Interferon-gamma (INF-gamma) release test can detect cutaneous adverse effects to statins.
Goldberg, Ilan; Isman, Gila; Shirazi, Idit; Brenner, Sarah
2009-12-01
An increasing number of cutaneous adverse effects are being reported as use of statins becomes more widespread. A study was undertaken to establish the relationship between statin and a cutaneous reaction by the in vitro interferon-gamma (INF-gamma) release test. The lymphocytes of 20 patients with suspected drug-induced skin reaction were incubated with and without the drug. The level of INF-gamma from the supernatant was measured by enzyme-linked immunosorbent assay (ELISA), and the increase calculated. Response was positive in 27 (21.43%) of the 126 drugs. Statin was the only drug with a positive response in 80% of those cases. Nine of 20 patients (45.0%) had complete resolution after discontinuation of the drug; 6 (30.0%) who replaced one drug by another statin had partial or no resolution; and 5 (20.0%) had no resolution despite cessation of statins of all kinds. A positive INF-gamma release test was found in patients who developed skin reactions while taking statins; the test's reliability was strengthened by prompt improvement following elimination of the suspected drug in the majority of patients.
[Interferon. An overview of the state of basic research with special regard to interferon-gamma].
Günther, G; Otto, B
1993-02-01
Interferons / An overview on the state of basic research with special regard to interferon-gamma Interferons are multifunctional glycoproteins with a broad range of antiviral, antiproliferative and immunoregulatory effects on the target cell. This review deals with the basics as well as with more recent developments in interferon research. A historic overview of 35 years of interferon research since the discovery of interferons by Isaacs and Lindenmann in 1957 introduces the most important milestones in this field and appreciates the work of the participating researchers. A brief description of the classification of interferons based on different tissue sources, different antigenic properties and different induction behaviour is made. The main part of this review focuses on human interferon-gamma. We discuss recent work on the structure-function relationship of interferon-gamma. The interferon-gamma receptor and its role in signal transduction is another part of this paper. The structure and length of the C-terminal region of interferon-gamma seems to be important for receptor binding and expression of biological activities. A conservative estimate is that the family of IFN-activated genes numbers 15-20 in most cells.
Wang, Xiao Yang; Crowston, Jonathan G; White, Andrew J R; Zoellner, Hans; Healey, Paul R
2014-08-01
The aim of the study was to investigate, using a native mitomycin-C-resistant human Tenon's fibroblast cell line, the possibility that interferon-alpha and gamma could be used with Fas agonists as an alternative anti-fibrotic strategy to mitomycin-C in trabeculectomy. A clinically resistant and in vitro verified mitomycin-C-resistant human Tenon's fibroblast cell line was pretreated with interferon-alpha and interferon-gamma for 48 h before stimulation with an agonistic Fas antibody (CH11) for 2 days to induce cell death. Cell death assays were undertaken. Changes in apoptosis-related proteins were determined by flow cytometry and Western blot. Pretreatment with interferon-alpha or interferon-gamma for 48 h increased Fas, Fas-associated protein with death domain and caspase-8 expression. Protein expression was further increased by combined exposure to interferon-alpha and gamma. Pretreatment with cytokines had no effect on Fas-L and Bcl-2. Interferon-alpha alone did not change the rate of induced cell death. A combination of interferon-alpha and gamma synergistically increased the sensitivity of mitomycin-C-resistant human Tenon's fibroblast cell line to induced cell death. An antagonistic anti-Fas antibody (ZB4) completely blocked induced cell death. Broad caspase inhibitors specific for caspases-8 and -3 reduced induced deaths in interferon pretreated mitomycin-C-resistant human Tenon's fibroblast cell line in a dose-dependent manner. Interferon-alpha and interferon-gamma render mitomycin-C-resistant human Tenon's fibroblast cell line sensitive to Fas-mediated apoptosis. The mechanism involves increased death-inducing signalling complex formation by upregulation of Fas, Fas-associated protein with death domain and caspase-8 expression. © 2013 Royal Australian and New Zealand College of Ophthalmologists.
Interferon-gamma inhibits HIV-induced invasiveness of monocytes.
Dhawan, S; Wahl, L M; Heredia, A; Zhang, Y; Epstein, J S; Meltzer, M S; Hewlett, I K
1995-12-01
HIV-infected monocytes form highly invasive network on basement membrane matrix and secrete high levels of 92-kd metalloproteinase (MMP-9), an enzyme that degrades basement membrane proteins. In the present study, using matrigel as a model basement membrane system, we demonstrate that treatment of human immunodeficiency virus (HIV)-infected monocytes with interferon-gamma at 50 U/ml inhibited the ability of infected monocytes to form an invasive network on matrigel and their invasion through the matrigel matrix. These effects were associated with a significant reduction in the levels of MMP-9 produced by HIV-infected monocytes treated with interferon-gamma 1 day prior to infection with HIV as compared with that of untreated HIV-infected monocytes. Monocytes treated with interferon-gamma 1 day after HIV infection showed the presence of integrated HIV sequences; however, the levels of MMP-9 were substantially lower than those produced by monocytes inoculated with live HIV, heat-inactivated HIV, or even the control uninfected monocytes. Exposure of monocytes to heat-inactivated HIV did not result in increased invasiveness or high MMP-9 production, suggesting that regulation of metalloproteinase by monocytes was independent of CD4-gp120 interactions and required active virus infection. Furthermore, addition of interferon-gamma to monocytes on day 10 after infection inhibited MMP-9 production by more than threefold with no significant reduction of virus replication. These results indicate that the mechanism of interferon-gamma-induced down-regulation of MMP-9 levels and reduced monocyte invasiveness may be mediated by a mechanism independent of antiviral activity of IFN-gamma in monocytes. Down-regulation of MMP-9 in HIV-infected monocytes by interferon-gamma may play an important role in the control of HIV pathogenesis.
... in people with severe, malignant osteopetrosis (an inherited bone disease). Interferon gamma-1b is in a class of ... you may have flu-like symptoms such as headache, fever, chills, muscle aches, and tiredness after your ...
[Expression of gamma interferon during HPV and Chlamydia trachomatis infection in cervical samples].
Colín-Ferreyra, María Del Carmen; Mendieta-Zerón, Hugo; Romero-Figueroa, María Del Socorro; Martínez-Madrigal, Migdania; Martínez-Pérez, Sergio; Domínguez-García, María Victoria
2015-02-01
The aim of this study was to mesure the expression of gamma interferon in HPV and Chlamydia trachomatis infection in squamous intraepithelial lesions. Samples from 100 patients diagnosed by colposcopy with or without squamous intraepithelial lesions were used in the present study. Each patient was found to be infected by HPV and C.trachomatis. Relative gamma interferon mRNA expression was assessed using a real-time reverse transcriptase PCR assay (RT-PCR). The relative units of expression of gamma interferon mRNA were 13, 1.8 and 0.3, for HPV and C.trachomatis co-infection, or HPV or C.trachomatis infection, respectively. HPV and C.trachomatis could overstimulate the expression of gamma interferon. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
Evaluation of Gamma Interferon and Antibody Tuberculosis Tests in Alpacas
Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin
2012-01-01
We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a “test package,” although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations. PMID:22914362
Evaluation of gamma interferon and antibody tuberculosis tests in alpacas.
Rhodes, Shelley; Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin
2012-10-01
We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a "test package," although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations.
Anti-interferon-gamma antibodies in the treatment of autoimmune diseases.
Skurkovich, Boris; Skurkovich, Simon
2003-02-01
Interferon (IFN)-gamma is an important immune regulator in normal immunity. When IFN gamma production is disturbed, various autoimmune diseases (ADs) can develop, in which we suggest that anti-IFN gamma could have a beneficial effect. Depending on the cell type in which IFN gamma synthesis is disturbed, different clinical manifestations may result. We have also proposed to remove tumor necrosis factor (TNF)-alpha, together with certain types of IFNs, to treat various ADs and AIDS, also an autoimmune condition. Anti-IFN gamma has been tested in several T-helper cell (Th1) ADs, including rheumatoid arthritis (RA), multiple sclerosis (MS), corneal transplant rejection, uveitis, Type I diabetes, schizophrenia (anti-IFN gamma and anti-TNF alpha), and various autoimmune skin diseases (alopecia areata, psoriasis vulgaris, vitiligo, pemphigus vulgaris and epidermolysis bullosa). A strong, sometimes striking, therapeutic response followed administration of anti-IFN gamma, indicating that it may be a promising therapy for Th1 ADs.
Bjerre, Anna; Brusletto, Berit; Høiby, Ernst Arne; Kierulf, Peter; Brandtzaeg, Petter
2004-02-01
To analyze plasma interferon-gamma and interleukin-10 concentrations in patients with systemic meningococcal disease and patients with severe Gram-positive septic shock caused by Streptococcus pneumoniae or Staphylococcus aureus. To study the in vitro cytokine (interferon-gamma and interleukin-10) responses in a whole blood model boosted with heat-killed Neisseria meningitidis, S. pneumoniae, and S. aureus before and after treatment with recombinant interleukin-10 or recombinant interferon-gamma. Experimental study. Laboratory. Plasma samples were collected from patients with systemic meningococcal disease (n = 66) and patients with severe Gram-positive septic shock caused by S. pneumoniae (n = 4) or S. aureus (n = 3). Whole blood was boosted with heat-killed N. meningitidis, S. pneumoniae, and S. aureus (1 x 106 colony forming units/mL), and plasmas were analyzed for interleukin-10 or interferon-gamma at 0, 5, 12, and 24 hrs. Furthermore, recombinant interleukin-10 or recombinant interferon-gamma was added before bacteria, and the effect on the secretion of interferon-gamma and interleukin-10, respectively, was analyzed after 24 hrs. The median concentration of interferon-gamma was 15 pg/mL and of interleukin-10 was 10,269 pg/mL in patients with meningococcal septic shock (n = 24) compared with median interferon-gamma concentration of 3400 pg/mL and interleukin-10 concentration of 465 pg/mL in patients with severe Gram-positive shock (p =.001). Increased interferon-gamma concentrations were associated with case fatality (p =.011). In a whole blood model we demonstrated that 1 x 106 colony forming units/mL of N. meningitidis induced more interleukin-10 but less interferon-gamma than S. pneumoniae. S. aureus induced minimal secretion of both cytokines. Recombinant interleukin-10 efficiently down-regulated the secretion of interferon-gamma, and vice versa, as shown in a whole blood model. We speculate whether high concentrations of interleukin-10 contribute to the
Qi, Guoyan; Liu, Peng; Gu, Shanshan; Yang, Hongxia; Dong, Huimin; Xue, Yinping
2018-04-01
Our study is aimed to explore the underlying genetic basis of myasthenia gravis. We collected a Chinese pedigree with myasthenia gravis, and whole-exome sequencing was performed on the two affected siblings and their parents. The candidate pathogenic gene was identified by bioinformatics filtering, which was further verified by Sanger sequencing. The homozygous mutation c.G40A (p.V14M) in interferon gamma receptor 1was identified. Moreover, the mutation was also detected in 3 cases of 44 sporadic myasthenia gravis patients. The p.V14M substitution in interferon gamma receptor 1 may affect the signal peptide function and the translocation on cell membrane, which could disrupt the binding of the ligand of interferon gamma and antibody production, contributing to myasthenia gravis susceptibility. We discovered that a rare variant c.G40A in interferon gamma receptor 1 potentially contributes to the myasthenia gravis pathogenesis. Further functional studies are needed to confirm the effect of the interferon gamma receptor 1 on the myasthenia gravis phenotype.
USDA-ARS?s Scientific Manuscript database
Currently the Bovigam assay is used as an official supplemental test within the bovine tuberculosis eradication program. This assay measures interferon-gamma (IFN-gamma) produced by lymphocytes in response to specific antigens. The objectives of the present study were to evaluate two Mycobacterium ...
(PCG) Protein Crystal Growth Gamma-Interferon
NASA Technical Reports Server (NTRS)
1989-01-01
(PCG) Protein Crystal Growth Gamma-Interferon. Stimulates the body's immune system and is used clinically in the treatment of cancer. Potential as an anti-tumor agent against solid tumors as well as leukemia's and lymphomas. It has additional utility as an anti-ineffective agent, including antiviral, anti-bacterial, and anti-parasitic activities. Principal Investigator on STS-26 was Charles Bugg.
[Peptide Ala-Glu-Asp-Gly and interferon gamma: their role in immune response during aging].
Lin'kova, N S; Kuznik, B I; Khavinson, V Kh
2012-01-01
The decrease of lymphocyte interferon gamma expression during aging is one of the main mechanisms leading to the immunodeficiency state in the elderly. Cell penetrating geroprotective peptide Ala-Glu-Asp-Gly has the capability to activate the proliferation of lymphocytes in thymus during its aging. The nucleotide sequence which is complementary contacted with peptide Ala-Glu-Asp-Gly was found in promoter region of interferon gamma gene. Thus, the immune protection of this peptide can be explained by its activation of the interferon gamma production in T-cells.
The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis
2017-09-01
AWARD NUMBER: W81XWH-16-1-0537 TITLE: The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis PRINCIPAL INVESTIGATOR: Stanley...Sep 2016 - 31 Aug 2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis 5b...subsets that likely counteracts IL-2 regulator activity and contribute to the pathogenesis of RA. 15. SUBJECT TERMS Rheumatoid arthritis ; Autoimmunity; T
Goodfellow, Alfred; Keeling, Douglas N; Hayes, Robert C; Webster, Duncan
2009-01-01
With increasing use of immunosuppressive therapy, including tumor necrosis factor alpha inhibitors, there is concern about infectious complications, including reactivation of latent Mycobacterium tuberculosis infection. Routine testing prior to administration of systemic immunosuppression includes the tuberculin skin test, which lacks sensitivity and specificity and may be difficult to interpret in the presence of extensive cutaneous disease. Treatment of individuals with latent tuberculosis infection is recommended when immunosuppressive medications are to be employed. We report a case in which a diagnosis of latent tuberculosis infection in a patient with extensive bullous pemphigoid was clarified by the use of an interferon-gamma release assay after equivocal tuberculin skin test results. Interferon-gamma release assays are useful adjuncts to the tuberculin skin test in the diagnosis of latent tuberculosis infection in the setting of extensive cutaneous disease.
Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza
2014-03-01
The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.
Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research
Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study suggests that interferon-gamma, which has been thought to contribute to an innate defense system against cancer, under some circumstances, may instead promote melanoma and incite the development of tumors.
Effect of gamma interferon on resolution of murine chlamydial genital infection.
Rank, R G; Ramsey, K H; Pack, E A; Williams, D M
1992-01-01
Mice infected in the genital tract with the Chlamydia trachomatis agent of mouse pneumonitis were treated with monoclonal rat anti-gamma interferon (anti-IFN-gamma) antibody to determine whether IFN-gamma participated in the resolution of the infection. In two experiments, anti-IFN-gamma antibody treatment resulted in significantly prolonged infections. In support of these data, passive administration of recombinant IFN-gamma to chronically infected nu/nu mice was able to bring about resolution of the infection in some animals. PMID:1398955
Razaghi, Ali; Owens, Leigh; Heimann, Kirsten
2016-12-20
Human interferon gamma is a cytokine belonging to a diverse group of interferons which have a crucial immunological function against mycobacteria and a wide variety of viral infections. To date, it has been approved for treatment of chronic granulomatous disease and malignant osteopetrosis, and its application as an immunotherapeutic agent against cancer is an increasing prospect. Recombinant human interferon gamma, as a lucrative biopharmaceutical, has been engineered in different expression systems including prokaryotic, protozoan, fungal (yeasts), plant, insect and mammalian cells. Human interferon gamma is commonly expressed in Escherichia coli, marketed as ACTIMMUNE ® , however, the resulting product of the prokaryotic expression system is unglycosylated with a short half-life in the bloodstream; the purification process is tedious and makes the product costlier. Other expression systems also did not show satisfactory results in terms of yields, the biological activity of the protein or economic viability. Thus, the review aims to synthesise available information from previous studies on the production of human interferon gamma and its glycosylation patterns in different expression systems, to provide direction to future research in this field. Copyright © 2016 Elsevier B.V. All rights reserved.
Brar, Kanwaljit; Leung, Donald Y M
2016-01-01
Atopic dermatitis (AD) is the most common inflammatory skin disease in the general population. There are different endophenotypes of AD that likely have a unique immune and molecular basis, such as those who are predisposed to eczema herpeticum, or Staphylococcus aureus infections. In this review, we highlight the endophenotypes of AD where reduced interferon gamma expression may be playing a role. Additionally, we review the potential role of recombinant interferon gamma therapy in the treatment of atopic dermatitis and the particular phenotypes that may benefit from this treatment. Recombinant interferon gamma treatment will likely benefit the pediatric population with AD, as well as those with susceptibilities for skin infections. Future studies are needed to elucidate whether IFN-γ may reduce the prevalence of skin infection in AD.
USDA-ARS?s Scientific Manuscript database
Gamma interferon (IFN-gamma)-induced protein 10 (IP-10) has recently shown promise as a diagnostic biomarker of Mycobacterium tuberculosis infection of humans. The aim of the current study was to compare IP-10 and IFN-gamma responses upon Mycobacterium bovis infection in cattle using archived sample...
Pai, Madhukar; Gokhale, Kaustubh; Joshi, Rajnish; Dogra, Sandeep; Kalantri, Shriprakash; Mendiratta, Deepak K; Narang, Pratibha; Daley, Charles L; Granich, Reuben M; Mazurek, Gerald H; Reingold, Arthur L; Riley, Lee W; Colford, John M
2005-06-08
Mycobacterium tuberculosis infection in health care workers has not been adequately studied in developing countries using newer diagnostic tests. To estimate latent tuberculosis infection prevalence in health care workers using the tuberculin skin test (TST) and a whole-blood interferon gamma (IFN-gamma) assay; to determine agreement between the tests; and to compare their correlation with risk factors. A cross-sectional comparison study of 726 health care workers aged 18 to 61 years (median age, 22 years) with no history of active tuberculosis conducted from January to May 2004, at a rural medical school in India. A total of 493 (68%) of the health care workers had direct contact with patients with tuberculosis and 514 (71%) had BCG vaccine scars. Tuberculin skin testing was performed using 1-TU dose of purified protein derivative RT23, and the IFN-gamma assay was performed by measuring IFN-gamma response to early secreted antigenic target 6, culture filtrate protein 10, and a portion of tuberculosis antigen TB7.7. Agreement between TST and the IFN-gamma assay, and comparison of the tests with respect to their association with risk factors. A large proportion of the health care workers were latently infected; 360 (50%) were positive by either TST or IFN-gamma assay, and 226 (31%) were positive by both tests. The prevalence estimates of TST and IFN-gamma assay positivity were comparable (41%; 95% confidence interval [CI], 38%-45% and 40%; 95% CI, 37%-43%, respectively). Agreement between the tests was high (81.4%; kappa = 0.61; 95% CI, 0.56-0.67). Increasing age and years in the health profession were significant risk factors for both IFN-gamma assay and TST positivity. BCG vaccination had little impact on TST and IFN-gamma assay results. Our study showed high latent tuberculosis infection prevalence in Indian health care workers, high agreement between TST and IFN-gamma assay, and similar association between positive test results and risk factors. Although TST and
Inhibited interferon-gamma but normal interleukin-3 production from rats flown on the Space Shuttle
NASA Technical Reports Server (NTRS)
Gould, Cheryl L.; Lyte, Mark; Williams, Joann; Mandel, Adrian D.; Sonnenfeld, Gerald
1987-01-01
Rats were flown on Space Shuttle SL-3 for one week. When spleen cells were removed from these rats and challenged with concanavalin-A, interferon-gamma production was severely inhibited, while interleukin-3 production was unaffected compared to ground-based control rats. These data indicate that there is a defect in interferon-gamma production in rats that have been exposed to spaceflight. This defect could contribute to, and be one reason for, immunosuppression observed after spaceflight.
Interferon Gamma as a Biomarker of Exposure to Enteric Viruses
Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...
Chuke, Stella O; Yen, Nguyen Thi Ngoc; Laserson, Kayla F; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G; Whitworth, William C; Shah, J Jina; Painter, John A; Mazurek, Gerald H; Maloney, Susan A
2014-01-01
Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB.
D'Ombrain, Marthe C; Voss, Till S; Maier, Alexander G; Pearce, J Andrew; Hansen, Diana S; Cowman, Alan F; Schofield, Louis
2007-08-16
Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP-1) is a variable antigen expressed by P. falciparum, the malarial parasite. PfEMP-1, present on the surface of infected host erythrocytes, mediates erythrocyte binding to vascular endothelium, enabling the parasite to avoid splenic clearance. In addition, PfEMP-1 is proposed to regulate host immune responses via interactions with the CD36 receptor on antigen-presenting cells. We investigated the immunoregulatory function of PfEMP-1 by comparing host cell responses to erythrocytes infected with either wild-type parasites or transgenic parasites lacking PfEMP-1. We showed that PfEMP-1 suppresses the production of the cytokine interferon-gamma by human peripheral blood mononuclear cells early after exposure to P. falciparum. Suppression of this rapid proinflammatory response was CD36 independent and specific to interferon-gamma production by gammadelta-T, NK, and alphabeta-T cells. These data demonstrate a parasite strategy for downregulating the proinflammatory interferon-gamma response and further establish transgenic parasites lacking PfEMP-1 as powerful tools for elucidating PfEMP-1 functions.
Interferon-γ Inhibits Ebola Virus Infection.
Rhein, Bethany A; Powers, Linda S; Rogers, Kai; Anantpadma, Manu; Singh, Brajesh K; Sakurai, Yasuteru; Bair, Thomas; Miller-Hunt, Catherine; Sinn, Patrick; Davey, Robert A; Monick, Martha M; Maury, Wendy
2015-01-01
Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.
The immunomodulatory effects of interferon-gamma on mature B-lymphocyte responses.
Jurado, A; Carballido, J; Griffel, H; Hochkeppel, H K; Wetzel, G D
1989-06-15
Interferon-gamma (IFN-gamma) exerts a broad spectrum of activities which affect the responses of mature B-cells. It strongly inhibits B-cell activation, acts as a B-cell growth factor (BCGF), and also induces final differentiation to immunoglobulin (Ig) production. IFN-gamma is deeply involved in the differential control of isotype expression, as it enhances IgG2a production and suppresses both IgG1 and IgE production. Although it is now possible to draw a general scheme of the effects of IFN-gamma on B-cells, a number of paradoxical results still exist in the field. In this manuscript, different experimental systems are analyzed in an attempt to explain these apparent paradoxes.
Chuke, Stella O.; Yen, Nguyen Thi Ngoc; Laserson, Kayla F.; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G.; Whitworth, William C.; Shah, J. Jina; Painter, John A.; Mazurek, Gerald H.; Maloney, Susan A.
2014-01-01
Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB. PMID:24738031
Effects of chicken interferon Gamma on Newcastle disease virus vaccine immunogenicity
USDA-ARS?s Scientific Manuscript database
More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFN') during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFN' wit...
Interferon-alpha and interferon-gamma sensitize human tenon fibroblasts to mitomycin-C.
Wang, Xiao Yang; Crowston, Jonathan G; Zoellner, Hans; Healey, Paul R
2007-08-01
To investigate the effect of interferon (IFN)-alpha and IFN-gamma pretreatment on mitomycin C (MMC)-induced cell death in human Tenon fibroblasts (HTFs) and the mechanisms by which IFN-alpha and IFN-gamma modulate the susceptibility of HTFs to MMC. HTFs were pretreated with IFN-alpha and IFN-gamma for 48 hours before 5-minute application of 0.4 mg/mL MMC. Cell death after 48 hours was determined by Annexin V/propidium iodide (PI) staining and lactate dehydrogenase (LDH) release assay. Fas, Fas-ligand, and Bcl-2 expression were determined by flow cytometry. Fas associated death domain (FADD), Bax, cytochrome c, and caspase expression were determined by Western blot analysis and immunofluorescence staining. MMC treatment increased cell death and upregulated Fas and FADD expression, but had no effect on Fas-Ligand, Bax, Bcl-2, or cytochrome c. Neither IFN-alpha nor IFN-gamma alone induced HTF death, but each increased cell death 2 days after MMC treatment in a dose-dependent fashion. Combination IFN-alpha and IFN-gamma had a synergistic effect. IFN-alpha and IFN-gamma pretreatment increased Fas expression. Fas upregulation was associated with increased sensitivity to MMC. IFN pretreatment increased procaspase-8, procaspase-9, and procaspase-3 expression, and caspase-3 activation. Caspase-8, caspase-3, and broad caspase inhibitors, but not caspase-9 inhibitor, inhibited MMC-induced cell death in nonpretreated and IFN-pretreated cells. IFN-alpha and IFN-gamma enhance the susceptibility of HTFs to MMC-induced cell death through a Fas-mediated and a caspase-3-dependent pathway. Pretreatment with IFN primed HTFs to MMC, providing a potential means for initially slowing the healing response with IFN and subsequently terminating fibroblast activity through MMC-induced cell death.
Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M
1992-01-01
The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001
Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M
1992-04-01
The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.
The tuberculin skin test increases the responses measured by T cell interferon-gamma release assays.
Vilaplana, C; Ruiz-Manzano, J; Gil, O; Cuchillo, F; Montané, E; Singh, M; Spallek, R; Ausina, V; Cardona, P J
2008-06-01
RUTI is a vaccine consisting of Mycobacterium tuberculosis bacilli grown in stress conditions that is fragmented, detoxified and liposomed. RUTI was designed to shorten the treatment of latent tuberculosis infection (LTBI) with isoniazid from 9 months to just 1 month, by additional treatment with two inoculations of RUTI 4 weeks apart. During the validation process for monitoring the immunogenicity of administration of RUTI in a Phase I clinical trial, the question arose whether to introduce the tuberculin skin test (TST) in the screening of non-LTBI volunteers. This study was designed to evaluate the effect of TST on subsequent different T-cell interferon-gamma release assay (TIGRA) responses, using a spectrum of M. tuberculosis-related antigens (ESAT-6, CFP-10, 16 kDa, 19 kDa, MPT64, Ag 85B, 38 kDa, hsp65, PPD and BCG). The results showed an increase in post-TST response even in non-LTBI subjects for most antigens tested, as measured both by whole blood assay (WBA) and ELISPOT. Increased ELISPOT response decreased toward pre-TST levels within 1 month whereas the WBA response did not. Taking into account that there is no definitive correlation between TST and TIGRA tests to diagnose LTBI and the feasibility that TST might alter the immune monitoring included in clinical trials, these data suggest that TST determination should be carefully planned to avoid any interference with TIGRA.
Laouar, Yasmina; Sutterwala, Fayyaz S; Gorelik, Leonid; Flavell, Richard A
2005-06-01
Interferon-gamma and interleukin 12 produced by the innate arm of the immune system are important regulators of T helper type 1 (T(H)1) cell development, but signals that negatively regulate their expression remain controversial. Here we show that transforming growth factor-beta (TGF-beta) controlled T(H)1 differentiation through the regulation of interferon-gamma produced by natural killer (NK) cells. Blockade of TGF-beta signaling in NK cells caused the accumulation of a large pool of NK cells secreting copious interferon-gamma, responsible for T(H)1 differentiation and protection from leishmania infection. In contrast, blockade of TGF-beta signaling in dendritic cells did not affect dendritic cell homeostasis or interleukin 12 production, thus indicating a previously undescribed demarcation of the function of TGF-beta in NK cells versus dendritic cells.
Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels
NASA Technical Reports Server (NTRS)
Pierangeli, Silvia S.; Sonnenfeld, Gerald
1989-01-01
Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.
Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity
1984-01-01
Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN
Gamma Interferon Release Assays for Detection of Mycobacterium tuberculosis Infection
Denkinger, Claudia M.; Kik, Sandra V.; Rangaka, Molebogeng X.; Zwerling, Alice; Oxlade, Olivia; Metcalfe, John Z.; Cattamanchi, Adithya; Dowdy, David W.; Dheda, Keertan; Banaei, Niaz
2014-01-01
SUMMARY Identification and treatment of latent tuberculosis infection (LTBI) can substantially reduce the risk of developing active disease. However, there is no diagnostic gold standard for LTBI. Two tests are available for identification of LTBI: the tuberculin skin test (TST) and the gamma interferon (IFN-γ) release assay (IGRA). Evidence suggests that both TST and IGRA are acceptable but imperfect tests. They represent indirect markers of Mycobacterium tuberculosis exposure and indicate a cellular immune response to M. tuberculosis. Neither test can accurately differentiate between LTBI and active TB, distinguish reactivation from reinfection, or resolve the various stages within the spectrum of M. tuberculosis infection. Both TST and IGRA have reduced sensitivity in immunocompromised patients and have low predictive value for progression to active TB. To maximize the positive predictive value of existing tests, LTBI screening should be reserved for those who are at sufficiently high risk of progressing to disease. Such high-risk individuals may be identifiable by using multivariable risk prediction models that incorporate test results with risk factors and using serial testing to resolve underlying phenotypes. In the longer term, basic research is necessary to identify highly predictive biomarkers. PMID:24396134
Joshi, Manish; Monson, Thomas P; Woods, Gail L
2012-01-01
Interferon-gamma release assays including the QuantiFERON-TB Gold In-Tube test (QFT-GIT [Cellestis Ltd, Australia]) may be used in place of the tuberculin skin test (TST) in surveillance programs for Mycobacterium tuberculosis infection control. However, data on performance and practicality of the QFT-GIT in such programs for health care workers (HCWs) are limited. To assess the performance, practicality and reversion rate of the QFT-GIT among HCWs at a tertiary health care institution in the United States. Retrospective chart review of HCWs at Central Arkansas Veterans Healthcare System (Arkansas, USA) who underwent QFT-GIT testing as a part of their employee screening between November 1, 2008 and October 31, 2009. QFT-GIT was used to screen 3290 HCWs. The initial QFT-GIT was interpreted as positive for 129 (3.9%) HCWs, negative for 3155 (95.9%) and indeterminate for six (0.2%). Testing with QFT-GIT was repeated in 45 HCWs who had positive results on the initial test. The QFT-GIT reverted to negative in 18 (40.0%) HCWs, all of whom had negative TST status and initial interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL. The QFT-GIT test is feasible in large health care setting as an alternative to TST for M tuberculosis infection screening in HCWs but is not free from challenges. The major concerns are the high number of positive test results and high reversion rates on repeat testing, illustrating poor short-term reproducibility of positive QFT-GIT test results. These results suggest adopting a borderline zone between interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL, and cautious clinical interpretation of values in this range.
Foster-Chang, Sarah A; Manning, Mary L; Chandler, Laura
2014-11-01
Selection of the most suitable test(s) for detection of Mycobacterium tuberculosis (TB) infection should be based on purpose, setting, effectiveness, and cost. Two tests are available to screen for latent TB: the tuberculin skin test (TST) and the more recent interferon-gamma release assays (IGRAs). Based on the administrative, logistic, and technical ease of use, an IGRA trial was initiated by the occupational health department at an urban Veteran's Administration health care facility for TB screening of new employees. As a result, new employees completing the pre-placement process within the organization's designated 14 days increased from 77% to 97%, new employee clearance to work time decreased from 13.18 to 5.91 days, and new employee TB screening costs were reduced by 40%. The IGRA is an acceptable alternative to the TST and has significant potential to improve the process of pre-placement TB screening. Copyright 2014, SLACK Incorporated.
Stockbridge, Erica L; Miller, Thaddeus L; Carlson, Erin K; Ho, Christine
2018-01-01
To determine whether latent tuberculosis infection risk factors are associated with an increased likelihood of latent tuberculosis infection testing in the US private healthcare sector. A national sample of medical and pharmacy claims representing services rendered January 2011 through December 2013 for 3,997,986 commercially insured individuals in the US who were 0 to 64 years of age. We used multivariable logistic regression models to determine whether TB/LTBI risk factors were associated with an increased likelihood of Interferon-Gamma Release Assay (IGRA) or Tuberculin Skin Test (TST) testing in the private sector. 4.31% (4.27-4.34%) received at least one TST/IGRA test between 2011 and 2013 while 1.69% (1.67-1.72%) received a TST/IGRA test in 2013. Clinical risk factors associated with a significantly increased likelihood of testing included HIV, immunosuppressive therapy, exposure to tuberculosis, a history of tuberculosis, diabetes, tobacco use, end stage renal disease, and alcohol use disorder. Other significant variables included gender, age, asthma, the state tuberculosis rate, population density, and percent of foreign-born persons in a county. Private sector TST/IGRA testing is not uncommon and testing varies with clinical risk indicators. Thus, the private sector can be a powerful resource in the fight against tuberculosis. Analyses of administrative data can inform how best to leverage private sector healthcare toward tuberculosis prevention activities.
Noh, G; Jang, E H
2014-01-01
Specific oral tolerance induction (SOTI) for IgE-mediated food allergy (IFA) can be successfully achieved using interfero gamma (classic SOTI). In this study, a tolerable dose was introduced during tolerance induction with interferon gamma (dual SOTI), and its effectiveness was evaluated. The study population comprised 25 IFA patients. Blood samples were taken for analysis, including complete blood count with differential counts of eosinophils, serum total IgE levels, and specific IgE for allergenic foods. Skin prick tests were conducted with the allergens. Oral food challenges were performed to diagnose IFA. Ten patients received dual SOTI, 5 received classic SOTI, 5 received SOTI without interferon gamma (original SOTI), and 5 were not treated (controls). Patients treated with dual SOTI and classic SOTI using interferon gamma became tolerant to the allergenic food. The tolerable dose was introduced successfully in dual SOTI. It was difficult to proceed with the same dosing protocol used for classic SOTI in cases treated with original SOTI. Following dual SOTI, the systemic reaction to oral intake subsided, but the local skin reaction to contact with the allergenic food persisted. Dual SOTI is an improved protocol for SOTI using interferon gamma for IFA.The local skin reaction and systemic reaction to oral intake were dissociated following dual SOTI. In cases of food allergy, tolerance appears to result from desensitization to allergens.
Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research
Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study
Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.
Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F
2003-01-01
A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.
Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies
Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D
2014-01-01
Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250
Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D
2008-02-01
One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.
Gil, Olga; Vilaplana, Cristina; Guirado, Evelyn; Díaz, Jorge; Cáceres, Neus; Singh, Mahavir; Cardona, Pere-Joan
2008-11-01
Gamma interferon responses of spleen cells in mice were examined during postchemotherapy relapse of intraperitoneally induced latent tuberculous infection. The mycobacterial extract RUTI, which prevented the relapse, significantly enhanced the immune responses to secreted and structural recombinant mycobacterial antigens, suggesting that RUTI-mediated protection was mediated by activated T cells.
Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.
Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G
1996-01-01
The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817
Grau, G E; Heremans, H; Piguet, P F; Pointaire, P; Lambert, P H; Billiau, A; Vassalli, P
1989-01-01
Experimental cerebral malaria (ECM), a lethal hyperacute neurological syndrome associated with high blood levels of tumor necrosis factor, develops in genetically susceptible (CBA/Ca) mice 7 days after infection with Plasmodium berghei ANKA strain. Injections of neutralizing monoclonal antibody against recombinant murine interferon gamma, not later than 4 days after infection, markedly reduced the incidence of ECM and the elevation in serum levels of tumor necrosis factor. This treatment prevented the cerebral lesions (plugging of brain vessels by monocytes, lymphocytes, and parasitized erythrocytes). In contrast, the extent of macrophage infiltration in lymphoid organs (which is a characteristic feature of mice developing ECM), as well as the course of infection, remained unaffected by the antibody treatment. Protected mice died at a later time of severe anemia and overwhelming parasitemia, the usual outcome of P. berghei infection in mice that are not susceptible to ECM. The present data indicate that interferon gamma constitutes an important link in the cytokine network that leads to brain vessel inflammation in experimental malaria. It is proposed that interferon gamma released by activated CD4+ T cells acts by augmenting both production and action of tumor necrosis factor. PMID:2501793
Development of a lion-specific interferon-gamma assay.
Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G
2012-10-15
The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.
Tang, Bone Siu-Fai; Chan, Jasper Fuk-Woo; Chen, Min; Tsang, Owen Tak-Yin; Mok, M. Y.; Lai, Raymond Wai-Man; Lee, Rodney; Que, Tak-Lun; Tse, Herman; Li, Iris Wai-Sum; To, Kelvin Kai-Wang; Cheng, Vincent Chi-Chung; Chan, Eric Yuk-Tat; Zheng, Bojian; Yuen, Kwok-Yung
2010-01-01
Acquired immunodeficiency due to autoantibody against gamma interferon has recently been associated with opportunistic nontuberculous mycobacteriosis, especially among Southeast Asians. We report another 8 cases, all except one apparently immunocompetent hosts who suffered from concomitant or sequential infections by other intracellular pathogens causing penicilliosis, extraintestinal nontyphoidal salmonellosis, and burkholderiosis. The only case with an underlying immunodeficiency syndrome had systemic lupus erythematosus that was quiescent throughout the multiple infective episodes. Eight out of 10 (80.0%) patients with serological evidence of penicilliosis, 5 out of 7 (71.4%) with culture-positive extraintestinal nontyphoidal salmonellosis, 5 out of 28 (17.9%) with serological evidence of melioidosis, and 7 out of 13 (53.8%) with culture-positive nontuberculous mycobacteriosis possessed autoantibody against gamma interferon, whereas only 1 out of 100 patients with systemic lupus erythematosus did. Our study represents the first and largest case series linking this emerging immunodeficiency syndrome with these atypical infections in apparently immunocompetent hosts. Thus, we advocate that any patient with unexplained recurrent or polymicrobial infections due to these intracellular pathogens should be screened for acquired immunodeficiency due to autoantibody against gamma interferon. PMID:20445006
Gao, Y; Chenping; Lin, X P
1997-10-01
In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.
Development of an aptamer beacon for detection of interferon-gamma.
Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander
2010-03-01
Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.
Effect of gamma interferon on lung function of mustard gas exposed patients, after 15 years.
Ghanei, Mostafa; Panahi, Yoones; Mojtahedzadeh, Mojtaba; Khalili, Ali Reza Hosseini; Aslani, Jafar
2006-01-01
Bronchiolitis has been known to be among the main the pathological features of lung lesions in Mustard Gas (MG) exposed patients. The purpose of this research was to evaluate the efficacy of interferon gamma-1b on the lung function in MG exposed patients with bronchiolitis. Thirty-six bronchiolitis patients, whose lung lesion had been diagnosed through High Resolution Computerized Tomography (HRCT) of the chest and also pathological study, were divided into two 18-member case and control groups. Both groups were receiving their conventional treatment (inhaled Felixotide and Servent). The case group were treated for 6 months with a combination of 200 microg of interferon gamma-1b (given three times per week subcutaneously) plus 7.5 mg of prednisolone (given once a day), while the control group received their previous conventional medications. Lung function was measured at base line and after 1, 3 and 6 months of treatment. In case and control groups, Forced Expiratory Volume in first second (FEV1) did not have statistical differences at the base line (49.3 +/- 2.9 and 48.7 +/- 4.1, respectively = 0.6), whereas a significant increase was seen in the case group (66.3 +/- 5.4) compared control group (57.3 +/- 8.6) at the subsequent months (P = 0.001 for the difference between the groups). Similar pattern of increase was observed in Forced Vital Capacity (FVC). The findings of this study indicate that a 6-month treatment with interferon gamma-1b plus a low-dose prednisolone is associated with an improvement in the lung function in mustard-gas exposed patients with bronchiolitis.
Electrochemical impedance spectroscopy based-on interferon-gamma detection
NASA Astrophysics Data System (ADS)
Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung
2014-03-01
Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.
Badie, B; Schartner, J; Vorpahl, J; Preston, K
2000-04-01
Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.
Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong
2010-01-01
Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
Morar, D; Tijhaar, E; Negrea, A; Hendriks, J; van Haarlem, D; Godfroid, J; Michel, A L; Rutten, V P M G
2007-01-15
Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-gamma) assay is used as a routine diagnostic tool to determine infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop reagents to set up a rhinoceros IFN-gamma (RhIFN-gamma) assay. The white rhinoceros IFN-gamma gene was cloned, sequenced and expressed as a mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-gamma shares a homology of 90% with equine IFN-gamma. Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant RhIFN-gamma were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that recombinant as well as native white rhinoceros IFN-gamma was recognised. This preliminary IFN-gamma enzyme-linked immunosorbent assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.
Dunn, John R; Kaneene, John B; Grooms, Daniel L; Bolin, Steven R; Bolin, Carole A; Bruning-Fann, Colleen S
2005-02-01
To determine whether cattle testing positive for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA were more likely to have false-positive responses on the caudal fold tuberculin (CFT) test or interferon-gamma (IFN-gamma) assay for Mycobacterium bovis than cattle testing negative for M paratuberculosis. 1043 cattle from 10 herds in Michigan. Feces and blood samples for plasma were collected from cattle > or =24 months old on the day the CFT test was read. Fecal samples were submitted for microbial culture for M paratuberculosis. Plasma samples were tested for antibody against M paratuberculosis, and IFN-gamma after stimulation with purified protein derivative tuberculin from M bovis or M avium. Of 1043 cattle, 180 (17.3%) had positive CFT test results (suspects) and 8 (0.8%) had positive IFN-gamma assay results after stimulation with purified protein derivative tuberculin from M bovis. Forty-five (4.3%) and 115 (11.0%) cattle tested positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA, respectively. Cattle with positive responses for M paratuberculosis appeared to have an increased likelihood of false-positive results on the CFT test, although this association was not significant. No significant association was detected among cattle testing positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA and positive CFT test and IFN-gamma assay results for M bovis.
Lee, Jung Nam; Ryu, Dong Yup; Park, Sung Han; You, Hyun Seok; Lee, Bong Eun; Kim, Dong Uk; Kim, Tae Oh; Heo, Jeong; Kim, Gwang Ha; Song, Geun Am; Kim, Suk; Park, Do Youn
2010-06-01
It is difficult to clinically and endoscopically differentiate intestinal tuberculosis (ITB) and Crohns disease (CD). The aim of this study was to evaluate the usefulness of in vitro interferon-gamma (INF-gamma) assay for differential diagnosis between ITB and CD. Sixty patients for whom differential diagnosis between ITB and CD was difficult were enrolled between January 2007 and January 2009. The INF-gamma-producing T-cell response to early secreted antigenic target 6 and culture filtrate protein 10 were measured by T-SPOT.TB blood test in vitro. We evaluated the usefulness of T-SPOT.TB blood test by comparing its results with the final diagnosis. Twenty and forty patients were revealed to be positive and negative in T-SPOT.TB blood test, respectively. Of the 20 patients found to be positive, 12 patients (60%) were finally diagnosed as ITB, 6 patients as CD, and 2 patients as Behcets enterocolitis. Of the 40 patients with negative results, 38 patients (95%) were diagnosed as CD; one as Behcets enterocolitis; one as nonspecific colitis; none as ITB. The sensitivity and specificity of T-SPOT.TB blood test for ITB were 100% and 83.3%, respectively. Positive and negative predictive values of T-SPOT.TB blood test for ITB were 60.0% and 100%, respectively. When differential diagnosis between ITB and CD is difficult, T-SPOT.TB blood test may be a helpful and rapid diagnostic tool to exclude ITB. Prospective large-scaled studies are required for further evaluation of the usefulness of T-SPOT.TB blood test for differential diagnosis between ITB and CD.
Goldberg, Ilan; Gilburd, Boris; Kravitz, Martine Szyper; Kivity, Shmuel; Chaim, Berta Ben; Klein, Tirza; Schiffenbauer, Yael; Trubniykovr, Ela; Brenner, Sarah; Shoenfeld, Yehuda
2005-03-01
There are several mechanisms to describe allergic drug reactions yet the methods to diagnose them are limited. To compare several conventional clinical and laboratory methods to diagnose skin reactions to drugs to a new method of diagnosing drug reactions by the CellScan system. The study entailed 21 patients who were diagnosed as suffering from drug eruptions, and 105 healthy controls with no history of drug allergy. The drugs were classified into two groups according to suspicion of causing drug allergy: high and low. Most of the patients were on more than one drug, leading to 41 patient-drug interactions (assays). Histamine releasing test (HRT), interferon (INF)-gamma releasing test and CellScan examination were performed on lymphocytes of the patients and controls. The HRTwas interpreted as positive in 9 out of 18 (50%) patients and in 13 out of 35 (37%) assays. Based on the INF-gamma releasing test, positive results were observed in 16 out of 21 (76%) patients and in 24 out of 41 (59%) assays. In the CellScan test (CST), positive results were observed in 17 out of 21 (81%) patients and in 29 out of 41 (71%) assays. The rate of identifying the drug for eruption in the high suspicion level drugs was 9 out of 22 (41%) assays in the HRT, 20 out of 24 (83%) assays in the INF-gamma releasing test, and 21 out of 24 (87%) studies with the CellScan method. The rate of determining of the drug that caused the eruption in the low suspicion level drugs was 4 out of 13 (31 %) in the HRT, 4 out of 17 (24%) assays in the INF-gamma releasing test, and 8 out of 17 (47%) analyses in the CST. When examined in the CellScan, 99 out of 105 (94%) controls were interpreted as negative. This preliminary study indicates that the CellScan seems to be an easy and promising method for the detection of drugs responsible for adverse skin reactions. In contrast to the HRT and to the Interferon-gamma secretion test, the CellScan method is characterized by its ability to track and monitor the
Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M
1993-01-01
Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454
Interferon system in women with genital papillomavirus infection receiving immunomodulatory therapy.
Rogovskaya, S I; Zhdanov, A V; Loginova, N S; Faizullin, L Z; Prilepskaya, V N; Van'ko, L V; Sukhikh, G T
2002-11-01
The interferon system was studied in women with genital papillomavirus infection. In most patients the interferon system was activated, while the ability of lymphocytes to respond to inductors decreased. Laserotherapy and immunomodulatory therapy with larifan, ridostin, and viferon for 1 month normalized blood interferon concentration (39.4% patients) and interferon-gamma production by lymphocytes in response to inductors (87.9% patients). After laser monotherapy these parameters returned to normal only in 13.2 and 7.6% patients, respectively. Correlation and regression analyses showed that changes in the interferon system were synchronized after immunomodulatory therapy. These data indicate that immunomodulatory therapy produces a complex effect on the interferon system. Measurements of blood interferon level can be used to predict the effect of further treatment with interferon-gamma inductors.
Potential mechanisms of cytosolic calcium modulation in interferon-gamma treated U937 cells
NASA Technical Reports Server (NTRS)
Klein, Jon B.; Mcleish, Kenneth R.; Sonnenfeld, Gerald; Dean, William L.
1987-01-01
The ability of interferon-gamma (IFN-gamma) to alter cytoplasmic Ca(2+) content in the monocytelike cell line U937 was investigated, using a slow Ca-channel blocker, diltiazem. In addition, the Ca-ATPase and the Ca-uptake activities were measured in isolated U937 membranes, together with the effect of inositol trisphosphate (IP3) upon the Ca(2+) release from Ca-loaded membranes. The addition of 50 U/ml INF-gamma to U937 cultures was found to increase internal Ca(2+) by about 100 percent within 3 min. The increase was significantly reduced by incubation in Ca-free buffer or by the addition of diltiazem. A crude membrane preparation from U937 cells was found to contain significant amounts of Ca-ATPase activity and to sequester Ca(2+) to a level of 8 nmol/mg in 30 sec; the addition of IP3 induced release of a portion of the sequestered Ca(2+) which was then resequestered. The results suggest that IFN-gamma causes an increase of cytoplasmic Ca(2+), in part, by the IP3-induced release from the internal storage sites and, in part, from the entry of extracellular Ca through slow channels.
Devane, John G; Martin, Mary L; Matson, Mark A
2014-06-01
Flu-like symptoms (FLS) are commonly experienced by patients receiving interferon gamma-1b which may cause discontinuation or disruption of dosing during initial therapy or on re-initiation following a break in therapy. In contrast to Type I interferons, the impact of dose-titration on FLS has not been reported and is not a practice described or included in the approved prescribing information for interferon gamma-1b.The objective of this study was to assess the effect of a 2 week titration regimen on the severity of FLS during the initial 3 weeks of therapy with three times weekly subcutaneous injections of interferon gamma-1b. Healthy men and women were randomized into a double-blind, two-period, crossover study. Each study period was 3 weeks in duration and there was a minimum 15 day washout between treatment periods. Two treatment regimens were compared: No Titration dosing (full 50 mcg/m(2) subcutaneously [s.c.] three times weekly for 3 weeks) and Titration (15 mcg/m(2) s.c. three times weekly during week 1, 30 mcg/m(2) s.c. three times weekly during week 2 followed by the full dose of 50 mcg/m(2) s.c. three times weekly during week 3). Subjects remained in the clinic for at least 12 hours following each injection. FLS was based on a composite score for fever, chills, tiredness and muscle aches assessed at baseline and 4, 8 and 12 hours following each injection. Acetaminophen was allowed at the discretion of the PI. The primary endpoint was the change from baseline in FLS severity at 8 hours averaged over the 3 weeks of treatment. Additional endpoints included FLS at 4 and 12 hours, individual flu-like symptoms, rates of discontinuation, incidence of FLS and acetaminophen use. NCT 01929382. Of the 40 subjects randomized, there were 15 (37.5%) discontinuations. Titration resulted in a significant reduction in FLS severity at 8 hours (p = 0.023) averaged over the 3 week treatment period. The difference in 3 week FLS severity reflects differences
Dufour, Barbara; Praud, Anne
2017-01-01
Understanding the factors leading each stakeholder to participate in an experimental trial is a key element for improving trial set-up and for identifying selection bias in statistical analyses. An experimental protocol, validated by the European Commission, was developed in France to assess the ability of the gamma-interferon test in terms of accuracy to replace the second intradermal skin test in cases of suspected bovine tuberculosis. Implemented between 2013 and 2015, this experimental trial was based on voluntary participation. To determine and understand the motivation or reluctance of farmers to take part in this trial, we carried out a sociological survey in France. Our study was based on semi-structured interviews with the farmers and other stakeholders involved. The analysis of findings demonstrated that shortening the lock-up period during tuberculosis suspicion, following the use of a gamma-interferon test, was an important aim and a genuine challenge for the animal health stakeholders. However, some farmers did not wish to continue the trial because it could potentially have drastic consequences for them. Moreover, misunderstandings and confusion concerning the objectives and consequences of the trial led stakeholders to reject it forcefully. Based on our results, we offer some recommendations: clear and appropriate communication tools should be prepared to explain the protocol and its aims. In addition, these types of animal health trials should be designed with the stakeholders’ interests in mind. This study provides a better understanding of farmer motivations and stakeholder influences on trial participation and outcomes. The findings can be used to help design trials so that they promote participation by farmers and by all animal health stakeholders in general. PMID:28973018
Santin, Miguel; García-García, José-María; Rigau, David; Altet, Neus; Anibarro, Luis; Casas, Irma; Díez, Nuria; García-Gasalla, Mercedes; Martínez-Lacasa, Xavier; Penas, Antón; Pérez-Escolano, Elvira; Sánchez, Francisca; Domínguez, José
2016-09-01
Interferon-gamma release assays are widely used for the diagnosis of tuberculosis infection in Spain. However, there is no consensus on their application in specific clinical scenarios. To develop a guide-line for their use, a panel of experts comprising specialists in infectious diseases, respiratory diseases, microbiology, pediatrics and preventive medicine, together with a methodologist, conducted a systematic literature search, summarized the findings, rated the quality of the evidence, and formulated recommendations following the Grading of Recommendations of Assessment Development and Evaluations methodology. This document provides evidence-based guidance on the use of interferon-gamma release assays for the diagnosis of tuberculosis infection in patients at risk of tuberculosis or suspected of having active disease. The guidelines will be applicable to specialist and primary care, and public health. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.
Kawai, K; Enomoto, T; Fornasier, V; Resetkova, E; Volpé, R
1997-03-01
We have studied the in vivo effects of human interferon alpha (IFN-alpha) and interferon gamma (IFN-gamma) administration on human thyroid tissue xenografted into two mouse strains: severe combined immunodeficient (SCID) mice and nude mice. Human lymphocytes survive in SCID mice but are lysed in nude mice. Thyroid tissues from Graves' disease or Hashimoto's thyroiditis, or paranodular [normal, (N)] tissue was xenografted into SCID mice (0.8 g/mouse) pretreated with anti-asialo GM-1 antiserum and radiation and also into nude mice. One week after xenografting, SCID and nude mice were divided into three groups. Group A was treated with IFN-alpha intraperitoneally (2,000 units/mouse) three times weekly; group B was treated with IFN-gamma similarly; group C was treated with phosphate buffered saline (PBS) only (control). Autologous human peripheral blood mononuclear cells (PBMCs) were added to mice receiving N xenografts. Blood was taken every 2 weeks for levels of IgG and thyroid antibodies (TAb). After 6 weeks of treatment, mice were sacrificed, and xenograft thyrocyte histocompatibility leukocyte antigen (HLA-DR) and intercellular adhesion molecule (ICAM-1) expression were measured. In addition, thyrocyte cultures were stimulated in vitro with 200 units/ml of either IFN-alpha or IFN-gamma or PBS (control). SCID mice xenografted with autoimmune thyroid disease (AITD) in group A showed a significantly higher TAb production than group C, whereas in group B, TAb production was not statistically increased compared to control (group C). SCID mice xenografted with N did not produce TAb in any group, nor did nude mice xenografted with AITD. Thyrocyte HLA-DR expression was markedly increased in group A and B in SCID mice xenografted with Graves' disease, Hashimoto's thyroiditis, and N tissue compared to group C. In contrast, only group B (IFN-gamma) showed an increase in thyrocyte HLA-DR in nude mice. In the in vitro studies, only IFN-gamma (not IFN-alpha) stimulated
COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?
Levick, Scott P.; Goldspink, Paul H.
2013-01-01
The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353
Al-Tawfiq, Jaffar A; Al-Abdely, Hail M
2010-05-01
We report a case of invasive aspergillosis due to Aspergillus fumigatus involving the cervical and thoracic vertebrae and upper mediastinum of a 17 year-old Saudi male with chronic granulomatous disease (CGD). The patient did not respond to a long course of liposomal amphotericin B but did to surgical drainage and a combination of caspofungin and itraconazole with subsequent suppression with oral voriconazole. Fourteen months after the start of therapy, the patient had anterior dislocation of T2 thoracic vertebra with cord transection and quadriplegia. He was then treated intravenously with liquid itraconazole and interferon-gamma. The patient made a remarkable recovery over a 2-year period and was eventually able to walk independently. Thus, a combination of antifungals and interferon-gamma may have resulted in the positive outcome in this case.
Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko
2007-06-01
Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.
Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N
2006-01-01
Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bursuker, I.; Pearce, M.T.
1990-02-01
The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less
Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade
2006-12-15
Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.
Interferon Gamma in African Trypanosome Infections: Friends or Foes?
Wu, Hui; Liu, Gongguan; Shi, Meiqing
2017-01-01
African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.
Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T
1996-01-01
We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819
Molina, Rose; Venkatesh, Kartik; Schantz-Dunn, Julianna; Meadows, Audra; Nour, Nawal; Diouf, Khady
2016-06-01
Background Currently there are no guidelines regarding optimal screening for latent tuberculosis infection during pregnancy. Objective This study measures completion rates and the concordance between the TSPOT.TB, a commercially available interferon gamma release assay (IGRA), and the traditional tuberculin skin test (TST) in a predominantly urban minority obstetrics practice. Design This is an observational cohort study of 141 pregnant women enrolled from an obstetrics practice with a large immigrant population. Women with a history of a positive TST result were excluded. Demographic and clinical risk factors for tuberculosis were assessed. Enrolled women underwent a T-SPOT.TB test and placement of TST, and returned in 48-72 h for TST interpretation. We calculated the completion rate and frequency of a positive result for each test, as well as the concordance between the T-SPOT.TB and TST. Results Among the 141 women enrolled, 75 % were either Latina or African-American, 44 % were born in a country with a high TB prevalence, and 52 % had received the Bacillus Calmette-Guerin vaccine. Seven women (5 %) had a positive screening test, a total of 3 positive T-SPOT.TB results and 6 positive TST results, and all were from countries with a high TB prevalence. The concordance of the two tests was 96.3 %. The completion rate for the T-SPOT.TB was 98 %, while the completion rate for the TST was 63 %. The IGRA test had a markedly higher completion rate in addition to maintaining high concordance with the two-step TST in this population of pregnant women with a high prevalence of prior TB exposure. Targeted screening of women from countries with a high prevalence of tuberculosis may be warranted during prenatal care.
Reiners, J J; Cantu, A; Thai, G; Pavone, A
1993-03-01
SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.
Lahuerta-Marin, Angela; Gallagher, Martin; McBride, Stewart; Skuce, Robin; Menzies, Fraser; McNair, Jim; McDowell, Stanley W J; Byrne, Andrew W
2015-09-04
Bovine tuberculosis (bTB), caused by Mycobacterium bovis, is a serious infectious disease that remains an ongoing concern for cattle farming worldwide. Tuberculin skin-tests are often used to identify infected animals (reactors) during test-and-cull programs, however, due to relatively poor sensitivity, additional tests can be implemented in parallel. For example, in Northern Ireland interferon-gamma (IFN-g) testing is used in high-risk herds. However, skin-test negative animals which are positive to the IFN-g test are not required by law to be slaughtered - therefore the final choice for these animals' fate is left with the owner. During this study we investigated whether these animals represented a greater risk of becoming a skin reactor, relative to IFN-g test negative animals from the same herds. Our study population included 1107 IFN-g positive animals from 239 herds. A Cox-proportional hazard model indicated that animals which tested IFN-g positive were 2.31 times (95% CI: 1.92-2.79; P < 0.001) more likely to become a reactor compared with IFN-g negative animals. Animals from dairy herds, and from herds in the south-east, were of higher risk than animals from beef herds and other regions, respectively. Our findings suggest that IFN-g positive animals represent a higher risk of failing a skin-test in the future, indicating the value of IFN-g testing for identifying early-stage infected animals. These IFN-g positive animals are not under any disease restriction, and may move freely (trade), which may put recipient herds at increased risk. Our findings provide important evidence for stakeholders engaged in bTB eradication programs.
Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H
2005-08-22
Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.
Flores, Jose; DuPont, Herbert L; Paredes-Paredes, Mercedes; Aguirre-Garcia, M Magdalena; Rojas, Araceli; Gonzalez, Alexei; Okhuysen, Pablo C
2010-05-01
Enterotoxigenic Escherichia coli (ETEC), which produces heat-labile toxin (LT), is a common cause of travelers' diarrhea (TD). The B subunit of ETEC LT is immunologically related to the B subunit of Vibrio cholerae toxin (CT). In this pilot study we evaluated the whole-blood gamma interferon response to CT B in 17 U.S. adults traveling to Mexico. Only one of nine subjects who demonstrated a cellular immune response as determined by whole-blood gamma interferon production to CT B on arrival to Mexico developed diarrhea, whereas five of eight without a cellular response developed diarrhea. Markers of the cellular immune response to ETEC LT could help in identifying individuals immune to ETEC LT, and these markers deserve additional study.
Visser, J; Blauw, B; Hinloopen, B; Brommer, E; de Kloet, E R; Kluft, C; Nagelkerken, L
1998-02-01
A disturbed hypothalamus-pituitary-adrenal gland axis and alterations at the immune system level have been observed in patients with chronic fatigue syndrome (CFS). Glucocorticoids are known to modulate T cell responses; therefore, purified CD4 T cells from CFS patients were studied to determine whether they have an altered sensitivity to dexamethasone (DEX). CD4 T cells from CFS patients produced less interferon-gamma than did cells from controls; by contrast, interleukin-4 production and cell proliferation were comparable. With CD4 T cells from CFS patients (compared with cells from controls), a 10- to 20-fold lower DEX concentration was needed to achieve 50% inhibition of interleukin-4 production and proliferation, indicating an increased sensitivity to DEX in CFS patients. Surprisingly, interferon-gamma production in patients and controls was equally sensitive to DEX. A differential sensitivity of cytokines or CD4 T cell subsets to glucocorticoids might explain an altered immunologic function in CFS patients.
Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude
2008-09-01
The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.
ERIC Educational Resources Information Center
Birch, Samantha J.; Golbeck, Amanda L.
2015-01-01
Objective: This analysis examined the effectiveness of utilizing interferon-gamma release assay (IGRA) technology in a TB (TB) screening program at a university. Participants: Participants were 2299 students at a Montana university who had presented to the university health center for TB screening during 2012 and 2013. Methods: A retrospective…
Kremers, Marjolein N. T.; Hodemaekers, Hennie M.; Hagenaars, Julia C. J. P.; Koning, Olivier H. J.; Renders, Nicole H. M.; Hermans, Mirjam H. A.; de Klerk, Arja; Notermans, Daan W.; Wever, Peter C.; Janssen, Riny
2015-01-01
A large community outbreak of Q fever occurred in the Netherlands in the period 2007 to 2010. Some of the infected patients developed chronic Q fever, which typically includes pathogen dissemination to predisposed cardiovascular sites, with potentially fatal consequences. To identify the immune mechanisms responsible for ineffective clearance of Coxiella burnetii in patients who developed chronic Q fever, we compared serum concentrations of 47 inflammation-associated markers among patients with acute Q fever, vascular chronic Q fever, and past resolved Q fever. Serum levels of gamma interferon were strongly increased in acute but not in vascular chronic Q fever patients, compared to past resolved Q fever patients. Interleukin-18 levels showed a comparable increase in acute as well as vascular chronic Q fever patients. Additionally, vascular chronic Q fever patients had lower serum levels of gamma interferon-inducible protein 10 (IP-10) and transforming growth factor β (TGF-β) than did acute Q fever patients. Serum responses for these and other markers indicate that type I immune responses to C. burnetii are affected in chronic Q fever patients. This may be attributed to an affected immune system in cardiovascular patients, which enables local C. burnetii replication at affected cardiovascular sites. PMID:25924761
Yoo, J C; Pae, H O; Choi, B M; Kim, W I; Kim, J D; Kim, Y M; Chung, H T
2000-02-01
The effects of ionizing irradiation on the nitric oxide (NO) production in murine embryonic liver cell line, BNL CL.2 cells, were investigated. Various doses (5-40 Gy) of radiation made BNL CL.2 cells responsive to interferon-gamma alone for the production of NO in a dose-dependent manner. Small amounts of lipopolysaccharide (LPS) or tumor necrosis factor-alpha (TNF-alpha) synergized with IFN-gamma in the production of NO from irradiated BNL CL.2 cells, even though LPS or TNF-alpha alone did not induce NO production from the same cells. Immunoblots showed parallel induction of inducible nitric oxide synthase (iNOS). NO production in irradiated BNL CL.2 cells by IFN-gamma or IFN-gamma plus LPS was decreased by the addition of catalase, suggesting that H(2)O(2) produced by ionizing irradiation primed the cells to trigger NO production in response to IFN-gamma or IFN-gamma plus LPS. Furthermore, the treatment of nongamma-irradiated BNL CL.2 cells with H(2)O(2) made the cells responsive to IFN-gamma or IFN-gamma plus LPS for the production of NO. This study shows that ionizing irradiation has the ability to induce iNOS gene expression in responsive to IFN-gamma via the formation of H(2)O(2) in BNL CL.2 murine embryonic liver cells.
Oliveira, Sandra Maria do Valle Leone de; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria
2017-01-01
To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. Avaliar a frequência de resultados indeterminados de um interferon-gamma release assay (IGRA, ensaio de liberação de interferon-gama) e os fatores relacionados com esses resultados em pessoas vivendo com HIV/AIDS (PVHA). Foram avaliadas 81 PVHA na região Centro-Oeste do Brasil, por meio do teste tuberculínico e de um IGRA. Informações a respeito de vari
Alternative activation of STAT1 and STAT3 in response to interferon-gamma.
Qing, Yulan; Stark, George R
2004-10-01
Interferon-gamma (IFNgamma) is a pluripotent cytokine whose major biological effects are mediated through a pathway in which STAT1 is the predominant and essential transcription factor. STAT3 can also be activated weakly by IFNgamma, but the mechanism of activation and function of STAT3 as a part of the interferon response are not known. Here we show that STAT3 activation is much stronger and more prolonged in STAT1-null mouse embryo fibroblasts than in wild-type cells. In response to IFNgamma, SRC-family kinases are required to activate STAT3 (but not STAT1) through tyrosine phosphorylation, whereas the receptor-bound kinases JAK1 and JAK2 are required to activate both STATs. Tyrosine 419 of the IFNgamma receptor subunit 1 (IFNGR1) is required to activate both STATs, suggesting that STAT1 and STAT3 compete with each other for the same receptor phosphotyrosine motif. Activated STAT3 can replace STAT1 in STAT1-null cells to drive the transcription of certain genes, for example, socs-3 and c/ebpdelta, which have gamma-activated sequence motifs in their promoters. Work from Ian Kerr's laboratory reveals that the gp130-linked interleukin-6 receptor, which usually activates STAT3 predominantly, activates STAT1 efficiently when STAT3 is absent. Because STAT1 and STAT3 have opposing biological effects (STAT3 is an oncogene, and STAT1 is a tumor suppressor), the reciprocal activation of these two transcription factors in response to IFNgamma or interleukin-6 suggests that their relative abundance, which may vary substantially in different normal cell types, under different conditions or in tumors is likely to have a major impact on how cells behave in response to different cytokines.
Erkens, C G M; Dinmohamed, A G; Kamphorst, M; Toumanian, S; van Nispen-Dobrescu, R; Alink, M; Oudshoorn, N; Mensen, M; van den Hof, S; Borgdorff, M; Verver, S
2014-04-01
Interferon-gamma release assays (IGRAs) are reported to be more specific for the diagnosis of latent tuberculous infection (LTBI) than the tuberculin skin test (TST). The two-step procedure, TST followed by an IGRA, is reported to be cost-effective in high-income countries, but it requires more financial resources. To assess the added value of IGRA compared to TST alone in the Netherlands. Test results and background data on persons tested with an IGRA were recorded by the Public Municipal Health Services in a web-based database. The number of persons diagnosed with LTBI using different screening algorithms was calculated. In those tested with an IGRA, at least 60% of persons who would have been diagnosed with LTBI based on TST alone had a negative IGRA. Among those with a TST reaction below the cut-off for the diagnosis of LTBI, 13% had a positive IGRA. For 41% of persons tested with an IGRA after TST, the IGRA influenced whether or not an LTBI diagnosis would be made. With the IGRA as reference standard, a high proportion of persons in low-prevalence settings are treated unnecessarily for LTBI if tested with TST alone, while a small proportion eligible for preventive treatment are missed. Incremental costs of the two-step strategy seem to be balanced by the improved targeting of preventive treatment.
NASA Technical Reports Server (NTRS)
Lah, T. T.; Hawley, M.; Rock, K. L.; Goldberg, A. L.
1995-01-01
Previous studies have indicated that acid-optimal cysteine proteinase(s) in the endosomal-lysosomal compartments, cathepsins, play a critical role in the proteolytic processing of endocytosed proteins to generate the antigenic peptides presented to the immune system on major histocompatibility complex (MHC) class II molecules. The presentation of these peptides and the expression of MHC class II molecules by macrophages and lymphocytes are stimulated by gamma-interferon (gamma-IFN). We found that treatment of human U-937 monocytes with gamma-IFN increased the activities and the content of the two major lysosomal cysteine proteinases, cathepsins B and L. Assays of protease activity, enzyme-linked immunosorbant assays (ELISA) and immunoblotting showed that this cytokine increased the amount of cathepsin B 5-fold and cathepsin L 3-fold in the lysosomal fraction. By contrast, the aspartic proteinase, cathepsin D, in this fraction was not significantly altered by gamma-IFN treatment. An induction of cathepsins B and L was also observed in mouse macrophages, but not in HeLa cells. These results suggest coordinate regulation in monocytes of the expression of cathepsins B and L and MHC class II molecules. Presumably, this induction of cysteine proteases contributes to the enhancement of antigen presentation by gamma-IFN.
Interferon-gamma enhances radiation-induced cell death via downregulation of Chk1
Kim, Kwang Seok; Choi, Kyu Jin; Bae, Sangwoo
2012-01-01
Interferon-gamma (IFNγ) is a cytokine with roles in immune responses as well as in tumor control. Interferon is often used in cancer treatment together with other therapies. Here we report a novel approach to enhancement of cancer cell killing by combined treatment of IFNγ with ionizing radiation. We found that IFNγ treatment alone in HeLa cells induced phosphorylation of Chk1 in a time- and dose-dependent manner, and resulted in cell arrest. Moreover IFNγ treatment was correlated with attenuation of Chk1 as the treatment shortened protein half-life of Chk1. As Chk1 is an essential cell cycle regulator for viability after DNA damage, attenuation of Chk1 by IFNγ pre-treatment in HeLa cells resulted in increased cell death following ionizing radiation about 2-folds than ionizing radiation treatment alone whereas IFNγ treatment alone had little effect on cell death. X-linked inhibitor of apoptosis-associated factor 1 (XAF1), an IFN-induced gene, seems to partly regulate IFNγ-induced Chk1 destabilization and radiation sensitivity because transient depletion of XAF1 by siRNA prevented IFNγ-induced Chk1 attenuation and partly protected cells from IFNγ-enhanced radiation cell killing. Therefore the results provide a novel rationale to combine IFNγ pretreatment and DNA-damaging anti-cancer drugs such as ionizing radiation to enhance cancer cell killing. PMID:22825336
NASA Astrophysics Data System (ADS)
Priwahyuningtyas, N. B.; Sinaga, B. Y. M.; Pandia, P.; Eyanoer, P. C.
