, and as maintenance therapy after conventional chemotherapy or complete remission after autologous or allogeneic transplantation. Interferon as a single induction agent or co-induction agent with other chemotherapy agents appears only to have minimal benefit in myeloma. Its role as maintenance therapy in the plateau phase of myeloma also remains uncertain. More recently, the use of interferon must now compete with the "new drugs"--thalidomide, lenalidomide and bortezomib in myeloma treatment. Will there be a future role of interferon in the treatment of multiple myeloma or will interferon be resigned to the history books remains to be seen.

Secretion of Interferon gamma (IFNγ) from Human Immune Cells is Altered by Exposure to Tributyltin (TBT) and Dibutyltin (DBT)

PubMed Central

Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret

2013-01-01

Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and also alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h and 6 day exposures to TBT (200- 2.5 nM) and DBT (5- 0.05 μM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from NK cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. PMID:24357260

Interferon response factor 3 is essential for house dust mite-induced airway allergy.

PubMed

Marichal, Thomas; Bedoret, Denis; Mesnil, Claire; Pichavant, Muriel; Goriely, Stanislas; Trottein, François; Cataldo, Didier; Goldman, Michel; Lekeux, Pierre; Bureau, Fabrice; Desmet, Christophe J

2010-10-01

Pattern-recognition receptors (PRRs) are critically involved in the pathophysiology of airway allergy, yet most of the signaling pathways downstream of PRRs implicated in allergic airway sensitization remain unknown. We sought to study the effects of genetic depletion of interferon response factor (IRF) 3 and IRF7, important transcription factors downstream of various PRRs, in a murine model of house dust mite (HDM)-induced allergic asthma. We compared HDM-induced allergic immune responses in IRF3-deficient (IRF3(-/-)), IRF7(-/-), and wild-type mice. Parameters of airway allergy caused by HDM exposure were strongly attenuated in IRF3(-/-), but not IRF7(-/-), mice compared with those in wild-type mice. Indeed, in HDM-exposed IRF3(-/-) mice HDM-specific T(H)2 cell responses did not develop. This correlated with impaired maturation and migration of IRF3(-/-) lung dendritic cells (DCs) on HDM treatment. Furthermore, adoptive transfer of HDM-loaded DCs indicated that IRF3(-/-) DCs had an intrinsic defect rendering them unable to migrate and to prime HDM-specific T(H)2 responses. Intriguingly, we also show that DC function and allergic airway sensitization in response to HDM were independent of signaling by type I interferons, the main target genes of IRF3. Through its role in DC function, IRF3, mainly known as a central activator of antiviral immunity, is essential for the development of T(H)2-type responses to airway allergens. Copyright © 2010 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

Enhanced production of human influenza virus in PBS-12SF cells with a reduced interferon response.

PubMed

Carvajal-Yepes, Monica; Sporer, Kelly R B; Carter, Jenna L; Colvin, Christopher J; Coussens, Paul M

2015-01-01

Influenza is one of the most important infectious diseases in humans. The best way to prevent severe illness caused by influenza infection is vaccination. Cell culture-derived influenza vaccines are being considered in addition to the widely used egg-based system in order to support the increasing seasonal demand and to be prepared in case of a pandemic. Cell culture based systems offer increased safety, capacity, and flexibility with reduced downstream processing relative to embryonated eggs. We have previously reported a chick embryo cell line, termed PBS-12SF, that supports replication of human and avian influenza A viruses to high titers (>10(7) PFU/ml) without the need for exogenous proteases or serum proteins. Viral infections in cells are limited by the Interferon (IFN) response typified by production of type I IFNs that bind to the IFNα/β receptor and activate an antiviral state. In this study, we investigated how neutralizing the interferon (IFN) response in PBS-12SF cells, via shRNA-mediated knock-down of IFNAR1 mRNA expression, affects influenza virus production. We were successful in knocking down ∼90% of IFNAR1 protein expression by this method, resulting in a significant decrease in the response to recombinant chIFNα stimulation in PBS-12SF cells as shown by a reduction in expression of interferon-responsive genes when compared to control cells. Additionally; IFNAR1-knock-down cells displayed enhanced viral HA production and released more virus into cell culture supernatants than parental PBS-12SF cells.

Changes in serum hepatitis C virus RNA in interferon nonresponders retreated with interferon plus ribavirin: a preliminary report.

PubMed

Nyberg, L; Albrecht, J; Glue, P; Gianelli, G; Zambas, D; Elliot, M; Conrad, A; McHutchison, J

1999-06-01

Ribavirin, a nucleoside analogue, inhibits replication of RNA and DNA viruses and may control hepatitis C virus (HCV) infection through modulation of anti-inflammatory and antiviral actions. Ribavirin monotherapy has no effect on serum HCV RNA levels. In combination with interferon, this agent appears to enhance the efficacy of interferon. The aim of this study was to monitor serum HCV RNA levels early during therapy with interferon and ribavirin compared with that previously seen in the same patients during interferon monotherapy. Five patients who previously showed no response to therapy with interferon alfa 3 MU three times weekly for 6 months were retreated with the identical dose of interferon alfa 2b in combination with oral ribavirin 1,000 mg/day. Serum HCV RNA levels were monitored at baseline, week 4, week 8, and week 12 of therapy by a quantitative multicycle polymerase chain reaction assay. In the first 8 to 12 weeks, serum HCV RNA levels showed a greater decrease in all patients when retreated with combination therapy compared with interferon alone. Mean (+/- SEM) serum HCV RNA levels for interferon therapy alone were 3.3 +/- 0.95, 1.2 +/- 0.95, 1.6 +/- 1.2, and 2.3 +/- 1.2 x 10(6) copies/ml at week 0, 4, 8, and 12, respectively. This was compared with 3.3 +/- 0.83, 0.3 +/- 0.2, 0.03 +/- 0.02, and 0.15 +/- 0.14 x 10(6), respectively, for the interferon and ribavirin group (p < 0.07 at week 8). Two of five patients had undetectable serum HCV RNA during combination therapy. Combination therapy with interferon and ribavirin in prior interferon nonresponders reduces serum HCV RNA levels compared with interferon alone. This may suggest some additional antiviral effect of ribavirin when given with interferon.

Interferon Response Factors 3 and 7 Protect against Chikungunya Virus Hemorrhagic Fever and Shock

PubMed Central

Rudd, Penny A.; Wilson, Jane; Gardner, Joy; Larcher, Thibaut; Babarit, Candice; Le, Thuy T.; Anraku, Itaru; Kumagai, Yutaro; Loo, Yueh-Ming; Gale, Michael; Akira, Shizuo; Khromykh, Alexander A.

2012-01-01

Chikungunya virus (CHIKV) infections can produce severe disease and mortality. Here we show that CHIKV infection of adult mice deficient in interferon response factors 3 and 7 (IRF3/7−/−) is lethal. Mortality was associated with undetectable levels of alpha/beta interferon (IFN-α/β) in serum, ∼50- and ∼10-fold increases in levels of IFN-γ and tumor necrosis factor (TNF), respectively, increased virus replication, edema, vasculitis, hemorrhage, fever followed by hypothermia, oliguria, thrombocytopenia, and raised hematocrits. These features are consistent with hemorrhagic shock and were also evident in infected IFN-α/β receptor-deficient mice. In situ hybridization suggested CHIKV infection of endothelium, fibroblasts, skeletal muscle, mononuclear cells, chondrocytes, and keratinocytes in IRF3/7−/− mice; all but the latter two stained positive in wild-type mice. Vaccination protected IRF3/7−/− mice, suggesting that defective antibody responses were not responsible for mortality. IPS-1- and TRIF-dependent pathways were primarily responsible for IFN-α/β induction, with IRF7 being upregulated >100-fold in infected wild-type mice. These studies suggest that inadequate IFN-α/β responses following virus infection can be sufficient to induce hemorrhagic fever and shock, a finding with implications for understanding severe CHIKV disease and dengue hemorrhagic fever/dengue shock syndrome. PMID:22761364

Interferons and Interferon Regulatory Factors in Malaria

PubMed Central

Claser, Carla; Tan, Kevin Shyong Wei; Rénia, Laurent

2014-01-01

Malaria is one of the most serious infectious diseases in humans and responsible for approximately 500 million clinical cases and 500 thousand deaths annually. Acquired adaptive immune responses control parasite replication and infection-induced pathologies. Most infections are clinically silent which reflects on the ability of adaptive immune mechanisms to prevent the disease. However, a minority of these can become severe and life-threatening, manifesting a range of overlapping syndromes of complex origins which could be induced by uncontrolled immune responses. Major players of the innate and adaptive responses are interferons. Here, we review their roles and the signaling pathways involved in their production and protection against infection and induced immunopathologies. PMID:25157202

Successful Application of the Gamma-Interferon Assay in a Bovine Tuberculosis Eradication Program: The French Bullfighting Herd Experience.

PubMed

Keck, Nicolas; Boschiroli, Maria-Laura; Smyej, Florence; Vogler, Valérie; Moyen, Jean-Louis; Desvaux, Stéphanie

2018-01-01

In the French Camargue region, where bovine tuberculosis had been enzootic for several years in bullfighting cattle herds, the gamma-interferon (IFN) assay was used since 2003 in parallel with the intradermal test in order to increase overall disease detection sensitivity in infected herds. This study presents the results of a field-evaluation of the assay during a 10-year period (2004-2014) of disease control and surveillance program and explores the particular pattern of IFN assay results in bullfight herds in comparison to cattle from other regions of France. The low sensitivity [59.2% (50.6; 67.3)] of IFN assay using the tuberculin stimulation could be related to the poor gamma-IFN production from bullfight cattle blood cells which is significantly lower than in animals of conventional breeds. The characteristics of the assay were progressively adapted to the epidemiological situation and the desired strategic applications. Data analysis with a receiver operating characteristic curve based on a simple S/P value algorithm allowed for the determination of a new cutoff adapted for a global screening, giving a high specificity of 99.9% results and a high accuracy of the assay. Having regularly risen to above 5% since 2005, with a peak around 10% in 2010, the annual incidence dropped to under 1% in 2014. The positive predictive value relative to the bacteriological confirmation evolved during the years, from 33% in 2009 to 12% during the last screening period, a normal trend in a context of decreasing prevalence. The estimated rate of false-positive reactions during screening campaigns was 0.67%, confirming the high specificity of the test, measured in bTB negative herds, in this epidemiological context. The proportion of false-positive reactions decreased with the age and was higher in males than in females. Although these results indicate that the IFN assay is accurate in the field, it also emphasizes great differences between interferon quantities produced by

Interferon-gamma receptor-deficiency renders mice highly susceptible to toxoplasmosis by decreased macrophage activation.

PubMed

Deckert-Schlüter, M; Rang, A; Weiner, D; Huang, S; Wiestler, O D; Hof, H; Schlüter, D

1996-12-01

Toxoplasma gondii may cause severe infections in immunocompromised patients including fetuses and those with AIDS. Among the factors mediating protection against T. gondii, IFN-gamma has gained special attention. To analyze the role of IFN-gamma in the early phase of toxoplasmosis, IFN-gamma receptor-deficient (IFN-gamma R0/0) mice were orally infected with low-virulent toxoplasms. IFN-gamma R0/0 mice died of the disease up to day 10 postinfection, whereas immunocompetent wild-type (WT) mice developed a chronic toxoplasmosis. Histopathology revealed that in IFN-gamma R0/0 mice, the parasite multiplied unrestrictedly in the small intestine, the intestinal lymphatic tissue, the liver, and the spleen. Ultimately, animals died of a necrotizing hepatitis. In WT mice, the same organs were effected, but multiplication of the parasite was effectively limited. Compared with WT mice, immunohistochemistry and flow cytometry demonstrated that in IFN-gamma R0/0 mice, macrophages were only marginally activated in response to the infection, as evidenced by a reduced expression of major histocompatability complex class II antigens. In addition, immunohistochemistry and RT-PCR showed a reduced production of the macrophage-derived cytokines tumor necrosis factor-alpha, inducible nitric oxide synthase, and IL-1 beta in the liver of IFN-gamma R0/0 mice. In contrast, activation of T cells, recruitment of immune cells to inflammatory foci, and anti-T. gondii IgM antibody production were unaffected by the mutation of the IFN-gamma R. Moreover, induction of IL-2, IL-4, and IL-10 mRNA transcripts in the liver was normal in IFN-gamma R0/0 mice. Adoptive transfer experiments revealed that the immune T cells of WT animals did not protect IFN-gamma R0/0 mice from lethal infection with highly virulent toxoplasms, whereas WT mice were significantly protected by the adoptive transfer. Based on these studies, we conclude that IFN-gamma is absolutely required for an efficient activation of

Human macrophage gamma interferon decreases gene expression but not replication of Mycobacterium tuberculosis: analysis of the host-pathogen reciprocal influence on transcription in a comparison of strains H37Rv and CMT97.

PubMed

Cappelli, G; Volpe, P; Sanduzzi, A; Sacchi, A; Colizzi, V; Mariani, F

2001-12-01

Mycobacterium tuberculosis is an intracellular pathogen that readily survives and replicates in human macrophages (MPhi). Host cells have developed different mycobactericidal mechanisms, including the production of inflammatory cytokines. The aim of this study was to compare the MPhi response, in terms of cytokine gene expression, to infection with the M. tuberculosis laboratory strain H37Rv and the clinical M. tuberculosis isolate CMT97. Both strains induce the production of interleukin-12 (IL-12) and IL-16 at comparable levels. However, the clinical isolate induces a significantly higher and more prolonged MPhi activation, as shown by reverse transcription-PCR analysis of IL-1beta, IL-6, IL-10, transforming growth factor beta, tumor necrosis factor alpha, and gamma interferon (IFN-gamma) transcripts. Interestingly, when IFN-gamma transcription is high, the number of M. tuberculosis genes expressed decreases and vice versa, whereas no mycobactericidal effect was observed in terms of bacterial growth. Expression of 11 genes was also studied in the two M. tuberculosis strains by infecting resting or activated MPhi and compared to bacterial intracellular survival. In both cases, a peculiar inverse correlation between expression of these genes and multiplication was observed. The number and type of genes expressed by the two strains differed significantly.

Downregulation of Interleukin-18-Mediated Cell Signaling and Interferon Gamma Expression by the Hepatitis B Virus e Antigen

PubMed Central

Jegaskanda, S.; Ahn, S. H.; Skinner, N.; Thompson, A. J.; Ngyuen, T.; Holmes, J.; De Rose, R.; Navis, M.; Winnall, W. R.; Kramski, M.; Bernardi, G.; Bayliss, J.; Colledge, D.; Sozzi, V.; Visvanathan, K.; Locarnini, S. A.; Kent, S. J.

2014-01-01

ABSTRACT The mechanisms by which hepatitis B virus (HBV) establishes and maintains chronic hepatitis B infection (CHB) are poorly defined. Innate immune responses play an important role in reducing HBV replication and pathogenesis. HBV has developed numerous mechanisms to escape these responses, including the production of the secreted hepatitis B e antigen (HBeAg), which has been shown to regulate antiviral toll-like receptor (TLR) and interleukin-1 (IL-1) signaling. IL-18 is a related cytokine that inhibits HBV replication in hepatoma cell lines and in the liver through the induction of gamma interferon (IFN-γ) by NK cells and T cells. We hypothesized that HBV or HBV proteins inhibit IFN-γ expression by NK cells as an accessory immunomodulatory function. We show that HBeAg protein inhibits the NF-κB pathway and thereby downregulates NK cell IFN-γ expression. Additionally, IFN-γ expression was significantly inhibited by exposure to serum from individuals with HBeAg-positive but not HBeAg-negative chronic HBV infection. Further, we show that the HBeAg protein suppresses IL-18-mediated NF-κB signaling in NK and hepatoma cells via modulation of the NF-κB pathway. Together, these findings show that the HBeAg inhibits IL-18 signaling and IFN-γ expression, which may play an important role in the establishment and/or maintenance of persistent HBV infection. IMPORTANCE It is becoming increasingly apparent that NK cells play a role in the establishment and/or maintenance of chronic hepatitis B infection. The secreted HBeAg is an important regulator of innate and adaptive immune responses. We now show that the HBeAg downregulates NK cell-mediated IFN-γ production and IL-18 signaling, which may contribute to the establishment of infection and/or viral persistence. Our findings build on previous studies showing that the HBeAg also suppresses the TLR and IL-1 signaling pathways, suggesting that this viral protein is a key regulator of antiviral innate immune responses

Two distinct interferon-γ genes in Tetraodon nigroviridis: Functional analysis during Vibrio parahaemolyticus infection.

PubMed

Peng, Wan; Lu, Dan-Qi; Li, Gao-Fei; Zhang, Xu; Yao, Mi; Zhang, Yong; Lin, Hao-Ran

2016-02-01

Interferon gamma (IFNγ) is a Th1 cytokine that plays a very important role in almost all phases of immune and inflammatory responses. In this study, we explored the functions of IFNγ1 and IFNγ2 of Tetraodon nigroviridis. Treating T. nigroviridis spleen and head kidney cells in vitro with recombinant T. nigroviridis IFNγ1 protein (rTn IFNγ1) or recombinant T. nigroviridis IFNγ2 protein (rTn IFNγ2) enhanced their nitric oxide responses. Both rTn IFNγ1 and rTn IFNγ2 also induced the expression of interferon-stimulated gene 15 (ISG15), a common anti-viral gene, although the expression of the interferon-inducible Mx gene was markedly inhibited by rTn IFNγ1 and was induced by rTn IFNγ2. The in vivo effects of rTn IFNγ1 and rTn IFNγ2 on Vibrio parahaemolyticus (V. parahaemolyticus) infection were assessed by intraperitoneally injecting rTn IFNγ1 or rTn IFNγ2 (100 ng) and V. parahaemolyticus (8 × 10(10)CFU/mL) into T. nigroviridis. A comparison of the group treated only with V. parahaemolyticus and those also treated with rTn IFNγ1 or rTn IFNγ2 showed that neither of these IFNγs protected T. nigroviridis from V. parahaemolyticus infection. However, rTn IFNγ1 more rapidly and robustly promoted inflammatory responses compared with rTn IFNγ2, whereas rTn IFNγ2 was involved in inducing the host to develop a more effective response earlier during the later stage of a V. parahaemolyticus infection. Moreover, microRNA-29b (miR-29b) expression is inversely correlated with IFNγ2 expression in T. nigroviridis. Copyright © 2015 Elsevier Ltd. All rights reserved.

Natural Killer Cells and Helicobacter pylori Infection: Bacterial Antigens and Interleukin-12 Act Synergistically To Induce Gamma Interferon Production

PubMed Central

Yun, Cheol H.; Lundgren, Anna; Azem, Josef; Sjöling, Åsa; Holmgren, Jan; Svennerholm, Ann-Mari; Lundin, B. Samuel

2005-01-01

Helicobacter pylori is known to induce a local immune response, which is characterized by activation of lymphocytes and the production of IFN-γ in the stomach mucosa. Since not only T cells, but also natural killer (NK) cells, are potent producers of gamma interferon (IFN-γ), we investigated whether NK cells play a role in the immune response to H. pylori infection. Our results showed that NK cells were present in both the gastric and duodenal mucosae but that H. pylori infection did not affect the infiltration of NK cells into the gastrointestinal area. Furthermore, we could show that NK cells could be activated directly by H. pylori antigens, as H. pylori bacteria, as well as lysate from H. pylori, induced the secretion of IFN-γ by NK cells. NK cells were also activated without direct contact when separated from the bacteria by an epithelial cell layer, indicating that the activation of NK cells by H. pylori can also occur in vivo, in the infected stomach mucosa. Moreover, the production of IFN-γ by NK cells was greatly enhanced when a small amount of interleukin-12 (IL-12) was added, and this synergistic effect was associated with increased expression of the IL-12 receptor β2. It was further evident that bacterial lysate alone was sufficient to induce the activation of cytotoxicity-related molecules. In conclusion, we demonstrated that NK cells are present in the gastroduodenal mucosa of humans and that NK cells produce high levels of IFN-γ when stimulated with a combination of H. pylori antigen and IL-12. We propose that NK cells play an active role in the local immune response to H. pylori infection. PMID:15731046

Gamma Interferon Loaded onto Albumin Nanoparticles: In Vitro and In Vivo Activities against Brucella abortus▿

PubMed Central

Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.

2007-01-01

The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401

Frequency of indeterminate results from an interferon-gamma release assay among HIV-infected individuals.

PubMed

Oliveira, Sandra Maria do Valle Leone de; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria

2017-01-01

To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. Avaliar a frequência de resultados indeterminados de um interferon-gamma release assay (IGRA, ensaio de liberação de interferon-gama) e os fatores relacionados com esses resultados em pessoas vivendo com HIV/AIDS (PVHA). Foram avaliadas 81 PVHA na região Centro-Oeste do Brasil, por meio do teste tuberculínico e de um IGRA. Informações a respeito de vari

Interferon antagonist NSs of La Crosse virus triggers a DNA damage response-like degradation of transcribing RNA polymerase II.

PubMed

Verbruggen, Paul; Ruf, Marius; Blakqori, Gjon; Överby, Anna K; Heidemann, Martin; Eick, Dirk; Weber, Friedemann

2011-02-04

La Crosse encephalitis virus (LACV) is a mosquito-borne member of the negative-strand RNA virus family Bunyaviridae. We have previously shown that the virulence factor NSs of LACV is an efficient inhibitor of the antiviral type I interferon system. A recombinant virus unable to express NSs (rLACVdelNSs) strongly induced interferon transcription, whereas the corresponding wt virus (rLACV) suppressed it. Here, we show that interferon induction by rLACVdelNSs mainly occurs through the signaling pathway leading from the pattern recognition receptor RIG-I to the transcription factor IRF-3. NSs expressed by rLACV, however, acts downstream of IRF-3 by specifically blocking RNA polymerase II-dependent transcription. Further investigations revealed that NSs induces proteasomal degradation of the mammalian RNA polymerase II subunit RPB1. NSs thereby selectively targets RPB1 molecules of elongating RNA polymerase II complexes, the so-called IIo form. This phenotype has similarities to the cellular DNA damage response, and NSs was indeed found to transactivate the DNA damage response gene pak6. Moreover, NSs expressed by rLACV boosted serine 139 phosphorylation of histone H2A.X, one of the earliest cellular reactions to damaged DNA. However, other DNA damage response markers such as up-regulation and serine 15 phosphorylation of p53 or serine 1524 phosphorylation of BRCA1 were not triggered by LACV infection. Collectively, our data indicate that the strong suppression of interferon induction by LACV NSs is based on a shutdown of RNA polymerase II transcription and that NSs achieves this by exploiting parts of the cellular DNA damage response pathway to degrade IIo-borne RPB1 subunits.

Interferon Induced Transfer of Viral Resistance

DTIC Science & Technology

1981-02-01

necseeary and Identify by block number) - Interferon, Cell Communication, Resistance Transfer, Viruses , Antibody Production, Polypeptide Hormones...lymphocytes and the foreign cells, but not mycoplasmas or endogenous viruses , appears to be required for induction. The kinetics of production of leukocyte...interferon by nonsensitized lymphocytes in response to foreign cells is similar to that induced by viruses . We have shown that a component probably of Vie

Tumor necrosis factor alpha mediates resistance to Trypanosoma cruzi infection in mice by inducing nitric oxide production in infected gamma interferon-activated macrophages.

PubMed Central

Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q

1995-01-01

Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147

Crucial role of gamma interferon-producing CD4+ Th1 cells but dispensable function of CD8+ T cell, B cell, Th2, and Th17 responses in the control of Brucella melitensis infection in mice.

PubMed

Vitry, Marie-Alice; De Trez, Carl; Goriely, Stanislas; Dumoutier, Laure; Akira, Shizuo; Ryffel, Bernhard; Carlier, Yves; Letesson, Jean-Jacques; Muraille, Eric

2012-12-01

Brucella spp. are facultative intracellular bacterial pathogens responsible for brucellosis, a worldwide zoonosis that causes abortion in domestic animals and chronic febrile disease associated with serious complications in humans. There is currently no approved vaccine against human brucellosis, and antibiotic therapy is long and costly. Development of a safe protective vaccine requires a better understanding of the roles played by components of adaptive immunity in the control of Brucella infection. The importance of lymphocyte subsets in the control of Brucella growth has been investigated separately by various research groups and remains unclear or controversial. Here, we used a large panel of genetically deficient mice to compare the importance of B cells, transporter associated with antigen processing (TAP-1), and major histocompatibility complex class II-dependent pathways of antigen presentation as well as T helper 1 (Th1), Th2, and Th17-mediated responses on the immune control of Brucella melitensis 16 M infection. We clearly confirmed the key function played by gamma interferon (IFN-γ)-producing Th1 CD4(+) T cells in the control of B. melitensis infection, whereas IFN-γ-producing CD8(+) T cells or B cell-mediated humoral immunity plays only a modest role in the clearance of bacteria during primary infection. In the presence of a Th1 response, Th2 or Th17 responses do not really develop or play a positive or negative role during the course of B. melitensis infection. On the whole, these results could improve our ability to develop protective vaccines or therapeutic treatments against brucellosis.

Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma.

PubMed

Magee, Kelsey E; Kelsey, Christina E; Kurzinski, Katherine L; Ho, Jonhan; Mlakar, Logan R; Feghali-Bostwick, Carol A; Torok, Kathryn S

2013-01-01

The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS.

Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma

PubMed Central

2013-01-01

Introduction The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. Methods The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). Results IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Conclusions Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS. PMID:24499523

The nucleocapsid protein of measles virus blocks host interferon response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takayama, Ikuyo; Sato, Hiroki; Watanabe, Akira

2012-03-01

Measles virus (MV) belongs to the genus Morbillivirus of the family Paramyxoviridae. A number of paramyxoviruses inhibit host interferon (IFN) signaling pathways in host immune systems by various mechanisms. Inhibition mechanisms have been described for many paramyxoviruses. Although there are inconsistencies among previous reports concerning MV, it appears that P/V/C proteins interfere with the pathways. In this study, we confirmed the effects of MV P gene products of a wild MV strain on IFN pathways and examined that of other viral proteins on it. Interestingly, we found that N protein acts as an IFN-{alpha}/{beta} and {gamma}-antagonist as strong as Pmore » gene products. We further investigated the mechanisms of MV-N inhibition, and revealed that MV-N blocks the nuclear import of activated STAT without preventing STAT and Jak activation or STAT degradation, and that the nuclear translocation of MV-N is important for the inhibition. The inhibitory effect of the N protein was observed as a common feature of other morbilliviruses. The results presented in this report suggest that N protein of MV as well as P/V/C proteins is involved in the inhibition of host IFN signaling pathways.« less

Essential Cell-Autonomous Role for Interferon (IFN) Regulatory Factor 1 in IFN-γ-Mediated Inhibition of Norovirus Replication in Macrophages

PubMed Central

Maloney, Nicole S.; Thackray, Larissa B.; Goel, Gautam; Hwang, Seungmin; Duan, Erning; Vachharajani, Punit; Xavier, Ramnik

2012-01-01

Noroviruses (NVs) cause the majority of cases of epidemic nonbacterial gastroenteritis worldwide and contribute to endemic enteric disease. However, the molecular mechanisms responsible for immune control of their replication are not completely understood. Here we report that the transcription factor interferon regulatory factor 1 (IRF-1) is required for control of murine NV (MNV) replication and pathogenesis in vivo. This led us to studies documenting a cell-autonomous role for IRF-1 in gamma interferon (IFN-γ)-mediated inhibition of MNV replication in primary macrophages. This role of IRF-1 in the inhibition of MNV replication by IFN-γ is independent of IFN-αβ signaling. While the signal transducer and activator of transcription STAT-1 was also required for IFN-γ-mediated inhibition of MNV replication in vitro, class II transactivator (CIITA), interferon regulatory factor 3 (IRF-3), and interferon regulatory factor 7 (IRF-7) were not required. We therefore hypothesized that there must be a subset of IFN-stimulated genes (ISGs) regulated by IFN-γ in a manner dependent only on STAT-1 and IRF-1. Analysis of transcriptional profiles of macrophages lacking various transcription factors confirmed this hypothesis. These studies identify a key role for IRF-1 in IFN-γ-dependent control of norovirus infection in mice and macrophages. PMID:22973039

Results of space experiment program "Interferon". II. Influence of spaceflight conditions on the activity of interferon preparations and interferon inducers ("Interferon II").

PubMed

Tálas, M; Bátkai, L; Stöger, I; Nagy, K; Hiros, L; Konstantinova, I; Kozharinov, V

1983-01-01

The influence of spaceflight conditions on the biological activity of HuIFN-alpha preparations (lyophilized, in solution and in ointment) and interferon inducers was studied. In antiviral activity no difference was observed between the samples kept aboard the spaceship and the controls kept under ground conditions. The interferon inducers poly I:C, poly G:C and gossipol placed in the space laboratory for 7 days maintained their interferon-inducing capacity. The circulating interferon level in mice was the same irrespective of the induction being performed with flight or ground-control samples of inducers.

Molecular stress response in the CNS of mice after systemic exposureto interferon-alpha, ionizing radiation and ketamine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lowe, Xiu R.; Marchetti, Francesco; Lu, Xiaochen

2009-03-03

We previously showed that the expression of troponin T1 (Tnnt 1) was induced in the central nervous system (CNS) of adultmice 30 min after treatment with ketamine, a glutamate N-methyl-D-aspartic acid (NMDA) receptor antagonist. We hypothesized that Tnnt 1 expression may be an early molecular biomarker of stress response in the CNS of mice. To further evaluate this hypothesis, we investigated the regional expression of Tnnt 1 in the mouse brain using RNA in situ hybridization 4 h after systemic exposure to interferon-a (IFN-a) and gamma ionizing radiation, both of which have be associated with wide ranges of neuropsychiatric complications.more » Adult B6C3F1 male mice were treated with either human IFN-a (a single i.p. injection at 1 x 105 IU/kg) or whole body gamma-radiation (10 cGy or 2 Gy). Patterns of Tnnt 1 transcript expression were compared in various CNS regions after IFN-a, radiation and ketamine treatments (previous study). Tnnt 1 expression was consistently induced in pyramidal neurons of cerebral cortex and hippocampus after all treatment regimens including 10 cGy of ionizing radiation. Regional expression of Tnnt 1 was induced in Purkinje cells of cerebellum after ionizing radiation and ketamine treatment; but not after IFN-a treatment. None of the three treatments induced Tnnt 1 expression in glial cells. The patterns of Tnnt 1 expression in pyramidal neurons of cerebral cortex andhippocampus, which are both known to play important roles in cognitive function, memory and emotion, suggest that the expression of Tnnt 1 may be an early molecular biomarker of induced CNS stress.« less

Spaceflight and immune responses of rhesus monkeys

NASA Technical Reports Server (NTRS)

Sonnenfeld, Gerald; Morton, Darla S.; Swiggett, Jeanene P.; Hakenewerth, Anne M.; Fowler, Nina A.

1995-01-01

The effects of restraint on immunological parameters was determined in an 18 day ARRT (adult rhesus restraint test). The monkeys were restrained for 18 days in the experimental station for the orbiting primate (ESOP), the chair of choice for Space Shuttle experiments. Several immunological parameters were determined using peripheral blood, bone marrow, and lymph node specimens from the monkeys. The parameters included: response of bone marrow cells to GM-CSF (granulocyte-macrophage colony stimulating factor), leukocyte subset distribution, and production of IFN-a (interferon-alpha) and IFN-gamma (interferon-gamma). The only parameter changed after 18 days of restraint was the percentage of CD8+ T cells. No other immunological parameters showed changes due to restraint. Handling and changes in housing prior to the restraint period did apparently result in some restraint-independent immunological changes. Handling must be kept to a minimum and the animals allowed time to recover prior to flight. All experiments must be carefully controlled. Restraint does not appear to be a major issue regarding the effects of space flight on immune responses.

T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.

PubMed

Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong

2017-05-12

Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.

Value of the tuberculin skin testing and of an interferon-gamma release assay in haemodialysis patients after exposure to M. tuberculosis

PubMed Central

2012-01-01

Background Patients with end-stage renal disease (ESRD) and Mycobacterium tuberculosis infection pose a high risk of developing active TB disease. It is therefore important to detect latent TB infection (LTBI) to be able to offer treatment and prevent progression to TB disease. We assessed the value of the tuberculin skin test (TST) and of an interferon-gamma release assay (Quantiferon®-TB Gold in-Tube, QFT) for diagnosing LTBI in ESRD patients, after prolonged exposure to a highly contagious TB case in a haemodialysis unit. As a high number of patients presented erythema without induration in the TST response, this type of reaction was also analysed. Method The TST and QFT were simultaneously performed twelve weeks after the last possible exposure to a bacilliferous TB patient. If the first TST (TST-1) was negative, a second TST (TST-2) was performed 15 days later to detect a booster response. A comparison was made between the TST responses (including those cases with erythema without induration) and those for the QFT. The correlation with risk of infection and the concordance between tests were both analysed. Results A total of 52 patients fulfilled the inclusion criteria. Overall, 11 patients (21.2%) had a positive TST response: 3 for TST-1 and 8 for TST-2, and 18 patients (34.6%) showed a positive QFT response (p = 0.065). Erythema without induration was found in 3 patients at TST-1 and in a further 9 patients at TST-2. The three patients with erythema without induration in TST-1 had a positive TST-2 response. Concordance between TST and QFT was weak for TST-1 (κ = 0.21); it was moderate for overall TST (κ = 0.49); and it was strong if both induration and erythema (κ = 0.67) were considered. Conclusions In patients with ESRD, erythema without induration in the TST response could potentially be an indicator of M. tuberculosis infection. The QFT shows better accuracy for LTBI diagnosis than the TST. PMID:22905901

Nuclear receptor ERR alpha and coactivator PGC-1 beta are effectors of IFN-gamma-induced host defense.

PubMed

Sonoda, Junichiro; Laganière, Josée; Mehl, Isaac R; Barish, Grant D; Chong, Ling-Wa; Li, Xiangli; Scheffler, Immo E; Mock, Dennis C; Bataille, Alain R; Robert, Francois; Lee, Chih-Hao; Giguère, Vincent; Evans, Ronald M

2007-08-01

Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.

[Conjunctival squamous cell carcinoma: paradoxical response to interferon eyedrops].

PubMed

Mata, E; Conesa, E; Castro, M; Martínez, L; de Pablo, C; González, M L

2014-07-01

A 67 year-old male seen for a longstanding corneal-conjunctival tumor. topical interferon α2b (IFN-α2b) 10 U/ml. A significant increase in lesion size was observed after 8 weeks. A surgical excision with cryotherapy was then performed. Pathological examination confirmed the diagnosis of squamous cell carcinoma. At this time the patient was found to have a positive HIV serology. Conjunctival intraepithelial neoplasia (CIN) is a pre-cancerous lesion of the ocular surface. Medical treatment of CIN is essentially with IFN-α2b due to its antiviral/antitumor properties. In patients with HIV, treatment response could be paradoxical. We recommend serology for HIV before treatment with topical IFN-α2b. Copyright © 2012 Sociedad Española de Oftalmología. Published by Elsevier Espana. All rights reserved.

Dietary Selenium Levels Affect Selenoprotein Expression and Support the Interferon-γ and IL-6 Immune Response Pathways in Mice

PubMed Central

Tsuji, Petra A.; Carlson, Bradley A.; Anderson, Christine B.; Seifried, Harold E.; Hatfield, Dolph L.; Howard, Michael T.

2015-01-01

Selenium is an essential element that is required to support a number of cellular functions and biochemical pathways. The objective of this study was to examine the effects of reduced dietary selenium levels on gene expression to assess changes in expression of non-selenoprotein genes that may contribute to the physiological consequences of selenium deficiency. Mice were fed diets that were either deficient in selenium or supplemented with selenium in the form of sodium selenite for six weeks. Differences in liver mRNA expression and translation were measured using a combination of ribosome profiling, RNA-Seq, microarrays, and qPCR. Expression levels and translation of mRNAs encoding stress-related selenoproteins were shown to be up-regulated by increased selenium status, as were genes involved in inflammation and response to interferon-γ. Changes in serum cytokine levels were measured which confirmed that interferon-γ, as well as IL-6, were increased in selenium adequate mice. Finally, microarray and qPCR analysis of lung tissue demonstrated that the selenium effects on immune function are not limited to liver. These data are consistent with previous reports indicating that adequate selenium levels can support beneficial immune responses, and further identify the IL-6 and interferon-γ pathways as being responsive to dietary selenium intake. PMID:26258789

Numerical detection, measuring and analysis of differential interferon resistance for individual HCV intra-host variants and its influence on the therapy response.