2018-03-01
Tuberculosis is an infectious disease which caused by Mycobacterium tuberculosis (M. tuberculosis) that infected numerous organ especially the lung. A person’s immunity is very affecting for a person exposed to pulmonary tuberculosis. T-helper-1 cell (Th1) is very influential in the immune system especially in interfering intracellular bacterial infection. One of the cytokines known produced by Th1 cell is interferon gamma (IFN-γ) which is in eliminating M. tuberculosis. The study aims to identify the association between level of IFN-γ and AFB positivity in pulmonary tuberculosis patients in Medan. It is a case-control study. The subjects of the study were 60 new cases of pulmonary tuberculosis with AFB sputum smear- positive that never received ATT consisting 20 cases AFB (+1), 20 cases AFB (+2) and 20 cases AFB (+3).Samples were plasma collected from the venous blood of pulmonary tuberculosis patients. The plasma then underwent laboratory assay with ELISA techniques. Independent t-test was p<0.05 considered significant. Level of IFN-γ in TB AFB (+1) is higher than TB AFB (+2) and (+3), with thesignificant statistical result (p=0.001).
Immunomodulatory intervention with Gamma interferon in mice with sepsis.
Wang, Yu; Kong, Bing-Bing; Yang, Wen-Ping; Zhao, Xin; Zhang, Rong
2017-09-15
Sepsis-triggered immune paralysis including T-cell dysfunction increase susceptibility to infection. Gamma interferon (IFNg) exert beneficial effects in patients with sepsis. Herein, we speculated that IFNg may attenuate T-cell dysfunction induced by sepsis, although the mechanisms remain elusive. To test this hypothesis, we used a model based on cecal ligation and puncture (CLP) to induce sepsis in mice. Male C57BL/6 mice were pretreated with recombinant human IFNg (0.01μg/g of body weight) before CLP. The immunophenotyping of cell surface receptor expression, and regulatory T cells (CD4+CD25+Foxp3+) were quantified by flow cytometry. Immunohistochemical staining was performed to evaluate the loss of immune effector cells. Formation of IFNg and interleukin 4 (IL-4) in the spleen and plasma levels of TNF-α, IL-6, high-mobility group box 1 (HMGB1) were determined using enzyme-linked immunosorbent assay. IFNg markedly inhibited the reduction in cytokine secretion from lipopolysaccharide (LPS)-stimulated splenocytes. IFNg-treated mices had significantly decreased percentages of programmed cell death 1 (PD-1) receptors, increased the percentages of positive costimulatory receptor CD28 on CD4 T cells expressing. IFNg markedly reduced T-cell apoptosis through upregulating the expression of Bcl-2. CLP-induced formation of regulatory T cells in the spleen was abolished in IFNg -treated mices. Moreover, IFNg treatment reduced plasma levels of TNF-α, IL-6, HMGB1. IFNg can be a powerful regulator of immune function under sepsis conditions. Therefore, targeted immune-enhancement with IFNg may be a valid therapeutic approach in sepsis. Copyright © 2017 Elsevier Inc. All rights reserved.
Coppen, S R; Newsam, R; Bull, A T; Baines, A J
1995-04-20
The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.
Chkhartishvili, Nikoloz; Kempker, Russell R; Dvali, Natia; Abashidze, Lela; Sharavdze, Lali; Gabunia, Pati; Blumberg, Henry M; Del Rio, Carlos; Tsertsvadze, Tengiz
2013-11-01
Improved tests to diagnose latent TB infection (LTBI) are needed. We sought to evaluate the performance of two commercially available interferon-gamma release assays (IGRAs) compared to the tuberculin skin test (TST) for the diagnosis of LTBI and to identify risk factors for LTBI among HIV-infected individuals in Georgia, a country with high rates of TB. HIV-patients were enrolled from the National AIDS Center in Tbilisi, Georgia. After providing informed consent, each participant completed a questionnaire, had blood drawn for QuantiFERON-TB Gold in-Tube (QFT-GIT) and T-SPOT.TB testing and had a TST placed. The TST was read at 48-72 hrs with ≥ 5 mm induration considered positive. Between 2009-2011, 240 HIV-infected persons (66% male) with a median age of 38 years and a median CD4 count of 255 cells/μl (IQR: 124-412) had diagnostic testing for LTBI performed. 94% had visible evidence of a BCG scar. The TST was positive in 41 (17%) patients; QFT-GIT in 70 (29%); and T-SPOT.TB in 56 (24%). At least one diagnostic test was positive in 109 (45%) patients and only among 13 (5%) patients were all three tests positive. Three (1%) QFT-GIT and 19 (8%) T-SPOT.TB test results were indeterminate. The agreement among all pairs of tests was poor: QFT-GIT vs. T-SPOT.TB (κ = 0.18, 95% CI .07-.30), QFT-GIT vs. TST (κ = 0.29, 95% CI .16-.42), and TST vs. T-SPOT.TB (κ = 0.22, 95% CI .07-.29). Risk factors for LTBI varied by diagnostic test and none showed associations between positive test results and well-known risk factors for TB, such as imprisonment, drug abuse and immunological status. A high proportion of HIV patients had at least one positive diagnostic test for LTBI; however, there was very poor agreement among all tests. This lack of agreement makes it difficult to know which test is superior and most appropriate for LTBI testing among HIV-infected patients. While further follow-up studies will help determine the predictive ability of different LTBI tests, improved
Manneberg, M.; Friedlein, A.; Kurth, H.; Lahm, H. W.; Fountoulakis, M.
1994-01-01
A soluble form of the human interferon gamma receptor that is required for the identification of interferon gamma antagonists was expressed in baculovirus-infected insect cells. The protein carried N-linked carbohydrate and showed a heterogeneity on denaturing polyacrylamide gels. We investigated the utilization of the potential sites for N-linked glycosylation and the structure of the carbohydrate moieties of this soluble receptor. Amino acid sequence analysis and ion spray mass spectrometry revealed that of the five potential sites for N-linked glycosylation, Asn17 and Asn69 were always utilized, whereas Asn62 and Asn162 were utilized in approximately one-third of the protein population. Asn223 was never found to be glycosylated. The soluble receptor was treated with N-glycosidase F and the oligosaccharides released were analyzed by matrix-assisted laser desorption mass spectrometry, which showed that the protein carried six types of short carbohydrate chains. The predominant species was a hexasaccharide of molecular mass 1,039, containing a fucose subunit linked to the proximal N-acetylglucosamine residue: [formula: see text] PMID:8142896
Inhibited interferon production after space flight
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Gould, C. L.; Williams, J.; Mandel, A. D.
1988-01-01
Several studies have been performed in our laboratories indicating that interferon production may be impaired in rodents after space flight. Using an antiorthostatic suspension model that simulates some of the effects of microgravity seen during space flight, we have shown that interferon-alpha/beta production was inhibited. The inhibition was not due solely to the stress of suspension. The inhibited interferon production was transient, as suspended animals returned to normal caging recovered the ability to produce interferon. Antiorthostatic suspension of mice also resulted in a loss of resistance to infection with the diabetogenic strain of encephalomyocarditis virus, which correlated with the drop in interferon production. In rats flown in US Space Shuttle mission SL-3, interferon-gamma production was inhibited severely when spleen cells were challenged with concanavalin-A upon return to earth. In contrast, interleukin-3 production by these cells was normal. These results suggest that immune responses may be altered after antiorthostatic modeling or space flight, and the resistance to viral infections may be especially affected.
Rodríguez-Güell, Elisabeth; Agustí, Gemma; Corominas, Mercè; Cardona, Pere-Joan; Luquin, Marina; Julián, Esther
2008-01-01
Whole heat-killed Mycobacterium vaccae is used as an immunotherapeutic agent in tuberculosis (TB), but the compound(s) that triggers its immunostimulatory ability is not known. Here, we show that among different subcellular fractions, the cell wall skeleton induced a prominent expression of gamma interferon in splenocytes from both non-TB and TB M. vaccae-treated mice. PMID:18337379
Gamma Interferon-Induced T-Cell Loss in Virulent Mycobacterium avium Infection
Flórido, Manuela; Pearl, John E.; Solache, Alejandra; Borges, Margarida; Haynes, Laura; Cooper, Andrea M.; Appelberg, Rui
2005-01-01
Infection by virulent Mycobacterium avium caused progressive severe lymphopenia in C57BL/6 mice due to increased apoptosis rates. T-cell depletion did not occur in gamma interferon (IFN-γ)-deficient mice which showed increased T-cell numbers and proliferation; in contrast, deficiency in nitric oxide synthase 2 did not prevent T-cell loss. Although T-cell loss was IFN-γ dependent, expression of the IFN-γ receptor on T cells was not required for depletion. Similarly, while T-cell loss was optimal if the T cells expressed IFN-γ, CD8+ T-cell depletion could occur in the absence of T-cell-derived IFN-γ. Depletion did not require that the T cells be specific for mycobacterial antigen and was not affected by deficiencies in the tumor necrosis factor receptors p55 or p75, the Fas receptor (CD95), or the respiratory burst enzymes or by forced expression of bcl-2 in hematopoietic cells. PMID:15908387
Reproducibility of Interferon Gamma (IFN-γ) Release Assays. A Systematic Review
Tagmouti, Saloua; Slater, Madeline; Benedetti, Andrea; Kik, Sandra V.; Banaei, Niaz; Cattamanchi, Adithya; Metcalfe, John; Dowdy, David; van Zyl Smit, Richard; Dendukuri, Nandini
2014-01-01
Rationale: Interferon gamma (IFN-γ) release assays for latent tuberculosis infection result in a larger-than-expected number of conversions and reversions in occupational screening programs, and reproducibility of test results is a concern. Objectives: Knowledge of the relative contribution and extent of the individual sources of variability (immunological, preanalytical, or analytical) could help optimize testing protocols. Methods: We performed a systematic review of studies published by October 2013 on all potential sources of variability of commercial IFN-γ release assays (QuantiFERON-TB Gold In-Tube and T-SPOT.TB). The included studies assessed test variability under identical conditions and under different conditions (the latter both overall and stratified by individual sources of variability). Linear mixed effects models were used to estimate within-subject SD. Measurements and Main Results: We identified a total of 26 articles, including 7 studies analyzing variability under the same conditions, 10 studies analyzing variability with repeat testing over time under different conditions, and 19 studies reporting individual sources of variability. Most data were on QuantiFERON (only three studies on T-SPOT.TB). A considerable number of conversions and reversions were seen around the manufacturer-recommended cut-point. The estimated range of variability of IFN-γ response in QuantiFERON under identical conditions was ±0.47 IU/ml (coefficient of variation, 13%) and ±0.26 IU/ml (30%) for individuals with an initial IFN-γ response in the borderline range (0.25–0.80 IU/ml). The estimated range of variability in noncontrolled settings was substantially larger (±1.4 IU/ml; 60%). Blood volume inoculated into QuantiFERON tubes and preanalytic delay were identified as key sources of variability. Conclusions: This systematic review shows substantial variability with repeat IFN-γ release assays testing even under identical conditions, suggesting that reversions
Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong
2008-01-01
We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.
Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T
1993-01-01
For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376
Keck, Nicolas; Boschiroli, Maria-Laura; Smyej, Florence; Vogler, Valérie; Moyen, Jean-Louis; Desvaux, Stéphanie
2018-01-01
In the French Camargue region, where bovine tuberculosis had been enzootic for several years in bullfighting cattle herds, the gamma-interferon (IFN) assay was used since 2003 in parallel with the intradermal test in order to increase overall disease detection sensitivity in infected herds. This study presents the results of a field-evaluation of the assay during a 10-year period (2004-2014) of disease control and surveillance program and explores the particular pattern of IFN assay results in bullfight herds in comparison to cattle from other regions of France. The low sensitivity [59.2% (50.6; 67.3)] of IFN assay using the tuberculin stimulation could be related to the poor gamma-IFN production from bullfight cattle blood cells which is significantly lower than in animals of conventional breeds. The characteristics of the assay were progressively adapted to the epidemiological situation and the desired strategic applications. Data analysis with a receiver operating characteristic curve based on a simple S/P value algorithm allowed for the determination of a new cutoff adapted for a global screening, giving a high specificity of 99.9% results and a high accuracy of the assay. Having regularly risen to above 5% since 2005, with a peak around 10% in 2010, the annual incidence dropped to under 1% in 2014. The positive predictive value relative to the bacteriological confirmation evolved during the years, from 33% in 2009 to 12% during the last screening period, a normal trend in a context of decreasing prevalence. The estimated rate of false-positive reactions during screening campaigns was 0.67%, confirming the high specificity of the test, measured in bTB negative herds, in this epidemiological context. The proportion of false-positive reactions decreased with the age and was higher in males than in females. Although these results indicate that the IFN assay is accurate in the field, it also emphasizes great differences between interferon quantities produced by
NASA Technical Reports Server (NTRS)
Degee, Antonie L. W.; Mansfield, John M.; Sonnenfeld, Gerald
1986-01-01
Earlier studies have demonstrated that mice resistant to Trypanosoma brucei rhodesiense (the B10.BR/SgSnJ strain) produces, upon infection by this parasite, two peaks of serum interferon (IFN), while the susceptible mice (C3HeB/FeJ) produces no IFN. In the present study, survival times were compared for B10.BR/SgSnJ, C3HeB/FeJ, and CBA/J (an intermediately resistant strain) mice that were injected, prior to infection with the parasite, with either of the following three preparations (1) IFN-gamma, (2) an antibody to IFN-gamma and (3) polyriboinosinic-polyribocytidylic acid (to induce IFN-alpha/beta). No effect on the survival times of mice by any of these preparations could be demonstrated, contrary to some previous reports.
Scorneaux, B; Ouadrhiri, Y; Anzalone, G; Tulkens, P M
1996-01-01
Listeria monocytogenes is a facultative intracellular pathogen which enters cells by endocytosis and reaches phagolysosomes from where it escapes and multiplies in the cytosol of untreated cells. Exposure of macrophages to gamma interferon (IFN-gamma) restricts L. monocytogenes to phagosomes and prevents its intracellular multiplication. We have tested whether IFN-gamma also modulates the susceptibility of L. monocytogenes to antibiotics. We selected drugs from three different classes displaying marked properties concerning their cellular accumulation and subcellular distribution, namely, ampicillin (not accumulated by cells but present in cytosol), azithromycin (largely accumulated by cells but mostly restricted to lysosomes), and sparfloxacin (accumulated to a fair extent but detected only in cytosol). We used a continuous line of myelomonocytic cells (THP-1 macrophages), which display specific surface receptors for IFN-gamma, and examined the activity of these antibiotics against L. monocytogenes Hly+ (virulent variant) and L. monocytogenes Hly- (a nonvirulent variant defective in hemolysin production). Untreated THP-1 and phorbol myristate acetate-differentiated THP-1 were permissive for infection and multiplication of intracellular L. monocytogenes Hly+ (virulent variant). All three antibiotics tested were bactericidal against this Listeria strain when added to an extracellular concentration of 10x their MIC. After preexposure of THP-1 to IFN-gamma, L. monocytogenes Hly+ was still phagocytosed but no longer grew intracellularly. The activity of ampicillin became almost undetectable (antagonistic effect), and that of azithromycin was unchanged (additive effect with that of IFN-gamma), whereas that of sparfloxacin was markedly enhanced (synergy). A similar behavior (lack of bacterial growth, associated with a loss of activity of ampicillin, an enhanced activity of sparfloxacin, and unchanged activity of azithromycin) was observed in cells infected with L
Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten
2014-01-01
ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID
Saldan, Alda; Mengoli, Carlo; Fiscon, Marta; Silvestre, Cristina; Fallico, Loredana; Peracchi, Marta; Furian, Lucrezia; Cusinato, Riccardo; Bonfante, Luciana; Rossi, Barbara; Marchini, Francesco; Sgarabotto, Dino; Rigotti, Paolo; Palù, Giorgio
2013-01-01
Assessing cytomegalovirus (CMV)-specific cell-mediated immunity (CMI) represents an appealing strategy for identifying transplant recipients at risk of infection. In this study, we compared two gamma interferon-releasing assays (IGRAs), Quantiferon-CMV and CMV enzyme-linked immunosorbent spot (ELISPOT), to determine the ability of each test to predict protective CMV-specific T-cell responses. Two hundred twenty-one Quantiferon-CMV and ELISPOT tests were conducted on 120 adult kidney transplant recipients (KTRs), including 100 CMV-seropositive transplant recipients (R+) and 20 CMV-seronegative transplant recipients of a CMV-positive donor (D+/R−). As a control cohort, 39 healthy adult subjects (including 33 CMV-seropositive and 6 CMV-seronegative subjects) were enrolled. CMV IgG serology was used as a reference for both tests. In the CMV-seropositive individuals, the ELISPOT and Quantiferon-CMV assays provided 46% concordance with the serology, 12% discordance, 18% disagreement between ELISPOT or Quantiferon-CMV and the serology, and 24% gray areas when one or both tests resulted in weak positives. None of the CMV-seronegative subjects showed detectable responses in the ELISPOT or the Quantiferon-CMV test. In transplant recipients, both the ELISPOT and Quantiferon-CMV assays positively correlated with each other and negatively correlated with CMV DNAemia in a significant way (P < 0.05). During the antiviral prophylaxis, all 20 D+/R− KTRs we examined displayed undetectable Quantiferon-CMV and ELISPOT results, and there was no evidence of CMV seroconversion. The receiving operator curve (ROC) statistical analysis revealed similar specificities and sensitivities in predicting detectable viremia (areas under the curve [AUC], 0.66 and 0.62 for Quantiferon-CMV and ELISPOT, respectively). ELISPOT and Quantiferon-CMV values of >150 spots/200,000 peripheral blood mononuclear cells (PBMCs) and >1 to 6 IU gamma interferon (IFN-γ) were associated with protection from CMV
NASA Technical Reports Server (NTRS)
Gould, Cheryl L.; Sonnenfeld, Gerald
1987-01-01
The effect of pretreatment of mice with 34 units/day, for five days, of interferon-gamma (IFN-gamma) on the course of infection with LD50 of Salmonella typhimurium strain LT-2 was assessed, using two IFN preparations: (1) a hybridoma supernatant fluid containing concanavalin-A-induced IFN-gamma activity and (2) pure murine IFN-gamma produced by recombinant DNA technology. The hybridoma supernatant-treated Salmonella-infected mice were found to die faster than mice treated only with Salmonella. Pure murine IFN-gamma was found to protect infected mice significantly, with 95 percent of mice surviving LD50 infection. In contrast, the Salmonella-infected mice treated with hybridoma supernatant were found to die faster than the Salmonella-infected untreated controls. Mice treated with concanavalin A alone prior to infection with S. typhimurium died more quickly than the untreated infected controls, suggesting that contamination with concanavalin A had a detrimental effect on mice survival.
Seto, Junji; Ahiko, Tadayuki
2014-04-01
To confirm the effectiveness of interferon-gamma release assays (IGRAs) in the tuberculosis (TB) contact investigation of elderly people, we analyzed the results of the QuantiFERON TB Gold in tube (QFT-3G) test, which is a commercially available IGRA. We analyzed the results of the QFT-3G test in 2,420 subjects who were in close contact with TB patients. We investigated subjects with latent TB infection and those showing the onset of TB among the QFT-3G-positive subjects. The QFT-3G-positive rate was 7.3% (95% confidence interval, 6.2%-8.3%). In addition, we demonstrated that the QFT-3G-positive rate increased with age (P < 0.001). The QFT-3G-positive rate was high, particularly in elderly people (> or = 60 years), but the rate was significantly lower than the predicted prevalence of TB infection. Therefore, it was assumed that the QFT-3G test does not always provide a positive result, even in cases of subjects with a previous TB infection. Furthermore, data from the QFT-3G-positive subjects indicated that approximately one half of subjects aged 60-69 years, approximately one-third of those aged 70-79 years, and approximately one-quarter of those aged over 80 years have had recent TB infections. In conclusion, the results of the QFT-3G test in elderly people need to be carefully evaluated according to the contact situation with TB patients; nevertheless, the QFT-3G test is useful for the screening of latent TB infection in elderly people who were in close contact with TB patients.
Don, Elena; Farafonova, Olga; Pokhil, Suzanna; Barykina, Darya; Nikiforova, Marina; Shulga, Darya; Borshcheva, Alena; Tarasov, Sergey; Ermolaeva, Tatyana; Epstein, Oleg
2016-01-01
In preliminary ELISA studies where released-active forms (RAF) of antibodies (Abs) to interferon-gamma (IFNg) were added to the antigen-antibody system, a statistically significant difference in absorbance signals obtained in their presence in comparison to placebo was observed. A piezoelectric immunosensor assay was developed to support these data and investigate the effects of RAF Abs to IFNg on the specific interaction between Abs to IFNg and IFNg. The experimental conditions were designed and optimal electrode coating, detection circumstances and suitable chaotropic agents for electrode regeneration were selected. The developed technique was found to provide high repeatability, intermediate precision and specificity. The difference between the analytical signals of RAF Ab samples and those of the placebo was up to 50.8%, whereas the difference between non-specific controls and the placebo was within 5%–6%. Thus, the piezoelectric immunosensor as well as ELISA has the potential to be used for detecting the effects of RAF Abs to IFNg on the antigen-antibody interaction, which might be the result of RAF’s ability to modify the affinity of IFNg to specific/related Abs. PMID:26791304
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Cunnick, J. E.; Armfield, A. V.; Wood, P. G.; Rabin, B. S.
1992-01-01
Mild electric foot-shock has been shown to be a stressor that can alter immune responses. Male Lewis rats were exposed to one session of 16 5.0-s 1.6-mA foot-shocks. Production of interferon-gamma by splenocytes in response to concanavalin-A was decreased in spleens from the shocked rats compared to control spleens. Spleen cells from rats treated with nadolol, a peripherally acting beta-adrenergic receptor antagonist, and then shocked, showed dose-dependent attenuation of the suppression of interferon-gamma production. This suggests that catecholamines mediate shock-induced suppression of interferon-gamma production. The percentage of splenic mononuclear cells expressing class II histocompatibility (Ia) antigens on their surfaces from spleens of shocked rats was determined by flow cytometry. Significantly decreased class II positive mononuclear cells were present in the spleens of shocked rats in comparison to the spleens of control rats. This may reflect an alteration of cell trafficking or decreased production of class II antigens.
Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.
2007-01-01
The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401
Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T
1999-01-01
A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.
Wang, C Q; Udupa, K B; Lipschitz, D A
1995-01-01
Interferon-gamma (INF-gamma) has been shown to suppress erythropoiesis and perhaps to contribute to the anemia of chronic disease. In this study we demonstrated that the concentration of INF gamma required to suppress murine burst forming unit-erythroid (BFU-E) growth was significantly less than that required to suppress colony forming unit-erythroid (CFU-E) growth. INF gamma acted at the most primitive step in erythroid progenitor cell differentiation and proliferation, as inhibition was maximal when added at the time of BFU-E culture initiation. Inhibition was progressively less if INF gamma addition was delayed after culture initiation. The effects of INF gamma on BFU-E did not require the presence of interleukin-1 alpha (IL-1 alpha), tumor necrosis factor-alpha (TNF alpha), or granulocyte macrophage colony stimulating factor (GM-CSF), as its effects were not neutralized by monoclonal antibodies against IL-1 alpha, TNF alpha, or GM-CSF. This applied whether INF gamma was added to culture with individual antibodies or with a combination of all three antibodies. INF gamma was not required for IL-1 alpha- or TNF alpha-induced suppression of BFU-E, as their effects were not neutralized by a monoclonal anti-INF gamma antibody. In contrast, GM-CSF-induced suppression of BFU-E was negated by the simultaneous addition of anti-INF gamma. We have previously shown that the addition of TNF alpha does not suppress BFU-E growth in cultures from marrow depleted of macrophages. Suppression did occur, however, if a small concentration of INF gamma that does not inhibit and increasing concentration of TNF alpha were added to culture, suggesting a synergistic effect between INF-gamma and TNF alpha. These observations suggest that INF gamma is a potent direct inhibitor of erythroid colony growth in vitro. It exerts its negative regulatory effect primarily on the earliest stages of erythroid progenitor cell differentiation and proliferation, as much higher doses are required to
[Gamma interferon: basics aspects, clinic significance and terapeutic uses].
Mata-Espinosa, Dulce A; Hernández-Pando, Rogelio
2008-01-01
Interferons are a family of pleiotropic cytokines, their name was assigned because of their anti-replicative viral activity. IFNgamma or immune type II interferon does not share receptors with the type I interferon, its structure is different and its gene is located in different chromosome, although its biologic effects are similar. Along of several years of research, it has been found that IFNgamma enhances the transcription of genes involved in immunomodulation, antiviral responses and antitumoral activities. Regarding to the immune system, IFNgamma increases the cytotoxic and phagocytic activity of macrophages and upregulates the expression of major histocompatibility complex (MHC) class I and class II molecules in dendritics cells and other antigen presenting cells. IFNgamma also promotes the development and differentiation of naive CD4+ T lymphocytes to Th1 helper subset. Indeed, this cytokine has a key role in the control of bacterial, micotic, viral and parasitic infections. Depending of the micro-environment, IFNgamma has a dual role as pro or anti inflammatory cytokine. Novel therapeutic strategies are currently being developed with the aim to enhance the immune response or replace IFNgamma gene abnormal expression with beneficial results in humans, being recombinant IFNgamma safe and well tolerated.
Bukhary, Zakeya A; Amer, Soliman M; Emara, Magdy M; Abdalla, Mohammad E; Ali, Sahar A
2018-01-01
Interferon gamma release assays (IGRA) is highly specific for Mycobacterium tuberculosis and is the preferred test in BCG-vaccinated individuals. The few studies that have screened health care workers (HCWs) in Saudi Arabia for latent tuberculosis infection (LTBI) using IGRA have varied in agreement with the traditional tuberculin skin test (TST). Assess the prevalence of LTBI among HCWs working in the Hajj pilgrimage using IGRA and TST and measuring their agreement. Cross-sectional prospective. Multiple non-tertiary care hospitals. HCWs who worked during the Hajj pilgrimage in Saudi Arabia in December 2015. Data was collected by standarized questionnaire. Samples were drawn and analyzed by standard methods. The prevalence of LTBI among HCW and the agreement by kappa statistic between QFT-GIT and TST. 520 subjects. Nurses accounted for 30.7% of the sample and physicians, 19.2%. The majority were BCG vaccinated (98.5%). There were a total of 56 positive by QFT-GIT and the LTBI rate was 10.8%. In 50 QFT positive/476 TST negative the LTBI rate was 10.5% in discordant tests, and in 6 QFT positive/44 TST positive it was 13.6% in concordant tests. The overall agreement between both tests was poor-83% and kappa was 0.02. LTBI prevalence was associated with longer employment (13.1 [9.2] years). The QFT-GIT positive test was significantly higher in physicians (P=.02) and in HCWs working in chest hospitals 16/76 (21.05%) (P=.001). Agreement between the tests was poor. QFT-GIT detected LTBI when TST was negative in HCWs who had a history of close contact with TB patients. A second step TST was not feasible within 2-3 weeks. None.
de Oliveira, Sandra Maria do Valle Leone; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria
2017-01-01
ABSTRACT Objective: To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). Methods: We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Results: Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. Conclusions: The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. PMID:28746533
Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J
2007-06-01
Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Badger, A.M.; Swift, B.; Sung, C.P.
1986-03-05
Recombinant murine gamma interferon (IFN-..gamma..) activates oil elicited C57BL/6 peritoneal macrophages to inhibit the growth of Listeria. Maximum activity is obtained with 10-20 units/ml, can be demonstrated in the absence of antibiotics and is not due to LPS contamination. Studies of the kinetics of this phenomenon demonstrate that a 30 minute incubation with IFN-..gamma.. is sufficient to initiate the antiproliferative state and full activity can be obtained with a 4 hour incubation. Alpha/beta interferon (IFN-..cap alpha../..beta..) is also active but requires 100X more units to obtain equivalent activity. The evaluation of a number of other BRMS demonstrated that MDP andmore » LPS could stimulate phagocytosis of Listeria but could not inhibit their growth. Bestatin, tuftsin, Con A, A23187 and Poly I:C did not stimulate either phagocytosis or growth inhibitory activity. These compounds were also tested for their ability to enhance the release of superoxide anion from PMA stimulated macrophages. With the exception of tuftsin and bestatin all of the BRMS tested were able to enhance the production of oxidative burst products confirming the findings of others of the dissociation between the two functions.« less
LaCourse, Sylvia M; Cranmer, Lisa M; Matemo, Daniel; Kinuthia, John; Richardson, Barbra A; Horne, David J; John-Stewart, Grace
2017-05-01
Peripartum immunologic changes may affect latent tuberculosis infection (LTBI) diagnostic performance among HIV-infected women. HIV-infected women were serially tested with tuberculin skin test (TST) and interferon gamma release assay [QuantiFERON TB Gold In-tube (QFT)] in pregnancy and 6 weeks postpartum in Kenya. Prevalence, sensitivity and agreement, and correlates of QFT/TST positivity were assessed. Quantitative QFT mitogen and Mycobacterium tuberculosis antigen (Mtb-Ag) responses were compared by peripartum stage. Incidence of test conversion at 6 weeks postpartum was evaluated in baseline TST-/QFT- women. Among 100 HIV-infected women, median age was 26 years, median CD4 was 555 cells per cubic millimeter, and 88% were on antiretrovirals. More women were QFT+ than TST+ in both pregnancy (35.4% vs. 13.5%, P = 0.001) and postpartum (29.6% vs. 14.8%, P < 0.001). Among 18 consistently QFT+ women, 8 (44%) converted from TST- to TST+, with improved test agreement postpartum (56.9%, κ = 0.20 to 82.4%, κ = 0.60). Three initially QFT-/TST- women had test conversion (TST+ and/or QFT+), suggesting new infection (incidence 13.4/100 person-years). Mean QFT mitogen (4.46 vs. 7.64 IU/mL, P < 0.001) and Mtb-Ag (1.03 vs. 1.54 IU/mL, P = 0.03) responses were lower among all women retested in pregnancy vs. postpartum, and specifically among persistently QFT+ women (Mtb-Ag: 3.46 vs. 4.48 IU/mL, P = 0.007). QFT indeterminate rate was higher in pregnancy (16%) compared with postpartum (0%) because of lower mitogen response. QFT identified >2-fold more women with LTBI compared with TST in pregnancy and postpartum. Lower QFT Mtb-Ag and mitogen responses in pregnancy compared with postpartum suggest that pregnancy-associated immunologic changes may influence LTBI test performance.
[Allergic asthma and interleukins 2, 4, 5, 6 and 12 and gamma interferon levels].
Bastida Segura, Diana Lyzbeth; López Velásquez, Benjamin; Castrejón Vázquez, María Isabel; Galicia Tapía, Jorge; Cano Altamirano, Silvia; Miranda Feria, Alfonso Javier
2004-01-01
Asthma is an inflammatory chronic illness, in which mastocyt cells, basophils, T lymphocytes, eosinophils and cytokines play a role. Its association with the production of TH2 cytokines is not well known, but it is considered an aberrant immune response, yielding the activation and recruitment of a number of effector cells (mastocyts/eosinophils) and the appearance of clinical symptoms. To determine the serum values of the interleukins 2, 4, 5, 6 and 12 and gamma interferon in relation to the severity degree of asthma and the time of immunotherapy in patients with stable chronic allergic bronchial asthma. Clinical records of allergic asthmatic patients from the external consultation at Servicio de Alergia e Immunología Clínica were reviewed in a period of 12 months (1st January 2002 to 1st January 2003) and those of healthy volunteers, forming three groups: Group 1, allergic asthmatics with immunotherapy less than 24 months; Group 2, allergic asthmatics with more than 24 months of immunotherapy, and Group 3, healthy volunteers (control group). Previous informed consent, a serum sample was taken of all subjects. Ninety-two subjects were included: 41 (45%) allergic asthmatics and 51 (55%) healthy volunteers. Significant differences were found in interleukins 2, 4, 5, 6 and 12 levels between healthy volunteers and asthmatics without relating the immunotherapy time. In the total group gamma interferon levels were not found. A relation of interleukins Th2 levels with the severity degree of asthma was not found. Differences of serum interleukins Th1 and Th2 in allergic patients related to immunotherapy time were not significant; even though, irrespective of immunotherapy time, IgG levels were always high. Patients with allergic asthma have a predominance of serum interleukins Th2 and, despite of the immunotherapy, in the maintaining phase, these continue high, which may be due to an immune system dysregulation maybe including other factors. Immunotherapy continues
Effect of interferon-gamma on complement gene expression in different cell types.
Lappin, D F; Guc, D; Hill, A; McShane, T; Whaley, K
1992-01-15
We have studied the expression of the complement components C2, C3, factor B, C1 inhibitor (C1-inh), C4-binding protein (C4-bp) and factor H in human peripheral blood monocytes, skin fibroblasts, umbilical vein endothelial cells (HUVEC) and the human hepatoma cell line G2 (Hep G2) in the absence and the presence of interferon-gamma (IFN-gamma). E.l.i.s.a. performed on culture fluids, run-on transcription assays, Northern blot and double-dilution dot-blot techniques confirmed that monocytes expressed all six components, whereas fibroblasts, HUVEC and HepG2 each expressed five of the six components. Fibroblasts and HUVEC did not synthesize C4-bp, and Hep G2 did not produce factor H. In addition to these differences, the synthesis rates of C3, C1-inh and factor H were not the same in all cell types. However, the synthesis rates of C2 and factor B were similar in all four cell types. The half-lives of the mRNAs were shorter in monocytes than in other cell types. Monocyte factor H mRNA had a half-life of 12 min in monocytes, compared with over 3 h in fibroblasts and HUVEC. The instability of factor H mRNA in monocytes may contribute to their low factor H secretion rate. IFN-gamma produced dose-dependent stimulation of C2, factor B, C1-inh, C4-bp and factor H synthesis by all cell types expressing these proteins, but decreased C3 synthesis in all four cell types. Cell-specific differences in the response to IFN-gamma were observed. The increased rates of transcription of the C1-inh and factor H genes in HUVEC were greater than in other cell types, while the increased rate of transcription of the C2, factor B and C1-inh genes in Hep G2 cells was less than in other cell types. IFN-gamma did not affect the stability of C3, factor H or C4 bp mRNAs, but increased the stability of factor B and C1-inh mRNAs and decreased the stability of C2 mRNA. Although these changes occurred in all four cell types studied, the half-life of C1-inh mRNA in monocytes was increased almost 4-fold
Haustein, Thomas; Ridout, Deborah A; Hartley, John C; Thaker, Urvashi; Shingadia, Delane; Klein, Nigel J; Novelli, Vas; Dixon, Garth L J
2009-08-01
Interferon-gamma release assays for the diagnosis of infection with Mycobacterium tuberculosis have been increasingly used in recent years and are endorsed by national guidelines, but experience regarding their use in children is still limited. We retrospectively evaluated the routine use of the QuantiFERON-TB Gold In-Tube assay (QFT-IT) in a pediatric tertiary care center with a high prevalence of immunocompromising conditions. The relationship between age, immune status, and likelihood of an indeterminate test result was analyzed using logistic regression analysis and fractional polynomials. Two hundred thirty-seven tests from 237 children were included in the analysis. Fifty-nine children (25%) were immunocompromised by our definition. An indeterminate test result was obtained in 83 children (35%). The likelihood of an indeterminate test result was inversely correlated with age (P < 0.001) for children who were not known to be immunocompromised, and decreased by 13% per year of age. Impaired immunity (P < 0.001) was independently associated with a higher probability of an indeterminate QFT-IT. Among 161 children with a documented tuberculin skin test, 89% had a concordant QFT-IT (kappa = 0.71). Twelve of 16 patients with culture-proven TB had a positive QFT-IT. These data suggest that QFT-IT may not provide a determinate test result in a substantial proportion of children in a tertiary care setting due to the combination of young age and primary and acquired immune deficiencies.
López-Alvarez, María R; Martínez-Sánchez, María V; Salgado-Cecilia, María G; Campillo, José A; Heine-Suñer, Damian; Villar-Permuy, Florentina; Fuster, José L; Bas, Agueda; Gil-Herrera, Juana; Muro, Manuel; García-Alonso, Ana M; Alvarez-López, María R; Minguela, Alfredo
2009-01-01
We report the first case of hemophagocytic lymphohistiocytosis (HLH) induced by the monoclonal expansion of Epstein-Barr virus (EBV)-negative NK cells. Consanguinity of the patient's parents made it necessary to discard familial HLH in the patient and her sister with identical HLA markers and demonstrate that no cause other than the expansion of NK cells, which secrete high levels of gamma interferon, was inducing HLH in this patient.
2012-01-01
Background Patients with end-stage renal disease (ESRD) and Mycobacterium tuberculosis infection pose a high risk of developing active TB disease. It is therefore important to detect latent TB infection (LTBI) to be able to offer treatment and prevent progression to TB disease. We assessed the value of the tuberculin skin test (TST) and of an interferon-gamma release assay (Quantiferon®-TB Gold in-Tube, QFT) for diagnosing LTBI in ESRD patients, after prolonged exposure to a highly contagious TB case in a haemodialysis unit. As a high number of patients presented erythema without induration in the TST response, this type of reaction was also analysed. Method The TST and QFT were simultaneously performed twelve weeks after the last possible exposure to a bacilliferous TB patient. If the first TST (TST-1) was negative, a second TST (TST-2) was performed 15 days later to detect a booster response. A comparison was made between the TST responses (including those cases with erythema without induration) and those for the QFT. The correlation with risk of infection and the concordance between tests were both analysed. Results A total of 52 patients fulfilled the inclusion criteria. Overall, 11 patients (21.2%) had a positive TST response: 3 for TST-1 and 8 for TST-2, and 18 patients (34.6%) showed a positive QFT response (p = 0.065). Erythema without induration was found in 3 patients at TST-1 and in a further 9 patients at TST-2. The three patients with erythema without induration in TST-1 had a positive TST-2 response. Concordance between TST and QFT was weak for TST-1 (κ = 0.21); it was moderate for overall TST (κ = 0.49); and it was strong if both induration and erythema (κ = 0.67) were considered. Conclusions In patients with ESRD, erythema without induration in the TST response could potentially be an indicator of M. tuberculosis infection. The QFT shows better accuracy for LTBI diagnosis than the TST. PMID:22905901
Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao
2003-10-31
Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung
2008-09-12
Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less
Werner-Felmayer, G; Baier-Bitterlich, G; Fuchs, D; Hausen, A; Murr, C; Reibnegger, G; Werner, E R; Wachter, H
1995-01-01
In a number of mammalian cell types, pteridine biosynthesis from guanosine 5'-triphosphate and formation of nitric oxide from L-arginine are induced by gamma interferon (IFN-gamma) and bacterial lipopolysaccharide (LPS). We assessed the possibility of using such metabolic alterations for the in vitro detection of pyrogens. Products from gram-negative and gram-positive bacteria and related synthetic compounds were tested for their potential to induce either of these pathways. Stimulation of pteridine biosynthesis was monitored as the formation of neopterin in the human myelomonocytic cell line THP-1. The formation of nitric oxide was determined as nitrite in murine J774A.1 macrophage cultures. The substances tested included toxic and detoxified parts of LPS and lipid A from Escherichia coli, Salmonella typhimurium, Salmonella minnesota, and Klebsiella pneumoniae as well as lipoteichoic acid and toxic shock syndrome toxin 1 from Staphylococcus aureus. Furthermore, two cell wall compounds from Mycobacterium tuberculosis, trehalose 6,6'-dimycolate and N-acetylmuramyl-L-alanyl-D-isoglutamine, which are active components of Freund's adjuvant, were used. When applied as a single stimulus, only the whole LPS molecule potently stimulated neopterin or nitrite formation. Lipid A and products from gram-positive bacteria were weakly active. For neopterin formation, lipid A required the presence of fetal calf serum. Besides detoxified LPS and independently from the presence of serum, all bacterial compounds tested strongly increased the effects mediated by IFN-gamma. Our results show that bacterial pyrogens can be detected by monitoring the formation of neopterin or nitrite. This may provide a basis for the development of an in vitro assay for the detection of pyrogenic contamination with the aim of replacing the currently used animal test. PMID:7664177
Interferon-gamma: biologic functions and HCV therapy (type I/II) (1 of 2 parts).
Gattoni, A; Parlato, A; Vangieri, B; Bresciani, M; Derna, R
2006-01-01
This review is aimed at exhaustively presenting and discussing the interferon-gamma (IFN-gamma), a cytokine that plays an important role in inducing and modulating an array of immune responses. A review of the most significant and recent clinical trials was performed. Although IFN-gamma has some antiviral activity, it is much less active in this regard than type I IFNs. IFN-gamma is involved in the regulation of nearly all phases of the immune and inflammatory responses, including the activation and differentiation of T cells, B cells, NK cells, macrophages, and others. It is therefore best regarded as a distint immunoregulatory cytokine. IFN-gamma secretion is a hallmark of Th1 lymphocytes. It is also secreted by nearly all CD8 T cells, by some Th0 cells, and by NK cells. Each of these cell types secretes IFN-gamma only when activated, usually as part of immune response and especially in response to IL-2 and IL-12. IFN-gamma production is inhibited by IL-4, IL-10, TGFbeta, glucocorticoids, cyclosporin A and FK506. Nearly all cell types express the heterodimeric receptor for IFN-beta and respond to this cytokine by increasing the surface expression of class I MHC proteins. As a result, virtually any cell in the vicinity of an IFN-beta-secreting cell becomes more efficient at presenting endogenous antigens and hence a better target for cytotoxic killing if it harbors an intracellular pathogen. Unlike the type I IFNs, IFN-gamma also increases the expression of class II MHC proteins on professional APCs, and so promotes antigen presentation to helper T cells as well. It also induces de novo expression of class II MHC proteins on venular endothelial cells and on some other epithelial and connective tissue cells that do not otherwise express them, thus enabling these cell types to function as temporary APCs at sites of intense immune reactions. The effector functions of NK cells are to lyse virus-infected cells and to secrete IFN-gamma, which activates macrofages to
[Interleukin 8 and interferon gamma in ocular toxoplasmosis].
Czepiel, Jacek; Biesiada, Grazyna; Sobczyk-Krupiarz, Iwona; Miklasszewska, Grazyna; Fedak, Danuta; Solnica, Bogdan; Mach, Tomasz; Garlicki, Aleksander
2011-01-01
Toxoplasmosis is one of the most common parasitic infections in the world, it is caused by Toxoplasma gondii. The infection is typically asymptomatic or the symptoms are very mild. Approximately 10% patients have limphadenopathy, involvement of the others organs, like eyes, nervous system, liver, heart, are observed more rarely. The aim of our study was to assess the level of selected cytokines in blood among patients with ocular toxoplasmosis. We have enrolled in the study 30 patients, 19-42 years old, treated for ocular toxoplasmosis, and 20 healthy volunteers, 20-48 years old, to the control group. Tests for blood morphology, C-reactive protein, the level of IL-8 and IFN-gamma were performed in all patients. The blood parameters in toxoplasmosis group were performed before antiparasitic treatment was given. The level of IFN-gamma in blood was lower among patients with ocular toxoplasmosis comparing with control group (1.52 vs. 4.18 pg/ml; p = 0.002). The level of IL-8 in blood was lower among patients with ocular toxoplasmosis comparing with control group (22.96 vs. 94.3 pg/ml; p = 0,007). There were no correlations between analyzed cytokines and blood morphology or CRP. The low level of IFN-gamma and IL-8 in blood is important factor leading to reactivation of the ocular toxoplasmosis.
Calès, P; Zarski, J P; Chapplain, J Marc; Bertrais, S; Sturm, N; Michelet, C; Babany, G; Chaigneau, J; Eddine Charaf, M
2012-02-01
We evaluated whether quantitative measurements of liver fibrosis with recently developed diagnostics outperform histological staging in detecting natural or interferon-induced changes. We compared Metavir staging, morphometry (area and fractal dimension) and six blood tests in 157 patients with chronic hepatitis C from two trials testing maintenance interferon for 96 weeks. Paired liver biopsies and blood tests were available for 101 patients, and there was a significant improvement in Metavir activity and a significant increase in blood tests reflecting fibrosis quantity in patients treated with interferon when compared with controls - all per cent changes in histological fibrosis measures were significantly increased in F1 vs F2-4 stages only in the interferon group. For the whole population studied between weeks 0 and 96, there was significant progression only in the area of fibrosis (AOF) (P = 0.026), FibroMeter (P = 0.020) and CirrhoMeter (P = 0.003). With regards to dynamic reproducibility, agreement was good (r(ic) ≥ 0.72) only for Metavir fibrosis score, FibroMeter and CirrhoMeter. The per cent change in AOF was significantly higher than that of fractal dimension (P = 0.003) or Metavir fibrosis score (P = 0.015). CirrhoMeter was the only blood test with a change significantly higher than that of AOF (P = 0.039). AOF and two blood tests, reflecting fibrosis quantity, have high sensitivity and/or reproducibility permitting the detection of a small progression in liver fibrosis over two years. A blood test reflecting fibrosis quantity is more sensitive and reproducible than morphometry. The study also shows that maintenance interferon does not improve fibrosis, whatever its stage. © 2011 Blackwell Publishing Ltd.
Seo, Kwang Won; Ahn, Jong-Joon; Ra, Seung Won; Kwon, Woon-Jung; Jegal, Yangjin
2014-06-01
The interferon gamma (IFN-γ) release assays (IGRAs) are the best method of detecting Mycobacterium tuberculosis infection. However, reports on IGRAs results obtained during and right after the treatment of tuberculosis (TB) have presented differing results. Some studies have shown declining responses, whereas other reports described persistent, fluctuating, or increasing responses. We postulated that the IGRA-positivity will decrease or revert long time after treatment of TB, and thus, evaluated the response of IGRA in subjects with a history of pulmonary TB. Seventy subjects (M:F = 51:19; age = 53.2 ± 11.8 years) underwent tuberculin skin tests (TSTs) and IGRA. The interval of time elapsed after the completion of anti-TB treatment was < 10 years for 16 subjects, 10-20 years for 13 subjects, 20-30 years for 16 subjects, and ≥ 30 years for 25 subjects. The TST was positive in 49 subjects (74%) and negative in 17 subjects (26%). The IGRA was positive in 52 subjects (74%) and negative in 18 subjects (26%). The IFN-γ level and the size of induration showed good correlation (r = 0.525, P < 0.001). However, the correlation between time elapsed after the completion of anti-TB treatment and the size of induration or that between time and the IFN-γ level was not significant. The TST and IGRA were positive in 72.7% and 68.0% of subjects ≥ 30 years after the treatment of pulmonary TB. In conclusion, majority of subjects with a history of pulmonary TB are IGRA-positive, even a few decades after the completion of anti-TB treatment.
Shin, K Y; Moon, H S; Park, H Y; Lee, T Y; Woo, Y N; Kim, H J; Lee, S J; Kong, G
2000-10-31
We have investigated the effects of tumor necrosis factor-alpha (TNF-alpha) and interferon (INF-gamma), the potent Bacillus Calmette-Guerin (BCG)-induced cytokines on the production of MMP-2, MMP-9, TIMP-1, TIMP-2 and MT1-MMP in high grade human bladder cancer cell lines, T-24, J-82 and HT-1376 cell lines. MMP-2 expression and activity were decreased in T-24 cells treated with both cytokines in a dose dependent manner. However, J-82 cells treated with TNF-alpha and INF-gamma revealed dose dependent increases of MMP-9 expression and activity with similar baseline expression and activity of MMP-2. HT-1376 cells after exposure to TNF-alpha only enhanced the expression and activity of MMP-9. These results indicate that TNF-alpha and INF-gamma could regulate the production of MMP-2 or MMP-9 on bladder cancer cells and their patterns of regulation are cell specific. Furthermore, this diverse response of bladder cancer cells to TNF-alpha and INF-gamma suggests that BCG immunotherapy may enhance the invasiveness of bladder cancer in certain conditions with induction of MMPs.
Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J
2018-05-01
To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Wirth, J. J.; Kierszenbaum, F.; Sonnenfeld, G.; Zlotnik, A.
1985-01-01
Results are reported from a study of the influence gamma interferon (GIFN) and interleukin 2 (IL2) have on the capability of P388D1 cells and mouse resident peritoneal macrophages (MPM) to attach to the blood-resident parasites Trypanosoma cruzi and kill them. Cultures of trypomastigote forms of the Tulahuen strain of T. cruzi grown in bovine serum were introduced into peritoneal cells of mice, along with P388D1 cells incubated with GIFN, IL2 and both. Control cells were also maintained. Statistical analysis were then performed on data on counts of the number of dead T. Cruzi cells. The GIFN enhanced the interaction of MPM and P388D1 cells with the surface of T. Cruzi, provided the interaction was given over 12 hr to take place. A depression of the cytotoxicity of P388D1 cells was attributed to mediation by H2O2, an effect partially offset by incubation with the lymphokine GIFN.
Interferon-gamma promoter hypomethylation and increased expression in chronic periodontitis
Zhang, Shaoping; Crivello, Antonino; Offenbacher, Steven; Moretti, Antonio; Paquette, David W.; Barros, Silvana P.
2011-01-01
Aim The goal of this investigation was to determine whether epigenetic modifications in the IFNG promoter are associated with an increase of IFNG transcription in different stages of periodontal diseases. Materials and Methods DNA was extracted from gingival biopsy samples collected from 47 total sites from 47 different subjects: 23 periodontally healthy sites, 12 experimentally induced gingivitis sites and 12 chronic periodontitis sites. Levels of DNA methylation within the IFNG promoter containing six CpG dinucleotides were determined using pyrosequencing technology. Interferon gamma mRNA expression was analysed by quantitative polymerase chain reactions using isolated RNA from part of the biological samples mentioned above. Results The methylation level of all six analysed CpG sites within the IFNG promoter region in the periodontitis biopsies {52% [interquartile range, IQR (43.8%, 63%)]} was significantly lower than periodontally healthy samples {62% [IQR (51.3%, 74%)], p =0.007} and gingivitis biopsies {63% [IQR (55%, 74%)], p =0.02}. The transcriptional level of IFNG in periodontitis biopsies was 1.96-fold and significantly higher than tissues with periodontal health (p =0.04). Although the mRNA level from experimental gingivitis samples exhibited an 8.5-fold increase as compared with periodontally healthy samples, no significant methylation difference was observed in experimental gingivitis sample. Conclusions A hypomethylation profile within IFNG promoter region is related to an increase of IFNG transcription present in the chronic periodontitis biopsies, while such an increase of IFNG in experimentally induced gingivitis seems independent of promoter methylation alteration. PMID:20958339
Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Se-Kyung; You, Su-Hwa; Kim, Taeseong; Tark, Dongseob; Lee, Hyang-Sim; Seo, Min-Goo; Kim, Byounghan
2015-01-01
ABSTRACT Because the currently available vaccines against foot-and-mouth disease (FMD) provide no protection until 4 to 7 days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is the application of antiviral agents. Combination treatment strategies have been used to enhance the efficacy of antiviral agents, and such strategies may be advantageous in overcoming viral mechanisms of resistance to antiviral treatments. We have developed recombinant adenoviruses (Ads) for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) targeting FMDV mRNAs encoding nonstructural proteins. The antiviral effects of Ad-porcine IFN-αγ and Ad-3siRNA expression were tested in combination in porcine cells, suckling mice, and swine. We observed enhanced antiviral effects in porcine cells and mice as well as robust protection against the highly pathogenic strain O/Andong/SKR/2010 and increased expression of cytokines in swine following combination treatment. In addition, we showed that combination treatment was effective against all serotypes of FMDV. Therefore, we suggest that the combined treatment with Ad-porcine IFN-αγ and Ad-3siRNA may offer fast-acting antiviral protection and be used with a vaccine during the period that the vaccine does not provide protection against FMD. IMPORTANCE The use of current foot-and-mouth disease (FMD) vaccines to induce rapid protection provides limited effectiveness because the protection does not become effective until a minimum of 4 days after vaccination. Therefore, during outbreaks antiviral agents remain the only available treatment to confer rapid protection and reduce the spread of foot-and-mouth disease virus (FMDV) in livestock until vaccine-induced protective immunity can become effective. Interferons (IFNs) and small interfering RNAs (siRNAs) have been reported to be effective antiviral agents against
Role of interferon in resistance and immunity to protozoa
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Degee, A. L. W.; Mansfield, J. M.; Newsome, A. L.; Arnold, R. R.
1985-01-01
Production of interferon (I) in response to protozoan infection, and the interferon-mediated inhibition of parasite replication were studied in order to determine if these effects may be related to immunologic-mediated resistance of the hosts. Two extracellular parasites-Trypanosoma brucei rhodesiense and Naegleria fowlei were used. Upon infection with the trypanosome, only resistant strains of mice produced I. An early peak of alpha/beta I is followed by appearance of gamma I, which coincided with antibody production and a drop in parasitemia. In case of the amoeba, pretreatment of its suspension with alpha/beta I inhibits its replication in vitro, and appears to protect mice from the infection and the disease. It is proposed that production of interferon, with its regulatory effect on the immune responses, may play a major role in regulating the processes of protozoan-caused diseases.
Inhibition of human mast cell growth and differentiation by interferon gamma-1b.
Kirshenbaum, A S; Worobec, A S; Davis, T A; Goff, J P; Semere, T; Metcalfe, D D
1998-03-01
In an effort to identify cytokines that inhibit human mast cell growth, we cultured HMC-1 cells and recombinant human stem cell factor (rhSCF)-dependent human bone marrow-derived mast cells (HBMCs) in the presence of interferon gamma (IFNgamma)-1b and interferon alpha (IFNalpha)-2b. HMC-1 cell numbers decreased in the presence of 1000 U/mL IFNgamma-1b but were unaffected by 1000 U/mL of IFNalpha-2b. HBMCs were then cultured for 0 to 7 days with 100 ng/mL rhSCF and 10 ng/mL recombinant human IL-3 (rhIL-3), followed by culture in rhSCF and administration of either 1000 U/mL IFNalpha-2b or 1000 U/mL IFNgamma-1b. HBMCs appearing in cultures with rhSCF alone or in combination with IFNalpha-2b were virtually identical in number through 8 weeks of culture. In cultures supplemented with IFNgamma-1b, HBMCs significantly decreased in number and incidence of granular metachromasia by 4 to 5 weeks (p<0.001). Similar results were obtained when human marrow was cultured from day 0 with rhSCF and IFNgamma-1b. Mature rhSCF-dependent HBMCs were also cultured at 5 weeks with rhSCF alone or in combination with IFNgamma-1b. Compared with cells cultured in rhSCF, mature 5-week HBMC cultures treated with rhSCF plus IFNgamma-1b revealed a decrease in mast cells, and those mast cells that remained had fewer toluidine blue- and tryptase-positive granules after 5 to 8 weeks. FACS analysis of rhSCF plus IFNgamma-1b-treated mature HBMCs revealed increased c-kit and Fc(epsilon)RI expression. Mast cell releasibility was not increased. IFNgamma-lb was thus able to suppress mast cell growth from CD34+ cells, suggesting that this agent should be considered as a candidate cytokine for the treatment of disorders of mast cell proliferation.
Gharesi-Fard, Behrouz; Zolghadri, Jaleh; Kamali-Sarvestani, Eskandar
2008-03-01
Considering the deleterious role of T helper1 (Th1) cells in pregnancy outcome, a successful treatment for recurrent spontaneous abortion (RSA) should be able to make a significant shift away from Th1 responses. Although paternal leukocyte immunization has been used for treatment of RSA for years, because of methodological differences there is no consensus on the mechanism of action and effectiveness of this method. Twenty-five Iranian non-pregnant women with RSA and 16 non-pregnant control women with at least two successful pregnancies were included in this study. All cases were followed up after leukocyte therapy for pregnancy outcome. Mononuclear cells from women were co-cultured with the husband's mononuclear cells before and after immunotherapy. The levels of tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) were checked on culture supernatant by enzyme-linked immunosorbent assay method. The mean concentration of TNF-alpha was significantly higher in patients compared with that in normal controls (P=0.0001). After immunotherapy, the TNF-alpha level was only significantly decreased in women with successful outcome (P=0.0001). Immunotherapy also induced a significant reduction in the IFN-gamma level (P=0.009). The results of this investigation confirm the role of TNF-alpha in RSA and propose the assessment of TNF-alpha production as a valuable prognostic parameter for the prediction of abortion after leukocyte therapy.
The elephant interferon gamma assay: a contribution to diagnosis of tuberculosis in elephants.
Angkawanish, T; Morar, D; van Kooten, P; Bontekoning, I; Schreuder, J; Maas, M; Wajjwalku, W; Sirimalaisuwan, A; Michel, A; Tijhaar, E; Rutten, V
2013-11-01
Mycobacterium tuberculosis (M. tb) has been shown to be the main causative agent of tuberculosis in elephants worldwide. M. tb may be transmitted from infected humans to other species including elephants and vice versa, in case of prolonged intensive contact. An accurate diagnostic approach covering all phases of the infection in elephants is required. As M. tb is an intracellular pathogen and cell-mediated immune (CMI) responses are elicited early after infection, the skin test is the CMI assay of choice in humans and cattle. However, this test is not applicable in elephants. The interferon gamma (IFN-γ) assay is considered a good alternative for the skin test in general, validated for use in cattle and humans. This study was aimed at development of an IFN-γ assay applicable for diagnosis of tuberculosis in elephants. Recombinant elephant IFN-γ (rEpIFN-γ) produced in eukaryotic cells was used to immunize mice and generate the monoclonal antibodies. Hybridomas were screened for IFN-γ-specific monoclonal antibody production and subcloned, and antibodies were isotyped and affinity purified. Western blot confirmed recognition of the rEpIFN-γ. The optimal combination of capture and detection antibodies selected was able to detect rEpIFN-γ in concentrations as low as 1 pg/ml. The assay was shown to be able to detect the native elephant IFN-γ, elicited in positive-control cultures (pokeweed mitogen (PWM), phorbol myristate acetate plus ionomycin (PMA/I)) of both Asian and African elephant whole-blood cultures (WBC). Preliminary data were generated using WBC from non-infected elephants, a M. tb infection-suspected elephant and a culture-confirmed M. tb-infected elephant. The latter showed measurable production of IFN-γ after stimulation with ESAT6/CFP10 PPDB and PPDA in concentration ranges as elicited in WBC by Mycobacterium tuberculosis complex (MTBC)-specific antigens in other species. Hence, the IFN-γ assay presented potential as a diagnostic tool for the
Titze-de-Almeida, Simoneide S; Lustosa, Cátia Faria; Horst, Camila Hillesheim; Bel, Elaine Del; Titze-de-Almeida, Ricardo
2014-12-01
This study examined whether the cytokine interferon (IFN) gamma plays a role in the injury of SH-SY5Y cells caused by MPP(+) (1-methyl-4-phenylpyridinium). First of all, IFN-gamma sensitized cells to the neurotoxin MPP(+), as determined by MTT (3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyltetrazolium bromide) assay. MPP(+)-injured cells showed higher reactive oxygen species (ROS) levels, which was reinforced by IFN-gamma. The injury triggered a marked expression of the neuronal NOS (nNOS) enzyme. L-NAME [N(ω)-nitro-L-arginine methyl ester, a non-specific NOS inhibitor] reestablished the cell viability after IFN-gamma challenging, and recovered cells from MPP(+) injury (95.0 vs. 84.7 %; P < 0.05). Seven-NI (7-nitroindazole, a nNOS inhibitor) protected cells against the injury by MPP(+) co-administered with IFN-gamma. Both inhibitors restrained the apoptosis of SH-SY5Y cells caused by MPP(+)/IFN-gamma. Regarding oxidative stress, L-NAME and 7-NI attenuated the increase in ROS levels caused by MPP(+) (45.3 or 48.4 vs. 87.9 %, P < 0.05). Indeed, L-NAME was more effective than 7-NI for reducing oxidative stress caused by MPP(+) under IFN-gamma exposition. The nNOS gene silencing by small-interfering RNAs recovered cells challenged by IFN-gamma (24 h), or MPP(+) (8 h). In conclusion, IFN-gamma sensitizes cells to MPP(+)-induced injury, also causing an increase in ROS levels. Pretreating cells with L-NAME or 7-NI reverts both the oxidative stress and apoptosis triggered by the neurotoxin MPP(+). Taking together, our data reinforce that IFN-gamma and NOS enzymes play a role in oxidative stress and dopaminergic cell death triggered by MPP(+).
Ruiz-Ruiz, Carmen; López-Rivas, Abelardo
2002-01-01
Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL/APO-2L) induces apoptosis in a variety of tumour cells upon binding to death receptors TRAIL-R1 and TRAIL-R2. Here we describe the sensitization by interferon (IFN)-gamma to TRAIL-induced apoptosis in the breast tumour cell lines MCF-7 and MDA-MB231. IFN-gamma promoted TRAIL-mediated activation of caspase-8, Bcl-2 interacting domain death agonist (Bid) degradation, Bcl-2-associated X protein (Bax) translocation to mitochondria, cytochrome c release to the cytosol and activation of caspase-9 in these cell lines. No changes in the expression of TRAIL receptors were observed upon IFN-gamma treatment. Overexpression of Bcl-2 in MCF-7 cells completely inhibited IFN-gamma-induced sensitization to TRAIL-mediated cell death. Interestingly, TRAIL-induced apoptosis was also clearly enhanced by IFN-gamma in caspase-3-overexpressing MCF-7 cells, in the absence of Bax translocation to mitochondria and cytochrome c release to the cytosol. In summary, our results suggest that IFN-gamma facilitates TRAIL-induced activation of mitochondria-regulated as well as mitochondria-independent apoptotic pathways in breast tumour cells. PMID:11936954
CMOS image sensor for detection of interferon gamma protein interaction as a point-of-care approach.
Marimuthu, Mohana; Kandasamy, Karthikeyan; Ahn, Chang Geun; Sung, Gun Yong; Kim, Min-Gon; Kim, Sanghyo
2011-09-01
Complementary metal oxide semiconductor (CMOS)-based image sensors have received increased attention owing to the possibility of incorporating them into portable diagnostic devices. The present research examined the efficiency and sensitivity of a CMOS image sensor for the detection of antigen-antibody interactions involving interferon gamma protein without the aid of expensive instruments. The highest detection sensitivity of about 1 fg/ml primary antibody was achieved simply by a transmission mechanism. When photons are prevented from hitting the sensor surface, a reduction in digital output occurs in which the number of photons hitting the sensor surface is approximately proportional to the digital number. Nanoscale variation in substrate thickness after protein binding can be detected with high sensitivity by the CMOS image sensor. Therefore, this technique can be easily applied to smartphones or any clinical diagnostic devices for the detection of several biological entities, with high impact on the development of point-of-care applications.
Rothel, James S; Andersen, Peter
2005-12-01
Tuberculosis is responsible for more then 2 million deaths worldwide each year and vies with HIV as the world's most fatal infectious disease. In many developing countries, attempts to control the spread of infection rely solely on identification and treatment of those with active disease, ignoring subclinical infection. However, in developed countries, large efforts are also expended to identify and give prophylactic drugs to people with latent tuberculosis infection. Until recently, the 100-year-old tuberculin skin test (Mantoux) has been the only available diagnostic test for latent tuberculosis infection, despite its many well-known limitations. Advances in scientific knowledge have led to the development of tests for tuberculosis that measure the production of interferon-gamma by T-cells stimulated in vitro with Mycobacterium tuberculosis-specific antigens. These interferon-gamma tests are highly specific and unaffected by prior Bacille Calmette-Guérin vaccination or immune reactivity to most atypical mycobacteria. They are more sensitive than the tuberculin skin test in detecting people with active tuberculosis, and their results correlate more closely with M. tuberculosis exposure risk factors than the tuberculin skin test in people likely to have latent tuberculosis infection. Science has caught up with one of the oldest diagnostic tests still in use worldwide, and the adoption of new, tuberculosis-specific interferon-gamma-based tests should move us one step closer to better control of this insidious pathogen.
Interferon-gamma and T-bet expression in a patient with toxoplasmic lymphadenopathy.
Jöhrens, Korinna; Moos, Verena; Schneider, Thomas; Stein, Harald; Anagnostopoulos, Ioannis
2010-04-01
Infection with Toxoplasma gondii (TG) presents in some individuals as a self-limited disease with a predominant lymphadenopathy characterized by prominent B-cell activation. As this is in contrast to the in vitro based concept of a T(h)1-immune response against TG, we investigated native lymphoid tissue and peripheral blood of a patient with serologic evidence of toxoplasmosis to verify which cells show T(h)1-response features. High-level expression of T-bet in monocytoid B-cells, in germinal center B-cells, and in a lesser amount in T cells could be demonstrated by immunohistochemistry. In vitro stimulation of lymph node cells with either TG, staphylococcus enterotoxin B, or phorbol 12-myristate 13-acetate/ionomycin revealed an interferon-gamma expression in T-bet(+) B cells only in the patient and not in controls. Similar results were found for T-bet(+) T cells which were also present in controls. CD4(+) peripheral blood cells stimulated with TG antigens showed a TG-specific but attenuated T(h)1-reactivity in the patient associated with a reduced expression of IL-2 when compared with controls. We conclude that the pathogenesis and course of toxoplasmic lymphadenopathy is based on a T(h)1-cell defect, which becomes compensated by the B cells mounting a T(h)1-like immune response.
Kim, K H; Oh, E-J; Jung, E-S; Park, Y-J; Choi, J Y; Kim, D-G; Lee, K Y; Kang, C S
2006-06-01
The aim of the present study was to identify whether the serum interferon-gamma (IFNgamma), a Th1 cytokine, or soluble CD30 (sCD30), a marker for activation of Th2 cytokine-producing T cells, predict acute cellular rejection episodes among liver graft patients. Pretransplant and posttransplant sera from 32 living donor liver transplant recipients obtained on days 1, 3, and 7 after surgery were tested for serum IFNgamma and sCD30 concentrations using commercial enzyme-linked immunosorbent assay kits. Recipients with an acute rejection episode (ARE) (n=14) displayed significantly higher IFNgamma concentrations pretransplant than did the patients with no ARE (n=18) (P<.05). The pretransplant serum levels of sCD30 were not different between the non-ARE and ARE groups. However, in comparison with the non-ARE group, who showed steadily decreasing serum sCD30 levels after transplantation, 12 among the 14 patients in the ARE group showed increasing sCD30 levels from day 1 to day 3 after transplantation (P<.05). These results suggest that the sCD30 increment during the early period after liver transplantation affects the immune response of rejection. This observation emphasizes the clinical relevance of serum sCD30, in addition to serum IFNgamma, as predictive markers for acute liver graft rejection.
Komohara, Yoshihiro; Takemura, Kenichi; Lei, Xiao Feng; Sakashita, Naomi; Harada, Mamoru; Suzuki, Hiroshi; Kodama, Tatsuhiko; Takeya, Motohiro
2009-11-01
Class A scavenger receptors (SR-A, CD204) are highly expressed in tumor-associated macrophages (TAM). To investigate the function of SR-A in TAM, wild-type and SR-A-deficient (SR-A(-/-)) mice were injected with EL4 cells. Although these groups of mice did not differ in the numbers of infiltrating macrophages and lymphocytes and in neovascularization, SR-A(-/-) mice had delayed growth of EL4 tumors. Expression of inducible nitric oxide (NO) synthase and interferon (IFN)-gamma mRNA increased significantly in tumor tissues from SR-A(-/-) mice. Engulfment of necrotic EL4 cells induced upregulation of NO and IFN-gamma production by cultured macrophages, and production of NO and IFN-gamma increased in SR-A(-/-) macrophages in vitro. IFN-beta production by cultured macrophages was also elevated in SR-A(-/-) macrophages in vitro. These results suggested that the antitumor activity of macrophages increased in SR-A(-/-) mice because of upregulation of NO and IFN-gamma production. These data indicate an important role of SR-A in regulating TAM function by inhibiting toll-like receptor (TLR)4-IFN-beta signaling.
Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo
2017-01-01
Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.
Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio
2003-01-01
The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960
Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A
2009-01-01
The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.
Hunsicker, A; Kullich, W; Weissenhofer, W; Lorenz, D; Petermann, J; Rokos, H; Schwesinger, G
1997-05-01
To establish a standardised reproducible animal model of intraperitoneal sepsis, and to investigate early immunoserological responses to find a mediator-based system for evaluation and grading of diffuse peritonitis in patients Prospective experimental study 4 Teaching hospitals, Germany and Austria 42 LEW. 1W rats, 12 of which acted as controls Gram negative sepsis was induced by intraperitoneal injection of 6 ml of a mixture of Escherichia coli (K1:H+) 10(10) organisms/ml, autogenous haemoglobin 2.9 ml (haemoglobin concentration 3%), 0.9% sodium chloride 3 ml, and suspension 0.1 ml. Control rats were given physiological saline 6 ml alone. Concentrations of endotoxin, interferon gamma (IFN-gamma), and biopterin, and serum phospholipase A2 (PLA2) activity. There were significant differences between the septic and control rats in concentrations of endotoxin (EU/ml) (median (interquartile range) 21.85 (2.02-159.5) compared with 0, p < 0.0001; IFN-gamma (pg/ml) 1263.0 (271.0-7575.0) compared with 101.0 (89.0-141.0), p < 0.0001; biopterin (nmol/L) 111.0 (66.4-156.3) compared with 53.7 (38.3-67.6), p < 0.001; and PLA2 (U/L) 163.0 (125.8-209.0) compared with 112.5 (88.5-126.5) p < 0.01. Measurements of concentrations of endotoxin, IFN-gamma, pteridines, and PLA2 activity may well be adequate markers for early recognition of sepsis, and perhaps for grading it during the first 6 hours after induction. The allow a clear distinction to be made between septic and non-septic disorders in 87% of cases.
Interferon effects on protozoan infections
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Wirth, J.; Kierszenbaum, F.; Degee, A. L. W.; Mansfield, J. M.
1985-01-01
The effects of interferon (IFN) on mice infected with two different parasitic protozoans, Trypanosoma cruzi and Trypanosoma brucei rhodesiense, are investigated experimentally. The preparation of the cell cultures, IFN and assays, antibody, and the experimental procedures are described. It is observed that in cells treated with IFN-gamma there is an increased association of T. cruzi with murine macrophages and an increase in the killing of T. cruzi by IFN-gamma-treated murine macrophages. For spleen cells infected with T.b. rhodesiense in vitro, it is detected that live trypanosomes cannot induce IFN in cells from normal mice, but can in cells from immunized mice; and that trypanosome-lysates induce IFN in vitro in cells from normal mice. The data suggest that there is a two-step mechanism for mice against T. cruzi and T.b. rhodesiense.