PubMed

Skums, Pavel; Campo, David S; Dimitrova, Zoya; Vaughan, Gilberto; Lau, Daryl T; Khudyakov, Yury

Hepatitis C virus (HCV) is a major cause of liver disease world-wide. Current interferon and ribavirin (IFN/RBV) therapy is effective in 50%-60% of patients. HCV exists in infected patients as a large viral population of intra-host variants (quasispecies), which may be differentially resistant to interferon treatment. We present a method for measuring differential interferon resistance of HCV quasispecies based on mathematical modeling and analysis of HCV population dynamics during the first hours of interferon therapy. The mathematical models showed that individual intra-host HCV variants have a wide range of resistance to IFN treatment in each patient. Analysis of differential IFN resistance among intra-host HCV variants allows for accurate prediction of response to IFN therapy. The models strongly suggest that resistance to interferon may vary broadly among closely related variants in infected hosts and therapy outcome may be defined by a single or a few variants irrespective of their frequency in the intra-host HCV population before treatment.

Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor

PubMed Central

Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian

2014-01-01

Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970

Gamma interferon-induced guanylate binding protein 1 is a novel actin cytoskeleton remodeling factor.

PubMed

Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael

2014-01-01

Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.

Perforin and gamma interferon expression are required for CD4+ and CD8+ T-cell-dependent protective immunity against a human parasite, Trypanosoma cruzi, elicited by heterologous plasmid DNA prime-recombinant adenovirus 5 boost vaccination.

PubMed

de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M

2009-10-01

A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.

Tuberculin Skin Tests versus Interferon-Gamma Release Assays in Tuberculosis Screening among Immigrant Visa Applicants.

PubMed

Chuke, Stella O; Yen, Nguyen Thi Ngoc; Laserson, Kayla F; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G; Whitworth, William C; Shah, J Jina; Painter, John A; Mazurek, Gerald H; Maloney, Susan A

2014-01-01

Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB.

Use of an Interferon Gamma Release Assay (IGRA) to test T-cell responsiveness to soluble Leishmania infantum antigen in whole blood of dogs from endemic areas.

PubMed

Zribi, Lilia; El-Goulli, Amel F; Ben-Abid, Meriem; Gharbi, Mohamed; Ben-Sghaier, Ines; Boufaden, Imed; Aoun, Karim; Bouratbine, Aïda

2017-11-15

Interferon-Gamma (IFN-γ) Release Assays (IGRAs) are easy tests that allow rapid screening of primed memory T-cells immunity in response to antigen. The aim of this study was to use IGRA to assess IFN-γ release in response to Soluble Leishmania infantum antigen (SLA) in whole blood of dogs living in endemic area of visceral leishmaniasis and to interpret IGRA results according to clinical examination, specific anti-Leishmania humoral response and presence of L. infantum DNA in blood. The study was carried out on 56 dogs living in greater Tunis area. Physical examination, quantitative serology and PCR on blood were used to characterize dogs' status in relation to Leishmania infection and disease. IGRA consisted on testing by ELISA for IFN-γ-secretion in whole blood after a 20-h challenge with SLA. PBS and Phytohemagglutinin (PHA) stimulations were used as controls. Four groups of dogs were characterized: 31 were negative by both serology and PCR, two had doubtful serology, 10 presented no to mild clinical signs but low antibodies levels and 13 were affected by Canine Leishmaniasis (CanL). In seronegative dogs, IGRA was little contributory in 4 puppies (age <6months) and 5 old dogs (median age=72months, IQR: 45-84 months) that didn't respond to PHA stimulation, IGRA was negative in 19 and positive in three animals with lymph node enlargement. In dogs with doubtful serology, IGRA was positive in one dog and negative in the other. In infected dogs with no to mild clinical signs, one dog exhibited high level of IFN-γ in absence of antigenic stimulation and all the other were positive by IGRA. CanL dogs showed variable IGRA results. Negative IGRAs (n=4) were shown in animals with the highest parasitic burden whereas positive IGRAs (n=5) were shown in dogs with negative PCR or low parasitic load. The 4 remaining dogs either didn't respond to PHA (n=2) or showed non-specific secretion in PBS tube (n=2). The results of this study showed that IGRA is a useful new tool

The elephant interferon gamma assay: a contribution to diagnosis of tuberculosis in elephants.

PubMed

Angkawanish, T; Morar, D; van Kooten, P; Bontekoning, I; Schreuder, J; Maas, M; Wajjwalku, W; Sirimalaisuwan, A; Michel, A; Tijhaar, E; Rutten, V

2013-11-01

Mycobacterium tuberculosis (M. tb) has been shown to be the main causative agent of tuberculosis in elephants worldwide. M. tb may be transmitted from infected humans to other species including elephants and vice versa, in case of prolonged intensive contact. An accurate diagnostic approach covering all phases of the infection in elephants is required. As M. tb is an intracellular pathogen and cell-mediated immune (CMI) responses are elicited early after infection, the skin test is the CMI assay of choice in humans and cattle. However, this test is not applicable in elephants. The interferon gamma (IFN-γ) assay is considered a good alternative for the skin test in general, validated for use in cattle and humans. This study was aimed at development of an IFN-γ assay applicable for diagnosis of tuberculosis in elephants. Recombinant elephant IFN-γ (rEpIFN-γ) produced in eukaryotic cells was used to immunize mice and generate the monoclonal antibodies. Hybridomas were screened for IFN-γ-specific monoclonal antibody production and subcloned, and antibodies were isotyped and affinity purified. Western blot confirmed recognition of the rEpIFN-γ. The optimal combination of capture and detection antibodies selected was able to detect rEpIFN-γ in concentrations as low as 1 pg/ml. The assay was shown to be able to detect the native elephant IFN-γ, elicited in positive-control cultures (pokeweed mitogen (PWM), phorbol myristate acetate plus ionomycin (PMA/I)) of both Asian and African elephant whole-blood cultures (WBC). Preliminary data were generated using WBC from non-infected elephants, a M. tb infection-suspected elephant and a culture-confirmed M. tb-infected elephant. The latter showed measurable production of IFN-γ after stimulation with ESAT6/CFP10 PPDB and PPDA in concentration ranges as elicited in WBC by Mycobacterium tuberculosis complex (MTBC)-specific antigens in other species. Hence, the IFN-γ assay presented potential as a diagnostic tool for the

EEG gamma synchronization is associated with response to paroxetine treatment.

PubMed

Arikan, Mehmet Kemal; Metin, Baris; Tarhan, Nevzat

2018-08-01

Resistance to medication is a significant problem in psychiatric practice, and effective methods for predicting response are needed to optimize treatment efficacy and limit morbidity. Gamma oscillations are considered as an index of the brain's general cognitive activity; however, the role of gamma oscillations in disease has not been studied sufficiently. This study aimed to determine if gamma power during rest can be used to predict response to anti-depressant medication treatment. Hamilton Depression Rating Scale (HDRS) score and resting state gamma power was measured in 18 medication-free patients during an episode of major depression. After 6 weeks of paroxetine monotherapy HDRS was administered again. Baseline gamma power at frontal, central and temporal electrodes before treatment was significantly related to post-treatment change in HDRS scores. The results indicate that gamma oscillations could be considered a marker of response to paroxetine treatment in patients with major depression. Copyright © 2018. Published by Elsevier B.V.

No changes in serum concentrations of interleukin 10 (IL-10) and interferon gamma (IF-gamma) before and after treatment of the thyroid eye disease (TED).

PubMed

Laban-Guceva, Nevenka; Antova, Magdalena; Bogoev, Milco

2007-11-01

TED is a severe eye disease leading in rare cases to decrease of sight, optic nerve compression and blindness. Recently, significant progresses in understanding the disease have been done. Nevertheless, the treatment of the disease, especially in its severe form remains challenging. Glucocorticoids (GC) have been the basis of the treatment for a long time. Orbital irradiation (OI) and optical decompression (OD) are also used in managing the severe forms of TED. Somatostatin, intravenous immunoglobulin have been also used, with conflicting results. Regarding the potential for the treatment of TED with cytokine antagonists, controlled clinical studies are not available. Since cytokines play an important role in the pathogenesis of the TED, they seemed to be logical choice for modern TED treatment. It has been shown that both Th1 (interleukin-2, tumor necrosis factor gamma, interleukin gamma) and Th2 (interleukin -4, -5, -10) profile T cells are activated in the TED. We therefore measured interleukin-gamma, IF-gamma and interleukin -10 (IL-10)(Th1 and Th2 pattern) to assess its relationship to the course of the disease. This paper shows that both Th1 (IL-2) and Th2 (IF-gamma) pathways represented by those two cytokines are not involved (IL-10 before 2.29+/-5.23 and after treatment 3.77+/-8.44; IF gamma before 0.50+/-0.24 and after treatment 0.35+/-0.19). No relationship to the response to treatment was found. GC resulted in positive response in 8/22 patients, OI (12 patients) given after CS therapy, resulted in a response in all patients. Increase in proptosis, loss of visual acuity is spite of CS treatment prompted OD in two patients, who both recovered visual acuity and proptosis fell under 25 mm Hertel.

Movement Limitation and Immune Responses of Rhesus Monkeys

NASA Technical Reports Server (NTRS)

Sonnenfeld, Gerald; Morton, Darla S.; Swiggett, Jeanene P.; Hakenewerth, Anne M.; Fowler, Nina A.

1993-01-01

The effects of restraint on immunological parameters was determined in an 18 day ARRT (adult rhesus restraint test). The monkeys were restrained for 18 days in the experimental station for the orbiting primate (ESOP), the chair of choice for Space Shuttle experiments. Several immunological parameters were determined using peripheral blood, bone marrow, and lymph node specimens from the monkeys. The parameters included: response of bone marrow cells to GM-CSF (granulocyte-macrophage colony stimulating factor), leukocyte subset distribution, and production of IFN-alpha (interferon-alpha) and IFN-gamma (interferon-gamma). The only parameter changed after 18 days of restraint was the percentage of CDB+ T cells. No other immunological parameters showed changes due to restraint. Handling and changes in housing prior to the restraint period did apparently result in some restraint-independent immunological changes. Handling must be kept to a minimum and the animals allowed time to recover prior to flight. All experiments must be carefully controlled. Restraint does not appear to be a major issue regarding the effects of space flight on immune responses.

Potential for all-trans retinoic acid (tretinoin) to enhance interferon-alpha treatment response in chronic myelogenous leukemia, melanoma, myeloma and renal cell carcinoma.

PubMed

Kast, Richard E

2008-10-01

This note mechanistically accounts for recent unexplained findings that all-trans retinoic acid (ATRA, also termed tretinoin) exerts an anti-viral effect against hepatitis C virus (HCV) in chronically infected patients, in whom ATRA also showed synergy with interferon-alpha. How HCV replication was suppressed was unclear. Both effects of ATRA can be accounted for by ATRA's upregulation of RIG protein, an 18 kDa product of retinoic induced gene-1. Increased RIG then couples ATRA to increased Type 1 interferons' production. Details of this mechanism predict that ATRA will similarly augment interferon-a activity in treating chronic myelogenous leukemia, melanoma, myeloma and renal cell carcinoma and that the addition of ribavirin and/or bexarotene will each incrementally enhance interferon-a responses in these cancers.

[Effects of recombinant human alpha-2b and gamma interferons on bone marrow megakaryocyte progenitors (CFU-Meg) from patients with chronic myelocytic leukemia].

PubMed

Tanabe, Y; Dan, K; Kuriya, S; Nomura, T

1989-10-01

The effects of recombinant human interferon (IFN) alpha-2b and gamma on the bone marrow megakaryocyte progenitors (CFU-Meg) were compared between eight patients in the chronic phase of Ph1-positive chronic myelocytic leukemia (CML) and five hematologically normal patients. CFU-Meg was assayed in plasma clot culture added with phytohemagglutinin-stimulated leukocyte-conditioned medium as a source of colony stimulating activity. The average count of CFU-Meg colonies formed from the bone marrow of CML patients was 5.5 times that of normal controls. Spontaneous CFU-Meg colonies were grown in seven of eight CML patients, but in none of five controls. Colony formation by CFU-Meg in CML as well as normal bone marrow was suppressed by the two preparations of IFN in a dose dependent fashion. Their suppressive influence on colonies from CFU-Meg was comparable between CML and normal bone marrow at lower concentrations, but was less marked for CML than normal bone marrow at higher concentrations. The formation of CFU-Meg colonies from CML bone marrow was more severely suppressed by IFN-gamma than IFN-alpha-2b. Depletion of either T lymphocytes or adherent cells from the CML bone marrow cells diminished the suppressive effects of IFN-gamma, but had no influence on the effects of IFN-alpha-2b.

Card9- and MyD88-Mediated Gamma Interferon and Nitric Oxide Production Is Essential for Resistance to Subcutaneous Coccidioides posadasii Infection.

PubMed

Hung, Chiung-Yu; Castro-Lopez, Natalia; Cole, Garry T

2016-04-01

Coccidioidomycosis is a potentially life-threatening respiratory disease which is endemic to the southwestern United States and arid regions of Central and South America. It is responsible for approximately 150,000 infections annually in the United States alone. Almost every human organ has been reported to harbor parasitic cells of Coccidioides spp. in collective cases of the disseminated form of this mycosis. Current understanding of the mechanisms of protective immunity against lung infection has been largely derived from murine models of pulmonary coccidioidomycosis. However, little is known about the nature of the host response to Coccidioides in extrapulmonary tissue. Primary subcutaneous coccidioidal infection is rare but has been reported to result in disseminated disease. Here, we show that activation of MyD88 and Card9 signal pathways are required for resistance to Coccidioides infection following subcutaneous challenge of C57BL/6 mice, which correlates with earlier findings of the protective response to pulmonary infection. MyD88(-/-) andCard9(-/-) mice recruited reduced numbers of T cells, B cells, and neutrophils to the Coccidioides-infected hypodermis com pared to wild-type mice; however, neutrophils were dispensable for resistance to skin infection. Further studies have shown that gamma interferon (IFN-γ) production and activation of Th1 cells characterize resistance to subcutaneous infection. Furthermore, activation of a phagosomal enzyme, inducible nitric oxide synthase, which is necessary for NO production, is a requisite for fungal clearance in the hypodermis. Collectively, our data demonstrate that MyD88- and Card9-mediated IFN-γ and nitric oxide production is essential for protection against subcutaneous Coccidioides infection. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Interferon alpha inhibits viral replication of a live-attenuated porcine reproductive and respiratory syndrome virus vaccine preventing development of an adaptive immune response in swine

USDA-ARS?s Scientific Manuscript database

Type I interferons, such as interferon alpha (IFNa), contribute to innate antiviral immunity by promoting production of antiviral mediators and are also involved in promoting an adaptive immune response. Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most devastating and c...

Fabrication of fiber-optic localized surface plasmon resonance sensor and its application to detect antibody-antigen reaction of interferon-gamma

NASA Astrophysics Data System (ADS)

Jeong, Hyeon-Ho; Erdene, Norov; Lee, Seung-Ki; Jeong, Dae-Hong; Park, Jae-Hyoung

2011-12-01

A fiber-optic localized surface plasmon (FO LSPR) sensor was fabricated by gold nanoparticles (Au NPs) immobilized on the end-face of an optical fiber. When Au NPs were formed on the end-face of an optical fiber by chemical reaction, Au NPs aggregation occurred and the Au NPs were immobilized in various forms such as monomers, dimers, trimers, etc. The component ratio of the Au NPs on the end-face of the fabricated FO LSPR sensor was slightly changed whenever the sensors were fabricated in the same condition. Including this phenomenon, the FO LSPR sensor was fabricated with high sensitivity by controlling the density of Au NPs. Also, the fabricated sensors were measured for the resonance intensity for the different optical systems and analyzed for the effect on sensitivity. Finally, for application as a biosensor, the sensor was used for detecting the antibody-antigen reaction of interferon-gamma.

Controlling nuclear JAKs and STATs for specific gene activation by IFN{gamma}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea

2011-07-08

Highlights: {yields} Gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interact with the promoter region of IFN{gamma}-associated genes along with transcription factor STAT1{alpha}. {yields} We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. {yields} The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interacted with the promoter region of IFN{gamma}-activated genes along with transcription factor STAT1{alpha}. Recent studies have suggested that activated Janus kinases pJAK2 andmore » pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFN{gamma}. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFN{gamma} treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The {beta}-actin gene, which is not activated by IFN{gamma}, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFN{gamma} treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFN{gamma} treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFN{gamma

Specificity, cross-talk and adaptation in Interferon signaling

NASA Astrophysics Data System (ADS)

Zilman, Anton

Innate immune system is the first line of defense of higher organisms against pathogens. It coordinates the behavior of millions of cells of multiple types, achieved through numerous signaling molecules. This talk focuses on the signaling specificity of a major class of signaling molecules - Type I Interferons - which are also used therapeutically in the treatment of a number of diseases, such as Hepatitis C, multiple sclerosis and some cancers. Puzzlingly, different Interferons act through the same cell surface receptor but have different effects on the target cells. They also exhibit a strange pattern of temporal cross-talk resulting in a serious clinical problem - loss of response to Interferon therapy. We combined mathematical modeling with quantitative experiments to develop a quantitative model of specificity and adaptation in the Interferon signaling pathway. The model resolves several outstanding experimental puzzles and directly affects the clinical use of Type I Interferons in treatment of viral hepatitis and other diseases.

Type I Interferon Responses by HIV-1 Infection: Association with Disease Progression and Control.

PubMed

Soper, Andrew; Kimura, Izumi; Nagaoka, Shumpei; Konno, Yoriyuki; Yamamoto, Keisuke; Koyanagi, Yoshio; Sato, Kei

2017-01-01

Human immunodeficiency virus type 1 (HIV-1) is the causative agent of acquired immunodeficiency syndrome and its infection leads to the onset of several disorders such as the depletion of peripheral CD4 + T cells and immune activation. HIV-1 is recognized by innate immune sensors that then trigger the production of type I interferons (IFN-Is). IFN-Is are well-known cytokines eliciting broad anti-viral effects by inducing the expression of anti-viral genes called interferon-stimulated genes (ISGs). Extensive in vitro studies using cell culture systems have elucidated that certain ISGs such as APOBEC3G, tetherin, SAM domain and HD domain-containing protein 1, MX dynamin-like GTPase 2, guanylate-binding protein 5, and schlafen 11 exert robust anti-HIV-1 activity, suggesting that IFN-I responses triggered by HIV-1 infection are detrimental for viral replication and spread. However, recent studies using animal models have demonstrated that at both the acute and chronic phase of infection, the role of IFN-Is produced by HIV or SIV infection in viral replication, spread, and pathogenesis, may not be that straightforward. In this review, we describe the pluses and minuses of HIV-1 infection stimulated IFN-I responses on viral replication and pathogenesis, and further discuss the possibility for therapeutic approaches.

Blockade of interferon Beta, but not interferon alpha, signaling controls persistent viral infection.

PubMed

Ng, Cherie T; Sullivan, Brian M; Teijaro, John R; Lee, Andrew M; Welch, Megan; Rice, Stephanie; Sheehan, Kathleen C F; Schreiber, Robert D; Oldstone, Michael B A

2015-05-13

Although type I interferon (IFN-I) is thought to be beneficial against microbial infections, persistent viral infections are characterized by high interferon signatures suggesting that IFN-I signaling may promote disease pathogenesis. During persistent lymphocytic choriomeningitis virus (LCMV) infection, IFNα and IFNβ are highly induced early after infection, and blocking IFN-I receptor (IFNAR) signaling promotes virus clearance. We assessed the specific roles of IFNβ versus IFNα in controlling LCMV infection. While blockade of IFNβ alone does not alter early viral dissemination, it is important in determining lymphoid structure, lymphocyte migration, and anti-viral T cell responses that lead to accelerated virus clearance, approximating what occurs during attenuation of IFNAR signaling. Comparatively, blockade of IFNα was not associated with improved viral control, but with early dissemination of virus. Thus, despite their use of the same receptor, IFNβ and IFNα have unique and distinguishable biologic functions, with IFNβ being mainly responsible for promoting viral persistence. Copyright © 2015 Elsevier Inc. All rights reserved.

Three-dimensional crystal structure of recombinant murine interferon-beta.

PubMed Central

Senda, T; Shimazu, T; Matsuda, S; Kawano, G; Shimizu, H; Nakamura, K T; Mitsui, Y

1992-01-01

The crystal structure of recombinant murine interferon-beta (IFN-beta) has been solved by the multiple isomorphous replacement method and refined to an R-factor of 20.5% against 2.6 A X-ray diffraction data. The structure shows a variant of the alpha-helix bundle with a new chain-folding topology, which seems to represent a basic structural framework of all the IFN-alpha and IFN-beta molecules belonging to the type I family. Functionally important segments of the polypeptide chain, as implied through numerous gene manipulation studies carried out so far, are spatially clustered indicating the binding site(s) to the receptor(s). Comparison of the present structure with those of other alpha-helical cytokine proteins, including porcine growth hormone, interleukin 2 and interferon gamma, indicated either a topological similarity in chain folding or a similar spatial arrangement of the alpha-helices. Images PMID:1505514

[Interleukin 8 and interferon gamma in ocular toxoplasmosis].

PubMed

Czepiel, Jacek; Biesiada, Grazyna; Sobczyk-Krupiarz, Iwona; Miklasszewska, Grazyna; Fedak, Danuta; Solnica, Bogdan; Mach, Tomasz; Garlicki, Aleksander

2011-01-01

Toxoplasmosis is one of the most common parasitic infections in the world, it is caused by Toxoplasma gondii. The infection is typically asymptomatic or the symptoms are very mild. Approximately 10% patients have limphadenopathy, involvement of the others organs, like eyes, nervous system, liver, heart, are observed more rarely. The aim of our study was to assess the level of selected cytokines in blood among patients with ocular toxoplasmosis. We have enrolled in the study 30 patients, 19-42 years old, treated for ocular toxoplasmosis, and 20 healthy volunteers, 20-48 years old, to the control group. Tests for blood morphology, C-reactive protein, the level of IL-8 and IFN-gamma were performed in all patients. The blood parameters in toxoplasmosis group were performed before antiparasitic treatment was given. The level of IFN-gamma in blood was lower among patients with ocular toxoplasmosis comparing with control group (1.52 vs. 4.18 pg/ml; p = 0.002). The level of IL-8 in blood was lower among patients with ocular toxoplasmosis comparing with control group (22.96 vs. 94.3 pg/ml; p = 0,007). There were no correlations between analyzed cytokines and blood morphology or CRP. The low level of IFN-gamma and IL-8 in blood is important factor leading to reactivation of the ocular toxoplasmosis.

Robust Protection against Highly Virulent Foot-and-Mouth Disease Virus in Swine by Combination Treatment with Recombinant Adenoviruses Expressing Porcine Alpha and Gamma Interferons and Multiple Small Interfering RNAs

PubMed Central

Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Se-Kyung; You, Su-Hwa; Kim, Taeseong; Tark, Dongseob; Lee, Hyang-Sim; Seo, Min-Goo; Kim, Byounghan

2015-01-01

ABSTRACT Because the currently available vaccines against foot-and-mouth disease (FMD) provide no protection until 4 to 7 days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is the application of antiviral agents. Combination treatment strategies have been used to enhance the efficacy of antiviral agents, and such strategies may be advantageous in overcoming viral mechanisms of resistance to antiviral treatments. We have developed recombinant adenoviruses (Ads) for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) targeting FMDV mRNAs encoding nonstructural proteins. The antiviral effects of Ad-porcine IFN-αγ and Ad-3siRNA expression were tested in combination in porcine cells, suckling mice, and swine. We observed enhanced antiviral effects in porcine cells and mice as well as robust protection against the highly pathogenic strain O/Andong/SKR/2010 and increased expression of cytokines in swine following combination treatment. In addition, we showed that combination treatment was effective against all serotypes of FMDV. Therefore, we suggest that the combined treatment with Ad-porcine IFN-αγ and Ad-3siRNA may offer fast-acting antiviral protection and be used with a vaccine during the period that the vaccine does not provide protection against FMD. IMPORTANCE The use of current foot-and-mouth disease (FMD) vaccines to induce rapid protection provides limited effectiveness because the protection does not become effective until a minimum of 4 days after vaccination. Therefore, during outbreaks antiviral agents remain the only available treatment to confer rapid protection and reduce the spread of foot-and-mouth disease virus (FMDV) in livestock until vaccine-induced protective immunity can become effective. Interferons (IFNs) and small interfering RNAs (siRNAs) have been reported to be effective antiviral agents against

CXCR6 promotes atherosclerosis by supporting T-cell homing, interferon-gamma production, and macrophage accumulation in the aortic wall.

PubMed

Galkina, Elena; Harry, Brian L; Ludwig, Andreas; Liehn, Elisa A; Sanders, John M; Bruce, Anthony; Weber, Christian; Ley, Klaus

2007-10-16

T lymphocytes are thought to be important in atherosclerosis, but very little is known about the mechanisms of lymphocyte recruitment into atherosclerosis-prone aortas. In this study we tested the hypothesis that CXCR6, a chemokine receptor that is expressed on a subset of CD4+ T helper 1 cells and natural killer T cells, is involved in lymphocyte homing into the aortic wall and modulates the development and progression of atherosclerosis. To investigate the role of CXCR6 in the development and progression of atherosclerosis, we bred CXCR6-deficient (CXCR6(GFP/GFP)) mice with apolipoprotein E-deficient (ApoE(-/-)) mice. We found that CXCR6(GFP/GFP)/ApoE(-/-) mice fed a Western diet for 17 weeks or a chow diet for 56 weeks had decreased atherosclerosis compared with ApoE(-/-) controls. Flow cytometry analysis of the aortas from CXCR6(GFP/GFP)/ApoE(-/-) mice showed that the reduction of atherosclerosis was accompanied by a decreased percentage of CXCR6+ T cells within the aortas. Short-term homing experiments demonstrated that CXCR6 is involved in the recruitment of CXCR6+ leukocytes into the atherosclerosis-prone aortic wall. The reduced percentage of CXCR6+ T cells within the aortas resulted in significantly diminished production of interferon-gamma and reduction of CD11b+/CD68+ macrophages in the aorta. These data provide evidence for a proatherosclerotic role of CXCR6. Absence of CXCR6 alters the recruitment of CXCR6+ leukocytes and modulates the local immune response within the aortic wall.

Allocation of Interferon Gamma mRNA Positive Cells in Caecum Hallmarks a Protective Trait Against Histomonosis.

PubMed

Kidane, Fana Alem; Mitra, Taniya; Wernsdorf, Patricia; Hess, Michael; Liebhart, Dieter

2018-01-01

Histomonosis is a parasitic disease of gallinaceous birds characterized by necrotic lesions in cacum and liver that usually turns fatal in turkeys while it is less severe in chickens. Vaccination using in vitro attenuated Histomonas meleagridis has been experimentally shown to confer protection against histomonosis. The protective mechanisms that underpin the vaccine-induced immune response are not resolved so far. Therefore, the actual study aimed to evaluate the location and quantitative distribution patterns of signature cytokines of type 1 [interferon gamma (IFN-γ)] or type 2 [interleukin (IL)-13] immune responses in vaccinated or infected hosts. An intergroup and interspecies difference in the spatial and temporal distribution patterns of cytokine mRNA positive cells was evident. Quantification of cells showed a significantly decreased percentage of IFN-γ mRNA positive cells at 4 days post-inoculation (DPI) in caeca of turkeys inoculated exclusively with the attenuated or the virulent inocula, compared to control birds. The decrement was followed by a surge of cells expressing mRNA for IFN-γ or IL-13, reaching a peak of increment at 10 DPI. By contrast, turkeys challenged following vaccination showed a slight increment of cecal IFN-γ mRNA positive cells at 4 DPI after which positive cell counts became comparable to control birds. The increase in infected birds was accompanied by an extensive distribution of positively stained cells up to the muscularis layer of cecal tissue whereas the vaccine group maintained an intact mucosal structure. In chickens, the level of changes of positive cells was generally lower compared to turkeys. However, control chickens were found with a higher percentage of IFN-γ mRNA positive cells in cecum compared to their turkey counterparts indicating a higher resistance to histomonosis, similar to the observation in immunized turkeys. In chickens, it could be shown that the changes of cytokine-positive cells were related to

Interferon-gamma and interlukin-4 patterns in BALB/c mice suffering from cutaneous leishmaniasis treated with cantharidin.

PubMed

Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

2014-06-01

Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. INFECTED BALB/C MICE WERE DIVIDED INTO FIVE GROUPS AS: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth.

Interferon-Gamma and Interlukin-4 Patterns in BALB/c Mice Suffering From Cutaneous Leishmaniasis Treated With Cantharidin

PubMed Central

Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

2014-01-01

Background: Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. Objectives: The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. Materials and Methods: Infected BALB/c mice were divided into five groups as: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. Results: The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. Conclusions: The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth. PMID:25371808

Induction of interferon-gamma and downstream pathways during establishment of fetal persistent infection with bovine viral diarrhea virus.

PubMed

Smirnova, Natalia P; Webb, Brett T; McGill, Jodi L; Schaut, Robert G; Bielefeldt-Ohmann, Helle; Van Campen, Hana; Sacco, Randy E; Hansen, Thomas R

2014-04-01

Development of transplacental infection depends on the ability of the virus to cross the placenta and replicate within the fetus while counteracting maternal and fetal immune responses. Unfortunately, little is known about this complex process. Non-cytopathic (ncp) strains of bovine viral diarrhea virus (BVDV), a pestivirus in the Flaviviridae family, cause persistent infection in early gestational fetuses (<150 days; persistently infected, PI), but are cleared by immunocompetent animals and late gestational fetuses (>150 days; transiently infected, TI). Evasion of innate immune response and development of immunotolerance to ncp BVDV have been suggested as possible mechanisms for the establishment of the persistent infection. Previously we have observed a robust temporal induction of interferon (IFN) type I (innate immune response) and upregulation of IFN stimulated genes (ISGs) in BVDV TI fetuses. Modest chronic upregulation of ISGs in PI fetuses and calves reflects a stimulated innate immune response during persistent BVDV infection. We hypothesized that establishing persistent fetal BVDV infection is also accompanied by the induction of IFN-gamma (IFN-γ). The aims of the present study were to determine IFN-γ concentration in blood and amniotic fluid from control, TI and PI fetuses during BVDV infection and analyze induction of the IFN-γ downstream pathways in fetal lymphoid tissues. Two experiments with in vivo BVDV infections were completed. In Experiment 1, pregnant heifers were infected with ncp BVDV type 2 on day 75 or 175 of gestation or kept naïve to generate PI, TI and control fetuses, respectively. Fetuses were collected by Cesarean section on day 190. In Experiment 2, fetuses were collected on days 82, 89, 97, 192 and 245 following infection of pregnant heifers on day 75 of gestation. The results were consistent with the hypothesis that ncp BVDV infection induces IFN-γ secretion during acute infection in both TI and PI fetuses and that lymphoid

Added value of interferon-gamma release assays in screening for tuberculous infection in the Netherlands.

PubMed

Erkens, C G M; Dinmohamed, A G; Kamphorst, M; Toumanian, S; van Nispen-Dobrescu, R; Alink, M; Oudshoorn, N; Mensen, M; van den Hof, S; Borgdorff, M; Verver, S

2014-04-01

Interferon-gamma release assays (IGRAs) are reported to be more specific for the diagnosis of latent tuberculous infection (LTBI) than the tuberculin skin test (TST). The two-step procedure, TST followed by an IGRA, is reported to be cost-effective in high-income countries, but it requires more financial resources. To assess the added value of IGRA compared to TST alone in the Netherlands. Test results and background data on persons tested with an IGRA were recorded by the Public Municipal Health Services in a web-based database. The number of persons diagnosed with LTBI using different screening algorithms was calculated. In those tested with an IGRA, at least 60% of persons who would have been diagnosed with LTBI based on TST alone had a negative IGRA. Among those with a TST reaction below the cut-off for the diagnosis of LTBI, 13% had a positive IGRA. For 41% of persons tested with an IGRA after TST, the IGRA influenced whether or not an LTBI diagnosis would be made. With the IGRA as reference standard, a high proportion of persons in low-prevalence settings are treated unnecessarily for LTBI if tested with TST alone, while a small proportion eligible for preventive treatment are missed. Incremental costs of the two-step strategy seem to be balanced by the improved targeting of preventive treatment.

Stimulated peripheral production of interferon-gamma is related to fatigue and depression in multiple sclerosis.

PubMed

Pokryszko-Dragan, A; Frydecka, I; Kosmaczewska, A; Ciszak, L; Bilińska, M; Gruszka, E; Podemski, R; Frydecka, D

2012-10-01

The aim of the study was to evaluate the stimulated production of interferon-gamma (IFNγ) by peripheral CD3+CD4+ T lymphocytes in patients with multiple sclerosis (MS) with regard to the degree of fatigue, and to investigate relationships between immunological parameters, level of depression and clinical variables. Forty MS patients (30 women, 10 men, aged 22-60 years): 20 fatigued and 20 non-fatigued were involved in the study. Fatigue was evaluated using the Fatigue Severity Scale (FSS) and Modified Fatigue Impact Scale (MFIS), depression level - using Beck Depression Inventory (BDI). Production of IFNγ by stimulated peripheral blood CD3+CD4+ T lymphocytes, assessed using flow cytometry, was compared between MS patients with different levels of fatigue and controls. Correlations were searched out between immunological findings and BDI, age, duration and course of MS, relapse rate, disability (assessed in Expanded Disability Status Scale - EDSS) and its progression. Stimulated production of IFNγ by CD3+CD4+ T lymphocytes was higher in severely fatigued patients in comparison with non-fatigued ones and controls, tended to correlate with FSS and MFIS, and correlated with BDI. No relationships were found between immunological findings and disease-related variables. Stimulated production of IFNγ by peripheral CD3+CD4+ T lymphocytes is related to fatigue and depression in MS patients. Copyright © 2012 Elsevier B.V. All rights reserved.

Tuberculin Skin Tests versus Interferon-Gamma Release Assays in Tuberculosis Screening among Immigrant Visa Applicants

PubMed Central

Chuke, Stella O.; Yen, Nguyen Thi Ngoc; Laserson, Kayla F.; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G.; Whitworth, William C.; Shah, J. Jina; Painter, John A.; Mazurek, Gerald H.; Maloney, Susan A.

2014-01-01

Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB. PMID:24738031

Reversal in fatigued athletes of a defect in interferon gamma secretion after administration of Lactobacillus acidophilus.

PubMed

Clancy, R L; Gleeson, M; Cox, A; Callister, R; Dorrington, M; D'Este, C; Pang, G; Pyne, D; Fricker, P; Henriksson, A

2006-04-01

Fatigue and impaired performance in athletes is well recognised and has been loosely linked to "overtraining". Reduced concentration of IgA in the saliva and increased shedding of Epstein Barr virus (EBV) have been associated with intense training in elite athletes. To determine whether athletes presenting with fatigue and impaired performance had an immune defect relevant to defective containment of EBV infection, and whether a probiotic preparation (Lactobacillus acidophilus) shown to enhance mucosal immunity in animal models could reverse any detected abnormality. The fatigued athletes had clinical characteristics consistent with re-activation of EBV infection and significantly (p = 0.02) less secretion of interferon (IFN) gamma from blood CD4 positive T cells. After one month of daily capsules containing 2 x 10(10) colony forming units of L acidophilus, secretion of IFNgamma from T cells had increased significantly (p = 0.01) to levels found in healthy control athletes. A significant (p = 0.03) increase in salivary IFNgamma concentrations in healthy control athletes after the one month course of L acidophilus demonstrated in man the capacity for this probiotic to enhance the mucosal IFNgamma concentration. This is the first evidence of a T cell defect in fatigued athletes, and of its reversal following probiotic therapy.