Sareneva, T; Mørtz, E; Tölö, H; Roepstorff, P; Julkunen, I
1996-12-01
Interferon-gamma (IFN-gamma) is a secretory glycoprotein produced by T cells in response to antigenic or mitogenic stimuli. We studied the kinetics of the synthesis, N-glycosylation, and secretion of IFN-gamma in human CD8+ T lymphocytes stimulated via T-cell receptor. Highly elevated IFN-gamma mRNA levels were found as early as 1 h after stimulation. Maximal IFN-gamma protein synthesis was observed 2-4 h after induction and appeared to correlate to steady-state IFN-gamma mRNA levels. As analyzed by pulse/chase experiments, the secretion of IFN-gamma from T cells was very rapid, the secretion half-time being approximately 20-25 min. Inhibition of N-glycosylation by tunicamycin dramatically reduced the expression of IFN-gamma, but did not block its secretion. Natural IFN-gamma is heterogeneously glycosylated and doubly, singly, and unglycosylated forms exist. Experiments performed in a cell-free translation/glycosylation system with mutated IFN-gamma constructs lacking either one of the potential glycosylation sites suggested that Asn25 is more efficiently glycosylated than Asn97. Site-specific oligosaccharide analysis of natural IFN-gamma by glycosidase treatment followed by matrix-assisted-laser-desorption-ionization mass spectrometry revealed considerable variation in the carbohydrate structures, with more than 30 different forms. The glycans at Asn25 consisted of fucosylated, mainly complex-type oligosaccharides, whereas the glycans at Asn97 were more heterogeneous, with hybrid and high-mannose structures. Our results emphasize the essential role of N-linked glycans in the biology of IFN-gamma and show that there is a considerable heterogeneity in the individual sugar chains of this important human cytokine.
Asea, A; Hansson, M; Czerkinsky, C; Houze, T; Hermodsson, S; Strannegård, O; Hellstrand, K
1996-08-01
Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-gamma by CD3-/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-gamma production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-gamma production was operating on a pretranslational level, as indicated by the inability of enriched NK cells to accumulate IFN-gamma mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-gamma production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-gamma production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-gamma in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-gamma mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-gamma production by preventing monocyte-induced oxidative damage to NK cells.
Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L
1997-01-01
Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728
Designing of interferon-gamma inducing MHC class-II binders
2013-01-01
Background The generation of interferon-gamma (IFN-γ) by MHC class II activated CD4+ T helper cells play a substantial contribution in the control of infections such as caused by Mycobacterium tuberculosis. In the past, numerous methods have been developed for predicting MHC class II binders that can activate T-helper cells. Best of author’s knowledge, no method has been developed so far that can predict the type of cytokine will be secreted by these MHC Class II binders or T-helper epitopes. In this study, an attempt has been made to predict the IFN-γ inducing peptides. The main dataset used in this study contains 3705 IFN-γ inducing and 6728 non-IFN-γ inducing MHC class II binders. Another dataset called IFNgOnly contains 4483 IFN-γ inducing epitopes and 2160 epitopes that induce other cytokine except IFN-γ. In addition we have alternate dataset that contains IFN-γ inducing and equal number of random peptides. Results It was observed that the peptide length, positional conservation of residues and amino acid composition affects IFN-γ inducing capabilities of these peptides. We identified the motifs in IFN-γ inducing binders/peptides using MERCI software. Our analysis indicates that IFN-γ inducing and non-inducing peptides can be discriminated using above features. We developed models for predicting IFN-γ inducing peptides using various approaches like machine learning technique, motifs-based search, and hybrid approach. Our best model based on the hybrid approach achieved maximum prediction accuracy of 82.10% with MCC of 0.62 on main dataset. We also developed hybrid model on IFNgOnly dataset and achieved maximum accuracy of 81.39% with 0.57 MCC. Conclusion Based on this study, we have developed a webserver for predicting i) IFN-γ inducing peptides, ii) virtual screening of peptide libraries and iii) identification of IFN-γ inducing regions in antigen (http://crdd.osdd.net/raghava/ifnepitope/). Reviewers This article was reviewed by Prof Kurt
Solis, B; Nova, E; Gómez, S; Samartín, S; Mouane, N; Lemtouni, A; Belaoui, H; Marcos, A
2002-12-01
For several years cytokine production has been associated with infections but it was not suspected that some types of food could also induce cytokines, even in a state of non-infection. Lactic bacteria can induce interferon (IFN) production in human healthy subjects, thus, a better protection against infections would be expected. Therefore, we planned to evaluate the effect of two diets including yoghurt or milk on IFN-gamma production during nutritional recovery in two different situations of malnutrition: (1) children with diarrhoea; and (2) patients with anorexia nervosa (AN). Both the diet including yoghurt of that including milk seemed to increase IFN-gamma production at the end of nutritional recovery in the malnourished children with diarrhoea. The significance of interferon production and the lymphocyte subset increase should be explored to know if a better resistance against pathogens is related to them. Regulation of intestinal absorption and moderate stimulation of interferon production make the yoghurt-based diet a good choice in the nutritional care of children. In the same way, an increase in the IFN-gamma production was observed in AN patients consuming yoghurt. This increase of IFN-gamma production could be considered a biological marker to detect the effect of probiotics on the immune response, especially in the improvement of a deficient nutritional status.
Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.
Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y
2017-10-01
Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.
Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret
2015-05-01
Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h, and 6 day exposures to TBT (200 - 2.5 nM) and DBT (5 - 0.05 µM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from immune cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. © 2013 Wiley Periodicals, Inc.
Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun
2012-06-29
The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.
Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A
2008-06-01
Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).
Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q
1995-01-01
Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147
Walker, D H; Popov, V L; Feng, H M
2000-09-01
A mouse model of typhus rickettsiosis that reproduces the hematogenous dissemination to the critical target organs, including brain, lungs, heart, and kidneys, primary endothelial and, to a lesser degree, macrophage intracellular rickettsial infection, and typical vascular-based lesions of louse-borne typhus and murine typhus was established. Intravenous inoculation of C3H/HeN mice with Rickettsia typhi caused disease with a duration of the incubation period and mortality rate that were dependent on the infective dose of rickettsiae. Lethal infection was associated with high concentrations of R. typhi in the lungs and brain, despite a brisker humoral immune response to the rickettsiae than in the sublethal infection. Gamma interferon and CD8 T lymphocytes were demonstrated to be crucial to clearance of the rickettsiae and recovery from infection in experiments in which specific monoclonal antibodies were administered to deplete these components. Death of animals depleted of gamma interferon or CD8 T lymphocytes was associated with overwhelming rickettsial infection demonstrated by titers of infectious rickettsiae and by immunohistochemistry. An effective antirickettsial immune response was associated with elevated serum concentrations of IL-12 on Day 5 and increased secretion of IL-12 by concanavalin-A-stimulated spleen cells on Day 5. Evidence for transient suppression of the immune response consisted of marked reduction in the secretion of IL-2 and IL-12 by concanavalin-A-stimulated spleen cells on Days 10 and 15. This model offers excellent opportunities for study of attenuation and pathogenetic mechanisms of typhus rickettsiae, which are established biologic weapons of potential use in bioterrorism.
Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma.
Magee, Kelsey E; Kelsey, Christina E; Kurzinski, Katherine L; Ho, Jonhan; Mlakar, Logan R; Feghali-Bostwick, Carol A; Torok, Kathryn S
2013-01-01
The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS.
Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma
2013-01-01
Introduction The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. Methods The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). Results IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Conclusions Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS. PMID:24499523
NASA Technical Reports Server (NTRS)
Mazumder, B.; Fox, P. L.
1999-01-01
Ceruloplasmin (Cp) is an acute-phase protein with ferroxidase, amine oxidase, and pro- and antioxidant activities. The primary site of Cp synthesis in human adults is the liver, but it is also synthesized by cells of monocytic origin. We have shown that gamma interferon (IFN-gamma) induces the synthesis of Cp mRNA and protein in monocytic cells. We now report that the induced synthesis of Cp is terminated by a mechanism involving transcript-specific translational repression. Cp protein synthesis in U937 cells ceased after 16 h even in the presence of abundant Cp mRNA. RNA isolated from cells treated with IFN-gamma for 24 h exhibited a high in vitro translation rate, suggesting that the transcript was not defective. Ribosomal association of Cp mRNA was examined by sucrose centrifugation. When Cp synthesis was high, i.e., after 8 h of IFN-gamma treatment, Cp mRNA was primarily associated with polyribosomes. However, after 24 h, when Cp synthesis was low, Cp mRNA was primarily in the nonpolyribosomal fraction. Cytosolic extracts from cells treated with IFN-gamma for 24 h, but not for 8 h, contained a factor which blocked in vitro Cp translation. Inhibitor expression was cell type specific and present in extracts of human cells of myeloid origin, but not in several nonmyeloid cells. The inhibitory factor bound to the 3' untranslated region (3'-UTR) of Cp mRNA, as shown by restoration of in vitro translation by synthetic 3'-UTR added as a "decoy" and detection of a binding complex by RNA gel shift analysis. Deletion mapping of the Cp 3'-UTR indicated an internal 100-nucleotide region of the Cp 3'-UTR that was required for complex formation as well as for silencing of translation. Although transcript-specific translational control is common during development and differentiation and global translational control occurs during responses to cytokines and stress, to our knowledge, this is the first report of translational silencing of a specific transcript following cytokine
Tálas, M; Bátkai, L; Stöger, I; Nagy, K; Hiros, L; Konstantinova, I; Kozharinov, V
1983-01-01
The influence of spaceflight conditions on the biological activity of HuIFN-alpha preparations (lyophilized, in solution and in ointment) and interferon inducers was studied. In antiviral activity no difference was observed between the samples kept aboard the spaceship and the controls kept under ground conditions. The interferon inducers poly I:C, poly G:C and gossipol placed in the space laboratory for 7 days maintained their interferon-inducing capacity. The circulating interferon level in mice was the same irrespective of the induction being performed with flight or ground-control samples of inducers.
Effects of Chicken Interferon Gamma on Newcastle Disease Virus Vaccine Immunogenicity
Cardenas-Garcia, Stivalis; Dunwoody, Robert P.; Marcano, Valerie; Diel, Diego G.; Williams, Robert J.; Gogal, Robert M.; Brown, Corrie C.; Miller, Patti J.; Afonso, Claudio L.
2016-01-01
More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFNγ) during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFNγ with Newcastle disease virus (NDV) antigens were evaluated for their ability to enhance the avian immune response and their protective capacity upon challenge with virulent NDV. These systems consisted of: 1) a DNA vaccine expressing the Newcastle disease virus fusion (F) protein co-administered with a vector expressing the chIFNγ gene for in ovo and booster vaccination, 2) a recombinant Newcastle disease virus expressing the chIFNγ gene (rZJ1*L/IFNγ) used as a live vaccine delivered in ovo and into juvenile chickens, and 3) the same rZJ1*L/IFNγ virus used as an inactivated vaccine for juvenile chickens. Co-administration of chIFNγ with a DNA vaccine expressing the F protein resulted in higher levels of morbidity and mortality, and higher amounts of virulent virus shed after challenge when compared to the group that did not receive chIFNγ. The live vaccine system co-delivering chIFNγ did not enhanced post-vaccination antibody response, nor improved survival after hatch, when administered in ovo, and did not affect survival after challenge when administered to juvenile chickens. The low dose of the inactivated vaccine co-delivering active chIFNγ induced lower antibody titers than the groups that did not receive the cytokine. The high dose of this vaccine did not increase the antibody titers or antigen-specific memory response, and did not reduce the amount of challenge virus shed or mortality after challenge. In summary, regardless of the delivery system, chIFNγ, when administered simultaneously with the vaccine antigen, did not enhance Newcastle disease virus vaccine immunogenicity. PMID:27409587
T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.
Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong
2017-05-12
Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.
Oxlade, Olivia; Pinto, Marcia; Trajman, Anete; Menzies, Dick
2013-01-01
Introduction Cost effectiveness analyses (CEA) can provide useful information on how to invest limited funds, however they are less useful if different analysis of the same intervention provide unclear or contradictory results. The objective of our study was to conduct a systematic review of methodologic aspects of CEA that evaluate Interferon Gamma Release Assays (IGRA) for the detection of Latent Tuberculosis Infection (LTBI), in order to understand how differences affect study results. Methods A systematic review of studies was conducted with particular focus on study quality and the variability in inputs used in models used to assess cost-effectiveness. A common decision analysis model of the IGRA versus Tuberculin Skin Test (TST) screening strategy was developed and used to quantify the impact on predicted results of observed differences of model inputs taken from the studies identified. Results Thirteen studies were ultimately included in the review. Several specific methodologic issues were identified across studies, including how study inputs were selected, inconsistencies in the costing approach, the utility of the QALY (Quality Adjusted Life Year) as the effectiveness outcome, and how authors choose to present and interpret study results. When the IGRA versus TST test strategies were compared using our common decision analysis model predicted effectiveness largely overlapped. Implications Many methodologic issues that contribute to inconsistent results and reduced study quality were identified in studies that assessed the cost-effectiveness of the IGRA test. More specific and relevant guidelines are needed in order to help authors standardize modelling approaches, inputs, assumptions and how results are presented and interpreted. PMID:23505412
Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor
Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian
2014-01-01
Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970
Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael
2014-01-01
Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.
Protective Role of Gamma Interferon during the Recall Response to Influenza Virus
Bot, Adrian; Bot, Simona; Bona, Constantin A.
1998-01-01
During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110
Tanabe, Y; Dan, K; Kuriya, S; Nomura, T
1989-10-01
The effects of recombinant human interferon (IFN) alpha-2b and gamma on the bone marrow megakaryocyte progenitors (CFU-Meg) were compared between eight patients in the chronic phase of Ph1-positive chronic myelocytic leukemia (CML) and five hematologically normal patients. CFU-Meg was assayed in plasma clot culture added with phytohemagglutinin-stimulated leukocyte-conditioned medium as a source of colony stimulating activity. The average count of CFU-Meg colonies formed from the bone marrow of CML patients was 5.5 times that of normal controls. Spontaneous CFU-Meg colonies were grown in seven of eight CML patients, but in none of five controls. Colony formation by CFU-Meg in CML as well as normal bone marrow was suppressed by the two preparations of IFN in a dose dependent fashion. Their suppressive influence on colonies from CFU-Meg was comparable between CML and normal bone marrow at lower concentrations, but was less marked for CML than normal bone marrow at higher concentrations. The formation of CFU-Meg colonies from CML bone marrow was more severely suppressed by IFN-gamma than IFN-alpha-2b. Depletion of either T lymphocytes or adherent cells from the CML bone marrow cells diminished the suppressive effects of IFN-gamma, but had no influence on the effects of IFN-alpha-2b.
Ota, Masaki; Kato, Seiya
2017-01-01
Although the World Health Organization recommends contact investigations around air travel-associated sputum smear-positive tuberculosis (TB) patients, evidence suggests that the information thus obtained may have overestimated the risk of TB infection because it involved some contacts born in countries with high TB burden who were likely to have been infected with TB in the past, or because tuberculin skin tests were used, which are less specific than the interferon gamma release assay (IGRA) particularly in areas where Bacillus Calmette-Guérin (BCG) vaccination coverage is high. We conducted a questionnaire survey on air travel-associated TB contact investigations in local health offices of Japan from 2012 to 2015, focusing on IGRA positivity. Among 651 air travel-associated TB contacts, average positivity was 3.8% (95% confidence interval (CI): 2.5–5.6) with a statistically significant increasing trend with older age (p < 0.0094). Positivity among 0–34 year-old contacts was 1.0% (95% CI: 0.12–3.5%), suggesting their risk of TB infection is as small as among Japanese young adults with low risk of TB infection (positivity: 0.85–0.90%). Limiting the contact investigation to fewer passengers (within two seats surrounding the index case, rather than two rows) seems reasonable in the case of aircraft with many seats per row. PMID:28367799
Kim, S; Ponka, P
2000-03-03
Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.
NASA Astrophysics Data System (ADS)
Jeong, Hyeon-Ho; Erdene, Norov; Lee, Seung-Ki; Jeong, Dae-Hong; Park, Jae-Hyoung
2011-12-01
A fiber-optic localized surface plasmon (FO LSPR) sensor was fabricated by gold nanoparticles (Au NPs) immobilized on the end-face of an optical fiber. When Au NPs were formed on the end-face of an optical fiber by chemical reaction, Au NPs aggregation occurred and the Au NPs were immobilized in various forms such as monomers, dimers, trimers, etc. The component ratio of the Au NPs on the end-face of the fabricated FO LSPR sensor was slightly changed whenever the sensors were fabricated in the same condition. Including this phenomenon, the FO LSPR sensor was fabricated with high sensitivity by controlling the density of Au NPs. Also, the fabricated sensors were measured for the resonance intensity for the different optical systems and analyzed for the effect on sensitivity. Finally, for application as a biosensor, the sensor was used for detecting the antibody-antigen reaction of interferon-gamma.
Ho, Nathan K.; Crandall, Ian; Sherman, Philip M.
2012-01-01
Enterohemorrhagic Escherichia coli serotype O157:H7 is a food borne enteric bacterial pathogen that causes significant morbidity and mortality in both developing and industrialized nations. E. coli O157:H7 infection of host epithelial cells inhibits the interferon gamma pro-inflammatory signaling pathway, which is important for host defense against microbial pathogens, through the inhibition of Stat-1 tyrosine phosphorylation. The aim of this study was to determine which bacterial factors are involved in the inhibition of Stat-1 tyrosine phosphorylation. Human epithelial cells were challenged with either live bacteria or bacterial-derived culture supernatants, stimulated with interferon-gamma, and epithelial cell protein extracts were then analyzed by immunoblotting. The results show that Stat-1 tyrosine phosphorylation was inhibited by E. coli O157:H7 secreted proteins. Using sequential anion exchange and size exclusion chromatography, YodA was identified, but not confirmed to mediate subversion of the Stat-1 signaling pathway using isogenic mutants. We conclude that E. coli O157:H7 subverts Stat-1 tyrosine phosphorylation in response to interferon-gamma through a still as yet unidentified secreted bacterial protein. PMID:22253910
Pérez de Val, Bernat; Vidal, Enric; López-Soria, Sergio; Marco, Alberto; Cervera, Zoraida; Martín, Maite; Mercader, Irene; Singh, Mahavir; Raeber, Alex; Domingo, Mariano
2016-02-10
Vaccination of domestic animals has emerged as an alternative long-term strategy for the control of tuberculosis (TB). A trial under field conditions was conducted in a TB-free goat herd to assess the safety of the Mycobacterium bovis BCG vaccine. Eleven kids and 10 milking goats were vaccinated with BCG. Bacterial shedding and interferon gamma (IFN-γ) responses were monitored throughout the study. Comprehensive pathological examination and mycobacterial culture of target tissues were performed. BCG vaccine strain was only isolated from the draining lymph node of the injection site of a kid euthanized at week 8 post-vaccination. The remaining animals were euthanized at week 24. Six out of 20 showed small granulomas at the injection site. BCG shedding was not detected in either faeces or in milk throughout the study. All vaccinated kids showed BCG-induced IFN-γ responses at week 8 post-vaccination. BCG vaccination of goats showed no lack of biological safety for the animals, environment and public health, and local adverse reactions were negligible. Copyright © 2016 Elsevier Ltd. All rights reserved.
Shaik, Junaid; Pillay, Manormoney; Jeena, Prakash
2014-09-01
Successful control of childhood TB requires early diagnosis, effective chemotherapy and a method of evaluating the response to therapy. Identification of suitable biomarkers that predict the response to anti-TB therapy may allow the duration of treatment to be shortened. The majority of biomarker studies in paediatric TB have focused on the role of T cell-based interferon-gamma (IFN-γ) release assays (IGRAs) in the diagnosis of either latent or active disease. Little has been published on the role of IGRAs in the monitoring response to therapy in children. We reviewed the available literature to ascertain the value of IGRAs in the monitoring of response to anti-TB therapy in children. We explored the results of the few studies that have investigated the role of IGRAs as markers of response to anti-TB treatment in children. We conclude that the role of IGRAs as surrogate markers appears promising. Robust clinical trials are, however, needed to entrench the value of IGRAs as surrogate biomarkers of response to anti-TB therapy in children. Copyright © 2013 Elsevier Ltd. All rights reserved.
Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long
2006-11-17
The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.
Ohyama, K; Kikuchi, H; Oda, Y; Moritake, K; Yamasaki, T
1993-06-01
We studied the effects of mouse IFN-gamma on the cytotoxic activity of murine activated macrophages (M phi) against mouse VM-Glioma cells (H-2b). Activated M phi were obtained from peritoneal exudate cells of mice from four strains, C57BL/6 (H-2b), C3H/He(H-2k), DBA/2 (H-2d), and BALB/c (H-2d), following intraperitoneal injection of (1) LPS 200 micrograms, (2) BCG 200 micrograms, (3) C. parvum 200 micrograms, or (4) MDP 350 micrograms 7 days prior to 20-hr 51Cr release-assay. Of the various combination of mouse strains and activating agents tested, that of activated M phi of the C3H/He mouse with induction by LPS had the most tumoricidal effect against the glioma cells, which was not MHC restricted. Although LPS-activated M phi underwent marked loss of cytotoxicity following initiation of in vitro culture, this 24 hr pretreatment with IFN-gamma inhibited this reduction in tumoricidal effects in a dose-dependent fashion. On the other hand, 24 hr pretreatment of target cells with IFN-gamma did not increase their susceptibility to lysis by activated M phi. These findings suggest that IFN-gamma augments the in vitro tumoricidal activation of M phi; This effect appears to be unrelated to any influence of IFN-gamma on target sensitivity to lysis by macrophages.
Three-dimensional crystal structure of recombinant murine interferon-beta.
Senda, T; Shimazu, T; Matsuda, S; Kawano, G; Shimizu, H; Nakamura, K T; Mitsui, Y
1992-01-01
The crystal structure of recombinant murine interferon-beta (IFN-beta) has been solved by the multiple isomorphous replacement method and refined to an R-factor of 20.5% against 2.6 A X-ray diffraction data. The structure shows a variant of the alpha-helix bundle with a new chain-folding topology, which seems to represent a basic structural framework of all the IFN-alpha and IFN-beta molecules belonging to the type I family. Functionally important segments of the polypeptide chain, as implied through numerous gene manipulation studies carried out so far, are spatially clustered indicating the binding site(s) to the receptor(s). Comparison of the present structure with those of other alpha-helical cytokine proteins, including porcine growth hormone, interleukin 2 and interferon gamma, indicated either a topological similarity in chain folding or a similar spatial arrangement of the alpha-helices. Images PMID:1505514
NASA Astrophysics Data System (ADS)
Daulay, R. S.; Daulay, R. M.
2018-03-01
Cellular immunity was mediated the host immune response against Mycobacterium tuberculosis, in which cytokine and T-helper (Th) 1 cells play an important role. Interferon-gamma (IFN-γ) is a leading cytokine involved in the immune response of tuberculosis (TB).The primary function of IFN-γ is to activate macrophages in opposition Mycobacterium tuberculosis. Contrast from IFN-γ, interleukin-10 (IL-10) is considered inhibitory cytokine, important to an adequate balance between inflammatory responses. To analyze cytokine profile, particularly IFN-γ and IL-10 of the children with TB in Indonesia, a cross-sectional study was conducted at two general hospitals and seven primary health care located in Medan and Batubara, North Sumatera, Indonesia. Among 51 children with TB disease and 51 healthy children, found that IFN-γ and IL-10 levels were lower in TB patients compared to healthy children. Statistically significant decreased production of the IFN-γ levels (p=0.042) were found in TB patients 9.41 (1.10-28.06) pg/ml contrast to healthy children 6.30 (1.30-89.76) pg/ml. Homologue finding of the IL-10 levels were also found in TB patients 4.93 (0.22-48.01) pg/ml and 4.93 (0.07-81.60) pg/ml in healthy children, but not statistically significant (p=0.784). High levels of IL-10 were not proven to suppress the levels production of IFN-γ in TB patients.
Household food insecurity is associated with low interferon-gamma levels in pregnant Indian women.
Vaidya, A; Bhosale, R; Sambarey, P; Suryavanshi, N; Young, S; Mave, V; Kanade, S; Kulkarni, V; Deshpande, P; Balasubramanian, U; Elf, J; Gupte, N; Gupta, A; Mathad, J S
2017-07-01
Over 20% of tuberculosis (TB) cases during pregnancy occur in India. To determine the association between household food insecurity and interferon-gamma (IFN-γ) levels in pregnancy. Pregnant women in India were administered the Household Food Insecurity Access Scale (HFIAS) questionnaire and underwent an IFN-γ release assay. Logistic regression was used to identify factors associated with food insecurity. Of 538 women, 60 (11%) had household food insecurity, 47 (78%) of which were moderate or severe food insecure. After mitogen stimulation, moderate or severe food insecure women had a median IFN-γ concentration of 4.2 IU/ml (IQR 2.2-9.8) vs. 8.4 IU/ml (IQR 3.0-10) in women with no or mild food insecurity (P = 0.03). In multivariate analysis, higher IFN-γ concentrations were associated with human immunodeficiency virus infection (OR 1.3, 95%CI 0.51-2.1, P = 0.001), and inversely associated with moderate or severe food insecurity (OR -1.6, 95%CI -2.9 to -0.27, P = 0.02) and the number of adults in the household (OR -0.08, 95%CI -0.16 to -0.01, P = 0.03). There was no association between food insecurity and IFN-γ response to Mycobacterium tuberculosis antigen. Food insecurity in pregnancy is associated with low IFN-γ levels. There was no association between food insecurity and IFN-γ response to M. tuberculosis antigen, but our study was underpowered to detect this outcome.
Elfrink, Floor; van den Hoek, Anneke; Mensen, Marlies E; Sonder, Gerard J B
2014-09-23
International travel from low-incidence to high-incidence countries for tuberculosis (TB) is regarded as a risk factor for acquiring TB infection. In this prospective study among long-term travellers we examined the incidence of TB infection using Interferon gamma release assay (IGRA) test and compared these data with results from a visit to the TB department to which all long-term travellers were routinely referred. Immunocompetent adults, travelling for 13-52 weeks to TB-endemic countries, donated blood pre- and post-travel for IGRA. The pre-travel IGRA was only tested in case of a positive IGRA post-travel. Results from their visit(s) to the TB department for TST pre- and post-travel were collected and compared with study results. We found two IGRA conversions in a group of 516 travellers, resulting in an attack rate (AR) of 0.4% (95% CI: 0.5 - 13.9) and an incidence rate (IR) of 0.85 per 1000 person-months (95% CI: 0.1-3.1).We found 5 tuberculin skin test (TST) conversions, resulting in AR of 1.9% (5/261; 95% CI: 0.6 - 4.4) and an IR of 4.26 per 1000 person-months (95% CI: 1.38- 9.94). In our study these converters all had a negative IGRA. One traveller however, who was retested later at the TB department due to a positive TST, then appeared to have seroconverted. The risk of long-term travellers among our study population acquiring TB infection is low. We conclude that post-travel IGRA alone could be used for screening for TB infection among long-term travellers to high-endemic TB countries, but preferably not earlier than 8 weeks after return. One might even argue that IGRA testing should be limited to only those travellers who are going to work in a medical setting. A person with a positive IGRA should be referred to a TB physician for further evaluation.
Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh
2014-06-01
Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. INFECTED BALB/C MICE WERE DIVIDED INTO FIVE GROUPS AS: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth.
Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh
2014-01-01
Background: Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. Objectives: The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. Materials and Methods: Infected BALB/c mice were divided into five groups as: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. Results: The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. Conclusions: The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth. PMID:25371808
Tuo, Wenbin; Fetterer, Raymond; Jenkins, Mark; Dubey, J. P.
2005-01-01
Gamma interferon (IFN-γ) response is essential to the development of a host protective immunity in response to infections by intracellular parasites. Neosporosis, an infection caused by the intracellular protozoan parasite Neospora caninum, is fatal when there is a complete lack of IFN-γ in the infected host. However, the mechanism by which IFN-γ is elicited by the invading parasite is unclear. This study has identified a microbial protein in the N. caninum tachyzoite N. caninum cyclophilin (NcCyP) as a major component of the parasite responsible for the induction of IFN-γ production by bovine peripheral blood mononuclear cells (PBMC) and antigen-specific CD4+ T cells. NcCyP has high sequence homology (86%) with Toxoplasma gondii 18-kDa CyP with a calculated molecular mass of 19.4 kDa. NcCyP is a secretory protein with a predicted signal peptide of 17 amino acids. Abundant NcCyP was detected in whole-cell N. caninum tachyzoite lysate antigen (NcAg) and N. caninum tachyzoite culture supernatant. In N. caninum tachyzoite culture supernatant, three NcCyP bands of 19, 22, and 24 kDa were identified. NcAg stimulated high levels of IFN-γ production by PBMC and CD4+ T cells. The IFN-γ-inducing effect of NcAg was blocked by cyclosporine, a specific ligand for CyP, in a dose-dependent manner. Furthermore, cyclosporine abolished IFN-γ production by PBMC from naïve cows as well as PBMC and CD4+ T cells from infected/immunized cows. These results indicate that the N. caninum tachyzoite naturally produces a potent IFN-γ-inducing protein, NcCyP, which may be important for parasite survival as well as host protection. PMID:16041025
Pokryszko-Dragan, A; Frydecka, I; Kosmaczewska, A; Ciszak, L; Bilińska, M; Gruszka, E; Podemski, R; Frydecka, D
2012-10-01
The aim of the study was to evaluate the stimulated production of interferon-gamma (IFNγ) by peripheral CD3+CD4+ T lymphocytes in patients with multiple sclerosis (MS) with regard to the degree of fatigue, and to investigate relationships between immunological parameters, level of depression and clinical variables. Forty MS patients (30 women, 10 men, aged 22-60 years): 20 fatigued and 20 non-fatigued were involved in the study. Fatigue was evaluated using the Fatigue Severity Scale (FSS) and Modified Fatigue Impact Scale (MFIS), depression level - using Beck Depression Inventory (BDI). Production of IFNγ by stimulated peripheral blood CD3+CD4+ T lymphocytes, assessed using flow cytometry, was compared between MS patients with different levels of fatigue and controls. Correlations were searched out between immunological findings and BDI, age, duration and course of MS, relapse rate, disability (assessed in Expanded Disability Status Scale - EDSS) and its progression. Stimulated production of IFNγ by CD3+CD4+ T lymphocytes was higher in severely fatigued patients in comparison with non-fatigued ones and controls, tended to correlate with FSS and MFIS, and correlated with BDI. No relationships were found between immunological findings and disease-related variables. Stimulated production of IFNγ by peripheral CD3+CD4+ T lymphocytes is related to fatigue and depression in MS patients. Copyright © 2012 Elsevier B.V. All rights reserved.
Clancy, R L; Gleeson, M; Cox, A; Callister, R; Dorrington, M; D'Este, C; Pang, G; Pyne, D; Fricker, P; Henriksson, A
2006-04-01
Fatigue and impaired performance in athletes is well recognised and has been loosely linked to "overtraining". Reduced concentration of IgA in the saliva and increased shedding of Epstein Barr virus (EBV) have been associated with intense training in elite athletes. To determine whether athletes presenting with fatigue and impaired performance had an immune defect relevant to defective containment of EBV infection, and whether a probiotic preparation (Lactobacillus acidophilus) shown to enhance mucosal immunity in animal models could reverse any detected abnormality. The fatigued athletes had clinical characteristics consistent with re-activation of EBV infection and significantly (p = 0.02) less secretion of interferon (IFN) gamma from blood CD4 positive T cells. After one month of daily capsules containing 2 x 10(10) colony forming units of L acidophilus, secretion of IFNgamma from T cells had increased significantly (p = 0.01) to levels found in healthy control athletes. A significant (p = 0.03) increase in salivary IFNgamma concentrations in healthy control athletes after the one month course of L acidophilus demonstrated in man the capacity for this probiotic to enhance the mucosal IFNgamma concentration. This is the first evidence of a T cell defect in fatigued athletes, and of its reversal following probiotic therapy.
Mossman, K; Nation, P; Macen, J; Garbutt, M; Lucas, A; McFadden, G
1996-01-01
Myxoma virus is a leporipoxvirus of New World rabbits (Sylvilagus sp.) that induces a rapidly lethal infection known as myxomatosis in the European rabbit (Oryctolagus cuniculus). Like all poxviruses, myxoma virus encodes a plethora of proteins to circumvent or inhibit a variety of host antiviral immune mechanisms. M-T7, the most abundantly secreted protein of myxoma virus-infected cells, was originally identified as an interferon-gamma receptor homolog (Upton, Mossman, and McFadden, Science 258, 1369-1372, 1992). Here, we demonstrate that M-T7 is dispensable for virus replication in cultured cells but is a critical virulence factor for virus pathogenesis in European rabbits. Disruption of both copies of the M-T7 gene in myxoma virus was achieved by the deletion of 372 bp of M-T7 coding sequences, replacement with a selectable marker, p7.5Ecogpt, and selection of a recombinant virus (vMyxlac-T7gpt) resistant to mycophenolic acid. vMyxlac-T7gpt expressed no detectable M-T7 protein and infected cells supernatants were devoid of any detectable interferon-gamma binding activities. Immunohistochemical staining with anti-beta-galactosidase and anti-CD43 antibodies demonstrated that in vMyxlac-T7gpt-infected rabbits the loss of M-T7 not only caused a dramatic reduction in disease symptoms and viral dissemination to secondary sites, but also dramatically influenced host leukocyte behavior. Notably, primary lesions in wild-type virus infections were generally underlayed by large masses of inflammatory cells that did not effectively migrate into the dermal sites of viral replication, whereas in vMyxlac-T7gpt infections this apparent block to leukocyte influx was relieved. A second major phenotypic distinction noted for the M-T7 knockout virus was the extensive activation of lymphocytes in secondary immune organs, particularly the spleen and lymph nodes, by Day 4 of the infection. This is in stark contrast to infection by wild-type myxoma virus, which results in relatively
Agosti, J M; Coombs, R W; Collier, A C; Paradise, M A; Benedetti, J K; Jaffe, H S; Corey, L
1992-05-01
To determine safety and efficacy of tumor necrosis factor (TNF) and interferon-gamma (IFN gamma) in the treatment of patients with acquired immunodeficiency syndrome (AIDS)-related complex, a randomized, double-blind study was conducted. Twenty-five patients with AIDS-related complex and CD4 lymphocytes less than or equal to 500 x 10(6)/L attended an AIDS Clinical Trials Unit of a tertiary referral center. Patients were administered tumor necrosis factor (TNF) (10 micrograms/m2) or IFN gamma (10 micrograms/m2), or both intramuscularly three times weekly for 16 weeks. Side effects from all three preparations included fever, constitutional symptoms, and local reactions. No significant hematologic, hepatic, renal, or coagulation abnormalities were observed. CD4 lymphocyte counts, beta 2-microglobulin, p24 antigen levels, and anti-p24 antibody did not change significantly during therapy. Similarly, no significant change was noted in rates of HIV isolation from peripheral blood mononuclear cells or plasma. TNF and IFN gamma were tolerable after premedication with acetaminophen; however, no significant change in markers of human immunodeficiency virus infection was demonstrated. These cytokines alone do not appear to be of benefit, nor do they appear to hasten the progression of HIV infection.
Bozeman, Ronald; Abel, Erika L; Macias, Everardo; Cheng, Tianyi; Beltran, Linda; DiGiovanni, John
2015-08-01
The current study was designed to explore the role of signal transducer and activator of transcription 1 (Stat1) during tumor promotion using the mouse skin multistage carcinogenesis model. Topical treatment with both 12-O-tetradecanoylphorbol-13-acetate (TPA) and 3-methyl-1,8-dihydroxy-9-anthrone (chrysarobin or CHRY) led to rapid phosphorylation of Stat1 on both tyrosine (Y701) and serine (S727) residues in epidermis. CHRY treatment also led to upregulation of unphosphorylated Stat1 (uStat1) at later time points. CHRY treatment also led to upregulation of interferon regulatory factor 1 (IRF-1) mRNA and protein, which was dependent on Stat1. Further analyses demonstrated that topical treatment with CHRY but not TPA upregulated interferon-gamma (IFNγ) mRNA in the epidermis and that the induction of both IRF-1 and uStat1 was dependent on IFNγ signaling. Stat1 deficient (Stat1(-/-) ) mice were highly resistant to skin tumor promotion by CHRY. In contrast, the tumor response (in terms of both papillomas and squamous cell carcinomas) was similar in Stat1(-/-) mice and wild-type littermates with TPA as the promoter. Maximal induction of both cyclooxygenase-2 and inducible nitric oxide synthase in epidermis following treatment with CHRY was also dependent on the presence of functional Stat1. These studies define a novel mechanism associated with skin tumor promotion by the anthrone class of tumor promoters involving upregulation of IFNγ signaling in the epidermis and downstream signaling through activated (phosphorylated) Stat1, IRF-1 and uStat1. © 2014 Wiley Periodicals, Inc.
Gill, Gurmit; Bajwa, Hammad; Strouhal, Peter; Buch, Harit N
2016-09-15
Interferon alpha is a widely used therapeutic agent in the treatment of hepatitis C virus infection. Clinical thyroid disease is seen in nearly 15 % of patients receiving interferon alpha for hepatitis C virus infection. The mechanism of thyroid dysfunction with interferon alpha is either autoimmune or inflammatory. We report a case of young woman who developed biphasic thyroid dysfunction posing a diagnostic challenge, while receiving interferon alpha treatment for hepatitis C virus infection. A 29-year-old, Caucasian woman with type 1 diabetes and hepatitis C virus infection was referred with hyperthyroidism, while she was at 17 weeks of a planned 24-week course of interferon alpha therapy. A laboratory investigation revealed a thyroid stimulation hormone level of 0.005 mU/L (0.350-4.94), free thyroxine of 45.6 pmol/L (9.0-19.0) and free tri-iodothyronine of 12.6 pmol/L (2.6-5.7). She had a mild neutropenia and alanine aminotransferase at double the reference value. Her thyroid peroxidase antibody level was 497 ku/L (<5.6) and thyroid inhibitory factor 7 IU/L (>1.8 iu/l is positive). Thyroid scintigraphy with technetium99 scan confirmed a normal-sized thyroid gland with diffuse but normal overall uptake. A diagnosis of interferon alpha-triggered autoimmune hyperthyroidism as opposed to an inflammatory thyroiditis was made. She was offered radioactive iodine therapy, as thionamides were considered inappropriate in view of her liver disease and mild neutropenia. Due to our patient's personal circumstances, radioactive iodine therapy was delayed by 8 weeks and her thyrotoxic symptoms were controlled with beta-blockers alone. A repeat thyroid function test, 4 weeks post treatment with interferon alpha, indicated spontaneous conversion to hypothyroidism with a thyroid stimulation hormone level of 100 mU/L, free thyroxine of 5.2 pmol/L and free tri-iodothyronine of 1.7 pmol/L. She subsequently received levothyroxine for 4 months only and had remained euthyroid for the
Galkina, Elena; Harry, Brian L; Ludwig, Andreas; Liehn, Elisa A; Sanders, John M; Bruce, Anthony; Weber, Christian; Ley, Klaus
2007-10-16
T lymphocytes are thought to be important in atherosclerosis, but very little is known about the mechanisms of lymphocyte recruitment into atherosclerosis-prone aortas. In this study we tested the hypothesis that CXCR6, a chemokine receptor that is expressed on a subset of CD4+ T helper 1 cells and natural killer T cells, is involved in lymphocyte homing into the aortic wall and modulates the development and progression of atherosclerosis. To investigate the role of CXCR6 in the development and progression of atherosclerosis, we bred CXCR6-deficient (CXCR6(GFP/GFP)) mice with apolipoprotein E-deficient (ApoE(-/-)) mice. We found that CXCR6(GFP/GFP)/ApoE(-/-) mice fed a Western diet for 17 weeks or a chow diet for 56 weeks had decreased atherosclerosis compared with ApoE(-/-) controls. Flow cytometry analysis of the aortas from CXCR6(GFP/GFP)/ApoE(-/-) mice showed that the reduction of atherosclerosis was accompanied by a decreased percentage of CXCR6+ T cells within the aortas. Short-term homing experiments demonstrated that CXCR6 is involved in the recruitment of CXCR6+ leukocytes into the atherosclerosis-prone aortic wall. The reduced percentage of CXCR6+ T cells within the aortas resulted in significantly diminished production of interferon-gamma and reduction of CD11b+/CD68+ macrophages in the aorta. These data provide evidence for a proatherosclerotic role of CXCR6. Absence of CXCR6 alters the recruitment of CXCR6+ leukocytes and modulates the local immune response within the aortic wall.
Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret
2013-01-01
Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and also alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h and 6 day exposures to TBT (200- 2.5 nM) and DBT (5- 0.05 μM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from NK cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. PMID:24357260
La Flamme, Anne Camille; Patton, Elisabeth A.; Pearce, Edward J.
2001-01-01
In the absence of interleukin-4 (IL-4), infection with Schistosoma mansoni leads to a severe fatal disease rather than the chronic survivable condition that occurs in wild-type (WT) mice. Because the sustained production of NO most closely correlates to weight loss and fatality in infected IL-4−/− mice and because gamma interferon (IFN-γ) is an important inducer of inducible NO synthase, infected IL-4−/− mice were treated with anti-IFN-γ antibodies to determine the role of IFN-γ during schistosomiasis in WT and IL-4−/− animals. When IFN-γ was neutralized, Th2 responses were enhanced and NO production was reduced in both WT and IL-4−/− mice. The decreased NO production correlated with a rescue of proliferation in splenocytes from infected IL-4−/− mice. Furthermore, the neutralization of IFN-γ in vivo improved the gross appearance of the liver and led to a reduction in granuloma size in infected IL-4−/− but not WT mice. However, the neutralization of IFN-γ in vivo did not affect the development of severe disease in infected IL-4−/− mice. These results suggest that while the increased production of IFN-γ does lead to some of the pathology observed in infected IL-4−/− mice, it is not ultimately responsible for cachexia and death. PMID:11705919
Kim, Ji-Yeon; Lee, Dong-Hyung; Joo, Jong-Kil; Jin, Jun-O; Wang, Ji-Won; Hong, Young-Seoub; Kwak, Jong-Young; Lee, Kyu-Sup
2009-09-01
Intraperitoneal immuno-inflammatory changes may be associated with the pathogenesis of endometriosis. We evaluated the effects of peritoneal fluid obtained from patients with endometriosis (ePF) on the release of interferon-gamma-induced protein-10 (IP-10/CXCL10) and interleukin-8 (IL-8/CXCL8) by neutrophils, CD4(+) T cells, and monocytes. Neutrophils, CD4(+) T cells, and monocytes were cultured with ePF and the chemokine levels in the supernatants were then measured using enzyme-linked immunosorbent assay. The addition of ePF to cultures of CD4(+) T cells led to a significant increase in the release of IP-10 when compared with control PF without endometriosis (cPF). There was a positive correlation between the levels of IL-8 and IP-10 in ePF (R = 0.89, P = 0.041), but not between the levels of IP-10 and IL-8 released by neutrophils, CD4(+) T cells, and monocytes. The levels of IP-10 in ePF were positively correlated with the release of IP-10 by ePF-treated neutrophils (R = 0.89, P < 0.001), CD4(+) T cells (R = 0.93, P < 0.001), and monocytes (R = 0.70, P = 0.01). Moreover, the addition of ePF significantly enhanced the interferon-gamma-induced release of IP-10 by nuetrophils and CD4(+) T cells. These findings suggest that neutrophils and T cells release differential levels of IP-10 and IL-8 in response to stimulation with ePF, and that these cells are a major source of IP-10 in the PF of endometriosis patients.
ERIC Educational Resources Information Center
Veeser, Peggy Ingram; Smith, Phillip Karl; Handy, Barry; Martin, Sharon R.
2007-01-01
Detecting and managing "Mycobacterium tuberculosis" (TB) infection in a health-science center population is a clinical dilemma. Tuberculin skin tests are still the preferred method for detecting present or past infection of TB. The authors discuss the performance of whole blood interferon gamma release assay test commercially known as…
Byleveld, P M; Pang, G T; Clancy, R L; Roberts, D C
1999-02-01
Ingestion of fish oil can suppress the inflammatory response to injury and may impair host resistance to infection. To investigate the effect of a diet containing fish oil on immunity to viral infection, 148 BALB/c mice were fed diets containing 3 g/100 g of sunflower oil with either 17 g/100 g of fish oil or beef tallow for 14 d before intranasal challenge with live influenza virus. At d 1 and d 5 after infection, the mice fed fish oil had higher lung viral load and lower body weight (P < 0.05). In addition to the greater viral load and weight loss at d 5 after infection, the fish oil group consumed less food (P < 0.05) while the beef tallow group was clearing the virus, had regained their preinfection weights and was returning to their preinfection food consumption. The fish oil group had impaired production of lung interferon-gamma (IFN-gamma), serum immunoglobulin (Ig) G and lung IgA-specific antibodies (all P < 0. 05) although lung IFN-alpha/beta and the relative proportions of bronchial lymph node CD4+ and CD8+ T lymphocytes did not differ between groups after infection. The present study demonstrates a delay in virus clearance in mice fed fish oil associated with reduced IFN-gamma and antibody production and a greater weight loss and suppression of appetite following influenza virus infection. However, differences observed during the course of infection did not affect the ultimate outcome as both groups cleared the virus and returned to preinfection food consumption and body weight by d 7.
Kuo, Joseph; Warner, Thomas F; Schell, Ronald F
2017-03-01
The immune mechanisms responsible for development of Lyme arthritis are partially understood with interleukin-17 (IL-17) and gamma-interferon (IFN-γ) playing a generally accepted role. Elevated levels of IL-17 and/or IFN-γ have been reported in samples from human Lyme arthritis patients and experimental mice. In addition, IL-17 and IFN-γ have been implicated in the onset of arthritis in Borrelia-primed and -infected C57BL/6 mice. Recently, we showed that IL-17-deficient mice developed swelling and histopathological changes consistent with arthritis in the presence of high levels of IFN-γ. We hypothesized that neutralization of IFN-γ in IL-17-deficient mice would inhibit Borrelia-induced arthritis. Our results, however, showed that swelling of the hind paws and histopathological changes of arthritis did not differ between Borrelia-primed and -infected IL-17-deficient and wild-type mice with or without neutralization of IFN-γ. We also found higher levels of tumor necrosis factor alpha (TNF-α) and IL-6 in the popliteal lymph node cells of Borrelia-primed and -infected IL-17-deficient mice after neutralization of IFN-γ. These results suggest that multiple cytokines interact in the development of Borrelia-induced arthritis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Zribi, Lilia; El-Goulli, Amel F; Ben-Abid, Meriem; Gharbi, Mohamed; Ben-Sghaier, Ines; Boufaden, Imed; Aoun, Karim; Bouratbine, Aïda
2017-11-15
Interferon-Gamma (IFN-γ) Release Assays (IGRAs) are easy tests that allow rapid screening of primed memory T-cells immunity in response to antigen. The aim of this study was to use IGRA to assess IFN-γ release in response to Soluble Leishmania infantum antigen (SLA) in whole blood of dogs living in endemic area of visceral leishmaniasis and to interpret IGRA results according to clinical examination, specific anti-Leishmania humoral response and presence of L. infantum DNA in blood. The study was carried out on 56 dogs living in greater Tunis area. Physical examination, quantitative serology and PCR on blood were used to characterize dogs' status in relation to Leishmania infection and disease. IGRA consisted on testing by ELISA for IFN-γ-secretion in whole blood after a 20-h challenge with SLA. PBS and Phytohemagglutinin (PHA) stimulations were used as controls. Four groups of dogs were characterized: 31 were negative by both serology and PCR, two had doubtful serology, 10 presented no to mild clinical signs but low antibodies levels and 13 were affected by Canine Leishmaniasis (CanL). In seronegative dogs, IGRA was little contributory in 4 puppies (age <6months) and 5 old dogs (median age=72months, IQR: 45-84 months) that didn't respond to PHA stimulation, IGRA was negative in 19 and positive in three animals with lymph node enlargement. In dogs with doubtful serology, IGRA was positive in one dog and negative in the other. In infected dogs with no to mild clinical signs, one dog exhibited high level of IFN-γ in absence of antigenic stimulation and all the other were positive by IGRA. CanL dogs showed variable IGRA results. Negative IGRAs (n=4) were shown in animals with the highest parasitic burden whereas positive IGRAs (n=5) were shown in dogs with negative PCR or low parasitic load. The 4 remaining dogs either didn't respond to PHA (n=2) or showed non-specific secretion in PBS tube (n=2). The results of this study showed that IGRA is a useful new tool
The effect of centaurein on interferon-{gamma} expression and Listeria infection in mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, S.-L.; Department of Biological Science and Technology, National Chiao Tung University, 1001, Ta Hsueh Road, Hsinchu 300, Taiwan; Yeh, H.-H.
2007-02-15
We previously found that centaurein enhanced IFN-{gamma} transcription in T cells. Here, we demonstrate that centaurein increased the IFN-{gamma} expression in T and NK cells and the serum IFN-{gamma} level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-{gamma} but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-{gamma} expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection viamore » a modulation of IFN-{gamma} expression.« less
Leung, Donald YM; Gao, Pei-Song; Grigoryev, Dmitry N; Rafaels, Nicholas M; Streib, Joanne E; Howell, Michael D; Taylor, Patricia A; Boguniewicz, Mark; Canniff, Jennifer; Armstrong, Brian; Zaccaro, Daniel J; Schneider, Lynda C; Hata, Tissa R; Hanifin, Jon M; Beck, Lisa A; Weinberg, Adriana; Barnes, Kathleen C
2011-01-01
Background The basis for increased susceptibility of atopic dermatitis (AD) patients to develop disseminated viral skin infections such as eczema herpeticum (ADEH+) is poorly understood. Objective We sought to determine whether atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Methods GeneChip profiling was used to identify differences in gene expression of peripheral blood mononuclear cells (PBMC) from patients with a history of ADEH+ as compared to ADEH− and non-atopic controls. Key differences in protein expression were verified by ELISPOT and/or ELISA. Clinical relevance was further demonstrated by a mouse model of disseminated viral skin infection and genetic association analysis for genetic variants in IFNG and IFNGR1 and ADEH among 435 cases and controls. Results We demonstrate by global gene expression analysis selective transcriptomic changes within the interferon (IFN) superfamily of PBMCs from ADEH+ subjects reflecting low IFNγ and IFNγ receptor gene expression. IFNγ protein production was also significantly lower in ADEH+ (N=24) compared to ADEH− (N=20) and non-atopic (NA; N=20) controls. IFNγ receptor knockout (KO) mice developed disseminated viral skin infection after epicutaneous challenge with vaccinia virus (VV). Genetic variants in IFNG and IFNGR1 SNPs were significantly associated with ADEH (112 cases, 166 controls) and IFNγ production: a 2-SNP (A–G) IFNGR1 haplotype (rs10457655 and rs7749390) showed the strongest association with a reduced risk of ADEH+ ((13.2% ADEH+ vs 25.5% ADEH−, P = 0.00057). Conclusions ADEH+ patients have reduced IFNγ production, and IFNG and IFNGR1 SNPs are significantly associated with ADEH+ and may contribute to an impaired immune response to herpes simplex virus (HSV). Clinical Implications Atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Capsule summary Using genomic
Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.
Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G
2010-04-15
Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.
Pan, L Y; Guyre, P M
1988-02-01
We investigated the influence of glucocorticoids on two effects of interferons (IFNs) which are thought to relate to their antitumor actions: cytotoxic activity and induction of HLA antigen expression. We treated human myeloid cell lines (U-937, HL-60, THP-1, K-562, and KG-1a), and T-(MOLT-4) and B- (Daudi) lymphoblastic cell lines with concentrations of IFN-alpha, IFN-gamma, and dexamethasone (Dex) which are commonly achieved in the circulation following therapeutic administration. The results show that for every cell line except Daudi, the greatest inhibition of cell growth occurred when IFN-gamma and Dex treatments were combined. The advantage of combined IFN-gamma and Dex treatment over treatment with either agent alone was most dramatic for the three cell lines (U-937, HL-60, and THP-1) which have monocytoid characteristics. There was also more growth inhibition by the combination of IFN-alpha and Dex than by either agent alone for all seven cell lines tested. The induction of HLA antigen expression by IFN-alpha and IFN-gamma, an effect which could increase recognition of the tumor cells by the immune system, was as great or greater in the presence of Dex as in its absence. These results demonstrate that glucocorticoids do not inhibit, and in some cases enhance, two effects of IFNs that appear to be related to their antitumor actions: inhibition of tumor cell proliferation and enhancement of HLA antigen expression.
Dron, M; Modjtahedi, N; Brison, O; Tovey, M G
1986-05-01
Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells.
Jans, Jop; Unger, Wendy W J; Vissers, Marloes; Ahout, Inge M L; Schreurs, Inge; Wickenhagen, Arthur; de Groot, Ronald; de Jonge, Marien I; Ferwerda, Gerben
2018-04-01
Interferon gamma (IFN-γ) plays an important role in the antiviral immune response during respiratory syncytial virus (RSV) infections. Monocytes and T cells are recruited to the site of RSV infection, but it is unclear whether cell-cell interactions between monocytes and T cells regulate IFN-γ production. In this study, micro-array data identified the upregulation of sialic acid-binding immunoglobulin-type lectin 1 (Siglec-1) in human RSV-infected infants. In vitro, RSV increased expression of Siglec-1 on healthy newborn and adult monocytes. RSV-induced Siglec-1 on monocytes inhibited IFN-γ production by adult CD4 + T cells. In contrast, IFN-γ production by RSV in newborns was not affected by Siglec-1. The ligand for Siglec-1, CD43, is highly expressed on adult CD4 + T cells compared to newborns. Our data show that Siglec-1 reduces IFN-γ release by adult T cells possibly by binding to the highly expressed CD43. The Siglec-1-dependent inhibition of IFN-γ in adults and the low expression of CD43 on newborn T cells provides a better understanding of the immune response against RSV in early life and adulthood. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sonoda, Soichiro; Yamaza, Haruyoshi; Ma, Lan; Tanaka, Yosuke; Tomoda, Erika; Aijima, Reona; Nonaka, Kazuaki; Kukita, Toshio; Shi, Songtao; Nishimura, Fusanori; Yamaza, Takayoshi
2016-01-01
Clinically, irreversible pulpitis is treated by the complete removal of pulp tissue followed by replacement with artificial materials. There is considered to be a high potential for autologous transplantation of human dental pulp stem cells (DPSCs) in endodontic treatment. The usefulness of DPSCs isolated from healthy teeth is limited. However, DPSCs isolated from diseased teeth with irreversible pulpitis (IP-DPSCs) are considered to be suitable for dentin/pulp regeneration. In this study, we examined the stem cell potency of IP-DPSCs. In comparison with healthy DPSCs, IP-DPSCs expressed lower colony-forming capacity, population-doubling rate, cell proliferation, multipotency, in vivo dentin regeneration, and immunosuppressive activity, suggesting that intact IP-DPSCs may be inadequate for dentin/pulp regeneration. Therefore, we attempted to improve the impaired in vivo dentin regeneration and in vitro immunosuppressive functions of IP-DPSCs to enable dentin/pulp regeneration. Interferon gamma (IFN-γ) treatment enhanced in vivo dentin regeneration and in vitro T cell suppression of IP-DPSCs, whereas treatment with tumor necrosis factor alpha did not. Therefore, these findings suggest that IFN-γ may be a feasible modulator to improve the functions of impaired IP-DPSCs, suggesting that autologous transplantation of IFN-γ-accelerated IP-DPSCs might be a promising new therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:26775677
Dron, M; Modjtahedi, N; Brison, O; Tovey, M G
1986-01-01
Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells. Images PMID:3785169
Contradictory results in interferon research
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.
1984-01-01
Several reports on immunologically related interferon research, both in the areas of basic science and clinical research, are briefly reviewed, and it is noted that in many cases the results obtained are contradictory. It is argued, however, that the contradictory results are not surprising since interferon is a biological response modifier and has been known to produce opposite results even when the same interferon prepartion is used. It is emphasized that dosage, timing, route, and other experimental conditions are essential factors in planning immunological studies with interferon. Careful planning of future experiments with interferon should be required to prevent the possible generation of effects that are opposite to those expected.
Ernberg, I; Einhorn, S; Strander, H; Klein, G
1981-11-01
Eleven biopsies from 9 patients with Burkitt's lymphoma were tested for their sensitivity to the cell multiplication inhibitory activity of interferon. Three were resistant to interferon while 8 were sensitive to various degrees. Different biopsies from the same patient did not differ in interferon sensitivity. These results indicate that Burkitt's lymphoma cells might be resistant to interferon already in vivo as previously shown for some derived cell lines tested in vitro. The results imply an inverse relationship between patient survival and interferon sensitivity of the tumor cells.
Interferon alfa-2b injection is used to treat a number of conditions.Interferon alfa-2b injection is used alone or in combination ... lymphoma (NHL; a slow-growing blood cancer). Interferon alfa-2b is in a class of medications called ...
Myeloid interferon-γ receptor deficiency does not affect atherosclerosis in LDLR(-/-) mice.
Boshuizen, Marieke C S; Neele, Annette E; Gijbels, Marion J J; van der Velden, Saskia; Hoeksema, Marten A; Forman, Ruth A; Muller, Werner; Van den Bossche, Jan; de Winther, Menno P J
2016-03-01
Atherosclerosis is a chronic lipid-driven inflammatory disease of the arterial wall. Interferon gamma (IFNγ) is an important immunomodulatory cytokine and a known pro-atherosclerotic mediator. However, cell-specific targeting of IFNγ or its signaling in atherosclerosis development has not been studied yet. As macrophages are important IFNγ targets, we here addressed the involvement of myeloid IFNγ signaling in murine atherosclerosis. Bone marrow was isolated from interferon gamma receptor 2 chain (IFNγR2) wildtype and myeloid IFNγR2 deficient mice and injected into lethally irradiated LDLR(-/-) mice. After recovery mice were put on a high fat diet for 10 weeks after which atherosclerotic lesion analysis was performed. In addition, the accompanying liver inflammation was assessed. Even though absence of myeloid IFNγ signaling attenuated the myeloid IFNγ response, no significant differences in atherosclerotic lesion size or phenotype were found. Also, when examining the liver inflammatory state no effects of IFNγR2 deficiency could be observed. Overall, our data argue against a role for myeloid IFNγR2 in atherosclerosis development. Since myeloid IFNγ signaling seems to be nonessential throughout atherogenesis, it is important to understand the mechanisms by which IFNγ acts in atherogenesis. In the future new studies should be performed considering other cell-specific targets. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Yuk, Seong-Su; Lee, Dong-Hun; Park, Jae-Keun; Tseren-Ochir, Erdene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon
2016-04-27
Interferon gamma (IFN-γ), an immunoregulatory cytokine, is known to control many microbial infections. In a previous study, chicken interferon gamma (chIFN-γ) was found to be up-regulated following avian influenza virus (AIV) infection in specific pathogen-free chickens. We aimed to investigate whether the pre-immune state induced by chIFN-γ could generate an antiviral response against influenza virus. We generated a chIFN-γ-expressing plasmid and transfected it into chicken embryo fibroblasts (CEFs) and then infected the cells with human origin H1N1 or avian origin H9N2 influenza viruses. Viral titers of culture medium were evaluated in MDCK cell and the viral RNA and IFN-stimulated genes (ISGs) were then quantified by real-time reverse transcriptase polymerase. To further evaluate the role of the antiviral effect of chIFN-γ by using a backward approach, synthetic small interfering RNAs (siRNA) targeting chIFN-γ were used to suppress chIFN-γ. The chIFN-γ-stimulated CEFs inhibited the replication of viral RNA (vRNA) and showed a mild decrease in the infectious virus load released in the culture medium. Compared to the mock-transfected control, the messenger RNA (mRNA) levels of type I IFNs and IFN-stimulated genes were up-regulated in the cells expressing chIFN-γ. After treatment with the siRNA, we detected a higher expression of viral genes than that observed in the mock-transfected control. Our results suggest that apart from the important role played by chIFN-γ in the antiviral state generated against influenza virus infection, the pre-immune state induced by chIFN-γ can be helpful in mitigating the propagation of influenza virus.
Dubey, J P; Verma, S K; Dunams, D; Calero-Bernal, R; Rosenthal, B M
2015-11-01
The North American opossum (Didelphis virginiana) is the definitive host for at least three named species of Sarcocystis: Sarcocystis falcatula, Sarcocystis neurona and Sarcocystis speeri. The South American opossums (Didelphis albiventris, Didelphis marsupialis and Didelphis aurita) are definitive hosts for S. falcatula and S. lindsayi. The sporocysts of these Sarcocystis species are similar morphologically. They are also not easily distinguished genetically because of the difficulties of DNA extraction from sporocysts and availability of distinguishing genetic markers. Some of these species can be distinguished by bioassay; S. neurona and S. speeri are infective to gamma interferon gene knockout (KO) mice, but not to budgerigars (Melopsittacus undulatus); whereas S. falcatula and S. lindsayi are infective to budgerigars but not to KO mice. The natural intermediate host of S. speeri is unknown. In the present study, development of sarcocysts of S. speeri in the KO mice is described. Sarcocysts were first seen at 12 days post-inoculation (p.i.), and they became macroscopic (up to 4 mm long) by 25 days p.i. The structure of the sarcocyst wall did not change from the time bradyzoites had formed at 50-220 days p.i. Sarcocysts contained unique villar protrusions, 'type 38'. The polymerase chain reaction amplifications and sequences analysis of three nuclear loci (18S rRNA, 28S rRNA and ITS1) and two mitochondrial loci (cox1 and cytb) of S. speeri isolate from an Argentinean opossum (D. albiventris) confirmed its membership among species of Sarcocystis and indicated an especially close relationship to another parasite in this genus that employs opossums as its definitive host, S. neurona. These results should be useful in finding natural intermediate host of S. speeri.
The Jak-STAT pathway stimulated by interferon alpha or interferon beta.
Horvath, Curt M
2004-11-23
Type I interferons, such as interferon alpha and interferon beta (IFN-alpha and beta), signal through a Janus kinase (Jak) to signal transduction and activator of transcription (STAT) pathway to stimulate gene expression. In response to ligand binding, the receptors dimerize, Jaks phosphorylate STAT1 and STAT2, which then dimerize and interact with a third transcriptional regulator IFN regulatory factor 9 (IRF9) to stimulate gene expression. IFN-alpha is the main innate antiviral cytokine and is essential for effective immune response to viral infection. The animation shows activation of STAT-responsive gene expression in response to type I IFNs.
Durward-Diioia, Marina; Harms, Jerome; Khan, Mike; Hall, Cherisse; Smith, Judith A.
2015-01-01
Brucella melitensis is a well-adapted zoonotic pathogen considered a scourge of mankind since recorded history. In some cases, initial infection leads to chronic and reactivating brucellosis, incurring significant morbidity and economic loss. The mechanism by which B. melitensis subverts adaptive immunological memory is poorly understood. Previous work has shown that Brucella-specific CD8+ T cells express gamma interferon (IFN-γ) and can transition to long-lived memory cells but are not polyfunctional. In this study, chronic infection of mice with B. melitensis led to CD8+ T cell exhaustion, manifested by programmed cell death 1 (PD-1) and lymphocyte activation gene 3 (LAG-3) expression and a lack of IFN-γ production. The B. melitensis-specific CD8+ T cells that produced IFN-γ expressed less IFN-γ per cell than did CD8+ cells from uninfected mice. Both memory precursor (CD8+ LFA1HI CD127HI KLRG1LO) and long-lived memory (CD8+ CD27HI CD127HI KLRG1LO) cells were identified during chronic infection. Interestingly, after adoptive transfer, mice receiving cells from chronically infected animals were able to contain infection more rapidly than recipients of cells from acutely infected or uninfected donors, although the proportions of exhausted CD8+ T cells increased after adoptive transfer in both challenged and unchallenged recipients. CD8+ T cells of challenged recipients initially retained the stunted IFN-γ production found prior to transfer, and cells from acutely infected mice were never seen to transition to either memory subset at all time points tested, up to 30 days post-primary infection, suggesting a delay in the generation of memory. Here we have identified defects in Brucella-responsive CD8+ T cells that allow chronic persistence of infection. PMID:26416901
Cerebrospinal fluid interferon-gamma-inducible protein 10 (IP-10, CXCL10) in HIV-1 infection.
Cinque, Paola; Bestetti, Arabella; Marenzi, Roberta; Sala, Serena; Gisslen, Magnus; Hagberg, Lars; Price, Richard W
2005-11-01
Interferon-gamma-inducible protein (IP-10 or CXCL10) is a potent chemoattractant and has been suggested to enhance retrovirus infection and mediate neuronal injury. In order to assess this chemokine in central nervous system (CNS) HIV infection, we measured the cerebrospinal fluid (CSF) and plasma concentrations of CXCL10 by immunoassay in samples derived from 97 HIV-infected subjects across a spectrum of immunological progression and CNS complications and from 16 HIV seronegative control subjects studied at three clinical centers between 1994 and 2001. We also examined changes in the CSF and plasma CXCL10 concentrations in 30 subjects starting and three stopping antiretroviral therapy. CSF CXCL10 concentrations: (1) correlated with CSF HIV RNA and white blood cell (WBC) counts, but not with blood CXCL10, HIV RNA, or CD4 counts; (2) were increased in subjects with primary and asymptomatic HIV infections and AIDS dementia complex, but less frequently in those with more advanced infection, with or without CNS opportunistic diseases except cytomegalovirus encephalitis; (3) decreased in subjects starting antiretroviral in association with decreases in CSF and plasma HIV RNA and CSF WBCs; and (4) conversely, increased in subjects stopping treatment in parallel with CSF HIV RNA and WBCs. These results confirm that CSF CXCL10 associates closely with both CSF HIV and WBCs and suggest that this chemokine may be both a response to and contributing determinant of local infection. High CSF levels may be useful in the diagnosis of ADC in subjects with advanced immunosuppression in whom CMV encephalitis has been ruled out, though this issue requires further study.
Effects of interferon on antibody formation
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.
1984-01-01
Studies of the effects of interferon on primary and secondary antibody responses and of the relationship of interferon to other cytokines, or cell products, are presented. Dosage- and timing-dependent immunoenhancing and immunosuppressive activities of interferon are documented for mouse spleen cell cultures and for mice infected with murine hepatitis virus (MHV-3). A possibility that altered interferon production might lead to immunopathological disorders, such as lupus erythematosus, AIDS, arthritis, etc., is discussed. Latest technological developments are presented that indicate that interferon does apparently play a major role in the regulation of antibody responses.
Deckert-Schlüter, M; Rang, A; Weiner, D; Huang, S; Wiestler, O D; Hof, H; Schlüter, D
1996-12-01
Toxoplasma gondii may cause severe infections in immunocompromised patients including fetuses and those with AIDS. Among the factors mediating protection against T. gondii, IFN-gamma has gained special attention. To analyze the role of IFN-gamma in the early phase of toxoplasmosis, IFN-gamma receptor-deficient (IFN-gamma R0/0) mice were orally infected with low-virulent toxoplasms. IFN-gamma R0/0 mice died of the disease up to day 10 postinfection, whereas immunocompetent wild-type (WT) mice developed a chronic toxoplasmosis. Histopathology revealed that in IFN-gamma R0/0 mice, the parasite multiplied unrestrictedly in the small intestine, the intestinal lymphatic tissue, the liver, and the spleen. Ultimately, animals died of a necrotizing hepatitis. In WT mice, the same organs were effected, but multiplication of the parasite was effectively limited. Compared with WT mice, immunohistochemistry and flow cytometry demonstrated that in IFN-gamma R0/0 mice, macrophages were only marginally activated in response to the infection, as evidenced by a reduced expression of major histocompatability complex class II antigens. In addition, immunohistochemistry and RT-PCR showed a reduced production of the macrophage-derived cytokines tumor necrosis factor-alpha, inducible nitric oxide synthase, and IL-1 beta in the liver of IFN-gamma R0/0 mice. In contrast, activation of T cells, recruitment of immune cells to inflammatory foci, and anti-T. gondii IgM antibody production were unaffected by the mutation of the IFN-gamma R. Moreover, induction of IL-2, IL-4, and IL-10 mRNA transcripts in the liver was normal in IFN-gamma R0/0 mice. Adoptive transfer experiments revealed that the immune T cells of WT animals did not protect IFN-gamma R0/0 mice from lethal infection with highly virulent toxoplasms, whereas WT mice were significantly protected by the adoptive transfer. Based on these studies, we conclude that IFN-gamma is absolutely required for an efficient activation of
Pithukpakorn, Manop; Roothumnong, Ekkapong; Angkasekwinai, Nasikarn; Suktitipat, Bhoom; Assawamakin, Anunchai; Luangwedchakarn, Voravich; Umrod, Pinklow; Thongnoppakhun, Wanna; Foongladda, Suporn; Suputtamongkol, Yupin
2015-01-01
Recently a newly identified clinical syndrome of disseminated non-tuberculous mycobacterial diseases (with or without other opportunistic infections in adult patients who were previously healthy, has been recognized in association with an acquired autoantibody to interferon-gamma. This syndrome is emerging as an important cause of morbidity and mortality, especially among people of Asian descent. Trigger for the production of this autoantibody remains unknown, but genetic factors are strongly suspected to be involved. We compared HLA genotyping between 32 patients with this clinical syndrome, and 38 controls. We found that this clinical syndrome was associated with very limited allele polymorphism, with HLA-DRB1 and DQB1 alleles, especially HLA-DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02. Odds ratio of DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02 were 7.03 (95% CI, 2.18–22.69, P<0.0001, 9.06 (95% CI, 2.79–29.46, P<0.0001), 6.68 (95% CI, 2.29–19.52, P = 0.0004), and 6.64 (95% CI, 2.30–19.20, P = 0.0004), respectively. Further investigation is warranted to provide better understanding on pathogenesis of this association. PMID:26011559
Mink parvoviruses and interferons: in vitro studies.