The interferon response circuit in antiviral host defense.

PubMed

Haller, O; Weber, F

2009-01-01

Viruses have learned to multiply in the face of a powerful innate and adaptive immune response of the host. They have evolved multiple strategies to evade the interferon (IFN) system which would otherwise limit virus growth at an early stage of infection. IFNs induce the synthesis of a range of antiviral proteins which serve as cell-autonomous intrinsic restriction factors. For example, the dynamin-like MxA GTPase inhibits the multiplication of influenza and bunyaviruses (such as La Crosse virus, Hantaan virus, Rift Valley Fever virus, and Crimean-Congo hemorrhagic fever virus) by binding and sequestering the nucleocapsid protein into large perinuclear complexes. To overcome such intracellular restrictions, virulent viruses either inhibit IFN synthesis, bind and inactivate secreted IFN molecules, block IFN-activated signaling, or disturb the action of IFN-induced antiviral proteins. Many viruses produce specialized proteins to disarm the danger signal or express virulence genes that target members of the IFN regulatory factor family (IRFs) or components of the JAK-STAT signaling pathway. An alternative evasion strategy is based on extreme viral replication speed which out-competes the IFN response. The identification of viral proteins with IFN antagonistic functions has great implications for disease prevention and therapy. Virus mutants lacking IFN antagonistic properties represent safe yet highly immunogenic candidate vaccines. Furthermore, novel drugs intercepting viral IFN-antagonists could be used to disarm the viral intruders.

Cytokine polymorphisms have a synergistic effect on severity of the acute sickness response to infection.

PubMed

Vollmer-Conna, Uté; Piraino, Barbara F; Cameron, Barbara; Davenport, Tracey; Hickie, Ian; Wakefield, Denis; Lloyd, Andrew R

2008-12-01

Functional polymorphisms in immune response genes are increasingly recognized as important contributors to the marked individual differences in susceptibility to and outcomes of infectious disease. The acute sickness response is a stereotypical set of illness manifestations mediated by the proinflammatory cytokines induced by many different pathogens. The genetic determinants of severity of the acute sickness response have not previously been explored. We examined the impact of functional polymorphisms in cytokine genes with critical roles in the early immune response (tumor necrosis factor-alpha, interleukin-6, interleukin-10, and interferon-gamma) on the severity and duration of illness following acute infection with Epstein-Barr virus, Coxiella burnetii (the causative agent of Q fever), or Ross River virus. We found that the interferon-gamma +874T/A and the interleukin-10 -592C/A polymorphisms significantly affected illness severity, cytokine protein levels, and the duration of illness. These cytokine genotypes acted in synergy to potentiate their influence on disease outcomes. These findings suggest that genetically determined variations in the intensity of the inflammatory response underpin the severity of the acute sickness response and predict the recovery time across varied infections.

Plasmacytoid dendritic cells and type I interferon in the immunological response against warts.

PubMed

Saadeh, D; Kurban, M; Abbas, O

2017-12-01

Plasmacytoid dendritic cells (pDCs) are the most potent producers of type I interferons (IFNs), and are involved in the pathogenesis of several cutaneous infectious (especially viral), inflammatory/autoimmune and neoplastic entities. Their role in the pathogenesis and regression of human papilloma virus (HPV)-induced skin lesions has not been well studied. To investigate pDC occurrence and activity in HPV-induced skin lesions, including inflamed and uninflamed warts as well as epidermodysplasia verruciformis (EDV)-associated lesions. In total 20 inflamed and 20 uninflamed HPV-induced skin lesions (including 7 EDV lesions) were retrieved from our database, and the tissue was immunohistochemically tested for pDC occurrence and activity using anti-BDCA-2 and anti-MxA antibodies, respectively. pDCs were present in all 20 inflamed warts and absent from all 20 uninflamed cases. MxA expression was also diffuse and strong in 75% (15/20) inflamed warts, but not in any of the uninflamed warts. pDCs constitute a central component of the inflammatory host response in inflamed warts, possibly contributing to their regression through production of type I interferons. © 2017 British Association of Dermatologists.

Viral evasion of DNA-stimulated innate immune responses

PubMed Central

Christensen, Maria H; Paludan, Søren R

2017-01-01

Cellular sensing of virus-derived nucleic acids is essential for early defenses against virus infections. In recent years, the discovery of DNA sensing proteins, including cyclic GMP–AMP synthase (cGAS) and gamma-interferon-inducible protein (IFI16), has led to understanding of how cells evoke strong innate immune responses against incoming pathogens carrying DNA genomes. The signaling stimulated by DNA sensors depends on the adaptor protein STING (stimulator of interferon genes), to enable expression of antiviral proteins, including type I interferon. To facilitate efficient infections, viruses have evolved a wide range of evasion strategies, targeting host DNA sensors, adaptor proteins and transcription factors. In this review, the current literature on virus-induced activation of the STING pathway is presented and we discuss recently identified viral evasion mechanisms targeting different steps in this antiviral pathway. PMID:26972769

How Does Vaccinia Virus Interfere With Interferon?

PubMed

Smith, Geoffrey L; Talbot-Cooper, Callum; Lu, Yongxu

2018-01-01

Interferons (IFNs) are secreted glycoproteins that are produced by cells in response to virus infection and other stimuli and induce an antiviral state in cells bearing IFN receptors. In this way, IFNs restrict virus replication and spread before an adaptive immune response is developed. Viruses are very sensitive to the effects of IFNs and consequently have evolved many strategies to interfere with interferon. This is particularly well illustrated by poxviruses, which have large dsDNA genomes and encode hundreds of proteins. Vaccinia virus is the prototypic poxvirus and expresses many proteins that interfere with IFN and are considered in this review. These proteins act either inside or outside the cell and within the cytoplasm or nucleus. They function by restricting the production of IFN by blocking the signaling pathways leading to transcription of IFN genes, stopping IFNs binding to their receptors, blocking IFN-induced signal transduction leading to expression of interferon-stimulated genes (ISGs), or inhibiting the antiviral activity of ISG products. © 2018 Elsevier Inc. All rights reserved.

Enhanced antitumor reactivity of tumor-sensitized T cells by interferon alfa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vander Woude, D.L.; Wagner, P.D.; Shu, S.

Tumor-draining lymph node cells from mice bearing the methylcholanthrene-induced MCA 106 tumors can be sensitized in vitro to acquire antitumor reactivity. We examined the effect of interferon alfa on the function of cells that underwent in vitro sensitization in adoptive immunotherapy. Interferon alfa increased the antitumor reactivity of in vitro sensitized cells in the treatment of MCA 106 pulmonary metastases. This effect was evident in irradiated mice, indicating that a host response to the interferon alfa was not required. Interferon alfa treatment increased class I major histocompatibility complex antigen expression on tumor cells and increased their susceptibility to lysis bymore » in vitro sensitized cells. These results suggest that interferon alfa enhancement of adoptive immunotherapy was mediated by its effect on tumor cells. Interferon alfa may be a useful adjunct to the adoptive immunotherapy of human cancer.« less

A randomized, double-blind, phase I/II trial of tumor necrosis factor and interferon-gamma for treatment of AIDS-related complex (Protocol 025 from the AIDS Clinical Trials Group).

PubMed

Agosti, J M; Coombs, R W; Collier, A C; Paradise, M A; Benedetti, J K; Jaffe, H S; Corey, L

1992-05-01

To determine safety and efficacy of tumor necrosis factor (TNF) and interferon-gamma (IFN gamma) in the treatment of patients with acquired immunodeficiency syndrome (AIDS)-related complex, a randomized, double-blind study was conducted. Twenty-five patients with AIDS-related complex and CD4 lymphocytes less than or equal to 500 x 10(6)/L attended an AIDS Clinical Trials Unit of a tertiary referral center. Patients were administered tumor necrosis factor (TNF) (10 micrograms/m2) or IFN gamma (10 micrograms/m2), or both intramuscularly three times weekly for 16 weeks. Side effects from all three preparations included fever, constitutional symptoms, and local reactions. No significant hematologic, hepatic, renal, or coagulation abnormalities were observed. CD4 lymphocyte counts, beta 2-microglobulin, p24 antigen levels, and anti-p24 antibody did not change significantly during therapy. Similarly, no significant change was noted in rates of HIV isolation from peripheral blood mononuclear cells or plasma. TNF and IFN gamma were tolerable after premedication with acetaminophen; however, no significant change in markers of human immunodeficiency virus infection was demonstrated. These cytokines alone do not appear to be of benefit, nor do they appear to hasten the progression of HIV infection.

Effect of statins on clinical and molecular responses to intramuscular interferon beta-1a.

PubMed

Rudick, R A; Pace, A; Rani, M R S; Hyde, R; Panzara, M; Appachi, S; Shrock, J; Maurer, S L; Calabresi, P A; Confavreux, C; Galetta, S L; Lublin, F D; Radue, E-W; Ransohoff, R M

2009-06-09

Findings from a small clinical study suggested that statins may counteract the therapeutic effects of interferon beta (IFNbeta) in patients with relapsing-remitting multiple sclerosis (RRMS). We conducted a post hoc analysis of data from the Safety and Efficacy of Natalizumab in Combination With IFNbeta-1a in Patients With Relapsing-Remitting Multiple Sclerosis (SENTINEL) study to determine the effects of statins on efficacy of IFNbeta. SENTINEL was a prospective trial of patients with RRMS treated with natalizumab (Tysabri, Biogen Idec, Inc., Cambridge, MA) plus IM IFNbeta-1a (Avonex, Biogen Idec, Inc.) 30 microg compared with placebo plus IM IFNbeta-1a 30 microg. Clinical and MRI outcomes in patients treated with IM IFNbeta-1a only (no-statins group, n = 542) were compared with those of patients taking IM IFNbeta-1a and statins at doses used to treat hyperlipidemia (statins group, n = 40). No significant differences were observed between treatment groups in adjusted annualized relapse rate (p = 0.937), disability progression (p = 0.438), number of gadolinium-enhancing lesions (p = 0.604), or number of new or enlarging T2-hyperintense lesions (p = 0.802) at 2 years. More patients in the statins group reported fatigue, extremity pain, muscle aches, and increases in hepatic transaminases compared with patients in the no-statins group. Statin treatment had no ex vivo or in vitro effect on induction of IFN-stimulated genes. Statin therapy does not appear to affect clinical effects of IM interferon beta-1a in patients with relapsing-remitting multiple sclerosis or the primary molecular response to interferon beta treatment.

The brain parenchyma has a type I interferon response that can limit virus spread.

PubMed

Drokhlyansky, Eugene; Göz Aytürk, Didem; Soh, Timothy K; Chrenek, Ryan; O'Loughlin, Elaine; Madore, Charlotte; Butovsky, Oleg; Cepko, Constance L

2017-01-03

The brain has a tightly regulated environment that protects neurons and limits inflammation, designated "immune privilege." However, there is not an absolute lack of an immune response. We tested the ability of the brain to initiate an innate immune response to a virus, which was directly injected into the brain parenchyma, and to determine whether this response could limit viral spread. We injected vesicular stomatitis virus (VSV), a transsynaptic tracer, or naturally occurring VSV-derived defective interfering particles (DIPs), into the caudate-putamen (CP) and scored for an innate immune response and inhibition of virus spread. We found that the brain parenchyma has a functional type I interferon (IFN) response that can limit VSV spread at both the inoculation site and among synaptically connected neurons. Furthermore, we characterized the response of microglia to VSV infection and found that infected microglia produced type I IFN and uninfected microglia induced an innate immune response following virus injection.

Retinoid X receptor α attenuates host antiviral response by suppressing type I interferon

PubMed Central

Ma, Feng; Liu, Su-Yang; Razani, Bahram; Arora, Neda; Li, Bing; Kagechika, Hiroyuki; Tontonoz, Peter; Núñez, Vanessa; Ricote, Mercedes; Cheng, Genhong

2015-01-01

The retinoid X receptor α (RXRα), a key nuclear receptor in metabolic processes, is down-regulated during host antiviral response. However, the roles of RXRα in host antiviral response are unknown. Here we show that RXRα overexpression or ligand activation increases host susceptibility to viral infections in vitro and in vivo, while Rxra −/− or antagonist treatment reduces infection by the same viruses. Consistent with these functional studies, ligand activation of RXR inhibits the expression of antiviral genes including type I interferon (IFN) and Rxra −/− macrophages produce more IFNβ than WT macrophages in response to polyI:C stimulation. Further results indicate that ligand activation of RXR suppresses the nuclear translocation of β-catenin, a co-activator of IFNβ enhanceosome. Thus, our studies have uncovered a novel RXR-dependent innate immune regulatory pathway, suggesting that the downregulation of RXR expression or RXR antagonist treatment benefits host antiviral response, whereas RXR agonist treatment may increase the risk of viral infections. PMID:25417649

Inhibition of Microprocessor Function during the Activation of the Type I Interferon Response.

PubMed

Witteveldt, Jeroen; Ivens, Alasdair; Macias, Sara

2018-06-12

Type I interferons (IFNs) are central components of the antiviral response. Most cell types respond to viral infections by secreting IFNs, but the mechanisms that regulate correct expression of these cytokines are not completely understood. Here, we show that activation of the type I IFN response regulates the expression of miRNAs in a post-transcriptional manner. Activation of IFN expression alters the binding of the Microprocessor complex to pri-miRNAs, reducing its processing rate and thus leading to decreased levels of a subset of mature miRNAs in an IRF3-dependent manner. The rescue of Microprocessor function during the antiviral response downregulates the levels of IFN-β and IFN-stimulated genes. All these findings support a model by which the inhibition of Microprocessor activity is an essential step to induce a robust type I IFN response in mammalian cells. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Expression of interferon-gamma and tumour necrosis factor-alpha messenger RNA does not correlate with protection in guinea pigs challenged with virulent Mycobacterium tuberculosis by the respiratory route.

PubMed

Jeevan, Amminikutty; Bonilla, Diana Lucia; McMurray, David Neil

2009-09-01

Cytokine messenger RNA (mRNA) expression was investigated in the spleen and lung digest cells of bacillus Calmette-Guérin (BCG)-vaccinated and non-vaccinated guinea pigs following low-dose, pulmonary exposure to virulent Mycobacterium tuberculosis. After purified protein derivative (PPD) stimulation, the levels of lung cell interferon-gamma (IFN-gamma), tumour necrosis factor-alpha (TNF-alpha) and spleen cell interleukin-12 (IL-12) p40 mRNAs were significantly increased in the non-vaccinated M. tuberculosis-infected guinea pigs compared to the BCG-vaccinated guinea pigs. In contrast, the expression of anti-inflammatory transforming growth factor-beta and IL-10 mRNAs was significantly enhanced in the spleens of BCG-vaccinated animals. Despite the presence of protective cytokine mRNA expression, the non-vaccinated guinea pigs had significantly higher lung and spleen bacterial burdens. In contrast, BCG-vaccinated guinea pigs controlled the bacterial multiplication in their lungs and spleens, indicating that both protective as well as anti-inflammatory cytokine responses are associated with a reduction in bacteria. In addition, lung digest cells from non-vaccinated guinea pigs contained a significantly higher percentage of neutrophils, CD3(+) and CD8(+) T cells, while the percentage of macrophages was increased in the BCG-vaccinated animals. Total and purified lung digest T cells co-cultured with lung macrophages (LMøs) proliferated poorly after PPD stimulation in both non-vaccinated and BCG-vaccinated animals while robust proliferation to PPD was observed when T cells were co-cultured with peritoneal macrophages (PMøs). Macrophages within the lung compartment appear to regulate the response of T cells irrespective of the vaccination status in guinea pigs. Taken together, our results suggest that type I cytokine mRNA expression is not associated with vaccine-induced protection in the low-dose guinea pig model of tuberculosis.

A comparison of mucosal inflammatory responses to Giardia muris in resistant B10 and susceptible BALB/c mice.

PubMed

Venkatesan, P; Finch, R G; Wakelin, D

1997-03-01

In the first three weeks of primary Giardia muris infections B10 mice clear infection more rapidly than BALB/c mice. There is evidence that interferon-gamma contributes to the relative resistance of B10 mice. The nature of the functional contribution of interferon-gamma is unclear and does not relate to the secretory or serum antibody response. Mucosal inflammatory events in these strains have been studied. Apart from a small rise in both strains of goblet cell and mucosal mast cell numbers, associated with release of mast cell protease-1 in serum, no inflammatory infiltrate was observed at the time trophozoites were cleared from the intestinal lumen. Inhibition of mast cell products (5-hydroxytryptamine and histamine) by cyproheptadine enhanced the intensity of infection in both strains. The relative resistance of B10 mice could not be explained in terms of the mucosal inflammatory response.

Assessing response to interferon-β in a multicenter dataset of patients with MS.

PubMed

Sormani, Maria Pia; Gasperini, Claudio; Romeo, Marzia; Rio, Jordi; Calabrese, Massimiliano; Cocco, Eleonora; Enzingher, Christian; Fazekas, Franz; Filippi, Massimo; Gallo, Antonio; Kappos, Ludwig; Marrosu, Maria Giovanna; Martinelli, Vittorio; Prosperini, Luca; Rocca, Maria Assunta; Rovira, Alex; Sprenger, Till; Stromillo, Maria Laura; Tedeschi, Gioacchino; Tintorè, Mar; Tortorella, Carla; Trojano, Maria; Montalban, Xavier; Pozzilli, Carlo; Comi, Giancarlo; De Stefano, Nicola

2016-07-12

To provide new insights into the role of markers of response to interferon-β therapy in multiple sclerosis (MS) in a multicenter setting, focusing on the relevance of MRI lesions in combination with clinical variables. A large multicenter clinical dataset was collected within the Magnetic Resonance Imaging in MS (MAGNIMS) network. This included a large cohort of patients with relapsing-remitting MS on interferon-β treatment, MRI and clinical assessments during the first year of treatment, and clinical follow-up of at least 2 additional years. Heterogeneity among centers was assessed before pooling the data. The association of 1-year MRI or clinical relapses with the risk of treatment failure (defined as Expanded Disability Status Scale [EDSS] worsening or treatment switch for inefficacy) and of EDSS worsening alone was evaluated using multivariate Cox models. A pooled dataset of 1,280 patients with relapsing-remitting MS from 9 MAGNIMS centers was analyzed. The risk of failure had a relevant increase with 1 relapse (hazard ratio [HR] 1.84, 95% confidence interval [CI] 1.39-2.44, p < 0.001) and ≥3 new T2 lesions (HR 1.55, 95% CI 0.92-2.60, p = 0.09). In patients without relapses and less than 3 new T2 lesions, the 3-year risk of failure and EDSS worsening were 17% and 15%; in patients with 1 relapse or ≥3 new T2 lesions, the risks were 27% and 22%; in patients with both conditions or more than 1 relapse, the risks were 48% (p < 0.001) and 29% (p < 0.001). Substantial MRI activity, particularly if in combination with clinical relapses, during the first year of treatment with interferon-β indicates significant risk of treatment failure and EDSS worsening in the short term. © 2016 American Academy of Neurology.

Interactions of the interferon system with cellular metabolism

NASA Technical Reports Server (NTRS)

Sonnenfeld, Gerald

1986-01-01

The results of studies concerning the interaction of the interferon (Inf) system with the activities of carcinogens, tumor promoters, and cytochrome P-450 are presented. The results show that the addition of a tumor promoter (TPA or 4-O-methyl-TPA) to a tissue culture enhances virus-induced Inf-gamma production, suggesting a potential value of tumor promoters in the biosynthesis of commercial Inf. On the other hand, the carcinogens were reported to inhibit the induction of Inf-alpha/beta in cultured cells and in intact animals (with no effect on the administered or preformed Inf). The demonstration of a correlation between the carcinogenic potential of a compound and its inhibitive effect on Inf production suggests a possible use of the Inf production assay in the evaluation of the carcinogenicity of chemicals. In addition, it was shown that the induction of Inf-alpha/beta as well as the administration of this Inf depresses the levels of rat liver cytochrome P-450 which is responsible for binding lipophilic drugs, steroids, and carcinogens, thus increasing the toxicity of the respective chemical.

Regulation by interferon alpha of immunoglobulin isotype selection and lymphokine production in mice

PubMed Central

1991-01-01

Antigens and infectious agents that stimulate interferon alpha(IFN- alpha) production in mice induce antibody responses that are predominantly of the immunoglobulin (Ig)G2a isotype and contain little or no IgE. This suggested the possibility that IFN-alpha might have a role in directing Ig isotype selection. Consistent with this possibility, we have found that injection of mice with recombinant mouse IFN-alpha suppresses IgE secretion, enhances IgG2a secretion, and has no independent effect on IgG1 secretion in mice stimulated with a foreign anti-IgD antibody. Injection of mice with polyinosinic acid.polycytidylic acid (poly I.C), an inducer of macrophage IFN-alpha production, also suppresses the anti-IgD antibody-induced IgE response and stimulates the IgG2a response; these effects are blocked by a sheep antibody that neutralizes mouse IFN-alpha/beta. Both recombinant IFN- alpha and poly I.C have maximum IgE suppressive and IgG2a stimulatory effects when injected early in the anti-IgD antibody-induced immune response. Addition of IFN-alpha to mouse B cells cultured with lipopolysaccharide (LPS) + interleukin 4 (IL-4) suppresses both IgG1 and IgE production, but much less potently than IFN-gamma. IFN-alpha suppresses anti-IgD antibody-induced increases in the level of splenic IL-4 mRNA, but enhances the anti-IgD antibody-induced increase in the splenic level of IFN-gamma mRNA. These results are consistent with the effect of IFN-alpha on Ig isotype expression in mice, as IL-4 stimulates IgE and suppresses IgG2a secretion while IFN-gamma exerts opposite effects. These observations suggest that antigen presenting cells, by secreting IFN-alpha early in the course of an immune response, can influence the nature of that response both through direct effects on B cells and by influencing the differentiation of T cells. PMID:1940796

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Features of Postoperative Immune Suppression Are Reversible With Interferon Gamma and Independent of Interleukin-6 Pathways.

PubMed

Longbottom, E Rebecca; Torrance, Hew D T; Owen, Helen C; Fragkou, Paraskevi C; Hinds, Charles J; Pearse, Rupert M; O'Dwyer, Michael J

2016-08-01

The aim of this study was to evaluate the role of interleukin (IL)-6 pathways in postoperative immune suppression and to assess the reversibility of this phenomenon. The postoperative period is characterized by increased IL-6 production and features of immune suppression. In vitro, IL-6 mediates anti-inflammatory effects through inhibition of interferon gamma (IFN-γ) pathways. The significance of the immunomodulatory effects of IL-6 in the clinical setting of postoperative immune suppression remains unclear. Patients over 45 years old undergoing elective surgery, involving the gastrointestinal tract, were recruited. IL-6 levels were assayed using an enzyme linked immunosorbent assay preoperatively, and at 24 and 48 hours. Peripheral blood mononuclear cells from healthy volunteers were cultured in perioperative serum and CD14Human Leukocyte Antigen-DR (HLA-DR) [monocyte HLA-DR (mHLA-DR)] geometric mean florescent intensity was measured in the presence and absence of IL-6 neutralizing antibody and recombinant IFN-γ. Of the 108 patients, 41 developed a postoperative infection. The IL-6 levels increased 19-fold from the preoperative sample to 24 hours postoperatively (P < 0.0001). Higher IL-6 levels at 24 (P = 0.0002) and 48 hours (P = 0.003) were associated with subsequent postoperative infectious complications. mHLA-DR mean florescent intensity fell when healthy peripheral blood mononuclear cells were cultured with postoperative serum compared with preoperative serum (P = 0.008). This decrease was prevented by the presence of IFN-γ in the culture media, but not by the presence of IL-6-neutralizing antibody. IL-6 levels increase after a major surgery and are associated with an increased susceptibility to postoperative infections. Serum obtained from postoperative patients induces an immunosuppressive response, reflected in reduced mHLA-DR levels, mediated through IL-6 independent pathways and is reversible with IFN-γ. These data may have

Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.

PubMed

Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K

2005-01-20

Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.

Antigen-Specific Interferon-Gamma Responses and Innate Cytokine Balance in TB-IRIS

PubMed Central

Goovaerts, Odin; Jennes, Wim; Massinga-Loembé, Marguerite; Ceulemans, Ann; Worodria, William; Mayanja-Kizza, Harriet; Colebunders, Robert; Kestens, Luc

2014-01-01

Background Tuberculosis-associated immune reconstitution inflammatory syndrome (TB-IRIS) remains a poorly understood complication in HIV-TB patients receiving antiretroviral therapy (ART). TB-IRIS could be associated with an exaggerated immune response to TB-antigens. We compared the recovery of IFNγ responses to recall and TB-antigens and explored in vitro innate cytokine production in TB-IRIS patients. Methods In a prospective cohort study of HIV-TB co-infected patients treated for TB before ART initiation, we compared 18 patients who developed TB-IRIS with 18 non-IRIS controls matched for age, sex and CD4 count. We analyzed IFNγ ELISpot responses to CMV, influenza, TB and LPS before ART and during TB-IRIS. CMV and LPS stimulated ELISpot supernatants were subsequently evaluated for production of IL-12p70, IL-6, TNFα and IL-10 by Luminex. Results Before ART, all responses were similar between TB-IRIS patients and non-IRIS controls. During TB-IRIS, IFNγ responses to TB and influenza antigens were comparable between TB-IRIS patients and non-IRIS controls, but responses to CMV and LPS remained significantly lower in TB-IRIS patients. Production of innate cytokines was similar between TB-IRIS patients and non-IRIS controls. However, upon LPS stimulation, IL-6/IL-10 and TNFα/IL-10 ratios were increased in TB-IRIS patients compared to non-IRIS controls. Conclusion TB-IRIS patients did not display excessive IFNγ responses to TB-antigens. In contrast, the reconstitution of CMV and LPS responses was delayed in the TB-IRIS group. For LPS, this was linked with a pro-inflammatory shift in the innate cytokine balance. These data are in support of a prominent role of the innate immune system in TB-IRIS. PMID:25415590

Tuberculosis screening of new hospital employees: compliance, clearance to work time, and cost using tuberculin skin test and interferon-gamma release assays.

PubMed

Foster-Chang, Sarah A; Manning, Mary L; Chandler, Laura

2014-11-01

Selection of the most suitable test(s) for detection of Mycobacterium tuberculosis (TB) infection should be based on purpose, setting, effectiveness, and cost. Two tests are available to screen for latent TB: the tuberculin skin test (TST) and the more recent interferon-gamma release assays (IGRAs). Based on the administrative, logistic, and technical ease of use, an IGRA trial was initiated by the occupational health department at an urban Veteran's Administration health care facility for TB screening of new employees. As a result, new employees completing the pre-placement process within the organization's designated 14 days increased from 77% to 97%, new employee clearance to work time decreased from 13.18 to 5.91 days, and new employee TB screening costs were reduced by 40%. The IGRA is an acceptable alternative to the TST and has significant potential to improve the process of pre-placement TB screening. Copyright 2014, SLACK Incorporated.

Arsenic enhances the apoptosis induced by interferon gamma: key role of IRF-1.

PubMed

El Bougrini, J; Pampin, M; Chelbi-Alix, M K

2006-05-15

Interferons (IFNs) and arsenic trioxide (As2O3) are known inhibitors of cell proliferation and have been used in the treatment of certain forms of malignancy. IFNgamma treatment of cells leads to tyrosine phosphorylation of STAT1 followed by dimerization that accumulates in the nucleus. This is followed by DNA binding, activation of target gene transcription, dephosphorylation, and return to the cytoplasm. We have shown earlier that IFNgamma and As2O3 act synergistically in acute promyelocytic leukemia cells to upregulate IRF-1 expression and to induce apoptosis. Here, we show that in the human fibrosarcoma cell line 2fTGH, As2O3 prolongs IFNgamma-induced STAT1 phosphorylation resulting in persistent binding of STAT1 to GAS motif leading to an increase in IRF-1 expression which correlated with both higher anti-proliferative effect and increased apoptosis. These biological responses induced by IFNgamma alone or in combination with As2O3 were abolished when IRF-1 expression was down-regulated by RNA interference, thus demonstrating the key role of IRF-1.

Influenza A virus TRIMs the type I interferon response.

PubMed

Ludwig, Stephan; Wolff, Thorsten

2009-05-08

The virulence of many pathogenic viruses depends on suppression of the innate type I interferon defense. For influenza viruses, a unique strategy has now been unraveled, as the viral nonstructural protein 1 was shown to inhibit activation of the pathogen recognition receptor RIG-I by binding the ubiquitin ligase TRIM25.

Interferon type I responses to virus infections in carp cells: In vitro studies on Cyprinid herpesvirus 3 and Rhabdovirus carpio infections.

PubMed

Adamek, Mikołaj; Rakus, Krzysztof Ł; Chyb, Jarosław; Brogden, Graham; Huebner, Arne; Irnazarow, Ilgiz; Steinhagen, Dieter

2012-09-01

Interferons (IFNs) are secreted mediators that play a fundamental role in the innate immune response against viruses among all vertebrate classes. Common carp is a host for two highly contagious viruses: spring viraemia of carp virus (Rhabdovirus carpio, SVCV) and the Cyprinid herpesvirus 3 (CyHV-3), which belong to Rhabdoviridae and Alloherpesviridae families, respectively. Both viruses are responsible for significant losses in carp aquaculture. In this paper we studied the mRNA expression profiles of genes encoding for proteins promoting various functions during the interferon pathway, from pattern recognition receptors to antiviral genes, during in vitro viral infection. Furthermore, we investigated the impact of the interferon pathway (stimulated with poly I:C) on CyHV-3 replication and the speed of virus spreading in cell culture. The results showed that two carp viruses, CyHV-3 and SVCV induced fundamentally different type I IFN responses in CCB cells. SVCV induced a high response in all studied genes, whereas CyHV-3 seems to induce no response in CCB cells, but it induces a response in head kidney leukocytes. The lack of an IFN type I response to CyHV-3 could be an indicator of anti-IFN actions of the virus, however the nature of this mechanism has to be evaluated in future studies. Our results also suggest that an activation of type I IFN in CyHV-3 infected cells can limit the spread of the virus in cell culture. This would open the opportunity to treat the disease associated with CyHV-3 by an application of poly I:C in certain cases. Copyright © 2012 Elsevier Ltd. All rights reserved.

Coordinated therapeutic effects of immune modulators and interferon.

PubMed Central

Cerutti, I; Chany, C

1983-01-01

Immune modulators injected 24 h before encephalomyocarditis virus significantly increase antiviral resistance in mice when interferon is administered 1 h after the virus. These immune modulators can be crude bacterial extracts or synthetic drugs. In some cases, the responses are additive; in others, they are clearly cooperative. To protect the mice against the development of 180 TG Crocker sarcomas, the association of bacterial extracts and interferon is highly effective under the condition that the drug concentrations and chronological order and number of injections are well defined. In contrast, the conjunction of interferon and synthetic immune modulators, in particular cimetidine, result in delayed tumor development with no significant change in the final survival rate in the experimental model described here. PMID:6315585

Interferon-gamma, macrophages, and virus spread after HSV-1 injection.

PubMed

Cathcart, Heather M; Zheng, Mei; Covar, Jason J; Liu, Yi; Podolsky, Robert; Atherton, Sally S

2011-06-07

After uniocular anterior chamber (AC) injection of HSV-1, the anterior segment of BALB/c mice becomes inflamed and infected; however, virus does not spread from the anterior segment to cause retinitis in the injected eye. The purpose of these studies was to determine whether interferon (IFN-)-γ and Mac-1(+) cells play a role in preventing direct anterior-to-posterior spread of HSV-1 in the injected eye. One AC of adult female BALB/c mice was injected with HSV-1 (KOS). The location of IFN-α, IFN-β, and IFN-γ in the injected eye was determined by immunofluorescence, and mRNA expression was quantified by qPCR. Injected eyes of IFN-γ knockout or clodronate-treated macrophage-depleted mice were examined to determine whether the absence of IFN-γ or Mac-1(+) macrophages affected the sites or timing of virus spread. IFN-α, IFN-β, and IFN-γ were observed in the anterior segment of injected eyes through 72 hours and mRNA levels of IFN-β and IFN-γ were increased in virus-infected eyes 48 to 120 hours after infection. However, the absence of IFN-γ or macrophages did not affect either the sites or the timing of HSV-1 infection in injected eyes. Protection of the retina of the injected eye does not depend on a single cell type or cytokine. In addition, in the eye, as in other sites of the body, there are redundancies in the innate response to virus infection.

Expression profiles of adult T-cell leukemia–lymphoma and associations with clinical responses to zidovudine and interferon α

PubMed Central

ALIZADEH, ASH A.; BOHEN, SEAN P.; LOSSOS, CHEN; MARTINEZ-CLIMENT, JOSE A.; RAMOS, JUAN CARLOS; CUBEDO-GIL, ELENA; HARRINGTON, WILLIAM J.; LOSSOS, IZIDORE S.

2014-01-01

Adult T-cell leukemia–lymphoma (ATLL) is an HTLV-1-associated lymphoproliferative malignancy that is frequently fatal. We compared gene expression profiles (GEPs) of leukemic specimens from nine patients with ATLL at the time of diagnosis and immediately after combination therapy with zidovudine (AZT) and interferon α (IFNα). GEPs were also related to genetic aberrations determined by comparative genomic hybridization. We identified several genes anomalously over-expressed in the ATLL leukemic cells at the mRNA level, including LYN, CSPG2, and LMO2, and confirmed LMO2 expression in ATLL cells at the protein level. In vivo AZT–IFNα therapy evoked a marked induction of interferon-induced genes accompanied by repression of cell-cycle regulated genes, including those encoding ribosomal proteins. Remarkably, patients not responding to AZT–IFNα differed most from responding patients in lower expression of these same IFN-responsive genes, as well as components of the antigen processing and presentation apparatus. Demonstration of specific gene expression signatures associated with response to AZT–IFNα therapy may provide novel insights into the mechanisms of action in ATLL. PMID:20370541

Robust interferon-α and IL-12 responses by dendritic cells are related to efficient CD4+ T-cell recovery in HIV patients on ART.

PubMed

Tan, Dino Bee Aik; Yong, Yean Kong; Lim, Andrew; Tan, Hong Yien; Kamarulzaman, Adeeba; French, Martyn; Price, Patricia

2011-05-01

Amongst HIV patients with successful virological responses to antiretroviral therapy (ART), poor CD4(+) T-cell recovery is associated with low nadir CD4(+) T-cell counts and persistent immune activation. These factors might be influenced by dendritic cell (DC) function. Interferon-α-producing plasmacytoid DC and IL-12-producing myeloid DC were quantified by flow cytometry after stimulation with agonists to TLR7/8 (CL075) or TLR9 (CpG-ODN). These were compared between patients who achieved CD4(+) T-cell counts above or below 200 cells/μL after 6 months on ART (High vs. Low groups). High Group patients had more DC producing interferon-α or IL-12 at Weeks 6 and 12 on ART than Low Group patients. The frequencies of cytokine-producing DC at Week 12 were directly correlated with CD4(+) T-cell counts at baseline and at Week 12. Patients with good recovery of CD4(+) T-cells had robust TLR-mediated interferon-α responses by plasmacytoid DC and IL-12 responses by myeloid DC during early ART (1-3 months). Copyright © 2011 Elsevier Inc. All rights reserved.