Wiedbrauk, D L; Bloom, M E; Lodmell, D L
1986-01-01
Although interferons can inhibit the replication of a number of viruses, little is known about their ability to inhibit parvovirus replication. Therefore, in vitro experiments were done to determine if Aleutian disease virus and mink enteritis virus, two autonomously replicating mink parvoviruses, induced interferon, were sensitive to the effects of interferon, or inhibited the production of interferon. The results indicated that these parvoviruses neither induced nor were sensitive to the effects of interferon. Furthermore, preexisting parvovirus infections did not inhibit poly(I).poly(C)-induced interferon production. This independence from the interferon system may, therefore, be a general property of the autonomously replicating parvoviruses. PMID:2431162
Toy, J L
1983-01-01
An overview of the interferons is presented. A description of something of what is known about them is given, including: their genes; their protein structures and characteristics; their mechanisms of actions; and their varied biological effects emphasising particularly their immunomodulatory actions. Finally, a brief summary is made of the current status of human clinical studies that have been conducted with interferons in the oncological and viral fields, mentioning also recent findings in patients who have the acquired immunodeficiency syndrome (AIDS). PMID:6193915
Nyberg, L; Albrecht, J; Glue, P; Gianelli, G; Zambas, D; Elliot, M; Conrad, A; McHutchison, J
1999-06-01
Ribavirin, a nucleoside analogue, inhibits replication of RNA and DNA viruses and may control hepatitis C virus (HCV) infection through modulation of anti-inflammatory and antiviral actions. Ribavirin monotherapy has no effect on serum HCV RNA levels. In combination with interferon, this agent appears to enhance the efficacy of interferon. The aim of this study was to monitor serum HCV RNA levels early during therapy with interferon and ribavirin compared with that previously seen in the same patients during interferon monotherapy. Five patients who previously showed no response to therapy with interferon alfa 3 MU three times weekly for 6 months were retreated with the identical dose of interferon alfa 2b in combination with oral ribavirin 1,000 mg/day. Serum HCV RNA levels were monitored at baseline, week 4, week 8, and week 12 of therapy by a quantitative multicycle polymerase chain reaction assay. In the first 8 to 12 weeks, serum HCV RNA levels showed a greater decrease in all patients when retreated with combination therapy compared with interferon alone. Mean (+/- SEM) serum HCV RNA levels for interferon therapy alone were 3.3 +/- 0.95, 1.2 +/- 0.95, 1.6 +/- 1.2, and 2.3 +/- 1.2 x 10(6) copies/ml at week 0, 4, 8, and 12, respectively. This was compared with 3.3 +/- 0.83, 0.3 +/- 0.2, 0.03 +/- 0.02, and 0.15 +/- 0.14 x 10(6), respectively, for the interferon and ribavirin group (p < 0.07 at week 8). Two of five patients had undetectable serum HCV RNA during combination therapy. Combination therapy with interferon and ribavirin in prior interferon nonresponders reduces serum HCV RNA levels compared with interferon alone. This may suggest some additional antiviral effect of ribavirin when given with interferon.
ERIC Educational Resources Information Center
Talbot, Elizabeth A.; Harland, Dawn; Wieland-Alter, Wendy; Burrer, Sherry; Adams, Lisa V.
2012-01-01
Objective: Interferon-[gamma] release assays (IGRAs) are an important tool for detecting latent "Mycobacterium tuberculosis" infection (LTBI). Insufficient data exist about IGRA specificity in college health centers, most of which screen students for LTBI using the tuberculin skin test (TST). Participants: Students at a low-TB incidence college…
López, Tatiana; García, Diego; Angel, Bárbara; Carrasco, Elena; Codner, Ethel; Ugarte, Francisca; Pérez-Bravo, Francisco
2008-02-02
In order to assess whether Fok I vitamin D receptor gene (VDR) polymorphism is involved in the genetic susceptibility of type 1 diabetes, a case-control study was conducted and VDR genotypes were related to serum concentrations of 25(OH) vitamin D and cytokines transforming growth factor beta1 (TGF-beta1) and interferon gamma (INF-gamma). 151 incident cases of type 1 diabetes and 182 non related healthy controls from Santiago were studied for VDR polymorphisms in peripheral blood DNA. Exon 2 (Fok I) segments were amplified by polimerase chain reaction and analyzed by means of restriction fragment length polymorphism to determine each corresponding genotype. Differences for allele, genotype and serological markers as 25(OH) vitamin D, TGF-beta1 and INF-gamma levels distribution between patients and controls were analyzed. Fok I polymorphism distribution analysis showed no differences between patients and controls. Among diabetics, higher levels of TGF-beta1 (median, 282.6 pg/ml; range, 131.8-3,031.4) were observed compared with healthy children (median, 232.2 pg/ml; range, 135.7-506.5) (p < 0.0038). Similar results were observed for INF-gamma concentrations (median, 121.1 pg/ml, and range, 5.3-228.8, in cases, and median, 89.6 pg/ml, and range, 10.9-117.2 in controls) (p < 0.0004). The diabetic carriers of the ff genotype showed low levels of 25(OH) vitamin D compared with the carriers of the F allele: mean (standard deviation), 23.1 (5.9) versus 27.9 (10.3) ng/ml (p < 0.03). A similar result was observed for TGF-beta1 concentrations in diabetic carriers of ff genotype and patients carriers of the F allele (298.5 versus 276.6; p < 0.05). Fok I polymorphism of VDR could have a marginal role in the immunologic disturbance in type 1 diabetes.
[Characterization and comparison of interferon reference standards using UPLC-MS].
Tao, Lei; Pei, De-ning; Han, Chun-mei; Chen, Wei; Rao, Chun-ming; Wang, Jun-zhi
2015-01-01
The study aims to characterize and compare interferon reference standards from 5 manufacturers. By testing molecular mass and trypsin-digested peptide mass mapping, the amino acid sequence was verified and post-translational modifications such as disulfide bond were identified. Results show that the molecular mass and amino acid sequence were consistent with theory; the disulfide bonds of 4 lots of interferon were Cys1-Cys98/Cys29-Cys138, 1 lot was Cys29-Cys139/Cys86-Cys99; N-terminal "+Met", acetyl N-terminal and Met oxidation were identified in part of the sample. UPLC-MS can be used to characterize and compare interferon reference standards from different manufacturers.
Plasma interferon-gamma-inducible protein-10 (IP-10) levels during acute hepatitis C virus infection
Grebely, Jason; Feld, Jordan J.; Applegate, Tanya; Matthews, Gail V.; Hellard, Margaret; Sherker, Alana; Petoumenos, Kathy; Zang, Geng; Shaw, Ineke; Yeung, Barbara; George, Jacob; Teutsch, Suzy; Kaldor, John M.; Cherepanov, Vera; Bruneau, Julie; Shoukry, Naglaa H.; Lloyd, Andrew R.; Dore, Gregory J.
2013-01-01
Systemic levels of interferon-gamma-inducible protein-10 (IP-10) are predictive of treatment-induced clearance in chronic HCV. In the present study, factors associated with plasma IP-10 levels at the time of acute HCV detection and the association between IP-10 levels and spontaneous clearance were assessed in three cohorts of acute HCV infection. Among 300 individuals, 245 (181 male, 47 HIV+) were HCV RNA+ at acute HCV detection. In adjusted analysis, factors independently associated with IP-10 levels ≥150 pg/mL (median level) included HCV RNA levels >6 log IU/mL, HIV co-infection and non-Aboriginal ethnicity. Among 245 HCV RNA+ at acute HCV detection, 214 were untreated (n=137) or had persistent infection (infection duration ≥26 weeks) at treatment initiation (n=77). Spontaneous clearance occurred in 14% (29 of 214). Individuals without spontaneous clearance had significantly higher mean plasma IP-10 levels at the time of acute HCV detection than those with clearance (248±32 vs. 142±22 pg/mL, P=0.008). The proportion of individuals with spontaneous clearance was 0% (0 of 22, P=0.048) and 16% (27 of 165) and in those in those with and without plasma IP-10 levels ≥380 pg/mL. In adjusted analyses, favourable IL28B genotype was associated with spontaneous clearance, while higher HCV RNA level was independently associated with lower odds of spontaneous clearance. Conclusion High IP-10 levels at acute HCV detection were associated with failure to spontaneously clear HCV. Patients with acute HCV and high baseline IP-10 levels, particularly >380 pg/mL, should be considered for early therapeutic intervention, and those with low levels should defer therapy for potential spontaneous clearance. PMID:23325615
Various heterologous cells exhibit interferon induced transfer of viral resistance.
Hughes, T K; Blalock, J E; Baron, S
1978-01-01
Previously it was shown that cocultivation of mouse L and human WISH or baby hamster kidney cells in the presence of mouse interferon resulted in decreased viral yield from both cell species. We now show that this phenomenon also occurs when rabbit kidney and human WISH cells, with their corresponding interferons, are cocultivated with human WISH and baby hamster kidney cells, respectively. This finding increases the number of donor cell types to three. The related finding that monkey VERO and chick embryo cells can be recipients of transferred resistance expands the number of heterologous recipient cell species capable of receiving transferred resistence to five. Not all cell types tested have been shown to function in this transfer system. The fact that VERO cells, which do not produce interferon, are capable of receiving transferred resistence is significant because it indicates that the mechanism of transfer does not involve production or interferon by the recipient cells.
No Love Lost Between Viruses and Interferons.
Fensterl, Volker; Chattopadhyay, Saurabh; Sen, Ganes C
2015-11-01
The interferon system protects mammals against virus infections. There are several types of interferons, which are characterized by their ability to inhibit virus replication and resultant pathogenesis by triggering both innate and cell-mediated immune responses. Virus infection is sensed by a variety of cellular pattern-recognition receptors and triggers the synthesis of interferons, which are secreted by the infected cells. In uninfected cells, cell surface receptors recognize the secreted interferons and activate intracellular signaling pathways that induce the expression of interferon-stimulated genes; the proteins encoded by these genes inhibit different stages of virus replication. To avoid extinction, almost all viruses have evolved mechanisms to defend themselves against the interferon system. Consequently, a dynamic equilibrium of survival is established between the virus and its host, an equilibrium that can be shifted to the host's favor by the use of exogenous interferon as a therapeutic antiviral agent.
Kalunian, K C
2016-09-01
Clinical trials of investigational agents in systemic lupus erythematosus (SLE) have focused on targeting dysregulated B and T cells; however, recent translational research findings of the importance of the dysregulation of the innate immune system in SLE have led to clinical trials that target interferon. Three biologics that target type I interferons have been tested for their efficacy and safety in active SLE patients; these phase II trials have tested the hypothesis that down-regulation of interferon-regulated gene expression (the interferon signature) lessen the clinical burden of SLE. Rontalizumab, an anti-interferon-α monoclonal antibody, was studied in patients who had discontinued immunosuppressants. This study failed to show efficacy as assessed by both two outcome assessments; however, in low interferon signature patients, response was higher and corticosteroid usage was less in rontalizumab-treated patients. Sifalimumab, another anti-interferon-α monoclonal antibody, was studied in patients who remained on standard of care therapy. This study showed significantly better efficacy in patients treated with two sifalimumab dosages; significant differences were seen in the high interferon signature group. In a similar design and in a similar population as the sifalimumab study, anifrolumab, a monoclonal antibody that binds to a type I interferon receptor, was studied in patients who remained on standard of care therapy. In this study, one dosage group demonstrated efficacy and statistically significant effects were achieved in both tested dosage groups with secondary end points. Oral corticosteroid reduction to ≤7.5 mg daily was achieved in one of the tested dosage groups and organ-specific outcomes were significantly improved in that same group. For all studies, no significant differences in serious adverse effects were seen; although, herpes zoster infections were increased in sifalimumab- and anifrolumab-treated patients and influenza rates were
Adam, Liana; Black, Peter C; Kassouf, Wassim; Eve, Beryl; McConkey, David; Munsell, Mark F; Benedict, William F; Dinney, Colin P N
2007-05-01
Intravesical adenovirus mediated interferon-alpha gene transfer has a potent therapeutic effect against superficial human bladder carcinoma xenografts growing in the bladder of athymic nude mice. We determined whether the inhibition of angiogenesis might contribute to the antitumor effect. We treated several human urothelial carcinoma cells with adenovirus mediated interferon-alpha 2b and monitored its effects on the production of angiogenic factors using real-time reverse-transcription polymerase chain reaction, Western blotting, and immunohistochemical analysis and a gel shift based transcription factor array. To assess the role of adenovirus mediated interferon 2b in angiogenic activity we used in vitro invasion assays and evaluated the anti-angiogenic effects of adenovirus mediated interferon gene therapy in an orthotopic murine model of human superficial bladder cancer. In adenovirus mediated interferon-alpha infected 253J B-V cells vascular endothelial growth factor was decreased and anti-angiogenic interferon-gamma inducible protein 10 was up-regulated. In contrast, the addition of as much as 100,000 IU recombinant interferon had no apparent effect on vascular endothelial growth factor production. Conditioned medium derived from adenovirus mediated interferon 2b infected 253J B-V cells greatly decreased the invasive potential of human endothelial cells and down-regulated their matrix metalloproteinase 2 expression compared to controls. Furthermore, adenovirus mediated interferon 2b blocked pro-angiogenic nuclear signals, such as the transcription factors activating protein-1 and 2, stimulating protein-1, nuclear factor kappaB and c-myb. In vivo experiments revealed significant vascular endothelial growth factor down-regulation and decreased tumor vessel density in the adenovirus mediated interferon 2b treated group compared to controls. Treatment with adenovirus mediated interferon 2b increases the angiostatic activity of the bladder cancer microenvironment
[Plasma levels of interferon gamma and interleukin 10 in patients with lymphonodular toxoplasmosis].
Bielec, D; Patorska-Mach, E; Semczuk, G; Toruń, E
1997-01-01
The concentrations of IFN gamma and IL 10 in plasma of sixteen patients with toxoplasmic lymphadenopathy were measured. These examinations were carried out two times in the interval of a month. We found increased level of IFN gamma and normal concentrations of IL 10 in both of these terms.
Jung, Yu Jung; Woo, Hye In; Jeon, Kyeongman; Koh, Won-Jung; Jang, Dong Kyoung; Cha, Hoon Suk; Koh, Eun Mi; Lee, Nam Yong; Kang, Eun-Suk
2015-01-01
We compared two interferon gamma release assays (IGRAs), QuantiFERON-TB Gold In-Tube (QFT-GIT) and T-SPOT.TB, for diagnosis of latent tuberculosis infection (LTBI) in patients before and while receiving tumor necrosis factor (TNF)-α antagonist therapy. This study evaluated the significance of sensitive IGRAs for LTBI screening and monitoring. Before starting TNF-α antagonist therapy, 156 consecutive patients with rheumatic diseases were screened for LTBI using QFT-GIT and T-SPOT.TB tests. According to our study protocol, QFT-GIT-positive patients received LTBI treatment. Patients positive by any IGRAs were subjected to follow-up IGRA tests after completing LTBI-treatment and/or during TNF-α antagonist therapy. At the initial LTBI screening, 45 (28.9%) and 70 (44.9%) patients were positive by QFT-GIT and T-SPOT.TB, respectively. The agreement rate between IGRA results was 78.8% (k = 0.56; 95% confidence interval [95% CI] = 0.43 to 0.68). Of 29 patients who were positive only by T-SPOT.TB in the initial screening, 83% (19/23) were persistently positive by T-SPOT.TB, while QFT-GIT testing showed that 36% (9/25) had conversion during TNF-α antagonist therapy. By the end of the follow-up period (218 to 1,264 days), four patients (4/137, 2.9%) developed active tuberculosis (TB) diseases during receiving TNF-α antagonist therapy. Among them, one was Q-T+, one was Q+T-, and the remaining two were Q-T- at the initial screening (Q, QuantiFERON-TB Gold In-Tube; T, T-SPOT.TB; +, positive; -, negative). Two (2/4, 50%) patients with TB reactivation had at least one prior risk factor consistent with previous TB infection. This study demonstrated the need to capitalize on sensitive IGRAs to monitor for LTBI in at-risk patients for a more sensitive diagnosis in countries with an intermediate TB burden.
Igarashi, Ikuo; Suzuki, Reiko; Waki, Seiji; Tagawa, Yoh-Ichi; Seng, Seyha; Tum, Sothyra; Omata, Yoshitaka; Saito, Atsushi; Nagasawa, Hideyuki; Iwakura, Yohichiro; Suzuki, Naoyoshi; Mikami, Takeshi; Toyoda, Yutaka
1999-01-01
Babesia microti produces a self-limiting infection in mice, and recovered mice are resistant to reinfection. In the present study, the role of T cells in protective immunity against challenge infection was examined. BALB/c mice which recovered from primary infection showed strong protective immunity against challenge infection. In contrast, nude mice which failed to control the primary infection and were cured with an antibabesial drug did not show protection against challenge infection. Treatment of immune mice with anti-CD4 monoclonal antibody (MAb) diminished the protective immunity against challenge infection, but treatment with anti-CD8 MAb had no effect on the protection. Transfer of CD4+ T-cell-depleted spleen cells resulted in higher parasitemia than transfer of CD8+ T-cell-depleted spleen cells. A high level of gamma interferon (IFN-γ), which was produced by CD4+ T cells, was observed for the culture supernatant of spleen cells from immune mice, and treatment of immune mice with anti-IFN-γ MAb partially reduced the protection. Moreover, no protection against challenge infection was found in IFN-γ-deficient mice. On the other hand, treatment of immune mice with MAbs against interleukin-2 (IL-2), IL-4, or tumor necrosis factor alpha did not affect protective immunity. These results suggest essential requirements for CD4+ T cells and IFN-γ in protective immunity against challenge infection with B. microti. PMID:10417185
Wrighton-Smith, Peter; Sneed, Laurie; Humphrey, Frances; Tao, Xuguang; Bernacki, Edward
2012-07-01
To determine the price point at which an interferon-γ release assay (IGRA) is less costly than a tuberculin skin test (TST) for health care employee tuberculosis screening. A multidecision tree-based cost model incorporating inputs gathered from time-motion studies and parallel testing by IGRA and TST was conducted in a subset of our employees. Administering a TST testing program costs $73.20 per person screened, $90.80 per new hire, and $63.42 per annual screen. Use of an IGRA for employee health testing is cost saving at an IGRA test cost of $54.83 or less per test and resulted in higher completion rates because of the elimination of the need for a second visit to interpret the TST. Using an IGRA for employee health screening can be an institutional cost saving and results in higher compliance rates.
[Fish interferon response and its molecular regulation: a review].
Zhang, Yibing; Gui, Jianfang
2011-05-01
Interferon response is the first line of host defense against virus infection. Recent years have witnessed tremendous progress in understanding of fish innate response to virus infection, especially in fish interferon antiviral response. A line of fish genes involved in interferon antiviral response have been identified and functional studies further reveal that fish possess an IFN antiviral system similar to mammals. However, fish virus-induced interferon genes contain introns similar to mammalian type III interferon genes although they encode proteins similar to type I interferons, which makes it hard to understand the evolution of vertebrate interferon genes directly resulting in a debate on nomenclature of fish interferon genes. Actually, fish display some unique mechanisms underlying interferon antiviral response. This review documents the recent progress on fish interferon response and its molecular mechanism.
Effects of isolation on interferon production and hematological and immunological parameters
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Measel, J.; Loken, M. R.; Degioanni, J.; Follini, S.; Galvagno, A.; Montalbini, M.
1992-01-01
A 27-year-old woman was maintained in an isolated state for 131 days in Carlsbad Caverns, New Mexico. Her diet was vitamin D-depleted. Determinations on the effects of such isolation on levels and activities of peripheral blood cells that are important for hematological homeostasis and immunological function were carried out. Throughout the duration of the study, the percentage of lymphoid cells that expressed CD3, CD4, CD8, CD19, Leu 8, and other markers remained relatively constant although the absolute numbers of these cells varied. Although the percentage of natural killer (NK) cells did not vary, the activity of these cells did change. NK cell activity became elevated as the isolation study progressed. Production of interferon-gamma (IFN-gamma) in response to mitogen stimulation was higher than expected throughout the isolation periods, but returned to the normal range after termination of the isolation. Red and white cell counts dropped significantly upon entering isolation, but soon returned to normal.
Cappelli, G; Volpe, P; Sanduzzi, A; Sacchi, A; Colizzi, V; Mariani, F
2001-12-01
Mycobacterium tuberculosis is an intracellular pathogen that readily survives and replicates in human macrophages (MPhi). Host cells have developed different mycobactericidal mechanisms, including the production of inflammatory cytokines. The aim of this study was to compare the MPhi response, in terms of cytokine gene expression, to infection with the M. tuberculosis laboratory strain H37Rv and the clinical M. tuberculosis isolate CMT97. Both strains induce the production of interleukin-12 (IL-12) and IL-16 at comparable levels. However, the clinical isolate induces a significantly higher and more prolonged MPhi activation, as shown by reverse transcription-PCR analysis of IL-1beta, IL-6, IL-10, transforming growth factor beta, tumor necrosis factor alpha, and gamma interferon (IFN-gamma) transcripts. Interestingly, when IFN-gamma transcription is high, the number of M. tuberculosis genes expressed decreases and vice versa, whereas no mycobactericidal effect was observed in terms of bacterial growth. Expression of 11 genes was also studied in the two M. tuberculosis strains by infecting resting or activated MPhi and compared to bacterial intracellular survival. In both cases, a peculiar inverse correlation between expression of these genes and multiplication was observed. The number and type of genes expressed by the two strains differed significantly.
Adjuvant immunotherapy of feline fibrosarcoma with recombinant feline interferon-omega.
Hampel, Verena; Schwarz, Bianca; Kempf, Christine; Köstlin, Roberto; Schillinger, Ulrike; Küchenhoff, Helmut; Fenske, Nora; Brill, Thomas; Hirschberger, Johannes
2007-01-01
Recombinant feline interferon-omega (rFeIFN-omega) was tested as a treatment option for cats with fibrosarcoma to assess safety and feasibility. Treatment with rFeIFN-omega in cats with fibrosarcoma is safe and feasible. Twenty domestic cats. In an open-labeled uncontrolled clinical trial 12 injections of 1 x 10(6) U/kg rFeIFN-omega were administered over a 5-week period: the 1st through 4th injections were given intratumorally, and the 5th through 12th injections were administered subcutaneously at the tumor excision site. Wide surgical excision of the tumors was carried out after the 4th injection and before the 5th injection of rFeIFN-omega. A Common Terminology Criteria for Adverse Events (CTCAE) analysis was conducted. Flow cytometry of fibrosarcoma cells after incubation with rFeIFN-omega and recombinant feline interferon-gamma was performed to assess the biological effect of rFeIFN-omega. Changes in blood cell count, increases in serum aspartate-amino-transferase activity, serum bilirubin concentration, serum creatinine and serum electrolyte concentrations, weight loss, anorexia, increased body temperature, and reduced general condition were observed but were mostly minor (grade 1 and 2) and self limiting. Eosinophilia (P = .025), neutropenia (P = .021), and weight loss (P < .001) were statistically correlated with rFeIFN-omega-treatment (analysis of parameters before treatment and after 3 injections of rFeIFN-omega). Flow cytometry of 5 unrelated feline fibrosarcoma cell lines showed increased expression of major histocompatibility complex (MHC) class I molecules (P = .026) in response to in vitro incubation with rFeIFN-omega, whereas expression of MHC class II molecules was not affected significantly. RFeIFN-omega for the treatment of feline fibrosarcoma is safe, well tolerated, and can be easily performed in practice. To assess the efficacy of the treatment, it should be tested in a placebo-controlled trial.
Low energy prompt gamma-ray tests of a large volume BGO detector.
Naqvi, A A; Kalakada, Zameer; Al-Anezi, M S; Raashid, M; Khateeb-ur-Rehman; Maslehuddin, M; Garwan, M A
2012-01-01
Tests of a large volume Bismuth Germinate (BGO) detector were carried out to detect low energy prompt gamma-rays from boron and cadmium-contaminated water samples using a portable neutron generator-based Prompt Gamma Neutron Activation Analysis (PGNAA) setup. Inspite of strong interference between the sample- and the detector-associated prompt gamma-rays, an excellent agreement has been observed between the experimental and calculated yields of the prompt gamma-rays, indicating successful application of the large volume BGO detector in the PGNAA analysis of bulk samples using low energy prompt gamma-rays. Copyright © 2011 Elsevier Ltd. All rights reserved.
Afzal, Muhammad Sohail
2016-09-18
In Pakistan which ranked second in terms of hepatitis C virus (HCV) infection, it is highly needed to have an established diagnostic test for antiviral therapy response prediction. Interleukin 28B (IL-28B) genetic testing is widely used throughout the world for interferon based therapy prediction for HCV patients and is quite helpful not only for health care workers but also for the patients. There is a strong relationship between single nucleotide polymorphisms at or near the IL-28B gene and the sustained virological response with pegylated interferon plus ribavirin treatment for chronic hepatitis C. Pakistan is a resource limited country, with very low per capita income and there is no proper social security (health insurance) system. The allocated health budget by the government is very low and is used on other health emergencies like polio virus and dengue virus infection. Therefore it is proposed that there should be a well established diagnostic test on the basis of IL-28B which can predict the antiviral therapy response to strengthen health care set-up of Pakistan. This test once established will help in better management of HCV infected patients.
van Brummelen, Sigrid E.; Bauwens, Anja M.; Schlösser, Noël J.; Arend, Sandra M.
2010-01-01
Treatment of latent Mycobacterium tuberculosis infection on the basis of the tuberculin skin test (TST) result is inaccurate due to the false-positive TST results that occur after Mycobacterium bovis BCG vaccination or exposure to nontuberculous mycobacteria (NTM). Gamma interferon release assays (IGRAs) are based on M. tuberculosis-specific antigens. In a previous study among BCG-naïve military employees, a positive TST result after deployment was mostly associated with a negative IGRA result, suggesting exposure to NTM. Data regarding the kinetics of IGRAs are limited and controversial. The present study aimed to reassess the rate of false-positive TST results and to evaluate the kinetics of the Quantiferon TB Gold In-Tube assay (QFT-Git) in military personnel with a positive TST result. QFT-Git was performed at the time of inclusion in the study and was repeated after 2, 6, 12, and 18 or 24 months. Of 192 participants, 17 were recruits and 175 were screened after deployment (n = 169) or because of travel or health care work. Baseline positive QFT-Git results were observed in 7/17 (41.2%) and 12/174 (6.9%) participants, respectively. During follow-up, a negative QFT-Git result remained negative in 163/165 (98.8%) participants. Of 18 subjects with an initial positive QFT-Git result, reversion to a negative result occurred in 1/6 (16%) recruits, whereas it occurred in 8/12 (66%) subjects after deployment or with other risk factors (P = 0.046). The quantitative result was significantly lower in subjects with reversion than in those with consistent positive results (P = 0.017). This study confirmed a low rate of positive QFT-Git results among military personnel with a positive TST result after deployment, supporting the hypothesis of exposure to NTM. Reversion of the majority of initially low-positive QFT-Git results indicates that QFT-Git may be useful for the diagnosis of later reinfections. PMID:20375241
Controlling nuclear JAKs and STATs for specific gene activation by IFN{gamma}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea
2011-07-08
Highlights: {yields} Gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interact with the promoter region of IFN{gamma}-associated genes along with transcription factor STAT1{alpha}. {yields} We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. {yields} The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interacted with the promoter region of IFN{gamma}-activated genes along with transcription factor STAT1{alpha}. Recent studies have suggested that activated Janus kinases pJAK2 andmore » pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFN{gamma}. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFN{gamma} treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The {beta}-actin gene, which is not activated by IFN{gamma}, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFN{gamma} treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFN{gamma} treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFN{gamma
Mutimer, D; Naoumov, N; Honkoop, P; Marinos, G; Ahmed, M; de Man, R; McPhillips, P; Johnson, M; Williams, R; Elias, E; Schalm, S
1998-06-01
Alpha-interferon achieves seroconversion in about one third of naive patients. Attempts to achieve seroconversion in patients who have previously failed alpha-interferon have proved disappointing. Combination chemotherapy (alpha-interferon with a nucleoside analogue) might provide a treatment alternative for these patients. We have undertaken a phase 2 study in 20 patients who had previously failed at least one course of alpha-interferon. The study was designed to assess the safety, tolerability and efficacy of the combination. All patients were treated for 16 weeks with alpha-interferon in combination with 12 or 16 weeks of Lamivudine (3'TC). Patients were followed for 16 weeks post-treatment. Pharmacokinetic studies were performed to identify/exclude significant pharmacokinetic drug interaction. The combination was well tolerated, and side-effects of the combination were indistinguishable from the recognised side-effects of alpha-interferon. Pharmacokinetic studies performed on days 1 and 29 did not show any significant interaction. All patients achieved HBV DNA clearance during treatment, but 19 relapsed at the end of treatment. HBeAg/anti-HBe seroconversion was observed for four patients, but was sustained for a single patient (who also had sustained DNA clearance). Combination therapy with alpha-interferon and lamivudine given for 16 weeks appears safe and is well tolerated. However, for this group of patients who had previously failed interferon monotherapy, the efficacy of combination interferon/lamivudine therapy appears disappointing, and other treatment strategies should be investigated.
[Alpha interferon induced hyperthyroidism: a case report and review of the literature].
Maiga, I; Valdes-Socin, H; Thiry, A; Delwaide, J; Sidibe, A T; Beckers, A
2015-01-01
Treatment with alpha interferon in hepatitis C triggers a thyroid autoimmunity in a variable percentage of cases (2-8%). This complication raises some questions about its screening, the possibility to continue anti-viral therapy and thyroid treatment. Alpha interferon has an immunomodulatory effect on the thyroid, but also an inhibitory effect on thyroid hormone synthesis. This explains the occurrence of cases of thyroid dysfunction, which often remain undetected because of their latency. Factors predicting thyroid dysfunction with interferon use are: female sex, history of thyroid disease and previous autoimmunity. Several clinical aspects are encountered including hypothyroidism (the most frequent depending on the series) and hyperthyroidism related to Graves' disease. For their detection, a cooperation between general practionners, gastroenterologists and endocrinologists is mandatory thyroid function tests are requested before, during and after treatment,with alpha interferon. Therapeutic aspects of thyroid disorders range from simple monitoring to symptomatic treatment, such as thyroxine prescription in the presence of hypothyroidism. Antithyroid drugs radioactive iodine or thyroid surgery are used in cases of severe or persistent Graves' disease induced by alpha interferon.
Schwaab, T; Heaney, J A; Schned, A R; Harris, R D; Cole, B F; Noelle, R J; Phillips, D M; Stempkowski, L; Ernstoff, M S
2000-04-01
The clinical observation of spontaneous regression in patients with renal cell carcinoma (RCC) and the response to various immunotherapeutic therapies strongly suggest a role for the host immune system in this disease. Prior studies showed that sequential administration of interferon (IFN) gamma and IFN alpha to RCC patients was safe. Clinical responses as well as immune changes in the peripheral blood mononuclear cell compartment were observed. Autologous tumor cell vaccines (AV) have also demonstrated activity in renal cell carcinoma. We hypothesize that the addition of AV to sequential IFN gamma and a therapy might improve the tumor-specific immune response by providing an appropriate source of antigen in the appropriate cytokine environment. To our knowledge, this is the first trial using AV combined with IFN alpha and IFN gamma. The purpose of this study was to evaluate the feasibility of manufacturing and administering (AV) from resected tumor samples, and administration of AV with combination IFN gamma and IFN alpha therapy. Finally, the impact on immunological parameters of these treatment options was assessed. Patients with metastatic RCC were randomly assigned to receive AV plus bCG along with a sequential administration of IFN gamma and a either together or after initiation of vaccine. Toxicity and clinical responses were evaluated. Modulations of the immune system were investigated by analyzing phenotype, cytokine mRNA expression, T cell proliferation and cytotoxicity in the peripheral blood mononuclear cell compartment. Fourteen patients with metastatic renal cell carcinoma were enrolled in this study; 9 were available for response evaluation. In a 70 day period, 3 (33%) showed mixed responses, 5 (56%) stable disease and 1 (11%) progression of disease. Toxicities were consistent with previous clinical reports. In the flow-cytometry phenotype analysis, stimulation of distinct subsets of circulating T-lymphocytes and a decrease of CD8+ T cell subsets was
de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M
2009-10-01
A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.
Bansal, Ruchi; Prakash, Jai; De Ruiter, Marieke; Poelstra, Klaas
2014-04-10
Hepatic stellate cells play a crucial role in the pathogenesis of hepatic fibrosis. Thus, pharmacological inhibition of pro-fibrotic activities of these cells might lead to an effective therapy for this disease. Among the potent anti-fibrotics, interferon gamma (IFNγ), a proinflammatory cytokine, is highly efficacious but it failed in clinical trials due to the poor efficacy and multiple adverse effects attributed to the ubiquitous IFNγ receptor (IFNγR) expression. To resolve these drawbacks, we chemically synthesized a chimeric molecule containing (a) IFNγ signaling peptide (IFNγ peptidomimetic, mimγ) that retains the agonistic activities of IFNγ but lacks an extracellular receptor recognition sequence for IFNγR; coupled via heterobifunctional PEG linker to (b) bicyclic platelet derived growth factor beta receptor (PDGFβR)-binding peptide (BiPPB) to induce internalization into the stellate cells that express PDGFβR. The synthesized targeted IFNγ peptidomimetic (mimγ-BiPPB) was extensively investigated for its anti-fibrotic and adverse effects in acute and chronic CCl4-induced liver fibrosis models in mice. Treatment with mimγ-BiPPB, after the onset of disease, markedly inhibited both early and established hepatic fibrosis as reflected by a reduced intrahepatic α-SMA, desmin and collagen-I mRNA expression and protein levels. While untargeted mimγ and BiPPB had no effect, and native IFNγ only induced a moderate reduction. Additionally, no off-target effects, e.g. systemic inflammation, were found with mimγ-BiPPB, which were substantially observed in mice treated with native IFNγ. The present study highlights the beneficial effects of a novel BiPPB mediated cell-specific targeting of IFNγ peptidomimetic to the disease-inducing cells and therefore represents a highly potential therapeutic approach to treat fibrotic diseases. Copyright © 2014 Elsevier B.V. All rights reserved.
Keskin, Ozlem; Tuncer, Ayfer; Adalioglu, Gonul; Sekerel, Bulent E; Sackesen, Cansin; Kalayci, Omer
2005-05-01
Information on the utility of atopy patch testing (APT) in the diagnosis of food allergy is derived from studies of children with atopic dermatitis. To evaluate the usefulness of APT in the diagnosis of cow's milk allergy (CMA) and to determine interleukin 4 and interferon-gamma production by peripheral blood mononuclear cells. Thirty-seven children (median age, 11 months) with suspected CMA who had a variety of symptoms that involved many organ systems were evaluated using double-blind placebo-controlled food challenges (DBPCFCs), and the performances of milk specific IgE, skin prick testing (SPT), and APT were determined. To search for a possible relationship between the diagnostic tests and the TH1/TH2 immune response, we measured interferon-gamma and interleukin 4 levels in the supernatants of peripheral blood mononuclear cell cultures. Seventeen children with positive DBPCFC results and 6 with a history of anaphylaxis were diagnosed as having CMA. The combined use of APT and SPT had a sensitivity of 100% and a negative predictive value of 100% but a specificity of 50% and a positive predictive value of 76%. The addition of milk specific IgE assays to APT and SPT did not improve these values. Pattern of cytokine secretion was not associated with APT positivity or a specific response to DBPCFC. Atopy patch testing may be a useful adjunct to SPT in excluding CMA in children who have allergic manifestations other than atopic dermatitis. However, DBPCFCs are still necessary in the presence of positive test results.
21 CFR 862.1360 - Gamma-glutamyl transpeptidase and isoenzymes test system.
Code of Federal Regulations, 2012 CFR
2012-04-01
... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1360 Gamma-glutamyl transpeptidase and isoenzymes test system. (a...
21 CFR 862.1360 - Gamma-glutamyl transpeptidase and isoenzymes test system.
Code of Federal Regulations, 2014 CFR
2014-04-01
... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1360 Gamma-glutamyl transpeptidase and isoenzymes test system. (a...
Estes, D M; Tuo, W; Brown, W C; Goin, J
1998-12-01
In this report, we sought to determine the role of selected type I interferons [interferon-alpha (IFN-alpha) and interferon-tau (IFN-tau)], IFN-gamma and transforming growth factor-beta (TGF-beta) in the regulation of bovine antibody responses. B cells were stimulated via CD40 in the presence or absence of B-cell receptor (BCR) cross-linking. IFN-alpha enhanced IgM, IgG2 and IgA responses but did not enhance IgG1 responses. BCR signalling alone was more effective at inducing IgG2 responses with IFN-alpha than dual cross-linking with CD40. Recombinant ovine IFN-tau was less effective at inducing IgG2 responses when compared with IFN-alpha, though IgA responses were similar in magnitude following BCR cross-linking. At higher concentrations, IFN-tau enhanced IgA responses greater than twofold over the levels observed with IFN-alpha. Previous studies have shown that addition of IFN-gamma to BCR or pokeweed mitogen-activated bovine B cells stimulates IgG2 production. However, following CD40 stimulation alone, IFN-gamma was relatively ineffective at stimulating high-rate synthesis of any non-IgM isotype. Dual cross-linking via CD40 and the BCR resulted in decreased synthesis of IgM with a concomitant increase in IgA and similar levels of IgG2 production to those obtained via the BCR alone. We also assessed the effects of endogenous and exogenous TGF-beta on immunoglobulin synthesis by bovine B cells. Exogenous TGF-beta stimulates both IgG2 and IgA production following CD40 and BCR cross-linking in the presence of IL-2. Blocking endogenous TGF-beta did not inhibit the up-regulation of IgG2 or IgA by interferons.
[The expression of interferon-lambda1 in CHO cell].
Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu
2013-06-01
To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.
2006-05-31
the project through a business case analysis conducted on this same subject. CAPT Monestersky, Preventive Medicine; LCDR Jacobs, Occupational Medicine...TB and LTBI (Taylor, Nolan, & Blumberg , Interferon-y screening for TB 8 2005). They are based on science founded in the 1 9 th century. The current...identify individuals who may not be suitable for service. For the majority who are suitable, the "P" days allow time to complete necessary business
Muramatsu, Matthew K.; Brothwell, Julie A.; Stein, Barry D.; Putman, Timothy E.; Rockey, Daniel D.
2016-01-01
Chlamydia trachomatis can enter a viable but nonculturable state in vitro termed persistence. A common feature of C. trachomatis persistence models is that reticulate bodies fail to divide and make few infectious progeny until the persistence-inducing stressor is removed. One model of persistence that has relevance to human disease involves tryptophan limitation mediated by the host enzyme indoleamine 2,3-dioxygenase, which converts l-tryptophan to N-formylkynurenine. Genital C. trachomatis strains can counter tryptophan limitation because they encode a tryptophan-synthesizing enzyme. Tryptophan synthase is the only enzyme that has been confirmed to play a role in interferon gamma (IFN-γ)-induced persistence, although profound changes in chlamydial physiology and gene expression occur in the presence of persistence-inducing stressors. Thus, we screened a population of mutagenized C. trachomatis strains for mutants that failed to reactivate from IFN-γ-induced persistence. Six mutants were identified, and the mutations linked to the persistence phenotype in three of these were successfully mapped. One mutant had a missense mutation in tryptophan synthase; however, this mutant behaved differently from previously described synthase null mutants. Two hypothetical genes of unknown function, ctl0225 and ctl0694, were also identified and may be involved in amino acid transport and DNA damage repair, respectively. Our results indicate that C. trachomatis utilizes functionally diverse genes to mediate survival during and reactivation from persistence in HeLa cells. PMID:27430273
Crisan, Dana; Grigorescu, Mircea Dan; Radu, Corina; Suciu, Alina; Grigorescu, Mircea
2017-04-01
One of the multiple factors contributing to virological response in chronic hepatitis C (CHC) is interferon-gamma-inducible protein-10 (IP-10). Its level reflects the status of interferon-stimulated genes, which in turn is associated with virological response to antiviral therapy. The aim of this study was to evaluate the role of serum IP-10 levels on sustained virological response (SVR) and the association of this parameter with insulin resistance (IR) and liver histology. Two hundred and three consecutive biopsy proven CHC patients were included in the study. Serum levels of IP-10 were determined using ELISA method. IR was evaluated by homeostasis model assessment-IR (HOMA-IR). Histological features were assessed invasively by liver biopsy and noninvasively using FibroTest, ActiTest and SteatoTest. Predictive factors for SVR and their interrelations were assessed. A cut-off value for IP-10 of 392 pg/ml was obtained to discriminate between responders and non-responders. SVR was obtained in 107 patients (52.70%). Area under the receiver operating characteristic curve for SVR was 0.875 with a sensitivity of 91.6 per cent, specificity 74.7 per cent, positive predictive value 80.3 per cent and negative predictive value 88.7 per cent. Higher values of IP-10 were associated with increasing stages of fibrosis (P<0.01) and higher grades of inflammation (P=0.02, P=0.07) assessed morphologically and noninvasively through FibroTest and ActiTest. Significant steatosis and IR were also associated with increased levels of IP-10 (P=0.01 and P=0.02). In multivariate analysis, IP-10 levels and fibrosis stages were independently associated with SVR. Our findings showed that the assessment of serum IP-10 level could be a predictive factor for SVR and it was associated with fibrosis, necroinflammatory activity, significant steatosis and IR in patients with chronic HCV infection.
Maloney, Nicole S.; Thackray, Larissa B.; Goel, Gautam; Hwang, Seungmin; Duan, Erning; Vachharajani, Punit; Xavier, Ramnik
2012-01-01
Noroviruses (NVs) cause the majority of cases of epidemic nonbacterial gastroenteritis worldwide and contribute to endemic enteric disease. However, the molecular mechanisms responsible for immune control of their replication are not completely understood. Here we report that the transcription factor interferon regulatory factor 1 (IRF-1) is required for control of murine NV (MNV) replication and pathogenesis in vivo. This led us to studies documenting a cell-autonomous role for IRF-1 in gamma interferon (IFN-γ)-mediated inhibition of MNV replication in primary macrophages. This role of IRF-1 in the inhibition of MNV replication by IFN-γ is independent of IFN-αβ signaling. While the signal transducer and activator of transcription STAT-1 was also required for IFN-γ-mediated inhibition of MNV replication in vitro, class II transactivator (CIITA), interferon regulatory factor 3 (IRF-3), and interferon regulatory factor 7 (IRF-7) were not required. We therefore hypothesized that there must be a subset of IFN-stimulated genes (ISGs) regulated by IFN-γ in a manner dependent only on STAT-1 and IRF-1. Analysis of transcriptional profiles of macrophages lacking various transcription factors confirmed this hypothesis. These studies identify a key role for IRF-1 in IFN-γ-dependent control of norovirus infection in mice and macrophages. PMID:22973039
Rapid activation of the interferon system in vivo.
Dianzani, F; Gullino, P; Baron, S
1978-01-01
Experiments were carried out to study the kinetics of local interferon production in the subcutaneous tissues of rats stimulated with Newcastle disease virus. Specifically, the interferon produced and released in the extracellular fluids was collected at various intervals of time in micropore chambers implanted into the subcutaneous tissue of rats. Interferon was detected at moderate titers 1 h after induction, and it was present at high titer at 2 h. The interferon levels remained remarkably high in the samples collected after 3, 5, and 24 h, and in some rats it was still detectable after 48 and 72 h. Since control experiments showed that it requires 2 to 3 h for interferon to penetrate the chambers, it may be concluded that high concentrations of interferon are present in the extracellular fluid within 1 h of induction. The evaluation of the kinetics of production and of the concentrations attained in the extracellular fluid suggests that in a solid tissue a cell infected by a potent interferon inducer may produce interferon early enough and in sufficient quantity to protect neighboring cells before the production of progeny virions. PMID:669799
Human B cells fail to secrete type I interferons upon cytoplasmic DNA exposure.
Gram, Anna M; Sun, Chenglong; Landman, Sanne L; Oosenbrug, Timo; Koppejan, Hester J; Kwakkenbos, Mark J; Hoeben, Rob C; Paludan, Søren R; Ressing, Maaike E
2017-11-01
Most cells are believed to be capable of producing type I interferons (IFN I) as part of an innate immune response against, for instance, viral infections. In macrophages, IFN I is potently induced upon cytoplasmic exposure to foreign nucleic acids. Infection of these cells with herpesviruses leads to triggering of the DNA sensors interferon-inducible protein 16 (IFI16) and cyclic GMP-AMP (cGAMP) synthase (cGAS). Thereby, the stimulator of interferon genes (STING) and the downstream molecules TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3) are sequentially activated culminating in IFN I secretion. Human gamma-herpesviruses, such as Epstein-Barr virus (EBV), exploit B cells as a reservoir for persistent infection. In this study, we investigated whether human B cells, similar to macrophages, engage the cytoplasmic DNA sensing pathway to induce an innate immune response. We found that the B cells fail to secrete IFN I upon cytoplasmic DNA exposure, although they express the DNA sensors cGAS and IFI16 and the signaling components TBK1 and IRF3. In primary human B lymphocytes and EBV-negative B cell lines, this deficiency is explained by a lack of detectable levels of the central adaptor protein STING. In contrast, EBV-transformed B cell lines did express STING, yet both these lines as well as STING-reconstituted EBV-negative B cells did not produce IFN I upon dsDNA or cGAMP stimulation. Our combined data show that the cytoplasmic DNA sensing pathway is dysfunctional in human B cells. This exemplifies that certain cell types cannot induce IFN I in response to cytoplasmic DNA exposure providing a potential niche for viral persistence. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K
2011-11-01
Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.
Testing the Gamma-Ray Burst Energy Relationships
NASA Technical Reports Server (NTRS)
Band, David L.; Preece, Robert D.
2005-01-01
Building on Nakar & Piran's analysis of the Amati relation relating gamma-ray burst peak energies E(sub p) and isotropic energies E(sub iso ) we test the consistency of a large sample of BATSE bursts with the Amati and Ghirlanda (which relates peak energies and actual gamma-ray energies E(sub gamma)) relations. Each of these relations can be exp ressed as a ratio of the different energies that is a function of red shift (for both the Amati and Ghirlanda relations) and beaming fraction f(sub B) (for the Ghirlanda relation). The most rigorous test, whic h allows bursts to be at any redshift, corroborates Nakar & Piran's r esult - 88% of the BATSE bursts are inconsistent with the Amati relat ion - while only l.6% of the bursts are inconsistent with the Ghirlan da relation if f(sub B) = 1. Modelling the redshift distribution resu lts in an energy ratio distribution for the Amati relation that is sh ifted by an order of magnitude relative to the observed distributions; any sub-population satisfying the Amati relation can comprise at mos t approx. 18% of our burst sample. A similar analysis of the Ghirland a relation depends sensitively on the beaming fraction distribution f or small values of f(sub B); for reasonable estimates of this distrib ution about a third of the burst sample is inconsistent with the Ghir landa relation. Our results indicate that these relations are an artifact of the selection effects of the burst sample in which they were f ound; these selection effects may favor sub-populations for which the se relations are valid.
Kowada, Akiko
Long-term expatriates from low to high tuberculosis (TB) incidence countries get high rates of active TB and latent TB infection (LTBI). TB screening for expatriates is important for occupational health. Interferon-gamma release assays are more accurate than tuberculin skin test (TST). Rifapentine plus isoniazid for 3 months (3HP) is as effective as 9 months of isoniazid (9H) with a higher treatment-completion rate. Decision trees and Markov models were constructed using a societal perspective on a lifetime horizon. The target population was a hypothetical cohort of 30 year-old expatriates. Seven strategies; TST with 3HP or 9H, QuantiFERON ® -TB Gold In-Tube (QFT) with 3HP or 9H, T-SPOT ® .TB (TSPOT) with 3HP or 9H and chest X-ray examination (CXR) were modeled. The main outcome measure of effectiveness was quality-adjusted life-years (QALYs) gained. QFT with 3HP yielded the greatest benefits with the lowest cost ($US 674.8; 25.95660 QALYs [year 2012 values]). CXR was the least cost-effective ($US 13,666.8; 24.62917 QALYs). Cost-effectiveness was sensitive to adherence rate of 3HP and QFT specificity, but not to BCG vaccination rate. Entry LTBI screening using QFT treated with 3HP is recommended on the basis of cost effectiveness among long-term expatriates from low to high incidence countries. Copyright © 2016 Elsevier Ltd. All rights reserved.
A gamma-ray testing technique for spacecraft. [considering cosmic radiation effects
NASA Technical Reports Server (NTRS)
Gribov, B. S.; Repin, N. N.; Sakovich, V. A.; Sakharov, V. M.
1977-01-01
The simulated cosmic radiation effect on a spacecraft structure is evaluated by gamma ray testing in relation to structural thickness. A drawing of the test set-up is provided and measurement errors are discussed.
Interferon alpha for the adjuvant treatment of cutaneous melanoma.
Mocellin, Simone; Lens, Marko B; Pasquali, Sandro; Pilati, Pierluigi; Chiarion Sileni, Vanna
2013-06-18
of treatment efficacy. Eighteen RCTs enrolling a total of 10,499 participants were eligible for the review. The results from 17 of 18 of these RCTs, published between 1995 and 2011, were suitable for meta-analysis and allowed us to quantify the therapeutic efficacy of interferon in terms of disease-free survival (17 trials) and overall survival (15 trials). Adjuvant interferon was associated with significantly improved disease-free survival (HR (hazard ratio) = 0.83; 95% CI (confidence interval) 0.78 to 0.87, P value < 0.00001) and overall survival (HR = 0.91; 95% CI 0.85 to 0.97; P value = 0.003). We detected no significant between-study heterogeneity (disease-free survival: I² statistic = 16%, Q-test P value = 0.27; overall survival: I² statistic = 6%; Q-test P value = 0.38).Considering that the 5-year overall survival rate for TNM stage II-III cutaneous melanoma is 60%, the number needed to treat (NNT) is 35 participants (95% CI = 21 to 108 participants) in order to prevent 1 death. The results of subgroup analysis failed to answer the question of whether some treatment features (i.e. dosage, duration) might have an impact on interferon efficacy or whether some participant subgroups (i.e. with or without lymph node positivity) might benefit differently from interferon adjuvant treatment.Grade 3 and 4 toxicity was observed in a minority of participants: In some trials, no-one had fever or fatigue of Grade 3 severity, but in other trials, up to 8% had fever and up to 23% had fatigue of Grade 3 severity. Less than 1% of participants had fever and fatigue of Grade 4 severity. Although it impaired quality of life, toxicity disappeared after treatment discontinuation. The results of this meta-analysis support the therapeutic efficacy of adjuvant interferon alpha for the treatment of people with high-risk (AJCC TNM stage II-III) cutaneous melanoma in terms of both disease-free survival and, though to a lower extent, overall survival. Interferon is also valid as a
NASA Technical Reports Server (NTRS)
Bodnarik, J.; Evans, L.; Floyd, S.; Lim, L.; McClanahan, T.; Namkung, M.; Parsons, A.; Schweitzer, J.; Starr, R.; Trombka, J.
2010-01-01
An outside neutron and gamma ray instrumentation test facility has been constructed at NASA's Goddard Space Flight Center (GSFC) to evaluate conceptual designs of gamma ray and neutron systems that we intend to propose for future planetary lander and rover missions. We will describe this test facility and its current capabilities for operation of planetary in situ instrumentation, utilizing a l4 MeV pulsed neutron generator as the gamma ray excitation source with gamma ray and neutron detectors, in an open field with the ability to remotely monitor and operate experiments from a safe distance at an on-site building. The advantage of a permanent test facility with the ability to operate a neutron generator outside and the flexibility to modify testing configurations is essential for efficient testing of this type of technology. Until now, there have been no outdoor test facilities for realistically testing neutron and gamma ray instruments planned for solar system exploration
Tenforde, Mark W.; Gupte, Nikhil; Dowdy, David W.; Asmuth, David M.; Balagopal, Ashwin; Pollard, Richard B.; Sugandhavesa, Patcharaphan; Lama, Javier R.; Pillay, Sandy; Cardoso, Sandra W.; Pawar, Jyoti; Santos, Breno; Riviere, Cynthia; Mwelase, Noluthando; Kanyama, Cecilia; Kumwenda, Johnstone; Hakim, James G.; Kumarasamy, Nagalingeswaran; Bollinger, Robert; Semba, Richard D.; Campbell, Thomas B.; Gupta, Amita
2015-01-01
Objective The association between pre-antiretroviral (ART) inflammation and immune activation and risk for incident tuberculosis (TB) after ART initiation among adults is uncertain. Design Nested case-control study (n = 332) within ACTG PEARLS trial of three ART regimens among 1571 HIV-infected, treatment-naïve adults in 9 countries. We compared cases (participants with incident TB diagnosed by 96 weeks) to a random sample of controls (participants who did not develop TB, stratified by country and treatment arm). Methods We measured pre-ART C-reactive protein (CRP), EndoCab IgM, ferritin, interferon gamma (IFN-γ), interleukin 6 (IL-6), interferon gamma-inducible protein 10 (IP-10), lipopolysaccharide (LPS), soluble CD14 (sCD14), tumor necrosis factor alpha (TNF-α), and CD4/DR+/38+ and CD8/DR+/38+ T cells. Markers were defined according to established cutoff definitions when available, 75th percentile of measured values when not, and detectable versus undetectable for LPS. Using logistic regression, we measured associations between biomarkers and incident TB, adjusting for age, sex, study site, treatment arm, baseline CD4 and log10 viral load. We assessed the discriminatory value of biomarkers using receiver operating characteristic (ROC) analysis. Results Seventy-seven persons (4.9%) developed incident TB during follow-up. Elevated baseline CRP (aOR 3.25, 95% CI: 1.55–6.81) and IP-10 (aOR 1.89, 95% CI: 1.05–3.39), detectable plasma LPS (aOR 2.39, 95% CI: 1.13–5.06), and the established TB risk factors anemia and hypoalbuminemia were independently associated with incident TB. In ROC analysis, CRP, albumin, and LPS improved discrimination only modestly for TB risk when added to baseline routine patient characteristics including CD4 count, body mass index, and prior TB. Conclusion Incident TB occurs commonly after ART initiation. Although associated with higher post-ART TB risk, baseline CRP, IP-10, and LPS add limited value to routine patient characteristics
Conducting High Cycle Fatigue Strength Step Tests on Gamma TiAl
NASA Technical Reports Server (NTRS)
Lerch, Brad; Draper, Sue; Pereira, J. Mike
2002-01-01
High cycle fatigue strength testing of gamma TiAl by the step test method is investigated. A design of experiments was implemented to determine if the coaxing effect occurred during testing. Since coaxing was not observed, step testing was deemed a suitable method to define the fatigue strength at 106 cycles.
Faulkner, C B; Simecka, J W; Davidson, M K; Davis, J K; Schoeb, T R; Lindsey, J R; Everson, M P
1995-01-01
Studies were conducted to determine whether the production of various cytokines is associated with Mycoplasma pulmonis disease expression. Susceptible C3H/HeN and resistant C57BL/6N mice were inoculated intranasally with 10(7) CFU of virulent M. pulmonis UAB CT or avirulent M. pulmonis UAB T. Expression of genes for tumor necrosis factor alpha (TNF-alpha), interleukin 1 alpha (IL-1 alpha), IL-1 beta, IL-6, and gamma interferon (IFN-gamma) in whole lung tissue and TNF-alpha gene expression in bronchoalveolar lavage (BAL) cells was determined by reverse transcription-PCR using specific cytokine primers at various times postinoculation. In addition, concentrations of TNF-alpha, IL-1, IL-6, and IFN-gamma were determined in BAL fluid and serum samples at various times postinoculation. Our results showed that there was a sequential appearance of cytokines in the lungs of infected mice: TNF-alpha, produced primarily by BAL cells, appeared first, followed by IL-1 and IL-6, which were followed by IFN-gamma. Susceptible C3H/HeN mice had higher and more persistent concentrations of TNF-alpha and IL-6 in BAL fluid than did resistant C57BL/6N mice, indicating that TNF-alpha and possibly IL-6 are important factors in pathogenesis of acute M. pulmonis disease in mice. Serum concentrations of IL-6 were elevated in C3H/HeN mice, but not C57BL/6N mice, following infection with M. pulmonis, suggesting that IL-6 has both local and systemic effects in M. pulmonis disease. PMID:7558323
Abe, Ayumi; Takano, Kenichi; Kojima, Takashi; Nomura, Kazuaki; Kakuki, Takuya; Kaneko, Yakuto; Yamamoto, Motohisa; Takahashi, Hiroki; Himi, Tetsuo
2016-06-01
Tight junctions (TJs) are necessary for salivary gland function and may serve as indicators of salivary gland epithelial dysfunction. IgG4-related disease (IgG4-RD) is a newly recognized fibro-inflammatory condition which disrupts the TJ associated epithelial barrier. The salivary glands are one of the most frequently involved organs in IgG4-RD, however, changes of the TJ associated epithelial barrier in salivary gland duct epithelium is poorly understood. Here, we investigated the regulation and function of TJs in human submandibular gland ductal epithelial cells (HSDECs) in normal and IgG4-RD. We examined submandibular gland (SMG) tissue from eight control individuals and 22 patients with IgG4-RD and established an HSDEC culture system. Immunohistochemistry, immunocytochemistry, western blotting, and measurement of transepithelial electrical resistance (TER) were performed. Claudin-4, claudin-7, occludin, and JAM-A were expressed at the apical side of the duct epithelium in submandibular gland (SMG) tissue and at the cell borders in HSDECs of normal and IgG4-RD. The expression and distribution of TJs in SMG tissue were not different in control individuals and patients with IgG4-RD in vivo and in vitro. Although interferon-gamma (IFNγ) generally disrupts the integrity and function of TJs, as manifested by decreased epithelial barrier function, IFNγ markedly increased the epithelial barrier function of HSDECs via upregulation of claudin-7 expression in HSDECs from patients with IgG4-RD. This is the first report showing an IFNγ-dependent increase in epithelial barrier function in the salivary gland duct epithelium. Our results provide insights into the functional significance of TJs in salivary gland duct epithelium in physiological and pathological conditions, including IgG4-RD.
Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M
2010-10-01
The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.
Cloning, sequencing, and expression of interferon-γ from elk in North America
Sweeney, Steven J.; Emerson, Carlene; Eriks, Inge S.
2001-01-01
Eradication of Mycobacterium bovis relies on accurate detection of infected animals, including potential domestic and wildlife reservoirs. Available diagnostic tests lack the sensitivity and specificity necessary for accurate detection, particularly in infected wildlife populations. Recently, an in vitro diagnostic test for cattle which measures plasma interferon-gamma (IFN-γ) levels in blood following in vitro incubation with M. bovis purified protein derivative has been enveloped. This test appears to have increased sensitivity over traditional testing. Unfortunately, it does not detect IFN-γ from Cervidae. To begin to address this problem, the IFN-γ gene from elk (Cervus elaphus) was cloned, sequenced, expressed, and characterized. cDNA was cloned from mitogen stimulated peripheral blood mononuclear cells. The predicted amino acid (aa) sequence was compared to known sequences from cattle, sheep, goats, red deer (Cervus elaphus), humans, and mice. Biological activity of the recombinant elk IFN-γ (rElkIFN-γ) was confirmed in a vesicular stomatitis virus cytopathic effect reduction assay. Production of monoclonal antibodies to IFN-γ epitopes conserved between ruminant species could provide an important tool for the development of reliable, practical diagnostic assays for detection of a delayed type hypersensitivity response to a variety of persistent infectious agents in ruminants, including M. bovis and Brucella abortus. Moreover, development of these reagents will aid investigators in studies to explore immunological responses of elk that are associated with resistance to infectious diseases.
Use of Disposable Micro Tissue Culture Plates for Antiviral and Interferon Induction Studies
Sidwell, Robert W.; Huffman, John H.
1971-01-01
A reproducible test system requiring small amounts of test compound was developed for evaluating antiviral and interferon-inducing activity. In the antiviral experiments, KB cells were grown in disposable polystyrene microplates covered with a standard domestic plastic wrap. Viruses used in the system were types 1 and 2 herpes simplex virus, vaccinia virus, type 3 adenovirus, myxoma virus, pseudorabies virus, type 3 parainfluenza virus, types 1A and 13 rhinovirus, vesicular stomatitis virus, coxsackievirus B, and type 2 poliovirus. Inhibition of viral cytopathogenic effect was the primary criterion of evaluation of antiviral activity. Reduction in cell and supernatant fluid virus titers was used as a secondary means of evaluation. The microplate system was adaptable for determining prophylactic, therapeutic, and inactivating effects against viruses. Mouse L-929 cells were used for the interferon induction studies, with vesicular stomatitis virus utilized as the indicator of interferon activity. Known active compounds evaluated in this microplate system had activity similar to that seen in macro in vitro systems. PMID:4332040
21 CFR 862.1360 - Gamma-glutamyl transpeptidase and isoenzymes test system.
Code of Federal Regulations, 2010 CFR
2010-04-01
... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1360 Gamma-glutamyl transpeptidase and isoenzymes test system. (a... alcoholic cirrhosis and primary and secondary liver tumors. (b) Classification. Class I (general controls...
Evasion of interferon responses by Ebola and Marburg viruses.
Basler, Christopher F; Amarasinghe, Gaya K
2009-09-01
The filoviruses, Ebola virus (EBOV) and Marburg virus (MARV), cause frequently lethal viral hemorrhagic fever. These infections induce potent cytokine production, yet these host responses fail to prevent systemic virus replication. Consistent with this, filoviruses have been found to encode proteins VP35 and VP24 that block host interferon (IFN)-alpha/beta production and inhibit signaling downstream of the IFN-alpha/beta and the IFN-gamma receptors, respectively. VP35, which is a component of the viral nucleocapsid complex and plays an essential role in viral RNA synthesis, acts as a pseudosubstrate for the cellular kinases IKK-epsilon and TBK-1, which phosphorylate and activate interferon regulatory factor 3 (IRF-3) and interferon regulatory factor 7 (IRF-7). VP35 also promotes SUMOylation of IRF-7, repressing IFN gene transcription. In addition, VP35 is a dsRNA-binding protein, and mutations that disrupt dsRNA binding impair VP35 IFN-antagonist activity while leaving its RNA replication functions intact. The phenotypes of recombinant EBOV bearing mutant VP35s unable to inhibit IFN-alpha/beta demonstrate that VP35 IFN-antagonist activity is critical for full virulence of these lethal pathogens. The structure of the VP35 dsRNA-binding domain, which has recently become available, is expected to provide insight into how VP35 IFN-antagonist and dsRNA-binding functions are related. The EBOV VP24 protein inhibits IFN signaling through an interaction with select host cell karyopherin-alpha proteins, preventing the nuclear import of otherwise activated STAT1. It remains to be determined to what extent VP24 may also modulate the nuclear import of other host cell factors and to what extent this may influence the outcome of infection. Notably, the Marburg virus VP24 protein does not detectably block STAT1 nuclear import, and, unlike EBOV, MARV infection inhibits STAT1 and STAT2 phosphorylation. Thus, despite their similarities, there are fundamental differences by which
[Interferon alpha-2b modified with polyethylene glycol].
Wu, Yingxin; Zhai, Yanqin; Lei, Jiandu; Ma, Guanghui; Su, Zhiguo
2008-09-01
In order to obtain a more stable PEGylated interferon alpha-2b, and prolong its half life, interferon alpha-2b (IFN alpha-2b) was modified with monomethoxy polyethylene glycol propionaldehyde (mPEG-ALD) 20000. It was found that the optimized reaction condition for the maximum bioactivity and highest PEGylation degree of the mono PEGylated interferon alpha-2b was as follows: in 20 mmol/L, pH 6.5, citric acid and sodium dihydrogen phosphate buffer, the concentration of IFN alpha-2b was 4 mg/mL, and the molar ratio of PEG/IFN alpha-2b was 8:1, and the reaction time was 20 h at 4 degrees C. Under the optimized reaction condition, the mono PEGylation degree reached to 55%. Ion exchange chromatography was used to separate and purify mono PEGylated interferon alpha-2b from the reaction mixture. The purity of mono PEGylated interferon alpha-2b was higher than 97% characterized by HPLC. The bioactivity of the mono PEGylated interferon alpha-2b was 13.4% of the native IFN alpha-2b, while its half life in SD rat is much longer than the native IFN alpha-2b. The mono PEGylated interferon alpha-2b is also stable in aqueous.
[Alpha-interferon and mental disorders].
Debien, C; De Chouly De Lenclave, M B; Foutrein, P; Bailly, D
2001-01-01
and test of positive reintroduction. The imputability is thus most likely towards, given the reported clinical observations and signs of direct cerebral toxicity described for interferon: induction of neurophysiological changes among healthy volunteers, reversible EEG impairments the second week of treatment, direct vascular and neurological toxicity. Eventually, authors have shown that the psychiatric morbidity could be more important among patients under treatment than in a control group. In conclusion, the imputability of interferon appears to be very likely, more particularly in the appearance of mood disorders, mainly depressive ones, of manic syndromes and of certain psychotic episodes. The most numerous therapeutic propositions naturally concern the depressive syndromes, because of their high frequency. In a recent article, the authors have detailed the pharmacological criteria of the ideal molecule: limited hepatic metabolism, low rate of proteinic fixation, long half-life and absence of active metabolite. So they advise not to prescribe imipraminic molecules and recommend the use of some SRI in first intention: citalopram and sertraline mainly, paroxetine to avoid given its pharmacological features that do not seem adapted. Only the minalcipram seems to show all the theoretical advantages described above. If there is an indication in the introduction of an anxiolytic medication, we shall prefer a benzodiazepine with short half-life like loxazepam and alprazolam. Besides, all the publications point out the importance of a specific clinical observation during the treatment as well as in the six months following its end. The agreement must bear full medical costs, above all including psychotherapic and social aspects. The proposed treatments for the other disorders are conventional: haloperidol and lithium for bipolar disorders, fluvoxamine for obsessive compulsive disorders and neuroleptics for psychotic disorders. The appearance of neuropsychiatric side
Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.
2001-01-01
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339
Longbottom, E Rebecca; Torrance, Hew D T; Owen, Helen C; Fragkou, Paraskevi C; Hinds, Charles J; Pearse, Rupert M; O'Dwyer, Michael J
2016-08-01
The aim of this study was to evaluate the role of interleukin (IL)-6 pathways in postoperative immune suppression and to assess the reversibility of this phenomenon. The postoperative period is characterized by increased IL-6 production and features of immune suppression. In vitro, IL-6 mediates anti-inflammatory effects through inhibition of interferon gamma (IFN-γ) pathways. The significance of the immunomodulatory effects of IL-6 in the clinical setting of postoperative immune suppression remains unclear. Patients over 45 years old undergoing elective surgery, involving the gastrointestinal tract, were recruited. IL-6 levels were assayed using an enzyme linked immunosorbent assay preoperatively, and at 24 and 48 hours. Peripheral blood mononuclear cells from healthy volunteers were cultured in perioperative serum and CD14Human Leukocyte Antigen-DR (HLA-DR) [monocyte HLA-DR (mHLA-DR)] geometric mean florescent intensity was measured in the presence and absence of IL-6 neutralizing antibody and recombinant IFN-γ. Of the 108 patients, 41 developed a postoperative infection. The IL-6 levels increased 19-fold from the preoperative sample to 24 hours postoperatively (P < 0.0001). Higher IL-6 levels at 24 (P = 0.0002) and 48 hours (P = 0.003) were associated with subsequent postoperative infectious complications. mHLA-DR mean florescent intensity fell when healthy peripheral blood mononuclear cells were cultured with postoperative serum compared with preoperative serum (P = 0.008). This decrease was prevented by the presence of IFN-γ in the culture media, but not by the presence of IL-6-neutralizing antibody. IL-6 levels increase after a major surgery and are associated with an increased susceptibility to postoperative infections. Serum obtained from postoperative patients induces an immunosuppressive response, reflected in reduced mHLA-DR levels, mediated through IL-6 independent pathways and is reversible with IFN-γ. These data may have
Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J.; Critser, John; Arwert, Fre; Haneline, Laura S.; Clapp, D. Wade
2006-01-01
Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc–/– cells to interferon-gamma (IFN-γ), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc–/– mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca–/– and Fancg–/– mice are hypersensitive to IFN-γ and that in vivo infusion of IFN-γ at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-γ conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients. PMID:16946306
MO-AB-206-02: Testing Gamma Cameras Based On TG177 WG Report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Halama, J.
2016-06-15
This education session will cover the physics and operation principles of gamma cameras and PET scanners. The first talk will focus on PET imaging. An overview of the principles of PET imaging will be provided, including positron decay physics, and the transition from 2D to 3D imaging. More recent advances in hardware and software will be discussed, such as time-of-flight imaging, and improvements in reconstruction algorithms that provide for options such as depth-of-interaction corrections. Quantitative applications of PET will be discussed, as well as the requirements for doing accurate quantitation. Relevant performance tests will also be described. Learning Objectives: Bemore » able to describe basic physics principles of PET and operation of PET scanners. Learn about recent advances in PET scanner hardware technology. Be able to describe advances in reconstruction techniques and improvements Be able to list relevant performance tests. The second talk will focus on gamma cameras. The Nuclear Medicine subcommittee has charged a task group (TG177) to develop a report on the current state of physics testing of gamma cameras, SPECT, and SPECT/CT systems. The report makes recommendations for performance tests to be done for routine quality assurance, annual physics testing, and acceptance tests, and identifies those needed satisfy the ACR accreditation program and The Joint Commission imaging standards. The report is also intended to be used as a manual with detailed instructions on how to perform tests under widely varying conditions. Learning Objectives: At the end of the presentation members of the audience will: Be familiar with the tests recommended for routine quality assurance, annual physics testing, and acceptance tests of gamma cameras for planar imaging. Be familiar with the tests recommended for routine quality assurance, annual physics testing, and acceptance tests of SPECT systems. Be familiar with the tests of a SPECT/CT system that include the CT
Interferon-based treatment of chronic hepatitis C.