MicroRNA-466l inhibits antiviral innate immune response by targeting interferon-alpha

PubMed Central

Li, Yingke; Fan, Xiaohua; He, Xingying; Sun, Haijing; Zou, Zui; Yuan, Hongbin; Xu, Haitao; Wang, Chengcai; Shi, Xueyin

2012-01-01

Effective recognition of viral infections and subsequent triggering of antiviral innate immune responses are essential for the host antiviral defense, which is tightly regulated by multiple regulators, including microRNAs (miRNAs). A previous study showed that miR-466l upregulates IL-10 expression in macrophages by antagonizing RNA-binding protein tristetraprolin-mediated IL-10 mRNA degradation. However, the ability of miR-466l to regulate antiviral immune responses remains unknown. Here, we found that interferon-alpha (IFN-α) expression was repressed in Sendai virus (SeV)- and vesicular stomatitis virus (VSV)-infected macrophages and in dendritic cells transfected with miR-466l expression. Moreover, multiple IFN-α species can be directly targeted by miR-466l through their 3′ untranslated region (3′UTR). This study has demonstrated that miR-466l could directly target IFN-α expression to inhibit host antiviral innate immune response. PMID:23042536

Differential Regulation of Interferon Responses by Ebola and Marburg Virus VP35 Proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Edwards, Megan R.; Liu, Gai; Mire, Chad E.

2016-02-11

Suppression of innate immune responses during filoviral infection contributes to disease severity. Ebola (EBOV) and Marburg (MARV) viruses each encode a VP35 protein that suppresses RIG-I-like receptor signaling and interferon-α/β (IFN-α/β) production by several mechanisms, including direct binding to double stranded RNA (dsRNA). Here, we demonstrate that in cell culture, MARV infection results in a greater upregulation of IFN responses as compared to EBOV infection. This correlates with differences in the efficiencies by which EBOV and MARV VP35s antagonize RIG-I signaling. Furthermore, structural and biochemical studies suggest that differential recognition of RNA elements by the respective VP35 C-terminal IFN inhibitorymore » domain (IID) rather than affinity for RNA by the respective VP35s is critical for this observation. Our studies reveal functional differences in EBOV versus MARV VP35 RNA binding that result in unexpected differences in the host response to deadly viral pathogens.« less

The effect of centaurein on interferon-{gamma} expression and Listeria infection in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, S.-L.; Department of Biological Science and Technology, National Chiao Tung University, 1001, Ta Hsueh Road, Hsinchu 300, Taiwan; Yeh, H.-H.

2007-02-15

We previously found that centaurein enhanced IFN-{gamma} transcription in T cells. Here, we demonstrate that centaurein increased the IFN-{gamma} expression in T and NK cells and the serum IFN-{gamma} level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-{gamma} but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-{gamma} expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection viamore » a modulation of IFN-{gamma} expression.« less

[Effectiveness of interferon-gamma release assays in the tuberculosis contact investigation of elderly people].

PubMed

Seto, Junji; Ahiko, Tadayuki

2014-04-01

To confirm the effectiveness of interferon-gamma release assays (IGRAs) in the tuberculosis (TB) contact investigation of elderly people, we analyzed the results of the QuantiFERON TB Gold in tube (QFT-3G) test, which is a commercially available IGRA. We analyzed the results of the QFT-3G test in 2,420 subjects who were in close contact with TB patients. We investigated subjects with latent TB infection and those showing the onset of TB among the QFT-3G-positive subjects. The QFT-3G-positive rate was 7.3% (95% confidence interval, 6.2%-8.3%). In addition, we demonstrated that the QFT-3G-positive rate increased with age (P < 0.001). The QFT-3G-positive rate was high, particularly in elderly people (> or = 60 years), but the rate was significantly lower than the predicted prevalence of TB infection. Therefore, it was assumed that the QFT-3G test does not always provide a positive result, even in cases of subjects with a previous TB infection. Furthermore, data from the QFT-3G-positive subjects indicated that approximately one half of subjects aged 60-69 years, approximately one-third of those aged 70-79 years, and approximately one-quarter of those aged over 80 years have had recent TB infections. In conclusion, the results of the QFT-3G test in elderly people need to be carefully evaluated according to the contact situation with TB patients; nevertheless, the QFT-3G test is useful for the screening of latent TB infection in elderly people who were in close contact with TB patients.

Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.

PubMed

Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G

2010-04-15

Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.

CD4+ T-Cell- and Gamma Interferon-Dependent Protection against Murine Malaria by Immunization with Linear Synthetic Peptides from a Plasmodium yoelii 17-Kilodalton Hepatocyte Erythrocyte Protein

PubMed Central

Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.

1999-01-01

Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206

Molecular cloning of ADIR, a novel interferon responsive gene encoding a protein related to the torsins.

PubMed

Dron, Michel; Meritet, Jean François; Dandoy-Dron, Françoise; Meyniel, Jean-Philippe; Maury, Chantal; Tovey, Michael G

2002-03-01

The expression of the previously uncharacterized gene Adir (for ATP dependent interferon responsive gene) was increased by 5- to 15-fold in tissue of the oral cavity or in spleen and liver of mice treated orally or intraperitoneally with IFN-alpha, and in mouse cells treated in vitro with IFN-alpha or IFN-gamma. The level of Adir mRNA was also increased 20- to 40-fold in the brains of animals infected with encephalomyocarditis virus. Adir is expressed ubiquitously in mouse tissues as 1.9-, 2.4-, and 3.5-kb mRNA transcripts encoding a 385-amino-acid protein with a conserved ATP binding domain containing typical nucleotide and Mg(2+) binding sites. We also characterized the human ortholog, ADIR, which is located on chromosome 1q25-q31 and contains six exons encoding a 397-amino-acid protein with 80% homology to the mouse protein. A single 2.3-kb mRNA was detected in all human tissues examined, except for placenta, which also contained a 1.25-kb tissue-specific transcript generated by alternative splicing and encoding a putative 336-amino-acid protein. Although ADIR exhibits low homology to DYT1 and TOR1B, the deduced ADIR protein sequences are highly homologous to torsin A and torsin B and more distantly related to members of the Clp/HSP100 family of proteins, suggesting that ADIR, like torsins, is related to the AAA chaperone-like family of ATPases. An ADIR-EGFP fusion protein expressed in HeLa cells was shown to be associated with the endoplasmic reticulum.

Polyfunctional cytokine responses by central memory CD4*T cells in response to bovine tuberculosis

USDA-ARS?s Scientific Manuscript database

CD4 T cells are crucial in immunity to tuberculosis (TB). Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), interleukin-2 (IL-2) and tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB. Mycobacterium bovis in...

Polyfunctional cytokine responses by central memory CD4+T cells in response to bovine tuberculosis

USDA-ARS?s Scientific Manuscript database

CD4 T cells are crucial in immunity to tuberculosis (TB). Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), interleukin-2 (IL-2) and tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB and HIV. Mycobacterium ...

MicroRNA203a suppresses glioma tumorigenesis through an ATM-dependent interferon response pathway

PubMed Central

Yang, Chuan He; Wang, Yinan; Sims, Michelle; Cai, Chun; He, Ping; Häcker, Hans; Yue, Junming; Cheng, Jinjun; Boop, Frederick A.; Pfeffer, Lawrence M.

2017-01-01

Glioblastoma (GBM) is a deadly and incurable brain tumor. Although microRNAs (miRNAs) play critical roles in regulating the cancer cell phenotype, the underlying mechanisms of how they regulate tumorigenesis are incompletely understood. We previously showed that miR-203a is expressed at relatively low levels in GBM patients, and ectopic miR-203a expression in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by interferon (IFN) or temozolomide in vitro, and inhibited GBM tumorigenesis in vivo. Here we show that ectopic expression of miR-203a in GBM cell lines promotes the IFN response pathway as evidenced by increased IFN production and IFN-stimulated gene (ISG) expression, and high basal tyrosine phosphorylation of multiple STAT proteins. Importantly, we identified that miR-203a directly suppressed the protein levels of ataxia-telangiectasia mutated (ATM) kinase that negatively regulates IFN production. We found that high ATM expression in GBM correlates with poor patient survival and that ATM expression is inversely correlated with miR-203a expression. Knockout of ATM expression and inhibition of ATM function in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by therapeutic agents in vitro, and markedly suppressed GBM tumor growth and promoted animal survival. In contrast, restoring ATM levels in GBM cells ectopically expressing miR-203a increased tumorigenicity and decreased animal survival. Our study suggests that low miR-203a expression in GBM suppresses the interferon response through an ATM-dependent pathway. PMID:29348882

MicroRNA203a suppresses glioma tumorigenesis through an ATM-dependent interferon response pathway.

PubMed

Yang, Chuan He; Wang, Yinan; Sims, Michelle; Cai, Chun; He, Ping; Häcker, Hans; Yue, Junming; Cheng, Jinjun; Boop, Frederick A; Pfeffer, Lawrence M

2017-12-22

Glioblastoma (GBM) is a deadly and incurable brain tumor. Although microRNAs (miRNAs) play critical roles in regulating the cancer cell phenotype, the underlying mechanisms of how they regulate tumorigenesis are incompletely understood. We previously showed that miR-203a is expressed at relatively low levels in GBM patients, and ectopic miR-203a expression in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by interferon (IFN) or temozolomide in vitro , and inhibited GBM tumorigenesis in vivo . Here we show that ectopic expression of miR-203a in GBM cell lines promotes the IFN response pathway as evidenced by increased IFN production and IFN-stimulated gene (ISG) expression, and high basal tyrosine phosphorylation of multiple STAT proteins. Importantly, we identified that miR-203a directly suppressed the protein levels of ataxia-telangiectasia mutated (ATM) kinase that negatively regulates IFN production. We found that high ATM expression in GBM correlates with poor patient survival and that ATM expression is inversely correlated with miR-203a expression. Knockout of ATM expression and inhibition of ATM function in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by therapeutic agents in vitro , and markedly suppressed GBM tumor growth and promoted animal survival. In contrast, restoring ATM levels in GBM cells ectopically expressing miR-203a increased tumorigenicity and decreased animal survival. Our study suggests that low miR-203a expression in GBM suppresses the interferon response through an ATM-dependent pathway.

Interferon modulation of c-myc expression in cloned Daudi cells: relationship to the phenotype of interferon resistance.

PubMed

Dron, M; Modjtahedi, N; Brison, O; Tovey, M G

1986-05-01

Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells.

Inflammation activates the interferon signaling pathways in taste bud cells.

PubMed

Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan

2007-10-03

Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.

Interferon-gamma improves impaired dentinogenic and immunosuppressive functions of irreversible pulpitis-derived human dental pulp stem cells

PubMed Central

Sonoda, Soichiro; Yamaza, Haruyoshi; Ma, Lan; Tanaka, Yosuke; Tomoda, Erika; Aijima, Reona; Nonaka, Kazuaki; Kukita, Toshio; Shi, Songtao; Nishimura, Fusanori; Yamaza, Takayoshi

2016-01-01

Clinically, irreversible pulpitis is treated by the complete removal of pulp tissue followed by replacement with artificial materials. There is considered to be a high potential for autologous transplantation of human dental pulp stem cells (DPSCs) in endodontic treatment. The usefulness of DPSCs isolated from healthy teeth is limited. However, DPSCs isolated from diseased teeth with irreversible pulpitis (IP-DPSCs) are considered to be suitable for dentin/pulp regeneration. In this study, we examined the stem cell potency of IP-DPSCs. In comparison with healthy DPSCs, IP-DPSCs expressed lower colony-forming capacity, population-doubling rate, cell proliferation, multipotency, in vivo dentin regeneration, and immunosuppressive activity, suggesting that intact IP-DPSCs may be inadequate for dentin/pulp regeneration. Therefore, we attempted to improve the impaired in vivo dentin regeneration and in vitro immunosuppressive functions of IP-DPSCs to enable dentin/pulp regeneration. Interferon gamma (IFN-γ) treatment enhanced in vivo dentin regeneration and in vitro T cell suppression of IP-DPSCs, whereas treatment with tumor necrosis factor alpha did not. Therefore, these findings suggest that IFN-γ may be a feasible modulator to improve the functions of impaired IP-DPSCs, suggesting that autologous transplantation of IFN-γ-accelerated IP-DPSCs might be a promising new therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:26775677

Effect of Pregnancy on Interferon Gamma Release Assay and Tuberculin Skin Test Detection of Latent TB Infection Among HIV-Infected Women in a High Burden Setting.

PubMed

LaCourse, Sylvia M; Cranmer, Lisa M; Matemo, Daniel; Kinuthia, John; Richardson, Barbra A; Horne, David J; John-Stewart, Grace

2017-05-01

Peripartum immunologic changes may affect latent tuberculosis infection (LTBI) diagnostic performance among HIV-infected women. HIV-infected women were serially tested with tuberculin skin test (TST) and interferon gamma release assay [QuantiFERON TB Gold In-tube (QFT)] in pregnancy and 6 weeks postpartum in Kenya. Prevalence, sensitivity and agreement, and correlates of QFT/TST positivity were assessed. Quantitative QFT mitogen and Mycobacterium tuberculosis antigen (Mtb-Ag) responses were compared by peripartum stage. Incidence of test conversion at 6 weeks postpartum was evaluated in baseline TST-/QFT- women. Among 100 HIV-infected women, median age was 26 years, median CD4 was 555 cells per cubic millimeter, and 88% were on antiretrovirals. More women were QFT+ than TST+ in both pregnancy (35.4% vs. 13.5%, P = 0.001) and postpartum (29.6% vs. 14.8%, P < 0.001). Among 18 consistently QFT+ women, 8 (44%) converted from TST- to TST+, with improved test agreement postpartum (56.9%, κ = 0.20 to 82.4%, κ = 0.60). Three initially QFT-/TST- women had test conversion (TST+ and/or QFT+), suggesting new infection (incidence 13.4/100 person-years). Mean QFT mitogen (4.46 vs. 7.64 IU/mL, P < 0.001) and Mtb-Ag (1.03 vs. 1.54 IU/mL, P = 0.03) responses were lower among all women retested in pregnancy vs. postpartum, and specifically among persistently QFT+ women (Mtb-Ag: 3.46 vs. 4.48 IU/mL, P = 0.007). QFT indeterminate rate was higher in pregnancy (16%) compared with postpartum (0%) because of lower mitogen response. QFT identified >2-fold more women with LTBI compared with TST in pregnancy and postpartum. Lower QFT Mtb-Ag and mitogen responses in pregnancy compared with postpartum suggest that pregnancy-associated immunologic changes may influence LTBI test performance.

Effects of adenoviral delivered interferon-alpha on porcine reproductive and respiratory syndrome virus infection in swine

USDA-ARS?s Scientific Manuscript database

Type I interferons, such as interferon (IFN) alpha, contribute to innate antiviral immunity by promoting production of antiviral mediators and also play a role in the adaptive immune response. Porcine reproductive and respiratory syndrome (PRRS) has been shown to induce a meager IFN-alpha response. ...

Interferon modulation of c-myc expression in cloned Daudi cells: relationship to the phenotype of interferon resistance.

PubMed Central

Dron, M; Modjtahedi, N; Brison, O; Tovey, M G

1986-01-01

Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells. Images PMID:3785169

Camel molar tooth enamel response to gamma rays using EPR spectroscopy.

PubMed

El-Faramawy, N A; El-Somany, I; Mansour, A; Maghraby, A M; Eissa, H; Wieser, A

2018-03-01

Tooth enamel samples from molar teeth of camel were prepared using a combined procedure of mechanical and chemical tooth treatment. Based on electron paramagnetic resonance (EPR) spectroscopy, the dose response of tooth enamel samples was examined and compared to that of human enamel. The EPR dose response of the tooth enamel samples was obtained through irradiation to gamma doses from 1 Gy up to 100 kGy. It was found that the radiation-induced EPR signal increased linearly with gamma dose for all studied tooth enamel samples, up to about 15 kGy. At higher doses, the dose response curve leveled off. The results revealed that the location of the native signal of camel tooth enamel was similar to that of enamel from human molars at 2.00644, but different from that of enamel from cows and goats. In addition, the peak-to-peak width (ΔH pp ) for human and camel molar teeth was similar. It was also found that the response of camel enamel to gamma radiation was 36% lower than that of human enamel. In conclusion, the results indicate the suitability of camel teeth for retrospective gamma dosimetry.

cGAS Senses Human Cytomegalovirus and Induces Type I Interferon Responses in Human Monocyte-Derived Cells

PubMed Central

Paijo, Jennifer; Döring, Marius; Spanier, Julia; Grabski, Elena; Nooruzzaman, Mohammed; Schmidt, Tobias; Witte, Gregor; Messerle, Martin; Hornung, Veit; Kaever, Volkhard; Kalinke, Ulrich

2016-01-01

Human cytomegalovirus (HCMV) infections of healthy individuals are mostly unnoticed and result in viral latency. However, HCMV can also cause devastating disease, e.g., upon reactivation in immunocompromised patients. Yet, little is known about human immune cell sensing of DNA-encoded HCMV. Recent studies indicated that during viral infection the cyclic GMP/AMP synthase (cGAS) senses cytosolic DNA and catalyzes formation of the cyclic di-nucleotide cGAMP, which triggers stimulator of interferon genes (STING) and thus induces antiviral type I interferon (IFN-I) responses. We found that plasmacytoid dendritic cells (pDC) as well as monocyte-derived DC and macrophages constitutively expressed cGAS and STING. HCMV infection further induced cGAS, whereas STING expression was only moderately affected. Although pDC expressed particularly high levels of cGAS, and the cGAS/STING axis was functional down-stream of STING, as indicated by IFN-I induction upon synthetic cGAMP treatment, pDC were not susceptible to HCMV infection and mounted IFN-I responses in a TLR9-dependent manner. Conversely, HCMV infected monocyte-derived cells synthesized abundant cGAMP levels that preceded IFN-I production and that correlated with the extent of infection. CRISPR/Cas9- or siRNA-mediated cGAS ablation in monocytic THP-1 cells and primary monocyte-derived cells, respectively, impeded induction of IFN-I responses following HCMV infection. Thus, cGAS is a key sensor of HCMV for IFN-I induction in primary human monocyte-derived DC and macrophages. PMID:27058035

Interferon Alfa-2b Injection

MedlinePlus

Interferon alfa-2b injection is used to treat a number of conditions.Interferon alfa-2b injection is used alone or in combination ... lymphoma (NHL; a slow-growing blood cancer). Interferon alfa-2b is in a class of medications called ...

Chronic hepatitis C virus patients with breakthroughs during interferon treatment can successfully be retreated with consensus interferon. The Consensus Interferon Study Group.

PubMed

Heathcote, E J; James, S; Mullen, K D; Hauser, S C; Rosenblate, H; Albert, D G

1999-08-01

Patients with chronic hepatitis C who have not had a sustained hepatitis C virus (HCV)-RNA response or serum alanine transaminase (ALT) response to a 6-month course of interferon (IFN) may respond to higher dose retreatment with consensus interferon (CIFN). Some nonresponders to initial IFN treatment have a transient response defined as undetectable HCV RNA or normalization of ALT during treatment, but subsequently have a "breakthrough" while still on treatment. The aim of this study was to determine if nonresponders who had breakthroughs responded differently to CIFN retreatment than nonresponders without breakthroughs using data from a large, multicenter trial. ALT and HCV RNA were monitored frequently during initial IFN therapy (either 9 mcg CIFN or 3 MU IFN-alpha2b 3 times per week). HCV-RNA breakthroughs were observed in 86 of 467 (18%) of all treated patients, and ALT breakthroughs were observed in 90 of 467 (19%) of all treated patients. There was no association between breakthroughs and the presence of either binding or neutralizing anti-IFN antibodies. When the patients who were nonresponders to initial IFN treatment were retreated with CIFN (15 mcg) for 12 months, 27% of those with viral breakthroughs had a sustained viral response compared with 8% in prior nonresponders without breakthroughs (P =.102). Sustained ALT responses were observed in 39% with breakthroughs compared with 10% in those without breakthroughs (P =.014). The data suggest that prior nonresponders with breakthroughs have a greater chance of responding to retreatment than do nonresponders without breakthroughs. However, most breakthrough patients would be missed unless repeated HCV-RNA testing were conducted during therapy.

Frequency of indeterminate results from an interferon-gamma release assay among HIV-infected individuals

PubMed Central

de Oliveira, Sandra Maria do Valle Leone; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria

2017-01-01

ABSTRACT Objective: To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). Methods: We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Results: Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. Conclusions: The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. PMID:28746533

Molecular characterization and development of Sarcocystis speeri sarcocysts in gamma interferon gene knockout mice.

PubMed

Dubey, J P; Verma, S K; Dunams, D; Calero-Bernal, R; Rosenthal, B M

2015-11-01

The North American opossum (Didelphis virginiana) is the definitive host for at least three named species of Sarcocystis: Sarcocystis falcatula, Sarcocystis neurona and Sarcocystis speeri. The South American opossums (Didelphis albiventris, Didelphis marsupialis and Didelphis aurita) are definitive hosts for S. falcatula and S. lindsayi. The sporocysts of these Sarcocystis species are similar morphologically. They are also not easily distinguished genetically because of the difficulties of DNA extraction from sporocysts and availability of distinguishing genetic markers. Some of these species can be distinguished by bioassay; S. neurona and S. speeri are infective to gamma interferon gene knockout (KO) mice, but not to budgerigars (Melopsittacus undulatus); whereas S. falcatula and S. lindsayi are infective to budgerigars but not to KO mice. The natural intermediate host of S. speeri is unknown. In the present study, development of sarcocysts of S. speeri in the KO mice is described. Sarcocysts were first seen at 12 days post-inoculation (p.i.), and they became macroscopic (up to 4 mm long) by 25 days p.i. The structure of the sarcocyst wall did not change from the time bradyzoites had formed at 50-220 days p.i. Sarcocysts contained unique villar protrusions, 'type 38'. The polymerase chain reaction amplifications and sequences analysis of three nuclear loci (18S rRNA, 28S rRNA and ITS1) and two mitochondrial loci (cox1 and cytb) of S. speeri isolate from an Argentinean opossum (D. albiventris) confirmed its membership among species of Sarcocystis and indicated an especially close relationship to another parasite in this genus that employs opossums as its definitive host, S. neurona. These results should be useful in finding natural intermediate host of S. speeri.

Is the use of IL28B genotype justified in the era of interferon-free treatments for hepatitis C?

PubMed Central

Kanda, Tatsuo; Nakamoto, Shingo; Yokosuka, Osamu

2015-01-01

In 2009, several groups reported that interleukin-28B (IL28B) genotypes are associated with the response to peginterferon plus ribavirin therapy for chronic hepatitis C virus (HCV) infection in a genome-wide association study, although the mechanism of this association is not yet well understood. However, in recent years, tremendous progress has been made in the treatment of HCV infection. In Japan, some patients infected with HCV have the IL28B major genotype, which may indicate a favorable response to interferon-including regimens; however, certain patients within this group are also interferon-intolerant or ineligible. In Japan, interferon-free 24-wk regimens of asunaprevir and daclatasvir are now available for HCV genotype 1b-infected patients who are interferon-intolerant or ineligible or previous treatment null-responders. The treatment response to interferon-free regimens appears better, regardless of IL28B genotype. Maybe other interferon-free regimens will widely be available soon. In conclusion, although some HCV-infected individuals have IL28B favorable alleles, importance of IL28B will be reduced with availability of oral interferon free regimen. PMID:26279979

Multisensory stimuli elicit altered oscillatory brain responses at gamma frequencies in patients with schizophrenia

PubMed Central

Stone, David B.; Coffman, Brian A.; Bustillo, Juan R.; Aine, Cheryl J.; Stephen, Julia M.

2014-01-01

Deficits in auditory and visual unisensory responses are well documented in patients with schizophrenia; however, potential abnormalities elicited from multisensory audio-visual stimuli are less understood. Further, schizophrenia patients have shown abnormal patterns in task-related and task-independent oscillatory brain activity, particularly in the gamma frequency band. We examined oscillatory responses to basic unisensory and multisensory stimuli in schizophrenia patients (N = 46) and healthy controls (N = 57) using magnetoencephalography (MEG). Time-frequency decomposition was performed to determine regions of significant changes in gamma band power by group in response to unisensory and multisensory stimuli relative to baseline levels. Results showed significant behavioral differences between groups in response to unisensory and multisensory stimuli. In addition, time-frequency analysis revealed significant decreases and increases in gamma-band power in schizophrenia patients relative to healthy controls, which emerged both early and late over both sensory and frontal regions in response to unisensory and multisensory stimuli. Unisensory gamma-band power predicted multisensory gamma-band power differently by group. Furthermore, gamma-band power in these regions predicted performance in select measures of the Measurement and Treatment Research to Improve Cognition in Schizophrenia (MATRICS) test battery differently by group. These results reveal a unique pattern of task-related gamma-band power in schizophrenia patients relative to controls that may indicate reduced inhibition in combination with impaired oscillatory mechanisms in patients with schizophrenia. PMID:25414652

HLA-DRB1 and HLA-DQB1 Are Associated with Adult-Onset Immunodeficiency with Acquired Anti-Interferon-Gamma Autoantibodies

PubMed Central

Pithukpakorn, Manop; Roothumnong, Ekkapong; Angkasekwinai, Nasikarn; Suktitipat, Bhoom; Assawamakin, Anunchai; Luangwedchakarn, Voravich; Umrod, Pinklow; Thongnoppakhun, Wanna; Foongladda, Suporn; Suputtamongkol, Yupin

2015-01-01

Recently a newly identified clinical syndrome of disseminated non-tuberculous mycobacterial diseases (with or without other opportunistic infections in adult patients who were previously healthy, has been recognized in association with an acquired autoantibody to interferon-gamma. This syndrome is emerging as an important cause of morbidity and mortality, especially among people of Asian descent. Trigger for the production of this autoantibody remains unknown, but genetic factors are strongly suspected to be involved. We compared HLA genotyping between 32 patients with this clinical syndrome, and 38 controls. We found that this clinical syndrome was associated with very limited allele polymorphism, with HLA-DRB1 and DQB1 alleles, especially HLA-DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02. Odds ratio of DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02 were 7.03 (95% CI, 2.18–22.69, P<0.0001, 9.06 (95% CI, 2.79–29.46, P<0.0001), 6.68 (95% CI, 2.29–19.52, P = 0.0004), and 6.64 (95% CI, 2.30–19.20, P = 0.0004), respectively. Further investigation is warranted to provide better understanding on pathogenesis of this association. PMID:26011559

Cell-Specific IRF-3 Responses Protect against West Nile Virus Infection by Interferon-Dependent and -Independent Mechanisms

PubMed Central

Daffis, Stephane; Samuel, Melanie A; Keller, Brian C; Gale, Michael; Diamond, Michael S

2007-01-01

Interferon regulatory factor (IRF)-3 is a master transcription factor that activates host antiviral defense programs. Although cell culture studies suggest that IRF-3 promotes antiviral control by inducing interferon (IFN)-β, near normal levels of IFN-α and IFN-β were observed in IRF-3−/− mice after infection by several RNA and DNA viruses. Thus, the specific mechanisms by which IRF-3 modulates viral infection remain controversial. Some of this disparity could reflect direct IRF-3-dependent antiviral responses in specific cell types to control infection. To address this and determine how IRF-3 coordinates an antiviral response, we infected IRF-3−/− mice and two primary cells relevant for West Nile virus (WNV) pathogenesis, macrophages and cortical neurons. IRF-3−/− mice were uniformly vulnerable to infection and developed elevated WNV burdens in peripheral and central nervous system tissues, though peripheral IFN responses were largely normal. Whereas wild-type macrophages basally expressed key host defense molecules, including RIG-I, MDA5, ISG54, and ISG56, and restricted WNV infection, IRF-3−/− macrophages lacked basal expression of these host defense genes and supported increased WNV infection and IFN-α and IFN-β production. In contrast, wild-type cortical neurons were highly permissive to WNV and did not basally express RIG-I, MDA5, ISG54, and ISG56. IRF-3−/− neurons lacked induction of host defense genes and had blunted IFN-α and IFN-β production, yet exhibited only modestly increased viral titers. Collectively, our data suggest that cell-specific IRF-3 responses protect against WNV infection through both IFN-dependent and -independent programs. PMID:17676997

Mink parvoviruses and interferons: in vitro studies.

PubMed Central

Wiedbrauk, D L; Bloom, M E; Lodmell, D L

1986-01-01

Although interferons can inhibit the replication of a number of viruses, little is known about their ability to inhibit parvovirus replication. Therefore, in vitro experiments were done to determine if Aleutian disease virus and mink enteritis virus, two autonomously replicating mink parvoviruses, induced interferon, were sensitive to the effects of interferon, or inhibited the production of interferon. The results indicated that these parvoviruses neither induced nor were sensitive to the effects of interferon. Furthermore, preexisting parvovirus infections did not inhibit poly(I).poly(C)-induced interferon production. This independence from the interferon system may, therefore, be a general property of the autonomously replicating parvoviruses. PMID:2431162

Chicken interferome: avian interferon-stimulated genes identified by microarray and RNA-seq of primary chick embryo fibroblasts treated with a chicken type I interferon (IFN-α).

PubMed

Giotis, Efstathios S; Robey, Rebecca C; Skinner, Natalie G; Tomlinson, Christopher D; Goodbourn, Stephen; Skinner, Michael A

2016-08-05

Viruses that infect birds pose major threats-to the global supply of chicken, the major, universally-acceptable meat, and as zoonotic agents (e.g. avian influenza viruses H5N1 and H7N9). Controlling these viruses in birds as well as understanding their emergence into, and transmission amongst, humans will require considerable ingenuity and understanding of how different species defend themselves. The type I interferon-coordinated response constitutes the major antiviral innate defence. Although interferon was discovered in chicken cells, details of the response, particularly the identity of hundreds of stimulated genes, are far better described in mammals. Viruses induce interferon-stimulated genes but they also regulate the expression of many hundreds of cellular metabolic and structural genes to facilitate their replication. This study focusses on the potentially anti-viral genes by identifying those induced just by interferon in primary chick embryo fibroblasts. Three transcriptomic technologies were exploited: RNA-seq, a classical 3'-biased chicken microarray and a high density, "sense target", whole transcriptome chicken microarray, with each recognising 120-150 regulated genes (curated for duplication and incorrect assignment of some microarray probesets). Overall, the results are considered robust because 128 of the compiled, curated list of 193 regulated genes were detected by two, or more, of the technologies.

Control of epithelial immune-response genes and implications for airway immunity and inflammation.

PubMed

Holtzman, M J; Look, D C; Sampath, D; Castro, M; Koga, T; Walter, M J

1998-01-01

A major goal of our research is to understand how immune cells (especially T cells) infiltrate the pulmonary airway during host defense and inflammatory disease (especially asthma). In that context, we have proposed that epithelial cells lining the airway provide critical biochemical signals for immune-cell influx and activation and that this epithelial-immune cell interaction is a critical feature of airway inflammation and hyperreactivity. In this brief report, we describe our progress in defining a subset of epithelial immune-response genes the expression of which is coordinated for viral defense both directly in response to replicating virus and indirectly under the control of a specific interferon-gamma signal transduction pathway featuring the Stat1 transcription factor as a critical relay signal between cytoplasm and nucleus. Unexpectedly, the same pathway is also activated during asthmatic airway inflammation in a setting where there is no apparent infection and no increase in interferon-gamma levels. The findings provide the first evidence of an overactive Stat1-dependent gene network in asthmatic airways and a novel molecular link between mucosal immunity and inflammation. The findings also offer the possibility that overactivity of Stat1-dependent genes might augment a subsequent T helper cell (Th1)-type response to virus or might combine with a heightened Th2-type response to allergen to account for more severe exacerbations of asthma.

Comparison of antibody and cytokine responses to primary Giardia muris infection in H-2 congenic strains of mice.

PubMed

Venkatesan, P; Finch, R G; Wakelin, D

1996-11-01

The course of primary infections with Giardia muris differs between BALB and B10 H-2 congenic strains of mice. In the first 3 weeks of infection, there is a more rapid decline in intestinal trophozoite and fecal cyst counts in B10 strains than in BALB strains. To determine whether this difference could be explained by variation in specific antibody responses, both secretory immunoglobulin A (IgA) and serum antibody responses were compared between these strains. No significant differences in the timing, titer, or specificity of secretory or serum antibodies were found. However, on comparing specific anti-G. muris serum IgG subclass responses, we found that B10 strains produced IgG2a while BALB strains produced IgG1, suggesting differential involvement of T helper 1 and 2 subsets of lymphocytes. When cells harvested from mesenteric lymph nodes were stimulated with concanavalin A in vitro, both gamma interferon and interleukin-5 were secreted by cells from B10 mice, but only interleukin-5 was secreted by cells from BALB/c mice. Specific blockade of gamma interferon by monoclonal antibody administered to B10 mice resulted in an enhanced intensity of infection.

The interferons.

PubMed Central

Toy, J L

1983-01-01

An overview of the interferons is presented. A description of something of what is known about them is given, including: their genes; their protein structures and characteristics; their mechanisms of actions; and their varied biological effects emphasising particularly their immunomodulatory actions. Finally, a brief summary is made of the current status of human clinical studies that have been conducted with interferons in the oncological and viral fields, mentioning also recent findings in patients who have the acquired immunodeficiency syndrome (AIDS). PMID:6193915

Bovine immune response to inoculation with Neospora caninum surface antigen SRS2 lipopeptides mimics immune response to infection with live parasites.

PubMed

Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor

2008-04-01

Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.

Histone H2B-IFI16 Recognition of Nuclear Herpesviral Genome Induces Cytoplasmic Interferon-β Responses

PubMed Central

Iqbal, Jawed; Ansari, Mairaj Ahmed; Kumar, Binod; Dutta, Dipanjan; Roy, Arunava; Chikoti, Leela; Pisano, Gina; Dutta, Sujoy; Veettil, Mohanan Valiya; Chandran, Bala

2016-01-01

IFI16 (gamma-interferon-inducible protein 16), a predominantly nuclear protein involved in transcriptional regulation, also functions as an innate immune response DNA sensor and induces the IL-1β and antiviral type-1 interferon-β (IFN-β) cytokines. We have shown that IFI16, in association with BRCA1, functions as a sequence independent nuclear sensor of episomal dsDNA genomes of KSHV, EBV and HSV-1. Recognition of these herpesvirus genomes resulted in IFI16 acetylation, BRCA1-IFI16-ASC-procaspase-1 inflammasome formation, cytoplasmic translocation, and IL-1β generation. Acetylated IFI16 also interacted with cytoplasmic STING and induced IFN-β. However, the identity of IFI16 associated nuclear proteins involved in STING activation and the mechanism is not known. Mass spectrometry of proteins precipitated by anti-IFI16 antibodies from uninfected endothelial cell nuclear lysate revealed that histone H2B interacts with IFI16. Single and double proximity ligation microscopy, immunoprecipitation, EdU-genome labeled virus infection, and chromatin immunoprecipitation studies demonstrated that H2B is associated with IFI16 and BRCA1 in the nucleus in physiological conditions. De novo KSHV and HSV-1 infection as well as latent KSHV and EBV infection induces the cytoplasmic distribution of H2B-IFI16, H2B-BRCA1 and IFI16-ASC complexes. Vaccinia virus (dsDNA) cytoplasmic replication didn’t induce the redistribution of nuclear H2B-IFI16 or H2B into the cytoplasm. H2B is critical in KSHV and HSV-1 genome recognition by IFI16 during de novo infection. Viral genome sensing by IFI16-H2B-BRCA1 leads to BRCA1 dependent recruitment of p300, and acetylation of H2B and IFI16. BRCA1 knockdown or inhibition of p300 abrogated the acetylation of H2B-IFI16 or H2B. Ran-GTP protein mediated the translocation of acetylated H2B and IFI16 to the cytoplasm along with BRCA1 that is independent of IFI16-ASC inflammasome. ASC knockdown didn’t affect the acetylation of H2B, its cytoplasmic

Responses to Cytokines and Interferons that Depend upon JAKs and STATs.

PubMed

Stark, George R; Cheon, HyeonJoo; Wang, Yuxin

2018-01-02

Many cytokines and all interferons activate members of a small family of kinases (the Janus kinases [JAKs]) and a slightly larger family of transcription factors (the signal transducers and activators of transcription [STATs]), which are essential components of pathways that induce the expression of specific sets of genes in susceptible cells. JAK-STAT pathways are required for many innate and acquired immune responses, and the activities of these pathways must be finely regulated to avoid major immune dysfunctions. Regulation is achieved through mechanisms that include the activation or induction of potent negative regulatory proteins, posttranslational modification of the STATs, and other modulatory effects that are cell-type specific. Mutations of JAKs and STATs can result in gains or losses of function and can predispose affected individuals to autoimmune disease, susceptibility to a variety of infections, or cancer. Here we review recent developments in the biochemistry, genetics, and biology of JAKs and STATs. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

Private sector tuberculosis prevention in the US: Characteristics associated with interferon-gamma release assay or tuberculin skin testing.