Souvignet, Claude; Lejeune, Olivier; Trepo, Christian
2007-01-01
The treatment of patients with chronic hepatitis C has rapidly evolved in the past 10 years centered on the use of interferon alpha 2 as an antiviral and immunomodulatory agent against hepatitis C virus. Firstly used as a monotherapy associated with a deceiving long-term efficacy, interferon alpha was then combined with ribavirin, a nucleoside analog with large antiviral properties. Combination of both drugs dramatically improved the efficacy of treatment with 50% of patients reaching a sustained viral response, characterized by the final eradication of the virus from the infected individual. Surprisingly, this synergistic effect remains greatly unexplained. The third step consisted in the use of pegylated interferon in order to adapt its pharmacokinetics and to allow a better efficacy with a more tolerable dosing schedule: once weekly subcutaneous injection instead of thrice weekly. Pegylated interferon combined with ribavirin during 24-48 weeks of treatment is the current standard of care with nearly 60% of sustained virologic response, overall. Development of new forms of interferon alpha are on the way with promising preliminary results.
Utsumi, J; Yamazaki, S; Kawaguchi, K; Kimura, S; Shimizu, H
1989-10-05
Human interferon-beta 1 is extremely stable is a low ionic strength solution of pH 2 such as 10 mM HCl at 37 degrees C. However, the presence of 0.15 M NaCl led to a remarkable loss of antiviral activity. The molecular-sieve high-performance liquid chromatography revealed that, whereas completely active human interferon-beta 1 eluted as a 25 kDa species (monomeric form), the inactivated preparation eluted primarily as a 90 kDa species (oligomeric form). The specific activity (units per mg protein) of the oligomeric form was approx. 10% of that of the monomeric form. This observation shows that oligomeric human interferon-beta 1 is apparently in an inactive form. When the oligomeric eluate was resolved by polyacrylamide gel containing sodium dodecyl sulphate (SDS), it appeared to be monomeric under non-reducing conditions. Monomerization of the oligomeric human interferon-beta 1 by treatment with 1% SDS, fully regenerated its antiviral activity. These results suggest that the inactivation of the human interferon-beta 1 preparation was caused by its oligomerization via hydrophobic interactions without the formation of intermolecular disulphide bonds. These oligomers can be dissociated by SDS to restore biological activity.
Alvarez, Guillermo Cabrera; Madrid-Marina, Vicente; Jimenez-Mendez, Ricardo; Buitimea, Angel Leon; Román, Margarita Bahena; Cortez-Gomez, Rudyard; Esparza, Jorge Reyes; Rodríguez-Fragoso, Lourdes
2007-01-01
The aim of this study was to investigate the effects of combinations of pegilated-interferon (PEG-IFN), ribavirin, and danazol on thrombocytopenia and liver injury in rats with fibrosis. Male adult Wistar rats were treated with either mineral oil, danazol (0.83 mg/kg per day), PEG-interferon alpha-2a (PEG-IFN, 0.3 microg/ week) + ribavirin (12 mg/kg per day), PEG-IFN + ribavirin + danazol, CCl(4) (4 g/kg for eight weeks), CCl(4) + PEG-IFN + ribavirin, or CCl(4) + PEG-IFN + ribavirin+ danazol. The following assays were conducted: hematology, clinical chemistry, liver function, liver fibrosis, lymphocyte cytokine mRNA expression, and bone-marrow DNA content. Platelet counts were low in sham-treated animals and animals treated with PEG- IFN + ribavirin (30% and 25% respectively; P < 0.05). PEG-IFN + ribavirin + danazol reduced platelet counts of fibrotic animals by only 9% (P < 0.05). PEG- IFN + ribavirin reduced hepatic collagen content by 50%, whereas danazol + PEG-IFN + ribavirin reduced hepatic collagen content by 60% (P < 0.05). PEG-IFN + ribavirin reduced the total bilirubin concentration by 27%, alanine amino transferase (ALT) activity by 75% and gamma-glutamyl transpeptidase (gamma-GTP) activity by 74% (P < 0.05). In contrast, danazol + PEG-IFN + ribavirin reduced total bilirubin levels by 61%, alkaline phosphatase activity by 45%, ALT activity by 76%, and gamma-GTP activity by 74% (P < 0.05). The only treatment that increased interleukin 10 (IL-10) mRNA in fibrotic rats was PEG-IFN + ribavirin. However, danazol + PEG-IFN + ribavirin reduced the expression of IL-6, IL-10, tumor necrosis factor alpha and transforming growth factor ss. Bone-marrow DNA content was not altered by any treatment. In conclusion, PEG-IFN + ribavirin + danazol could be a new therapeutic option for patients with liver injury, fibrosis, and thrombocytopenia.
Yu, Hong-Ren; Tain, You-Lin; Sheen, Jiunn-Ming; Tiao, Mao-Meng; Chen, Chih-Cheng; Kuo, Ho-Chang; Hung, Pi-Lien; Hsieh, Kai-Sheng; Huang, Li-Tung
2016-01-01
Overexposure to prenatal glucocorticoid (GC) disturbs hypothalamic-pituitary-adrenocortical axis-associated neuroendocrine metabolism and susceptibility to metabolic syndrome. A high-fat (HF) diet is a major environmental factor that can cause metabolic syndrome. We aimed to investigate whether prenatal GC plus a postnatal HF diet could alter immune programming in rat offspring. Pregnant Sprague-Dawley rats were given intraperitoneal injections of dexamethasone or saline at 14–21 days of gestation. Male offspring were then divided into four groups: vehicle, prenatal dexamethasone exposure, postnatal HF diet (VHF), and prenatal dexamethasone exposure plus a postnatal HF diet (DHF). The rats were sacrificed and adaptive immune function was evaluated. Compared to the vehicle, the DHF group had lower interferon gamma (IFN-γ) production by splenocytes at postnatal day 120. Decreases in H3K9 acetylation and H3K36me3 levels at the IFN-γ promoter correlated with decreased IFN-γ production. The impaired IFN-γ production and aberrant site-specific histone modification at the IFN-γ promoter by prenatal dexamethasone treatment plus a postnatal HF diet resulted in resilience at postnatal day 180. Prenatal dexamethasone and a postnatal HF diet decreased IFN-γ production through a site-specific and an age-dependent histone modification. These findings suggest a mechanism by which prenatal exposure to GC and a postnatal environment exert effects on fetal immunity programming. PMID:27669212
Connell, Tom G; Davies, Mary-Ann; Johannisen, Christine; Wood, Kathryn; Pienaar, Sandy; Wilkinson, Katalin A; Wilkinson, Robert J; Zar, Heather J; Beatty, David; Nicol, Mark P; Curtis, Nigel; Eley, Brian
2010-05-27
Recent interest has focused on the potential use of serial interferon gamma (IFN-gamma) release assay (IGRA) measurements to assess the response to anti-tuberculous (TB) treatment. The kinetics of IFN-gamma responses to Mycobacterium tuberculosis (MTB) antigens in HIV-infected children during treatment have not however been previously investigated. IFN-gamma responses to the MTB antigens, ESAT-6, CFP-10 and PPD were measured by an enzyme-linked immunospot assay (IFN-gamma ELISpot) at presentation and at one, two and six months after starting anti-tuberculous treatment in HIV-infected children with definite or probable TB. Responses at different time points were compared using a Mann-Whitney U test with paired data analysed using the Wilcoxon signed rank test. A Fisher's exact or Chi-squared test was used to compare proportions when test results were analysed as dichotomous outcomes. Of 102 children with suspected TB, 22 (21%) had definite TB and 24 (23%) probable TB. At least one follow up IFN-gamma ELISpot assay result was available for 31 (67%) of the 46 children. In children with definite or probable TB in whom the IFN-gamma ELISpot assay result was positive at presentation, anti-tuberculous treatment was accompanied by a significant decrease in both the magnitude of the IFN-gamma response to individual or combined MTB-specific antigens (ESAT-6 median 110 SFCs/106 PBMC (IQR 65-305) at presentation vs. 15 (10-115) at six months, p = 0.04; CFP-10 177 (48-508) vs. 20 (5-165), p = 0.004, ESAT-6 or CFP-10 median 250 SFCs/106 PBMC (IQR 94-508) vs. 25 (10-165), p = 0.004) and in the proportion of children with a positive IFN-gamma ELISpot assay (Fisher's exact test: ESAT-6 15/0 vs 5/11, p = 0.0002, CFP-10 22/0 vs 8/17, p = 0.0001, ESAT-6 or CFP-10 22/0 vs. 9/17, p= 0.002). However almost half of the children had a positive IFN-gamma ELISpot assay after six months of anti-tuberculous treatment. In addition, there was conversion of the IFN-gamma ELISpot assay result
Hepatic inclusions during interferon therapy in chronic viral hepatitis.
Schaff, Z; Hoofnagle, J H; Grimley, P M
1986-01-01
Two types of cytomembranous abnormalities were identified for the first time in liver biopsies from patients with chronic active type B hepatitis during treatment with recombinant alpha-interferon. Tubuloreticular inclusions were present in the hepatic endothelial cells, Kupffer cells and perisinusoidal cells of liver biopsies from both patients, and they were absent in liver biopsies obtained before treatment. Cylindrical confronting lamellae, having "test tube" or "ring-shape" forms were observed in the cytoplasm both of Kupffer cells and macrophages in the second liver biopsy of one of the patients. The findings suggest that interferon can be involved in the pathogenesis of both cytomembranous abnormalities, but that additional biological factors may play a role in formation of the cylindrical confronting lamellae.
Anticonvulsant properties of alpha, gamma, and alpha, gamma-substituted gamma-butyrolactones.
Klunk, W E; Covey, D F; Ferrendelli, J A
1982-09-01
Derivatives of gamma-butyrolactone (GBL) substituted on the alpha- and/or gamma-positions were synthesized and tested for their effects on behavior in mice, on the electroencephalographs and blood pressure of paralyzed-ventilated guinea pigs, and on electrical activity of incubated hippocampal slices. Several compounds, including alpha-ethyl-alpha-methyl GBL (alpha-EMGBL), alpha, alpha-dimethyl GBL, alpha, gamma-diethyl-alpha, gamma-dimethyl GBL, and gamma-ethyl-gamma-methyl GBL, prevented seizures induced by pentylenetetrazol, beta-ethyl-beta-methyl-gamma-butyrolactone (beta-EMGBL), picrotoxin, or all three compounds in mice and guinea pigs but had no effect on seizures induced by maximal electroshock or bicuculline. Neither gamma-hydroxybutyrate (GHB) nor alpha-isopropylidine GBL had any anticonvulsant activity. The anticonvulsant alpha-substituted compounds had a potent hypotensive effect and antagonized the hypertensive effect of beta-EMGBL, alpha-EMGBL was tested in incubated hippocampal slices and was found to depress basal activity and antagonize excitation induced by beta-EMGBL. These results demonstrate that alpha-alkyl-substituted GBL and, to a lesser extent, gamma-substituted derivatives are anticonvulsant agents and that their effects are strikingly different from those of GHB or beta-alkyl-substituted GBLs, which are epileptogenic. Possibly beta- and alpha-substituted GBLs act at the same site as agonists and antagonists, respectively.
Interferon in resistance to bacterial and protozoan infections
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald; Gould, Cheryl L.; Kierszenbaum, Felipe; Degee, Antonie L. W.; Mansfield, John M.
1986-01-01
The effects of genetic differences in mouse strains on the modulation of protozoan infections by interferon (IFN) were investigated. In one set of experiments, three different strains of mice were injected with T. cruzi, and their sera were assayed at five time intervals for IFN titer. A greater quantity of IFN was produced by mouse strains that were susceptible to T. cruzi infection than by the more resistant strain. In another set of experiments, spleen cell cultures from inbred strains of mice were challenged with an antigen made from T.b. rhodesiense. The cells from mice resistant to infection, produced greater amounts of IFN-gamma than did cells from the susceptible mice. In a third set of experiments, it was found that mice injected with T.b. rhodesiense before being infected with a diabetogenic virus (EMC-D) were resistant to the effects of the virus and did not produce virus-specific antibody.
Alvares, C T G; Cruz, J F; Romano, C C; Brandão, F Z
2016-04-15
This study evaluated the influence of artificial insemination (AI) by cervical retraction (CRI) on serum levels of interferon gamma (IFNγ) and interleukin-10 (IL-10) in ewes. Synchronized pluriparous Santa Inês ewes were subjected to natural mating (NM, n = 8) and AI, which was performed for a fixed time (55 ± 1 hour) by CRI (n = 8) or laparoscopy (n = 8). Ewes were classified as pregnant, with return to estrus (RE) or with embryonic loss (EL). Blood samples were collected on Day 0, Day 3, Day 5, Day 12, and Day 17 (Day 0 = AI/NM) for progesterone dosage and cytokines were quantified from Day 0 to Day 12. Progesterone levels were constant, except for a decrease in ewes with RE at Day 17 (P < 0.05). Regardless of the reproductive method used, there was no difference in the IFNγ and IL-10 levels at any time, with averages of 642.1, 713.2, and 741.2 pg/mL for IFNγ and 667.1, 616.8, and 721.1 pg/mL for IL-10 when using CRI, laproscopy, and NM, respectively. Regarding the physiological status, ewes with EL had lower serum levels of IFNγ and IL-10 than pregnant ewes and ewes with RE, regardless of the reproductive method used, with averages of 769.1, 714.9, and 555.7 pg/mL for IFNγ and 713.8, 699.3, and 578.7 pg/mL for IL-10 in pregnant ewes, ewes with RE and EL, respectively (P < 0.01). In conclusion, AI by CRI in Santa Inês ewes does not alter the profile of serum cytokines IFNγ and IL-10 and does not induce an inflammatory reaction that can compromise pregnancy. Copyright © 2016 Elsevier Inc. All rights reserved.
O'Brien, Kevin B; Schultz-Cherry, Stacey; Knoll, Laura J
2011-09-01
Outbreaks of influenza A viruses are associated with significant human morbidity worldwide. Given the increasing resistance to the available influenza drugs, new therapies for the treatment of influenza virus infection are needed. An alternative approach is to identify products that enhance a protective immune response. In these studies, we demonstrate that infecting mice with the Th1-inducing parasite Toxoplasma gondii prior to highly pathogenic avian H5N1 influenza virus infection led to decreased lung viral titers and enhanced survival. A noninfectious fraction of T. gondii soluble antigens (STAg) elicited an immune response similar to that elicited by live parasites, and administration of STAg 2 days after H5N1 influenza virus infection enhanced survival, lowered viral titers, and reduced clinical disease. STAg administration protected H5N1 virus-infected mice lacking lymphocytes, suggesting that while the adaptive immune response was not required for enhanced survival, it was necessary for STAg-mediated viral clearance. Mechanistically, we found that administration of STAg led to increased production of gamma interferon (IFN-γ) from natural killer (NK) cells, which were both necessary and sufficient for survival. Further, administration of exogenous IFN-γ alone enhanced survival from H5N1 influenza virus infection, although not to the same level as STAg treatment. These studies demonstrate that a noninfectious T. gondii extract enhances the protective immune response against severe H5N1 influenza virus infections even when a single dose is administered 2 days postinfection.
Interferon-alpha in the treatment of multiple myeloma.
Khoo, Teh Liane; Vangsted, Annette Juul; Joshua, Douglas; Gibson, John
2011-03-01
Interferons are soluble proteins produced naturally by cells in response to viruses. It has both anti-proliferative and immunomodulating properties and is one of the first examples of a biological response modifier use to treat the haematological malignancy multiple myeloma. Interferon has been used in this clinical practice for over thirty years. However, despite considerable efforts, numerous clinical trials and two large meta-analysis, its exact role in the management of multiple myeloma still remains unclear. Its role in the treatment of multiple myeloma has been as a single induction agent, a co-induction agent with other chemotherapy regimens, and as maintenance therapy after conventional chemotherapy or complete remission after autologous or allogeneic transplantation. Interferon as a single induction agent or co-induction agent with other chemotherapy agents appears only to have minimal benefit in myeloma. Its role as maintenance therapy in the plateau phase of myeloma also remains uncertain. More recently, the use of interferon must now compete with the "new drugs"--thalidomide, lenalidomide and bortezomib in myeloma treatment. Will there be a future role of interferon in the treatment of multiple myeloma or will interferon be resigned to the history books remains to be seen.
MEASUREMENTS OF GAMMA-RAY DOSES OF DIFFERENT RADIOISOTOPES BY THE TEST-FILM METHOD (in German)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Domanus, J.; Halski, L.
The test-film method seems to be most suitable for systematic, periodical measurements of individual doses of ionizing radiation. Persons handling radioisotopes are irradiated with gamma rays of different energies. The energy of gamma radiation lies within much broader limits than is the case with x rays. Therefore it was necessary to check whether the test-film method is suitable for measuring doses of gamma-rays of such different energies and to choose the proper combination of film and screen to reach the necessary measuring range. Polish films, Foton Rentgen and Foton Rentgen Super and films from the German Democratic Republic, Agfa Texomore » R and Agfa Texo S were tested. Expositions were made without intensifying screens as well as with lead and fluorescent screens. The investigations showed that for dosimetric purposes the Foton Rentgen Super films are most suitable. However, not one of the film-screen combinations gave satisfactory results for radioisotopes with radiation of different energies. In such a case the test-film method gives only approximate results. If, on the contrary, gamma energies do not differ greatly, the test- film method proves to be quite good. (auth)« less
Fisher, P B; Prignoli, D R; Hermo, H; Weinstein, I B; Pestka, S
1985-01-01
We have analyzed the effects of various human interferons produced in bacteria and the antileukemic compound mezerein (MEZ) on growth and melanogenesis in human melanoma cells. In four human melanoma cell lines, recombinant human fibroblast interferon (IFN-beta) was more active than recombinant human leukocyte interferons (IFN-alpha A, IFN-alpha D, or IFN-alpha A/D (Bgl] in inhibiting cellular proliferation. When monolayer cultures were exposed to 1000 IU/ml IFN-beta for four days the degree of growth inhibition in the different melanoma cell lines varied between 94 and 26%. Similarly, four days growth in medium containing 10 ng/ml MEZ resulted in either no inhibition of growth or as much as 53% inhibition of growth, depending on the specific melanoma cell line tested. MEZ induced dendrite-like processes, cytoplasmic projections morphologically similar to those normally found in neurons and melanocytes, in all four melanoma cell lines, whereas none of the interferons tested had this effect. The combination of interferon and MEZ resulted in a dramatic inhibition in cellular proliferation in all four melanoma cell lines. When cell extracts were assayed for melanin content, a marker of melanoma cell differentiation, the combination of IFN-beta and MEZ resulted in higher levels of melanin than with either agent alone. Dendrite-like formation was also prominent in the cultures treated with this combination. These results indicate that the antiproliferative effect of interferon toward human melanoma dells can be enhanced by treatment with MEZ and that this effect is associated with an enhancement of terminal differentiation.
Meager, A; Wadhwa, M; Dilger, P; Bird, C; Thorpe, R; Newsom-Davis, J; Willcox, N
2003-04-01
We have screened for spontaneous anticytokine autoantibodies in patients with infections, neoplasms and autoimmune diseases, because of their increasingly reported co-occurrence. We tested for both binding and neutralizing autoantibodies to a range of human cytokines, including interleukin-1alpha (IL-1alpha), IL-1beta, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12, IL-18, interferon-alpha2 (IFN-alpha2), IFN-omega, IFN-beta, IFN-gamma, tumour necrosis factor alpha (TNF-alpha), transforming growth factor beta-1 (TGF-beta1) and granulocyte-macrophage colony stimulating factor (GM-CSF), in plasmas or sera. With two notable exceptions described below, we found only occasional, mostly low-titre, non-neutralizing antibodies, mainly to GM-CSF; also to IL-10 in pemphigoid. Strikingly, however, high-titre, mainly IgG, autoantibodies to IFN-alpha2, IFN-omega and IL-12 were common at diagnosis in patients with late-onset myasthenia gravis (LOMG+), thymoma (T) but no MG (TMG-) and especially with both thymoma and MG together (TMG+). The antibodies recognized other closely related type I IFN-alpha subtypes, but rarely the distantly related type I IFN-beta, and never (detectably) the unrelated type II IFN-gamma. Antibodies to IL-12 showed a similar distribution to those against IFN-alpha2, although prevalences were slightly lower; correlations between individual titres against each were so modest that they appear to be entirely different specificities. Neither showed any obvious correlations with clinical parameters including thymoma histology and HLA type, but they did increase sharply if the tumours recurred. These antibodies neutralized their respective cytokine in bioassays in vitro; although they persisted for years severe infections were surprisingly uncommon, despite the immunosuppressive therapy also used in most cases. These findings must hold valuable clues to autoimmunizing mechanisms in paraneoplastic autoimmunity.
Xin, Ting; Jia, Hong; Ding, Jiabo; Li, Pingjun; Yang, Hongjun; Hou, Shaohua; Yuan, Weifeng; Guo, Xiaoyu; Wang, Haichun; Liang, Qianqian; Li, Ming
2013-01-01
Bovine tuberculosis (bTB) is a worldwide zoonosis caused mainly by Mycobacterium bovis. The traditional diagnostic method used often is the tuberculin skin test, which uses bovine purified protein derivatives (PPD-B). However, it is difficult to maintain uniformity of PPD-B from batch to batch, and it shares common antigens with nonpathogenic environmental mycobacteria. To overcome these problems, M. bovis-specific antigens that showed good T cell stimulation, such as CFP-10, ESAT-6, Rv3615c, etc., have been used in the skin test, but there have been no large-scale clinical studies on these antigens. In this study, two combinations (CFP-10/ESAT-6/TB10.4 protein cocktail and CFP-10/ESAT-6/Rv3872/MPT63 protein cocktail) were developed and used as stimuli in the skin test. Cattle were double-blind tested to assess the efficiency of the protein cocktail-based skin tests. The results showed that the CFP-10/ESAT-6/TB10.4 protein cocktail-based skin test can differentiate TB-infected cattle from Mycobacterium avium-infected ones and that it shows a high degree of agreement with the traditional tuberculin skin test (κ = 0.8536) and gamma interferon (IFN-γ) release assay (κ = 0.8154). Compared to the tuberculin skin test, the relative sensitivity and relative specificity of the CFP-10/ESAT-6/TB10.4-based skin test were 87% and 97%, respectively., The relative sensitivity and relative specificity of the CFP-10/ESAT-6/TB10.4-based skin test were 93% and 92%, respectively, on comparison with the IFN-γ release assay. The correlation between the increases in skin thickness observed after the inoculation of stimuli was high (PPD-B versus CFP-10/ESAT-6/TB10.4, Spearman r of 0.8435). The correlation between the optical density at 450 nm (OD450) obtained after blood stimulation with PPD-B and the increase in skin thickness observed after inoculation of the CFP-10/ESAT-6/TB10.4 protein cocktail was high (Spearman r = 0.7335). Therefore, the CFP-10/ESAT-6/TB10.4-based skin test
Pang, W Y; Earley, B; Sweeney, T; Crowe, M A
2006-02-01
The objective of this study was to determine the effect of carprofen (C) administration before banding or burdizzo castration of bulls on cortisol, in vitro interferon-gamma (IFN-gamma) production, acute-phase proteins, feed intake, and growth. Fifty Holstein Friesian bulls (5.5 mo old; 191 +/- 3.7 kg) were blocked by weight and assigned randomly to 1 of 5 treatments (n = 10/treatment): 1) untreated control (2) banding castration at 0 min (Band); 3) Band following an i.v. injection of 1.4 mg/kg of BW of C at -20 min (Band+C); 4) Burdizzo castration at 0 min (Burd); or 5) Burd following 1.4 mg/kg of BW of C at -20 min (Burd+C). Castration acutely increased plasma cortisol concentrations compared with control; no significant differences occurred in peak and interval to peak cortisol responses between Band and Band+C or Burd and Burd+C groups. The administration of C in Band+C reduced (P < 0.05) the cortisol concentration between 6 and 12 h postcastration compared with Band animals. Overall, the integrated cortisol response was greater (P < 0.05) in the castrates than in control, whereas C treatments tended to reduce this response compared with Band (P = 0.08) and Burd (P = 0.07), respectively. Plasma fibrinogen was elevated in Band animals on d 14 and in Burd animals on d 3 and 14. Carprofen administration reduced Band- and Burd-induced fibrinogen production on d 14 and 3, respectively. Plasma haptoglobin was elevated in Band animals on d 3 and 35 compared with control, and C administration was effective in reducing the haptoglobin elevation on d 35 in Band+C compared with Band. There were no differences among treatments in in vitro IFN-gamma production induced by concanavalin A and phytohemagglutinin on d 1 and 2. Overall from d -1 to 16, there were no DMI differences among treatments. From d -1 to 35, there were no ADG differences among treatments. In conclusion, banding and burdizzo castration increased plasma cortisol with no change in in vitro IFN-gamma
Specificity, cross-talk and adaptation in Interferon signaling
NASA Astrophysics Data System (ADS)
Zilman, Anton
Innate immune system is the first line of defense of higher organisms against pathogens. It coordinates the behavior of millions of cells of multiple types, achieved through numerous signaling molecules. This talk focuses on the signaling specificity of a major class of signaling molecules - Type I Interferons - which are also used therapeutically in the treatment of a number of diseases, such as Hepatitis C, multiple sclerosis and some cancers. Puzzlingly, different Interferons act through the same cell surface receptor but have different effects on the target cells. They also exhibit a strange pattern of temporal cross-talk resulting in a serious clinical problem - loss of response to Interferon therapy. We combined mathematical modeling with quantitative experiments to develop a quantitative model of specificity and adaptation in the Interferon signaling pathway. The model resolves several outstanding experimental puzzles and directly affects the clinical use of Type I Interferons in treatment of viral hepatitis and other diseases.
Transfer of interferon alfa into human breast milk.
Kumar, A R; Hale, T W; Mock, R E
2000-08-01
Originally assumed to be antiviral substances, the efficacy of interferons in a number of pathologies, including malignancies, multiple sclerosis, and other immune syndromes, is increasingly recognized. This study provides data on the transfer of interferon alfa (2B) into human milk of a patient receiving massive intravenous doses for the treatment of malignant melanoma. Following an intravenous dose of 30 million IU, the amount of interferon transferred into human milk was only slightly elevated (1551 IU/mL) when compared to control milk (1249 IU/mL). These data suggest that even following enormous doses, interferon is probably too large in molecular weight to transfer into human milk in clinically relevant amounts.
Results of interferon treatment in children with chronic hepatitis B.
Grigorescu-Sido, Paula; Călin, Lazăr; Manasia, Rodica; Mireştean, Stefan; Creţ, Victoria; Skorka, Cristina; Grigorescu-Sido, Anca
2002-12-01
Many observations report a variable therapeutical response to interferon in children with chronic hepatitis B. In order to evaluate the efficiency of alpha-interferon treatment in the downregulation of viral replication and in the eradication of infection in these patients, we assessed HBeAg/HBeAb and HBsAg/HBsAb seroconversion (as well as with clinical outcome and the changes in the plasma level of aminotransferases) in 61 treated patients. The diagnosis was established by means of the usual clinical, biochemical and histopathological criteria. There was no possibility to viral DNA test and no control group was included. Patients were selected for interferon treatment who displayed at least a two fold rise in the plasma level of aminotransferases as compared to normal values, as well as necroinflammatory activity (score > or = 6) and positive HBeAg as a marker of viral replication. Treatment was carried out with alpha-2a interferon or alpha-2b interferon in a dose of 3 million U/m2/dose in 3 weekly doses for a period of 4-6 months. The monitoring interval was 6.6+/-3 years. HBeAg/HBeAb seroconversion was registered in 77.2% of the patients and mainly occurred during the first year of follow-up (50.9 %). HBsAg/HBsAb seroconversion was revealed in 1.75% of the cases. The therapeutical response was complete, incomplete, transient and absent in 1.75%, 64.9%, 10.5% and 22.8% of the patients, respectively. The results show that the eradication of HBV infection is insignificant, but the downregulation of viral replication and, subsequently the halt of further progression of hepatic lesions is obtained in a high percentage of cases, highlighting the efficiency of this treatment in children with chronic hepatitis B
Interferon in lyssavirus infection.
Rieder, Martina; Finke, Stefan; Conzelmann, Karl-Klaus
2012-01-01
Rabies is a zoonosis still claiming more than 50 000 human deaths per year. Typically, human cases are due to infection with rabies virus, the prototype of the Lyssavirus genus, but sporadic cases of rabies-like encephalitis caused by other lyssaviruses have been reported. In contrast to rabies virus, which has an extremely broad host range including many terrestrial warm-blooded animals, rabies-related viruses are associated predominantly with bats and rarely infect terrestrial species. In spite of a very close genetic relationship of rabies and rabies-related viruses, the factors determining the limited host range of rabies-related viruses are not clear. In the past years the importance of viral countermeasures against the host type I interferon system for establishment of an infection became evident. The rabies virus phosphoprotein (P) has emerged as a critical factor required for paralysing the signalling cascades leading to transcriptional activation of interferon genes as well as interferon signalling pathways, thereby limiting expression of antiviral and immune stimulatory genes. Comparative studies would be of interest in order to determine whether differential abilities of the lyssavirus P proteins contribute to the restricted host range of lyssaviruses.
INF-gamma rearranges membrane topography of MHC-I and ICAM-1 in colon carcinoma cells.
Bacsó, Zsolt; Bene, László; Damjanovich, László; Damjanovich, Sándor
2002-01-18
Flow-cytometric fluorescence energy transfer (FCET) measurements between fluorescently labeled cell surface MHC-I and ICAM-1 molecules indicated similar receptor patterns in the plasma membrane of interferon-gamma (INF-gamma)-treated colon carcinoma cells as those observed earlier at the surface of lymphoid cells. INF-gamma activation significantly increased the density of MHC-I and ICAM-1 proteins in the membrane. This increase in receptor density was accompanied by decreased proximity level of the homo-associated MHC-I receptors. Hetero-association of MHC-I and ICAM-1 molecules was increased by INF-gamma treatment. INF-gamma changed neither hetero- nor homo-association of transferrin receptors. By staining the sphingomyelin/cholesterol-enriched lipid microdomains with fluorescently labeled cholera toxin B subunit, we found an increase in the amount of lipid-raft associated G(M1)-gangliosides due to INF-gamma treatment. Confocal microscopic results and FCET measurements show that MHC-I and ICAM-1 are components of G(M1)-ganglioside containing lipid-rafts and also support an increase in the size of these lipid-rafts upon INF-gamma treatment.
Auyeung, S Freda; Long, Qi; Royster, Erica Bruce; Murthy, Smitha; McNutt, Marcia D; Lawson, David; Miller, Andrew; Manatunga, Amita; Musselman, Dominique L
2009-10-01
Interferon-alpha therapy, which is used to treat metastatic malignant melanoma, can cause patients to develop two distinct neurobehavioral symptom complexes: a mood syndrome and a neurovegetative syndrome. Interferon-alpha effects on serotonin metabolism appear to contribute to the mood and anxiety syndrome, while the neurovegetative syndrome appears to be related to interferon-alpha effects on dopamine. Our goal is to propose a design for utilizing a sequential, multiple assignment, randomized trial design for patients with malignant melanoma to test the relative efficacy of drugs that target serotonin versus dopamine metabolism during 4 weeks of intravenous, then 8 weeks of subcutaneous, interferon-alpha therapy. Patients will be offered participation in a double-blinded, randomized, controlled, 14-week trial involving two treatment phases. During the first month of intravenous interferon-alpha therapy, we will test the hypotheses that escitalopram will be more effective in reducing depressed mood, anxiety, and irritability, whereas methylphenidate will be more effective in diminishing interferon-alpha-induced neurovegetative symptoms, such as fatigue and psychomotor slowing. During the next 8 weeks of subcutaneous interferon therapy, participants whose symptoms do not improve significantly will be randomized to the alternate agent alone versus escitalopram and methylphenidate together. We present a prototype for a single-center, sequential, multiple assignment, randomized trial, which seeks to determine the efficacy of sequenced and targeted treatment for the two distinct symptom complexes suffered by patients treated with interferon-alpha. Because we cannot completely control for external factors, a relevant question is whether or not 'short-term' neuropsychiatric interventions can increase the number of interferon-alpha doses tolerated and improve long-term survival. This sequential, multiple assignment, randomized trial proposes a framework for developing
Interferon-gamma, macrophages, and virus spread after HSV-1 injection.
Cathcart, Heather M; Zheng, Mei; Covar, Jason J; Liu, Yi; Podolsky, Robert; Atherton, Sally S
2011-06-07
After uniocular anterior chamber (AC) injection of HSV-1, the anterior segment of BALB/c mice becomes inflamed and infected; however, virus does not spread from the anterior segment to cause retinitis in the injected eye. The purpose of these studies was to determine whether interferon (IFN-)-γ and Mac-1(+) cells play a role in preventing direct anterior-to-posterior spread of HSV-1 in the injected eye. One AC of adult female BALB/c mice was injected with HSV-1 (KOS). The location of IFN-α, IFN-β, and IFN-γ in the injected eye was determined by immunofluorescence, and mRNA expression was quantified by qPCR. Injected eyes of IFN-γ knockout or clodronate-treated macrophage-depleted mice were examined to determine whether the absence of IFN-γ or Mac-1(+) macrophages affected the sites or timing of virus spread. IFN-α, IFN-β, and IFN-γ were observed in the anterior segment of injected eyes through 72 hours and mRNA levels of IFN-β and IFN-γ were increased in virus-infected eyes 48 to 120 hours after infection. However, the absence of IFN-γ or macrophages did not affect either the sites or the timing of HSV-1 infection in injected eyes. Protection of the retina of the injected eye does not depend on a single cell type or cytokine. In addition, in the eye, as in other sites of the body, there are redundancies in the innate response to virus infection.
Interferon Induced Transfer of Viral Resistance
1981-02-01
necseeary and Identify by block number) - Interferon, Cell Communication, Resistance Transfer, Viruses , Antibody Production, Polypeptide Hormones...lymphocytes and the foreign cells, but not mycoplasmas or endogenous viruses , appears to be required for induction. The kinetics of production of leukocyte...interferon by nonsensitized lymphocytes in response to foreign cells is similar to that induced by viruses . We have shown that a component probably of Vie
Interferon Induced Transfer of Viral Resistance
1982-02-01
released from the cell membrane. We have also shown that CM’s activity is removed by a gelatin /sepharose affinity column which selectively binds...interferon preparation adsorbing to the WISH cells, interferon was subjected to gelatin /sepharose affinity chromatography to remove endogenous...caused an increase in the amount of H-.amnino acids incorporated into a gelatin binding protein, presumably fibronectin. This suggests that in addition to
[Interferons--its method of administration and adverse effect related to pharmacokinetics ].
Furue, H
1984-02-01
The potential role of interferons in the treatment of malignant diseases is currently being evaluated. This paper reviews experimental and clinical findings regarding pharmacokinetics, method of administration, and side reactions of interferons. Interferon in the blood is rapidly cleared from the circulation. Intramuscular injection of alpha-interferon causes low but stable interferon levels in the blood. However, in the case of beta-interferon, interferon is never detected consistently in the blood after intramuscular or subcutaneous administration. The studies with animal models suggest that doses higher than those given in current clinical trials will be necessary to obtain clearly beneficial effects in human. The maximum safely tolerated daily dose is appreciably higher than that used in most previous studies, although even at this level, considerable toxicity may be encountered. Adequate method of administration, route, dose and interval are not yet established at all. Exact mechanism of anticancer activity is not yet well defined. The most frequent side reaction is fever. However, the exact mechanism to cause these side reactions is also not yet clarified. Dose limiting central nervous system toxicities, hypotension, hypocalcaemia etc. are occasionally encountered in some instances. Antibody to interferon is demonstrated in some cases. Purification of interferon does not always causes reduction of side reactions. The treatment of cancer cases with interferon has just started and there are many problems to be solved. However, therapeutic beneficial may be achieved in the treatment of malignant tumors by appropriate combinations of interferon with conventional treatment. More laboratory studies as well as carefully controlled clinical observations are warranted.
Inada, Takefumi; Kubo, Kozue; Shingu, Koh
2010-10-01
Propofol is an intravenous anesthetic, widely used for general anesthesia during surgery, which inevitably involves tissue trauma with inflammation. At sites of inflammation, prostanoids, especially prostaglandin E₂ (PGE₂), are abundant. This study addresses the effect of propofol on macrophage PGE₂ production. Using thioglycollate-elicited murine peritoneal macrophages, propofol (7.5-30 μM) suppressed lipopolysaccharide-induced PGE₂ production. The suppression was via the direct inhibition of cyclooxygenase (COX) enzyme activity and due neither to the downregulation of COX expression nor the inhibition of arachidonic acid release from plasma membranes. In macrophage:natural killer (NK) cell co-culture, propofol dramatically increased interferon-gamma (IFN-γ) production, and the actions of propofol were mimicked by a selective COX-2 inhibitor, NS-398, as well as the selective EP4 receptor antagonist L-161,982, suggesting a role of PGE₂ suppression in the upregulation of IFN-γ production. Furthermore, in purified NK cell culture, PGE₂ directly suppressed the production of IFN-γ by activated NK cells, which was reversed by selective inhibition of EP4 activity. Taken together, our results show that, in macrophage:NK cell co-culture, propofol, through the suppression of macrophage PGE₂ production, upregulates NK cell IFN-γ production by alleviating EP4 receptor-mediated suppression of IFN-γ production. Propofol may potentially exert considerable influence on inflammation and immunity by suppressing PGE₂ synthesis. Copyright © 2010 Elsevier B.V. All rights reserved.
Kidane, Fana Alem; Mitra, Taniya; Wernsdorf, Patricia; Hess, Michael; Liebhart, Dieter
2018-01-01
Histomonosis is a parasitic disease of gallinaceous birds characterized by necrotic lesions in cacum and liver that usually turns fatal in turkeys while it is less severe in chickens. Vaccination using in vitro attenuated Histomonas meleagridis has been experimentally shown to confer protection against histomonosis. The protective mechanisms that underpin the vaccine-induced immune response are not resolved so far. Therefore, the actual study aimed to evaluate the location and quantitative distribution patterns of signature cytokines of type 1 [interferon gamma (IFN-γ)] or type 2 [interleukin (IL)-13] immune responses in vaccinated or infected hosts. An intergroup and interspecies difference in the spatial and temporal distribution patterns of cytokine mRNA positive cells was evident. Quantification of cells showed a significantly decreased percentage of IFN-γ mRNA positive cells at 4 days post-inoculation (DPI) in caeca of turkeys inoculated exclusively with the attenuated or the virulent inocula, compared to control birds. The decrement was followed by a surge of cells expressing mRNA for IFN-γ or IL-13, reaching a peak of increment at 10 DPI. By contrast, turkeys challenged following vaccination showed a slight increment of cecal IFN-γ mRNA positive cells at 4 DPI after which positive cell counts became comparable to control birds. The increase in infected birds was accompanied by an extensive distribution of positively stained cells up to the muscularis layer of cecal tissue whereas the vaccine group maintained an intact mucosal structure. In chickens, the level of changes of positive cells was generally lower compared to turkeys. However, control chickens were found with a higher percentage of IFN-γ mRNA positive cells in cecum compared to their turkey counterparts indicating a higher resistance to histomonosis, similar to the observation in immunized turkeys. In chickens, it could be shown that the changes of cytokine-positive cells were related to
Beta-interferon inhibits cell infection by Trypanosoma cruzi
NASA Technical Reports Server (NTRS)
Kierszenbaum, F.; Sonnenfeld, G.
1984-01-01
Beta interferon has been shown to inhibit the capacity of bloodstream forms of the flagellate Trypanosoma cruzi, the causative agent of Chagas' disease, to associate with and infect mouse peritoneal macrophages and rat heart myoblasts. The inhibitory effect was abrogated in the presence of specific antibodies to the interferon. Pretreatment of the parasites with interferon reduced their infectivity for untreated host cells, whereas pretreament of either type of host cell did not affect the interaction. The effect of interferon on the trypanosomes was reversible; the extent of the inhibitory effect was significantly reduced afer 20 min, and was undetectable after 60 min when macrophages were used as host cells. For the myoblasts, 60 min elapsed before the inhibitory effect began to subside and 120 min elapsed before it became insignificant or undetectable.
Yun, Cheol H.; Lundgren, Anna; Azem, Josef; Sjöling, Åsa; Holmgren, Jan; Svennerholm, Ann-Mari; Lundin, B. Samuel
2005-01-01
Helicobacter pylori is known to induce a local immune response, which is characterized by activation of lymphocytes and the production of IFN-γ in the stomach mucosa. Since not only T cells, but also natural killer (NK) cells, are potent producers of gamma interferon (IFN-γ), we investigated whether NK cells play a role in the immune response to H. pylori infection. Our results showed that NK cells were present in both the gastric and duodenal mucosae but that H. pylori infection did not affect the infiltration of NK cells into the gastrointestinal area. Furthermore, we could show that NK cells could be activated directly by H. pylori antigens, as H. pylori bacteria, as well as lysate from H. pylori, induced the secretion of IFN-γ by NK cells. NK cells were also activated without direct contact when separated from the bacteria by an epithelial cell layer, indicating that the activation of NK cells by H. pylori can also occur in vivo, in the infected stomach mucosa. Moreover, the production of IFN-γ by NK cells was greatly enhanced when a small amount of interleukin-12 (IL-12) was added, and this synergistic effect was associated with increased expression of the IL-12 receptor β2. It was further evident that bacterial lysate alone was sufficient to induce the activation of cytotoxicity-related molecules. In conclusion, we demonstrated that NK cells are present in the gastroduodenal mucosa of humans and that NK cells produce high levels of IFN-γ when stimulated with a combination of H. pylori antigen and IL-12. We propose that NK cells play an active role in the local immune response to H. pylori infection. PMID:15731046
George, Joseph; Banik, Naren L.; Ray, Swapan K.
2011-01-01
Human telomerase reverse transcriptase (hTERT) is the catalytic component of telomerase that facilitates tumor cell invasion and proliferation. Telomerase and hTERT are remarkably upregulated in majority of cancers including glioblastoma. Interferon-gamma (IFN-γ) modulates several cellular activities including cell cycle and multiplication through transcriptional regulation. The present investigation was designed to unravel the molecular mechanisms of the inhibition of cell proliferation, migration, and invasion of human glioblastoma SNB-19 and LN-18 cell lines after knockdown of hTERT using a plasmid vector based siRNA and concurrent treatment with IFN-γ. We observed more than 80% inhibition of cell proliferation, migration, and invasion of both cell lines after the treatment with combination of hTERT siRNA and IFN-γ. Our studies also showed accumulation of apoptotic cells in subG1 phase and an increase in cell population in G0/G1 with a reduction in G2/M phase indicating cell cycle arrest in G0/G1 phase for apoptosis. Semiquantitative and real-time RT-PCR analyses demonstrated significant downregulation of c- Myc and upregulation of p21 Waf1 and p27 Kip1. Western blotting confirmed the downregulation of the molecules involved in cell proliferation, migration, and invasion and also showed upregulation of cell cycle inhibitors. In conclusion, our study demonstrated that knockdown of hTERT siRNA and concurrent treatment with IFN-γ effectively inhibited cell proliferation, migration, and invasion in glioblastoma cells through downregulation of the molecules involved in these processes and cell cycle inhibition. Therefore, the combination of hTERT siRNA and IFN-γ offers a potential therapeutic strategy for controlling growth of human glioblastoma cells. PMID:20394835
Dinges, Martin M.; Schlievert, Patrick M.
2001-01-01
The superantigenic function of toxic shock syndrome toxin 1 (TSST-1) is generally regarded as an important determinant of its lethal effects in humans or experimental animals. This study examined the role of superantigenicity in a BALB/c mouse model of lethal TSST-1-induced hypersensitivity to lipopolysaccharide (LPS). In this model, TSST-1 greatly potentiated both LPS-induced lethality, as well as LPS-induced serum tumor necrosis factor alpha (TNF-α) activity. Although BALB/c-SCID mice were resistant to these LPS enhancement effects of TSST-1, BALB/c-SCID mice reconstituted with T cells were completely susceptible to the enhancement effect of TSST-1 on LPS-induced serum TNF-α. Mice pretreated with cyclosporine (Cs) or neutralizing antibodies against gamma interferon (IFN-γ) did not develop lethal LPS hypersensitivity when injected with TSST-1, and these agents reduced the enhancement effect of TSST-1 on LPS-induced serum TNF-α by 99 and 85%, respectively. Cs pretreatment also completely inhibited the known capacity of TSST-1 to amplify LPS-induced levels of IFN-γ in serum. In contrast, mice given Cs after a priming injection of TSST-1, but before LPS, still exhibited lethal hypersensitivity to LPS. Cs given after TSST-1 also did not inhibit enhancement of LPS-induced serum TNF-α by TSST-1 but inhibited the enhancement effect of TSST-1 on LPS-induced serum IFN-γ by 50%. These experiments support the theory that TSST-1-induced hypersensitivity to LPS is mediated primarily by IFN-γ derived from superantigen-activated T cells. PMID:11179286
Kuo, Joseph; Warner, Thomas F; Schell, Ronald F
2017-08-31
The role that cytokines play in the induction of Lyme arthritis is gradually being delineated. We showed previously that severe arthritis developed in a T-cell-driven murine model, even in mice lacking interleukin-17A (IL-17A) and administered anti-gamma-interferon (IFN-γ) antibody. Increased levels of tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6), two pro-inflammatory cytokines, were detected in cultures of popliteal lymph node cells obtained from these mice. We hypothesized that concomitantly administered anti-IL-6, anti-TNF-α and anti-IFN-γ antibodies would inhibit the development of arthritis in IL-17A-deficient mice. Our results showed that swelling of the hind paws and histopathological changes consistent with arthritis were significantly reduced in IL-17A-deficient mice that administered the three anti-cytokine antibodies. These results suggest that treatment with multiple anti-cytokine antibodies can abrogate the induction of Lyme arthritis in mice. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
van Gorkom, T; Sankatsing, S U C; Voet, W; Ismail, D M; Muilwijk, R H; Salomons, M; Vlaminckx, B J M; Bossink, A W J; Notermans, D W; Bouwman, J J M; Kremer, K; Thijsen, S F T
2018-04-01
Two-tier serology testing is most frequently used for the diagnosis of Lyme borreliosis (LB); however, a positive result is no proof of active disease. To establish a diagnosis of active LB, better diagnostics are needed. Tests investigating the cellular immune system are available, but studies evaluating the utility of these tests on well-defined patient populations are lacking. Therefore, we investigated the utility of an enzyme-linked immunosorbent spot (ELISpot) assay to diagnose active Lyme neuroborreliosis. Peripheral blood mononuclear cells (PBMCs) of various study groups were stimulated by using Borrelia burgdorferi strain B31 and various recombinant antigens, and subsequently, the number of Borrelia -specific interferon gamma (IFN-γ)-secreting T cells was measured. We included 33 active and 37 treated Lyme neuroborreliosis patients, 28 healthy individuals treated for an early manifestation of LB in the past, and 145 untreated healthy individuals. The median numbers of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs did not differ between active Lyme neuroborreliosis patients (6.0; interquartile range [IQR], 0.5 to 14.0), treated Lyme neuroborreliosis patients (4.5; IQR, 2.0 to 18.6), and treated healthy individuals (7.4; IQR, 2.3 to 14.9) ( P = 1.000); however, the median number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs among untreated healthy individuals was lower (2.0; IQR, 0.5 to 3.9) ( P ≤ 0.016). We conclude that the Borrelia ELISpot assay, measuring the number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs, correlates with exposure to the Borrelia bacterium but cannot be used for the diagnosis of active Lyme neuroborreliosis. Copyright © 2018 van Gorkom et al.
van Gorkom, T.; Sankatsing, S. U. C.; Voet, W.; Ismail, D. M.; Muilwijk, R. H.; Salomons, M.; Vlaminckx, B. J. M.; Bossink, A. W. J.; Notermans, D. W.; Bouwman, J. J. M.; Kremer, K.
2018-01-01
ABSTRACT Two-tier serology testing is most frequently used for the diagnosis of Lyme borreliosis (LB); however, a positive result is no proof of active disease. To establish a diagnosis of active LB, better diagnostics are needed. Tests investigating the cellular immune system are available, but studies evaluating the utility of these tests on well-defined patient populations are lacking. Therefore, we investigated the utility of an enzyme-linked immunosorbent spot (ELISpot) assay to diagnose active Lyme neuroborreliosis. Peripheral blood mononuclear cells (PBMCs) of various study groups were stimulated by using Borrelia burgdorferi strain B31 and various recombinant antigens, and subsequently, the number of Borrelia-specific interferon gamma (IFN-γ)-secreting T cells was measured. We included 33 active and 37 treated Lyme neuroborreliosis patients, 28 healthy individuals treated for an early manifestation of LB in the past, and 145 untreated healthy individuals. The median numbers of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs did not differ between active Lyme neuroborreliosis patients (6.0; interquartile range [IQR], 0.5 to 14.0), treated Lyme neuroborreliosis patients (4.5; IQR, 2.0 to 18.6), and treated healthy individuals (7.4; IQR, 2.3 to 14.9) (P = 1.000); however, the median number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs among untreated healthy individuals was lower (2.0; IQR, 0.5 to 3.9) (P ≤ 0.016). We conclude that the Borrelia ELISpot assay, measuring the number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs, correlates with exposure to the Borrelia bacterium but cannot be used for the diagnosis of active Lyme neuroborreliosis. PMID:29367297
Interferon for the treatment of genital warts: a systematic review
2009-01-01
Background Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. Methods We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis Results 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the
Interferon for the treatment of genital warts: a systematic review.
Yang, Jin; Pu, Yu-Guo; Zeng, Zhong-Ming; Yu, Zhi-Jian; Huang, Na; Deng, Qi-Wen
2009-09-21
Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the recurrence rate of the two
Inflammation activates the interferon signaling pathways in taste bud cells.
Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan
2007-10-03
Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.
Interactions of the interferon system with cellular metabolism
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald
1986-01-01
The results of studies concerning the interaction of the interferon (Inf) system with the activities of carcinogens, tumor promoters, and cytochrome P-450 are presented. The results show that the addition of a tumor promoter (TPA or 4-O-methyl-TPA) to a tissue culture enhances virus-induced Inf-gamma production, suggesting a potential value of tumor promoters in the biosynthesis of commercial Inf. On the other hand, the carcinogens were reported to inhibit the induction of Inf-alpha/beta in cultured cells and in intact animals (with no effect on the administered or preformed Inf). The demonstration of a correlation between the carcinogenic potential of a compound and its inhibitive effect on Inf production suggests a possible use of the Inf production assay in the evaluation of the carcinogenicity of chemicals. In addition, it was shown that the induction of Inf-alpha/beta as well as the administration of this Inf depresses the levels of rat liver cytochrome P-450 which is responsible for binding lipophilic drugs, steroids, and carcinogens, thus increasing the toxicity of the respective chemical.
Slattery, E; Taira, H; Broeze, R; Lengyel, P
1980-07-01
Conditions are described for the production of 0.3 to 0.7 NIH mouse reference standard units of interferon per cell from Ehrlich ascites tumour cells cultured as monolayers and induced by infection with Newcastle disease virus (NDV). Inclusion of theophylline (6 mM) in the medium increased the interferon yield three to four times. Cells infected with NDV started to lyse at about 15 p.i., but infected, theophylline-treated cells lysed only 24 p.i. Several other methylxanthines (e.g. theobromine, caffeine and isobutylmethylxanthine) when tested a concentrations similar to that of theophylline, did not boost interferon production. Dibutyryl cyclic AMP (10(-10) to 10(-2)M) did not substitute for theophylline in increasing interferon production, and, if used together with theophylline, did not cause further enhancement.
Interferon β induces clearance of mutant ataxin 7 and improves locomotion in SCA7 knock-in mice.
Chort, Alice; Alves, Sandro; Marinello, Martina; Dufresnois, Béatrice; Dornbierer, Jean-Gabriel; Tesson, Christelle; Latouche, Morwena; Baker, Darren P; Barkats, Martine; El Hachimi, Khalid H; Ruberg, Merle; Janer, Alexandre; Stevanin, Giovanni; Brice, Alexis; Sittler, Annie
2013-06-01
We showed previously, in a cell model of spinocerebellar ataxia 7, that interferon beta induces the expression of PML protein and the formation of PML protein nuclear bodies that degrade mutant ataxin 7, suggesting that the cytokine, used to treat multiple sclerosis, might have therapeutic value in spinocerebellar ataxia 7. We now show that interferon beta also induces PML-dependent clearance of ataxin 7 in a preclinical model, SCA7(266Q/5Q) knock-in mice, and improves motor function. Interestingly, the presence of mutant ataxin 7 in the mice induces itself the expression of endogenous interferon beta and its receptor. Immunohistological studies in brains from two patients with spinocerebellar ataxia 7 confirmed that these modifications are also caused by the disease in humans. Interferon beta, administered intraperitoneally three times a week in the knock-in mice, was internalized with its receptor in Purkinje and other cells and translocated to the nucleus. The treatment induced PML protein expression and the formation of PML protein nuclear bodies and decreased mutant ataxin 7 in neuronal intranuclear inclusions, the hallmark of the disease. No reactive gliosis or other signs of toxicity were observed in the brain or internal organs. The performance of the SCA7(266Q/5Q) knock-in mice was significantly improved on two behavioural tests sensitive to cerebellar function: the Locotronic® Test of locomotor function and the Beam Walking Test of balance, motor coordination and fine movements, which are affected in patients with spinocerebellar ataxia 7. In addition to motor dysfunction, SCA7(266Q/5Q) mice present abnormalities in the retina as in patients: ataxin 7-positive neuronal intranuclear inclusions that were reduced by interferon beta treatment. Finally, since neuronal death does not occur in the cerebellum of SCA7(266Q/5Q) mice, we showed in primary cell cultures expressing mutant ataxin 7 that interferon beta treatment improves Purkinje cell survival.
V/V(max) test applied to SMM gamma-ray bursts
NASA Technical Reports Server (NTRS)
Matz, S. M.; Higdon, J. C.; Share, G. H.; Messina, D. C.; Iadicicco, A.
1992-01-01
We have applied the V/V(max) test to candidate gamma-ray bursts detected by the Gamma-Ray Spectrometer (GRS) aboard the SMM satellite to examine quantitatively the uniformity of the burst source population. For a sample of 132 candidate bursts identified in the GRS data by an automated search using a single uniform trigger criterion we find average V/V(max) = 0.40 +/- 0.025. This value is significantly different from 0.5, the average for a uniform distribution in space of the parent population of burst sources; however, the shape of the observed distribution of V/V(max) is unusual and our result conflicts with previous measurements. For these reasons we can currently draw no firm conclusion about the distribution of burst sources.
Enhanced antitumor reactivity of tumor-sensitized T cells by interferon alfa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vander Woude, D.L.; Wagner, P.D.; Shu, S.
Tumor-draining lymph node cells from mice bearing the methylcholanthrene-induced MCA 106 tumors can be sensitized in vitro to acquire antitumor reactivity. We examined the effect of interferon alfa on the function of cells that underwent in vitro sensitization in adoptive immunotherapy. Interferon alfa increased the antitumor reactivity of in vitro sensitized cells in the treatment of MCA 106 pulmonary metastases. This effect was evident in irradiated mice, indicating that a host response to the interferon alfa was not required. Interferon alfa treatment increased class I major histocompatibility complex antigen expression on tumor cells and increased their susceptibility to lysis bymore » in vitro sensitized cells. These results suggest that interferon alfa enhancement of adoptive immunotherapy was mediated by its effect on tumor cells. Interferon alfa may be a useful adjunct to the adoptive immunotherapy of human cancer.« less
Jegaskanda, S.; Ahn, S. H.; Skinner, N.; Thompson, A. J.; Ngyuen, T.; Holmes, J.; De Rose, R.; Navis, M.; Winnall, W. R.; Kramski, M.; Bernardi, G.; Bayliss, J.; Colledge, D.; Sozzi, V.; Visvanathan, K.; Locarnini, S. A.; Kent, S. J.
2014-01-01
ABSTRACT The mechanisms by which hepatitis B virus (HBV) establishes and maintains chronic hepatitis B infection (CHB) are poorly defined. Innate immune responses play an important role in reducing HBV replication and pathogenesis. HBV has developed numerous mechanisms to escape these responses, including the production of the secreted hepatitis B e antigen (HBeAg), which has been shown to regulate antiviral toll-like receptor (TLR) and interleukin-1 (IL-1) signaling. IL-18 is a related cytokine that inhibits HBV replication in hepatoma cell lines and in the liver through the induction of gamma interferon (IFN-γ) by NK cells and T cells. We hypothesized that HBV or HBV proteins inhibit IFN-γ expression by NK cells as an accessory immunomodulatory function. We show that HBeAg protein inhibits the NF-κB pathway and thereby downregulates NK cell IFN-γ expression. Additionally, IFN-γ expression was significantly inhibited by exposure to serum from individuals with HBeAg-positive but not HBeAg-negative chronic HBV infection. Further, we show that the HBeAg protein suppresses IL-18-mediated NF-κB signaling in NK and hepatoma cells via modulation of the NF-κB pathway. Together, these findings show that the HBeAg inhibits IL-18 signaling and IFN-γ expression, which may play an important role in the establishment and/or maintenance of persistent HBV infection. IMPORTANCE It is becoming increasingly apparent that NK cells play a role in the establishment and/or maintenance of chronic hepatitis B infection. The secreted HBeAg is an important regulator of innate and adaptive immune responses. We now show that the HBeAg downregulates NK cell-mediated IFN-γ production and IL-18 signaling, which may contribute to the establishment of infection and/or viral persistence. Our findings build on previous studies showing that the HBeAg also suppresses the TLR and IL-1 signaling pathways, suggesting that this viral protein is a key regulator of antiviral innate immune responses
Sonoda, Junichiro; Laganière, Josée; Mehl, Isaac R; Barish, Grant D; Chong, Ling-Wa; Li, Xiangli; Scheffler, Immo E; Mock, Dennis C; Bataille, Alain R; Robert, Francois; Lee, Chih-Hao; Giguère, Vincent; Evans, Ronald M
2007-08-01
Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.
Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-09-01
The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.
Genetic, Phenotypic, and Interferon Biomarker Status in ADAR1-Related Neurological Disease.
Rice, Gillian I; Kitabayashi, Naoki; Barth, Magalie; Briggs, Tracy A; Burton, Annabel C E; Carpanelli, Maria Luisa; Cerisola, Alfredo M; Colson, Cindy; Dale, Russell C; Danti, Federica Rachele; Darin, Niklas; De Azua, Begoña; De Giorgis, Valentina; De Goede, Christian G L; Desguerre, Isabelle; De Laet, Corinne; Eslahi, Atieh; Fahey, Michael C; Fallon, Penny; Fay, Alex; Fazzi, Elisa; Gorman, Mark P; Gowrinathan, Nirmala Rani; Hully, Marie; Kurian, Manju A; Leboucq, Nicolas; Lin, Jean-Pierre S-M; Lines, Matthew A; Mar, Soe S; Maroofian, Reza; Martí-Sanchez, Laura; McCullagh, Gary; Mojarrad, Majid; Narayanan, Vinodh; Orcesi, Simona; Ortigoza-Escobar, Juan Dario; Pérez-Dueñas, Belén; Petit, Florence; Ramsey, Keri M; Rasmussen, Magnhild; Rivier, François; Rodríguez-Pombo, Pilar; Roubertie, Agathe; Stödberg, Tommy I; Toosi, Mehran Beiraghi; Toutain, Annick; Uettwiller, Florence; Ulrick, Nicole; Vanderver, Adeline; Waldman, Amy; Livingston, John H; Crow, Yanick J
2017-06-01
We investigated the genetic, phenotypic, and interferon status of 46 patients from 37 families with neurological disease due to mutations in ADAR1 . The clinicoradiological phenotype encompassed a spectrum of Aicardi-Goutières syndrome, isolated bilateral striatal necrosis, spastic paraparesis with normal neuroimaging, a progressive spastic dystonic motor disorder, and adult-onset psychological difficulties with intracranial calcification. Homozygous missense mutations were recorded in five families. We observed a p.Pro193Ala variant in the heterozygous state in 22 of 23 families with compound heterozygous mutations. We also ascertained 11 cases from nine families with a p.Gly1007Arg dominant-negative mutation, which occurred de novo in four patients, and was inherited in three families in association with marked phenotypic variability. In 50 of 52 samples from 34 patients, we identified a marked upregulation of type I interferon-stimulated gene transcripts in peripheral blood, with a median interferon score of 16.99 (interquartile range [IQR]: 10.64-25.71) compared with controls (median: 0.93, IQR: 0.57-1.30). Thus, mutations in ADAR1 are associated with a variety of clinically distinct neurological phenotypes presenting from early infancy to adulthood, inherited either as an autosomal recessive or dominant trait. Testing for an interferon signature in blood represents a useful biomarker in this context. Georg Thieme Verlag KG Stuttgart · New York.
Inactivation of human interferon by body fluids
NASA Technical Reports Server (NTRS)
Cesario, T. C.; Mandell, A.; Tilles, J. G.
1973-01-01
Description of the effects of human feces, bile, saliva, serum, and cerebrospinal fluid on interferon activity. It is shown that crude interferon is inactivated by at least 50% more than with the control medium used, when incubated for 4 hr in vitro in the presence of serum, saliva, or cerebrospinal liquid, and by close to 100% when incubated with stool extract or bile.
Nordén, Rickard; Martner, Anna; Samuelsson, Ebba; Hynsjö, Lars; Wold, Agnes E.
2017-01-01
ABSTRACT A peculiar trait of pneumococci (Streptococcus pneumoniae) is their propensity to undergo spontaneous lysis during stationary growth due to activation of the enzyme autolysin (LytA), which fragments the peptidoglycan cell wall. The fragments that are generated upon autolysis impair phagocytosis and reduce production of interleukin-12 (IL-12) and gamma interferon (IFN-γ) by human leukocytes in response to intact pneumococci, thereby impeding crucial host defenses. The objective was to identify additional monocyte genes whose transcription is induced by intact pneumococci and subverted by autolyzed bacteria. Monocytes were isolated from healthy blood donors and stimulated for 3 h with UV-inactivated S. pneumoniae (Rx1PLY− LytA+ strain), which is capable of autolyzing, its LytA− isogenic autolysin-deficient mutant, or a mixture of the two (containing twice the initial bacterial concentration). Gene expression was assessed by Illumina microarray, and selected findings were confirmed by reverse transcription-quantitative real-time PCR (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and flow cytometry. In all, we identified 121 genes that were upregulated to a significantly higher degree by intact than autolyzed pneumococci. These included IFNB1 and a large set of interferon-induced genes, such as IFIT3, RSAD2, CFCL1, and CXCL10 genes, as well as IL12B and CD40 genes. RT-qPCR revealed that transcription of these genes in response to intact pneumococci diminished when autolyzed pneumococci were admixed and that this pattern was independent of pneumolysin. Thus, transcription of interferon-related genes is triggered by intact pneumococci and subverted by fragments generated by spontaneous bacterial autolysis. We suggest that interferon-related pathways are important for elimination of pneumococci and that autolysis contributes to virulence by extinguishing these pathways. PMID:28223347
Arsenic enhances the apoptosis induced by interferon gamma: key role of IRF-1.
El Bougrini, J; Pampin, M; Chelbi-Alix, M K
2006-05-15
Interferons (IFNs) and arsenic trioxide (As2O3) are known inhibitors of cell proliferation and have been used in the treatment of certain forms of malignancy. IFNgamma treatment of cells leads to tyrosine phosphorylation of STAT1 followed by dimerization that accumulates in the nucleus. This is followed by DNA binding, activation of target gene transcription, dephosphorylation, and return to the cytoplasm. We have shown earlier that IFNgamma and As2O3 act synergistically in acute promyelocytic leukemia cells to upregulate IRF-1 expression and to induce apoptosis. Here, we show that in the human fibrosarcoma cell line 2fTGH, As2O3 prolongs IFNgamma-induced STAT1 phosphorylation resulting in persistent binding of STAT1 to GAS motif leading to an increase in IRF-1 expression which correlated with both higher anti-proliferative effect and increased apoptosis. These biological responses induced by IFNgamma alone or in combination with As2O3 were abolished when IRF-1 expression was down-regulated by RNA interference, thus demonstrating the key role of IRF-1.
[Results of testing of MINISKAN mobile gamma-ray camera and specific features of its design].
Utkin, V M; Kumakhov, M A; Blinov, N N; Korsunskiĭ, V N; Fomin, D K; Kolesnikova, N V; Tultaev, A V; Nazarov, A A; Tararukhina, O B
2007-01-01
The main results of engineering, biomedical, and clinical testing of MINISKAN mobile gamma-ray camera are presented. Specific features of the camera hardware and software, as well as the main technical specifications, are described. The gamma-ray camera implements a new technology based on reconstructive tomography, aperture encoding, and digital processing of signals.
Kurtz, S M; Siskey, R; Reitman, M
2010-05-01
The objectives of this study were three-fold: (1) to determine the applicability of the small punch test to characterize Bionate 80A polycarbonate urethane (PCU) acetabular implants; (2) to evaluate the susceptibility of PCU acetabular implants to exhibit degradation of mechanical behavior following gamma irradiation in air and accelerated aging; and (3) to compare the oxidation of gamma-air sterilized PCU following accelerated aging and 5 years of natural shelf aging. In addition to attenuated total reflectance-Fourier transform infrared spectroscopy, we also adapted a miniature specimen mechanical test, the small punch test, for the deformable PCU cups. Accelerated aging was performed using ASTM F2003, a standard test that represents a severe oxidative challenge. The results of this study suggest that the small punch test is sufficiently sensitive and reproducible to discriminate slight differences in the large-deformation mechanical behavior of Bionate 80A following accelerated aging. The gamma-air sterilized PCU had a reduction of 9% in ultimate load after aging. Five years of shelf aging had little effect on the mechanical properties of the PCU. Overall, our findings suggest that the Bionate 80A material has greater oxidative stability than ultra-high molecular weight polyethylene following gamma irradiation in air and exposure to a severe oxidative challenge. (c) 2010 Wiley Periodicals, Inc.
Karachaliou, Niki; Gonzalez-Cao, Maria; Crespo, Guillermo; Drozdowskyj, Ana; Aldeguer, Erika; Gimenez-Capitan, Ana; Teixido, Cristina; Molina-Vila, Miguel Angel; Viteri, Santiago; De Los Llanos Gil, Maria; Algarra, Salvador Martin; Perez-Ruiz, Elisabeth; Marquez-Rodas, Ivan; Rodriguez-Abreu, Delvys; Blanco, Remedios; Puertolas, Teresa; Royo, Maria Angeles; Rosell, Rafael
2018-01-01
Background: Programmed death-ligand 1 (PD-L1) may be induced by oncogenic signals or can be upregulated via interferon gamma (IFN-γ). We have explored whether the expression of IFNG, the gene encoding IFN-γ, is associated with clinical response to the immune checkpoint blockade in non-small cell lung cancer (NSCLC) and melanoma patients. The role of inflammation-associated transcription factors STAT3, IKBKE, STAT1 and other associated genes has also been examined. Methods: Total RNA from 17 NSCLC and 21 melanoma patients was analyzed by quantitative reverse transcription PCR. STAT3 and Rantes, YAP1 and CXCL5, DNMT1, RIG1 and TET1, EOMES, IFNG, PD-L1 and CTLA4, IKBKE and NFATC1 mRNA were examined. PD-L1 protein expression in tumor and immune cells and stromal infiltration of CD8+ T-cells were also evaluated. Progression-free survival and overall survival were estimated. Results: A total of 17 NSCLC patients received nivolumab and 21 melanoma patients received pembrolizumab. Progression-free survival with nivolumab was significantly longer in NSCLC patients with high versus low IFNG expression (5.1 months versus 2 months, p = 0.0124). Progression-free survival with pembrolizumab was significantly longer in melanoma patients with high versus low IFNG expression (5.0 months versus 1.9 months, p = 0.0099). Significantly longer overall survival was observed for melanoma patients with high versus low IFNG expression (not reached versus 10.2 months p = 0.0183). There was a trend for longer overall survival for NSCLC patients with high versus low IFNG expression. Conclusions: IFN-γ is an important marker for prediction of response to immune checkpoint blockade. Further research is warranted in order to validate whether IFNG is more accurate than PD-L1. PMID:29383037
Zibara, Kazem; Zeidan, Asad; Bjeije, Hassan; Kassem, Nouhad; Badran, Bassam; El-Zein, Nabil
2017-03-01
Interferon gamma (IFN-ɣ) is a pleiotropic cytokine which plays dual contrasting roles in cancer. Although IFN-ɣ has been clinically used to treat various malignancies, it was recently shown to have protumorigenic activities. Reactive oxygen species (ROS) are overproduced in cancer cells, mainly due to NADPH oxidase activity, which results into several changes in signaling pathways. In this study, we examined IFN-ɣ effect on the phosphorylation levels of key signaling proteins, through ROS production, in the human breast cancer cell line MCF-7. After treatment by IFN-ɣ, results showed a significant increase in the phosphorylation of STAT1, Src, raf, AKT, ERK1/2 and p38 signaling molecules, in a time specific manner. Src and Raf were found to be involved in early stages of IFN-ɣ signaling since their phosphorylation increased very rapidly. Selective inhibition of Src-family kinases resulted in an immediate significant decrease in the phosphorylation status of Raf and ERK1/2, but not p38 and AKT. On the other hand, IFN-ɣ resulted in ROS generation, through H 2 O 2 production, whereas pre-treatment with the ROS inhibitor NAC caused ROS inhibition and a significant decrease in the phosphorylation levels of AKT, ERK1/2, p38 and STAT1. Moreover, pretreatment with a selective NOX1 inhibitor resulted in a significant decrease of AKT phosphorylation. Finally, no direct relationship was found between ROS production and calcium mobilization. In summary, IFN-ɣ signaling in MCF-7 cell line is ROS-dependent and follows the Src/Raf/ERK pathway whereas its signaling through the AKT pathway is highly dependent on NOX1.