PubMed

Stockbridge, Erica L; Miller, Thaddeus L; Carlson, Erin K; Ho, Christine

2018-01-01

To determine whether latent tuberculosis infection risk factors are associated with an increased likelihood of latent tuberculosis infection testing in the US private healthcare sector. A national sample of medical and pharmacy claims representing services rendered January 2011 through December 2013 for 3,997,986 commercially insured individuals in the US who were 0 to 64 years of age. We used multivariable logistic regression models to determine whether TB/LTBI risk factors were associated with an increased likelihood of Interferon-Gamma Release Assay (IGRA) or Tuberculin Skin Test (TST) testing in the private sector. 4.31% (4.27-4.34%) received at least one TST/IGRA test between 2011 and 2013 while 1.69% (1.67-1.72%) received a TST/IGRA test in 2013. Clinical risk factors associated with a significantly increased likelihood of testing included HIV, immunosuppressive therapy, exposure to tuberculosis, a history of tuberculosis, diabetes, tobacco use, end stage renal disease, and alcohol use disorder. Other significant variables included gender, age, asthma, the state tuberculosis rate, population density, and percent of foreign-born persons in a county. Private sector TST/IGRA testing is not uncommon and testing varies with clinical risk indicators. Thus, the private sector can be a powerful resource in the fight against tuberculosis. Analyses of administrative data can inform how best to leverage private sector healthcare toward tuberculosis prevention activities.

Plasmacytoid dendritic cells control dengue and Chikungunya virus infections via IRF7-regulated interferon responses

PubMed Central

Zafirova, Biljana; This, Sébastien; Coléon, Séverin; Décembre, Elodie; Paidassi, Helena; Bouvier, Isabelle; Joubert, Pierre-Emmanuel; Duffy, Darragh; Walzer, Thierry

2018-01-01

Type I interferon (IFN-I) responses are critical for the control of RNA virus infections, however, many viruses, including Dengue (DENV) and Chikungunya (CHIKV) virus, do not directly activate plasmacytoid dendritic cells (pDCs), robust IFN-I producing cells. Herein, we demonstrated that DENV and CHIKV infected cells are sensed by pDCs, indirectly, resulting in selective IRF7 activation and IFN-I production, in the absence of other inflammatory cytokine responses. To elucidate pDC immunomodulatory functions, we developed a mouse model in which IRF7 signaling is restricted to pDC. Despite undetectable levels of IFN-I protein, pDC-restricted IRF7 signaling controlled both viruses and was sufficient to protect mice from lethal CHIKV infection. Early pDC IRF7-signaling resulted in amplification of downstream antiviral responses, including an accelerated natural killer (NK) cell-mediated type II IFN response. These studies revealed the dominant, yet indirect role of pDC IRF7-signaling in directing both type I and II IFN responses during arbovirus infections. PMID:29914621

Phleboviruses and the Type I Interferon Response

PubMed Central

Wuerth, Jennifer Deborah; Weber, Friedemann

2016-01-01

The genus Phlebovirus of the family Bunyaviridae contains a number of emerging virus species which pose a threat to both human and animal health. Most prominent members include Rift Valley fever virus (RVFV), sandfly fever Naples virus (SFNV), sandfly fever Sicilian virus (SFSV), Toscana virus (TOSV), Punta Toro virus (PTV), and the two new members severe fever with thrombocytopenia syndrome virus (SFTSV) and Heartland virus (HRTV). The nonstructural protein NSs is well established as the main phleboviral virulence factor in the mammalian host. NSs acts as antagonist of the antiviral type I interferon (IFN) system. Recent progress in the elucidation of the molecular functions of a growing list of NSs proteins highlights the astonishing variety of strategies employed by phleboviruses to evade the IFN system. PMID:27338447

Intranasal administration of poly-gamma glutamate induced antiviral activity and protective immune responses against H1N1 influenza A virus infection.

PubMed

Kim, Eun-Ha; Choi, Young-Ki; Kim, Chul-Joong; Sung, Moon-Hee; Poo, Haryoung

2015-10-06

The global outbreak of a novel swine-origin strain of the 2009 H1N1 influenza A virus and the sudden, worldwide increase in oseltamivir-resistant H1N1 influenza A viruses highlight the urgent need for novel antiviral therapy. Here, we investigated the antiviral efficacy of poly-gamma glutamate (γ-PGA), a safe and edible biomaterial that is naturally synthesized by Bacillus subtilis, against A/Puerto Rico/8/1934 (PR8) and A/California/04/2009 (CA04) H1N1 influenza A virus infections in C57BL/6 mice. Intranasal administration of γ-PGA for 5 days post-infection improved survival, increased production of antiviral cytokines including interferon-beta (IFN-β) and interleukin-12 (IL-12), and enhanced activation of natural killer (NK) cells and influenza antigen-specific cytotoxic T lymphocytes (CTL) activity. These results suggest that γ-PGA protects mice against H1N1 influenza A virus by enhancing antiviral immune responses.

The importance of communication in promoting voluntary participation in an experimental trial: A qualitative study based on the assessment of the gamma-interferon test for the diagnosis of bovine tuberculosis in France

PubMed Central

Dufour, Barbara; Praud, Anne

2017-01-01

Understanding the factors leading each stakeholder to participate in an experimental trial is a key element for improving trial set-up and for identifying selection bias in statistical analyses. An experimental protocol, validated by the European Commission, was developed in France to assess the ability of the gamma-interferon test in terms of accuracy to replace the second intradermal skin test in cases of suspected bovine tuberculosis. Implemented between 2013 and 2015, this experimental trial was based on voluntary participation. To determine and understand the motivation or reluctance of farmers to take part in this trial, we carried out a sociological survey in France. Our study was based on semi-structured interviews with the farmers and other stakeholders involved. The analysis of findings demonstrated that shortening the lock-up period during tuberculosis suspicion, following the use of a gamma-interferon test, was an important aim and a genuine challenge for the animal health stakeholders. However, some farmers did not wish to continue the trial because it could potentially have drastic consequences for them. Moreover, misunderstandings and confusion concerning the objectives and consequences of the trial led stakeholders to reject it forcefully. Based on our results, we offer some recommendations: clear and appropriate communication tools should be prepared to explain the protocol and its aims. In addition, these types of animal health trials should be designed with the stakeholders’ interests in mind. This study provides a better understanding of farmer motivations and stakeholder influences on trial participation and outcomes. The findings can be used to help design trials so that they promote participation by farmers and by all animal health stakeholders in general. PMID:28973018

Exosome-mediated miR-146a transfer suppresses type I interferon response and facilitates EV71 infection

PubMed Central

Fu, Yuxuan; Zhang, Li; Zhang, Fang; Tang, Ting; Zhou, Qi; Feng, Chunhong; Jin, Yu

2017-01-01

Exosomes can transfer genetic materials between cells. Their roles in viral infections are beginning to be appreciated. Researches have shown that exosomes released from virus-infected cells contain a variety of viral and host cellular factors that are able to modulate recipient’s cellular response and result in productive infection of the recipient host. Here, we showed that EV71 infection resulted in upregulated exosome secretion and differential packaging of the viral genomic RNA and miR-146a into exosomes. We provided evidence showing that miR-146a was preferentially enriched in exosomes while the viral RNA was not in infected cells. Moreover, the exosomes contained replication-competent EV71 RNA in complex with miR-146a, Ago2, and GW182 and could mediate EV71 transmission independent of virus-specific receptor. The exosomal viral RNA could be transferred to and replicate in a new target cell while the exosomal miR-146a suppressed type I interferon response in the target cell, thus facilitating the viral replication. Additionally, we found that the IFN-stimulated gene factors (ISGs), BST-2/tetherin, were involved in regulating EV71-induced upregulation of exosome secretion. Importantly, in vivo study showed that exosomal viral RNA exhibited differential tissue accumulation as compared to the free virus particles. Together, our findings provide evidence that exosomes secreted by EV71-infected cells selectively packaged high level miR-146a that can be functionally transferred to and facilitate exosomal EV71 RNA to replicate in the recipient cells by suppressing type I interferon response. PMID:28910400

Clearance of Virulent but Not Avirulent Rhodococcus equi from the Lungs of Adult Horses Is Associated with Intracytoplasmic Gamma Interferon Production by CD4+ and CD8+ T Lymphocytes

PubMed Central

Hines, Stephen A.; Stone, Diana M.; Hines, Melissa T.; Alperin, Debby C.; Knowles, Donald P.; Norton, Linda K.; Hamilton, Mary J.; Davis, William C.; McGuire, Travis C.

2003-01-01

Rhodococcus equi is a gram-positive bacterium that infects alveolar macrophages and causes rhodococcal pneumonia in horses and humans. The virulence plasmid of R. equi appears to be required for both pathogenicity in the horse and the induction of protective immunity. An understanding of the mechanisms by which virulent R. equi circumvents protective host responses and by which bacteria are ultimately cleared is important for development of an effective vaccine. Six adult horses were challenged with either virulent R. equi or an avirulent, plasmid-cured derivative. By using a flow cytometric method for intracytoplasmic detection of gamma interferon (IFN-γ) in equine bronchoalveolar lavage fluid (BALF) cells, clearance of the virulent strain was shown to be associated with increased numbers of pulmonary CD4+ and CD8+ T lymphocytes producing IFN-γ. There was no change in IFN-γ-positive cells in peripheral blood, suggesting that a type 1 recall response at the site of challenge was protective. The plasmid-cured strain of R. equi was cleared in horses without a significant increase in IFN-γ-producing T lymphocytes in BALF. In contrast to these data, a previous report in foals suggested an immunomodulating role for R. equi virulence plasmid-encoded products in downregulating IFN-γ expression by equine CD4+ T lymphocytes. Intracytoplasmic detection of IFN-γ provides a method to better determine whether modulation of macrophage-activating cytokines by virulent strains occurs uniquely in neonates and contributes to their susceptibility to rhodococcal pneumonia. PMID:12626444

The type I interferon response during viral infections: a "SWOT" analysis.

PubMed

Gaajetaan, Giel R; Bruggeman, Cathrien A; Stassen, Frank R

2012-03-01

The type I interferon (IFN) response is a strong and crucial moderator for the control of viral infections. The strength of this system is illustrated by the fact that, despite some temporary discomfort like a common cold or diarrhea, most viral infections will not cause major harm to the healthy immunocompetent host. To achieve this, the immune system is equipped with a wide array of pattern recognition receptors and the subsequent coordinated type I IFN response orchestrated by plasmacytoid dendritic cells (pDCs) and conventional dendritic cells (cDCs). The production of type I IFN subtypes by dendritic cells (DCs), but also other cells is crucial for the execution of many antiviral processes. Despite this coordinated response, morbidity and mortality are still common in viral disease due to the ability of viruses to exploit the weaknesses of the immune system. Viruses successfully evade immunity and infection can result in aberrant immune responses. However, these weaknesses also open opportunities for improvement via clinical interventions as can be seen in current vaccination and antiviral treatment programs. The application of IFNs, Toll-like receptor ligands, DCs, and antiviral proteins is now being investigated to further limit viral infections. Unfortunately, a common threat during stimulation of immunity is the possible initiation or aggravation of autoimmunity. Also the translation from animal models to the human situation remains difficult. With a Strengths-Weaknesses-Opportunities-Threats ("SWOT") analysis, we discuss the interaction between host and virus as well as (future) therapeutic options, related to the type I IFN system. Copyright © 2011 John Wiley & Sons, Ltd.

Chlamydia trachomatis Is Resistant to Inclusion Ubiquitination and Associated Host Defense in Gamma Interferon-Primed Human Epithelial Cells.

PubMed

Haldar, Arun K; Piro, Anthony S; Finethy, Ryan; Espenschied, Scott T; Brown, Hannah E; Giebel, Amanda M; Frickel, Eva-Maria; Nelson, David E; Coers, Jörn

2016-12-13

The cytokine gamma interferon (IFN-γ) induces cell-autonomous immunity to combat infections with intracellular pathogens, such as the bacterium Chlamydia trachomatis The present study demonstrates that IFN-γ-primed human cells ubiquitinate and eliminate intracellular Chlamydia-containing vacuoles, so-called inclusions. We previously described how IFN-γ-inducible immunity-related GTPases (IRGs) employ ubiquitin systems to mark inclusions for destruction in mouse cells and, furthermore, showed that the rodent pathogen Chlamydia muridarum blocks ubiquitination of its inclusions by interfering with mouse IRG function. Here, we report that ubiquitination of inclusions in human cells is independent of IRG and thus distinct from the murine pathway. We show that C. muridarum is susceptible to inclusion ubiquitination in human cells, while the closely related human pathogen C. trachomatis is resistant. C. muridarum, but not C. trachomatis, inclusions attract several markers of cell-autonomous immunity, including the ubiquitin-binding protein p62, the ubiquitin-like protein LC3, and guanylate-binding protein 1. Consequently, we find that IFN-γ priming of human epithelial cells triggers the elimination of C. muridarum, but not C. trachomatis, inclusions. This newly described defense pathway is independent of indole-2,3-dioxygenase, a known IFN-γ-inducible anti-Chlamydia resistance factor. Collectively, our observations indicate that C. trachomatis evolved mechanisms to avoid a human-specific, ubiquitin-mediated response as part of its unique adaptation to its human host. Chlamydia trachomatis is the leading cause of sexually transmitted bacterial infections and responsible for significant morbidity, including pelvic inflammatory disease, infertility, and ectopic pregnancies in women. As an obligate intracellular pathogen, C. trachomatis is in perpetual conflict with cell-intrinsic defense programs executed by its human host. Our study defines a novel anti

Identification of a human non-interferon lymphokine activating monocyte complement biosynthesis.

PubMed Central

Drouet, C; Reboul, A; Colomb, M

1989-01-01

A monocyte-stimulating activity produced by mitogen-induced mononuclear cells has been defined by its ability to enhance the synthesis in vitro of complement C1 subcomponents, C2 and C3. A lymphokine responsible for this activity was purified from culture supernatants of peripheral blood mononuclear cells activated by staphylococcal enterotoxin A. From 0.5 litre of supernatant the purification procedure [(NH4)2SO4 precipitation, phenyl-Sepharose chromatography and preparative electrofocusing] yielded about 100 pmol of purified lymphokine. Its pI is 7.9 and its Mr, estimated by SDS/polyacrylamide-gel electrophoresis, is 14,600, 27,000 and 56,000, the high-Mr species representing oligomeric forms of the Mr-14,600 molecule. Its amino acid analysis reveals a high percentage of hydrophobic amino acids (34%); the absence of histidine residues suggests that it is a novel monocyte-activating lymphokine. It enhances C1r and C1s biosynthesis at a pretranslational level. From its structure and activity this lymphokine appears different from gamma-interferon. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:2481436

Detection of bacterial pyrogens on the basis of their effects on gamma interferon-mediated formation of neopterin or nitrite in cultured monocyte cell lines.

PubMed Central

Werner-Felmayer, G; Baier-Bitterlich, G; Fuchs, D; Hausen, A; Murr, C; Reibnegger, G; Werner, E R; Wachter, H

1995-01-01

In a number of mammalian cell types, pteridine biosynthesis from guanosine 5'-triphosphate and formation of nitric oxide from L-arginine are induced by gamma interferon (IFN-gamma) and bacterial lipopolysaccharide (LPS). We assessed the possibility of using such metabolic alterations for the in vitro detection of pyrogens. Products from gram-negative and gram-positive bacteria and related synthetic compounds were tested for their potential to induce either of these pathways. Stimulation of pteridine biosynthesis was monitored as the formation of neopterin in the human myelomonocytic cell line THP-1. The formation of nitric oxide was determined as nitrite in murine J774A.1 macrophage cultures. The substances tested included toxic and detoxified parts of LPS and lipid A from Escherichia coli, Salmonella typhimurium, Salmonella minnesota, and Klebsiella pneumoniae as well as lipoteichoic acid and toxic shock syndrome toxin 1 from Staphylococcus aureus. Furthermore, two cell wall compounds from Mycobacterium tuberculosis, trehalose 6,6'-dimycolate and N-acetylmuramyl-L-alanyl-D-isoglutamine, which are active components of Freund's adjuvant, were used. When applied as a single stimulus, only the whole LPS molecule potently stimulated neopterin or nitrite formation. Lipid A and products from gram-positive bacteria were weakly active. For neopterin formation, lipid A required the presence of fetal calf serum. Besides detoxified LPS and independently from the presence of serum, all bacterial compounds tested strongly increased the effects mediated by IFN-gamma. Our results show that bacterial pyrogens can be detected by monitoring the formation of neopterin or nitrite. This may provide a basis for the development of an in vitro assay for the detection of pyrogenic contamination with the aim of replacing the currently used animal test. PMID:7664177

Gamma-interferon exerts a critical early restriction on replication and dissemination of yellow fever virus vaccine strain 17D-204.

PubMed

Lam, L K Metthew; Watson, Alan M; Ryman, Kate D; Klimstra, William B

2018-01-01

Live attenuated viruses are historically among the most effective viral vaccines. Development of a safe vaccine requires the virus to be less virulent, a phenotype that is historically arrived by empirical evaluation often leaving the mechanisms of attenuation unknown. The yellow fever virus 17D live attenuated vaccine strain has been developed as a delivery vector for heterologous antigens; however, the mechanisms of attenuation remain elusive. The successful and safe progress of 17D as a vaccine vector and the development of live attenuated vaccines (LAVs) to related flaviviruses requires an understanding of the molecular mechanisms leading to attenuation. Using subcutaneous infection of interferon-deficient mouse models of wild type yellow fever virus (WT YFV) pathogenesis and 17D-mediated immunity, we found that, in the absence of type I IFN (IFN-α/β), type II interferon (IFN-γ) restricted 17D replication, but not that of WT YFV, by 1-2 days post-infection. In this context, IFN-γ responses protected 17D-infected animals from mortality, largely restricted the virus to lymphoid organs, and eliminated viscerotropic disease signs such as steatosis in the liver and inflammatory cell infiltration into the spleen. However, WT YFV caused a disseminated infection, gross liver pathology, and rapid death of the animals. In vitro, IFN-γ treatment of myeloid cells suppressed the replication of 17D significantly more than that of WT YFV, suggesting a direct differential effect on 17D virus replication. Together these data indicate that an important mechanism of 17D attenuation in vivo is increased sensitivity to IFN-γ stimulated responses elicited early after infection.

[Association between Fok I vitamin D receptor (VDR) gene polymorphism and plasmatic concentrations of transforming growth factor-beta1 and interferon gamma in type 1 diabetes mellitus].

PubMed

López, Tatiana; García, Diego; Angel, Bárbara; Carrasco, Elena; Codner, Ethel; Ugarte, Francisca; Pérez-Bravo, Francisco

2008-02-02

In order to assess whether Fok I vitamin D receptor gene (VDR) polymorphism is involved in the genetic susceptibility of type 1 diabetes, a case-control study was conducted and VDR genotypes were related to serum concentrations of 25(OH) vitamin D and cytokines transforming growth factor beta1 (TGF-beta1) and interferon gamma (INF-gamma). 151 incident cases of type 1 diabetes and 182 non related healthy controls from Santiago were studied for VDR polymorphisms in peripheral blood DNA. Exon 2 (Fok I) segments were amplified by polimerase chain reaction and analyzed by means of restriction fragment length polymorphism to determine each corresponding genotype. Differences for allele, genotype and serological markers as 25(OH) vitamin D, TGF-beta1 and INF-gamma levels distribution between patients and controls were analyzed. Fok I polymorphism distribution analysis showed no differences between patients and controls. Among diabetics, higher levels of TGF-beta1 (median, 282.6 pg/ml; range, 131.8-3,031.4) were observed compared with healthy children (median, 232.2 pg/ml; range, 135.7-506.5) (p < 0.0038). Similar results were observed for INF-gamma concentrations (median, 121.1 pg/ml, and range, 5.3-228.8, in cases, and median, 89.6 pg/ml, and range, 10.9-117.2 in controls) (p < 0.0004). The diabetic carriers of the ff genotype showed low levels of 25(OH) vitamin D compared with the carriers of the F allele: mean (standard deviation), 23.1 (5.9) versus 27.9 (10.3) ng/ml (p < 0.03). A similar result was observed for TGF-beta1 concentrations in diabetic carriers of ff genotype and patients carriers of the F allele (298.5 versus 276.6; p < 0.05). Fok I polymorphism of VDR could have a marginal role in the immunologic disturbance in type 1 diabetes.

Treatment of inflammatory airway disease in young standardbreds with interferon alpha

PubMed Central

2004-01-01

Abstract The effect of oral treatment with natural or recombinant human interferon alpha (HIA) on inflammatory airway disease in young standardbreds was assessed in a double-blind, randomized clinical trial. A total of 34 horses with nasal discharge, excess mucus in the trachea, and a persistent cough of at least 2 weeks’ duration that interfered with training completed the trial. Horses were rested for 1 week and received oral treatment with either a saline placebo, recombinant human interferon alpha (rHIA; 90 U/horse/day), or natural human interferon alpha (nHIA: 50 U/horse/day) for 5 days. There was a significant decline in nasal discharge and cough scores in all groups and the apparent response rate was similar. However, significantly fewer horses relapsed within 2 weeks once treatment was ceased when interferon rather than placebo was used (P = 0.012). Seventeen of 22 horses treated with rHIA or nHIA were cough-free 4 weeks after treatment, compared with only 4 of 12 after treatment with the placebo. Treatment with oral interferon is a useful adjunct to rest in standardbreds with inflammatory airway disease. PMID:15317391

Plasma interferon-gamma-inducible protein-10 (IP-10) levels during acute hepatitis C virus infection

PubMed Central

Grebely, Jason; Feld, Jordan J.; Applegate, Tanya; Matthews, Gail V.; Hellard, Margaret; Sherker, Alana; Petoumenos, Kathy; Zang, Geng; Shaw, Ineke; Yeung, Barbara; George, Jacob; Teutsch, Suzy; Kaldor, John M.; Cherepanov, Vera; Bruneau, Julie; Shoukry, Naglaa H.; Lloyd, Andrew R.; Dore, Gregory J.

2013-01-01

Systemic levels of interferon-gamma-inducible protein-10 (IP-10) are predictive of treatment-induced clearance in chronic HCV. In the present study, factors associated with plasma IP-10 levels at the time of acute HCV detection and the association between IP-10 levels and spontaneous clearance were assessed in three cohorts of acute HCV infection. Among 300 individuals, 245 (181 male, 47 HIV+) were HCV RNA+ at acute HCV detection. In adjusted analysis, factors independently associated with IP-10 levels ≥150 pg/mL (median level) included HCV RNA levels >6 log IU/mL, HIV co-infection and non-Aboriginal ethnicity. Among 245 HCV RNA+ at acute HCV detection, 214 were untreated (n=137) or had persistent infection (infection duration ≥26 weeks) at treatment initiation (n=77). Spontaneous clearance occurred in 14% (29 of 214). Individuals without spontaneous clearance had significantly higher mean plasma IP-10 levels at the time of acute HCV detection than those with clearance (248±32 vs. 142±22 pg/mL, P=0.008). The proportion of individuals with spontaneous clearance was 0% (0 of 22, P=0.048) and 16% (27 of 165) and in those in those with and without plasma IP-10 levels ≥380 pg/mL. In adjusted analyses, favourable IL28B genotype was associated with spontaneous clearance, while higher HCV RNA level was independently associated with lower odds of spontaneous clearance. Conclusion High IP-10 levels at acute HCV detection were associated with failure to spontaneously clear HCV. Patients with acute HCV and high baseline IP-10 levels, particularly >380 pg/mL, should be considered for early therapeutic intervention, and those with low levels should defer therapy for potential spontaneous clearance. PMID:23325615

Regulation of Production of Mucosal Antibody to Pneumococcal Protein Antigens by T-Cell-Derived Gamma Interferon and Interleukin-10 in Children

PubMed Central

Zhang, Qibo; Bernatoniene, Jolanta; Bagrade, Linda; Paton, James C.; Mitchell, Timothy J.; Hammerschmidt, Sven; Nunez, Desmond A.; Finn, Adam

2006-01-01

Nasopharyngeal tonsils (adenoids) are part of human nasopharynx-associated lymphoid tissue, which may play an important role in local defense against pneumococci. Recent studies with animals have suggested that several pneumococcal proteins, including CbpA and pneumolysin (Ply), may be vaccine candidates. Our recent data obtained with children suggest that antibodies to these proteins may protect against carriage. This study was performed to investigate the regulation of the T-cell-dependent antibody responses to CbpA and pneumolysin by cytokines in adenoidal immune cells from children. Adenoidal mononuclear cells (MNC) were cultured with pneumococcal concentrated culture supernatants (CCS) or recombinant proteins. Cytokine expression profiles in adenoidal MNC after antigen stimulation were analyzed by reverse transcription-PCR, protein array analysis, and an immunoassay, along with an antibody production analysis. The roles, interactions, and cellular sources of the main cytokines identified were evaluated further. Pneumococcal CCS induced production of CbpA- and Ply-specific antibodies in association with several chemokines and cytokines, including gamma interferon (IFN-γ) and interleukin-10 (IL-10) in MNC. The antibody production correlated well with the concentrations of these two cytokines. Addition of recombinant IFN-γ or IL-10 enhanced antibody production, and monoclonal antibodies to these two cytokines and T-cell depletion significantly reduced antibody production. Intracellular cytokine staining showed that T cells are a major source of IFN-γ and IL-10. Recombinant Ply and, to a lesser extent, recombinant CbpA induced significant production of IFN-γ and IL-10 in MNC. T-cell-derived IFN-γ and IL-10 may be key regulators of production of mucosal antibody to pneumococcal protein antigens in the nasopharynx and may play an important role in local protection against pneumococcal infection in children. PMID:16861661

Interleukin-28B polymorphisms and interferon gamma inducible protein-10 serum levels in seronegative occult hepatitis C virus infection.

PubMed

Bartolomé, Javier; Castillo, Inmaculada; Quiroga, Juan Antonio; Carreño, Vicente

2016-02-01

Polymorphisms upstream interleukin (IL)-28B gene and serum levels of interferon gamma inducible protein-10 (IP-10) are associated with spontaneous and treatment-induced hepatitis C virus (HCV) clearance. Patients with seronegative occult HCV infection are anti-HCV and serum HCV-RNA negative but have viral RNA in liver and abnormal values of liver enzymes. We examined if the rs12979860 polymorphism of IL-28B and serum IP-10 levels differ between chronic and seronegative occult CV infection. IL-28B polymorphism was determined with allele specific TaqMan probes in total DNA isolated from peripheral blood mononuclear cells and IP-10 by an enzyme-linked immunosorbent assay in serum from 99 patients with seronegative occult HCV infection and 130 untreated patients with chronic hepatitis C. IL-28B genotypes were also determined in 54 healthy volunteers. Prevalence of the IL-28B CC genotype was significantly higher in seronegative occult HCV infection (52/99; 52.5%) than in chronic hepatitis C (32/130; 24.6%, P < 0.0001) or healthy controls (19/54: 32.5%, P = 0.039). Among patients with seronegative occult HCV infection, HCV-RNA load in liver was significantly lower in those with the IL-28B CC genotype than in those with CT + TT genotypes (2.8 × 10(5)  ± 5.8 × 10(4) vs. 4.1 × 10(5)  ± 5.9 × 10(4)  copies/μg of total RNA respectively; P = 0.023). Mean serum IP-10 levels were significantly lower in patients with seronegative occult HCV infection than in patients with chronic hepatitis C (160.8 ± 17.9 vs. 288.7 ± 13.3 pg/ml respectively; P < 0.0001). These findings suggest that the host immune response plays an important role in seronegative occult HCV infection in comparison with chronic hepatitis C. © 2015 Wiley Periodicals, Inc.

Results of interferon treatment in children with chronic hepatitis B.

PubMed

Grigorescu-Sido, Paula; Călin, Lazăr; Manasia, Rodica; Mireştean, Stefan; Creţ, Victoria; Skorka, Cristina; Grigorescu-Sido, Anca

2002-12-01

Many observations report a variable therapeutical response to interferon in children with chronic hepatitis B. In order to evaluate the efficiency of alpha-interferon treatment in the downregulation of viral replication and in the eradication of infection in these patients, we assessed HBeAg/HBeAb and HBsAg/HBsAb seroconversion (as well as with clinical outcome and the changes in the plasma level of aminotransferases) in 61 treated patients. The diagnosis was established by means of the usual clinical, biochemical and histopathological criteria. There was no possibility to viral DNA test and no control group was included. Patients were selected for interferon treatment who displayed at least a two fold rise in the plasma level of aminotransferases as compared to normal values, as well as necroinflammatory activity (score > or = 6) and positive HBeAg as a marker of viral replication. Treatment was carried out with alpha-2a interferon or alpha-2b interferon in a dose of 3 million U/m2/dose in 3 weekly doses for a period of 4-6 months. The monitoring interval was 6.6+/-3 years. HBeAg/HBeAb seroconversion was registered in 77.2% of the patients and mainly occurred during the first year of follow-up (50.9 %). HBsAg/HBsAb seroconversion was revealed in 1.75% of the cases. The therapeutical response was complete, incomplete, transient and absent in 1.75%, 64.9%, 10.5% and 22.8% of the patients, respectively. The results show that the eradication of HBV infection is insignificant, but the downregulation of viral replication and, subsequently the halt of further progression of hepatic lesions is obtained in a high percentage of cases, highlighting the efficiency of this treatment in children with chronic hepatitis B

Host Defense against Viral Infection Involves Interferon Mediated Down-Regulation of Sterol Biosynthesis

PubMed Central

Blanc, Mathieu; Hsieh, Wei Yuan; Robertson, Kevin A.; Watterson, Steven; Shui, Guanghou; Lacaze, Paul; Khondoker, Mizanur; Dickinson, Paul; Sing, Garwin; Rodríguez-Martín, Sara; Phelan, Peter; Forster, Thorsten; Strobl, Birgit; Müller, Matthias; Riemersma, Rudolph; Osborne, Timothy; Wenk, Markus R.; Angulo, Ana; Ghazal, Peter

2011-01-01

Little is known about the protective role of inflammatory processes in modulating lipid metabolism in infection. Here we report an intimate link between the innate immune response to infection and regulation of the sterol metabolic network characterized by down-regulation of sterol biosynthesis by an interferon regulatory loop mechanism. In time-series experiments profiling genome-wide lipid-associated gene expression of macrophages, we show a selective and coordinated negative regulation of the complete sterol pathway upon viral infection or cytokine treatment with IFNγ or β but not TNF, IL1β, or IL6. Quantitative analysis at the protein level of selected sterol metabolic enzymes upon infection shows a similar level of suppression. Experimental testing of sterol metabolite levels using lipidomic-based measurements shows a reduction in metabolic output. On the basis of pharmacologic and RNAi inhibition of the sterol pathway we show augmented protection against viral infection, and in combination with metabolite rescue experiments, we identify the requirement of the mevalonate-isoprenoid branch of the sterol metabolic network in the protective response upon statin or IFNβ treatment. Conditioned media experiments from infected cells support an involvement of secreted type 1 interferon(s) to be sufficient for reducing the sterol pathway upon infection. Moreover, we show that infection of primary macrophages containing a genetic knockout of the major type I interferon, IFNβ, leads to only a partial suppression of the sterol pathway, while genetic knockout of the receptor for all type I interferon family members, ifnar1, or associated signaling component, tyk2, completely abolishes the reduction of the sterol biosynthetic activity upon infection. Levels of the proteolytically cleaved nuclear forms of SREBP2, a key transcriptional regulator of sterol biosynthesis, are reduced upon infection and IFNβ treatment at both the protein and de novo transcription level. The

Gamma prime precipitation modeling and strength responses in powder metallurgy superalloys

NASA Astrophysics Data System (ADS)

Mao, Jian

Precipitation-hardened nickel-based superalloys have been widely used as high temperature structural materials in gas turbine engine applications for more than 50 years. Powder metallurgy (P/M) technology was introduced as an innovative manufacturing process to overcome severe segregation and poor workability of alloys with high alloying contents. The excellent mechanical properties of P/M superalloys also depend upon the characteristic microstructures, including grain size and size distribution of gamma' precipitates. Heat treatment is the most critical processing step that has ultimate influences on the microstructure, and hence, on the mechanical properties of the materials. The main objective of this research was to study the gamma ' precipitation kinetics in various cooling circumstances and also study the strength response to the cooling history in two model alloys, Rne88DT and U720LI. The research is summarized below: (1) An experimental method was developed to allow accurate simulation and control of any desired cooling profile. Two novel cooling methods were introduced: continuous cooling and interrupt cooling. Isothermal aging was also carried out. (2) The growth and coarsening kinetics of the cooling gamma' precipitates were experimentally studied under different cooling and aging conditions, and the empirical equations were established. It was found that the cooling gamma' precipitate versus the cooling rate follows a power law. The gamma' precipitate size versus aging time obeys the LSW cube law for coarsening. (3) The strengthening of the material responses to the cooling rate and the decreasing temperature during cooling was investigated in both alloys. The tensile strength increases with the cooling rate. In addition, the non-monotonic response of strength versus interrupt temperature is of great interest. (4) An energy-driven model integrated with the classic growth and coarsen theories was successfully embedded in a computer program developed to

A Recombinant Adenovirus Expressing Ovine Interferon Tau Prevents Influenza Virus-Induced Lethality in Mice.

PubMed

Martín, V; Pascual, E; Avia, M; Rangel, G; de Molina, A; Alejo, A; Sevilla, N

2016-01-06

Ovine interferon tau (IFN-τ) is a unique type I interferon with low toxicity and a broad host range in vivo. We report the generation of a nonreplicative recombinant adenovirus expressing biologically active IFN-τ. Using the B6.A2G-Mx1 mouse model, we showed that single-dose intranasal administration of recombinant Ad5-IFN-τ can effectively prevent lethality and disease induced by highly virulent hv-PR8 influenza virus by activating the interferon response and preventing viral replication. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Adenoviral mediated interferon-alpha 2b gene therapy suppresses the pro-angiogenic effect of vascular endothelial growth factor in superficial bladder cancer.

PubMed

Adam, Liana; Black, Peter C; Kassouf, Wassim; Eve, Beryl; McConkey, David; Munsell, Mark F; Benedict, William F; Dinney, Colin P N

2007-05-01

Intravesical adenovirus mediated interferon-alpha gene transfer has a potent therapeutic effect against superficial human bladder carcinoma xenografts growing in the bladder of athymic nude mice. We determined whether the inhibition of angiogenesis might contribute to the antitumor effect. We treated several human urothelial carcinoma cells with adenovirus mediated interferon-alpha 2b and monitored its effects on the production of angiogenic factors using real-time reverse-transcription polymerase chain reaction, Western blotting, and immunohistochemical analysis and a gel shift based transcription factor array. To assess the role of adenovirus mediated interferon 2b in angiogenic activity we used in vitro invasion assays and evaluated the anti-angiogenic effects of adenovirus mediated interferon gene therapy in an orthotopic murine model of human superficial bladder cancer. In adenovirus mediated interferon-alpha infected 253J B-V cells vascular endothelial growth factor was decreased and anti-angiogenic interferon-gamma inducible protein 10 was up-regulated. In contrast, the addition of as much as 100,000 IU recombinant interferon had no apparent effect on vascular endothelial growth factor production. Conditioned medium derived from adenovirus mediated interferon 2b infected 253J B-V cells greatly decreased the invasive potential of human endothelial cells and down-regulated their matrix metalloproteinase 2 expression compared to controls. Furthermore, adenovirus mediated interferon 2b blocked pro-angiogenic nuclear signals, such as the transcription factors activating protein-1 and 2, stimulating protein-1, nuclear factor kappaB and c-myb. In vivo experiments revealed significant vascular endothelial growth factor down-regulation and decreased tumor vessel density in the adenovirus mediated interferon 2b treated group compared to controls. Treatment with adenovirus mediated interferon 2b increases the angiostatic activity of the bladder cancer microenvironment

IFN-gamma receptor-deficient mice generate antiviral Th1-characteristic cytokine profiles but altered antibody responses.