Peng, Wan; Lu, Dan-Qi; Li, Gao-Fei; Zhang, Xu; Yao, Mi; Zhang, Yong; Lin, Hao-Ran
2016-02-01
Interferon gamma (IFNγ) is a Th1 cytokine that plays a very important role in almost all phases of immune and inflammatory responses. In this study, we explored the functions of IFNγ1 and IFNγ2 of Tetraodon nigroviridis. Treating T. nigroviridis spleen and head kidney cells in vitro with recombinant T. nigroviridis IFNγ1 protein (rTn IFNγ1) or recombinant T. nigroviridis IFNγ2 protein (rTn IFNγ2) enhanced their nitric oxide responses. Both rTn IFNγ1 and rTn IFNγ2 also induced the expression of interferon-stimulated gene 15 (ISG15), a common anti-viral gene, although the expression of the interferon-inducible Mx gene was markedly inhibited by rTn IFNγ1 and was induced by rTn IFNγ2. The in vivo effects of rTn IFNγ1 and rTn IFNγ2 on Vibrio parahaemolyticus (V. parahaemolyticus) infection were assessed by intraperitoneally injecting rTn IFNγ1 or rTn IFNγ2 (100 ng) and V. parahaemolyticus (8 × 10(10)CFU/mL) into T. nigroviridis. A comparison of the group treated only with V. parahaemolyticus and those also treated with rTn IFNγ1 or rTn IFNγ2 showed that neither of these IFNγs protected T. nigroviridis from V. parahaemolyticus infection. However, rTn IFNγ1 more rapidly and robustly promoted inflammatory responses compared with rTn IFNγ2, whereas rTn IFNγ2 was involved in inducing the host to develop a more effective response earlier during the later stage of a V. parahaemolyticus infection. Moreover, microRNA-29b (miR-29b) expression is inversely correlated with IFNγ2 expression in T. nigroviridis. Copyright © 2015 Elsevier Ltd. All rights reserved.
McCabe, Amanda; Smith, Julianne N P; Costello, Angelica; Maloney, Jackson; Katikaneni, Divya; MacNamara, Katherine C
2018-05-17
Severe aplastic anemia results from profound hematopoietic stem cell loss. T cells and interferon gamma have long been associated with severe aplastic anemia, yet the underlying mechanisms driving hematopoietic stem cell loss remain unknown. Using a mouse model of severe aplastic anemia, we demonstrate that interferon gamma-dependent hematopoietic stem cell loss required macrophages. Interferon gamma was necessary for bone marrow macrophage persistence, despite loss of other myeloid cells and hematopoietic stem cells. Depleting macrophages or abrogating interferon gamma signaling specifically in macrophages did not impair T cell activation or interferon gamma production in the bone marrow but rescued hematopoietic stem cells and reduced mortality. Thus, macrophages are not required for induction of interferon gamma in severe aplastic anemia and rather act as sensors of interferon gamma. Macrophage depletion rescued thrombocytopenia, increased bone marrow megakaryocytes, preserved platelet-primed stem cells, and increased the platelet-repopulating capacity of transplanted hematopoietic stem cells. In addition to the hematopoietic effects, severe aplastic anemia induced loss of non-hematopoietic stromal populations, including podoplanin-positive stromal cells. However, a subset of podoplanin-positive macrophages was increased during disease, and blockade of podoplanin in mice was sufficient to rescue disease. Our data further our understanding of disease pathogenesis demonstrating a novel role for macrophages as sensors of interferon gamma, thus illustrating an important role for the microenvironment in pathogenesis of severe aplastic anemia. Copyright © 2018, Ferrata Storti Foundation.
Rizvi, Meher; Sultan, Asfia; Chowdhry, Madhav; Azam, Mohd; Khan, Fatima; Shukla, Indu; Khan, Haris M
2018-01-01
Scrub typhus is lesser known cause of fever of unknown origin in India. Even if there have been reports documenting the prevalence of scrub typhus in different parts of India, it is still an unknown entity, and clinicians usually do not consider it as differential diagnosis. The present study was performed to document the prevalence of scrub typhus among febrile patients in western part of Uttar Pradesh and to assess the clinical profile of infected patients on the one hand and knowledge, attitude, and practices among clinicians on the other. A total of 357 adult patients with fever of more than 5-day duration were recruited. All patients underwent complete physical examination, and detailed clinical history was elicited as per predesigned pro forma. After primary screening to rule out malaria, enteric fever, and leptospirosis infection, secondary screening for scrub typhus was done by rapid screen test and IgM ELISA. Scrub typhus infection was positive in 91 (25.5%) cases. The most common symptoms among the patients were fever (100%), pain in abdomen (79.1%), pedal edema 56 (61.5%), rash 44 (48.3%), headache 44 (48.3%), vomiting 42 (46.1%), constipation 33 (36.2%), cough 28 (30.7%), and lymphadenopathy 20 (21.9%). The median values of interleukin-8, interferon-gamma, and tumor necrosis factor-alpha in healthy controls were 15.54 pg/ml, 7.77 pg/ml, and 54.1 pg/ml, respectively, while the median values of these cytokines in scrub typhus-positive patients were 21.04 pg/ml, 8.74 pg/ml, and 73.8 pg/ml, respectively. Our results highlight that scrub typhus infection is an important cause of pyrexia of unknown origin, and active surveillance is necessary to assess the exact magnitude and distribution of the disease.
Interferon-β 1a and SARS Coronavirus Replication
Hensley, Lisa E.; Fritz, Elizabeth A.; Karp, Christopher; Huggins, John W.; Geisbert, Thomas W.
2004-01-01
A global outbreak of severe acute respiratory syndrome (SARS) caused by a novel coronavirus began in March 2003. The rapid emergence of SARS and the substantial illness and death it caused have made it a critical public health issue. Because no effective treatments are available, an intensive effort is under way to identify and test promising antiviral drugs. Here, we report that recombinant human interferon (IFN)-β 1a potently inhibits SARS coronavirus replication in vitro. PMID:15030704
Wilden, Holger; Schirrmacher, Volker; Fournier, Philippe
2011-08-01
Newcastle disease virus (NDV) is an interesting agent for activating innate immune activity in macrophages including secretion of TNF-α and IFN-α, upregulation of TRAIL and activation of NF-κB and iNOS. However, the molecular mechanism of such cellular activities remains largely unknown. Tumor selectivity of replication of NDV has been described to be linked to deviations in tumor cells of the type I interferon response. We therefore focused on the interferon response to NDV of macrophages as part of innate anti-viral and anti-tumor activity. In particular, we investigated the functional significance of the interferon regulatory factor genes (IRF)-3 and IRF-7. Deletion of the IRF-3 or IRF-7 gene was found to increase susceptibility of mouse macrophages to virus infection. Surprisingly, NDV replicated better in IRF-3 KO than in IRF-7 KO macrophages. Further analysis showed that IRF-3 KO macrophages have a lower basal and NDV-induced RIG-I expression in comparison to IRF-7 KO macrophages. This might explain why, in IRF-3 KO macrophages, the secretion of type I interferons after NDV infection is delayed, when compared to IRF-7 KO and wild-type macrophages. In addition, IRF-3 KO cells showed reduced NDV-induced levels of IRF-7. This effect could be prevented by priming the cells first by interferon-α. Further results indicated that an early production of type I interferon rather than high maximal levels at later time points are important for resistance to infection by NDV. In conclusion, these results demonstrate an important role of IRF-3 for the innate anti-viral response to NDV of mouse macrophages.
Cosmic veto gamma-spectrometry for Comprehensive Nuclear-Test-Ban Treaty samples
NASA Astrophysics Data System (ADS)
Burnett, J. L.; Davies, A. V.
2014-05-01
The Comprehensive Nuclear-Test-Ban Treaty (CTBT) is supported by a global network of monitoring stations that perform high-resolution gamma-spectrometry on air filter samples for the identification of 85 radionuclides. At the UK CTBT Radionuclide Laboratory (GBL15), a novel cosmic veto gamma-spectrometer has been developed to improve the sensitivity of station measurements, providing a mean background reduction of 80.8% with mean MDA improvements of 45.6%. The CTBT laboratory requirement for a 140Ba MDA is achievable after 1.5 days counting compared to 5-7 days using conventional systems. The system consists of plastic scintillation plates that detect coincident cosmic-ray interactions within an HPGe gamma-spectrometer using the Canberra LynxTM multi-channel analyser. The detector is remotely configurable using a TCP/IP interface and requires no dedicated coincidence electronics. It would be especially useful in preventing false-positives at remote station locations (e.g. Halley, Antarctica) where sample transfer to certified laboratories is logistically difficult. The improved sensitivity has been demonstrated for a CTBT air filter sample collected after the Fukushima incident.
Galor, Anat; Garg, Nisha; Nanji, Afshan; Joag, Madhura; Nuovo, Gerard; Palioura, Sotiria; Wang, Gaofeng; Karp, Carol L
2015-11-01
To identify the frequency of human papilloma virus (HPV) in ocular surface squamous neoplasia (OSSN) and to evaluate differences in clinical features and treatment response of tumors with positive versus negative HPV results. Retrospective case series. Twenty-seven patients with OSSN. Ocular surface squamous neoplasia specimens were analyzed for the presence of HPV. Clinical features and response to interferon were determined retrospectively and linked to the presence (versus absence) of HPV. Clinical characteristics of OSSN by HPV status. Twenty-one of 27 tumors (78%) demonstrated positive HPV results. The HPV genotypes identified included HPV-16 in 10 tumors (48%), HPV-31 in 5 tumors, HPV-33 in 1 tumor, HPV-35 in 2 tumors, HPV-51 in 2 tumors, and a novel HPV in 3 tumors (total of 23 tumors because 1 tumor had 3 identified genotypes). Tumors found in the superior limbus were more likely to show positive HPV results (48% vs. 0%; P=0.06, Fisher exact test). Tumors with positive HPV-16 results were larger (68 vs. 34 mm2; P=0.08, Mann-Whitney U test) and were more likely to have papillomatous morphologic features (50% vs. 12%; P=0.07, Fisher exact test) compared with tumors showing negative results for HPV-16. Human papilloma virus status was not found to be associated with response to interferon therapy (P=1.0, Fisher exact test). Metrics found to be associated with a nonfavorable response to interferon were male gender and tumors located in the superior conjunctivae. The presence of HPV in OSSN seems to be more common in lesions located in the nonexposed, superior limbus. Human papilloma virus presence does not seem to be required for a favorable response to interferon therapy. Copyright © 2015 American Academy of Ophthalmology. All rights reserved.
Feng, Xuan; Han, Diana; Kilaru, Bharat K.; Franek, Beverly S.; Niewold, Timothy B.; Reder, Anthony T.
2014-01-01
Objective To determine whether statins affect type 1 interferon responses in relapsing-remitting multiple sclerosis (RRMS). Design Study effects of atorvastatin on type 1 interferon responses in Jurkat cells, mononuclear cells (MNCs) from therapy-naive patients with RRMS in vitro, and MNCs from interferon-treated RRMS patients in vivo in 4 conditions: no drug, statin only, interferon-beta only, and statin added on to interferon-beta therapy. Patients The study examined clinically stable patients with RRMS: 21 therapy-naive patients and 14 patients receiving interferon-beta with a statin. Interventions Statin effects on in vitro and in vivo interferon-beta–induced STAT1 transcription factor activation, expression of interferon-stimulated proteins in MNCs, and serum type 1 interferon activity. Results In vitro, atorvastatin dose dependently inhibited expression of interferon-stimulated P-Y-STAT1 by 44% (P< .001), interferon regulatory factor 1 protein by 30% (P= .006), and myxovirus resistance 1 protein by 32% (P=.004) compared with no-statin control in MNCs from therapy-naive RRMS patients. In vivo, 9 of 10 patients who received high-dose statins (80 mg) had a significant reduction in interferon-beta therapy–induced serum interferon-α/β activity, whereas only 2 of 4 patients who received medium-dose statins (40 mg) had reductions. High-dose add-on statin therapy significantly blocked interferon-beta function, with less P-Y-STAT1 transcription factor activation, and reduced myxovirus resistance 1 protein and viperin protein production. Medium doses of statins did not change STAT1 activation. Conclusions High-dose add-on statin therapy significantly reduces interferon-beta function and type 1 interferon responses in RRMS patients. These data provide a putative mechanism for how statins could counteract the beneficial effects of interferon-beta and worsen disease. PMID:22801747
Laban-Guceva, Nevenka; Antova, Magdalena; Bogoev, Milco
2007-11-01
TED is a severe eye disease leading in rare cases to decrease of sight, optic nerve compression and blindness. Recently, significant progresses in understanding the disease have been done. Nevertheless, the treatment of the disease, especially in its severe form remains challenging. Glucocorticoids (GC) have been the basis of the treatment for a long time. Orbital irradiation (OI) and optical decompression (OD) are also used in managing the severe forms of TED. Somatostatin, intravenous immunoglobulin have been also used, with conflicting results. Regarding the potential for the treatment of TED with cytokine antagonists, controlled clinical studies are not available. Since cytokines play an important role in the pathogenesis of the TED, they seemed to be logical choice for modern TED treatment. It has been shown that both Th1 (interleukin-2, tumor necrosis factor gamma, interleukin gamma) and Th2 (interleukin -4, -5, -10) profile T cells are activated in the TED. We therefore measured interleukin-gamma, IF-gamma and interleukin -10 (IL-10)(Th1 and Th2 pattern) to assess its relationship to the course of the disease. This paper shows that both Th1 (IL-2) and Th2 (IF-gamma) pathways represented by those two cytokines are not involved (IL-10 before 2.29+/-5.23 and after treatment 3.77+/-8.44; IF gamma before 0.50+/-0.24 and after treatment 0.35+/-0.19). No relationship to the response to treatment was found. GC resulted in positive response in 8/22 patients, OI (12 patients) given after CS therapy, resulted in a response in all patients. Increase in proptosis, loss of visual acuity is spite of CS treatment prompted OD in two patients, who both recovered visual acuity and proptosis fell under 25 mm Hertel.
Antiviral activity of ovine interferon tau 4 against foot-and-mouth disease virus.
Usharani, Jayaramaiah; Park, Sun Young; Cho, Eun-Ju; Kim, Chungsu; Ko, Young-Joon; Tark, Dongseob; Kim, Su-Mi; Park, Jong-Hyeon; Lee, Kwang-Nyeong; Lee, Myoung-Heon; Lee, Hyang-Sim
2017-07-01
Foot-and-mouth disease (FMD) is an economically important disease in most parts of the world and new therapeutic agents are needed to protect the animals before vaccination can trigger the host immune response. Although several interferons have been used for their antiviral activities against Foot-and-mouth disease virus (FMDV), ovine interferon tau 4 (OvIFN-τ4), with a broad-spectrum of action, cross-species antiviral activity, and lower incidence of toxicity in comparison to other type І interferons, has not yet been evaluated for this indication. This is the first study to evaluate the antiviral activity of OvIFN-τ4 against various strains of FMDV. The effective anti-cytopathic concentration of OvIFN-τ4 and its effectiveness pre- and post-infection with FMDV were tested in vitro in LFBK cells. In vivo activity of OvIFN-τ4 was then confirmed in a mouse model of infection. OvIFN-τ4 at a concentration of 500 ng, protected mice until 5days post-FMDV challenge and provided 90% protection for 10 days following FMDV challenge. These results suggest that OvIFN-τ4 could be used as an alternative to other interferons or antiviral agents at the time of FMD outbreak. Copyright © 2017. Published by Elsevier B.V.
Park, Sookyoung; Nozaki, Kenkichi; Smith, Joshua A.; Krause, James S.; Banik, Naren L.
2014-01-01
Insulin-like growth factor-1 (IGF-1) is a neuroprotective growth factor that promotes neuronal survival by inhibition of apoptosis. In order to examine whether IGF-1 exerts cytoprotective effects against extracellular inflammatory stimulation, ventral spinal cord 4.1 (VSC4.1) motoneuron cells were treated with interferon-gamma (IFN-γ). Our data demonstrated apoptotic changes, increased calpain:calpastatin and Bax:Bcl-2 ratios, and expression of apoptosis related proteases (caspase-3 and −12) in motoneurons rendered by IFN-γ in a dose-dependent manner. Post-treatment with IGF-1 attenuated these changes. In addition, IGF-1 treatment of motoneurons exposed to IFN-γ decreased expression of inflammatory markers (cyclooxygenase-2 and nuclear factor-kappa B:inhibitor of kappa B ratio). Furthermore, IGF-1 attenuated the loss of expression of IGF-1 receptors (IGF-1Rα and IGF-1Rβ) and estrogen receptors (ERα and ERβ) induced by IFN-γ. To determine whether the protective effects of IGF-1 are associated with ERs, ERs antagonist ICI and selective siRNA targeted against ERα and ERβ were used in VSC4.1 motoneurons. Distinctive morphological changes were observed following siRNA knockdown of ERα and ERβ. In particular, apoptotic cell death assessed by TUNEL assay was enhanced in both ERα and ERβ-silenced VSC4.1 motoneurons following IFN-γ and IGF-1 exposure. These results suggest that IGF-1 protects motoneurons from inflammatory insult by a mechanism involving pivotal interactions with ERα and ERβ. PMID:24188094
Franssila, R; Auramo, J; Modrow, S; Möbs, M; Oker-Blom, C; Käpylä, P; Söderlund-Venermo, M; Hedman, K
2005-01-01
Human parvovirus B19 is a small non-enveloped DNA virus with an icosahedral capsid consisting of proteins of only two species, the major protein VP2 and the minor protein VP1. VP2 is contained within VP1, which has an additional unique portion (VP1u) of 227 amino acids. We determined the ability of eukaryotically expressed parvovirus B19 virus-like particles consisting of VP1 and VP2 in the ratio recommended for vaccine use, or of VP2 alone, to stimulate, in an HLA class II restricted manner, peripheral blood mononuclear cells (PBMC) to proliferate and to secrete interferon gamma (IFN-γ) and interleukin (IL)-10 cytokines among recently and remotely B19 infected subjects. PBMC reactivity with VP1u was determined specifically with a prokaryotically expressed VP1u antigen. In general, B19-specific IFN-γ responses were stronger than IL-10 responses in both recent and remote infection; however, IL-10 responses were readily detectable among both groups, with the exception of patients with relapsed or persisting symptoms who showed strikingly low IL-10 responses. Whereas VP1u-specific IFN-γ responses were very strong among the recently infected subjects, the VP1u-specific IFN-γ and IL-10 responses were virtually absent among the remotely infected subjects. The disappearance of VP1u-specific IFN-γ expression is surprising, as B-cell immunity against VP1u is well maintained. PMID:16178856
Heathcote, E J; James, S; Mullen, K D; Hauser, S C; Rosenblate, H; Albert, D G
1999-08-01
Patients with chronic hepatitis C who have not had a sustained hepatitis C virus (HCV)-RNA response or serum alanine transaminase (ALT) response to a 6-month course of interferon (IFN) may respond to higher dose retreatment with consensus interferon (CIFN). Some nonresponders to initial IFN treatment have a transient response defined as undetectable HCV RNA or normalization of ALT during treatment, but subsequently have a "breakthrough" while still on treatment. The aim of this study was to determine if nonresponders who had breakthroughs responded differently to CIFN retreatment than nonresponders without breakthroughs using data from a large, multicenter trial. ALT and HCV RNA were monitored frequently during initial IFN therapy (either 9 mcg CIFN or 3 MU IFN-alpha2b 3 times per week). HCV-RNA breakthroughs were observed in 86 of 467 (18%) of all treated patients, and ALT breakthroughs were observed in 90 of 467 (19%) of all treated patients. There was no association between breakthroughs and the presence of either binding or neutralizing anti-IFN antibodies. When the patients who were nonresponders to initial IFN treatment were retreated with CIFN (15 mcg) for 12 months, 27% of those with viral breakthroughs had a sustained viral response compared with 8% in prior nonresponders without breakthroughs (P =.102). Sustained ALT responses were observed in 39% with breakthroughs compared with 10% in those without breakthroughs (P =.014). The data suggest that prior nonresponders with breakthroughs have a greater chance of responding to retreatment than do nonresponders without breakthroughs. However, most breakthrough patients would be missed unless repeated HCV-RNA testing were conducted during therapy.
Treatment of Hepatitis C Infections with Interferon: A Historical Perspective
2010-01-01
infected AKR cells: a novel effect of interferon,” Proceedings of the National Academy of Sciences of the United States of America, vol. 71, no. 9, pp...Treatment of Hepatitis C Infections with Interferon: A Historical Perspective Robert M. Friedman and Sara Contente Department of Pathology, Uniformed...involve new anti-HCV agents that are currently under development. The antiviral activity of interferon (IFN), first described in 1957, was in a chick cell
IFN-gamma induction by SCG, 1,3-beta-D-glucan from Sparassis crispa, in DBA/2 mice in vitro.
Harada, Toshie; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito
2002-12-01
Sparassis crispa Fr. in an edible mushroom recently cultivable in Japan. A branched beta-glucan from S. crispa (SCG) is a major 6-branched 1,3-beta-D-glucan showing antitumor activity. In this study, we examined interferon-gamma (IFN-gamma) induction by SCG from splenocytes in DBA/2 mice in vitro. In the splenocytes derived from almost all inbred strains of mice except for DBA/1 and DBA/2 mice, IFN-gamma production was not induced by SCG. The breeder and genders of DBA/2 mice showed no influence on IFN-gamma induction by SCG. On the other hand, the magnitude of IFN-gamma induction was lower in young mice than in their older counterparts. IFN-gamma was induced by SCG in adherent splenocytes, but IFN-gamma production was most significantly increased by SCG in instances involving coexistence of adherent and nonadherent splenocytes. In fact, inhibition of cell-cell contact reduced IFN-gamma induction by SCG. In addition, interleukin-12 p70 (IL-12p70) was induced by SCG in DBA/2 mice. It was suggested that soluble factors and cell-cell contact mediate synergistic effects on SCG-induced IFN-gamma production.
Lu, Jia-Jie; Chen, En-Qiang; Yang, Jia-Hong; Zhou, Tao-You; Liu, Li; Tang, Hong
2012-01-10
A functional interferon regulatory element (IRE) has been found in the EnhI/X promoter region of hepatitis B virus (HBV) genome. The purpose of this study is to compare the gene order of responder and non-responder to interferon therapy in patients with chronic hepatitis B (CHB), so as to evaluate the relationship between IRE mutation and the response to interferon treatment for CHB patients. Synthetic therapeutic effect is divided into complete response (CR), partial response (PR) and non-response (NR). Among the 62 cases included in this study, 40 cases (64.5%) were in the response group (CR and PR) and 22 (35.5%) cases were in the NR group. Wild type sequence of HBV IRE TTTCACTTTC were found in 35 cases (56.5%), and five different IRE gene sequences. included TTTtACTTTC, TTTCAtTTTC, TTTtAtTTTC, TTTtACTTTt and cTTtACcTTC, were found in 22 cases (35.5%), 1 case (1.6%), 1 case (1.6%), 2 cases (3.2%) and 1 case (1.6%) respectively. There were 41.9%cases (26/62) with forth base C→T mutation, consisted of 32.5% (13/40) cases in response group and 59.1% (13/22) cases in NR group. Among the 35 cases with IRE sequences, there were 67.5% (27/40) cases in response group and 36.4% (8/22) in NR group, and the difference in IRE sequences between two groups was statistic significantly (P = 0.027). The result suggested that there is likely relationship between the forth base mutation (C→T) of IRE region and the response of HBV to Interferon therapy, and this mutation may partially decrease the inhibition effect of interferon on HBV. The forth base C→T mutation in IRE element of HBV may partially influence the response of Interferon treatment in CHB patients.
Jeevan, Amminikutty; Bonilla, Diana Lucia; McMurray, David Neil
2009-09-01
Cytokine messenger RNA (mRNA) expression was investigated in the spleen and lung digest cells of bacillus Calmette-Guérin (BCG)-vaccinated and non-vaccinated guinea pigs following low-dose, pulmonary exposure to virulent Mycobacterium tuberculosis. After purified protein derivative (PPD) stimulation, the levels of lung cell interferon-gamma (IFN-gamma), tumour necrosis factor-alpha (TNF-alpha) and spleen cell interleukin-12 (IL-12) p40 mRNAs were significantly increased in the non-vaccinated M. tuberculosis-infected guinea pigs compared to the BCG-vaccinated guinea pigs. In contrast, the expression of anti-inflammatory transforming growth factor-beta and IL-10 mRNAs was significantly enhanced in the spleens of BCG-vaccinated animals. Despite the presence of protective cytokine mRNA expression, the non-vaccinated guinea pigs had significantly higher lung and spleen bacterial burdens. In contrast, BCG-vaccinated guinea pigs controlled the bacterial multiplication in their lungs and spleens, indicating that both protective as well as anti-inflammatory cytokine responses are associated with a reduction in bacteria. In addition, lung digest cells from non-vaccinated guinea pigs contained a significantly higher percentage of neutrophils, CD3(+) and CD8(+) T cells, while the percentage of macrophages was increased in the BCG-vaccinated animals. Total and purified lung digest T cells co-cultured with lung macrophages (LMøs) proliferated poorly after PPD stimulation in both non-vaccinated and BCG-vaccinated animals while robust proliferation to PPD was observed when T cells were co-cultured with peritoneal macrophages (PMøs). Macrophages within the lung compartment appear to regulate the response of T cells irrespective of the vaccination status in guinea pigs. Taken together, our results suggest that type I cytokine mRNA expression is not associated with vaccine-induced protection in the low-dose guinea pig model of tuberculosis.
Bartolomé, Javier; Castillo, Inmaculada; Quiroga, Juan Antonio; Carreño, Vicente
2016-02-01
Polymorphisms upstream interleukin (IL)-28B gene and serum levels of interferon gamma inducible protein-10 (IP-10) are associated with spontaneous and treatment-induced hepatitis C virus (HCV) clearance. Patients with seronegative occult HCV infection are anti-HCV and serum HCV-RNA negative but have viral RNA in liver and abnormal values of liver enzymes. We examined if the rs12979860 polymorphism of IL-28B and serum IP-10 levels differ between chronic and seronegative occult CV infection. IL-28B polymorphism was determined with allele specific TaqMan probes in total DNA isolated from peripheral blood mononuclear cells and IP-10 by an enzyme-linked immunosorbent assay in serum from 99 patients with seronegative occult HCV infection and 130 untreated patients with chronic hepatitis C. IL-28B genotypes were also determined in 54 healthy volunteers. Prevalence of the IL-28B CC genotype was significantly higher in seronegative occult HCV infection (52/99; 52.5%) than in chronic hepatitis C (32/130; 24.6%, P < 0.0001) or healthy controls (19/54: 32.5%, P = 0.039). Among patients with seronegative occult HCV infection, HCV-RNA load in liver was significantly lower in those with the IL-28B CC genotype than in those with CT + TT genotypes (2.8 × 10(5) ± 5.8 × 10(4) vs. 4.1 × 10(5) ± 5.9 × 10(4) copies/μg of total RNA respectively; P = 0.023). Mean serum IP-10 levels were significantly lower in patients with seronegative occult HCV infection than in patients with chronic hepatitis C (160.8 ± 17.9 vs. 288.7 ± 13.3 pg/ml respectively; P < 0.0001). These findings suggest that the host immune response plays an important role in seronegative occult HCV infection in comparison with chronic hepatitis C. © 2015 Wiley Periodicals, Inc.
Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu
2008-08-01
The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.
Assessment of Type I Interferon Signaling in Pediatric Inflammatory Disease.
Rice, Gillian I; Melki, Isabelle; Frémond, Marie-Louise; Briggs, Tracy A; Rodero, Mathieu P; Kitabayashi, Naoki; Oojageer, Anthony; Bader-Meunier, Brigitte; Belot, Alexandre; Bodemer, Christine; Quartier, Pierre; Crow, Yanick J
2017-02-01
Increased type I interferon is considered relevant to the pathology of a number of monogenic and complex disorders spanning pediatric rheumatology, neurology, and dermatology. However, no test exists in routine clinical practice to identify enhanced interferon signaling, thus limiting the ability to diagnose and monitor treatment of these diseases. Here, we set out to investigate the use of an assay measuring the expression of a panel of interferon-stimulated genes (ISGs) in children affected by a range of inflammatory diseases. A cohort study was conducted between 2011 and 2016 at the University of Manchester, UK, and the Institut Imagine, Paris, France. RNA PAXgene blood samples and clinical data were collected from controls and symptomatic patients with a genetically confirmed or clinically well-defined inflammatory phenotype. The expression of six ISGs was measured by quantitative polymerase chain reaction, and the median fold change was used to calculate an interferon score (IS) for each subject compared to a previously derived panel of 29 controls (where +2 SD of the control data, an IS of >2.466, is considered as abnormal). Results were correlated with genetic and clinical data. Nine hundred ninety-two samples were analyzed from 630 individuals comprising symptomatic patients across 24 inflammatory genotypes/phenotypes, unaffected heterozygous carriers, and controls. A consistent upregulation of ISG expression was seen in 13 monogenic conditions (455 samples, 265 patients; median IS 10.73, interquartile range (IQR) 5.90-18.41), juvenile systemic lupus erythematosus (78 samples, 55 patients; median IS 10.60, IQR 3.99-17.27), and juvenile dermatomyositis (101 samples, 59 patients; median IS 9.02, IQR 2.51-21.73) compared to controls (78 samples, 65 subjects; median IS 0.688, IQR 0.427-1.196), heterozygous mutation carriers (89 samples, 76 subjects; median IS 0.862, IQR 0.493-1.942), and individuals with non-molecularly defined autoinflammation (89 samples, 69
Current report on the interferon program at Roswell Park Memorial Institute.
Murphy, G P
1981-01-01
An overview of the interferon program at Roswell Park Memorial Institute (RPMI), is presented. This program encompasses three interrelated areas of research and new drug development: (a) basic research on purification and characterization of animal and human interferons (leukocyte, fibroblast, and immune); (b) large scale manufacture and preclinical testing of human fibroblast interferon (HFIF); and (c) clinical trials with HFIF to determine its safety of administration as well as antiviral, antitumor, and immunomodulatory activities in patients with neoplastic or viral disease. The antitumor effect of HFIF produced at RPMI as assessed by intralesional injection of various metastatic nodules resulted in an overall 71% local response. Phase I studies in 13 patients demonstrated that HFIF can be administered safely by the subcutaneous, intramuscular, and intravenous routes in doses up to 25 million units per day without any serious untoward effects. Intrathecal administration of HFIF into patients with CNS leukemia was also well tolerated. Pharmacokinetic studies indicated significant levels of HFIF in serum and cerebrospinal fluid after intravenous and intrathecal administration, respectively. Coincidental with the HFIF systemic administration during the Phase I trials, favorable responses in several laboratory, immune, and clinical parameters were observed. These results provide the rationale for conducting phase II and phase III clinical trials with HFIF produced at RPMI.
Gupta, Kanupriya; Ogendi, Brian M. O.; Bakshi, Rakesh K.; Kapil, Richa; Press, Christen G.; Sabbaj, Steffanie; Lee, Jeannette Y.
2017-01-01
ABSTRACT Chlamydia trachomatis infection is the most prevalent bacterial sexually transmitted infection and can cause significant reproductive morbidity in women. There is insufficient knowledge of C. trachomatis-specific immune responses in humans, which could be important in guiding vaccine development efforts. In contrast, murine models have clearly demonstrated the essential role of T helper type 1 (Th1) cells, especially interferon gamma (IFN-γ)-producing CD4+ T cells, in protective immunity to chlamydia. To determine the frequency and magnitude of Th1 cytokine responses elicited to C. trachomatis infection in humans, we stimulated peripheral blood mononuclear cells from 90 chlamydia-infected women with C. trachomatis elementary bodies, Pgp3, and major outer membrane protein and measured IFN-γ-, tumor necrosis factor alpha (TNF-α)-, and interleukin-2 (IL-2)-producing CD4+ and CD8+ T-cell responses using intracellular cytokine staining. The majority of chlamydia-infected women elicited CD4+ TNF-α responses, with frequency and magnitude varying significantly depending on the C. trachomatis antigen used. CD4+ IFN-γ and IL-2 responses occurred infrequently, as did production of any of the three cytokines by CD8+ T cells. About one-third of TNF-α-producing CD4+ T cells coproduced IFN-γ or IL-2. In summary, the predominant Th1 cytokine response elicited to C. trachomatis infection in women was a CD4+ TNF-α response, not CD4+ IFN-γ, and a subset of the CD4+ TNF-α-positive cells produced a second Th1 cytokine. PMID:28100498
[Interferon-alpha and liver fibrosis in patients with chronic damage due to hepatitis C virus].
Gonzalez-Huezo, María Sarai; Gallegos-Orozco, Juan Fernando
2003-01-01
The present review focuses on the published information published regarding the effects of interferon alpha therapy on liver fibrosis in patients with chronic liver damage secondary to hepatitis C infection. Data reviewed included results of the in vitro effects of interferon on hepatic cell line cultures with regards to indirect markers of fibrosis, activation of hepatic stellate cells and oxidative stress response. In the clinical arena, there is current clear evidence of a favorable histological outcome in patients with sustained viral response to interferon therapy. For this reason, the current review focuses more on the histological outcomes regarding liver fibrosis in patients who have not attained viral response to therapy (non-responders) or who already have biopsy defined cirrhosis. Data in these patients were analyzed according to the results of objective testing of fibrosis through the assessment of liver biopsy and its change during time, specially because the morbidity and mortality of this disease is directly related to the complications of liver cirrhosis and not necessarily to the persistence of the hepatitis C virus. Lastly, it is concluded that the process of liver fibrosis/cirrhosis is a dynamic one and that there is some evidence to support the usefulness of interferon alpha therapy as a means to halt or retard the progression of hepatic fibrosis. The result of current clinical trials in which interferon therapy is being used to modify the progression of fibrosis in non-responders or cirrhotic patients is eagerly awaited.
Hung, Chiung-Yu; Castro-Lopez, Natalia; Cole, Garry T
2016-04-01
Coccidioidomycosis is a potentially life-threatening respiratory disease which is endemic to the southwestern United States and arid regions of Central and South America. It is responsible for approximately 150,000 infections annually in the United States alone. Almost every human organ has been reported to harbor parasitic cells of Coccidioides spp. in collective cases of the disseminated form of this mycosis. Current understanding of the mechanisms of protective immunity against lung infection has been largely derived from murine models of pulmonary coccidioidomycosis. However, little is known about the nature of the host response to Coccidioides in extrapulmonary tissue. Primary subcutaneous coccidioidal infection is rare but has been reported to result in disseminated disease. Here, we show that activation of MyD88 and Card9 signal pathways are required for resistance to Coccidioides infection following subcutaneous challenge of C57BL/6 mice, which correlates with earlier findings of the protective response to pulmonary infection. MyD88(-/-) andCard9(-/-) mice recruited reduced numbers of T cells, B cells, and neutrophils to the Coccidioides-infected hypodermis com pared to wild-type mice; however, neutrophils were dispensable for resistance to skin infection. Further studies have shown that gamma interferon (IFN-γ) production and activation of Th1 cells characterize resistance to subcutaneous infection. Furthermore, activation of a phagosomal enzyme, inducible nitric oxide synthase, which is necessary for NO production, is a requisite for fungal clearance in the hypodermis. Collectively, our data demonstrate that MyD88- and Card9-mediated IFN-γ and nitric oxide production is essential for protection against subcutaneous Coccidioides infection. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Coordinated therapeutic effects of immune modulators and interferon.
Cerutti, I; Chany, C
1983-01-01
Immune modulators injected 24 h before encephalomyocarditis virus significantly increase antiviral resistance in mice when interferon is administered 1 h after the virus. These immune modulators can be crude bacterial extracts or synthetic drugs. In some cases, the responses are additive; in others, they are clearly cooperative. To protect the mice against the development of 180 TG Crocker sarcomas, the association of bacterial extracts and interferon is highly effective under the condition that the drug concentrations and chronological order and number of injections are well defined. In contrast, the conjunction of interferon and synthetic immune modulators, in particular cimetidine, result in delayed tumor development with no significant change in the final survival rate in the experimental model described here. PMID:6315585
Zhang, Qibo; Bernatoniene, Jolanta; Bagrade, Linda; Paton, James C.; Mitchell, Timothy J.; Hammerschmidt, Sven; Nunez, Desmond A.; Finn, Adam
2006-01-01
Nasopharyngeal tonsils (adenoids) are part of human nasopharynx-associated lymphoid tissue, which may play an important role in local defense against pneumococci. Recent studies with animals have suggested that several pneumococcal proteins, including CbpA and pneumolysin (Ply), may be vaccine candidates. Our recent data obtained with children suggest that antibodies to these proteins may protect against carriage. This study was performed to investigate the regulation of the T-cell-dependent antibody responses to CbpA and pneumolysin by cytokines in adenoidal immune cells from children. Adenoidal mononuclear cells (MNC) were cultured with pneumococcal concentrated culture supernatants (CCS) or recombinant proteins. Cytokine expression profiles in adenoidal MNC after antigen stimulation were analyzed by reverse transcription-PCR, protein array analysis, and an immunoassay, along with an antibody production analysis. The roles, interactions, and cellular sources of the main cytokines identified were evaluated further. Pneumococcal CCS induced production of CbpA- and Ply-specific antibodies in association with several chemokines and cytokines, including gamma interferon (IFN-γ) and interleukin-10 (IL-10) in MNC. The antibody production correlated well with the concentrations of these two cytokines. Addition of recombinant IFN-γ or IL-10 enhanced antibody production, and monoclonal antibodies to these two cytokines and T-cell depletion significantly reduced antibody production. Intracellular cytokine staining showed that T cells are a major source of IFN-γ and IL-10. Recombinant Ply and, to a lesser extent, recombinant CbpA induced significant production of IFN-γ and IL-10 in MNC. T-cell-derived IFN-γ and IL-10 may be key regulators of production of mucosal antibody to pneumococcal protein antigens in the nasopharynx and may play an important role in local protection against pneumococcal infection in children. PMID:16861661
Vortia, Eugene; Uko, Victor E; Yen-Lieberman, Belinda; Frawley, Jill; Worley, Sarah E; Danziger-Isakov, Lara; Kaplan, Barbara; Mahajan, Lori
2018-03-19
Tumor necrosis factor alpha (TNF-α) inhibitors are linked with increased risk of reactivation of active tuberculosis. The QuantiFERON-TB Gold In-Tube test is approved for screening latent tuberculosis infection in children and adults. There are limited data on the test performance in children on long-term treatment with TNF-α inhibitors. The objective of this study was to assess the proportion of indeterminate results for the QuantiFERON-TB Gold In-Tube in children with inflammatory bowel disease (IBD) on long-term infliximab treatment and to evaluate the range of interferon-γ responses to mitogen. A single-center prospective study of children 5 to 19 years of age with IBD on long-term infliximab treatment (>3 months). Each child was assessed for tuberculosis exposure risk and had blood drawn for the QuantiFERON-TB Gold In-Tube. Data on the range of interferon-γ responses and final QuantiFERON-TB Gold In-Tube test results were collected. Ninety-three children were included, with a median age of 16 years. The median total duration of infliximab therapy was 34 months (range, 3-119 months). The QuantiFERON-TB Gold In-Tube was indeterminate in 1 patient (1.1%), positive in 2 patients, and negative in 90 patients. The maximum interferon-γ response to mitogen (10 IU/mL) was observed in 82 patients (88%), with only 1 patient having an inadequate response. The proportion of indeterminate results was significantly lower than the prospectively hypothesized rate of 8%, based on prior studies in nonimmunosuppressed patients (P = 0.004). Pediatric patients with IBD on long-term treatment with infliximab had an adequate interferon-γ response to mitogen and a low indeterminate rate when assessed with the QuantiFERON-TB Gold In-Tube test. This study demonstrates a robust interferon gamma response to phytohemagglutinin stimulation in a pediatric population on long-term therapy with infliximab. The QuantiFERON-TB Gold In-Tube test may therefore be useful as a periodic
Chen, Wei
2016-02-01
To observe the clinical efficacy of spleen, liver and kidney-strengthening formula combined with polyethylene glycol interferon in the treatment of HBeAg positive chronic hepatitis B(HP-HBV).One hundred and twenty-six patients with HP-HBV, who were treated in the hospital from June 2012 to December 2014, were selected and injected with polyethylene glycol interferon α-2a(or α-2b). The treatment course for the patients lasted for 24 weeks. Base on the level of HBV-DNA, patients are divided into response group and poor response group. According to random number table, the poor response group were randomized into control group and test group. Patients in the control group were injected with polyethylene glycol interferon α-2a(or α-2b), and patients in the test group were treated with spleen, liver and kidney-strengthening formula combined with polyethylene glycol interferon. Clinical efficacies of the 2 groups were observed, and changes in the level of HBeAg, ALT and HBV-DNA were observed before treatment and at the 24th week after treatment, and virological and serological response, biochemical responses, integral clinical symptoms and signs, adverse reactions were observed after 48 weeks of treatment.After 24 weeks of treatment, the response group was significantly better than the poor response group in HBeAg, ALT and the level of HBV-DNA(P<0.05). After 48 weeks of treatment, there was statistical significance in HBV-DNA negative conversion rate, HBeAg negative conversion rate between the 2 groups(P<0.05), and the test group was better in the two indicators. And the test group was significantly lower than the control group in clinical symptoms and signs score at the 48th week after treatment(P<0.05), with a significantly lower adverse reaction rate than the control group(P<0.05).Combination of spleen, liver and kidney-strengthening formula and polyethylene glycol interferon α-2a was effective and safe in the treatment of chronic hepatitis B, and so worth
Qiao, H-L; Liu, J-H; Yang, J; Dong, Z-M
2005-08-01
The aim of this study was to investigate the relationships between skin test, specific immunoglobulin (Ig) E and cytokines in penicillin allergy. We collected the sera of 259 patients with historical positive skin test to penicillins, with immediate positive skin test and with a negative skin test results. The positive rate of specific IgE antibodies in 259 patients was 62.2% (161) by using radioallergosorbent test (RAST). Of the eight kinds of antigenic determinants, the positive rates of specific IgE to major and minor determinants were 43.63% (113) and 52.51% (136), respectively (p < 0.05). In 122 patients with immediate positive skin test, when the degrees of skin test were +, 2+, 3+ and 4+, the positive rates of specific IgE were 45.7, 57.1, 85.2 and 100%, respectively. The levels of interleukin (IL)-4, IL-13 and interferon (IFN)-gamma in the sera of patients with positive skin test were significantly increased with the degree of positive skin test (p < 0.05). The combined use of major and minor determinants in RAST offers the better test for the detection of penicillin-specific IgE antibodies. IL-4, IL-13 and IFN-gamma play important roles in penicillin allergy.
St Laurent, G; Yoshie, O; Floyd-Smith, G; Samanta, H; Sehgal, P B; Lengyel, P
1983-05-01
(2'-5')(A)n synthetase and RNAase L (a latent endoribonuclease) are among the mediators of interferon action. The product of (2'-5')(A)n synthetase (i.e., (2'-5')(A)n) binds, and thereby activates RNAase L. Interferons induce in Ehrlich ascites tumor (EAT) cells two mRNAs (sizes 1.5 kb and 3.8 kb), which can be translated in Xenopus oocytes into (2'-5')(A)n synthetases of 20,000 to 30,000 daltons and 85,000 to 100,000 daltons, respectively. (2'-5')(A)n synthetases of corresponding sizes are induced by interferons in EAT cells. In the cell extract the bulk of the larger enzyme is in the cytoplasmic fraction, and the bulk of the smaller one in the nuclear fraction. The only known function of (2'-5')(A)n is the activation of RNAase L, and RNAase L can be selectively crosslinked to a (2'-5')(A)n derivative in a cytoplasmic extract from EAT cells. The same (2'-5')(A)n derivative can be crosslinked to several proteins in the nuclear extract of EAT cells, and some of these proteins are induced by interferon.
Blanc, Mathieu; Hsieh, Wei Yuan; Robertson, Kevin A.; Watterson, Steven; Shui, Guanghou; Lacaze, Paul; Khondoker, Mizanur; Dickinson, Paul; Sing, Garwin; Rodríguez-Martín, Sara; Phelan, Peter; Forster, Thorsten; Strobl, Birgit; Müller, Matthias; Riemersma, Rudolph; Osborne, Timothy; Wenk, Markus R.; Angulo, Ana; Ghazal, Peter
2011-01-01
Little is known about the protective role of inflammatory processes in modulating lipid metabolism in infection. Here we report an intimate link between the innate immune response to infection and regulation of the sterol metabolic network characterized by down-regulation of sterol biosynthesis by an interferon regulatory loop mechanism. In time-series experiments profiling genome-wide lipid-associated gene expression of macrophages, we show a selective and coordinated negative regulation of the complete sterol pathway upon viral infection or cytokine treatment with IFNγ or β but not TNF, IL1β, or IL6. Quantitative analysis at the protein level of selected sterol metabolic enzymes upon infection shows a similar level of suppression. Experimental testing of sterol metabolite levels using lipidomic-based measurements shows a reduction in metabolic output. On the basis of pharmacologic and RNAi inhibition of the sterol pathway we show augmented protection against viral infection, and in combination with metabolite rescue experiments, we identify the requirement of the mevalonate-isoprenoid branch of the sterol metabolic network in the protective response upon statin or IFNβ treatment. Conditioned media experiments from infected cells support an involvement of secreted type 1 interferon(s) to be sufficient for reducing the sterol pathway upon infection. Moreover, we show that infection of primary macrophages containing a genetic knockout of the major type I interferon, IFNβ, leads to only a partial suppression of the sterol pathway, while genetic knockout of the receptor for all type I interferon family members, ifnar1, or associated signaling component, tyk2, completely abolishes the reduction of the sterol biosynthetic activity upon infection. Levels of the proteolytically cleaved nuclear forms of SREBP2, a key transcriptional regulator of sterol biosynthesis, are reduced upon infection and IFNβ treatment at both the protein and de novo transcription level. The
NASA Technical Reports Server (NTRS)
Mackay, R. A.; Ebert, L. J.
1985-01-01
The kinetics of the formation and subsequent development of the directional coarsening of the gamma-prime precipitate in model Ni-Al-Mo-Ta superalloy single crystals are examined during tensile creep under various stress levels at 982 and 1038 C. Special attention is given to the gamma and gamma-prime relation to creep time and strain in order to trace the changing gamma-gamma-prime morphology. Directional coarsening of gamma-prime is found to begin during primary creep and its rate is shown to increase with an increase in temperature or stress level. The length of gamma-prime thickness increased linearly with time up to a plateau reached after the onset of steady state creep. The raft thickness, equal to the gamma-prime size, remained constant at this initial value up through the onset of the tertiary creep. The interlaminar spacing indicates the stability of directionally coarsened structure.
Interferon-λ restricts West Nile virus neuroinvasion by tightening the blood-brain barrier.
Lazear, Helen M; Daniels, Brian P; Pinto, Amelia K; Huang, Albert C; Vick, Sarah C; Doyle, Sean E; Gale, Michael; Klein, Robyn S; Diamond, Michael S
2015-04-22
Although interferon-λ [also known as type III interferon or interleukin-28 (IL-28)/IL-29] restricts infection by several viruses, its inhibitory mechanism has remained uncertain. We used recombinant interferon-λ and mice lacking the interferon-λ receptor (IFNLR1) to evaluate the effect of interferon-λ on infection with West Nile virus, an encephalitic flavivirus. Cell culture studies in mouse keratinocytes and dendritic cells showed no direct antiviral effect of exogenous interferon-λ, even though expression of interferon-stimulated genes was induced. We observed no differences in West Nile virus burden between wild-type and Ifnlr1(-/-) mice in the draining lymph nodes, spleen, or blood. We detected increased West Nile virus infection in the brain and spinal cord of Ifnlr1(-/-) mice, yet this was not associated with a direct antiviral effect in mouse neurons. Instead, we observed an increase in blood-brain barrier permeability in Ifnlr1(-/-) mice. Treatment of mice with pegylated interferon-λ2 resulted in decreased blood-brain barrier permeability, reduced West Nile virus infection in the brain without affecting viremia, and improved survival against lethal virus challenge. An in vitro model of the blood-brain barrier showed that interferon-λ signaling in mouse brain microvascular endothelial cells increased transendothelial electrical resistance, decreased virus movement across the barrier, and modulated tight junction protein localization in a protein synthesis- and signal transducer and activator of transcription 1 (STAT1)-independent manner. Our data establish an indirect antiviral function of interferon-λ in which noncanonical signaling through IFNLR1 tightens the blood-brain barrier and restricts viral neuroinvasion and pathogenesis. Copyright © 2015, American Association for the Advancement of Science.
Zhou, Hao; Chen, Shun; Wang, Mingshu; Cheng, Anchun
2014-01-01
Interferon may be thought of as a key, with the interferon receptor as the signal lock: Crosstalk between them maintains their balance during viral infection. In this review, the protein structure of avian interferon and the interferon receptor are discussed, indicating remarkable similarity between different species. However, the structures of the interferon receptors are more sophisticated than those of the interferons, suggesting that the interferon receptor is a more complicated signal lock system and has considerable diversity in subtypes or structures. Preliminary evolutionary analysis showed that the subunits of the interferon receptor formed a distinct clade, and the orthologs may be derived from the same ancestor. Furthermore, the development of interferons and interferon receptors in birds may be related to an animal’s age and the maintenance of a balanced state. In addition, the equilibrium between interferon and its receptor during pathological and physiological states revealed that the virus and the host influence this equilibrium. Birds could represent an important model for studies on interferon’s antiviral activities and may provide the basis for new antiviral strategies. PMID:25405736
Measuring the charged pion polarizability in the gamma gamma -> pi+pi- reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lawrence, David W.; Miskimen, Rory A.; Mushkarenkov, Alexander Nikolaevich
2013-08-01
Development has begun of a new experiment to measure the charged pion polarizabilitymore » $$\\alpha_{\\pi}-\\beta_{\\pi}$$. The charged pion polarizability ranks among the most important tests of low-energy QCD presently unresolved by experiment. Analogous to precision measurements of $$\\pi^{\\circ}\\rightarrow\\gamma\\gamma$$ that test the intrinsic odd-parity (anomalous) sector of QCD, the pion polarizability tests the intrinsic even-parity sector of QCD. The measurement will be performed using the $$\\gamma\\gamma\\rightarrow\\pi^{+{}}\\pi^{-{}}$$ cross section accessed via the Primakoff mechanism on nuclear targets using the GlueX detector in Hall D at Jefferson Lab. The linearly polarized photon source in Hall-D will be utilized to separate the Primakoff cross-section from coherent $$\\rho^{\\circ}$$ production.« less
Ng, Cherie T; Sullivan, Brian M; Teijaro, John R; Lee, Andrew M; Welch, Megan; Rice, Stephanie; Sheehan, Kathleen C F; Schreiber, Robert D; Oldstone, Michael B A
2015-05-13
Although type I interferon (IFN-I) is thought to be beneficial against microbial infections, persistent viral infections are characterized by high interferon signatures suggesting that IFN-I signaling may promote disease pathogenesis. During persistent lymphocytic choriomeningitis virus (LCMV) infection, IFNα and IFNβ are highly induced early after infection, and blocking IFN-I receptor (IFNAR) signaling promotes virus clearance. We assessed the specific roles of IFNβ versus IFNα in controlling LCMV infection. While blockade of IFNβ alone does not alter early viral dissemination, it is important in determining lymphoid structure, lymphocyte migration, and anti-viral T cell responses that lead to accelerated virus clearance, approximating what occurs during attenuation of IFNAR signaling. Comparatively, blockade of IFNα was not associated with improved viral control, but with early dissemination of virus. Thus, despite their use of the same receptor, IFNβ and IFNα have unique and distinguishable biologic functions, with IFNβ being mainly responsible for promoting viral persistence. Copyright © 2015 Elsevier Inc. All rights reserved.
Hecker, M.; Preiss, C.; Klemm, P.; Busse, R.
1996-01-01
1. In view of the potential deleterious effects of high amounts of nitric oxide (NO) produced by the inducible isoform of NO synthase (iNOS) in inflammation, the prevention of the expression of this enzyme represents an important therapeutic goal. In cytokine-stimulated cells, activation of nuclear factor kappa B (NF-kappa B) is crucial for the increase in iNOS gene expression. Since NF-kappa B activation appears to involve a redox-sensitive step, we have investigated whether three structurally unrelated antioxidants, 5,7-dihydroxyflavone (chrysin), 3,4-dichloroisocoumarin (DCI) and N-acetyl 5-hydroxytryptamine (N-acetylserotonin, NAS), affect iNOS expression in cultured RAW 264.7 monocyte/macrophages stimulated with bacterial lipopolysaccharide (LPS, 140 ng ml-1) and interferon-gamma (IFN gamma, 5 u ml-1). 2. During a 6 h incubation period neither LPS nor IFN gamma alone exerted a significant effect but when combined, caused a prominent increase in nitrite formation, iNOS mRNA and protein abundance. Co-incubation with chrysin (50 microM), DCI (50 microM) or NAS (1 mM) markedly attenuated this increase in iNOS gene expression. 3. DCI, but not chrysin or NAS, prevented the activation of NF-kappa B in cells exposed to LPS plus IFN gamma for 30 min. In contrast, all three antioxidants significantly blunted the DNA-binding activity of interferon regulatory factor 1 (IRF-1), which mediates the synergistic effect of IFN gamma on iNOS gene expression in cells treated for 2 h with LPS plus IFN gamma. 4. DCI thus appears to inhibit iNOS gene expression at the transcriptional level by preventing the activation of both NF-kappa B and IRF-1. The inhibitory effect of DCI on NF-kappa B activation, however, does not seem to be related to its antioxidative properties, since DCI, unlike chrysin or NAS, is a potent serine protease inhibitor which stabilizes the inactive NF-kappa B complex by protecting the inhibitory I kappa B-alpha subunit from proteolytic degradation. 5. The
Park, Sookyoung; Nozaki, Kenkichi; Smith, Joshua A; Krause, James S; Banik, Naren L
2014-03-01
Insulin-like growth factor-1 (IGF-1) is a neuroprotective growth factor that promotes neuronal survival by inhibition of apoptosis. To examine whether IGF-1 exerts cytoprotective effects against extracellular inflammatory stimulation, ventral spinal cord 4.1 (VSC4.1) motoneuron cells were treated with interferon-gamma (IFN-γ). Our data demonstrated apoptotic changes, increased calpain:calpastatin and Bax:Bcl-2 ratios, and expression of apoptosis-related proteases (caspase-3 and -12) in motoneurons rendered by IFN-γ in a dose-dependent manner. Post-treatment with IGF-1 attenuated these changes. In addition, IGF-1 treatment of motoneurons exposed to IFN-γ decreased expression of inflammatory markers (cyclooxygenase-2 and nuclear factor-kappa B:inhibitor of kappa B ratio). Furthermore, IGF-1 attenuated the loss of expression of IGF-1 receptors (IGF-1Rα and IGF-1Rβ) and estrogen receptors (ERα and ERβ) induced by IFN-γ. To determine whether the protective effects of IGF-1 are associated with ERs, ERs antagonist ICI and selective siRNA targeted against ERα and ERβ were used in VSC4.1 motoneurons. Distinctive morphological changes were observed following siRNA knockdown of ERα and ERβ. In particular, apoptotic cell death assessed by TUNEL assay was enhanced in both ERα and ERβ-silenced VSC4.1 motoneurons following IFN-γ and IGF-1 exposure. These results suggest that IGF-1 protects motoneurons from inflammatory insult by a mechanism involving pivotal interactions with ERα and ERβ. © 2013 International Society for Neurochemistry.
Cross-talk between interferon-gamma and interleukin-18 in melanogenesis.
Zhou, Jia; Ling, Jingjing; Wang, Yong; Shang, Jing; Ping, Fengfeng
2016-10-01
Skin is the largest organ in our body and strategically placed to provide a metabolically active biological barrier against a range of noxious stressors. A lot of inflammatory cytokines, which are increased after ultraviolet (UV) irradiation produced by keratinocytes or other immunocytes, are closely related to pigmentary changes, including interleukin-18 (IL-18) and interferon-γ (IFN-γ). In this study, the effect of cross-talk between IL-18 and IFN-γ on melanogenesis was investigated. Treatment with IL-18 resulted in a dose-dependent increase of melanogenesis, while IFN-γ made an opposite effect. This influence of IL-18 and IFN-γ was mediated by regulations of microphthalmia-associated transcription factor (MITF) and its downstream enzymatic cascade expressions. Furthermore, IFN-γ inhibited basal and IL-18-induced melanogenesis. IFN-γ increased signal transducer and activator of transcription-1 (STAT-1) phosphorylation to play its position in regulating melanin pigmentation, and its inhibitory effect could be prevented by Janus Kinase 1 (JAK 1) inhibitor. IFN-γ could inhibit melanogenesis by decreasing melanocyte dendrite formation. In addition, IFN-γ inhibited the expressions of Rab Pases to suppress the mature and transport of melanosomes. IL-18 could rapidly induce Akt and PTEN phosphorylation and p65 expression in B16F10 cells. When treatment with IL-18 and IFN-γ together, the phosphorylation level of Protein Kinase B (Akt) and phosphatase and tensin homolog deleted on chromosome ten (PTEN) and expression of p65 NF-κB were inhibited, compared with treated with IL-18 only. Our studies indicated that IFN-γ could directly induce B16F10 cells apoptosis in vitro. Furthermore, we demonstrated that IFN-γ markedly up-regulated IL-18 binding protein (BP) production in normal human foreskin-derived epidermal keratinocytes in dose-dependent manner. UVB irradiation induced protease-activated receptor-2 (PAR-2) expression in NHEK, IFN-γ could inhibit this
Human interferon and its inducers: clinical program overview at Roswell Park Memorial Institute.
Carter, W A; Horoszewicz, J S
1978-11-01
An overview of the clinical interferon program at Roswell Park Memorial Institute is presented. Purified fibroblast interferon and a novel inducer of human interferon [rIn-r(C12,U)n] are being evaluated for possible antiviral, antiproliferative, and immunomodulatory activities in patients with cancer.
Suppressing effect of low-dose gamma-ray irradiation on collagen-induced arthritis.
Nakatsukasa, Hiroko; Tsukimoto, Mitsutoshi; Ohshima, Yasuhiro; Tago, Fumitoshi; Masada, Ayako; Kojima, Shuji
2008-07-01
We previously reported attenuation of autoimmune disease by low-dose gamma-ray irradiation in MRL-lpr/lpr mice. Here, we studied the effect of low-dose gamma-ray irradiation on collagen-induced arthritis (CIA) in DBA/1J mice. Mice were immunized with type II collagen, and exposed to low-dose gamma-rays (0.5 Gy per week for 5 weeks). Paw swelling, redness, and bone degradation were suppressed by irradiation, which also delayed the onset of pathological change and reduced the severity of the arthritis. Production of tumor necrosis factor-alpha, interferon-gamma, and interleukin-6, which play important roles in the onset of CIA, was suppressed by the irradiation. The level of anti-type II collagen antibody, which is essential for the onset of CIA, was also lower in irradiated CIA mice. The population of plasma cells was increased in CIA mice, but irradiation blocked this increase. Since regulatory T cells are known to be involved in suppression of autoimmune disease, the population of CD4(+)CD25(+)Foxp3(+) regulatory T cells was measured. Intriguingly, a significant increase of these regulatory T cells was found in irradiated CIA mice. Overall, our data suggest that low-dose gamma-ray irradiation could attenuate CIA through suppression of pro-inflammatory cytokines and autoantibody production, and induction of regulatory T cells.
... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS, a disease in which ... interferon beta-1b injection at around the same time of day each time you inject it. Follow ...
Tests and foreseen developments of fibered-OSLD gamma heating measurements in low-power reactors
NASA Astrophysics Data System (ADS)
Gruel, A.; Guillou, M. Le; Blaise, P.; Destouches, C.; Magne, S.
2018-01-01
In this paper are presented test measurements of a fibered-OSLD system performed during a dedicated experimental phase in EOLE zero-power reactor. The measurement setup consists of an OSLD crystal connected onto the extremity of an optical fiber and a laser stimulation system, manufactured by the CEA/LIST in Saclay. The OSL sensor is remotely stimulated via an optical fiber using a diode-pumped solid-state laser. The OSL light is collected and guided back along the same fiber to a photomultiplier tube. Results obtained using this system are compared to usual gamma heating measurement protocol using OSLD pellets. The presence of induced radio-luminescence in the OSLD during the irradiation was also observed and could be used to monitor the gamma flux. The feasibility of remote measurements is achieved, whereas further developments could be conducted to improve this technique since the readout procedure still requires to withdraw the OSLD off the gamma flux (hence from the core) on account of the dose rate (around a few Gy.h-1), and the readout time remains quite long for on-line applications. Several improvements are foreseen, and will be tested in the forthcoming years.
Interferons and Interferon Regulatory Factors in Malaria
Claser, Carla; Tan, Kevin Shyong Wei; Rénia, Laurent
2014-01-01
Malaria is one of the most serious infectious diseases in humans and responsible for approximately 500 million clinical cases and 500 thousand deaths annually. Acquired adaptive immune responses control parasite replication and infection-induced pathologies. Most infections are clinically silent which reflects on the ability of adaptive immune mechanisms to prevent the disease. However, a minority of these can become severe and life-threatening, manifesting a range of overlapping syndromes of complex origins which could be induced by uncontrolled immune responses. Major players of the innate and adaptive responses are interferons. Here, we review their roles and the signaling pathways involved in their production and protection against infection and induced immunopathologies. PMID:25157202
How Does Vaccinia Virus Interfere With Interferon?
Smith, Geoffrey L; Talbot-Cooper, Callum; Lu, Yongxu
2018-01-01
Interferons (IFNs) are secreted glycoproteins that are produced by cells in response to virus infection and other stimuli and induce an antiviral state in cells bearing IFN receptors. In this way, IFNs restrict virus replication and spread before an adaptive immune response is developed. Viruses are very sensitive to the effects of IFNs and consequently have evolved many strategies to interfere with interferon. This is particularly well illustrated by poxviruses, which have large dsDNA genomes and encode hundreds of proteins. Vaccinia virus is the prototypic poxvirus and expresses many proteins that interfere with IFN and are considered in this review. These proteins act either inside or outside the cell and within the cytoplasm or nucleus. They function by restricting the production of IFN by blocking the signaling pathways leading to transcription of IFN genes, stopping IFNs binding to their receptors, blocking IFN-induced signal transduction leading to expression of interferon-stimulated genes (ISGs), or inhibiting the antiviral activity of ISG products. © 2018 Elsevier Inc. All rights reserved.
Accelerated Aging Test for Plastic Scintillator Gamma Ray Detectors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kouzes, Richard T.
Polyvinyl toluene (PVT) and polystyrene (PS), collectively referred to as “plastic scintillator,” are synthetic polymer materials used to detect gamma radiation, and are commonly used in instrumentation. Recent studies have revealed that plastic scintillator undergoes an environmentally related material degradation that adversely affects performance under certain conditions and histories. A significant decrease in gamma ray sensitivity has been seen in some detectors in systems as they age. The degradation of sensitivity of plastic scintillator over time is due to a variety of factors, and the term “aging” is used to encompass all factors. Some plastic scintillator samples show no agingmore » effects (no significant change in sensitivity over more than 10 years), while others show severe aging (significant change in sensitivity in less than 5 years). Aging effects arise from weather (variations in heat and humidity), chemical exposure, mechanical stress, light exposure, and loss of volatile components. The damage produced by these various causes can be cumulative, causing observable damage to increase over time. Damage may be reversible up to some point, but becomes permanent under some conditions. It has been demonstrated that exposure of plastic scintillator in an environmental chamber to 30 days of high temperature and humidity (90% relative humidity and 55°C) followed by a single cycle to cold temperature (-30°C) will produce severe fogging in all PVT samples. This thermal cycle will be referred to as the “Accelerated Aging Test.” This document describes the procedure for performing this Accelerated Aging Test.« less
Yuan, Yitong; Liu, Shunqi; Zhao, Yue; Lian, Ling; Lian, Zhengxing
2018-01-01
Interferon-γ (IFN-γ) is critical for innate and adaptive immunity against viral and bacterial infections. IFN-γ reportedly affects the phagocytic ability of monocytes and macrophages as well as regulates pituitary function in humans and mice. The present study analyzed the impact of IFN-γ on monocyte and macrophage phagocytosis, production performance, and pituitary function in vivo and in vitro (in dwarf chickens). IFN-γ was injected into dwarf chickens through a vein, and then, the laying rate, average egg weight, and levels of follicle-stimulating hormone (FSH) and IFN-γ were measured in treatment and control groups. For the in vitro experiment, the pituitary tissues were supplemented with IFN-γ, and the mRNA expression levels of follicle-stimulating hormone beta subunit ( FSH-β ), interferon gamma receptor 1 ( IFNGR 1), and interferon gamma receptor 2 ( IFNGR 2) in the pituitary were assessed. Monocyte and macrophage phagocytosis product (PP) was decreased by IFN-γ treatment in a dose-dependent manner in vitro. In the in vivo experiment, the level of IFN-γ in the treatment group was higher than that in the control group at 7 d ( P < 0.05), 14 d ( P < 0.01), and 21 d ( P < 0.01) post-injection. Compared with the control group, monocyte and macrophage PP was lower in the treatment group after injection ( P < 0.01). The laying rate was higher in the treatment group than in the control group at 2 and 3 wk post-injection ( P < 0.05). There was a significant difference between the treatment and control groups in the levels of FSH at 1, 3, 7, and 14 d post-injection ( P < 0.01). In the in vitro experiment, increased mRNA expression levels of FSH-β , IFNGR 1, and IFNGR 2 were observed in the treatment group after stimulation with 100 U/mL IFN-γ for 24 h compared to those in the control group ( P < 0.05). IFN-γ inhibited the phagocytosis of monocytes and macrophages; up-regulated the mRNA expression levels of the FSH
Zhang, Xiaobo; De Paiva, Cintia S; Su, Zhitao; Volpe, Eugene A; Li, De-Quan; Pflugfelder, Stephen C
2014-01-01
Evidence suggests that the cytokine interferon (IFN)-γ released by natural killer and CD4(+) T cells contributes to the conjunctival goblet cell (GC) loss in dry eye. The purpose of this study was to investigate if topical neutralization of IFN-γ prevents or alleviates GC loss in an experimental desiccating stress (DS) model of dry eye. In this study, we found that topical IFN-γ neutralization significantly decreased DS-induced conjunctival GC loss. This was accompanied by decreased epithelial apoptosis, and increased IL-13 and decreased FoxA2 expression in the forniceal conjunctiva. To establish that IFN-γ produced by pathogenic CD4(+) T cells contributes to DS-induced GC loss, adoptive transfer of CD4(+) T cells isolated from DS exposed donors to naïve RAG-1(-/-) recipient mice was performed. Similar to the donor mice, topical IFN-γ neutralization decreased conjunctival GC loss, suppressed apoptosis and increased IL-13 expression in adoptive transfer recipients. In summary, this study demonstrated that topical neutralization of IFN-γ prevents GC loss via modulating apoptosis and maintaining IL-13 signaling. Copyright © 2013 Elsevier Ltd. All rights reserved.
Airway fungal colonization compromises the immune system allowing bacterial pneumonia to prevail.
Roux, Damien; Gaudry, Stéphane; Khoy-Ear, Linda; Aloulou, Meryem; Phillips-Houlbracq, Mathilde; Bex, Julie; Skurnik, David; Denamur, Erick; Monteiro, Renato C; Dreyfuss, Didier; Ricard, Jean-Damien
2013-09-01
To study the correlation between fungal colonization and bacterial pneumonia and to test the effect of antifungal treatments on the development of bacterial pneumonia in colonized rats. Experimental animal investigation. University research laboratory. Pathogen-free male Wistar rats weighing 250-275 g. Rats were colonized by intratracheal instillation of Candida albicans. Fungal clearance from the lungs and immune response were measured. Both colonized and noncolonized animals were secondarily instilled with different bacterial species (Pseudomonas aeruginosa, Escherichia coli, or Staphylococcus aureus). Bacterial phagocytosis by alveolar macrophages was evaluated in the presence of interferon-gamma, the main cytokine produced during fungal colonization. The effect of antifungal treatments on fungal colonization and its immune response were assessed. The prevalence of P. aeruginosa pneumonia was compared in antifungal treated and control colonized rats. C. albicans was slowly cleared and induced a Th1-Th17 immune response with very high interferon-gamma concentrations. Airway fungal colonization favored the development of bacterial pneumonia. Interferon-gamma was able to inhibit the phagocytosis of unopsonized bacteria by alveolar macrophages. Antifungal treatment decreased airway fungal colonization, lung interferon-gamma levels and, consequently, the prevalence of subsequent bacterial pneumonia. C. albicans airway colonization elicited a Th1-Th17 immune response that favored the development of bacterial pneumonia via the inhibition of bacterial phagocytosis by alveolar macrophages. Antifungal treatment decreased the risk of bacterial pneumonia in colonized rats.
Conrady, Christopher D; Halford, William P; Carr, Daniel J J
2011-02-01
The mouse model of genital herpes relies on medoxyprogesterone treatment of female mice to render the vaginal lumen susceptible to inoculation with herpes simplex virus 2 (HSV-2). In the present study, we report that mice deficient in the A1 chain of the type I interferon receptor (CD118(-/-)) are susceptible to HSV-2 in the absence of medroxyprogesterone preconditioning. In the absence of hormone pretreatment, 2,000 PFU of a clinical isolate of HSV-2 was sufficient to establish a productive infection in the vagina of 75% ± 17% and in the spinal cord of 71% ± 14% of CD118(-/-) mice, whereas the same dose of HSV-2 replicated to detectable levels in only 13% ± 13% of vaginal samples and 0% of spinal cord samples from wild-type mice, as determined at day 5 postinfection. The susceptibility to HSV-2 infection in the CD118(-/-) mice was associated with a significant reduction in the infiltration of HSV-specific cytotoxic T lymphocytes into the vaginal tissue, the local production of gamma interferon (IFN-γ), and the expression of T cell-recruiting chemokines CCL5, CXCL9, and CXCL10. Collectively, the results underscore the significant contribution of type I IFNs in resistance to genital HSV-2 infection.
NASA Astrophysics Data System (ADS)
Zenoni, A.; Bignotti, F.; Donzella, A.; Donzella, G.; Ferrari, M.; Pandini, S.; Andrighetto, A.; Ballan, M.; Corradetti, S.; Manzolaro, M.; Monetti, A.; Rossignoli, M.; Scarpa, D.; Alloni, D.; Prata, M.; Salvini, A.; Zelaschi, F.
2017-11-01
Materials and components employed in the presence of intense neutron and gamma fields are expected to absorb high dose levels that may induce deep modifications of their physical and mechanical properties, possibly causing loss of their function. A protocol for irradiating elastomeric materials in reactor mixed neutron and gamma fields and for testing the evolution of their main mechanical and physical properties with absorbed dose has been developed. Four elastomeric compounds used for vacuum O-rings, one fluoroelastomer polymer (FPM) based and three ethylene propylene diene monomer rubber (EPDM) based, presently available on the market have been selected for the test. One EPDM is rated as radiation resistant in gamma fields, while the other elastomers are general purpose products. Particular care has been devoted to dosimetry calculations, since absorbed dose in neutron fields, unlike pure gamma fields, is strongly dependent on the material composition and, in particular, on the hydrogen content. The products have been tested up to about 2 MGy absorbed dose. The FPM based elastomer, in spite of its lower dose absorption in fast neutron fields, features the largest variations of properties, with a dramatic increase in stiffness and brittleness. Out of the three EPDM based compounds, one shows large and rapid changes in the main mechanical properties, whereas the other two feature more stable behaviors. The performance of the EPDM rated as radiation resistant in pure gamma fields does not appear significantly better than that of the standard product. The predictive capability of the accelerated irradiation tests performed as well as the applicable concepts of threshold of radiation damage is discussed in view of the use of the examined products in the selective production of exotic species facility, now under construction at the Legnaro National Laboratories of the Italian Istituto Nazionale di Fisica Nucleare. It results that a careful account of dose rate effects
Zenoni, A; Bignotti, F; Donzella, A; Donzella, G; Ferrari, M; Pandini, S; Andrighetto, A; Ballan, M; Corradetti, S; Manzolaro, M; Monetti, A; Rossignoli, M; Scarpa, D; Alloni, D; Prata, M; Salvini, A; Zelaschi, F
2017-11-01
Materials and components employed in the presence of intense neutron and gamma fields are expected to absorb high dose levels that may induce deep modifications of their physical and mechanical properties, possibly causing loss of their function. A protocol for irradiating elastomeric materials in reactor mixed neutron and gamma fields and for testing the evolution of their main mechanical and physical properties with absorbed dose has been developed. Four elastomeric compounds used for vacuum O-rings, one fluoroelastomer polymer (FPM) based and three ethylene propylene diene monomer rubber (EPDM) based, presently available on the market have been selected for the test. One EPDM is rated as radiation resistant in gamma fields, while the other elastomers are general purpose products. Particular care has been devoted to dosimetry calculations, since absorbed dose in neutron fields, unlike pure gamma fields, is strongly dependent on the material composition and, in particular, on the hydrogen content. The products have been tested up to about 2 MGy absorbed dose. The FPM based elastomer, in spite of its lower dose absorption in fast neutron fields, features the largest variations of properties, with a dramatic increase in stiffness and brittleness. Out of the three EPDM based compounds, one shows large and rapid changes in the main mechanical properties, whereas the other two feature more stable behaviors. The performance of the EPDM rated as radiation resistant in pure gamma fields does not appear significantly better than that of the standard product. The predictive capability of the accelerated irradiation tests performed as well as the applicable concepts of threshold of radiation damage is discussed in view of the use of the examined products in the selective production of exotic species facility, now under construction at the Legnaro National Laboratories of the Italian Istituto Nazionale di Fisica Nucleare. It results that a careful account of dose rate effects
Dhanasekaran, S; Jenum, S; Stavrum, R; Ritz, C; Kenneth, J; Vaz, M; Doherty, T M; Grewal, H M S
2014-01-01
The tuberculin skin test (TST) and QuantiFERON-TB-Gold-In-tube (QFTGIT) are adjunctive tests used in the diagnosis of pediatric tuberculosis (TB). Neither test can rule out TB; however, a positive test usually triggers preventive treatment in TB contacts aged <5 years. TST and QFTGIT can give divergent results and it is unclear how discordant results should be interpreted in terms of TB risk and preventive treatment. To understand the immune processes underlying concordant or discordant TST and QFTGIT results, we analyzed immune responses in children from Palamaner Taluk in India (a TB-endemic region with routine neonatal BCG vaccination) who were referred to a TB case verification ward on suspicion of TB. Two hundred and ten children aged <3 years were classified according to their TST and QFTGIT results, and their immune responses analyzed by dual-colour-Reverse-Transcriptase-Multiple-Ligation-dependent-Probe-Amplification, using a panel of 45 genes and a 10-plex antigen-specific enzyme-linked immunosorbent assay. We show that immune biomarkers FPR1, TNFRSF1A and interferon (IFN)-γ are upregulated (all P<0.05) in concordant test-positive children, whereas BPI is downregulated (P<0.05). In contrast, SEC14L1 (P=0.034) and Interferon gamma-induced protein 10 (IP-10) (P=0.001) are differentially expressed between the TST+QFTGIT- /TST-QFTGIT+ groups. Known TB exposure was more frequent in concordant positive children and results were consistent with elevated expression of genes associated with inflammatory responses. Children with discordant test results displayed a mixed profile with activation of both pro- and anti-inflammatory markers. TST and/or QFTGIT positivity appears to reflect distinct but overlapping aspects of host immunity.
Janjua, N Z; Islam, N; Wong, J; Yoshida, E M; Ramji, A; Samji, H; Butt, Z A; Chong, M; Cook, D; Alvarez, M; Darvishian, M; Tyndall, M; Krajden, M
2017-08-01
We evaluated the shift in the characteristics of people who received interferon-based hepatitis C virus (HCV) treatments and those who received recently introduced direct-acting antivirals (DAAs) in British Columbia (BC), Canada. The BC Hepatitis Testers Cohort includes 1.5 million individuals tested for HCV or HIV, or reported cases of hepatitis B and active tuberculosis in BC from 1990 to 2013 linked to medical visits, hospitalization, cancer, prescription drugs and mortality data. This analysis included all patients who filled at least one prescription for HCV treatment until 31 July 2015. HCV treatments were classified as older interferon-based treatments including pegylated interferon/ribavirin (PegIFN/RBV) with/without boceprevir or telaprevir, DAAs with RBV or PegIFN/RBV, and newer interferon-free DAAs. Of 11 886 people treated for HCV between 2000 and 2015, 1164 (9.8%) received interferon-free DAAs (ledipasvir/sofosbuvir: n=1075; 92.4%), while 452 (3.8%) received a combination of DAAs and RBV or PegIFN/RBV. Compared to those receiving interferon-based treatment, people with HIV co-infection (adjusted odds ratio [aOR]: 2.96, 95% CI: 2.31-3.81), cirrhosis (aOR: 1.77, 95% CI: 1.45-2.15), decompensated cirrhosis (aOR: 1.72, 95% CI: 1.31-2.28), diabetes (aOR: 1.30, 95% CI: 1.10-1.54), a history of injection drug use (aOR: 1.34, 95% CI: 1.09-1.65) and opioid substitution therapy (aOR: 1.30, 95% CI: 1.01-1.67) were more likely to receive interferon-free DAAs. Socio-economically marginalized individuals were significantly less likely (most deprived vs most privileged: aOR: 0.71, 95% CI: 0.58-0.87) to receive DAAs. In conclusion, there is a shift in prescription of new HCV treatments to previously excluded groups (eg HIV-co-infected), although gaps remain for the socio-economically marginalized populations. © 2017 John Wiley & Sons Ltd.
Treatment of inflammatory airway disease in young standardbreds with interferon alpha
2004-01-01
Abstract The effect of oral treatment with natural or recombinant human interferon alpha (HIA) on inflammatory airway disease in young standardbreds was assessed in a double-blind, randomized clinical trial. A total of 34 horses with nasal discharge, excess mucus in the trachea, and a persistent cough of at least 2 weeks’ duration that interfered with training completed the trial. Horses were rested for 1 week and received oral treatment with either a saline placebo, recombinant human interferon alpha (rHIA; 90 U/horse/day), or natural human interferon alpha (nHIA: 50 U/horse/day) for 5 days. There was a significant decline in nasal discharge and cough scores in all groups and the apparent response rate was similar. However, significantly fewer horses relapsed within 2 weeks once treatment was ceased when interferon rather than placebo was used (P = 0.012). Seventeen of 22 horses treated with rHIA or nHIA were cough-free 4 weeks after treatment, compared with only 4 of 12 after treatment with the placebo. Treatment with oral interferon is a useful adjunct to rest in standardbreds with inflammatory airway disease. PMID:15317391
Possible prevention of chronic hepatitis B by early interferon therapy.
Trépo, C; Chemin, I; Petit, M A; Chossegros, P; Zoulim, F; Chevallier, P; Sepetjan, M
1990-01-01
A study is currently underway to investigate the efficacy of interferon therapy in patients with prolonged (greater than or equal to 10 weeks but less than 6 months) hepatitis B infection. To date, a total of 15 patients have been enrolled in the study and randomly assigned to receive either placebo for 24 weeks (n = 8) or interferon 5 million units subcutaneously 3 times a week for 24 weeks (n = 7), with follow up for 1 year. Thirteen patients have completed the follow-up period: seven patients in the placebo group and six in the treated group. Five of the six treated patients completely eradicated the infection during interferon therapy, with clearance of hepatitis B e and surface antigens, and seroconversion to antibody positivity in each case. Two of the eight placebo patients seroconverted during the placebo period. Clearance of hepatitis B e antigen was associated with a sudden rise in serum transaminase levels and an exacerbation of hepatitis, a phenomenon that has also been reported in chronic hepatitis B patients who have responded well to interferon therapy. Therapy was well tolerated in all cases. Our results suggest that interferon treatment of patients with prolonged hepatitis B infection may prevent progression to chronicity. If confirmed by further study, they should trigger more vigilant screening for patients with raised serum transaminase levels and viral markers of hepatitis B infection.
USDA-ARS?s Scientific Manuscript database
Interferons (IFNs) are key cytokines identified in vertebrates, and evolutionary dominance of intronless IFN genes in amniotes is a signature event in IFN evolution. For the first time, we show that the emergence and expansion of intronless IFN genes is evident in amphibians, shown by 24-37 intronle...
Ang, Marcus; Nguyen, Hai V; Kiew, Sieh Yean; Chen, Shu; Chee, Soon-Phaik; Finkelstein, Eric
2015-07-01
Although tuberculous uveitis remains a major cause of ocular morbidity in the developing world, there is no consensus on which diagnostic test or testing strategy is the most cost effective. In this study we carried out a cost-effectiveness analysis to determine the most cost-effective diagnostic test strategy. In this prospective study, we recruited 102 patients from Singapore National Eye Centre with signs suggestive of tuberculous uveitis. Using prospective data from this cohort and from published meta-analyses, we modelled the incremental cost effectiveness of the following strategies: tuberculin skin test (TST) only; interferon-γ release assay (IGRA) only; IGRA following a positive TST result; and dual-test strategy, conducting TST and IGRA at presentation. Incremental cost-effectiveness ratios (ICERs) were calculated for each strategy and analysed using a willingness-to-pay threshold of $50,000 per quality-adjusted life year (QALY) gained. In our population, the least cost effective was the IGRA-only strategy. The dual-test strategy was the most cost effective, with an improvement of 0.017 QALY at an incremental cost of $190 relative to the TST-only strategy (ICER $11,500); while the TST-only strategy was more cost effective than the third strategy, using IGRA following a positive TST result (ICER $3610). This remained consistent while varying the costs of IGRA and TST, the incidence of tuberculosis and tuberculous uveitis, as well as the diagnostic accuracy of IGRA and TST found in previous studies in various populations. The dual-test strategy (performing TST and IGRA at presentation) was the most cost effective strategy for the diagnosis of tuberculous uveitis in our population. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Identification of a human non-interferon lymphokine activating monocyte complement biosynthesis.
Drouet, C; Reboul, A; Colomb, M
1989-01-01
A monocyte-stimulating activity produced by mitogen-induced mononuclear cells has been defined by its ability to enhance the synthesis in vitro of complement C1 subcomponents, C2 and C3. A lymphokine responsible for this activity was purified from culture supernatants of peripheral blood mononuclear cells activated by staphylococcal enterotoxin A. From 0.5 litre of supernatant the purification procedure [(NH4)2SO4 precipitation, phenyl-Sepharose chromatography and preparative electrofocusing] yielded about 100 pmol of purified lymphokine. Its pI is 7.9 and its Mr, estimated by SDS/polyacrylamide-gel electrophoresis, is 14,600, 27,000 and 56,000, the high-Mr species representing oligomeric forms of the Mr-14,600 molecule. Its amino acid analysis reveals a high percentage of hydrophobic amino acids (34%); the absence of histidine residues suggests that it is a novel monocyte-activating lymphokine. It enhances C1r and C1s biosynthesis at a pretranslational level. From its structure and activity this lymphokine appears different from gamma-interferon. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:2481436
The effects of interferon-alpha/beta in a model of rat heart transplantation
NASA Technical Reports Server (NTRS)
Slater, A. D.; Klein, J. B.; Sonnenfeld, G.; Ogden, L. L. 2nd; Gray, L. A. Jr
1992-01-01
Interferons have multiple immunologic effects. One such effect is the activation of expression of cell surface antigens. Interferon alpha/beta enhance expression of class I but not class II histocompatibility antigens. Contradictory information has been published regarding the effect of interferon-alpha/beta administration in patients with kidney transplantation. In a model of rat heart transplantation we demonstrated that administration of interferon-alpha/beta accelerated rejection in a dose-dependent fashion in the absence of maintenance cyclosporine. Animals treated with maintenance cyclosporine had evidence of increased rejection at 20 days that was resolved completely at 45 days with cyclosporine alone.
Coad, Michael; Clifford, Derek; Rhodes, Shelley G; Hewinson, R Glyn; Vordermeier, H Martin; Whelan, Adam O
2010-01-01
The principal surveillance tool used to control bovine tuberculosis in cattle is the removal of animals that provide a positive response to the tuberculin skin-test. In this study we performed a longitudinal investigation of the immunological and diagnostic consequences of repeated short-interval skin-tests in cattle naturally infected with Mycobacterium bovis. Tuberculin skin-test positive cattle were subjected to up to four further intradermal comparative cervical skin-tests at approximately 60-day intervals. A significant progressive reduction in the strength of the skin-test was observed after successive tests. In contrast, the magnitude of interferon-gamma (IFN-gamma) responses was not influenced by repeat skin-testing either transiently around the time of each skin-test or longitudinally following repeated tests. A significant boost in blood interleukin-10 (IL-10) production was observed within 3 days following each skin-test although the magnitude of this boosted response returned to lower levels by day 10 post-test. The application of a novel multiplex assay to simultaneously measure seven cytokines and chemokines also identified that skin-testing resulted in a significant and progressive reduction in antigen specific interleukin-1beta (IL-1beta) whilst confirming stable IFN-gamma and elevated IL-10 responses in the blood. Therefore, we have demonstrated that in cattle naturally infected with M. bovis, repeat short-interval skin-testing can lead to a progressive reduction in skin-test responsiveness which has potential negative consequences for the detection of infected animals with marginal or inconclusive skin-test responses. The desensitising effect is associated with decreased IL-1beta and elevated IL-10 responses, but importantly, does not influence antigen specific IFN-gamma responses. INRA, EDP Sciences, 2009
Smirnova, Natalia P; Webb, Brett T; McGill, Jodi L; Schaut, Robert G; Bielefeldt-Ohmann, Helle; Van Campen, Hana; Sacco, Randy E; Hansen, Thomas R
2014-04-01
Development of transplacental infection depends on the ability of the virus to cross the placenta and replicate within the fetus while counteracting maternal and fetal immune responses. Unfortunately, little is known about this complex process. Non-cytopathic (ncp) strains of bovine viral diarrhea virus (BVDV), a pestivirus in the Flaviviridae family, cause persistent infection in early gestational fetuses (<150 days; persistently infected, PI), but are cleared by immunocompetent animals and late gestational fetuses (>150 days; transiently infected, TI). Evasion of innate immune response and development of immunotolerance to ncp BVDV have been suggested as possible mechanisms for the establishment of the persistent infection. Previously we have observed a robust temporal induction of interferon (IFN) type I (innate immune response) and upregulation of IFN stimulated genes (ISGs) in BVDV TI fetuses. Modest chronic upregulation of ISGs in PI fetuses and calves reflects a stimulated innate immune response during persistent BVDV infection. We hypothesized that establishing persistent fetal BVDV infection is also accompanied by the induction of IFN-gamma (IFN-γ). The aims of the present study were to determine IFN-γ concentration in blood and amniotic fluid from control, TI and PI fetuses during BVDV infection and analyze induction of the IFN-γ downstream pathways in fetal lymphoid tissues. Two experiments with in vivo BVDV infections were completed. In Experiment 1, pregnant heifers were infected with ncp BVDV type 2 on day 75 or 175 of gestation or kept naïve to generate PI, TI and control fetuses, respectively. Fetuses were collected by Cesarean section on day 190. In Experiment 2, fetuses were collected on days 82, 89, 97, 192 and 245 following infection of pregnant heifers on day 75 of gestation. The results were consistent with the hypothesis that ncp BVDV infection induces IFN-γ secretion during acute infection in both TI and PI fetuses and that lymphoid
Haldar, Arun K; Piro, Anthony S; Finethy, Ryan; Espenschied, Scott T; Brown, Hannah E; Giebel, Amanda M; Frickel, Eva-Maria; Nelson, David E; Coers, Jörn
2016-12-13
The cytokine gamma interferon (IFN-γ) induces cell-autonomous immunity to combat infections with intracellular pathogens, such as the bacterium Chlamydia trachomatis The present study demonstrates that IFN-γ-primed human cells ubiquitinate and eliminate intracellular Chlamydia-containing vacuoles, so-called inclusions. We previously described how IFN-γ-inducible immunity-related GTPases (IRGs) employ ubiquitin systems to mark inclusions for destruction in mouse cells and, furthermore, showed that the rodent pathogen Chlamydia muridarum blocks ubiquitination of its inclusions by interfering with mouse IRG function. Here, we report that ubiquitination of inclusions in human cells is independent of IRG and thus distinct from the murine pathway. We show that C. muridarum is susceptible to inclusion ubiquitination in human cells, while the closely related human pathogen C. trachomatis is resistant. C. muridarum, but not C. trachomatis, inclusions attract several markers of cell-autonomous immunity, including the ubiquitin-binding protein p62, the ubiquitin-like protein LC3, and guanylate-binding protein 1. Consequently, we find that IFN-γ priming of human epithelial cells triggers the elimination of C. muridarum, but not C. trachomatis, inclusions. This newly described defense pathway is independent of indole-2,3-dioxygenase, a known IFN-γ-inducible anti-Chlamydia resistance factor. Collectively, our observations indicate that C. trachomatis evolved mechanisms to avoid a human-specific, ubiquitin-mediated response as part of its unique adaptation to its human host. Chlamydia trachomatis is the leading cause of sexually transmitted bacterial infections and responsible for significant morbidity, including pelvic inflammatory disease, infertility, and ectopic pregnancies in women. As an obligate intracellular pathogen, C. trachomatis is in perpetual conflict with cell-intrinsic defense programs executed by its human host. Our study defines a novel anti
Interferon-Induced Ifit2/ISG54 Protects Mice from Lethal VSV Neuropathogenesis
Fensterl, Volker; Wetzel, Jaime L.; Ramachandran, Srividya; Ogino, Tomoaki; Stohlman, Stephen A.; Bergmann, Cornelia C.; Diamond, Michael S.; Virgin, Herbert W.; Sen, Ganes C.
2012-01-01
Interferon protects mice from vesicular stomatitis virus (VSV) infection and pathogenesis; however, it is not known which of the numerous interferon-stimulated genes (ISG) mediate the antiviral effect. A prominent family of ISGs is the interferon-induced with tetratricopeptide repeats (Ifit) genes comprising three members in mice, Ifit1/ISG56, Ifit2/ISG54 and Ifit3/ISG49. Intranasal infection with a low dose of VSV is not lethal to wild-type mice and all three Ifit genes are induced in the central nervous system of the infected mice. We tested their potential contributions to the observed protection of wild-type mice from VSV pathogenesis, by taking advantage of the newly generated knockout mice lacking either Ifit2 or Ifit1. We observed that in Ifit2 knockout (Ifit2 −/−) mice, intranasal VSV infection was uniformly lethal and death was preceded by neurological signs, such as ataxia and hind limb paralysis. In contrast, wild-type and Ifit1 −/− mice were highly protected and survived without developing such disease. However, when VSV was injected intracranially, virus replication and survival were not significantly different between wild-type and Ifit2−/− mice. When administered intranasally, VSV entered the central nervous system through the olfactory bulbs, where it replicated equivalently in wild-type and Ifit2 −/− mice and induced interferon-β. However, as the infection spread to other regions of the brain, VSV titers rose several hundred folds higher in Ifit2 −/− mice as compared to wild-type mice. This was not caused by a broadened cell tropism in the brains of Ifit2 −/− mice, where VSV still replicated selectively in neurons. Surprisingly, this advantage for VSV replication in the brains of Ifit2−/− mice was not observed in other organs, such as lung and liver. Pathogenesis by another neurotropic RNA virus, encephalomyocarditis virus, was not enhanced in the brains of Ifit2 −/− mice. Our study provides a clear demonstration of
Type I interferons modulate methotrexate resistance in gestational trophoblastic neoplasia.
Elias, Kevin M; Harvey, Richard A; Hasselblatt, Kathleen T; Seckl, Michael J; Berkowitz, Ross S
2017-06-01
Resistance to methotrexate is a leading clinical problem in gestational trophoblastic neoplasia (GTN), but there are limited laboratory models for this condition. We created isogenic trophoblastic cell lines resistant to methotrexate and compared these to the parent cell lines using gene expression microarrays and qRT-PCR followed by mechanistic studies using recombinant cytokines, pathway inhibitors, and patient sera. Gene expression microarrays and focused analysis by qRT-PCR revealed methotrexate led to type I interferon upregulation, in particular interferon alpha 2 (IFNA2), and methotrexate resistance was associated with chronic low level increases in type I interferon expression. Recombinant IFNA2 imparted chemosensitive choriocarcinoma cells with partial resistance to methotrexate, while chemoresistant choriocarcinoma cells were uniquely sensitive to fludarabine, a STAT1 inhibitor. In pre-treatment patient sera, IFNA2 levels correlated with subsequent resistance to methotrexate chemotherapy. Methotrexate resistance is influenced by type I interferon signaling with prognostic and therapeutic implications for treating women with GTN. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
2012-01-01
Background The synergistic combination of interferon (IFN) alpha-2b and IFN gamma results in more potent in vitro biological effects mediated by both IFNs. The aim of this investigation was to evaluate by first time the pharmacokinetics and pharmacodynamics of this combination in patients with mycosis fungoides. Methods An exploratory, prospective, open-label clinical trial was conducted. Twelve patients, both genders, 18 to 75 years-old, with mycosis fungoides at stages IB to III, were eligible for the study. All of them received intramuscularly a single high dose (23 × 106 IU) of a novel synergistic IFN mixture (HeberPAG®) for pharmacokinetic and pharmacodynamic studies. Serum IFN alpha-2b and IFN gamma concentrations were measured during 96 hours by commercial enzyme immunoassays (EIA) specific for each IFN. Other blood IFN-inducible markers and laboratory variables were used as pharmacodynamics and safety criteria. Results The pharmacokinetic evaluation by EIA yielded a similar pattern for both IFNs that are also in agreement with the well-known described profiles for these molecules when these are administered separately. The average values for main parameters were: Cmax: 263 and 9.3 pg/mL; Tmax: 9.5 and 6.9 h; AUC: 4483 and 87.5 pg.h/mL, half-life (t1/2): 4.9 and 13.4 h; mean residence time (MRT): 13.9 and 13.5 h, for serum IFN alpha-2b and IFN gamma, respectively. The pharmacodynamic variables were strongly stimulated by simultaneous administration of both IFNs: serum neopterin and beta-2 microglobulin levels (β2M), and stimulation of 2’-5’ oligoadenylate synthetase (OAS1) mRNA expression. The most encouraging data was the high increment of serum neopterin, 8.0 ng/mL at 48 h, not been described before for any unmodified or pegylated IFN. Additionally, β2M concentration doubled the pre-dose value at 24–48 hours. For both variables the values remained clearly upper baseline levels at 96 hours. Conclusions HeberPAG®possesses improved
Massacesi, Luca; Tramacere, Irene; Amoroso, Salvatore; Battaglia, Mario A.; Benedetti, Maria Donata; Filippini, Graziella; La Mantia, Loredana; Repice, Anna; Solari, Alessandra; Tedeschi, Gioacchino; Milanese, Clara
2014-01-01
For almost three decades in many countries azathioprine has been used to treat relapsing-remitting multiple sclerosis. However its efficacy was usually considered marginal and following approval of β interferons for this indication it was no longer recommended as first line treatment, even if presently no conclusive direct β interferon-azathioprine comparison exists. To compare azathioprine efficacy versus the currently available β interferons in relapsing-remitting multiple sclerosis, a multicenter, randomized, controlled, single-blinded, non-inferiority trial was conducted in 30 Italian multiple sclerosis centers. Eligible patients (relapsing-remitting course; ≥2 relapses in the last 2 years) were randomly assigned to azathioprine or β interferons. The primary outcome was annualized relapse rate ratio (RR) over 2 years. Key secondary outcome was number of new brain MRI lesions. Patients (n = 150) were randomized in 2 groups (77 azathioprine, 73 β interferons). At 2 years, clinical evaluation was completed in 127 patients (62 azathioprine, 65 β interferons). Annualized relapse rate was 0.26 (95% Confidence Interval, CI, 0.19–0.37) in the azathioprine and 0.39 (95% CI 0.30–0.51) in the interferon group. Non-inferiority analysis showed that azathioprine was at least as effective as β interferons (relapse RRAZA/IFN 0.67, one-sided 95% CI 0.96; p<0.01). MRI outcomes were analyzed in 97 patients (50 azathioprine and 47 β interferons). Annualized new T2 lesion rate was 0.76 (95% CI 0.61–0.95) in the azathioprine and 0.69 (95% CI 0.54–0.88) in the interferon group. Treatment discontinuations due to adverse events were higher (20.3% vs. 7.8%, p = 0.03) in the azathioprine than in the interferon group, and concentrated within the first months of treatment, whereas in the interferon group discontinuations occurred mainly during the second year. The results of this study indicate that efficacy of azathioprine is not inferior to that of
Anisn-Dort Neutron-Gamma Flux Intercomparison Exercise for a Simple Testing Model
NASA Astrophysics Data System (ADS)
Boehmer, B.; Konheiser, J.; Borodkin, G.; Brodkin, E.; Egorov, A.; Kozhevnikov, A.; Zaritsky, S.; Manturov, G.; Voloschenko, A.
2003-06-01
The ability of transport codes ANISN, DORT, ROZ-6, MCNP and TRAMO, as well as nuclear data libraries BUGLE-96, ABBN-93, VITAMIN-B6 and ENDF/B-6 to deliver consistent gamma and neutron flux results was tested in the calculation of a one-dimensional cylindrical model consisting of a homogeneous core and an outer zone with a single material. Model variants with H2O, Fe, Cr and Ni in the outer zones were investigated. The results are compared with MCNP-ENDF/B-6 results. Discrepancies are discussed. The specified test model is proposed as a computational benchmark for testing calculation codes and data libraries.
... lesions Interferon-gamma release blood test, such as the QFT-Gold test to test for prior exposure to TB ... verify that A.D.A.M. follows rigorous standards of quality and accountability. A.D.A.M. is among the first to achieve this important distinction for online ...
Synergistic induction of apoptosis in primary rat decidual cells by INF-gamma and TNF.
Almeida, A; Correia-da-Silva, G; Cepa, M; Bell, S C; Teixeira, N A
2007-03-01
In the rat, in response to blastocyst implantation, stromal cells of the endometrium proliferate and differentiate into decidual cells, forming the decidua. After reaching its maximum development, the decidua undergoes regression. This phenomenon appears to be due to an active process involving apoptosis. As there is sparse knowledge concerning the mechanisms of induction of decidual cell death, the potential role of cytokines present in the uterine environment during pregnancy, such as tumor necrosis factor (TNF) and interferon-gamma (INF-gamma) was explored in primary cultures of rat decidual cells. The effects of these factors upon cellular viability, nuclear morphologic alterations, expression, and enzymatic activities of the effector caspases-3/7 were evaluated. The results obtained demonstrated that in contrast to TNF, which did not induce any alteration, INF-gamma and in association with TNF caused a decrease in cell viability and an increase in the appearance of apoptotic bodies in a time-dependent manner that was augmented in the co-presence of TNF. An increase in caspase-3/7 activities after 12 hr of TNF/INF-gamma treatment was also observed. These findings suggest that INF-gamma expressed in the uterine environment may play an important role in regulating apoptosis through potential synergistic mechanisms with TNF and thereby modulate decidual stability and regression during pregnancy. (c) 2006 Wiley-Liss, Inc.
Lethal Zika Virus Disease Models in Young and Older Interferon α/β Receptor Knock Out Mice.
Marzi, Andrea; Emanuel, Jackson; Callison, Julie; McNally, Kristin L; Arndt, Nicolette; Chadinha, Spencer; Martellaro, Cynthia; Rosenke, Rebecca; Scott, Dana P; Safronetz, David; Whitehead, Stephen S; Best, Sonja M; Feldmann, Heinz
2018-01-01
The common small animal disease models for Zika virus (ZIKV) are mice lacking the interferon responses, but infection of interferon receptor α/β knock out (IFNAR -/- ) mice is not uniformly lethal particularly in older animals. Here we sought to advance this model in regard to lethality for future countermeasure efficacy testing against more recent ZIKV strains from the Asian lineage, preferably the American sublineage. We first infected IFNAR -/- mice subcutaneously with the contemporary ZIKV-Paraiba strain resulting in predominantly neurological disease with ~50% lethality. Infection with ZIKV-Paraiba by different routes established a uniformly lethal model only in young mice (4-week old) upon intraperitoneal infection. However, intraperitoneal inoculation of ZIKV-French Polynesia resulted in uniform lethality in older IFNAR -/- mice (10-12-weeks old). In conclusion, we have established uniformly lethal mouse disease models for efficacy testing of antivirals and vaccines against recent ZIKV strains representing the Asian lineage.
Neri, Sergio; Bertino, Gaetano; Petralia, Antonio; Giancarlo, Crisafulli; Rizzotto, Agostino; Calvagno, Giuseppe Stefano; Mauceri, Barbara; Abate, Giuseppe; Boemi, Patrizia; Di Pino, Antonino; Ignaccolo, Luca; Vadalà, Giuseppe; Misseri, Maria; Maiorca, Daniela; Mastrosimone, Gianluca; Judica, Antonino; Palermo, Filippo
2010-10-01
To evaluate the effectiveness of psychiatric counseling in reducing the rate of development of psychiatric side effects of antiviral therapy with interferon-α and ribavirin among study participants compared with standard clinical monitoring alone. Interferon-α is used to treat chronic hepatitis C. Interferons may induce adverse events that usually, but not always, reverse within a few days after the end of therapy. Two hundred eleven patients with chronic hepatitis C, genotype 1b were treated with peginterferon and ribavirin for 48 weeks in a prospective trial. Two groups were randomly created. Group A was interviewed by a team of gastroenterologists, psychiatrists, and psychologists and treated with psychotherapy once a month. Group B was monitored once a month according to a conventional protocol that did not include psychotherapy. SVR (sustained viral response), severe psychiatric symptom onset, and mood progression were assessed (P calculated using Fisher exact test, Friedman test, Dunn posttest, and Mann-Whitney U-test). At baseline, there was no difference in depressive symptoms or liver histologic score between the 2 groups. The onset rate of severe psychiatric manifestations was 4.7% (Group A) and 16.1% (Group B) between the 24th and 36th weeks (P<0.01). Fifteen participants in Group A and 39 in Group B required antidepressants and benzodiazepines (P<0.05). Patients can develop depressive symptoms during interferon therapy. Multidisciplinary medical treatment with psychiatric counseling provided during the treatment of chronic hepatitis C may contribute to the decrease or prevent the higher rates of depression associated with interferon treatment.
Test results of a new detector system for gamma ray isotopic measurements
DOE Office of Scientific and Technical Information (OSTI.GOV)
Malcom, J.E.; Bonner, C.A.; Hurd, J.R.
1993-08-01
A new type of gamma-ray detector system for isotopic measurements has been developed. This new system, a ``Duo detector`` array, consists of two intrinsic germanium detectors, a planar followed by a coaxial mounted on the same axis within a single cryostat assembly. This configuration allows the isotopic analysis system to take advantage of spectral data results that are collected simultaneously from different gamma-ray energy regimes. Princeton Gamma Tech (PGT) produced several prototypes of this Duo detector array which were then tested by Rocky Flats personnel until the design was optimized. An application for this detector design is in automated, roboticizedmore » NDA systems such as those being developed at the Los Alamos TA-55 Plutonium Facility. The Duo detector design reduces the space necessary for the isotopic instrument by a factor of two (only one liquid nitrogen dewar is needed), and also reduces the complexity of the mechanical systems and controlling software. Data will be presented on measurements of nuclear material with a Duo detector for a wide variety of matrices. Results indicate that the maximum count rate can be increased up to 100,000 counts per second yet maintaining excellent resolution and energy rate product.« less
Interferon Beta-1a Intramuscular Injection
... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS, a disease in which ... interferon beta-1a intramuscular at around the same time of day on your injection days. Follow the ...
Renal thrombotic microangiopathy caused by interferon beta-1a treatment for multiple sclerosis
Mahe, Julien; Meurette, Aurélie; Moreau, Anne; Vercel, Caroline; Jolliet, Pascale
2013-01-01
Interferon beta-1a is available as an immunomodulating agent for relapsing forms of multiple sclerosis. Common side effects include flu-like symptoms, asthenia, anorexia, and administration site reaction. Kidney disorders are rarely reported. In this study we describe the case of a woman who has been undergoing treatment with interferon beta-1a for multiple sclerosis for 5 years. She developed a hemolytic-uremic syndrome with intravascular hemolysis in a context of severe hypertension. A kidney biopsy showed a thrombotic microangiopathy. This observation highlights an uncommon side effect of long-term interferon beta-1a therapy. Pathophysiological mechanisms leading to this complication might be explained by the antiangiogenic activity of interferon. PMID:23950639
Underlying pathways for interferon risk to type II diabetes mellitus.
Abdel-Hamid, Nabil; Jubori, Taghreed Al; Farhan, Amaal; Mahrous, Mariam; Gouri, Adel; Awad, Ezzat; Breuss, Johannes
2013-11-01
It has been known that chronic liver treatments interfere with blood glucose metabolism. It was recognized that diabetes mellitus among chronic hepatitis C was greater in other types of chronic liver diseases. Hepatitis C directly promotes insulin resistance through the proteosomal degradation of insulin resistance substrate. It suppressed hepatocyte glucose uptake through down-regulation of surface expression of glucose transporter. Long-term exposure to cytokine over expression seems to be cytotoxic to both beta cells of the pancreas and to hepatocytes. Elevated tumor necrosis factor-a, or its neutralization, increased insulin sensitivity. Interferon-a may also elevate the serum level of interleukin-1 which is cytotoxic to pancreatic islet cells. Both diabetes mellitus and resistance to interferon-a therapy are abnormally mediated by over-expression of suppressor of cytokine signaling-1 in hepatocytes of chronic hepatitis C patients. These data suggest that interferon-a therapy should be administered with caution in patients showing any predisposition to Diabetes mellitus. Anti inflammatory therapy is critically recommended as a protector against disease development due to cytokine mediated Diabetes mellitus during hepatitis C therapy, since inflammation seems to be a main candidate to interferon suspected diabetogenesis.
LIDT test coupled with gamma radiation degraded optics
NASA Astrophysics Data System (ADS)
IOAN, M.-R.
2016-06-01
A laser can operate in regular but also in nuclear ionizing radiation environments. This paper presents the results of a real time measuring method used to detect the laser induced damage threshold (LIDT) in the optical surfaces/volumes of TEMPAX borosilicate glasses operating in high gamma rays fields. The laser damage quantification technique is applied by using of an automated station intended to measure the damage threshold of optical components, according to the International Standard ISO 21254. Single and multiple pulses laser damage thresholds were determined. For an optical material, life time when it is subjected to multiple pulses of high power laser radiation can be predicted. A few ns pulses shooting laser, operating in regular conditions, inflects damage to a target by its intense electrical component but also in a lower manner by local absorption of its transported thermal energy. When the beam is passing thru optical glass elements affected by ionizing radiation fields, the thermal component is starting to have a more important role, because of the increased thermal absorption in the material's volume caused by the radiation induced color centers. LIDT results on TEMPAX optical glass windows, with the contribution due to the gamma radiation effects (ionization mainly by Compton effect in this case), are presented. This contribution was highlighted and quantified. Energetic, temporal and spatial beam characterizations (according to ISO 11554 standards) and LIDT tests were performed using a high power Nd: YAG laser (1064 nm), before passing the beam through each irradiated glass sample (0 kGy, 1.3 kGy and 21.2 kGy).
Weiner, N; Williams, N; Birch, G; Ramachandran, C; Shipman, C; Flynn, G
1989-01-01
The topical delivery of liposomally encapsulated interferon was evaluated in the cutaneous herpes simplex virus guinea pig model. Application of liposomally entrapped interferon caused a reduction of lesion scores, whereas application of interferon formulated as a solution or as an emulsion was ineffective. The method of liposomal preparation rather than the lipid composition of the bilayers appeared to be the most important factor for reducing lesion scores. Only liposomes prepared by the dehydration-rehydration method were effective. This finding implied that the dehydration and subsequent rehydration of the liposomes facilitate partitioning of the interferon into liposomal bilayers, where the drug is positioned for transfer into the lipid compartment of the stratum corneum. Liposomes do not appear to function as permeation enhancers but seem to provide the needed physicochemical environment for transfer of interferon into the skin. PMID:2802550
Interferon after surgery for women with advanced (Stage II-IV) epithelial ovarian cancer.
Lawal, Aramide O; Musekiwa, Alfred; Grobler, Liesl
2013-06-06
Epithelial ovarian cancer (EOC) is a life-threatening disease. Most often women become symptomatic only in the advanced stages of the disease, increasing the difficulty of treatment. Whilst the disease responds well to surgery and chemotherapy, the relapse rate is high. New treatments to prevent disease recurrence or progression, prolong survival, and increase the quality of life are needed. To assess the effectiveness and safety of interferon after surgery in the treatment of advanced (stage II-IV) EOC. The Cochrane Gynaecological Cancer Review Group Specialized Register, Cochrane Central Register of Controlled Trials (CENTRAL) Issue 1, 2012, MEDLINE and EMBASE were searched to January 2012. Handsearching of conference proceedings was also undertaken. Reference lists of reviews and included trials were screened and experts in the field were contacted for additional trials. Clinical trials registers were searched for ongoing trials. Randomised controlled trials (RCTs) involving participants with advanced EOC that compared post-operative chemotherapy alone with post-operative interferon therapy in combination with chemotherapy or post-operative chemotherapy followed by interferon or observation alone Two review authors (AL and AM) independently screened the search results for relevant trials and extracted pre-specified information from each included trial. Data were managed using Review Manager 5.1. Hazard ratios (HR) were calculated for time-to-event outcomes and risk ratios (RR) for dichotomous outcomes, with corresponding 95% confidence intervals (CI). Five trials, including 1476 participants, were included in the review. Two trials compared interferon with observation alone and three trials compared interferon plus chemotherapy with chemotherapy alone. A meta-analysis of two trials involving 370 participants found no significant difference in both overall survival (HR 1.14, 95% CI 0.84 to 1.55) and progression free survival (HR 0.99, 95% CI 0.79 to 1.24) between
Viral Replication Complexes Are Targeted by LC3-Guided Interferon-Inducible GTPases.
Biering, Scott B; Choi, Jayoung; Halstrom, Rachel A; Brown, Hailey M; Beatty, Wandy L; Lee, Sanghyun; McCune, Broc T; Dominici, Erin; Williams, Lelia E; Orchard, Robert C; Wilen, Craig B; Yamamoto, Masahiro; Coers, Jörn; Taylor, Gregory A; Hwang, Seungmin
2017-07-12
All viruses with positive-sense RNA genomes replicate on membranous structures in the cytoplasm called replication complexes (RCs). RCs provide an advantageous microenvironment for viral replication, but it is unknown how the host immune system counteracts these structures. Here we show that interferon-gamma (IFNG) disrupts the RC of murine norovirus (MNV) via evolutionarily conserved autophagy proteins and the induction of IFN-inducible GTPases, which are known to destroy the membrane of vacuoles containing bacteria, protists, or fungi. The MNV RC was marked by the microtubule-associated-protein-1-light-chain-3 (LC3) conjugation system of autophagy and then targeted by immunity-related GTPases (IRGs) and guanylate-binding proteins (GBPs) upon their induction by IFNG. Further, the LC3 conjugation system and the IFN-inducible GTPases were necessary to inhibit MNV replication in mice and human cells. These data suggest that viral RCs can be marked and antagonized by a universal immune defense mechanism targeting diverse pathogens replicating in cytosolic membrane structures. Copyright © 2017 Elsevier Inc. All rights reserved.
Werner-Felmayer, G; Werner, E R; Fuchs, D; Hausen, A; Reibnegger, G; Wachter, H
1990-05-15
Determination of neopterin [D-erythro-6-(1',2',3'-trihydroxypropyl)pterin] in body fluids is a powerful diagnostic tool in a variety of diseases in which activation of cellular immune mechanisms is involved, such as certain malignancies, allograft rejection, and autoimmune and infectious diseases. In vitro, neopterin is released into the supernatant by peripheral blood-derived monocytes/macrophages upon stimulation with gamma-interferon. In parallel, cleavage of tryptophan by indoleamine 2,3-dioxygenase is induced. We report here that the human myelomonocytic cell line THP-1 forms neopterin and degrades tryptophan upon treatment with gamma-interferon. Like in macrophages alpha-interferon and beta-interferon induce these pathways only to a much smaller degree. The action of interferons is enhanced by cotreatment with tumor necrosis factor alpha, lipopolysaccharide, or dexamethasone. gamma-Interferon-induced neopterin formation and indoleamine 2,3-dioxygenase activity are increased by raising extracellular tryptophan concentrations. The pattern of intracellularly formed pteridines upon stimulation with gamma-interferon shows the unique characteristics of human monocytes/macrophages. Neopterin, monapterin, and biopterin are produced in a 50:2:1 ratio. Thus, the THP-1 cell line provides a permanent, easily accessible in vitro system for studying the induction and mechanism of neopterin formation.
Ocrelizumab versus Interferon Beta-1a in Relapsing Multiple Sclerosis.
Hauser, Stephen L; Bar-Or, Amit; Comi, Giancarlo; Giovannoni, Gavin; Hartung, Hans-Peter; Hemmer, Bernhard; Lublin, Fred; Montalban, Xavier; Rammohan, Kottil W; Selmaj, Krzysztof; Traboulsee, Anthony; Wolinsky, Jerry S; Arnold, Douglas L; Klingelschmitt, Gaelle; Masterman, Donna; Fontoura, Paulo; Belachew, Shibeshih; Chin, Peter; Mairon, Nicole; Garren, Hideki; Kappos, Ludwig
2017-01-19
B cells influence the pathogenesis of multiple sclerosis. Ocrelizumab is a humanized monoclonal antibody that selectively depletes CD20+ B cells. In two identical phase 3 trials, we randomly assigned 821 and 835 patients with relapsing multiple sclerosis to receive intravenous ocrelizumab at a dose of 600 mg every 24 weeks or subcutaneous interferon beta-1a at a dose of 44 μg three times weekly for 96 weeks. The primary end point was the annualized relapse rate. The annualized relapse rate was lower with ocrelizumab than with interferon beta-1a in trial 1 (0.16 vs. 0.29; 46% lower rate with ocrelizumab; P<0.001) and in trial 2 (0.16 vs. 0.29; 47% lower rate; P<0.001). In prespecified pooled analyses, the percentage of patients with disability progression confirmed at 12 weeks was significantly lower with ocrelizumab than with interferon beta-1a (9.1% vs. 13.6%; hazard ratio, 0.60; 95% confidence interval [CI], 0.45 to 0.81; P<0.001), as was the percentage of patients with disability progression confirmed at 24 weeks (6.9% vs. 10.5%; hazard ratio, 0.60; 95% CI, 0.43 to 0.84; P=0.003). The mean number of gadolinium-enhancing lesions per T 1 -weighted magnetic resonance scan was 0.02 with ocrelizumab versus 0.29 with interferon beta-1a in trial 1 (94% lower number of lesions with ocrelizumab, P<0.001) and 0.02 versus 0.42 in trial 2 (95% lower number of lesions, P<0.001). The change in the Multiple Sclerosis Functional Composite score (a composite measure of walking speed, upper-limb movements, and cognition; for this z score, negative values indicate worsening and positive values indicate improvement) significantly favored ocrelizumab over interferon beta-1a in trial 2 (0.28 vs. 0.17, P=0.004) but not in trial 1 (0.21 vs. 0.17, P=0.33). Infusion-related reactions occurred in 34.3% of the patients treated with ocrelizumab. Serious infection occurred in 1.3% of the patients treated with ocrelizumab and in 2.9% of those treated with interferon beta-1a. Neoplasms
Breckler, L A; Hale, J; Taylor, A; Dunstan, J A; Thornton, C A; Prescott, S L
2008-11-01
During pregnancy, variations in maternal-foetal cellular interactions may influence immune programming. This study was carried out to determine if maternal responses to foetal alloantigens are altered by maternal allergic disease and/or previous pregnancies. For this cohort study, peripheral blood was collected from allergic (n = 69) and nonallergic (n = 63) pregnant women at 20, 30, 36-week gestation and 6-week postpartum (pp). Cord blood was collected at delivery. Mixed lymphocyte reactions were used to measure maternal cytokine responses [interleukin-6 (IL-6), IL-10, IL-13 and (interferon-gamma) IFN-gamma] at each time point towards foetal mononuclear cells. Maternal cytokine responses during pregnancy (20, 30 and 36 weeks) were suppressed compared to the responses at 6-week pp. The ratio of maternal IFN-gamma/IL-13 and IFN-gamma/IL-10 responses were lower during pregnancy. Allergic mothers had lower IFN-gamma responses at each time-point during pregnancy with the greatest difference in responses observed at 36-week gestation. When allergic and nonallergic women were further stratified by gravidity group, IFN-gamma responses of allergic multigravid mothers were significantly lower than nonallergic multigravid mothers during pregnancy. During normal pregnancy, peripheral T-cell cytokine responses to foetal alloantigens may be altered by both allergic status of the mother and previous pregnancies. These factors could influence the cytokine milieu experienced by the foetus and will be further explored in the development of allergic disease during early life.
Methodology comparison for gamma-heating calculations in material-testing reactors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lemaire, M.; Vaglio-Gaudard, C.; Lyoussi, A.
2015-07-01
The Jules Horowitz Reactor (JHR) is a Material-Testing Reactor (MTR) under construction in the south of France at CEA Cadarache (French Alternative Energies and Atomic Energy Commission). It will typically host about 20 simultaneous irradiation experiments in the core and in the beryllium reflector. These experiments will help us better understand the complex phenomena occurring during the accelerated ageing of materials and the irradiation of nuclear fuels. Gamma heating, i.e. photon energy deposition, is mainly responsible for temperature rise in non-fuelled zones of nuclear reactors, including JHR internal structures and irradiation devices. As temperature is a key parameter for physicalmore » models describing the behavior of material, accurate control of temperature, and hence gamma heating, is required in irradiation devices and samples in order to perform an advanced suitable analysis of future experimental results. From a broader point of view, JHR global attractiveness as a MTR depends on its ability to monitor experimental parameters with high accuracy, including gamma heating. Strict control of temperature levels is also necessary in terms of safety. As JHR structures are warmed up by gamma heating, they must be appropriately cooled down to prevent creep deformation or melting. Cooling-power sizing is based on calculated levels of gamma heating in the JHR. Due to these safety concerns, accurate calculation of gamma heating with well-controlled bias and associated uncertainty as low as possible is all the more important. There are two main kinds of calculation bias: bias coming from nuclear data on the one hand and bias coming from physical approximations assumed by computer codes and by general calculation route on the other hand. The former must be determined by comparison between calculation and experimental data; the latter by calculation comparisons between codes and between methodologies. In this presentation, we focus on this latter kind of bias
Lotrich, Francis E; Ferrell, Robert E; Rabinovitz, Mordechai; Pollock, Bruce G
2009-02-15
Major depressive disorder (MDD) occurs in a subset of patients receiving interferon-alpha treatment, although many are resilient to this side effect. Genetic differences in the serotonin reuptake transporter promoter (5-HTTLPR) may interact with the inflammatory system and influence depression risk. A cohort of 71 nondepressed hepatitis C patients about to receive interferon-alpha was prospectively followed, employing a diagnostic structured clinical interview (Structured Clinical Interview for DSM-IV Axis I Disorders [SCID-I]) and self-report questionnaires. Patients were genotyped for the 5-HTTLPR (L(G), L(A), and S) and the variable number of tandem repeats (VNTR) polymorphism in the second intron. Kaplan-Meier analyses were used to compare major depression incidence. Genotype effects on sleep quality (Pittsburgh Sleep Quality Index) and Beck Depression Inventory (BDI) were assessed using mixed-effect repeated-measure analyses. The L(A) allele was associated with a decreased rate of developing MDD (Mantel-Cox log rank test p < .05) with the L(A)/L(A) genotype being the most resilient. This genotype was also associated with better sleep quality [F(61.2,2) = 3.3, p < .05]. The ability of baseline sleep quality to predict depression incidence disappeared when also including genotype in the model. Conversely, the relationship of neuroticism with depression incidence (B = .07, SE = .02, p < .005) was not mitigated when including genotype. Using a prospective design, 5-HTTLPR is associated with MDD incidence during interferon-alpha treatment. Preliminary evidence that this effect could be mediated by effects on sleep quality was observed. These findings provide support for a possible interaction between inflammatory cytokine (interferon-alpha) exposure and 5-HTTLPR variability in MDD.
Higgs, Brandon W; Morehouse, Christopher; Streicher, Katie L; Brohawn, Philip; Pilataxi, Fernanda; Gupta, Ashok; Ranade, Koustubh
2018-05-01
To identify a predictive biomarker for durvalumab, an anti-programmed death ligand 1 (PD-L1) monoclonal antibody. RNA sequencing of 97 advanced-stage non-small-cell lung carcinoma (NSCLC) biopsies from a nonrandomized phase 1b/2 clinical trial (1108/NCT01693562) were profiled to identify a predictive signature; 62 locally advanced or metastatic urothelial cancer (UC) tumors from the same study were profiled to confirm predictive utility of the signature. Thirty NSCLC patients provided pre- and posttreatment tumors for messenger RNA (mRNA) analysis. NSCLC with ≥25% tumor cells and UC with ≥25% tumor or immune cells stained for PD-L1 at any intensity were scored PD-L1 positive (PD-L1+). Kaplan-Meier and Cox proportional hazards analyses were used to adjust for gender, age, prior therapies, histology, ECOG, liver metastasis, and smoking. Tumor mutation burden (TMB) was calculated using data from The Cancer Genome Atlas (TCGA). In the NSCLC discovery set, a four-gene interferon gamma (IFNγ)-positive (IFNγ+) signature comprising IFNγ, CD274, LAG3, and CXCL9 was associated with higher overall response rates, longer median progression-free survival, and overall survival compared with signature-low patients. IFNγ+-signature NSCLC patients had improved survival regardless of immunohistochemistry (IHC) PD-L1 status. These associations were replicated in a UC cohort. The IFNγ+ signature was induced twofold (P = 0.003) by durvalumab after 8 weeks of therapy in NSCLC patients, and baseline signature was associated with TMB but not survival in TCGA data. The IFNγ+ mRNA signature may assist in identifying patients with improved outcomes to durvalumab, independent of PD-L1 assessed by IHC. Copyright ©2018, American Association for Cancer Research.
Moroda, Masataka; Takamoto, Masaya; Iwakura, Yoichiro; Nakayama, Jun; Aosai, Fumie
2017-12-01
Interleukin17A (IL-17A) is known to be involved in the host defense against pathogens and the pathogenesis of autoimmune diseases. Previously, we showed that excessive amounts of interferon gamma (IFN-γ) play an important role in the pathogenesis of the lethal effects of Toxoplasma gondii by inducing anaphylactic responses. In the study described in this report, we examined the effects of IL-17A deficiency on murine host defense against oral T. gondii infection. IL-17A-deficient C57BL/6 (B6) mice exhibited higher rates of mortality than wild-type (WT) mice during the acute phase of T. gondii infection. CD4 + T cells in the mesenteric lymph nodes (mLNs) and ileum of T. gondii -infected IL-17A-deficient mice produced higher levels of IFN-γ than did those of WT mice. In addition, the level of T. gondii HSP70 ( T.g HSP70) expression was also significantly increased in the ileum, mLNs, liver, and spleen of infected IL-17A-deficient mice compared with that in WT mice. These elevated levels of expression of T.g HSP70 and IFN-γ in infected IL-17A-deficient mice were presumably linked to the IL-17A defect since they decreased to WT levels after treatment with recombinant IL-17A. Furthermore, IL-17A-deficient mice were highly susceptible to the anaphylactic effect of T.g HSP70, and the survival of IL-17A-deficient mice during the acute phase was improved by treatment with an anti- T.g HSP70 monoclonal antibody. These results suggest that IL-17A plays an important role in host survival against T. gondii infection by protecting the host from an anaphylactic reaction via the downregulation of T.g HSP70 and IFN-γ production. Copyright © 2017 American Society for Microbiology.
Sperber, K; Silverstein, L; Brusco, C; Yoon, C; Mullin, G E; Mayer, L
1995-01-01
Superantigens are potent inducers of T-cell proliferation and induce a broad range of cytokines, including tumor necrosis factor (TNF), gamma interferon, and interleukin 2 (IL-2). In the present study, we compared the abilities of different staphylococcal superantigens (staphylococcal enterotoxin B [SEB], staphylococcal enterotoxin E [SEE], and toxic shock syndrome toxin 1 [TSST-1]) to stimulate distinct cytokine profiles in peripheral blood mononuclear cells (PBMC), lamina propria lymphocytes (LPL), and intraepithelial lymphocytes (IEL). One million PBMC, LPL, and IEL were stimulated with various concentrations of superantigen (10 to 0.001 ng/ml) for 24, 48, and 72 h. Maximum cytokine production by PBMC, LPL, and IEL was observed for all three superantigens at 48 h at a concentration of 1 ng/ml. In PBMC, SEE and TSST-1 stimulated more IL-2 and gamma interferon than SEB. SEE and TSST-1 also stimulated more TNF and IL-4 production than SEB. In contrast, SEB stimulated more IL-6 than either SEE or TSST-1. In LPL, there was no SEE-induced IL-2 or IL-4 production, but IL-6, TNF, and gamma interferon were induced. SEB similarly induced no IL-2 or gamma interferon from the LPL, but IL-4, IL-6, and TNF were detected. TSST-1 stimulation of LPL resulted in IL-2 and TNF production but no IL-4, IL-6, or gamma interferon. In IEL, SEE induced no IL-2, IL-4, or gamma interferon but produced IL-6 and TNF, while SEB stimulation resulted in no IL-2 or gamma interferon but did result in detectable IL-4, IL-6, and TNF. Taken together, these data indicate that there are significant differences in the cytokine profiles induced by superantigens in LPL and IEL compared with those in PBMC, and these differences may relate to differences in activation requirements. PMID:7583927
Dalbjerg, Sara Maria; Tsakiri, Anna; Frederiksen, Jette Lautrup
2016-07-01
Multiple sclerosis is an inflammatory disease of the central nervous system for which there is currently no cure. Interferon-beta-1-alpha is worldwide one of the most widely used treatments in multiple sclerosis. To our knowledge there is one previous reported case of rhabdomyolysis associated with Interferon-beta treatment. We describe a 30 year old man with relapsing remitting multiple sclerosis who developed rhabdomyolysis and increased creatine kinase following Interferon-beta-1-alpha therapy. After the medication was discontinued, the patient rapidly improved. Clinicians should be aware of the possibility of rhabdomyolysis occurring during Interferon-beta-1-alpha therapy. In cases where patients complain of severe myalgia, and in particular if weakness is reported, creatine kinase activity should be measured to prevent irreversible rhabdomyolysis during Interferon-beta-1-alpha therapy in patients with multiple sclerosis. Copyright © 2016 Elsevier B.V. All rights reserved.
Monitoring acute phase proteins in retrovirus infected cats undergoing feline interferon-ω therapy.
Leal, R O; Gil, S; Sepúlveda, N; McGahie, D; Duarte, A; Niza, M M R E; Tavares, L
2014-01-01
Recombinant feline interferon-ω therapy is an immunomodulator currently used in the treatment of different retroviral diseases including feline immune deficiency virus and feline leukaemia virus. Although its mechanism of action remains unclear, this drug appears to potentiate the innate response. Acute phase proteins are one of the key components of innate immunity and studies describing their use as a monitoring tool for the immune system in animals undergoing interferon-ω therapy are lacking. This study aimed to determine whether interferon-ω therapy influences acute phase protein concentrations namely serum amyloid-A, α-1-glycoprotein and C-reactive protein. A single-arm study was performed using 16 cats, living in an animal shelter, naturally infected with retroviruses and subjected to the interferon-ω therapy licensed protocol. Samples were collected before (D0), during (D10 and D30) and after therapy (D65). Serum amyloid-A and C-reactive protein were measured by specific enzyme-linked immunosorbent assay kits and α-1-glycoprotein by single radial immunodiffusion. All the acute phase proteins significantly increased in cats undergoing interferon-ω therapy (D0/D65: P<0·05) CLINICAL SIGNIFICANCE: Acute phase proteins appear to be reasonable predictors of innate-immune stimulation and may be useful in the individual monitoring of naturally retroviral infected cats undergoing interferon-ω therapy. © 2013 British Small Animal Veterinary Association.
The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon
Fernández de Marco, María del Mar; Alejo, Alí; Hudson, Paul; Damon, Inger K.; Alcami, Antonio
2010-01-01
Variola virus (VARV) caused smallpox, one of the most devastating human diseases and the first to be eradicated, but its deliberate release represents a dangerous threat. Virulent orthopoxviruses infecting humans, such as monkeypox virus (MPXV), could fill the niche left by smallpox eradication and the cessation of vaccination. However, immunomodulatory activities and virulence determinants of VARV and MPXV remain largely unexplored. We report the molecular characterization of the VARV- and MPXV-secreted type I interferon-binding proteins, which interact with the cell surface after secretion and prevent type I interferon responses. The proteins expressed in the baculovirus system have been purified, and their interferon-binding properties characterized by surface plasmon resonance. The ability of these proteins to inhibit a broad range of interferons was investigated to identify potential adaptation to the human immune system. Furthermore, we demonstrate by Western blot and activity assays the expression of the type I interferon inhibitor during VARV and MPXV infections. These findings are relevant for the design of new vaccines and therapeutics to smallpox and emergent virulent orthopoxviruses because the type I interferon-binding protein is a major virulence factor in animal models, vaccination with this protein induces protective immunity, and its neutralization prevents disease progression.—Fernández de Marco, M. M., Alejo, A., Hudson, P., Damon, I. K., Alcami, A. The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon. PMID:20019241
Nol, Pauline; Rhyan, Jack C.; Robbe-Austerman, Suelee; McCollum, Matt P.; Rigg, Tara D.; Saklou, Nadia T.; Salman, Mo D.
2013-01-01
White-tailed deer (Odocoileus virginianus) experimentally infected with a virulent strain of Mycobacterium bovis have been shown to transmit the bacterium to other deer and cattle (Bos taurus) by sharing of pen waste and feed. The risk of transmission of M. bovis bacille Calmette-Guerin (BCG) vaccine from orally vaccinated white-tailed deer to other deer and cattle, however, is not well understood. In order to evaluate this risk, we orally vaccinated 14 white-tailed deer with 1×109 colony forming units BCG in lipid-formulated baits and housed them with nine non-vaccinated deer. Each day we exposed the same seven naïve cattle to pen space utilized by the deer to look for transmission between the two species. Before vaccination and every 60 days until the end of the study, we performed tuberculin skin testing on deer and cattle, as well as interferon-gamma testing in cattle, to detect cellular immune response to BCG exposure. At approximately 27 weeks all cattle and deer were euthanized and necropsied. None of the cattle converted on either caudal fold, comparative cervical tests, or interferon-gamma assay. None of the cattle were culture positive for BCG. Although there was immunological evidence that BCG transmission occurred from deer to deer, we were unable to detect immunological or microbiological evidence of transmission to cattle. This study suggests that the risk is likely to be low that BCG-vaccinated white-tailed deer would cause domestic cattle to react to the tuberculin skin test or interferon-gamma test through exposure to a BCG-contaminated environment. PMID:23565211
Gugssa, A; Gebru, S; Lee, C M; Baccetti, B; Anderson, W
2005-08-01
Trypanosoma musculi-macrophage co-cultures were studied to investigate the biological role of lipopolysaccharide (LPS) induced cytokines in controlling the proliferation of parasites in vitro. Macrophages, isolated by peritoneal lavage, sustained the growth and proliferation of the parasites. Macrophages activated with LPS were characterized by up-regulation of nitric oxide synthase (iNOS) and phagocytosis of fluorescent latex spheres. Activated macrophages showed marked inhibition of the association and proliferation of the parasites. The LPS treated macrophages produced cytokines, especially interferon gamma (INF-gamma), which was detected by Western blot. Trypanosomes, inhibited from association with macrophages, did not proliferate and instead formed clusters held together by their flagella. Cells in these clusters were apoptotic, as demonstrated by the Apoptag reaction and gel fragmentation assay. In addition, high levels of caspase 8 and caspase 3 were shown in floating trypanosome clusters. The results would suggest that INF-gamma and other cytokines released by activated macrophages, possibly functioning through the INF-gammaR1, Fas ligand, CD95 or other death ligands in the trypanosome plasma membrane initiates the apoptosis cascade in trypanosomes.
Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.
1999-01-01
Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206
Spiewak, Radoslaw; Moed, Heleen; von Blomberg, Brigitta Mary E; Bruynzeel, Derk P; Scheper, Rik J; Gibbs, Susan; Rustemeyer, Thomas
2007-02-01
To date, no in vitro test is suitable for routine diagnosis of contact allergy. The aim of our study was to establish improved in vitro test protocol for the detection of antigen-specific responses of lymphocytes from patients with allergic contact dermatitis to nickel (Ni-ACD). Blood leucocytes from 14 Ni-ACD patients and 14 controls were cultured in the presence of 'cytokine cocktails' skewing lymphocytes towards 'type 1' [interferon-gamma (IFN-gamma)-secreting] or 'type 2' [interleukin (IL)-5 and IL-13-secreting] phenotypes. The cocktails consisted of IL-7 and, respectively, either IL-12 or IL-4. Cell responses to nickel were measured with enzyme-linked immunospot assay (ELISpot), enzyme-linked immunosorbent assay (ELISA), and lymphocyte proliferation test (LPT). Significant differences between patients with Ni-ACD and controls were found for the 'type 2' cytokines IL-13 and IL-5, with further increase of allergen-specific responses occurring when cultures were supplemented with IL-7 and IL-4. No significant differences were found for IFN-gamma. The best correlate to clinical diagnosis was LPT with 'type 2' skewing (r= 0.739, P < 0.001), followed by IL-13 ELISpot with 'type 2' skewing (r= 0.654, P < 0.001). The non-radioactive method that correlated best with LPT was IL-2 ELISpot (r= 0.809, P < 0.001). Overall, we conclude that combining ELISpot assay with proposed modifications of culture conditions improves detection of specific lymphocyte responses in contact allergy to nickel.
Predicting diffusion paths and interface motion in gamma/gamma + beta, Ni-Cr-Al diffusion couples
NASA Technical Reports Server (NTRS)
Nesbitt, J. A.; Heckel, R. W.
1987-01-01
A simplified model has been developed to predict Beta recession and diffusion paths in ternary gamma/gamma + beta diffusion couples (gamma:fcc, beta: NiAl structure). The model was tested by predicting beta recession and diffusion paths for four gamma/gamma + beta, Ni-Cr-Al couples annealed for 100 hours at 1200 C. The model predicted beta recession within 20 percent of that measured for each of the couples. The model also predicted shifts in the concentration of the gamma phase at the gamma/gamma + beta interface within 2 at. pct Al and 6 at. pct Cr of that measured in each of the couples. A qualitative explanation based on simple kinetic and mass balance arguments has been given which demonstrates the necessity for diffusion in the two-phase region of certain gamma/gamma + beta, Ni-Cr-Al couples.
Conrady, Christopher D.; Halford, William P.; Carr, Daniel J. J.
2011-01-01
The mouse model of genital herpes relies on medoxyprogesterone treatment of female mice to render the vaginal lumen susceptible to inoculation with herpes simplex virus 2 (HSV-2). In the present study, we report that mice deficient in the A1 chain of the type I interferon receptor (CD118−/−) are susceptible to HSV-2 in the absence of medroxyprogesterone preconditioning. In the absence of hormone pretreatment, 2,000 PFU of a clinical isolate of HSV-2 was sufficient to establish a productive infection in the vagina of 75% ± 17% and in the spinal cord of 71% ± 14% of CD118−/− mice, whereas the same dose of HSV-2 replicated to detectable levels in only 13% ± 13% of vaginal samples and 0% of spinal cord samples from wild-type mice, as determined at day 5 postinfection. The susceptibility to HSV-2 infection in the CD118−/− mice was associated with a significant reduction in the infiltration of HSV-specific cytotoxic T lymphocytes into the vaginal tissue, the local production of gamma interferon (IFN-γ), and the expression of T cell-recruiting chemokines CCL5, CXCL9, and CXCL10. Collectively, the results underscore the significant contribution of type I IFNs in resistance to genital HSV-2 infection. PMID:21147921
The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon.
Fernández de Marco, María del Mar; Alejo, Alí; Hudson, Paul; Damon, Inger K; Alcami, Antonio
2010-05-01
Variola virus (VARV) caused smallpox, one of the most devastating human diseases and the first to be eradicated, but its deliberate release represents a dangerous threat. Virulent orthopoxviruses infecting humans, such as monkeypox virus (MPXV), could fill the niche left by smallpox eradication and the cessation of vaccination. However, immunomodulatory activities and virulence determinants of VARV and MPXV remain largely unexplored. We report the molecular characterization of the VARV- and MPXV-secreted type I interferon-binding proteins, which interact with the cell surface after secretion and prevent type I interferon responses. The proteins expressed in the baculovirus system have been purified, and their interferon-binding properties characterized by surface plasmon resonance. The ability of these proteins to inhibit a broad range of interferons was investigated to identify potential adaptation to the human immune system. Furthermore, we demonstrate by Western blot and activity assays the expression of the type I interferon inhibitor during VARV and MPXV infections. These findings are relevant for the design of new vaccines and therapeutics to smallpox and emergent virulent orthopoxviruses because the type I interferon-binding protein is a major virulence factor in animal models, vaccination with this protein induces protective immunity, and its neutralization prevents disease progression.
Lam, L K Metthew; Watson, Alan M; Ryman, Kate D; Klimstra, William B
2018-01-01
Live attenuated viruses are historically among the most effective viral vaccines. Development of a safe vaccine requires the virus to be less virulent, a phenotype that is historically arrived by empirical evaluation often leaving the mechanisms of attenuation unknown. The yellow fever virus 17D live attenuated vaccine strain has been developed as a delivery vector for heterologous antigens; however, the mechanisms of attenuation remain elusive. The successful and safe progress of 17D as a vaccine vector and the development of live attenuated vaccines (LAVs) to related flaviviruses requires an understanding of the molecular mechanisms leading to attenuation. Using subcutaneous infection of interferon-deficient mouse models of wild type yellow fever virus (WT YFV) pathogenesis and 17D-mediated immunity, we found that, in the absence of type I IFN (IFN-α/β), type II interferon (IFN-γ) restricted 17D replication, but not that of WT YFV, by 1-2 days post-infection. In this context, IFN-γ responses protected 17D-infected animals from mortality, largely restricted the virus to lymphoid organs, and eliminated viscerotropic disease signs such as steatosis in the liver and inflammatory cell infiltration into the spleen. However, WT YFV caused a disseminated infection, gross liver pathology, and rapid death of the animals. In vitro, IFN-γ treatment of myeloid cells suppressed the replication of 17D significantly more than that of WT YFV, suggesting a direct differential effect on 17D virus replication. Together these data indicate that an important mechanism of 17D attenuation in vivo is increased sensitivity to IFN-γ stimulated responses elicited early after infection.