PubMed

Schijns, V E; Haagmans, B L; Rijke, E O; Huang, S; Aguet, M; Horzinek, M C

1994-09-01

The lymphokine IFN-gamma is a pleiotropic immunomodulator and possesses intrinsic antiviral activity. We studied its significance in the development of antiviral immune responses by using IFN-gamma receptor-deficient (IFN-gamma R-/-) mice. After inoculation with live attenuated pseudorabies virus (PRV), the mutant mice showed no infectivity titers in various tissues, and transient viral Ag expression only in the spleen, similar as in wild-type mice. However, the absence of the IFN-gamma R resulted in increased proliferative splenocyte responses. The PRV-immune animals showed a normal IFN-gamma and IL-2 production, without detectable IL-4, and with decreased IL-10 secretion in response to viral Ag or Con A. Immunohistochemically, an increased ratio of IFN-gamma:IL-4-producing spleen cells was found. After immunization with either live attenuated or inactivated PRV, IFN-gamma R-/- mice produced significantly less antiviral Ab, and more succumbed to challenge infection than the intact control animals. The reduction in Ab titers in the mutant mice correlated with lower protection by their sera in transfer experiments. Our data demonstrate that ablation of the IFN-gamma receptor surprisingly does not inhibit the generation of antiviral Th1-type and increase Th2-type cytokine responses. However, it profoundly impairs the generation of protective antiviral Ab.

Dose response and repair kinetics of gamma-H2AX foci induced by in vitro irradiation of whole blood and T-lymphocytes with X- and gamma-radiation.

PubMed

Beels, Laurence; Werbrouck, Joke; Thierens, Hubert

2010-09-01

Dose response and repair kinetics of phosphorylated histone H2A isoform X (gamma-H2AX) foci in T-lymphocytes were investigated in the low-dose range after in vitro irradiation of whole blood and T-lymphocytes with 100 kVp X-rays and (60)Co gamma-rays. Whole blood or isolated T-lymphocytes were irradiated in vitro and gamma-H2AX foci were scored. Dose response was determined in the 0-500 mGy dose range. Foci kinetics were studied at doses of 5 and 200 mGy up to 24 h post-irradiation. After X-irradiation, the dose response for whole blood shows a biphasic behaviour with a low-dose hypersensitivity, which is less pronounced for isolated T-lymphocytes. In contrast, gamma-radiation shows a linear dose response for both irradiation conditions. Concerning repair kinetics, delayed repair was found after X-ray whole blood irradiation (5 and 200 mGy) with 40% of the foci persisting 24 h post-irradiation. This number of foci is reduced to 10% after irradiation of isolated T-lymphocytes with 200 mGy X-rays. On the contrary, gamma-H2AX foci are reduced to background levels 24 h post-irradiation with 200 mGy (60)Co gamma-rays. gamma-H2AX foci response and repair kinetics depend on irradiation conditions and radiation quality, possibly linked to Bystander response.

[Plasma levels of interferon gamma and interleukin 10 in patients with lymphonodular toxoplasmosis].

PubMed

Bielec, D; Patorska-Mach, E; Semczuk, G; Toruń, E

1997-01-01

The concentrations of IFN gamma and IL 10 in plasma of sixteen patients with toxoplasmic lymphadenopathy were measured. These examinations were carried out two times in the interval of a month. We found increased level of IFN gamma and normal concentrations of IL 10 in both of these terms.

Roles of CD4+ T Cells and Gamma Interferon in Protective Immunity against Babesia microti Infection in Mice

PubMed Central

Igarashi, Ikuo; Suzuki, Reiko; Waki, Seiji; Tagawa, Yoh-Ichi; Seng, Seyha; Tum, Sothyra; Omata, Yoshitaka; Saito, Atsushi; Nagasawa, Hideyuki; Iwakura, Yohichiro; Suzuki, Naoyoshi; Mikami, Takeshi; Toyoda, Yutaka

1999-01-01

Babesia microti produces a self-limiting infection in mice, and recovered mice are resistant to reinfection. In the present study, the role of T cells in protective immunity against challenge infection was examined. BALB/c mice which recovered from primary infection showed strong protective immunity against challenge infection. In contrast, nude mice which failed to control the primary infection and were cured with an antibabesial drug did not show protection against challenge infection. Treatment of immune mice with anti-CD4 monoclonal antibody (MAb) diminished the protective immunity against challenge infection, but treatment with anti-CD8 MAb had no effect on the protection. Transfer of CD4+ T-cell-depleted spleen cells resulted in higher parasitemia than transfer of CD8+ T-cell-depleted spleen cells. A high level of gamma interferon (IFN-γ), which was produced by CD4+ T cells, was observed for the culture supernatant of spleen cells from immune mice, and treatment of immune mice with anti-IFN-γ MAb partially reduced the protection. Moreover, no protection against challenge infection was found in IFN-γ-deficient mice. On the other hand, treatment of immune mice with MAbs against interleukin-2 (IL-2), IL-4, or tumor necrosis factor alpha did not affect protective immunity. These results suggest essential requirements for CD4+ T cells and IFN-γ in protective immunity against challenge infection with B. microti. PMID:10417185

An IRF-3-, IRF-5-, and IRF-7-Independent Pathway of Dengue Viral Resistance Utilizes IRF-1 to Stimulate Type I and II Interferon Responses.

PubMed

Carlin, Aaron F; Plummer, Emily M; Vizcarra, Edward A; Sheets, Nicholas; Joo, Yunichel; Tang, William; Day, Jeremy; Greenbaum, Jay; Glass, Christopher K; Diamond, Michael S; Shresta, Sujan

2017-11-07

Interferon-regulatory factors (IRFs) are a family of transcription factors (TFs) that translate viral recognition into antiviral responses, including type I interferon (IFN) production. Dengue virus (DENV) and other clinically important flaviviruses are suppressed by type I IFN. While mice lacking the type I IFN receptor (Ifnar1 -/- ) succumb to DENV infection, we found that mice deficient in three transcription factors controlling type I IFN production (Irf3 -/- Irf5 -/- Irf7 -/- triple knockout [TKO]) survive DENV challenge. DENV infection of TKO mice resulted in minimal type I IFN production but a robust type II IFN (IFN-γ) response. Using loss-of-function approaches for various molecules, we demonstrate that the IRF-3-, IRF-5-, IRF-7-independent pathway predominantly utilizes IFN-γ and, to a lesser degree, type I IFNs. This pathway signals via IRF-1 to stimulate interleukin-12 (IL-12) production and IFN-γ response. These results reveal a key antiviral role for IRF-1 by activating both type I and II IFN responses during DENV infection. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Interferon Lambda: A New Sword in Cancer Immunotherapy

PubMed Central

Lasfar, Ahmed; Abushahba, Walid; Balan, Murugabaskar; Cohen-Solal, Karine A.

2011-01-01

The discovery of the interferon-lambda (IFN-λ) family has considerably contributed to our understanding of the role of interferon not only in viral infections but also in cancer. IFN-λ proteins belong to the new type III IFN group. Type III IFN is structurally similar to type II IFN (IFN-γ) but functionally identical to type I IFN (IFN-α/β). However, in contrast to type I or type II IFNs, the response to type III IFN is highly cell-type specific. Only epithelial-like cells and to a lesser extent some immune cells respond to IFN-λ. This particular pattern of response is controlled by the differential expression of the IFN-λ receptor, which, in contrast to IFN-α, should result in limited side effects in patients. Recently, we and other groups have shown in several animal models a potent antitumor role of IFN-λ that will open a new challenging era for the current IFN therapy. PMID:22190970

Hijacking of RIG-I signaling proteins into virus-induced cytoplasmic structures correlates with the inhibition of type I interferon responses.

PubMed

Santiago, Felix W; Covaleda, Lina M; Sanchez-Aparicio, Maria T; Silvas, Jesus A; Diaz-Vizarreta, Ana C; Patel, Jenish R; Popov, Vsevolod; Yu, Xue-jie; García-Sastre, Adolfo; Aguilar, Patricia V

2014-04-01

Recognition of viral pathogens by the retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) family results in the activation of type I interferon (IFN) responses. To avoid this response, most viruses have evolved strategies that target different essential steps in the activation of host innate immunity. In this study, we report that the nonstructural protein NSs of the newly described severe fever with thrombocytopenia syndrome virus (SFTSV) is a potent inhibitor of IFN responses. The SFTSV NSs protein was found to inhibit the activation of the beta interferon (IFN-β) promoter induced by viral infection and by a RIG-I ligand. Astonishingly, we found that SFTSV NSs interacts with and relocalizes RIG-I, the E3 ubiquitin ligase TRIM25, and TANK-binding kinase 1 (TBK1) into SFTSV NSs-induced cytoplasmic structures. Interestingly, formation of these SFTSV NSs-induced structures occurred in the absence of the Atg7 gene, a gene essential for autophagy. Furthermore, confocal microscopy studies revealed that these SFTSV NSs-induced structures colocalize with Rab5 but not with Golgi apparatus or endoplasmic reticulum markers. Altogether, the data suggest that sequestration of RIG-I signaling molecules into endosome-like structures may be the mechanism used by SFTSV to inhibit IFN responses and point toward a novel mechanism for the suppression of IFN responses. The mechanism by which the newly described SFTSV inhibits host antiviral responses has not yet been fully characterized. In this study, we describe the redistribution of RIG-I signaling components into virus-induced cytoplasmic structures in cells infected with SFTSV. This redistribution correlates with the inhibition of host antiviral responses. Further characterization of the interplay between the viral protein and components of the IFN responses could potentially provide targets for the rational development of therapeutic interventions.

Hijacking of RIG-I Signaling Proteins into Virus-Induced Cytoplasmic Structures Correlates with the Inhibition of Type I Interferon Responses

PubMed Central

Santiago, Felix W.; Covaleda, Lina M.; Sanchez-Aparicio, Maria T.; Silvas, Jesus A.; Diaz-Vizarreta, Ana C.; Patel, Jenish R.; Popov, Vsevolod; Yu, Xue-jie; García-Sastre, Adolfo

2014-01-01

ABSTRACT Recognition of viral pathogens by the retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) family results in the activation of type I interferon (IFN) responses. To avoid this response, most viruses have evolved strategies that target different essential steps in the activation of host innate immunity. In this study, we report that the nonstructural protein NSs of the newly described severe fever with thrombocytopenia syndrome virus (SFTSV) is a potent inhibitor of IFN responses. The SFTSV NSs protein was found to inhibit the activation of the beta interferon (IFN-β) promoter induced by viral infection and by a RIG-I ligand. Astonishingly, we found that SFTSV NSs interacts with and relocalizes RIG-I, the E3 ubiquitin ligase TRIM25, and TANK-binding kinase 1 (TBK1) into SFTSV NSs-induced cytoplasmic structures. Interestingly, formation of these SFTSV NSs-induced structures occurred in the absence of the Atg7 gene, a gene essential for autophagy. Furthermore, confocal microscopy studies revealed that these SFTSV NSs-induced structures colocalize with Rab5 but not with Golgi apparatus or endoplasmic reticulum markers. Altogether, the data suggest that sequestration of RIG-I signaling molecules into endosome-like structures may be the mechanism used by SFTSV to inhibit IFN responses and point toward a novel mechanism for the suppression of IFN responses. IMPORTANCE The mechanism by which the newly described SFTSV inhibits host antiviral responses has not yet been fully characterized. In this study, we describe the redistribution of RIG-I signaling components into virus-induced cytoplasmic structures in cells infected with SFTSV. This redistribution correlates with the inhibition of host antiviral responses. Further characterization of the interplay between the viral protein and components of the IFN responses could potentially provide targets for the rational development of therapeutic interventions. PMID:24478431

Reversion and conversion of Mycobacterium tuberculosis IFN-gamma ELISpot results during anti-tuberculous treatment in HIV-infected children.

PubMed

Connell, Tom G; Davies, Mary-Ann; Johannisen, Christine; Wood, Kathryn; Pienaar, Sandy; Wilkinson, Katalin A; Wilkinson, Robert J; Zar, Heather J; Beatty, David; Nicol, Mark P; Curtis, Nigel; Eley, Brian

2010-05-27

Recent interest has focused on the potential use of serial interferon gamma (IFN-gamma) release assay (IGRA) measurements to assess the response to anti-tuberculous (TB) treatment. The kinetics of IFN-gamma responses to Mycobacterium tuberculosis (MTB) antigens in HIV-infected children during treatment have not however been previously investigated. IFN-gamma responses to the MTB antigens, ESAT-6, CFP-10 and PPD were measured by an enzyme-linked immunospot assay (IFN-gamma ELISpot) at presentation and at one, two and six months after starting anti-tuberculous treatment in HIV-infected children with definite or probable TB. Responses at different time points were compared using a Mann-Whitney U test with paired data analysed using the Wilcoxon signed rank test. A Fisher's exact or Chi-squared test was used to compare proportions when test results were analysed as dichotomous outcomes. Of 102 children with suspected TB, 22 (21%) had definite TB and 24 (23%) probable TB. At least one follow up IFN-gamma ELISpot assay result was available for 31 (67%) of the 46 children. In children with definite or probable TB in whom the IFN-gamma ELISpot assay result was positive at presentation, anti-tuberculous treatment was accompanied by a significant decrease in both the magnitude of the IFN-gamma response to individual or combined MTB-specific antigens (ESAT-6 median 110 SFCs/106 PBMC (IQR 65-305) at presentation vs. 15 (10-115) at six months, p = 0.04; CFP-10 177 (48-508) vs. 20 (5-165), p = 0.004, ESAT-6 or CFP-10 median 250 SFCs/106 PBMC (IQR 94-508) vs. 25 (10-165), p = 0.004) and in the proportion of children with a positive IFN-gamma ELISpot assay (Fisher's exact test: ESAT-6 15/0 vs 5/11, p = 0.0002, CFP-10 22/0 vs 8/17, p = 0.0001, ESAT-6 or CFP-10 22/0 vs. 9/17, p= 0.002). However almost half of the children had a positive IFN-gamma ELISpot assay after six months of anti-tuberculous treatment. In addition, there was conversion of the IFN-gamma ELISpot assay result

Hepatitis E virus persists in the presence of a type III interferon response.

PubMed

Yin, Xin; Li, Xinlei; Ambardekar, Charuta; Hu, Zhimin; Lhomme, Sébastien; Feng, Zongdi

2017-05-01

The RIG-I-like RNA helicase (RLR)-mediated interferon (IFN) response plays a pivotal role in the hepatic antiviral immunity. The hepatitis A virus (HAV) and the hepatitis C virus (HCV) counter this response by encoding a viral protease that cleaves the mitochondria antiviral signaling protein (MAVS), a common signaling adaptor for RLRs. However, a third hepatotropic RNA virus, the hepatitis E virus (HEV), does not appear to encode a functional protease yet persists in infected cells. We investigated HEV-induced IFN responses in human hepatoma cells and primary human hepatocytes. HEV infection resulted in persistent virus replication despite poor spread. This was companied by a type III IFN response that upregulated multiple IFN-stimulated genes (ISGs), but type I IFNs were barely detected. Blocking type III IFN production or signaling resulted in reduced ISG expression and enhanced HEV replication. Unlike HAV and HCV, HEV did not cleave MAVS; MAVS protein size, mitochondrial localization, and function remained unaltered in HEV-replicating cells. Depletion of MAVS or MDA5, and to a less extent RIG-I, also diminished IFN production and increased HEV replication. Furthermore, persistent activation of the JAK/STAT signaling rendered infected cells refractory to exogenous IFN treatment, and depletion of MAVS or the receptor for type III IFNs restored the IFN responsiveness. Collectively, these results indicate that unlike other hepatotropic RNA viruses, HEV does not target MAVS and its persistence is associated with continuous production of type III IFNs.

Effects of adenoviral delivered interferon-alpha on porcine reproductive and respiratory syndrome virus infection in swine.

USDA-ARS?s Scientific Manuscript database

Type I interferons, such as interferon alpha (IFN-alpha), contribute to innate antiviral immunity by promoting production of antiviral mediators and also play a role in the adaptive immune response. Porcine reproductive and respiratory syndrome (PRRS) is one of the most devastating and costly diseas...

Hepatitis A and hepatitis C viruses: divergent infection outcomes marked by similarities in induction and evasion of interferon responses.

PubMed

Qu, Lin; Lemon, Stanley M

2010-11-01

Hepatitis A and hepatitis C viruses (HAV and HCV) are both positive-strand ribonucleic acid (RNA) viruses with hepatotropic lifestyles. Despite several important differences, they share many biological and molecular features and similar genome replication schemes. Despite this, HAV infections are usually effectively controlled by the host with elimination of the virus, whereas HCV most often is able to establish lifelong persistent infection. The mechanisms underlying this difference are unknown. The cellular helicases RIG-I and MDA5, and Toll-like receptor 3, are pattern recognition receptors that sense virus-derived RNAs within hepatocytes in the liver. Activation of these receptors leads to their interaction with specific adaptor proteins, mitochondrial antiviral signaling protein (MAVS) and TIR-domain-containing adapter-inducing interferon-β (TRIF), respectively, which engage downstream kinases to activate two crucial transcription factors, nuclear factor kappa B (NF-κB) and interferon regulatory factor 3 (IRF3). This results in the induction of interferons (IFNs) and IFN-stimulated genes that ultimately establish an antiviral state. These signaling pathways are central to host antiviral defense and thus frequent targets for viral interference. Both HAV and HCV express proteases that target signal transduction through these pathways and that block the induction of IFNs upon sensing of viral RNA by these receptors. An understanding of the differences and similarities in the early innate immune responses to these infections is likely to provide important insights into the mechanism underlying the long-term persistence of HCV. © Thieme Medical Publishers.

The Rhoptry Proteins ROP18 and ROP5 Mediate Toxoplasma gondii Evasion of the Murine, But Not the Human, Interferon-Gamma Response

PubMed Central

Niedelman, Wendy; Gold, Daniel A.; Rosowski, Emily E.; Sprokholt, Joris K.; Lim, Daniel; Farid Arenas, Ailan; Melo, Mariane B.; Spooner, Eric; Yaffe, Michael B.; Saeij, Jeroen P. J.

2012-01-01

The obligate intracellular parasite Toxoplasma gondii secretes effector proteins into the host cell that manipulate the immune response allowing it to establish a chronic infection. Crosses between the types I, II and III strains, which are prevalent in North America and Europe, have identified several secreted effectors that determine strain differences in mouse virulence. The polymorphic rhoptry protein kinase ROP18 was recently shown to determine the difference in virulence between type I and III strains by phosphorylating and inactivating the interferon-γ (IFNγ)-induced immunity-related GTPases (IRGs) that promote killing by disrupting the parasitophorous vacuole membrane (PVM) in murine cells. The polymorphic pseudokinase ROP5 determines strain differences in virulence through an unknown mechanism. Here we report that ROP18 can only inhibit accumulation of the IRGs on the PVM of strains that also express virulent ROP5 alleles. In contrast, specific ROP5 alleles can reduce IRG coating even in the absence of ROP18 expression and can directly interact with one or more IRGs. We further show that the allelic combination of ROP18 and ROP5 also determines IRG evasion and virulence of strains belonging to other lineages besides types I, II and III. However, neither ROP18 nor ROP5 markedly affect survival in IFNγ-activated human cells, which lack the multitude of IRGs present in murine cells. These findings suggest that ROP18 and ROP5 have specifically evolved to block the IRGs and are unlikely to have effects in species that do not have the IRG system, such as humans. PMID:22761577

[Interferon-alpha and liver fibrosis in patients with chronic damage due to hepatitis C virus].

PubMed

Gonzalez-Huezo, María Sarai; Gallegos-Orozco, Juan Fernando

2003-01-01

The present review focuses on the published information published regarding the effects of interferon alpha therapy on liver fibrosis in patients with chronic liver damage secondary to hepatitis C infection. Data reviewed included results of the in vitro effects of interferon on hepatic cell line cultures with regards to indirect markers of fibrosis, activation of hepatic stellate cells and oxidative stress response. In the clinical arena, there is current clear evidence of a favorable histological outcome in patients with sustained viral response to interferon therapy. For this reason, the current review focuses more on the histological outcomes regarding liver fibrosis in patients who have not attained viral response to therapy (non-responders) or who already have biopsy defined cirrhosis. Data in these patients were analyzed according to the results of objective testing of fibrosis through the assessment of liver biopsy and its change during time, specially because the morbidity and mortality of this disease is directly related to the complications of liver cirrhosis and not necessarily to the persistence of the hepatitis C virus. Lastly, it is concluded that the process of liver fibrosis/cirrhosis is a dynamic one and that there is some evidence to support the usefulness of interferon alpha therapy as a means to halt or retard the progression of hepatic fibrosis. The result of current clinical trials in which interferon therapy is being used to modify the progression of fibrosis in non-responders or cirrhotic patients is eagerly awaited.

Local and Systemic Response of Mice to Interferon-α1 -Transfected Friend Leukemia Cells

PubMed Central

Gabriele, Lucia; Kaido, Thomas; Woodrow, David; Moss, Jill; Ferrantini, Maria; Proletti, Enrico; Santodonato, Laura; Rozera, Carmela; Maury, Chantal; Gresser, Ion

1995-01-01

DBA/2 mice were injected subcutaneously with an interferon (IFN)-α/-resistant line of Friend erythroleukemia cells (FLC) transfected with the mouse IFN-α1 gene. These tumor cells produced IFN constitutively, and mice had persistently high levels of IFN in the circulation. We examined the IFN-induced host mechanisms responsible for the local inhibition of growth of these IFN-α-transfected FLC and some of the unusual systemic effects of constant interferonemia such as extramedullary hematopoiesis in the liver, an increase in myeloid cells in the spleen, and persistently elevated splenic natural killer (NK) cell activity. In addition, both DBA/2 +/bg and beige mice developed a rapid and specific resistance to intravenous challenge with parental FLC In previous experiments DBA/2 beige mice could not be protected by exogenous IFN-α/β. The differences in the response of mice to the constitutive production of IFN-α by IFN-α-transfected tumor cells and their response to exogenous IFN is discussed in terms of the effects of IFN on the host and of antitumor therapy. ImagesFigure 2Figure 3Figure 4Figure 5Figure 6 PMID:7639337

Overexpression of Cyclooxygenase-2 and Transforming Growth Factor-Beta 1 is an Independent Predictor of Poor Virological Response to Interferon Therapy in Chronic HCV Genotype 4 Patients

PubMed Central

Gomaa, Wafaey M.; Ibrahim, Mohammed A.; Shatat, Mohamed E.

2014-01-01

Background/Aims: COX-2 and TGF-β1 are overexpressed in hepatitis C virus (HCV) infection and are related to hepatitis pathogenesis and hepatic fibrosis. The current study investigated the relationship between pretreatment COX-2 and TGF-β1 hepatic expression in HCV genotype 4 and the virological response to interferon therapy. Patients and Methods: Liver biopsies of 55 patients with HCV infection genotype 4 were selected together with 10 liver biopsies as control. The patients’ clinicopathological data were collected. Immunohistochemistry was done using anti-COX-2 and anti-TGF-β1 antibodies. Statistical tests were used to determine the association between both COX-2 and TGF-β1 expression in relation to clinicopathological parameters and response to interferon therapy. Results: COX-2 was upregulated especially in nonresponders and was an independent predictor of poor virological response. However, COX-2 showed no association with other clinicopathological features. TGF-β1 was upregulated and associated with nonresponders, histological activity, and fibrosis stage. There was no association between TGF-β1 and other clinicopathological features. There was an association between COX-2 and TGF-β1 immunoexpression. Conclusion: Overexpression of COX-2 and TGF-β1 is an independent predictor for poor outcome of interferon and ribavirin therapy and these might be useful markers for the response to treatment. Both molecules are associated together; however, their role during hepatitis treatment has to be clarified. PMID:24496160

Type I Interferons as Stimulators of DC-Mediated Cross-Priming: Impact on Anti-Tumor Response.

PubMed

Schiavoni, Giovanna; Mattei, Fabrizio; Gabriele, Lucia

2013-12-25

Induction of potent tumor-specific cytotoxic T-cell responses is a fundamental objective in anticancer therapeutic strategies. This event requires that antigen-presenting cells present tumor-associated antigens (Ag) on their MHC class-I molecule, in a process termed cross-presentation. Dendritic cells (DC) are particularly keen on this task and can induce the cross-priming of CD8(+) T cells, when exposed to danger or inflammatory signals that stimulate their activation. Type I interferons (IFN-I), a family of long-known immunostimulatory cytokines, have been proven to produce optimal activation signal for DC-induced cross-priming. Recent in vitro and in vivo evidences have suggested that IFN-I-stimulated cross-priming by DC against tumor-associated Ag is a key mechanism for cancer immunosurveillance and may be usefully exploited to boost anti-tumor CD8(+) T-cell responses. Here, we will review the cross-presentation properties of different DC subsets, with special focus on cell-associated and tumor Ag, and discuss how IFN-I can modify this function, with the aim of identifying more specific and effective strategies for improving anticancer responses.

Lentiviral vectors encoding shRNAs efficiently transduce and knockdown LINGO-1 but induce an interferon response and cytotoxicity in CNS neurons

PubMed Central

Hutson, Thomas H.; Foster, Edmund; Dawes, John M.; Hindges, Robert; Yáñez-Muñoz, Rafael J.; Moon, Lawrence D.F.

2017-01-01

Background Knocking down neuronal LINGO-1 using short hairpin RNAs (shRNAs) might enhance axon regeneration in the CNS. Integration-deficient lentiviral vectors have great potential as a therapeutic delivery system for CNS injuries. However, recent studies have revealed that shRNAs can induce an interferon response resulting in off-target effects and cytotoxicity. Methods CNS neurons were transduced with integration-deficient lentiviral vectors in vitro. The transcriptional effect of shRNA expression was analysed using qRT-PCR and northern blots were used to assess shRNA production. Results Integration-deficient lentiviral vectors efficiently transduced CNS neurons and knocked down LINGO-1 mRNA in vitro. However, an increase in cell death was observed when lentiviral vectors encoding an shRNA were applied or when high vector concentrations were used. We demonstrate that high doses of vector or the use of vectors encoding shRNAs can induce an up-regulation of interferon stimulated genes (OAS1 and PKR) and a down-regulation of off- target genes (including p75NTR and NgR1). Furthermore, the northern blot demonstrated that these negative consequences occur even when lentiviral vectors express low levels of shRNAs. Together, these results may explain why neurite outgrowth was not enhanced on an inhibitory substrate after transduction with lentiviral vectors encoding an shRNA targeting LINGO-1. Conclusions These findings highlight the importance of including appropriate controls to verify silencing specificity and the requirement to check for an interferon response when conducting RNA interference experiments. However, the potential benefits that RNA interference and viral vectors offer to gene-based therapies to CNS injuries cannot be overlooked and demand further investigation. PMID:22499506

Interferon-free treatment for HCV-infected patients with decompensated cirrhosis.

PubMed

Kanda, Tatsuo

2017-01-01

Progress in interferon-free treatment against hepatitis C virus (HCV) has remained a challenge in patients with decompensated cirrhosis due to a paucity of information on efficacy and safety profiles. This review illustrates that interferon-free treatment could result in greater than 85 % sustained virological response (SVR) rates in patients with HCV genotype 1 and decompensated cirrhosis. The combination of pangenotypic HCV NS5A inhibitor velpatasvir and HCV NS5B inhibitor sofosbuvir has demonstrated high SVR rates in patients with HCV genotypes 1, 2, 3, 4 or 6 and decompensated cirrhosis. Certain patients discontinued treatment due to adverse events, death or having liver transplantation. Taken together, interferon-free treatment could produce higher SVR rates in decompensated hepatic cirrhosis. However, as adverse events were occasionally observed, liver transplantation should always be considered as well. Further improvements in treatment are called for in patients with decompensated cirrhosis.

Interferon alpha inhibits replication of a live-attenuated porcine reproductive and respiratory syndrome virus vaccine preventing development of an adaptive immune response in swine.

PubMed

Brockmeier, Susan L; Loving, Crystal L; Eberle, Kirsten C; Hau, Samantha J; Buckley, Alexandra; Van Geelen, Albert; Montiel, Nestor A; Nicholson, Tracy; Lager, Kelly M

2017-12-01

Type I interferons, such as interferon alpha (IFN-α), contribute to innate antiviral immunity by promoting production of antiviral mediators and are also involved in promoting an adaptive immune response. Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most devastating and costly viruses to the swine industry world-wide and has been shown to induce a meager IFN-α response. Previously we administered porcine IFN-α using a replication-defective adenovirus vector (Ad5-IFN-α) at the time of challenge with virulent PRRSV and demonstrated an increase in the number of virus-specific IFNγ secreting cells, indicating that the presence of IFN-α at the time of infection can alter the adaptive immune responses to PRRSV. In the current experiment, we explored the use of IFN-α as an adjuvant administered with live-attenuated PRRSV vaccine as a method to enhance immune response to the vaccine. Unlike the previous studies with fully virulent virus, one injection of the Ad5-IFN-α abolished replication of the vaccine virus and as a result there was no detectible adaptive immune response. Although IFN-α did not have the desired adjuvant effect, the results further highlight the use of IFN-α as a treatment for PRRSV infection. Published by Elsevier B.V.

Airway fungal colonization compromises the immune system allowing bacterial pneumonia to prevail.

PubMed

Roux, Damien; Gaudry, Stéphane; Khoy-Ear, Linda; Aloulou, Meryem; Phillips-Houlbracq, Mathilde; Bex, Julie; Skurnik, David; Denamur, Erick; Monteiro, Renato C; Dreyfuss, Didier; Ricard, Jean-Damien

2013-09-01

To study the correlation between fungal colonization and bacterial pneumonia and to test the effect of antifungal treatments on the development of bacterial pneumonia in colonized rats. Experimental animal investigation. University research laboratory. Pathogen-free male Wistar rats weighing 250-275 g. Rats were colonized by intratracheal instillation of Candida albicans. Fungal clearance from the lungs and immune response were measured. Both colonized and noncolonized animals were secondarily instilled with different bacterial species (Pseudomonas aeruginosa, Escherichia coli, or Staphylococcus aureus). Bacterial phagocytosis by alveolar macrophages was evaluated in the presence of interferon-gamma, the main cytokine produced during fungal colonization. The effect of antifungal treatments on fungal colonization and its immune response were assessed. The prevalence of P. aeruginosa pneumonia was compared in antifungal treated and control colonized rats. C. albicans was slowly cleared and induced a Th1-Th17 immune response with very high interferon-gamma concentrations. Airway fungal colonization favored the development of bacterial pneumonia. Interferon-gamma was able to inhibit the phagocytosis of unopsonized bacteria by alveolar macrophages. Antifungal treatment decreased airway fungal colonization, lung interferon-gamma levels and, consequently, the prevalence of subsequent bacterial pneumonia. C. albicans airway colonization elicited a Th1-Th17 immune response that favored the development of bacterial pneumonia via the inhibition of bacterial phagocytosis by alveolar macrophages. Antifungal treatment decreased the risk of bacterial pneumonia in colonized rats.

Combination alpha-interferon and lamivudine therapy for alpha-interferon-resistant chronic hepatitis B infection: results of a pilot study.

PubMed

Mutimer, D; Naoumov, N; Honkoop, P; Marinos, G; Ahmed, M; de Man, R; McPhillips, P; Johnson, M; Williams, R; Elias, E; Schalm, S

1998-06-01

Alpha-interferon achieves seroconversion in about one third of naive patients. Attempts to achieve seroconversion in patients who have previously failed alpha-interferon have proved disappointing. Combination chemotherapy (alpha-interferon with a nucleoside analogue) might provide a treatment alternative for these patients. We have undertaken a phase 2 study in 20 patients who had previously failed at least one course of alpha-interferon. The study was designed to assess the safety, tolerability and efficacy of the combination. All patients were treated for 16 weeks with alpha-interferon in combination with 12 or 16 weeks of Lamivudine (3'TC). Patients were followed for 16 weeks post-treatment. Pharmacokinetic studies were performed to identify/exclude significant pharmacokinetic drug interaction. The combination was well tolerated, and side-effects of the combination were indistinguishable from the recognised side-effects of alpha-interferon. Pharmacokinetic studies performed on days 1 and 29 did not show any significant interaction. All patients achieved HBV DNA clearance during treatment, but 19 relapsed at the end of treatment. HBeAg/anti-HBe seroconversion was observed for four patients, but was sustained for a single patient (who also had sustained DNA clearance). Combination therapy with alpha-interferon and lamivudine given for 16 weeks appears safe and is well tolerated. However, for this group of patients who had previously failed interferon monotherapy, the efficacy of combination interferon/lamivudine therapy appears disappointing, and other treatment strategies should be investigated.

Synergistic induction of apoptosis in primary rat decidual cells by INF-gamma and TNF.

PubMed

Almeida, A; Correia-da-Silva, G; Cepa, M; Bell, S C; Teixeira, N A

2007-03-01

In the rat, in response to blastocyst implantation, stromal cells of the endometrium proliferate and differentiate into decidual cells, forming the decidua. After reaching its maximum development, the decidua undergoes regression. This phenomenon appears to be due to an active process involving apoptosis. As there is sparse knowledge concerning the mechanisms of induction of decidual cell death, the potential role of cytokines present in the uterine environment during pregnancy, such as tumor necrosis factor (TNF) and interferon-gamma (INF-gamma) was explored in primary cultures of rat decidual cells. The effects of these factors upon cellular viability, nuclear morphologic alterations, expression, and enzymatic activities of the effector caspases-3/7 were evaluated. The results obtained demonstrated that in contrast to TNF, which did not induce any alteration, INF-gamma and in association with TNF caused a decrease in cell viability and an increase in the appearance of apoptotic bodies in a time-dependent manner that was augmented in the co-presence of TNF. An increase in caspase-3/7 activities after 12 hr of TNF/INF-gamma treatment was also observed. These findings suggest that INF-gamma expressed in the uterine environment may play an important role in regulating apoptosis through potential synergistic mechanisms with TNF and thereby modulate decidual stability and regression during pregnancy. (c) 2006 Wiley-Liss, Inc.

Plasma microRNA profile as a predictor of early virological response to interferon treatment in chronic hepatitis B patients.

PubMed

Zhang, Xiaonan; Chen, Cuncun; Wu, Min; Chen, Liang; Zhang, Jiming; Zhang, Xinxin; Zhang, Zhanqin; Wu, Jingdi; Wang, Jiefei; Chen, Xiaorong; Huang, Tao; Chen, Lixiang; Yuan, Zhenghong

2012-01-01

Interferon (IFN) and pegylated interferon (PEG-IFN) treatment of chronic hepatitis B leads to a sustained virological response in a limited proportion of patients and has considerable side effects. To find novel markers associated with prognosis of IFN therapy, we investigated whether a pretreatment plasma microRNA profile could be used to predict early virological response to IFN. We performed microRNA microarray analysis of plasma samples from 94 patients with chronic hepatitis B who received IFN therapy. The microRNA profiles from 13 liver biopsy samples were also measured. The OneR feature ranking and incremental feature selection method were used to rank and optimize the number of features in the model. Support vector machine prediction engine and jack-knife cross-validation were used to generate and evaluate the prediction model. The optimized model consisting of 11 microRNAs yielded a 74.2% overall accuracy in the training group and was independently confirmed in the test group (71.4% accuracy). Univariate and multivariate logistic regression analyses confirmed its independent association with early virological response (OR=7.35; P=2.12×10(-5)). Combining the microRNA profile with the alanine aminotransferase level improved the overall accuracy from 73.4% to 77.3%. Co-transfection of an HBV replicative construct with microRNA mimics revealed that let-7f, miR-939 and miR-638 were functionally associated with the HBV life cycle. The 11 microRNA signatures in plasma, together with basic clinical variables, might provide an accurate method to assist in medication decisions and improve the overall sustained response to IFN treatment.

Immunological role of CD4+CD28null T lymphocytes, natural killer cells, and interferon-gamma in pediatric patients with sickle cell disease: relation to disease severity and response to therapy.

PubMed

ElAlfy, Mohsen Saleh; Adly, Amira Abdel Moneam; Ebeid, Fatma Soliman ElSayed; Eissa, Deena Samir; Ismail, Eman Abdel Rahman; Mohammed, Yasser Hassan; Ahmed, Manar Elsayed; Saad, Aya Sayed

2018-06-20

Sickle cell disease (SCD) is associated with alterations in immune phenotypes. CD4 + CD28 null T lymphocytes have pro-inflammatory functions and are linked to vascular diseases. To assess the percentage of CD4 + CD28 null T lymphocytes, natural killer cells (NK), and IFN-gamma levels, we compared 40 children and adolescents with SCD with 40 healthy controls and evaluated their relation to disease severity and response to therapy. Patients with SCD steady state were studied, focusing on history of frequent vaso-occlusive crisis, hydroxyurea therapy, and IFN-gamma levels. Analysis of CD4 + CD28 null T lymphocytes and NK cells was done by flow cytometry. Liver and cardiac iron overload were assessed. CD4 + CD28 null T lymphocytes, NK cells, and IFN-gamma levels were significantly higher in patients than controls. Patients with history of frequent vaso-occlusive crisis and those with vascular complications had higher percentage of CD4 + CD28 null T lymphocytes and IFN-gamma while levels were significantly lower among hydroxyurea-treated patients. CD4 + CD28 null T lymphocytes were positively correlated to transfusional iron input while these cells and IFN-gamma were negatively correlated to cardiac T2* and duration of hydroxyurea therapy. NK cells were correlated to HbS and indirect bilirubin. Increased expression of CD4 + CD28 null T lymphocytes highlights their role in immune dysfunction and pathophysiology of SCD complications.

Interferon gamma peptidomimetic targeted to hepatic stellate cells ameliorates acute and chronic liver fibrosis in vivo.

PubMed

Bansal, Ruchi; Prakash, Jai; De Ruiter, Marieke; Poelstra, Klaas

2014-04-10

Hepatic stellate cells play a crucial role in the pathogenesis of hepatic fibrosis. Thus, pharmacological inhibition of pro-fibrotic activities of these cells might lead to an effective therapy for this disease. Among the potent anti-fibrotics, interferon gamma (IFNγ), a proinflammatory cytokine, is highly efficacious but it failed in clinical trials due to the poor efficacy and multiple adverse effects attributed to the ubiquitous IFNγ receptor (IFNγR) expression. To resolve these drawbacks, we chemically synthesized a chimeric molecule containing (a) IFNγ signaling peptide (IFNγ peptidomimetic, mimγ) that retains the agonistic activities of IFNγ but lacks an extracellular receptor recognition sequence for IFNγR; coupled via heterobifunctional PEG linker to (b) bicyclic platelet derived growth factor beta receptor (PDGFβR)-binding peptide (BiPPB) to induce internalization into the stellate cells that express PDGFβR. The synthesized targeted IFNγ peptidomimetic (mimγ-BiPPB) was extensively investigated for its anti-fibrotic and adverse effects in acute and chronic CCl4-induced liver fibrosis models in mice. Treatment with mimγ-BiPPB, after the onset of disease, markedly inhibited both early and established hepatic fibrosis as reflected by a reduced intrahepatic α-SMA, desmin and collagen-I mRNA expression and protein levels. While untargeted mimγ and BiPPB had no effect, and native IFNγ only induced a moderate reduction. Additionally, no off-target effects, e.g. systemic inflammation, were found with mimγ-BiPPB, which were substantially observed in mice treated with native IFNγ. The present study highlights the beneficial effects of a novel BiPPB mediated cell-specific targeting of IFNγ peptidomimetic to the disease-inducing cells and therefore represents a highly potential therapeutic approach to treat fibrotic diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

Fluorescence-Activated Cell Sorting-Based Analysis Reveals an Asymmetric Induction of Interferon-Stimulated Genes in Response to Seasonal Influenza A Virus

PubMed Central

von Recum-Knepper, Jessica; Sadewasser, Anne; Weinheimer, Viola K.

2015-01-01

ABSTRACT Influenza A virus (IAV) infection provokes an antiviral response involving the expression of type I and III interferons (IFN) and IFN-stimulated genes (ISGs) in infected cell cultures. However, the spatiotemporal dynamics of the IFN reaction are incompletely understood, as previous studies investigated mainly the population responses of virus-infected cultures, although substantial cell-to-cell variability has been documented. We devised a fluorescence-activated cell sorting-based assay to simultaneously quantify expression of viral antigens and ISGs, such as ISG15, MxA, and IFIT1, in IAV-infected cell cultures at the single-cell level. This approach revealed that seasonal IAV triggers an unexpected asymmetric response, as the major cell populations expressed either viral antigen or ISG, but rarely both. Further investigations identified a role of the viral NS1 protein in blocking ISG expression in infected cells, which surprisingly did not reduce paracrine IFN signaling to noninfected cells. Interestingly, viral ISG control was impaired in cultures infected with avian-origin IAV, including the H7N9 virus from eastern China. This phenotype was traced back to polymorphic NS1 amino acids known to be important for stable binding of the polyadenylation factor CPSF30 and concomitant suppression of host cell gene expression. Most significantly, mutation of two amino acids within the CPSF30 attachment site of NS1 from seasonal IAV diminished the strict control of ISG expression in infected cells and substantially attenuated virus replication. In conclusion, our approach revealed an asymmetric, NS1-dependent ISG induction in cultures infected with seasonal IAV, which appears to be essential for efficient virus propagation. IMPORTANCE Interferons are expressed by infected cells in response to IAV infection and play important roles in the antiviral immune response by inducing hundreds of interferon-stimulated genes (ISGs). Unlike many previous studies, we

Virologic response to treatment with Pegylated Interferon alfa-2b and Ribavirin for chronic hepatitis C in children.

PubMed

Pawłowska, Malgorzata; Pilarczyk, Malgorzata; Halota, Waldemar

2010-12-01

This study assessed the efficacy and safety of treatment of chronic hepatitis C in children with pegylated interferon alpha and ribavirin. Investigations were performed on 53 children with chronic hepatitis C, aged 8-17 years. Children were divided into 2 groups: naïve (n=29) and retreated (n=24). All children were administered a combined therapy with pegylated interferon (IFN) alpha-2b 1.5 mcg/kg/wk and ribavirin 15 mg/kg/d for 48 weeks. Mean baseline viral load was 0.456×10(6) IU/mL, mean alanine aminotransferase (ALT) activity was 45.8±24.3 IU/mL. No child had liver disease assessed greater than grade 2, stage 2 according to modified Scheuer scale. Serum hepatitis C virus (HCV) RNA in TW 12-EVR, TW 48-ETR, and W 72-sustained virologic response (SVR) with the polymerase chain reaction (PCR) method (Roche TaqMan) were evaluated. Sustained virologic response was achieved in 47% of children. The prevalence of relapses was 7.5%. The most important predictor of SVR in both groups was undetectable HCV RNA at TW 12. All retreated children who achieved partial EVR - (the HCV RNA level decreased more than 2 logs relative to baseline) were relapsers. In responders from both groups, baseline ALT activity was higher and baseline viral load was lower. In all children who achieved SVR, HCV RNA was undetectable 12 months later. Pegylated IFN and ribavirin are effective in treating chronic hepatitis C in children. Complete EVR is predictive of a sustained viral response. And high rate of relapses in retreated patients may suggest a longer duration of retherapy.

Evidence for clonal selection of gamma/delta T cells in response to a human pathogen

PubMed Central

1991-01-01

T cells bearing gamma/delta antigen receptors comprise a resident population of intraepithelial lymphocytes in organs such as skin, gut, and lungs, where they are strategically located to contribute to the initial defense against infection. An important unsolved question about antigen-driven gamma/delta T cell responses regards the breadth of their T cell receptor (TCR) repertoire, since many specific epithelial compartments in mice display limited diversity. We have examined the diversity of TCR delta gene expression among human gamma/delta T cells from skin lesions induced by intradermal challenge with Mycobacterium leprae. We show that the vast majority of gamma/delta cells from M. leprae lesions use either V delta 1-J delta 1 or V delta 2-J delta 1 gene rearrangements and, within a given region of the lesion, display limited junctional diversity. This contrasts markedly with the extensive diversity of gamma/delta T cells from peripheral blood of these same individuals, as well as skin from normal donors. These results indicate that the gamma/delta response to M. leprae involves the selection of a limited number of clones from among a diverse repertoire, probably in response to specific mycobacterial and/or host antigens. PMID:1651977

Efficacy of HCV treatment in Poland at the turn of the interferon era - the EpiTer study.

PubMed

Flisiak, Robert; Pogorzelska, Joanna; Berak, Hanna; Horban, Andrzej; Orłowska, Iwona; Simon, Krzysztof; Tuchendler, Ewelina; Madej, Grzegorz; Piekarska, Anna; Jabłkowski, Maciej; Deroń, Zbigniew; Mazur, Włodzimierz; Kaczmarczyk, Marcin; Janczewska, Ewa; Pisula, Arkadiusz; Smykał, Jacek; Nowak, Krzysztof; Matukiewicz, Marek; Halota, Waldemar; Wernik, Joanna; Sikorska, Katarzyna; Mozer-Lisewska, Iwona; Rozpłochowski, Błażej; Garlicki, Aleksander; Tomasiewicz, Krzysztof; Krzowska-Firych, Joanna; Baka-Ćwierz, Barbara; Kryczka, Wiesław; Zarębska-Michaluk, Dorota; Olszok, Iwona; Boroń-Kaczmarska, Anna; Sobala-Szczygieł, Barbara; Szlauer, Bronisława; Korcz-Ondrzejek, Bogumiła; Sieklucki, Jerzy; Pleśniak, Robert; Ruszała, Agata; Postawa-Kłosińska, Barbara; Citko, Jolanta; Lachowicz-Wawrzyniak, Anna; Musialik, Joanna; Jezierska, Edyta; Dobracki, Witold; Dobracka, Beata; Hałubiec, Jan; Krygier, Rafał; Strokowska, Anna; Chomczyk, Wojciech; Witczak-Malinowska, Krystyna

2016-12-01

Was to analyze the efficacy achieved with regimens available for chronic hepatitis C (CHC) in Poland between 2013 and 2016. Data were collected from 29 centers and included 6786 patients with available sustained virologic response (SVR) data between 1 January 2013 and 31 March 2016. The sustained virologic response rate for genotypes (G) 1a, 1b, 2, 3 and 4 was 62%, 56%, 92%, 67% and 56% respectively; 71% patients ( n = 4832) were treated with pegylated interferon α (Peg-IFNα) and ribavirin (RBV), with SVR rates of 58%, 49%, 92%, 67% and 55% respectively. The sustained virologic response among 5646 G1 infected patients was the lowest with natural interferon α (7%, n = 70) or PegIFN (50%, n = 3779) with RBV, and improved in those receiving triple regimens of Peg-IFN + RBV combined with boceprevir (47%, n = 485), telaprevir (64%, n = 805), simeprevir (73%, n = 132) or sofosbuvir (70%, n = 23). The sustained virologic response with interferon-free regimens of sofosbuvir and RBV ( n = 7), sofosbuvir and simeprevir ( n = 53), and ledipasvir and sofosbuvir ( n = 64) achieved 86%, 89% and 94% respectively. The highest SVR of 98% was observed with ombitasvir/paritaprevir combined with dasabuvir ( n = 227). Patients infected with G3 ( n = 896) and G4 ( n = 220) received mostly Peg-IFN + RBV with SVR of 67% and 56% respectively. Interferon-free regimens were administered in 18 G3/G4 patients and all achieved an SVR. Sofosbuvir combined with Peg-IFN and RBV was administered to 33 patients with an SVR rate of 94%, and a similar rate was achieved among 13 G2 patients treated with interferon and RBV. We observed significant differences in efficacy of HCV regimens available in Poland at the turn of the interferon era. The data will be useful as a comparison for therapeutic options expected in the next few years.

Lymphoproliferative and gamma interferon responses to stress-regulated Mycobacterium avium subsp. paratuberculosis recombinant proteins.

PubMed

Gurung, Ratna B; Begg, Douglas J; Purdie, Auriol C; de Silva, Kumudika; Bannantine, John P; Whittington, Richard J

2014-06-01

Johne's disease in ruminants is a chronic infection of the intestines caused by Mycobacterium avium subsp. paratuberculosis. An important strategy to control disease is early detection, and a potentially efficient method for early detection is measurement of cell-mediated immune responses developed by the host in response to exposure or infection. One method is to measure lymphoproliferation and cytokine release from the host cells when exposed to the organism or parts of the organism. In this study, 10 recombinant M. avium subsp. paratuberculosis proteins known to be upregulated under in vitro stress conditions were evaluated by examining their ability to evoke memory as a result of exposure by vaccination or oral challenge with live Mycobacterium avium subsp. paratuberculosis. Out of 10 proteins, MAP2698c was found to induce higher cell-mediated immune responses in vaccinated and challenged sheep in comparison to healthy controls. The findings suggest that not all stress-regulated proteins have the diagnostic potential to detect cell-mediated immune responses in ovine paratuberculosis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Lymphoproliferative and Gamma Interferon Responses to Stress-Regulated Mycobacterium avium subsp. paratuberculosis Recombinant Proteins

PubMed Central

Gurung, Ratna B.; Begg, Douglas J.; Purdie, Auriol C.; de Silva, Kumudika; Bannantine, John P.

2014-01-01

Johne's disease in ruminants is a chronic infection of the intestines caused by Mycobacterium avium subsp. paratuberculosis. An important strategy to control disease is early detection, and a potentially efficient method for early detection is measurement of cell-mediated immune responses developed by the host in response to exposure or infection. One method is to measure lymphoproliferation and cytokine release from the host cells when exposed to the organism or parts of the organism. In this study, 10 recombinant M. avium subsp. paratuberculosis proteins known to be upregulated under in vitro stress conditions were evaluated by examining their ability to evoke memory as a result of exposure by vaccination or oral challenge with live Mycobacterium avium subsp. paratuberculosis. Out of 10 proteins, MAP2698c was found to induce higher cell-mediated immune responses in vaccinated and challenged sheep in comparison to healthy controls. The findings suggest that not all stress-regulated proteins have the diagnostic potential to detect cell-mediated immune responses in ovine paratuberculosis. PMID:24695774

[The expression of interferon-lambda1 in CHO cell].

PubMed

Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu

2013-06-01

To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.

NS1 Protein Mutation I64T Affects Interferon Responses and Virulence of Circulating H3N2 Human Influenza A Viruses

PubMed Central

DeDiego, Marta L.; Nogales, Aitor; Lambert-Emo, Kris; Martinez-Sobrido, Luis

2016-01-01

ABSTRACT Influenza NS1 protein is the main viral protein counteracting host innate immune responses, allowing the virus to efficiently replicate in interferon (IFN)-competent systems. In this study, we analyzed NS1 protein variability within influenza A (IAV) H3N2 viruses infecting humans during the 2012-2013 season. We also evaluated the impact of the mutations on the ability of NS1 proteins to inhibit host innate immune responses and general gene expression. Surprisingly, a previously unidentified mutation in the double-stranded RNA (dsRNA)-binding domain (I64T) decreased NS1-mediated general inhibition of host protein synthesis by decreasing its interaction with cleavage and polyadenylation specificity factor 30 (CPSF30), leading to increased innate immune responses after viral infection. Notably, a recombinant A/Puerto Rico/8/34 H1N1 virus encoding the H3N2 NS1-T64 protein was highly attenuated in mice, most likely because of its ability to induce higher antiviral IFN responses at early times after infection and because this virus is highly sensitive to the IFN-induced antiviral state. Interestingly, using peripheral blood mononuclear cells (PBMCs) collected at the acute visit (2 to 3 days after infection), we show that the subject infected with the NS1-T64 attenuated virus has diminished responses to interferon and to interferon induction, suggesting why this subject could be infected with this highly IFN-sensitive virus. These data demonstrate the importance of influenza virus surveillance in identifying new mutations in the NS1 protein, affecting its ability to inhibit innate immune responses and, as a consequence, the pathogenicity of the virus. IMPORTANCE Influenza A and B viruses are one of the most common causes of respiratory infections in humans, causing 1 billion infections and between 300,000 and 500,000 deaths annually. Influenza virus surveillance to identify new mutations in the NS1 protein affecting innate immune responses and, as a consequence

Risk of tuberculosis among air passengers estimated by interferon gamma release assay: survey of contact investigations, Japan, 2012 to 2015

PubMed Central

Ota, Masaki; Kato, Seiya

2017-01-01

Although the World Health Organization recommends contact investigations around air travel-associated sputum smear-positive tuberculosis (TB) patients, evidence suggests that the information thus obtained may have overestimated the risk of TB infection because it involved some contacts born in countries with high TB burden who were likely to have been infected with TB in the past, or because tuberculin skin tests were used, which are less specific than the interferon gamma release assay (IGRA) particularly in areas where Bacillus Calmette-Guérin (BCG) vaccination coverage is high. We conducted a questionnaire survey on air travel-associated TB contact investigations in local health offices of Japan from 2012 to 2015, focusing on IGRA positivity. Among 651 air travel-associated TB contacts, average positivity was 3.8% (95% confidence interval (CI): 2.5–5.6) with a statistically significant increasing trend with older age (p < 0.0094). Positivity among 0–34 year-old contacts was 1.0% (95% CI: 0.12–3.5%), suggesting their risk of TB infection is as small as among Japanese young adults with low risk of TB infection (positivity: 0.85–0.90%). Limiting the contact investigation to fewer passengers (within two seats surrounding the index case, rather than two rows) seems reasonable in the case of aircraft with many seats per row. PMID:28367799

Analyzing the Utilization of Interferon-Gamma Screening for Tuberculosis at Recruit Training Command, Great Lakes

DTIC Science & Technology

2006-05-31

the project through a business case analysis conducted on this same subject. CAPT Monestersky, Preventive Medicine; LCDR Jacobs, Occupational Medicine...TB and LTBI (Taylor, Nolan, & Blumberg , Interferon-y screening for TB 8 2005). They are based on science founded in the 1 9 th century. The current...identify individuals who may not be suitable for service. For the majority who are suitable, the "P" days allow time to complete necessary business

Beyond Tryptophan Synthase: Identification of Genes That Contribute to Chlamydia trachomatis Survival during Gamma Interferon-Induced Persistence and Reactivation

PubMed Central

Muramatsu, Matthew K.; Brothwell, Julie A.; Stein, Barry D.; Putman, Timothy E.; Rockey, Daniel D.

2016-01-01

Chlamydia trachomatis can enter a viable but nonculturable state in vitro termed persistence. A common feature of C. trachomatis persistence models is that reticulate bodies fail to divide and make few infectious progeny until the persistence-inducing stressor is removed. One model of persistence that has relevance to human disease involves tryptophan limitation mediated by the host enzyme indoleamine 2,3-dioxygenase, which converts l-tryptophan to N-formylkynurenine. Genital C. trachomatis strains can counter tryptophan limitation because they encode a tryptophan-synthesizing enzyme. Tryptophan synthase is the only enzyme that has been confirmed to play a role in interferon gamma (IFN-γ)-induced persistence, although profound changes in chlamydial physiology and gene expression occur in the presence of persistence-inducing stressors. Thus, we screened a population of mutagenized C. trachomatis strains for mutants that failed to reactivate from IFN-γ-induced persistence. Six mutants were identified, and the mutations linked to the persistence phenotype in three of these were successfully mapped. One mutant had a missense mutation in tryptophan synthase; however, this mutant behaved differently from previously described synthase null mutants. Two hypothetical genes of unknown function, ctl0225 and ctl0694, were also identified and may be involved in amino acid transport and DNA damage repair, respectively. Our results indicate that C. trachomatis utilizes functionally diverse genes to mediate survival during and reactivation from persistence in HeLa cells. PMID:27430273

THE DEVELOPMENT OF A PHOTOTROPIC ANODIZED ALUMINUM FINISH RESPONSIVE TO GAMMA RADIATION.

DTIC Science & Technology

The present investigation was conducted to establish a phototropic anodized aluminum finish sensitive to gamma radiation. A comprehensive literature...search revealed a number of candidate phototropic materials but very little information about gamma radiation response. Because early trials...indicated that each candidate phototropic system possessed different dyeing characteristics for an anodic film, time-consuming trials with dyed anodic films

Natural killer cells promote tissue injury and systemic inflammatory responses during fatal Ehrlichia-induced toxic shock-like syndrome.

PubMed

Stevenson, Heather L; Estes, Mark D; Thirumalapura, Nagaraja R; Walker, David H; Ismail, Nahed

2010-08-01

Human monocytotropic ehrlichiosis is caused by Ehrlichia chaffeensis, a Gram-negative bacterium lacking lipopolysaccharide. We have shown that fatal murine ehrlichiosis is associated with CD8(+)T cell-mediated tissue damage, tumor necrosis factor-alpha, and interleukin (IL)-10 overproduction, and CD4(+)Th1 hyporesponsiveness. In this study, we examined the relative contributions of natural killer (NK) and NKT cells in Ehrlichia-induced toxic shock. Lethal ehrlichial infection in wild-type mice induced a decline in NKT cell numbers, and late expansion and migration of activated NK cells to the liver, a main infection site that coincided with development of hepatic injury. The spatial and temporal changes in NK and NKT cells in lethally infected mice correlated with higher NK cell cytotoxic activity, higher expression of cytotoxic molecules such as granzyme B, higher production of interferon-gamma and tumor necrosis factor-alpha, increased hepatic infiltration with CD8alphaCD11c(+) dendritic cells and CD8(+)T cells, decreased splenic CD4(+)T cells, increased serum concentrations of IL-12p40, IL-18, RANTES, and monocyte chemotactic protein-1, and elevated production of IL-18 by liver mononuclear cells compared with nonlethally infected mice. Depletion of NK cells prevented development of severe liver injury, decreased serum levels of interferon-gamma, tumor necrosis factor-alpha, and IL-10, and enhanced bacterial elimination. These data indicate that NK cells promote immunopathology and defective anti-ehrlichial immunity, possibly via decreasing the protective immune response mediated by interferon-gamma producing CD4(+)Th1 and NKT cells.

Plasmacytoid dendritic cell interferon-α production to R-848 stimulation is decreased in male infants.

PubMed

Wang, Jennifer P; Zhang, Lei; Madera, Rachel F; Woda, Marcia; Libraty, Daniel H

2012-07-06

Sex differences in response to microbial infections, especially viral ones, may be associated with Toll-like receptor (TLR)-mediated responses by plasmacytoid dendritic cells (pDCs). In this study, we identified sex differences in human infant pDC interferon-α production following challenge with the TLR7/8 agonist R-848. Male pDC responses were significantly lower than those of females during early infancy. This difference may be attributed to the androgen surge experienced by males during the early infancy period. Pretreatment of human pDCs with dihydrotestosterone produced a significant reduction in interferon-α production following R-848 challenge. Androgen-mediated regulation of pDC TLR7-driven innate immune responses may contribute to the observed sex differences in response to infections during early infancy.

Rapid activation of the interferon system in vivo.

PubMed Central

Dianzani, F; Gullino, P; Baron, S

1978-01-01

Experiments were carried out to study the kinetics of local interferon production in the subcutaneous tissues of rats stimulated with Newcastle disease virus. Specifically, the interferon produced and released in the extracellular fluids was collected at various intervals of time in micropore chambers implanted into the subcutaneous tissue of rats. Interferon was detected at moderate titers 1 h after induction, and it was present at high titer at 2 h. The interferon levels remained remarkably high in the samples collected after 3, 5, and 24 h, and in some rats it was still detectable after 48 and 72 h. Since control experiments showed that it requires 2 to 3 h for interferon to penetrate the chambers, it may be concluded that high concentrations of interferon are present in the extracellular fluid within 1 h of induction. The evaluation of the kinetics of production and of the concentrations attained in the extracellular fluid suggests that in a solid tissue a cell infected by a potent interferon inducer may produce interferon early enough and in sufficient quantity to protect neighboring cells before the production of progeny virions. PMID:669799

Polyfunctional CD4 T cells in the response to bovine tuberculosis

USDA-ARS?s Scientific Manuscript database

CD4 T cells are crucial in immunity to tuberculosis (TB). Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), Interleukin-2 (IL-2) and Tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB and HIV. However, the a...

Monitoring acute phase proteins in retrovirus infected cats undergoing feline interferon-ω therapy.

PubMed

Leal, R O; Gil, S; Sepúlveda, N; McGahie, D; Duarte, A; Niza, M M R E; Tavares, L

2014-01-01

Recombinant feline interferon-ω therapy is an immunomodulator currently used in the treatment of different retroviral diseases including feline immune deficiency virus and feline leukaemia virus. Although its mechanism of action remains unclear, this drug appears to potentiate the innate response. Acute phase proteins are one of the key components of innate immunity and studies describing their use as a monitoring tool for the immune system in animals undergoing interferon-ω therapy are lacking. This study aimed to determine whether interferon-ω therapy influences acute phase protein concentrations namely serum amyloid-A, α-1-glycoprotein and C-reactive protein. A single-arm study was performed using 16 cats, living in an animal shelter, naturally infected with retroviruses and subjected to the interferon-ω therapy licensed protocol. Samples were collected before (D0), during (D10 and D30) and after therapy (D65). Serum amyloid-A and C-reactive protein were measured by specific enzyme-linked immunosorbent assay kits and α-1-glycoprotein by single radial immunodiffusion. All the acute phase proteins significantly increased in cats undergoing interferon-ω therapy (D0/D65: P<0·05) CLINICAL SIGNIFICANCE: Acute phase proteins appear to be reasonable predictors of innate-immune stimulation and may be useful in the individual monitoring of naturally retroviral infected cats undergoing interferon-ω therapy. © 2013 British Small Animal Veterinary Association.

In vivo induction of interferon gamma expression in grey horses with metastatic melanoma resulting from direct injection of plasmid DNA coding for equine interleukin 12.

PubMed

Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K

2011-11-01

Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.

The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon.

PubMed

Fernández de Marco, María del Mar; Alejo, Alí; Hudson, Paul; Damon, Inger K; Alcami, Antonio

2010-05-01

Variola virus (VARV) caused smallpox, one of the most devastating human diseases and the first to be eradicated, but its deliberate release represents a dangerous threat. Virulent orthopoxviruses infecting humans, such as monkeypox virus (MPXV), could fill the niche left by smallpox eradication and the cessation of vaccination. However, immunomodulatory activities and virulence determinants of VARV and MPXV remain largely unexplored. We report the molecular characterization of the VARV- and MPXV-secreted type I interferon-binding proteins, which interact with the cell surface after secretion and prevent type I interferon responses. The proteins expressed in the baculovirus system have been purified, and their interferon-binding properties characterized by surface plasmon resonance. The ability of these proteins to inhibit a broad range of interferons was investigated to identify potential adaptation to the human immune system. Furthermore, we demonstrate by Western blot and activity assays the expression of the type I interferon inhibitor during VARV and MPXV infections. These findings are relevant for the design of new vaccines and therapeutics to smallpox and emergent virulent orthopoxviruses because the type I interferon-binding protein is a major virulence factor in animal models, vaccination with this protein induces protective immunity, and its neutralization prevents disease progression.

[Effects of interferon-gamma on cytotoxicity of murine activated macrophages against murine glioma cells].

PubMed

Ohyama, K; Kikuchi, H; Oda, Y; Moritake, K; Yamasaki, T

1993-06-01

We studied the effects of mouse IFN-gamma on the cytotoxic activity of murine activated macrophages (M phi) against mouse VM-Glioma cells (H-2b). Activated M phi were obtained from peritoneal exudate cells of mice from four strains, C57BL/6 (H-2b), C3H/He(H-2k), DBA/2 (H-2d), and BALB/c (H-2d), following intraperitoneal injection of (1) LPS 200 micrograms, (2) BCG 200 micrograms, (3) C. parvum 200 micrograms, or (4) MDP 350 micrograms 7 days prior to 20-hr 51Cr release-assay. Of the various combination of mouse strains and activating agents tested, that of activated M phi of the C3H/He mouse with induction by LPS had the most tumoricidal effect against the glioma cells, which was not MHC restricted. Although LPS-activated M phi underwent marked loss of cytotoxicity following initiation of in vitro culture, this 24 hr pretreatment with IFN-gamma inhibited this reduction in tumoricidal effects in a dose-dependent fashion. On the other hand, 24 hr pretreatment of target cells with IFN-gamma did not increase their susceptibility to lysis by activated M phi. These findings suggest that IFN-gamma augments the in vitro tumoricidal activation of M phi; This effect appears to be unrelated to any influence of IFN-gamma on target sensitivity to lysis by macrophages.

Alopecia of IFN-gamma knockout mouse as a model for disturbance of the hair cycle: a unique arrest of the hair cycle at the anagen phase accompanied by mitosis.

PubMed

Hirota, Ryuichiro; Tajima, Sadao; Yoneda, Yukio; Tamayama, Takumi; Watanabe, Masahito; Ueda, Kouichi; Kubota, Takahiro; Yoshida, Ryotaro

2002-09-01

Interferon-gamma(-/-) (IFN-gamma(-/-)) and IFN-gamma(+/+) C57BL/6 mice (3 weeks of age) completed the production of morphogenesis-derived hair. Around 6 weeks of age, however, most of the IFN-gamma(-/-) but none of the IFN-gamma(+/+) mice began to lose hairs in the dorsal and occipital areas in the absence of inflammatory reactions, and the alopecia was sustained for at least several 10-week periods of observation. A single subcutaneous injection of IFN-gamma to IFN-gamma(-/-) mice at 3, but not 4, 5, or 8 weeks of age could protect all the mice from alopecia, revealing that the lack of IFN-gamma around 3 weeks of age is directly responsible for the alopecia. Histologic features showed that the hair follicles of the IFN-gamma(+/+) mice passed through the anagen (4-5 weeks of age) and catagen/telogen ( approximately 6 weeks of age) phases, whereas those of IFN-gamma(-/-) mice (5 weeks of age or older) stayed in the anagen phase. TUNEL and bromodeoxyuridine experiments suggested that an arrest with unlimited DNA synthesis of the hair cycle in the anagen phase by the lack of IFN-gamma-dependent apoptosis in the midfollicle region and diffuse shedding of previously formed hair induced alopecia in IFN-gamma(-/-) mice.

Interferon production and signaling pathways are antagonized during henipavirus infection of fruit bat cell lines.

PubMed

Virtue, Elena R; Marsh, Glenn A; Baker, Michelle L; Wang, Lin-Fa

2011-01-01

Bats are natural reservoirs for a spectrum of infectious zoonotic diseases including the recently emerged henipaviruses (Hendra and Nipah viruses). Henipaviruses have been observed both naturally and experimentally to cause serious and often fatal disease in many different mammal species, including humans. Interestingly, infection of the flying fox with henipaviruses occurs in the absence of clinical disease. The extreme variation in the disease pattern between humans and bats has led to an investigation into the effects of henipavirus infection on the innate immune response in bat cell lines. We report that henipavirus infection does not result in the induction of interferon expression, and the viruses also inhibit interferon signaling. We also confirm that the interferon production and signaling block in bat cells is not due to differing viral protein expression levels between human and bat hosts. This information, in addition to the known lack of clinical signs in bats following henipavirus infection, suggests that bats control henipavirus infection by an as yet unidentified mechanism, not via the interferon response. This is the first report of henipavirus infection in bat cells specifically investigating aspects of the innate immune system.

RIOK3 Is an Adaptor Protein Required for IRF3-Mediated Antiviral Type I Interferon Production

PubMed Central

Feng, Jun; De Jesus, Paul D.; Su, Victoria; Han, Stephanie; Gong, Danyang; Wu, Nicholas C.; Tian, Yuan; Li, Xudong; Wu, Ting-Ting; Chanda, Sumit K.

2014-01-01

ABSTRACT Detection of cytosolic nucleic acids by pattern recognition receptors leads to the induction of type I interferons (IFNs) and elicits the innate immune response. We report here the identification of RIOK3 as a novel adaptor protein that is essential for the cytosolic nucleic acid-induced type I IFN production and for the antiviral response to gammaherpesvirus through two independent kinome-wide RNA interference screens. RIOK3 knockdown blocks both cytosolic double-stranded B-form DNA and double-stranded RNA-induced IRF3 activation and IFN-β production. In contrast, the overexpression of RIOK3 activates IRF3 and induces IFN-β. RIOK3 functions downstream of TBK1 and upstream of IRF3 activation. Furthermore, RIOK3 physically interacts with both IRF3 and TBK1 and is necessary for the interaction between TBK1 and IRF3. In addition, global transcriptome analysis shows that the expression of many gene involved antiviral responses is dependent on RIOK3. Thus, knockdown of RIOK3 inhibits cellular antiviral responses against both DNA and RNA viruses (herpesvirus and influenza A virus). Our data suggest that RIOK3 plays a critical role in the antiviral type I IFN pathway by bridging TBK1 and IRF3. IMPORTANCE The innate immune response, such as the production of type I interferons, acts as the first line of defense, limiting infectious pathogens directly and shaping the adaptive immune response. In this study, we identified RIOK3 as a novel regulator of the antiviral type I interferon pathway. Specifically, we found that RIOK3 physically interacts with TBK1 and IRF3 and bridges the functions between TBK1 and IRF3 in the activation of type I interferon pathway. The identification of a cellular kinase that plays a role the type I interferon pathway adds another level of complexity in the regulation of innate immunity and will have implications for developing novel strategies to combat viral infection. PMID:24807708

Type I Interferons as Stimulators of DC-Mediated Cross-Priming: Impact on Anti-Tumor Response

PubMed Central

Schiavoni, Giovanna; Mattei, Fabrizio; Gabriele, Lucia

2013-01-01

Induction of potent tumor-specific cytotoxic T-cell responses is a fundamental objective in anticancer therapeutic strategies. This event requires that antigen-presenting cells present tumor-associated antigens (Ag) on their MHC class-I molecule, in a process termed cross-presentation. Dendritic cells (DC) are particularly keen on this task and can induce the cross-priming of CD8+ T cells, when exposed to danger or inflammatory signals that stimulate their activation. Type I interferons (IFN-I), a family of long-known immunostimulatory cytokines, have been proven to produce optimal activation signal for DC-induced cross-priming. Recent in vitro and in vivo evidences have suggested that IFN-I-stimulated cross-priming by DC against tumor-associated Ag is a key mechanism for cancer immunosurveillance and may be usefully exploited to boost anti-tumor CD8+ T-cell responses. Here, we will review the cross-presentation properties of different DC subsets, with special focus on cell-associated and tumor Ag, and discuss how IFN-I can modify this function, with the aim of identifying more specific and effective strategies for improving anticancer responses. PMID:24400008

The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon

PubMed Central

Fernández de Marco, María del Mar; Alejo, Alí; Hudson, Paul; Damon, Inger K.; Alcami, Antonio

2010-01-01

Variola virus (VARV) caused smallpox, one of the most devastating human diseases and the first to be eradicated, but its deliberate release represents a dangerous threat. Virulent orthopoxviruses infecting humans, such as monkeypox virus (MPXV), could fill the niche left by smallpox eradication and the cessation of vaccination. However, immunomodulatory activities and virulence determinants of VARV and MPXV remain largely unexplored. We report the molecular characterization of the VARV- and MPXV-secreted type I interferon-binding proteins, which interact with the cell surface after secretion and prevent type I interferon responses. The proteins expressed in the baculovirus system have been purified, and their interferon-binding properties characterized by surface plasmon resonance. The ability of these proteins to inhibit a broad range of interferons was investigated to identify potential adaptation to the human immune system. Furthermore, we demonstrate by Western blot and activity assays the expression of the type I interferon inhibitor during VARV and MPXV infections. These findings are relevant for the design of new vaccines and therapeutics to smallpox and emergent virulent orthopoxviruses because the type I interferon-binding protein is a major virulence factor in animal models, vaccination with this protein induces protective immunity, and its neutralization prevents disease progression.—Fernández de Marco, M. M., Alejo, A., Hudson, P., Damon, I. K., Alcami, A. The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon. PMID:20019241

Characterization of the Gamma Response of a Cadmium Capture-gated Neutron Spectrometer

NASA Astrophysics Data System (ADS)

Hogan, Nathaniel; Rees, Lawrence; Czirr, Bart; Bastola, Suraj

2010-10-01

We have studied the gamma response of a newly developed capture-gated neutron spectrometer. Such spectrometers detect a dual signal from incoming neutrons, allowing for differentiation between other particles, such as gamma rays. The neutron provides a primary light pulse in either plastic or liquid scintillator through neutron-proton collisions. A capture material then delivers a second pulse as the moderated neutron captures in the intended material, which then de-excites with the release of gamma energy. The presented spectrometer alternates one centimeter thick plastic scintillators with sheets of cadmium inserted in between for neutron capture. The neutron capture in cadmium offers a release of gamma energy ˜ 9 MeV. To verify that the interaction was caused by a neutron, the response functions of both events must be well known. Due to the prior existence of many capture-gated neutron spectrometers, the proton recoil pulse has already been studied, but the capture pulse is unique to each spectrometer and must be measured. Experimental results agree with theoretical Monte-Carlo code, both suggesting that the optics and geometry of the spectrometer play a large role in its efficiency. Results prove promising for the efficiency of the spectrometer.

Pathogenic Influenza Viruses and Coronaviruses Utilize Similar and Contrasting Approaches To Control Interferon-Stimulated Gene Responses

PubMed Central

Menachery, Vineet D.; Eisfeld, Amie J.; Schäfer, Alexandra; Josset, Laurence; Sims, Amy C.; Proll, Sean; Fan, Shufang; Li, Chengjun; Neumann, Gabriele; Tilton, Susan C.; Chang, Jean; Gralinski, Lisa E.; Long, Casey; Green, Richard; Williams, Christopher M.; Weiss, Jeffrey; Matzke, Melissa M.; Webb-Robertson, Bobbie-Jo; Schepmoes, Athena A.; Shukla, Anil K.; Metz, Thomas O.; Smith, Richard D.; Waters, Katrina M.; Katze, Michael G.; Kawaoka, Yoshihiro

2014-01-01

ABSTRACT The broad range and diversity of interferon-stimulated genes (ISGs) function to induce an antiviral state within the host, impeding viral pathogenesis. While successful respiratory viruses overcome individual ISG effectors, analysis of the global ISG response and subsequent viral antagonism has yet to be examined. Employing models of the human airway, transcriptomics and proteomics datasets were used to compare ISG response patterns following highly pathogenic H5N1 avian influenza (HPAI) A virus, 2009 pandemic H1N1, severe acute respiratory syndrome coronavirus (SARS-CoV), and Middle East respiratory syndrome CoV (MERS-CoV) infection. The results illustrated distinct approaches utilized by each virus to antagonize the global ISG response. In addition, the data revealed that highly virulent HPAI virus and MERS-CoV induce repressive histone modifications, which downregulate expression of ISG subsets. Notably, influenza A virus NS1 appears to play a central role in this histone-mediated downregulation in highly pathogenic influenza strains. Together, the work demonstrates the existence of unique and common viral strategies for controlling the global ISG response and provides a novel avenue for viral antagonism via altered histone modifications. PMID:24846384

Interferons direct Th2 cell reprogramming to generate a stable GATA-3(+)T-bet(+) cell subset with combined Th2 and Th1 cell functions.

PubMed

Hegazy, Ahmed N; Peine, Michael; Helmstetter, Caroline; Panse, Isabel; Fröhlich, Anja; Bergthaler, Andreas; Flatz, Lukas; Pinschewer, Daniel D; Radbruch, Andreas; Löhning, Max

2010-01-29

Current T cell differentiation models invoke separate T helper 2 (Th2) and Th1 cell lineages governed by the lineage-specifying transcription factors GATA-3 and T-bet. However, knowledge on the plasticity of Th2 cell lineage commitment is limited. Here we show that infection with Th1 cell-promoting lymphocytic choriomeningitis virus (LCMV) reprogrammed otherwise stably committed GATA-3(+) Th2 cells to adopt a GATA-3(+)T-bet(+) and interleukin-4(+)interferon-gamma(+) "Th2+1" phenotype that was maintained in vivo for months. Th2 cell reprogramming required T cell receptor stimulation, concerted type I and type II interferon and interleukin-12 signals, and T-bet. LCMV-triggered T-bet induction in adoptively transferred virus-specific Th2 cells was crucial to prevent viral persistence and fatal immunopathology. Thus, functional reprogramming of unfavorably differentiated Th2 cells may facilitate the establishment of protective immune responses. Stable coexpression of GATA-3 and T-bet provides a molecular concept for the long-term coexistence of Th2 and Th1 cell lineage characteristics in single memory T cells. Copyright 2010 Elsevier Inc. All rights reserved.

[Autoimmunity in children with chronic hepatitis C treated with interferon alpha and ribavirin].

PubMed

Gora-Gebka, Magdalena; Liberek, Anna; Bako, Wanda; Raczkowska-Kozak, Janina; Sikorska-Wisniewska, Grazyna; Korzon, Maria

2004-01-01

The role of interferon alpha or the virus itself in the pathogenesis and the risk of autoimmunological disorders in patients infected with HCV, still remain unknown, especially in children. The aim of the study was to evaluate the incidence of autoantibodies and the risk of autoimmunological disorders in children with chronic hepatitis C, treated with interferon alpha and ribavirin in the Department of Paediatrics, Paediatric Gastroenterology and Oncology in Gdansk. In the studied group of 12 patients, in 4 cases autoantibodies were present in low titers prior to the treatment and they had no prognostic value for the response to the therapy or the risk of autoimmunological disorders. Positive response for the treatment was achieved in 4 cases; in 3 cases indications for discontinuation of the therapy were established. During the therapy with interferon alpha and ribavirin, in 2 children elevation of serum titers of antibodies to liver-kidney microsome type 1 (anti-LKM1) (> 1:640) with normal gammaglobulin levels was noted. In none of the children autoimmunological disorders were observed.

Regulation of human intestinal T-cell responses by type 1 interferon-STAT1 signaling is disrupted in inflammatory bowel disease.

PubMed

Giles, E M; Sanders, T J; McCarthy, N E; Lung, J; Pathak, M; MacDonald, T T; Lindsay, J O; Stagg, A J

2017-01-01

Type 1 interferon (IFN-1) promotes regulatory T-cell function to suppress inflammation in the mouse intestine, but little is known about IFN-1 in the human gut. We therefore assessed the influence of IFN-1 on CD4+ T-cells isolated from human colon tissue obtained from healthy controls or patients with inflammatory bowel disease (IBD). Immunofluorescent imaging revealed constitutive expression of IFNβ in human intestinal tissue, and colonic T-cells were responsive to exogenous IFN-1 as assessed by phosphorylation of signal transduction and activator of transcription 1 (pSTAT1) and induction of interferon stimulated genes (ISGs). Unlike their blood counterparts, intestinal T-cells from non-inflamed regions of IBD colon displayed enhanced responsiveness to IFN-1, increased frequency of pSTAT1+ cells, and greater induction of ISGs upon IFN-1 exposure in vitro. In healthy tissue, antibody neutralization of IFNβ selectively reduced T-cell production of the pro-regulatory cytokine interleukin-10 (IL-10) and increased IFNγ synthesis. In contrast, neutralization of IFNβ in IBD tissue cultures increased the frequency of T-cells producing inflammatory cytokines but did not alter IL-10 expression. These data support a role for endogenous IFN-1 as a context-dependent modulator of T-cell function that promotes regulatory activity in healthy human intestine, but indicate that the IFN-1/STAT1 pathway is dysregulated in inflammatory bowel disease.

C-Reactive Protein (CRP), Interferon Gamma-Inducible Protein 10 (IP-10), and Lipopolysaccharide (LPS) Are Associated with Risk of Tuberculosis after Initiation of Antiretroviral Therapy in Resource-Limited Settings

PubMed Central

Tenforde, Mark W.; Gupte, Nikhil; Dowdy, David W.; Asmuth, David M.; Balagopal, Ashwin; Pollard, Richard B.; Sugandhavesa, Patcharaphan; Lama, Javier R.; Pillay, Sandy; Cardoso, Sandra W.; Pawar, Jyoti; Santos, Breno; Riviere, Cynthia; Mwelase, Noluthando; Kanyama, Cecilia; Kumwenda, Johnstone; Hakim, James G.; Kumarasamy, Nagalingeswaran; Bollinger, Robert; Semba, Richard D.; Campbell, Thomas B.; Gupta, Amita

2015-01-01

Objective The association between pre-antiretroviral (ART) inflammation and immune activation and risk for incident tuberculosis (TB) after ART initiation among adults is uncertain. Design Nested case-control study (n = 332) within ACTG PEARLS trial of three ART regimens among 1571 HIV-infected, treatment-naïve adults in 9 countries. We compared cases (participants with incident TB diagnosed by 96 weeks) to a random sample of controls (participants who did not develop TB, stratified by country and treatment arm). Methods We measured pre-ART C-reactive protein (CRP), EndoCab IgM, ferritin, interferon gamma (IFN-γ), interleukin 6 (IL-6), interferon gamma-inducible protein 10 (IP-10), lipopolysaccharide (LPS), soluble CD14 (sCD14), tumor necrosis factor alpha (TNF-α), and CD4/DR+/38+ and CD8/DR+/38+ T cells. Markers were defined according to established cutoff definitions when available, 75th percentile of measured values when not, and detectable versus undetectable for LPS. Using logistic regression, we measured associations between biomarkers and incident TB, adjusting for age, sex, study site, treatment arm, baseline CD4 and log10 viral load. We assessed the discriminatory value of biomarkers using receiver operating characteristic (ROC) analysis. Results Seventy-seven persons (4.9%) developed incident TB during follow-up. Elevated baseline CRP (aOR 3.25, 95% CI: 1.55–6.81) and IP-10 (aOR 1.89, 95% CI: 1.05–3.39), detectable plasma LPS (aOR 2.39, 95% CI: 1.13–5.06), and the established TB risk factors anemia and hypoalbuminemia were independently associated with incident TB. In ROC analysis, CRP, albumin, and LPS improved discrimination only modestly for TB risk when added to baseline routine patient characteristics including CD4 count, body mass index, and prior TB. Conclusion Incident TB occurs commonly after ART initiation. Although associated with higher post-ART TB risk, baseline CRP, IP-10, and LPS add limited value to routine patient characteristics

Plasmacytoid dendritic cell interferon-α production to R-848 stimulation is decreased in male infants

PubMed Central

2012-01-01

Background Sex differences in response to microbial infections, especially viral ones, may be associated with Toll-like receptor (TLR)-mediated responses by plasmacytoid dendritic cells (pDCs). Results In this study, we identified sex differences in human infant pDC interferon-α production following challenge with the TLR7/8 agonist R-848. Male pDC responses were significantly lower than those of females during early infancy. This difference may be attributed to the androgen surge experienced by males during the early infancy period. Pretreatment of human pDCs with dihydrotestosterone produced a significant reduction in interferon-α production following R-848 challenge. Conclusions Androgen-mediated regulation of pDC TLR7-driven innate immune responses may contribute to the observed sex differences in response to infections during early infancy. PMID:22769054

Role for herpes simplex virus 1 ICP27 in the inhibition of type I interferon signaling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Karen E.; Song, Byeongwoon; Knipe, David M.

2008-05-10

Host cells respond to viral infection by many mechanisms, including the production of type I interferons which act in a paracrine and autocrine manner to induce the expression of antiviral interferon-stimulated genes (ISGs). Viruses have evolved means to inhibit interferon signaling to avoid induction of the innate immune response. Herpes simplex virus 1 (HSV-1) has several mechanisms to inhibit type I interferon production, the activities of ISGs, and the interferon signaling pathway itself. We report that the inhibition of the Jak/STAT pathway by HSV-1 requires viral gene expression and that viral immediate-early protein ICP27 plays a role in downregulating STAT-1more » phosphorylation and in preventing the accumulation of STAT-1 in the nucleus. We also show that expression of ICP27 by transfection causes an inhibition of IFN-induced STAT-1 nuclear accumulation. Therefore, ICP27 is necessary and sufficient for at least some of the effects of HSV infection on STAT-1.« less

Current report on the interferon program at Roswell Park Memorial Institute.

PubMed

Murphy, G P

1981-01-01

An overview of the interferon program at Roswell Park Memorial Institute (RPMI), is presented. This program encompasses three interrelated areas of research and new drug development: (a) basic research on purification and characterization of animal and human interferons (leukocyte, fibroblast, and immune); (b) large scale manufacture and preclinical testing of human fibroblast interferon (HFIF); and (c) clinical trials with HFIF to determine its safety of administration as well as antiviral, antitumor, and immunomodulatory activities in patients with neoplastic or viral disease. The antitumor effect of HFIF produced at RPMI as assessed by intralesional injection of various metastatic nodules resulted in an overall 71% local response. Phase I studies in 13 patients demonstrated that HFIF can be administered safely by the subcutaneous, intramuscular, and intravenous routes in doses up to 25 million units per day without any serious untoward effects. Intrathecal administration of HFIF into patients with CNS leukemia was also well tolerated. Pharmacokinetic studies indicated significant levels of HFIF in serum and cerebrospinal fluid after intravenous and intrathecal administration, respectively. Coincidental with the HFIF systemic administration during the Phase I trials, favorable responses in several laboratory, immune, and clinical parameters were observed. These results provide the rationale for conducting phase II and phase III clinical trials with HFIF produced at RPMI.

Measurement of ex vivo ELISpot interferon-gamma recall responses to Plasmodium falciparum AMA1 and CSP in Ghanaian adults with natural exposure to malaria.

PubMed

Ganeshan, Harini; Kusi, Kwadwo A; Anum, Dorothy; Hollingdale, Michael R; Peters, Bjoern; Kim, Yohan; Tetteh, John K A; Ofori, Michael F; Gyan, Ben A; Koram, Kwadwo A; Huang, Jun; Belmonte, Maria; Banania, Jo Glenna; Dodoo, Daniel; Villasante, Eileen; Sedegah, Martha

2016-02-01

Malaria eradication requires a concerted approach involving all available control tools, and an effective vaccine would complement these efforts. An effective malaria vaccine should be able to induce protective immune responses in a genetically diverse population. Identification of immunodominant T cell epitopes will assist in determining if candidate vaccines will be immunogenic in malaria-endemic areas. This study therefore investigated whether class I-restricted T cell epitopes of two leading malaria vaccine antigens, Plasmodium falciparum circumsporozoite protein (CSP) and apical membrane antigen-1 (AMA1), could recall T cell interferon-γ responses from naturally exposed subjects using ex vivo ELISpot assays. Thirty-five subjects aged between 24 and 43 years were recruited from a malaria-endemic urban community of Ghana in 2011, and their peripheral blood mononuclear cells (PBMCs) were tested in ELISpot IFN-γ assays against overlapping 15mer peptide pools spanning the entire CSP and AMA1 antigens, and 9-10mer peptide epitope mixtures that included previously identified and/or predicted human leukocyte antigen (HLA) class 1-restricted epitopes from same two antigens. For CSP, 26 % of subjects responded to at least one of the nine 15mer peptide pools whilst 17 % responded to at least one of the five 9-10mer HLA-restricted epitope mixtures. For AMA1, 63 % of subjects responded to at least one of the 12 AMA1 15mer peptide pools and 51 % responded to at least one of the six 9-10mer HLA-restricted epitope mixtures. Following analysis of data from the two sets of peptide pools, along with bioinformatics predictions of class I-restricted epitopes and the HLA supertypes expressed by a subset of study subjects, peptide pools that may contain epitopes recognized by multiple HLA supertypes were identified. Collectively, these results suggest that natural transmission elicits ELISpot IFN-γ activities to class 1-restricted epitopes that are largely HLA-promiscuous. These

Nipah Virus V Protein Evades Alpha and Gamma Interferons by Preventing STAT1 and STAT2 Activation and Nuclear Accumulation

PubMed Central

Rodriguez, Jason J.; Parisien, Jean-Patrick; Horvath, Curt M.

2002-01-01

Characterization of recent outbreaks of fatal encephalitis in southeast Asia identified the causative agent to be a previously unrecognized enveloped negative-strand RNA virus of the Paramyxoviridae family, Nipah virus. One feature linking Nipah virus to this family is a conserved cysteine-rich domain that is the hallmark of paramyxovirus V proteins. The V proteins of other paramyxovirus species have been linked with evasion of host cell interferon (IFN) signal transduction and subsequent antiviral responses by inducing proteasomal degradation of the IFN-responsive transcription factors, STAT1 or STAT2. Here we demonstrate that Nipah virus V protein escapes IFN by a distinct mechanism involving direct inhibition of STAT protein function. Nipah virus V protein differs from other paramyxovirus V proteins in its subcellular distribution but not in its ability to inhibit cellular IFN responses. Nipah virus V protein does not induce STAT degradation but instead inhibits IFN responses by forming high-molecular-weight complexes with both STAT1 and STAT2. We demonstrate that Nipah virus V protein accumulates in the cytoplasm by a Crm1-dependent mechanism, alters the STAT protein subcellular distribution in the steady state, and prevents IFN-stimulated STAT redistribution. Consistent with the formation of complexes, STAT protein tyrosine phosphorylation is inhibited in cells expressing the Nipah virus V protein. As a result, Nipah virus V protein efficiently prevents STAT1 and STAT2 nuclear translocation in response to IFN, inhibiting cellular responses to both IFN-α and IFN-γ. PMID:12388709

Altered interferon-γ response in patients with Q-fever fatigue syndrome.

PubMed

Keijmel, Stephan P; Raijmakers, Ruud P H; Bleeker-Rovers, Chantal P; van der Meer, Jos W M; Netea, Mihai G; Schoffelen, Teske; van Deuren, Marcel

2016-04-01

Whether immunological mechanisms underlie Q-fever fatigue syndrome (QFS) remains unclear. For acute Q-fever, the antigen-specific interferon-γ (IFNγ) response may be a useful tool for diagnosis, and the IFNγ/interleukin(IL)-2 production ratio may be a marker for chronic Q-fever and treatment monitoring. Here we explored the specific IFNγ production and IFNγ/IL-2 ratio in QFS patients. IFNγ and IL-2 production were tested in ex-vivo stimulated whole blood of QFS patients (n = 20), and compared to those previously determined in seropositive controls (n = 135), and chronic Q-fever patients (n = 28). Also, the correlation between patient characteristics and IFNγ, IL-2, and IFNγ/IL-2 ratio was determined. QFS patients were younger (p < 0.001), but gender distribution was similar to seropositive controls and chronic Q-fever patients. Coxiella burnetii Nine Mile stimulation revealed a higher IFNγ production in QFS (median 319.5 pg/ml) than in seropositive controls (120 pg/ml, p < 0.01), but comparable to chronic Q-fever (2846 pg/ml). The IFNγ/IL-2 ratio was similar to that in seropositive controls, but lower than in chronic Q-fever patients (p < 0.01). Symptom duration was positively correlated with IL-2 production, and negatively correlated with the IFNγ/IL-2 ratio. These results point to an altered cell-mediated immunity in QFS, and suggest a different immune response than in chronic Q-fever. Copyright © 2016 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

Dampened STING-Dependent Interferon Activation in Bats.

PubMed

Xie, Jiazheng; Li, Yang; Shen, Xurui; Goh, Geraldine; Zhu, Yan; Cui, Jie; Wang, Lin-Fa; Shi, Zheng-Li; Zhou, Peng

2018-03-14

Compared with terrestrial mammals, bats have a longer lifespan and greater capacity to co-exist with a variety of viruses. In addition to cytosolic DNA generated by these viral infections, the metabolic demands of flight cause DNA damage and the release of self-DNA into the cytoplasm. However, whether bats have an altered DNA sensing/defense system to balance high cytosolic DNA levels remains an open question. We demonstrate that bats have a dampened interferon response due to the replacement of the highly conserved serine residue (S358) in STING, an essential adaptor protein in multiple DNA sensing pathways. Reversing this mutation by introducing S358 restored STING functionality, resulting in interferon activation and virus inhibition. Combined with previous reports on bat-specific changes of other DNA sensors such as TLR9, IFI16, and AIM2, our findings shed light on bat adaptation to flight, their long lifespan, and their unique capacity to serve as a virus reservoir. Copyright © 2018 Elsevier Inc. All rights reserved.

Dichotomy of protective cellular immune responses to human visceral leishmaniasis.

PubMed

Khalil, E A G; Ayed, N B; Musa, A M; Ibrahim, M E; Mukhtar, M M; Zijlstra, E E; Elhassan, I M; Smith, P G; Kieny, P M; Ghalib, H W; Zicker, F; Modabber, F; Elhassan, A M

2005-05-01

Healing/protective responses in human visceral leishmaniasis (VL) are associated with stimulation/production of Th1 cytokines, such as interferon IFN-gamma, and conversion in the leishmanin skin test (LST). Such responses were studied for 90 days in 44 adult healthy volunteers from VL non-endemic areas, with no past history of VL/cutaneous leishmaniasis (CL) and LST non-reactivity following injection with one of four doses of Alum-precipitated autoclaved Leishmania major (Alum/ALM) +/- bacille Calmette-Guerin (BCG), a VL candidate vaccine. The vaccine was well tolerated with minimal localized side-effects and without an increase in antileishmanial antibodies or interleukin (IL)-5. Five volunteers (5/44; 11.4%) had significant IFN-gamma production by peripheral blood mononuclear cells (PBMCs) in response to Leishmania antigens in their prevaccination samples (P = 0.001) but were LST non-reactive. On day 45, more than half the volunteers (26/44; 59.0%) had significantly high LST indurations (mean 9.2 +/- 2.7 mm) and high IFN-gamma levels (mean 1008 +/- 395; median 1247 pg/ml). Five volunteers had significant L. donovani antigen-induced IFN-gamma production (mean 873 +/- 290; median 902; P = 0.001), but were non-reactive in LST. An additional five volunteers (5/44; 11.4%) had low IFN-gamma levels (mean 110 +/- 124 pg/ml; median 80) and were non-reactive in LST (induration = 00 mm). The remaining eight volunteers had low IFN-gamma levels, but significant LST induration (mean 10 +/- 2.9 mm; median 11). By day 90 the majority of volunteers (27/44; 61.4%) had significant LST induration (mean 10.8 +/- 9.9 mm; P < 0.001), but low levels of L. donovani antigen-induced IFN-gamma (mean 66.0 +/- 62 pg/ml; P > 0.05). Eleven volunteers (11/44; 25%) had significantly high levels of IFN-gamma and LST induration, while five volunteers had low levels of IFN-gamma (<100 pg/ml) and no LST reactivity (00 mm). One volunteer was lost to follow-up. In conclusion, it is hypothesized that

Gene expression and production of tumor necrosis factor alpha, interleukin 1, interleukin 6, and gamma interferon in C3H/HeN and C57BL/6N mice in acute Mycoplasma pulmonis disease.

PubMed Central

Faulkner, C B; Simecka, J W; Davidson, M K; Davis, J K; Schoeb, T R; Lindsey, J R; Everson, M P

1995-01-01

Studies were conducted to determine whether the production of various cytokines is associated with Mycoplasma pulmonis disease expression. Susceptible C3H/HeN and resistant C57BL/6N mice were inoculated intranasally with 10(7) CFU of virulent M. pulmonis UAB CT or avirulent M. pulmonis UAB T. Expression of genes for tumor necrosis factor alpha (TNF-alpha), interleukin 1 alpha (IL-1 alpha), IL-1 beta, IL-6, and gamma interferon (IFN-gamma) in whole lung tissue and TNF-alpha gene expression in bronchoalveolar lavage (BAL) cells was determined by reverse transcription-PCR using specific cytokine primers at various times postinoculation. In addition, concentrations of TNF-alpha, IL-1, IL-6, and IFN-gamma were determined in BAL fluid and serum samples at various times postinoculation. Our results showed that there was a sequential appearance of cytokines in the lungs of infected mice: TNF-alpha, produced primarily by BAL cells, appeared first, followed by IL-1 and IL-6, which were followed by IFN-gamma. Susceptible C3H/HeN mice had higher and more persistent concentrations of TNF-alpha and IL-6 in BAL fluid than did resistant C57BL/6N mice, indicating that TNF-alpha and possibly IL-6 are important factors in pathogenesis of acute M. pulmonis disease in mice. Serum concentrations of IL-6 were elevated in C3H/HeN mice, but not C57BL/6N mice, following infection with M. pulmonis, suggesting that IL-6 has both local and systemic effects in M. pulmonis disease. PMID:7558323

Interferon-gamma increased epithelial barrier function via upregulating claudin-7 expression in human submandibular gland duct epithelium.

PubMed

Abe, Ayumi; Takano, Kenichi; Kojima, Takashi; Nomura, Kazuaki; Kakuki, Takuya; Kaneko, Yakuto; Yamamoto, Motohisa; Takahashi, Hiroki; Himi, Tetsuo

2016-06-01

Tight junctions (TJs) are necessary for salivary gland function and may serve as indicators of salivary gland epithelial dysfunction. IgG4-related disease (IgG4-RD) is a newly recognized fibro-inflammatory condition which disrupts the TJ associated epithelial barrier. The salivary glands are one of the most frequently involved organs in IgG4-RD, however, changes of the TJ associated epithelial barrier in salivary gland duct epithelium is poorly understood. Here, we investigated the regulation and function of TJs in human submandibular gland ductal epithelial cells (HSDECs) in normal and IgG4-RD. We examined submandibular gland (SMG) tissue from eight control individuals and 22 patients with IgG4-RD and established an HSDEC culture system. Immunohistochemistry, immunocytochemistry, western blotting, and measurement of transepithelial electrical resistance (TER) were performed. Claudin-4, claudin-7, occludin, and JAM-A were expressed at the apical side of the duct epithelium in submandibular gland (SMG) tissue and at the cell borders in HSDECs of normal and IgG4-RD. The expression and distribution of TJs in SMG tissue were not different in control individuals and patients with IgG4-RD in vivo and in vitro. Although interferon-gamma (IFNγ) generally disrupts the integrity and function of TJs, as manifested by decreased epithelial barrier function, IFNγ markedly increased the epithelial barrier function of HSDECs via upregulation of claudin-7 expression in HSDECs from patients with IgG4-RD. This is the first report showing an IFNγ-dependent increase in epithelial barrier function in the salivary gland duct epithelium. Our results provide insights into the functional significance of TJs in salivary gland duct epithelium in physiological and pathological conditions, including IgG4-RD.

NS1 Protein Mutation I64T Affects Interferon Responses and Virulence of Circulating H3N2 Human Influenza A Viruses.

PubMed

DeDiego, Marta L; Nogales, Aitor; Lambert-Emo, Kris; Martinez-Sobrido, Luis; Topham, David J

2016-11-01

Influenza NS1 protein is the main viral protein counteracting host innate immune responses, allowing the virus to efficiently replicate in interferon (IFN)-competent systems. In this study, we analyzed NS1 protein variability within influenza A (IAV) H3N2 viruses infecting humans during the 2012-2013 season. We also evaluated the impact of the mutations on the ability of NS1 proteins to inhibit host innate immune responses and general gene expression. Surprisingly, a previously unidentified mutation in the double-stranded RNA (dsRNA)-binding domain (I64T) decreased NS1-mediated general inhibition of host protein synthesis by decreasing its interaction with cleavage and polyadenylation specificity factor 30 (CPSF30), leading to increased innate immune responses after viral infection. Notably, a recombinant A/Puerto Rico/8/34 H1N1 virus encoding the H3N2 NS1-T64 protein was highly attenuated in mice, most likely because of its ability to induce higher antiviral IFN responses at early times after infection and because this virus is highly sensitive to the IFN-induced antiviral state. Interestingly, using peripheral blood mononuclear cells (PBMCs) collected at the acute visit (2 to 3 days after infection), we show that the subject infected with the NS1-T64 attenuated virus has diminished responses to interferon and to interferon induction, suggesting why this subject could be infected with this highly IFN-sensitive virus. These data demonstrate the importance of influenza virus surveillance in identifying new mutations in the NS1 protein, affecting its ability to inhibit innate immune responses and, as a consequence, the pathogenicity of the virus. Influenza A and B viruses are one of the most common causes of respiratory infections in humans, causing 1 billion infections and between 300,000 and 500,000 deaths annually. Influenza virus surveillance to identify new mutations in the NS1 protein affecting innate immune responses and, as a consequence, the pathogenicity of

A novel system to diagnose cutaneous adverse drug reactions employing the cellscan--comparison with histamine releasing test and Inf-gamma Releasing Test.

PubMed

Goldberg, Ilan; Gilburd, Boris; Kravitz, Martine Szyper; Kivity, Shmuel; Chaim, Berta Ben; Klein, Tirza; Schiffenbauer, Yael; Trubniykovr, Ela; Brenner, Sarah; Shoenfeld, Yehuda

2005-03-01

There are several mechanisms to describe allergic drug reactions yet the methods to diagnose them are limited. To compare several conventional clinical and laboratory methods to diagnose skin reactions to drugs to a new method of diagnosing drug reactions by the CellScan system. The study entailed 21 patients who were diagnosed as suffering from drug eruptions, and 105 healthy controls with no history of drug allergy. The drugs were classified into two groups according to suspicion of causing drug allergy: high and low. Most of the patients were on more than one drug, leading to 41 patient-drug interactions (assays). Histamine releasing test (HRT), interferon (INF)-gamma releasing test and CellScan examination were performed on lymphocytes of the patients and controls. The HRTwas interpreted as positive in 9 out of 18 (50%) patients and in 13 out of 35 (37%) assays. Based on the INF-gamma releasing test, positive results were observed in 16 out of 21 (76%) patients and in 24 out of 41 (59%) assays. In the CellScan test (CST), positive results were observed in 17 out of 21 (81%) patients and in 29 out of 41 (71%) assays. The rate of identifying the drug for eruption in the high suspicion level drugs was 9 out of 22 (41%) assays in the HRT, 20 out of 24 (83%) assays in the INF-gamma releasing test, and 21 out of 24 (87%) studies with the CellScan method. The rate of determining of the drug that caused the eruption in the low suspicion level drugs was 4 out of 13 (31 %) in the HRT, 4 out of 17 (24%) assays in the INF-gamma releasing test, and 8 out of 17 (47%) analyses in the CST. When examined in the CellScan, 99 out of 105 (94%) controls were interpreted as negative. This preliminary study indicates that the CellScan seems to be an easy and promising method for the detection of drugs responsible for adverse skin reactions. In contrast to the HRT and to the Interferon-gamma secretion test, the CellScan method is characterized by its ability to track and monitor the

Epigenetic Reprogramming of the Type III Interferon Response Potentiates Antiviral Activity and Suppresses Tumor Growth

PubMed Central

Ding, Siyuan; Khoury-Hanold, William; Iwasaki, Akiko; Robek, Michael D.

2014-01-01

Type III interferon (IFN-λ) exhibits potent antiviral activity similar to IFN-α/β, but in contrast to the ubiquitous expression of the IFN-α/β receptor, the IFN-λ receptor is restricted to cells of epithelial origin. Despite the importance of IFN-λ in tissue-specific antiviral immunity, the molecular mechanisms responsible for this confined receptor expression remain elusive. Here, we demonstrate that the histone deacetylase (HDAC) repression machinery mediates transcriptional silencing of the unique IFN-λ receptor subunit (IFNLR1) in a cell-type-specific manner. Importantly, HDAC inhibitors elevate receptor expression and restore sensitivity to IFN-λ in previously nonresponsive cells, thereby enhancing protection against viral pathogens. In addition, blocking HDAC activity renders nonresponsive cell types susceptible to the pro-apoptotic activity of IFN-λ, revealing the combination of HDAC inhibitors and IFN-λ to be a potential antitumor strategy. These results demonstrate that the type III IFN response may be therapeutically harnessed by epigenetic rewiring of the IFN-λ receptor expression program. PMID:24409098

Type I interferon enhances necroptosis of Salmonella Typhimurium–infected macrophages by impairing antioxidative stress responses

PubMed Central

Hos, Nina Judith; Hos, Deniz; Klimek, Jennifer; Abdullah, Zeinab; Krönke, Martin

2017-01-01

Salmonella enterica serovar Typhimurium exploits the host’s type I interferon (IFN-I) response to induce receptor-interacting protein (RIP) kinase–mediated necroptosis in macrophages. However, the events that drive necroptosis execution downstream of IFN-I and RIP signaling remain elusive. In this study, we demonstrate that S. Typhimurium infection causes IFN-I–mediated up-regulation of the mitochondrial phosphatase Pgam5 through RIP3. Pgam5 subsequently interacts with Nrf2, which sequesters Nrf2 in the cytosol, thereby repressing the transcription of Nrf2-dependent antioxidative genes. The impaired ability to respond to S. Typhimurium–induced oxidative stress results in reactive oxygen species–mediated mitochondrial damage, energy depletion, transient induction of autophagy, and autophagic degradation of p62. Reduced p62 levels impair interaction of p62 with Keap1, which further decreases Nrf2 function and antioxidative responses to S. Typhimurium infection, eventually leading to cell death. Collectively, we identify impaired Nrf2-dependent redox homeostasis as an important mechanism that promotes cell death downstream of IFN-I and RIP3 signaling in S. Typhimurium–infected macrophages. PMID:29055012

Adjuvant immunotherapy of feline fibrosarcoma with recombinant feline interferon-omega.

PubMed

Hampel, Verena; Schwarz, Bianca; Kempf, Christine; Köstlin, Roberto; Schillinger, Ulrike; Küchenhoff, Helmut; Fenske, Nora; Brill, Thomas; Hirschberger, Johannes

2007-01-01

Recombinant feline interferon-omega (rFeIFN-omega) was tested as a treatment option for cats with fibrosarcoma to assess safety and feasibility. Treatment with rFeIFN-omega in cats with fibrosarcoma is safe and feasible. Twenty domestic cats. In an open-labeled uncontrolled clinical trial 12 injections of 1 x 10(6) U/kg rFeIFN-omega were administered over a 5-week period: the 1st through 4th injections were given intratumorally, and the 5th through 12th injections were administered subcutaneously at the tumor excision site. Wide surgical excision of the tumors was carried out after the 4th injection and before the 5th injection of rFeIFN-omega. A Common Terminology Criteria for Adverse Events (CTCAE) analysis was conducted. Flow cytometry of fibrosarcoma cells after incubation with rFeIFN-omega and recombinant feline interferon-gamma was performed to assess the biological effect of rFeIFN-omega. Changes in blood cell count, increases in serum aspartate-amino-transferase activity, serum bilirubin concentration, serum creatinine and serum electrolyte concentrations, weight loss, anorexia, increased body temperature, and reduced general condition were observed but were mostly minor (grade 1 and 2) and self limiting. Eosinophilia (P = .025), neutropenia (P = .021), and weight loss (P < .001) were statistically correlated with rFeIFN-omega-treatment (analysis of parameters before treatment and after 3 injections of rFeIFN-omega). Flow cytometry of 5 unrelated feline fibrosarcoma cell lines showed increased expression of major histocompatibility complex (MHC) class I molecules (P = .026) in response to in vitro incubation with rFeIFN-omega, whereas expression of MHC class II molecules was not affected significantly. RFeIFN-omega for the treatment of feline fibrosarcoma is safe, well tolerated, and can be easily performed in practice. To assess the efficacy of the treatment, it should be tested in a placebo-controlled trial.

DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis

PubMed Central

Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra

2016-01-01

Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227

Interferon Gamma Messenger RNA Signature in Tumor Biopsies Predicts Outcomes in Patients with Non-Small-Cell Lung Carcinoma or Urothelial Cancer Treated with Durvalumab.