Predictive Factors for Beneficial Response to Interferon-alfa Therapy in Chronic Hepatitis C
Yoon, Seung-Kew; Kim, Sung Soo; Park, Young Min; Shim, Kyu Sik; Lee, Chang Don; Sun, Hee Sik; Park, Doo Ho; Kim, Boo Sung; Ryu, Wang Shick; Cho, Joong Myung
1995-01-01
Objectives: Interferon is the only established teatment for chronic hepatitis C but the host-dependent or virus-related factors affecting the response rate to interferon therapy are not yet dear. The purpose of this study was to investigate the factors predictive of response to interferon-alfa therapy in chronic hepatitis C. Methods: Twenty-five consecutive patients with chronic hepatitis C were randomized to three regimens of interferon-alfa: group A (n=7, 3MU every day for 3 months), group B (n=8, 3MU every other day for 3 months) and group C (n=10, 3MU every other day for 6 months), We quantified serum HC RNA levels by competitive reverse transcription-polymerase chain reaction (RT-PCR)and performed HCV genotyping using type-specific primers deduced from the NS5 region of the HCV genome. We also attempted to identify which demographic, biochemical and histologic factors in addition to virus-related factors would significantly predict beneficial response to interferon by multivariate analysis. Results: Sustained responders were 8 (36.4%), nonsustained responders were 2 (9.1%) and nonresponders were 12 (54.5%) of 22 patients who had received complete therapy. The initial HCV RNA level (logarithmic transformed copy numbers per ml of serum)in sustained responders (5.75±0.39) was significantly lower than that of nonsustained responders (6.80±0.71)and nonresponders (6.70±0.52) (p<0.05). In multivariate multiple logistic regression analysis, the serum HCV RNA level before therapy was only the independent predictor of a sustained response to interferon-alfa therapy (p=0.001). Conclusions: Serum HCV RNA level before therapy was the most useful predictor of a sustained response to interferon-alfa therapy for chronic hepatitis C. PMID:7495780
The lived experience of interferon-free treatments for hepatitis C: A thematic analysis.
Whiteley, David; Whittaker, Anne; Elliott, Lawrie; Cunningham-Burley, Sarah
2016-12-01
International discourse concerning the evolution in hepatitis C virus (HCV) therapy has tended to focus on improving outcomes, shortened treatment length and reduced side-effects of interferon-free regimens. How these treatments are being understood and experienced by the people receiving them has so far been overlooked. This study therefore aimed to explore the lived experience of individuals taking interferon-free HCV therapies. Data were generated through 16 semi-structured interviews with a purposive sample of eight participants, recruited from a university hospital in Scotland. The interviews took place between June 2015 and March 2016, before and after a period of interferon-free HCV treatment. The data were interrogated using a thematic analysis, underpinned by social phenomenological theory. Three overriding themes were identified. 'Expectations and realisations' characterised the influence that interferon continued to cast over interferon-free treatment, contrasting the practicalities of taking interferon-free therapy with preconceived notions. 'An honour and a pleasure' portrayed a positive experience of an undemanding therapy, yet among those with a history of drug use, was also positioned as a privilege, associated with feelings of luck and guilt. 'Treatment needs' illustrated the strategies participants used to search for treatment efficacy, and the value those with a significant history of drug use placed on support. One nonconforming case is then discussed to enhance rigour and trustworthiness. This is the first qualitative exploration of the experience of interferon-free HCV treatment reported globally. The results from this study suggest a cultural lag exists between the pharmacological developments which have been witnessed, and societal understandings of them. This has implications for the way services meet the needs of, and offer therapy to, HCV positive individuals. Copyright © 2016 Elsevier B.V. All rights reserved.
Hirota, Ryuichiro; Tajima, Sadao; Yoneda, Yukio; Tamayama, Takumi; Watanabe, Masahito; Ueda, Kouichi; Kubota, Takahiro; Yoshida, Ryotaro
2002-09-01
Interferon-gamma(-/-) (IFN-gamma(-/-)) and IFN-gamma(+/+) C57BL/6 mice (3 weeks of age) completed the production of morphogenesis-derived hair. Around 6 weeks of age, however, most of the IFN-gamma(-/-) but none of the IFN-gamma(+/+) mice began to lose hairs in the dorsal and occipital areas in the absence of inflammatory reactions, and the alopecia was sustained for at least several 10-week periods of observation. A single subcutaneous injection of IFN-gamma to IFN-gamma(-/-) mice at 3, but not 4, 5, or 8 weeks of age could protect all the mice from alopecia, revealing that the lack of IFN-gamma around 3 weeks of age is directly responsible for the alopecia. Histologic features showed that the hair follicles of the IFN-gamma(+/+) mice passed through the anagen (4-5 weeks of age) and catagen/telogen ( approximately 6 weeks of age) phases, whereas those of IFN-gamma(-/-) mice (5 weeks of age or older) stayed in the anagen phase. TUNEL and bromodeoxyuridine experiments suggested that an arrest with unlimited DNA synthesis of the hair cycle in the anagen phase by the lack of IFN-gamma-dependent apoptosis in the midfollicle region and diffuse shedding of previously formed hair induced alopecia in IFN-gamma(-/-) mice.
Interferon-free treatment for HCV-infected patients with decompensated cirrhosis.
Kanda, Tatsuo
2017-01-01
Progress in interferon-free treatment against hepatitis C virus (HCV) has remained a challenge in patients with decompensated cirrhosis due to a paucity of information on efficacy and safety profiles. This review illustrates that interferon-free treatment could result in greater than 85 % sustained virological response (SVR) rates in patients with HCV genotype 1 and decompensated cirrhosis. The combination of pangenotypic HCV NS5A inhibitor velpatasvir and HCV NS5B inhibitor sofosbuvir has demonstrated high SVR rates in patients with HCV genotypes 1, 2, 3, 4 or 6 and decompensated cirrhosis. Certain patients discontinued treatment due to adverse events, death or having liver transplantation. Taken together, interferon-free treatment could produce higher SVR rates in decompensated hepatic cirrhosis. However, as adverse events were occasionally observed, liver transplantation should always be considered as well. Further improvements in treatment are called for in patients with decompensated cirrhosis.
The nucleocapsid protein of measles virus blocks host interferon response
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takayama, Ikuyo; Sato, Hiroki; Watanabe, Akira
2012-03-01
Measles virus (MV) belongs to the genus Morbillivirus of the family Paramyxoviridae. A number of paramyxoviruses inhibit host interferon (IFN) signaling pathways in host immune systems by various mechanisms. Inhibition mechanisms have been described for many paramyxoviruses. Although there are inconsistencies among previous reports concerning MV, it appears that P/V/C proteins interfere with the pathways. In this study, we confirmed the effects of MV P gene products of a wild MV strain on IFN pathways and examined that of other viral proteins on it. Interestingly, we found that N protein acts as an IFN-{alpha}/{beta} and {gamma}-antagonist as strong as Pmore » gene products. We further investigated the mechanisms of MV-N inhibition, and revealed that MV-N blocks the nuclear import of activated STAT without preventing STAT and Jak activation or STAT degradation, and that the nuclear translocation of MV-N is important for the inhibition. The inhibitory effect of the N protein was observed as a common feature of other morbilliviruses. The results presented in this report suggest that N protein of MV as well as P/V/C proteins is involved in the inhibition of host IFN signaling pathways.« less
A new assay system for guinea pig interferon biological activity.
Yamamoto, Toshiko; Jeevan, Amminikutty; Ohishi, Kazue; Nojima, Yasuhiro; Umemori, Kiyoko; Yamamoto, Saburo; McMurray, David N
2002-07-01
We have developed an assay system for guinea pig interferon (IFN) based on reduction of viral cytopathic effect (CPE) in various cell lines. CPE inhibition was detected optimally in the guinea pig fibroblast cell line 104C1 infected with encephalomyocarditis virus (EMCV). The amount of biologically active guinea pig IFN was quantified by estimating viable cell numbers colorimetrically by means of a tetrazolium compound, 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium monosodium salt (WST-1) and 1-methoxy-5-methylphenazinium methylsulfate (PMS). WST-1 color developed until stopped by the addition of sulfuric acid. This had no effect on the colorimetric assay, and the color was stable for at least 24 h. The acid also inactivated the EMCV and, thus, eliminated the viral hazard. Inhibition of CPE activity was highly correlated with the concentration of culture supernatants from BCG-vaccinated guinea pig splenocytes stimulated in vitro with tuberculin or an immunostimulatory oligoDNA. This assay detected guinea pig IFN and human IFN-alpha, but not IFN-gamma from human, mouse, rat, pig, or dog. This assay system has proved useful for the titration of guinea pig IFN, being easy to perform, free from viral hazard, relatively species specific, highly reproducible, and inexpensive.
Hines, Stephen A.; Stone, Diana M.; Hines, Melissa T.; Alperin, Debby C.; Knowles, Donald P.; Norton, Linda K.; Hamilton, Mary J.; Davis, William C.; McGuire, Travis C.
2003-01-01
Rhodococcus equi is a gram-positive bacterium that infects alveolar macrophages and causes rhodococcal pneumonia in horses and humans. The virulence plasmid of R. equi appears to be required for both pathogenicity in the horse and the induction of protective immunity. An understanding of the mechanisms by which virulent R. equi circumvents protective host responses and by which bacteria are ultimately cleared is important for development of an effective vaccine. Six adult horses were challenged with either virulent R. equi or an avirulent, plasmid-cured derivative. By using a flow cytometric method for intracytoplasmic detection of gamma interferon (IFN-γ) in equine bronchoalveolar lavage fluid (BALF) cells, clearance of the virulent strain was shown to be associated with increased numbers of pulmonary CD4+ and CD8+ T lymphocytes producing IFN-γ. There was no change in IFN-γ-positive cells in peripheral blood, suggesting that a type 1 recall response at the site of challenge was protective. The plasmid-cured strain of R. equi was cleared in horses without a significant increase in IFN-γ-producing T lymphocytes in BALF. In contrast to these data, a previous report in foals suggested an immunomodulating role for R. equi virulence plasmid-encoded products in downregulating IFN-γ expression by equine CD4+ T lymphocytes. Intracytoplasmic detection of IFN-γ provides a method to better determine whether modulation of macrophage-activating cytokines by virulent strains occurs uniquely in neonates and contributes to their susceptibility to rhodococcal pneumonia. PMID:12626444
Chang, Chia-Chu; Kor, Chew-Teng; Chen, Ting-Yu; Wu, Hung-Ming
2017-01-01
Introduction Sleep disturbance is very common in menopausal women and poor sleep quality has been linked to systemic inflammation. However, the impact of poor sleep quality on health outcomes of menopausal women remains unclear. This study evaluated the relationships between sleep quality and inflammation in menopausal women. Participants and design This cross-sectional study enrolled 281 healthy women aged 45 to 60 years. The Pittsburgh Sleep Quality Index (PSQI) was used to measure quality of sleep. Multiplex assays were used to measure the levels of 9 cytokines in morning fasting plasma samples. Other variables measured in this study included clinical characteristics and high-sensitivity C-reactive protein (hs-CRP). Setting The study was performed at a medical center. Results The 281 participants comprised 79 (28%) perimenopausal women and 202 (72%) postmenopausal women. Global PSQI scores were positively correlated with plasma hs-CRP levels (P = 0.012) and were marginally associated with interferon gamma-inducible protein-10 (IP10), interleukin 6 (IL6), and macrophage inflammatory protein-1beta (MIP-1β) levels. After adjusting for age, body mass index, menopause duration, and follicle stimulating hormone, multiple linear regression analysis revealed that high PSQI scores and sleep efficiency < 65% were associated with elevated plasma levels of hs-CRP, IP10, and IL6. In addition, sleep duration < 5 hours was associated with high hs-CRP levels. Conclusion Our data show that poor sleep quality and low sleep efficiency are associated with elevated levels of circulating inflammatory factors IP10, IL6 and hs-CRP and that short sleep duration is associated with high levels of hs-CRP in menopausal women. These findings provide novel evidence that poor sleep quality is linked to low-grade systemic inflammation in menopausal women. PMID:28060925
Giotis, Efstathios S; Robey, Rebecca C; Skinner, Natalie G; Tomlinson, Christopher D; Goodbourn, Stephen; Skinner, Michael A
2016-08-05
Viruses that infect birds pose major threats-to the global supply of chicken, the major, universally-acceptable meat, and as zoonotic agents (e.g. avian influenza viruses H5N1 and H7N9). Controlling these viruses in birds as well as understanding their emergence into, and transmission amongst, humans will require considerable ingenuity and understanding of how different species defend themselves. The type I interferon-coordinated response constitutes the major antiviral innate defence. Although interferon was discovered in chicken cells, details of the response, particularly the identity of hundreds of stimulated genes, are far better described in mammals. Viruses induce interferon-stimulated genes but they also regulate the expression of many hundreds of cellular metabolic and structural genes to facilitate their replication. This study focusses on the potentially anti-viral genes by identifying those induced just by interferon in primary chick embryo fibroblasts. Three transcriptomic technologies were exploited: RNA-seq, a classical 3'-biased chicken microarray and a high density, "sense target", whole transcriptome chicken microarray, with each recognising 120-150 regulated genes (curated for duplication and incorrect assignment of some microarray probesets). Overall, the results are considered robust because 128 of the compiled, curated list of 193 regulated genes were detected by two, or more, of the technologies.
Test of Compton camera components for prompt gamma imaging at the ELBE bremsstrahlung beam
NASA Astrophysics Data System (ADS)
Hueso-González, F.; Golnik, C.; Berthel, M.; Dreyer, A.; Enghardt, W.; Fiedler, F.; Heidel, K.; Kormoll, T.; Rohling, H.; Schöne, S.; Schwengner, R.; Wagner, A.; Pausch, G.
2014-05-01
In the context of ion beam therapy, particle range verification is a major challenge for the quality assurance of the treatment. One approach is the measurement of the prompt gamma rays resulting from the tissue irradiation. A Compton camera based on several position sensitive gamma ray detectors, together with an imaging algorithm, is expected to reconstruct the prompt gamma ray emission density map, which is correlated with the dose distribution. At OncoRay and Helmholtz-Zentrum Dresden-Rossendorf (HZDR), a Compton camera setup is being developed consisting of two scatter planes: two CdZnTe (CZT) cross strip detectors, and an absorber consisting of one Lu2SiO5 (LSO) block detector. The data acquisition is based on VME electronics and handled by software developed on the ROOT framework. The setup has been tested at the linear electron accelerator ELBE at HZDR, which is used in this experiment to produce bunched bremsstrahlung photons with up to 12.5 MeV energy and a repetition rate of 13 MHz. Their spectrum has similarities with the shape expected from prompt gamma rays in the clinical environment, and the flux is also bunched with the accelerator frequency. The charge sharing effect of the CZT detector is studied qualitatively for different energy ranges. The LSO detector pixel discrimination resolution is analyzed and it shows a trend to improve for high energy depositions. The time correlation between the pulsed prompt photons and the measured detector signals, to be used for background suppression, exhibits a time resolution of 3 ns FWHM for the CZT detector and of 2 ns for the LSO detector. A time walk correction and pixel-wise calibration is applied for the LSO detector, whose resolution improves up to 630 ps. In conclusion, the detector setup is suitable for time-resolved background suppression in pulsed clinical particle accelerators. Ongoing tasks are the quantitative comparison with simulations and the test of imaging algorithms. Experiments at proton
D'Ambrosio, Roberta; Degasperi, Elisabetta; Aghemo, Alessio; Fraquelli, Mirella; Lampertico, Pietro; Rumi, Maria Grazia; Facchetti, Floriana; Grassi, Eleonora; Casazza, Giovanni; Rosenberg, William; Bedossa, Pierre; Colombo, Massimo
2016-01-01
Liver biopsy (LB) has lost popularity to stage liver fibrosis in the era of highly effective anti-hepatitis C virus (HCV) therapy, yet diagnosis of persistent cirrhosis may have important implications following HCV eradication. As performance of serological non-invasive tests (NITs) to predict residual fibrosis in non-viremic HCV patients is unknown, we investigated accuracy of NITs to predict residual fibrosis in cirrhotics after a sustained virological response (SVR) to interferon (IFN). Thirty-eight patients with a pre-treatment histological diagnosis of cirrhosis and a 48-104 months post-SVR LB were tested with APRI, CDS, FIB-4, FibroQ, Forns Score, GUCI Index, King Score, Lok Index, PLF, ELF. In 23 (61%) patients, cirrhosis had histologically regressed. All NITs values declined after SVR without any significant difference between regressors and non-regressors (AUROC 0.52-0.75). Using viremic cut-offs, PPV ranged from 34% to 100%, with lower NPV (63% - 68%). NITs performance did not improve using derived cut-offs (PPV: 40% - 80%; NPV: 66% - 100%). PLF, which combines several NITs with transient elastography, had the best diagnostic performance (AUROC 0.75, Sn 61%, Sp 90%, PPV 80%, NPV 78%). After treatment, none of the NITs resulted significantly associated with any of the histological features (activity grade, fibrosis stage, area of fibrosis). The diagnostic estimates obtained using both viremic and derived cut-off values of NITs were suboptimal, indicating that none of these tests helps predicting residual fibrosis and that LB remains the gold standard for this purpose.
Kuvibidila, Solo; Porretta, Connie; Baliga, Surendra
2014-02-01
Aneuploidy, a condition associated with altered chromosome number, hence DNA index, is frequently seen in many diseases including cancers and affects immunity. Iron, an essential nutrient for humans, modulates the immune function and the proliferation of normal and cancer cells. To determine whether impaired immunity seen in iron-deficient subjects may be related to aneuploidy, we measured spleen cell DNA index, percent of cells in different phases of the cell cycle, plasma and/or supernatant IL-2, IL-10, IL-12, and interferon-gamma in control, pair-fed, iron-deficient, and iron-replete mice (N=20-22/group). The test and control diets differed only in iron content (0.09mmol/kg versus 0.9mmol/kg) and were fed for 68days. Mean levels of hemoglobin and liver iron stores of iron-deficient and iron-replete mice were 40-60% lower than those of control and pair-fed mice (P<0.05). Mean plasma levels of IL-10, interferon-gamma and percent of cells in S+G2/M phases were lower in mice with than in those without aneuploidy (P<0.05). Lowest plasma IL-12 and interferon-gamma concentrations were observed in iron-deficient mice with aneuploidy. Mean percents of cultures with aneuploidy and DNA indexes were higher in iron-deficient and iron-replete than in control and pair-fed mice likely due to delayed cell division (P<0.05). Aneuploidy decreased the concentration of IL-2 and interferon-gamma in baseline cultures while it increased that of interferon-gamma in anti-CD3 treated cultures. Aneuploidic indexes negatively correlated with cytokine levels, percents of cells in S+G2/M phases and indicators of iron status (P<0.05). Although chromosome cytogenetics was not performed, for the first time, we report that increased aneuploidy rate may modulate the immune function during iron-deficiency. Copyright © 2014. Published by Elsevier Ltd.
Gonçales, Fernando L; Moma, Camila A; Vigani, Aline G; Angerami, Adriana F C F; Gonçales, Eduardo S L; Tozzo, Raquel; Pavan, Maria H P; Gonçales, Neiva S L
2010-07-20
More than 50% of hepatitis C viruses (HCV)-infected patients do not respond to the classical Interferon (IFN)/Ribavirin (RBV) combination therapy. The aim of this study was to evaluate the efficacy of retreatment with Peg-Interferon alpha-2b (PEG-IFN alpha-2b) plus RBV, in patients with HCV, genotypes 1 or 3, who were non-responders to the previous standard treatment with IFN/RBV. In the period 2005-2007, a total of 238 HCV chronic patients were non-responders to previous treatment with IFN plus RBV. Of these 130 agreed to be retreated with PEG-IFN alpha-2b and participated in this evaluation (90 with genotype 1 HCV and 40 with genotype 3 HCV). Patients were retreated at assisted IFN application hubs in compliance with the country's public health system rules. They received subcutaneous PEG-IFN alpha-2b, 1.5 microg, once weekly, associated with RBV, through the oral route, with doses determined according to weight (1,000 mg if weight
2010-01-01
Background More than 50% of hepatitis C viruses (HCV)-infected patients do not respond to the classical Interferon (IFN)/Ribavirin (RBV) combination therapy. The aim of this study was to evaluate the efficacy of retreatment with Peg-Interferon alpha-2b (PEG-IFN alpha-2b) plus RBV, in patients with HCV, genotypes 1 or 3, who were non-responders to the previous standard treatment with IFN/RBV. Methods In the period 2005-2007, a total of 238 HCV chronic patients were non-responders to previous treatment with IFN plus RBV. Of these 130 agreed to be retreated with PEG-IFN alpha-2b and participated in this evaluation (90 with genotype 1 HCV and 40 with genotype 3 HCV). Patients were retreated at assisted IFN application hubs in compliance with the country's public health system rules. They received subcutaneous PEG-IFN alpha-2b, 1.5 μg, once weekly, associated with RBV, through the oral route, with doses determined according to weight (1,000 mg if weight ≤ 75 kg and 1,250 mg if > 75 kg). Patients with genotype 1 HCV were retreated for over 48 weeks and patients with genotype 3 HCV for over 24 weeks. HCV-RNA was tested by polymerase chain reaction (PCR) at baseline, at week 12, at the end of the treatment, and 6 months thereafter. The predictiveness of week 12 in the development of a sustained virologic response (SVR) was also evaluated. Patients with negative HCV-RNA at week 12 were considered as early virologic responders (EVR). Results EVR was observed in 25% of the patients with genotype 1 HCV and in 64% of the patients genotype 3 HCV (risk = 2.075 and p-value = 0.0414). SVR was observed in 22.2% of the patients with genotype 1 HCV and in 40% with genotype 3 HCV (intention-to-treat analysis). The positive predictive value (PPV) of the HCV-RNA testing at week 12, in order to obtain the SVR, was 65% for genotype 1 and 56% for genotype 3, and the negative predictive value (NPV) was 88% for genotype 1 and 89% for genotype 3. Conclusions PEG-IFN alpha-2b plus weight
Hegazy, Ahmed N; Peine, Michael; Helmstetter, Caroline; Panse, Isabel; Fröhlich, Anja; Bergthaler, Andreas; Flatz, Lukas; Pinschewer, Daniel D; Radbruch, Andreas; Löhning, Max
2010-01-29
Current T cell differentiation models invoke separate T helper 2 (Th2) and Th1 cell lineages governed by the lineage-specifying transcription factors GATA-3 and T-bet. However, knowledge on the plasticity of Th2 cell lineage commitment is limited. Here we show that infection with Th1 cell-promoting lymphocytic choriomeningitis virus (LCMV) reprogrammed otherwise stably committed GATA-3(+) Th2 cells to adopt a GATA-3(+)T-bet(+) and interleukin-4(+)interferon-gamma(+) "Th2+1" phenotype that was maintained in vivo for months. Th2 cell reprogramming required T cell receptor stimulation, concerted type I and type II interferon and interleukin-12 signals, and T-bet. LCMV-triggered T-bet induction in adoptively transferred virus-specific Th2 cells was crucial to prevent viral persistence and fatal immunopathology. Thus, functional reprogramming of unfavorably differentiated Th2 cells may facilitate the establishment of protective immune responses. Stable coexpression of GATA-3 and T-bet provides a molecular concept for the long-term coexistence of Th2 and Th1 cell lineage characteristics in single memory T cells. Copyright 2010 Elsevier Inc. All rights reserved.
Regulation by interferon alpha of immunoglobulin isotype selection and lymphokine production in mice
1991-01-01
Antigens and infectious agents that stimulate interferon alpha(IFN- alpha) production in mice induce antibody responses that are predominantly of the immunoglobulin (Ig)G2a isotype and contain little or no IgE. This suggested the possibility that IFN-alpha might have a role in directing Ig isotype selection. Consistent with this possibility, we have found that injection of mice with recombinant mouse IFN-alpha suppresses IgE secretion, enhances IgG2a secretion, and has no independent effect on IgG1 secretion in mice stimulated with a foreign anti-IgD antibody. Injection of mice with polyinosinic acid.polycytidylic acid (poly I.C), an inducer of macrophage IFN-alpha production, also suppresses the anti-IgD antibody-induced IgE response and stimulates the IgG2a response; these effects are blocked by a sheep antibody that neutralizes mouse IFN-alpha/beta. Both recombinant IFN- alpha and poly I.C have maximum IgE suppressive and IgG2a stimulatory effects when injected early in the anti-IgD antibody-induced immune response. Addition of IFN-alpha to mouse B cells cultured with lipopolysaccharide (LPS) + interleukin 4 (IL-4) suppresses both IgG1 and IgE production, but much less potently than IFN-gamma. IFN-alpha suppresses anti-IgD antibody-induced increases in the level of splenic IL-4 mRNA, but enhances the anti-IgD antibody-induced increase in the splenic level of IFN-gamma mRNA. These results are consistent with the effect of IFN-alpha on Ig isotype expression in mice, as IL-4 stimulates IgE and suppresses IgG2a secretion while IFN-gamma exerts opposite effects. These observations suggest that antigen presenting cells, by secreting IFN-alpha early in the course of an immune response, can influence the nature of that response both through direct effects on B cells and by influencing the differentiation of T cells. PMID:1940796
Treatment of three patients with systemic mastocytosis with interferon alpha-2b.
Worobec, A S; Kirshenbaum, A S; Schwartz, L B; Metcalfe, D D
1996-08-01
It has been reported that the administration of interferon alpha-2b is of potential benefit in the treatment of mastocytosis based on a single patient study (NEJM, Feb 27, 1992, 326(9):619-623). Following this report, we administered interferon alpha-2b at a dose of 4 to 5 million units per square meter of body surface area for at least 12 months to one patient with mastocytosis with an associated hematologic disorder (patient 1), one patient with aggressive systemic mastocytosis (patient 2), and one patient with indolent mastocytosis (patient 3). Patients were monitored with the following clinical and laboratory parameters: serial bone marrow biopsies and aspirates, patient log of histamine release attacks, medication dependency, plasma tryptase levels, serum lactate dehydrogenase (LDH) levels, white blood cell counts and differentials, extent of urticaria pigmentosa lesions, bony involvement, and extent of gastrointestinal involvement and hepatomegaly. We also examined the ability of interferon alpha-2b to inhibit recombinant human stem cell factor (rhSCF)-dependent mast cell proliferation from CD34+ bone marrow-derived cells. All patients demonstrated continued progression of disease in one or more clinical criteria at one year of therapy. Similarly, interferon alpha-2b did not inhibit the culture of mast cells from CD34+ bone marrow-derived cells in the presence of SCF. Thus, in our study of three patients with systemic mastocytosis, treatment with interferon alpha-2b was found to be ineffective in controlling progression of disease.
Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.
Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K
2005-01-20
Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.
Interferon regulatory factors: A key to tumour immunity.
Chen, Yan-Jie; Li, Jing; Lu, Nan; Shen, Xi-Zhong
2017-08-01
Interferon regulatory factors (IRFs), which have 10 members, belong to the transcription factor family and were named because of the regulation of interferon expression. They play important roles in the immune regulation, cell differentiation, cell apoptosis, and cell cycle regulation. This article will review the functional characteristics and immune activity of the family members, especially in the role of cell differentiation and autoimmune diseases. Intensive studies will help uncover the pathogenesis of the disease in a more comprehensive view, and provide novel targets for disease treatment. But the most important problems yet to solve is IRFs function in the development processes of tumour, and whether IRFs can be an important regulator in tumour immune treatment. Copyright © 2017. Published by Elsevier B.V.
EFFECT OF INTERFERON-α ON CORTICAL GLUTAMATE IN PATIENTS WITH HEPATITIS C: A PROTON MRS STUDY
Taylor, Matthew J; Godlewska, Beata; Near, Jamie; Christmas, David; Potokar, John; Collier, Jane; Klenerman, Paul; Barnes, Eleanor; Cowen, Philip J
2013-01-01
Background The development of depressive symptomatology is a recognised complication of treatment with the cytokine, interferon-α, and has been seen as supporting inflammatory theories of the pathophysiology of major depression. Major depression has been associated with changes in glutamatergic activity and recent formulations of interferon-induced depression have implicated neurotoxic influences which could also lead to changes in glutamate function. The present study used magnetic resonance spectroscopy (MRS) to measure both glutamate and its major metabolite, glutamine in patients with hepatitis C who received treatment with pegylated-interferon-α and ribavirin. Methods MRS measurements of glutamate and glutamine were taken from a 25×20×20mm voxel including pregenual anterior cingulate cortex in 12 patients before and after 4-6 weeks treatment with interferon. Results Interferon treatment led to an increase in cortical levels of glutamine (p= 0.02) and a significant elevation in the ratio of glutamine to glutamate (p<.01). Further, changes in glutamine level correlated significantly with ratings of depression and anxiety at the time of the second scan. Conclusions We conclude that treatment with interferon-α is associated with MRS-visible changes in glutamatergic metabolism. However, the changes seen differ from those reported in major depression which suggests that the pathophysiology of interferon-induced depression may be distinct from that of major depression more generally. PMID:23659574
Darwish, Samar F; El-Bakly, Wesam M; El-Naga, Reem N; Awad, Azza S; El-Demerdash, Ebtehal
2015-11-01
Iron-overload is a well-known factor of hepatotoxicity and liver fibrosis, which found to be a common finding among hepatitis C virus patients and related to interferon resistance. We aimed to elucidate the potential antifibrotic effect of deferoxamine; the main iron chelator, and its additional usefulness to interferon-based therapy in concanavalin A-induced immunological model of liver fibrosis. Rats were treated with deferoxamine and/or pegylated interferon-α for 6 weeks. Hepatotoxicity indices, oxidative stress, inflammatory and liver fibrosis markers were assessed. Concanavalin A induced a significant increase in hepatotoxicity indices and lipid peroxidation accompanied with a significant depletion of total antioxidant capacity, glutathione level and superoxide dismutase activity. Besides, it increased CD4(+) T-cells content and the downstream inflammatory cascades, including NF-κB, TNF-α, iNOS, COX-2, IL-6 and IFN-γ. Furthermore, α-SMA, TGF-β1 and hydroxyproline were increased markedly, which confirmed by histopathology. Treatment with either deferoxamine or pegylated interferon-α alone reduced liver fibrosis markers significantly and improved liver histology. However, some of the hepatotoxicity indices and oxidative stress markers did not improve upon pegylated interferon-α treatment alone, besides the remarkable increase in IL-6. Combination therapy of deferoxamine with pegylated interferon-α further improved all previous markers, ameliorated IL-6 elevation, as well as increased hepcidin expression. In conclusion, our study provides evidences for the potent antifibrotic effects of deferoxamine and the underlying mechanisms that involved attenuating oxidative stress and subsequent inflammatory cascade, as well as the production of profibrogenic factors. Addition of deferoxamine to interferon regimen for HCV patients may offer a promising adjuvant modality to enhance therapeutic response. Copyright © 2015 Elsevier Inc. All rights reserved.
MHC class I, beta2 microglobulin, and the INF-gamma receptor are upregulated in aged motoneurons.
Edström, Erik; Kullberg, Susanna; Ming, Yu; Zheng, Huaiyu; Ulfhake, Brun
2004-12-15
During aging, spinal cord motoneurons show characteristic changes including the loss of afferent boutons, a selective process that associates with gliosis and behavioral motor impairment. Evidence suggests that the major histocompatibility complex Class I (MHC I) system may be involved in synaptic plasticity of neurons during development and regeneration. In search of a mechanism governing senescent changes in synaptic connectivity, we report evidence for increased expression of MHC I and beta2 microglobulin (beta2M) in motoneurons and glial-like profiles of 30-month-old rats. The regulatory signal(s) for MHC I expression in normal neurons remains unresolved but among tentative molecules are cytokines such as interferon-gamma (INF-gamma) and tumor necrosis factor alpha (TNF-alpha). Interestingly, aged motoneurons, overlapping with those showing increased levels of MHC I, contained increased levels of INF-gamma receptor message. INF-gamma mRNA was detected at low levels in most (8/9) of the aged spinal cords but only infrequently (2/9) in young adult spinal cords; however, the cellular localization of INF-gamma mRNA could not be determined. Our data also indicates that TNF-alpha is upregulated in the senescent spinal cord but that TNF-alpha immunoreactive protein does not associate with motoneurons. We report evidence for an increased expression of MHC I and beta2M in senescent spinal motoneurons and discuss the possibility that this regulation associates with INF-gamma or changes in neurotrophin signaling and neuron activity in senescence. (c) 2004 Wiley-Liss, Inc.
Testing the Isotropic Universe Using the Gamma-Ray Burst Data of Fermi/GBM
NASA Astrophysics Data System (ADS)
Řípa, Jakub; Shafieloo, Arman
2017-12-01
The sky distribution of gamma-ray bursts (GRBs) has been intensively studied by various groups for more than two decades. Most of these studies test the isotropy of GRBs based on their sky number density distribution. In this work, we propose an approach to test the isotropy of the universe through inspecting the isotropy of the properties of GRBs such as their duration, fluences, and peak fluxes at various energy bands and different timescales. We apply this method on the Fermi/Gamma-ray Burst Monitor (GBM) data sample containing 1591 GRBs. The most noticeable feature we found is near the Galactic coordinates l≈ 30^\\circ , b≈ 15^\\circ , and radius r≈ 20^\\circ {--}40^\\circ . The inferred probability for the occurrence of such an anisotropic signal (in a random isotropic sample) is derived to be less than a percent in some of the tests while the other tests give results consistent with isotropy. These are based on the comparison of the results from the real data with the randomly shuffled data samples. Considering the large number of statistics we used in this work (some of which are correlated with each other), we can anticipate that the detected feature could be a result of statistical fluctuations. Moreover, we noticed a considerably low number of GRBs in this particular patch, which might be due to some instrumentation or observational effects that can consequently affect our statistics through some systematics. Further investigation is highly desirable in order to clarify this result, e.g., utilizing a larger future Fermi/GBM data sample as well as data samples of other GRB missions and also looking for possible systematics.
Fink, Annette; Lemmermann, Niels A W; Gillert-Marien, Dorothea; Thomas, Doris; Freitag, Kirsten; Böhm, Verena; Wilhelmi, Vanessa; Reifenberg, Kurt; Reddehase, Matthias J; Holtappels, Rafaela
2012-11-01
Cytomegalovirus (CMV) disease with multiple organ manifestations is the most feared viral complication limiting the success of hematopoietic cell transplantation as a therapy of hematopoietic malignancies. A timely endogenous reconstitution of CD8 T cells controls CMV infection, and adoptive transfer of antiviral CD8 T cells is a therapeutic option to prevent CMV disease by bridging the gap between an early CMV reactivation and delayed endogenous reconstitution of protective immunity. Preclinical research in murine models has provided 'proof of concept' for CD8 T-cell therapy of CMV disease. Protection by CD8 T cells appears to be in conflict with the finding that CMVs encode proteins that inhibit antigen presentation to CD8 T cells by interfering with the constitutive trafficking of peptide-loaded MHC class I molecules (pMHC-I complexes) to the cell surface. Here, we have systematically explored antigen presentation in the presence of the three currently noted immune evasion proteins of murine CMV in all possible combinations and its modulation by pre-treatment of cells with interferon-gamma (IFN-γ). The data reveal improvement in antigen processing by pre-treatment with IFN-γ can almost overrule the inhibitory function of immune evasion molecules in terms of pMHC-I expression levels capable of triggering most of the specific CD8 T cells, though the intensity of stimulation did not retrieve their full functional capacity. Notably, an in vivo conditioning of host tissue cells with IFN-γ in adoptive cell transfer recipients constitutively overexpressing IFN-γ (B6-SAP-IFN-γ mice) enhanced the antiviral efficiency of CD8 T cells in this transgenic cytoimmunotherapy model.
Martín, V; Pascual, E; Avia, M; Rangel, G; de Molina, A; Alejo, A; Sevilla, N
2016-01-06
Ovine interferon tau (IFN-τ) is a unique type I interferon with low toxicity and a broad host range in vivo. We report the generation of a nonreplicative recombinant adenovirus expressing biologically active IFN-τ. Using the B6.A2G-Mx1 mouse model, we showed that single-dose intranasal administration of recombinant Ad5-IFN-τ can effectively prevent lethality and disease induced by highly virulent hv-PR8 influenza virus by activating the interferon response and preventing viral replication. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Haemolytic anaemia to the alpha-interferon treatment: a proposed mechanism.
Barbolla, L; Paniagua, C; Outeiriño, J; Prieto, E; Sánchez Fayos, J
1993-01-01
Auto-immune haemolytic anaemia (AIHA) has been found in a case of alpha-interferon treatment. Serum antibody and eluate were positive in the absence of the drug. Although the patient recovered after the treatment was stopped, DAGT remained positive for at least 8 months. The mechanism proposed to explain why this drug induced AIHA is similar to that proposed for alpha-methyl-dopa. Drugs could alter the red cell membrane and impair the immune system. Such changes have been observed with alpha-interferon and were related with increased autoimmunity.
Z{gamma}{gamma}{gamma} {yields} 0 Processes in SANC
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bardin, D. Yu., E-mail: bardin@nu.jinr.ru; Kalinovskaya, L. V., E-mail: kalinov@nu.jinr.ru; Uglov, E. D., E-mail: corner@nu.jinr.ru
2013-11-15
We describe the analytic and numerical evaluation of the {gamma}{gamma} {yields} {gamma}Z process cross section and the Z {yields} {gamma}{gamma}{gamma} decay rate within the SANC system multi-channel approach at the one-loop accuracy level with all masses taken into account. The corresponding package for numeric calculations is presented. For checking of the results' correctness we make a comparison with the other independent calculations.
Sneaky Gamma-Rays: Using Gravitational Lensing to Avoid Gamma-Gamma-Absorption
NASA Astrophysics Data System (ADS)
Boettcher, Markus; Barnacka, Anna
2014-08-01
It has recently been suggested that gravitational lensing studies of gamma-ray blazars might be a promising avenue to probe the location of the gamma-ray emitting region in blazars. Motivated by these prospects, we have investigated potential gamma-gamma absorption signatures of intervening lenses in the very-high-energy gamma-ray emission from lensedblazars. We considered intervening galaxies and individual stars within these galaxies. We find that the collective radiation field of galaxies acting as sources of macrolensing are not expected to lead to significant gamma-gamma absorption. Individual stars within intervening galaxies could, in principle, cause a significant opacity to gamma-gamma absorption for VHE gamma-rays if the impact parameter (the distance of closest approach of the gamma-ray to the center of the star) is small enough. However, we find that the curvature of the photon path due to gravitational lensing will cause gamma-ray photons to maintain a sufficiently large distance from such stars to avoid significant gamma-gamma absorption. This re-inforces the prospect of gravitational-lensing studies of gamma-ray blazars without interference due to gamma-gamma absorption due to the lensing objects.
Yoneto, Toshihiko; Yoshimoto, Takayuki; Wang, Chrong-Reen; Takahama, Yasuhiro; Tsuji, Moriya; Waki, Seiji; Nariuchi, Hideo
1999-01-01
We have examined the roles of gamma interferon (IFN-γ), nitric oxide (NO), and natural killer (NK) cells in the host resistance to infection with the blood-stage malarial parasite Plasmodium berghei XAT, an irradiation-induced attenuated variant of the lethal strain P. berghei NK65. Although the infection with P. berghei XAT enhanced NK cell lytic activity of splenocytes, depletion of NK1.1+ cells caused by the treatment of mice with anti-NK1.1 antibody affected neither parasitemia nor IFN-γ production by their splenocytes. The P. berghei XAT infection induced a large amount of NO production by splenocytes during the first peak of parasitemia, while P. berghei NK65 infection induced a small amount. Unexpectedly, however, mice deficient in inducible nitric oxide synthase (iNOS−/−) cleared P. berghei XAT after two peaks of parasitemia were observed, as occurred for wild-type control mice. Although the infected iNOS−/− mouse splenocytes did not produce a detectable level of NO, they produced an amount of IFN-γ comparable to that produced by wild-type control mouse splenocytes, and treatment of these mice with neutralizing anti-IFN-γ antibody led to the progression of parasitemia and fatal outcome. CD4−/− mice infected with P. berghei XAT could not clear the parasite, and all these mice died with apparently reduced IFN-γ production. Furthermore, treatment with carrageenan increased the susceptibility of mice to P. berghei XAT infection. These results suggest that neither NO production nor NK cell activation is critical for the resistance to P. berghei XAT infection and that IFN-γ plays an important role in the elimination of malarial parasites, possibly by the enhancement of phagocytic activity of macrophages. PMID:10225894
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duffó, Gustavo, E-mail: duffo@cnea.gov.ar; Consejo Nacional de Investigaciones Científicas y Técnicas; Universidad Nacional de San Martín, Av. Gral. Paz 1499, 1650 San Martín, Buenos Aires
2015-08-15
The accelerated corrosion by the impressed current technique is widely used in studies of concrete durability since it has the advantage that tests can be carried out within reasonable periods of time. In the present work the relationship between the applied current density and the resulting damage on the reinforcing steel, by applying optical microscopy, scanning electron microscopy, gamma-ray radiography and gravimetric measurements, was studied by means of the implementation of accelerated corrosion tests on reinforced mortar. The results show that the efficiency of the applied current is between 1 and 77%, regardless of the applied current density, the water/cementmore » ratio and the mortar cover depth of the specimens. The results show the applicability of the gamma-ray radiography technique to detect localized corrosion of steel rebars in laboratory specimens.« less
Conrad, Curdin; Di Domizio, Jeremy; Mylonas, Alessio; Belkhodja, Cyrine; Demaria, Olivier; Navarini, Alexander A; Lapointe, Anne-Karine; French, Lars E; Vernez, Maxime; Gilliet, Michel
2018-01-02
Although anti-tumor necrosis factor (TNF) agents are highly effective in the treatment of psoriasis, 2-5% of treated patients develop psoriasis-like skin lesions called paradoxical psoriasis. The pathogenesis of this side effect and its distinction from classical psoriasis remain unknown. Here we show that skin lesions from patients with paradoxical psoriasis are characterized by a selective overexpression of type I interferons, dermal accumulation of plasmacytoid dendritic cells (pDC), and reduced T-cell numbers, when compared to classical psoriasis. Anti-TNF treatment prolongs type I interferon production by pDCs through inhibition of their maturation. The resulting type I interferon overexpression is responsible for the skin phenotype of paradoxical psoriasis, which, unlike classical psoriasis, is independent of T cells. These findings indicate that paradoxical psoriasis represents an ongoing overactive innate inflammatory process, driven by pDC-derived type I interferon that does not lead to T-cell autoimmunity.
Bernitz, Netanya; Clarke, Charlene; Roos, Eduard O; Goosen, Wynand J; Cooper, David; van Helden, Paul D; Parsons, Sven D C; Miller, Michele A
2018-02-01
African buffaloes (Syncerus caffer) are wildlife maintenance hosts of Mycobacterium bovis, the cause of bovine tuberculosis. Consequently, M. bovis infected buffaloes pose a transmission risk for cattle and other wildlife species. Previously, a modification to the Qiagen QuantiFERON ® -TB Gold (QFT) system, using QFT tubes and an in-house bovine interferon-gamma (IFN-γ) ELISA, was evaluated for the detection of M. bovis infection in buffaloes. Subsequently, Qiagen has developed a commercially available cattletype ® IFN-gamma ELISA for the detection of antigen-specific IFN-γ release in ruminants. The aim of this study was to investigate the use of QFT tubes and the cattletype ® IFN-gamma ELISA, in a cattletype IFN-γ release assay (IGRA), to detect M. bovis infection in African buffaloes. The test agreements between the cattletype IGRA, single comparative intradermal skin test (SCITT) and Bovigam ® 1G IGRA in two M. bovis-exposed buffalo populations (n = 134 and n = 92) were calculated and κ coefficients ranged from 0.65 (95% CI 0.48-0.82) to 0.86 (95% CI 0.72-0.99). Increasing the QFT incubation time in one M. bovis-exposed buffalo cohort (n = 92), from 20 to 40 h, had no effect on the cattletype IGRA test results. Inter-assay and intra-assay reproducibility determination for the cattletype IGRA produced coefficient of variations (CV) <9.1% and <1.7%, respectively. A total of 21/21 known M. bovis-unexposed buffaloes tested negative in the cattletype IGRA. Moreover, the cattletype IGRA test result values were significantly greater for 13 M. bovis culture-positive buffaloes compared with 14 M. bovis-exposed culture-negative (P < .01) and 21 M. bovis-unexposed (P < .001) buffaloes, respectively. These findings suggest that the combination of QFT tubes and the cattletype ® IFN-gamma ELISA is a promising new diagnostic assay for the detection of M. bovis infection in African buffaloes. However, further research is needed to evaluate the
A Platinum-Enriched gamma+gamma' Two-Phase Bond Coat on Ni-Base Superalloys
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Ying; Pint, Bruce A; Haynes, James A
2005-01-01
Pt-enriched {gamma} + {gamma}{prime} two-phase coating was applied to directionally-solidified Ni-based superalloy Ren{acute e} 142 substrates with three different Hf levels (0.02, 0.76, and 1.37 wt.%). The coating was prepared by electroplating a thin layer of Pt on the superalloy followed by a diffusion treatment. The as-deposited coating exhibited a {gamma} + {gamma}{prime} two-phase microstructure with a major composition of Ni-16Al-18Pt-7Cr-9Co (in at.%) along with some incorporation of refractory elements from the substrates. Cyclic oxidation testing at 1100 C in air indicated improved oxidation resistance of the Ren{acute e} 142 alloys with the Pt-enriched {gamma} + {gamma}{prime} coatings. In addition,more » the oxidation resistance of both uncoated and coated alloys was proportional to the Hf content in the substrate. Compared with the single-phase {beta}-(Ni,Pt)Al coating, slightly higher mass gains and localized spallation were observed on the {gamma} + {gamma}{prime} two-phase coating, which might be due to the segregation of refractory elements and high sulfur levels in these superalloy substrates.« less
Role for herpes simplex virus 1 ICP27 in the inhibition of type I interferon signaling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, Karen E.; Song, Byeongwoon; Knipe, David M.
2008-05-10
Host cells respond to viral infection by many mechanisms, including the production of type I interferons which act in a paracrine and autocrine manner to induce the expression of antiviral interferon-stimulated genes (ISGs). Viruses have evolved means to inhibit interferon signaling to avoid induction of the innate immune response. Herpes simplex virus 1 (HSV-1) has several mechanisms to inhibit type I interferon production, the activities of ISGs, and the interferon signaling pathway itself. We report that the inhibition of the Jak/STAT pathway by HSV-1 requires viral gene expression and that viral immediate-early protein ICP27 plays a role in downregulating STAT-1more » phosphorylation and in preventing the accumulation of STAT-1 in the nucleus. We also show that expression of ICP27 by transfection causes an inhibition of IFN-induced STAT-1 nuclear accumulation. Therefore, ICP27 is necessary and sufficient for at least some of the effects of HSV infection on STAT-1.« less
Hypothyroidism In Hepatitis C Patients On Pegylated Interferon Therapy.
Hameed, Muhammad Asim; Mehmood, Asif; Farooq, Muhammad Ahsan; Tayyab, Ghias Un Nabi; Haq Toor, Israr Ul
2016-01-01
Chronic hepatitis has become a major health problem all over the world especially in the third world countries. The most common cause of chronic hepatitis in Pakistan is hepatitis C which can lead Toliver cirrhosis and hepatocellular carcinoma. In Pakistan Pegylated Interferon Alpha is still corner stone of therapy for chronic hepatitis C. One of the major side effects of this therapy is the development of thyroid dysfunction, i.e., hypothyroidism and hyperthyroidism. This study was done to assess the frequency of hypothyroidism in hepatitis C patients after three months of pegylated interferon therapy. This study was conducted from 1st October 2013 to 31st march 2014 at outpatients department (OPD) of Gastroenterology and Hepatology, Lahore General Hospital Lahore. Descriptive case series study design was used. The sample of 200 patients was taken from the patients who visited OPD and fulfil the inclusion criteria of the study. Serum thyroid stimulating hormone level (TSH) was done before and after completion of three months therapy at centre for Nuclear Medicine (CENUM) laboratory, Mayo Hospital, Lahore by immune-radiometric assay (IRMA) and patients having TSH>4.0 mIU/L (normal range: 0.2-4.0 mIU/L) were considered hypothyroid. The mean age of the patients was 36.29±8.5 years. One hundred and twenty-three (61.5%) were male and 77 (38.5%) were female. After 3 months of interferon therapy, 163 (81.5%) patients were euthyroid and 37(18.5%) patients were having thyroid dysfunction. There were total 29 (14.5%) hypothyroid patients; 8 (27.6%) were male and 21 (72.4%) female. It is concluded from this study that frequency of hypothyroidism in patients with chronic hepatitis C was 14.5% after treatment with pegylated interferon therapy for 3 months. Female patients were more prone to develop hypothyroidism as compared to male patients.
Akahane, Y; Miyazaki, Y; Naitoh, S; Takeda, K; Tsuda, F; Okamoto, H; Itoh, K; Miyakawa, Y; Mayumi, M
1996-02-01
Because of its specific association with hepatitis C virus (HCV) infection, the cold activation of complement is an easy and inexpensive indicator of HCV viremia. It was evaluated for eligibility as a marker of response to interferon in patients with hepatitis C. The cold activation of complement was determined by the loss or decrease of hemolytic activity with the microtitration method in sera that had been stored at 4 degrees C overnight. We observed the loss of hemolytic activity by the cold activation of complement in 236 (72%) and a decrease in 56 (17%) of 327 sera from patients with HCV-associated chronic liver disease, which was much more (p < 0.001) that in 1 (1%) and 13 (14%), respectively, of 49 sera from patients with chronic liver disease associated with hepatitis B virus infection. Interferon-alpha (total dose 516 x 10(6) units) or interferon-alpha 2b (774 x 10(6) units) was given to 67 patients with chronic hepatitis C, of whom 56 had the cold activation of complement. The response to interferon was evaluated by the clearance of serum HCV RNA at 6 months after the completion of therapy. The cold activation of complement disappeared in 18 patients, of whom 15 (86%) responded. It persisted or fluctuated in the remaining 38 patients, only six (16%) of whom responded to interferon (p < 0.001). The cold activation of complement once disappeared at the completion of interferon and then reappeared in patients who relapsed after completing interferon therapy. These results indicate that the cold activation of complement may be associated with the presence of HCV in blood and a lower rate of durable response after completion of interferon therapy.
Janfeshan, Sahar; Yaghobi, Ramin; Eidi, Akram; Karimi, Mohammad Hossein; Geramizadeh, Bita; Malekhosseini, Seyed Ali; Kafilzadeh, Farshid
2017-12-01
Hepatitis B virus, which mainly affects normal liver function, leads to severe acute and chronic hepatitis, resulting in cirrhosis and hepatocellular carcinoma, but can be safely treated after liver transplant. Evaluation of determinative biomarkers may facilitate more effective treatment of posttransplant rejection. Therefore, we investigated interferon regulatory factor 1 expression in hepatitis B virus-infected liver transplant patients with and without previous rejection compared with controls. Hepatitis B virus-infected liver recipients were divided into those with (20 patients) and without a rejection (26 patients), confirmed by pathologic analyses in those who had a rejection. In addition, a healthy control group composed of 13 individuals was included. Expression levels of interferon regulatory factor 1 were evaluated during 3 follow-ups after transplant using an in-house comparative SYBR green real-time polymerase chain reaction method. Statistical analyses were performed with SPSS software (SPSS: An IBM Company, version 16.0, IBM Corporation, Armonk, NY, USA). Modifications of interferon regulatory factor 1 gene expression levels in patient groups with and without rejection were not significant between days 1, 4, and 7 after liver transplant. Interferon regulatory factor 1 mRNA expression levels were down-regulated in patients without rejection versus patients with rejection, although not significantly at day 1 (P = .234) and day 4 (P = .302) but significantly at day 7 (P = .004) after liver transplant. Down-regulation of interferon regulatory factor 1 gene expression in hepatitis B virus patients without rejection emphasized counteraction between hepatitis B virus replication and interferon regulatory factor 1 production. On the other hand, interferon regulatory factor 1 gene overexpression in patients with rejection may result in inflammatory reactions and ischemic-reperfusion injury. Therefore, a better understanding of the association between
Benaiges, D; Garcia-Retortillo, M; Mas, A; Cañete, N; Broquetas, T; Puigvehi, M; Chillarón, J J; Flores-Le Roux, J A; Sagarra, E; Cabrero, B; Zaffalon, D; Solà, R; Pedro-Botet, J; Carrión, J A
2016-01-01
The clinical value of thyrotropin receptor antibodies for the differential diagnosis of thyrotoxicosis induced by pegylated interferon-alpha remains unknown. We analyzed the diagnostic accuracy of thyrotropin receptor antibodies in the differential diagnosis of thyrotoxicosis in patients with chronic hepatitis C (CHC) receiving pegylated interferon-alpha plus ribavirin. Retrospective analysis of 274 patients with CHC receiving pegylated interferon-alpha plus ribavirin. Interferon-induced thyrotoxicosis was classified according to clinical guidelines as Graves disease, autoimmune and non- autoimmune destructive thyroiditis. 48 (17.5%) patients developed hypothyroidism, 17 (6.2%) thyrotoxicosis (6 non- autoimmune destructive thyroiditis, 8 autoimmune destructive thyroiditis and 3 Graves disease) and 22 "de novo" thyrotropin receptor antibodies (all Graves disease, 2 of the 8 autoimmune destructive thyroiditis and 17 with normal thyroid function). The sensitivity and specificity of thyrotropin receptor antibodies for Graves disease diagnosis in patients with thyrotoxicosis were 100 and 85%, respectively. Patients with destructive thyroiditis developed hypothyroidism in 87.5% of autoimmune cases and in none of those with a non- autoimmune etiology (p<0.001). Thyrotropin receptor antibodies determination cannot replace thyroid scintigraphy for the differential diagnosis of thyrotoxicosis in CHC patients treated with pegylated interferon. © Georg Thieme Verlag KG Stuttgart · New York.
Dampened STING-Dependent Interferon Activation in Bats.
Xie, Jiazheng; Li, Yang; Shen, Xurui; Goh, Geraldine; Zhu, Yan; Cui, Jie; Wang, Lin-Fa; Shi, Zheng-Li; Zhou, Peng
2018-03-14
Compared with terrestrial mammals, bats have a longer lifespan and greater capacity to co-exist with a variety of viruses. In addition to cytosolic DNA generated by these viral infections, the metabolic demands of flight cause DNA damage and the release of self-DNA into the cytoplasm. However, whether bats have an altered DNA sensing/defense system to balance high cytosolic DNA levels remains an open question. We demonstrate that bats have a dampened interferon response due to the replacement of the highly conserved serine residue (S358) in STING, an essential adaptor protein in multiple DNA sensing pathways. Reversing this mutation by introducing S358 restored STING functionality, resulting in interferon activation and virus inhibition. Combined with previous reports on bat-specific changes of other DNA sensors such as TLR9, IFI16, and AIM2, our findings shed light on bat adaptation to flight, their long lifespan, and their unique capacity to serve as a virus reservoir. Copyright © 2018 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paessler, Slobodan; Yun, Nadezhda E.; Judy, Barbara M.
2007-10-25
We evaluated the safety and immunogenicity of a chimeric alphavirus vaccine candidate in mice with selective immunodeficiencies. This vaccine candidate was highly attenuated in mice with deficiencies in the B and T cell compartments, as well as in mice with deficient gamma-interferon responsiveness. However, the level of protection varied among the strains tested. Wild type mice were protected against lethal VEEV challenge. In contrast, alpha/beta ({alpha}{beta}) TCR-deficient mice developed lethal encephalitis following VEEV challenge, while mice deficient in gamma/delta ({gamma}{delta}) T cells were protected. Surprisingly, the vaccine potency was diminished by 50% in animals lacking interferon-gamma receptor alpha chain (R1)-chainmore » and a minority of vaccinated immunoglobulin heavy chain-deficient ({mu}MT) mice survived challenge, which suggests that neutralizing antibody may not be absolutely required for protection. Prolonged replication of encephalitic VEEV in the brain of pre-immunized mice is not lethal and adoptive transfer experiments indicate that CD3{sup +} T cells are required for protection.« less
Chicha, Laurie; Jarrossay, David; Manz, Markus G
2004-12-06
Because of different cytokine responsiveness, surface receptor, and transcription factor expression, human CD11c(-) natural type I interferon-producing cells (IPCs) and CD11c(+) dendritic cells were thought to derive through lymphoid and myeloid hematopoietic developmental pathways, respectively. To directly test this hypothesis, we used an in vitro assay allowing simultaneous IPC, dendritic cell, and B cell development and we tested lymphoid and myeloid committed hematopoietic progenitor cells for their developmental capacity. Lymphoid and common myeloid and granulocyte/macrophage progenitors were capable of developing into both functional IPCs, expressing gene transcripts thought to be associated with lymphoid lineage development, and into dendritic cells. However, clonal progenitors for both populations were about fivefold more frequent within myeloid committed progenitor cells. Thus, in humans as in mice, natural IPC and dendritic cell development robustly segregates with myeloid differentiation. This would fit with natural interferon type I-producing cell and dendritic cell activity in innate immunity, the evolutionary older arm of the cellular immune system.
Kuwata, Akiko; Ohashi, Masuo; Sugiyama, Masaya; Ueda, Ryuzo; Dohi, Yasuaki
2002-12-01
A 47-year-old man with renal cell carcinoma underwent nephrectomy, and postoperative chemotherapy was performed with recombinant alpha-interferon. Five years later, he experienced dyspnea during physical exertion. An echocardiogram revealed dilatation and systolic dysfunction of the left ventricle, and thallium-201 myocardial scintigraphy showed diffuse heterogeneous perfusion. We diagnosed congestive heart failure because of cardiomyopathy induced by alpha-interferon therapy. Withdrawal of interferon therapy and the combination of an angiotensin-converting enzyme inhibitor, diuretics, and digitalis improved left ventricular systolic function. Furthermore, myocardial scintigraphy using [123I] beta-methyl-p-iodophenylpentadecanoic acid (123I-BMIPP) or [123 I]metaiodobenzylguanidine (123I-MIBG) revealed normal perfusion after the improvement of congestive heart failure. This is a rare case of interferon-induced cardiomyopathy that resulted in normal myocardial images in 123I-BMIPP and 123I-MIBG scintigrams after withdrawal of interferon therapy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Jeeyun; Im, Young-Hyuck; Jung, Hae Hyun
2005-08-26
The A549 cells, non-small cell lung cancer cell line from human, were resistant to interferon (IFN)-{alpha} treatment. The IFN-{alpha}-treated A549 cells showed increase in protein expression levels of NF-{kappa}B and COX-2. IFN-{alpha} induced NF-{kappa}B binding activity within 30 min and this increased binding activity was markedly suppressed with inclusion of curcumin. Curcumin also inhibited IFN-{alpha}-induced COX-2 expression in A549 cells. Within 10 min, IFN-{alpha} rapidly induced the binding activity of a {gamma}-{sup 32}P-labeled consensus GAS oligonucleotide probe, which was profoundly reversed by curcumin. Taken together, IFN-{alpha}-induced activations of NF-{kappa}B and COX-2 were inhibited by the addition of curcumin in A549more » cells.« less
Peng, X M; Lei, R X; Gu, L; Ma, H H; Xie, Q F; Gao, Z L
2007-10-01
The influence of human genetics on the natural history of hepatitis B virus (HBV) infection may be diminished in endemic areas because infection at a young age predisposes to chronic HBV infection. The present study aimed to address this issue through the determination of the influences of single nucleotide polymorphisms (SNPs) of myxovirus resistence-1 (MxA) -88 G/T and interferon (IFN)-gamma +874 A/T on the natural history of HBV infection in endemic regions. One hundred adult patients with self-limiting HBV infection (positive for both anti-HBs and anti-HBc) and 340 adult patients with persistent HBV infection were recruited from southern China, an endemic area with an HBsAg carrier rate of 17.8%. SNPs of MxA -88 G/T and interferon (IFN)-gamma +874 A/T were typed using a protocol based on competitively differentiated polymerase chain reaction. A highly significant difference in the distribution of MxA -88 G/T was observed between those with persistent and self-limiting HBV infections. The latter displayed a lower frequency of the GG genotype (41.0% vs. 52.9%, P = 0.036) and a higher frequency of the TT genotype (16.0% vs. 2.4%, P = 0.000), compared to patients with persistent infection. These differences were not gender- or age-specific. However, a significant distribution difference of IFN-gamma +874 A/T was not observed. Between two groups of patients, respectively, the distribution frequencies of the AA genotype (65.0% vs. 72.8%, P = 0.139) and the TT genotype (2.0% vs. 1.2%, P = 0.894) were found. These results suggest that MxA gene -88 G/T and IFN-gamma +874 A/T behave differently in endemic HBV infections. Further study is necessary to clarify the influences of human genetics on endemic HBV infections.
Distinct interferon-gamma and interleukin-9 expression in cutaneous and oral lichen planus.
Weber, B; Schlapbach, C; Stuck, M; Simon, H-U; Borradori, L; Beltraminelli, H; Simon, D
2017-05-01
Cutaneous (CLP) and oral lichen planus (OLP) as the main subtypes of lichen planus (LP) present with different clinical manifestation and disease course, although their histopathologic features such as the band-like lymphocyte infiltrate and keratinocyte apoptosis are similar. So far, the underlying cellular and molecular mechanisms remain poorly understood. The aim of this study was to characterize and compare the in situ cellular infiltrates, cytokine expression profiles and apoptosis markers in CLP and OLP. Using immunofluorescence staining and laser scanning microscopy, we evaluated the cellular infiltrate (CD1a, CD3, CD4, CD8, CD21, CD57, CD123), cytokine expression (interleukin (IL)-1, IL-6, IL-9, IL-10, IL-17, IL-22, IL-23, tumour necrosis factor-α, transforming growth factor-β, interferon (IFN)-γ), and apoptosis markers (Fas, Fas ligand, cleaved caspase-3, TUNEL) of 21 anonymized biopsy specimens of LP (11 CLP, 10 OLP). Among infiltrating cells mainly T cells and natural killer (NK) cells as well as plasmacytoid dendritic cells (DC) were observed. A predominance of CD8+ T cells was noted in OLP. In both CLP and OLP, T helper (Th)1, Th9, Th17, and Th22-type cytokines were expressed. The expression of IL-9, IFN-γ and IL-22 was higher in CLP compared to that of OLP (P = 0.0165; P = 0.0016; P = 0.052 respectively). Expression of Fas and Fas ligand as well as cleaved caspase-3-positive cells was observed in the epithelium of all LP samples. The cell and cytokine patterns of CLP and OLP were partially distinct and generally resembled those reported for autoimmune diseases. The presence of CD8+ and NK cells as well as Fas/Fas ligand expression suggested that various pathways involved in keratinocyte apoptosis are relevant for LP. These results might help to establish targeted therapies for LP. © 2016 European Academy of Dermatology and Venereology.
Gamma-Ray Pulse Tube Cooler Development and Testing
NASA Technical Reports Server (NTRS)
Ross, R.; Johnson, D.; Kotsubo, V.; Evtimov, B.; Olson, J.; Nast, T.; Rawlings, R.
2000-01-01
For a variety of space-science applications, such as gamma-ray spectroscopy, the introduction of cryogenic cooling via a cryocooler can greatly increase the potential science return by allowing the use of more sensitive and lower noise detectors.
King, Thomas C; Upfal, Mark; Gottlieb, Andrew; Adamo, Philip; Bernacki, Edward; Kadlecek, Chris P; Jones, Jeffrey G; Humphrey-Carothers, Frances; Rielly, Albert F; Drewry, Pamela; Murray, Kathy; DeWitt, Marcie; Matsubara, Janet; O'Dea, Louis; Balser, John; Wrighton-Smith, Peter
2015-08-01
Interferon-γ release assays have significant advantages over tuberculin skin testing in many clinical situations. However, recent studies have called into question their reliability in serial testing of healthcare workers because of reportedly high rates of positivity and high conversion/reversion rates on retesting. To define the performance characteristics of the T-SPOT.TB test, an interferon-γ release assay, during serial screening programs of healthcare workers at 19 U.S. hospitals. A total of 42,155 T-SPOT.TB test results from healthcare workers at 19 geographically diverse hospitals obtained for routine tuberculosis screening programs were analyzed to determine the rates of positivity, reversion, and conversion in serial testing data. In 19,630 evaluable serial pairs from 16,076 healthcare workers, the mean test positivity rate was 2.3% (range, 0.0-27.4%). The mean conversion rate was 0.8% (range, 0.0-2.5%), and the mean reversion rate was 17.6%. Positivity and conversion rates correlated with known tuberculosis risk factors including age and sex. The observed specificity of the T-SPOT.TB test was at least 98.6%. The high concordance and test completion rates in this study suggest that the T-SPOT.TB test is a reliable tool for healthcare worker serial screening. As expected, the observed positivity rates were lower compared with the tuberculin skin test, likely reflecting the higher specificity of this test. Furthermore, the observed rates of conversion were low and significantly correlated with the geographic incidence of tuberculosis. Our findings suggest that the T-SPOT.TB test is an accurate and reliable way to screen healthcare workers.
NASA Technical Reports Server (NTRS)
Whittenberger, J. D.; Wirth, G.
1982-01-01
A simple ternary gamma/gamma-prime-alpha alloy of nominal composition (wt-%) Ni-32Mo-6Al has been directionally solidified at 17 mm/h and tested in creep rupture at 1073, 1173, and 1273 K. A uniform microstructure consisting of square-shaped Mo fibers in a gamma + gamma-prime matrix was found despite some variation in the molybdenum and aluminum concentrations along the growth direction. Although the steady-state creep rate is well described by the normal stress temperature equation, the stress exponent (12) and the activation energy (580 kJ/mol) are high. The rupture behavior is best characterized by the Larson-Miller parameter where the constant equals 20.
Patterson, Michael; Seregin, Alexey; Huang, Cheng; Kolokoltsova, Olga; Smith, Jennifer; Miller, Milagros; Smith, Jeanon; Yun, Nadezhda; Poussard, Allison; Grant, Ashley; Tigabu, Bersabeh; Walker, Aida; Paessler, Slobodan
2014-02-01
Machupo virus (MACV) is the etiological agent of Bolivian hemorrhagic fever (BHF), a reemerging and neglected tropical disease associated with high mortality. The prototypical strain of MACV, Carvallo, was isolated from a human patient in 1963, but minimal in vitro and in vivo characterization has been reported. To this end, we utilized reverse genetics to rescue a pathogenic MACV from cloned cDNAs. The recombinant MACV (rMACV) had in vitro growth properties similar to those of the parental MACV. Both viruses caused similar disease development in alpha/beta and gamma interferon receptor knockout mice, including neurological disease development and high mortality. In addition, we have identified a novel murine model with mortality and neurological disease similar to BHF disease reported in humans and nonhuman primates.
Ren, Hongyu; Li, Yuhong; Jiang, Han; Du, Minquan
2016-11-01
A number of studies recently revealed a link between periodontal disease and preterm birth (PTB). PTB can be induced by dental infection with Porphyromonas gingivalis (Pg), a periodontopathic bacterium. This study aims to investigate responses of human extravillous trophoblast-derived HTR8/SVneo cells to Pg infection. Cell apoptosis, cell viability, protein expression, and cytokine production in HTR8 cells were measured via: 1) flow cytometry, 2) CCK-8 assay, 3) western blot, and 4) enzyme-linked immunosorbent assay methods, respectively. Pg decreased cell viability and increased cell apoptosis, active caspase-3 and Fas expression, and interferon-gamma (IFN-γ) secretion in HTR8 cells. Extracellular signal-regulated kinase (ERK) 1/2 inhibitor U0126 and FasL neutralizing antibody NOK1 that blocks FasL/Fas interaction both significantly suppressed Pg-induced apoptosis. U0126 also inhibited IFN-γ secretion and Fas expression close to control levels. Moreover, treatment with recombinant IFN-γ also significantly decreased number of viable HTR8 cells and increased Fas expression, suggesting IFN-γ may play an important role in Pg-induced apoptosis of HTR8 cells, at least partially through regulation of Fas expression. To the best of the authors' knowledge, this is the first study to demonstrate Pg induces IFN-γ secretion, Fas expression, and apoptosis in human extravillous trophoblast-derived HTR8/SVneo cells in an ERK1/2-dependent manner, and IFN-γ (explored by recombinant IFN-γ) and Fas are involved in Pg-induced apoptosis. The finding that Pg infection abnormally regulates inflammation and apoptosis of human trophoblasts may give new insights into the possible link of PTB with maternal periodontal disease and periodontal pathogens.
Paessler, Slobodan; Yun, Nadezhda E.; Judy, Barbara M.; Dziuba, Natallia; Zacks, Michele A.; Grund, Anna H.; Frolov, Ilya; Campbell, Gerald A.; Weaver, Scott C.; Estes, D. Mark
2007-01-01
We evaluated the safety and immunogenicity of a chimeric alphavirus vaccine candidate in mice with selective immunodeficiencies. This vaccine candidate was highly attenuated in mice with deficiencies in the B and T cell compartments, as well as in mice with deficient gamma-interferon responsiveness. However, the level of protection varied among the strains tested. Wild type mice were protected against lethal VEEV challenge. In contrast, alpha/beta (αβ) TCR-deficient mice developed lethal encephalitis following VEEV challenge, while mice deficient in gamma/delta ( γδ) T cells were protected. Surprisingly, the vaccine potency was diminished by 50% in animals lacking interferon-gamma receptor alpha chain (R1)-chain and a minority of vaccinated immunoglobulin heavy chain-deficient (μMT) mice survived challenge, which suggests that neutralizing antibody may not be absolutely required for protection. Prolonged replication of encephalitic VEEV in the brain of pre-immunized mice is not lethal and adoptive transfer experiments indicate that CD3+ T cells are required for protection. PMID:17610927
DOE Office of Scientific and Technical Information (OSTI.GOV)
Achasov, N. N., E-mail: achasov@math.nsc.ru
2011-03-15
The approach to the Z {yields} {gamma}{psi} and Z {yields} {gamma}Y decay study is presented in detail, based on the sum rules for the Z {yields} cc-bar {yields} {gamma}{gamma}* and Z {yields} bb-bar {yields} {gamma}{gamma}* amplitudes and their derivatives. The branching ratios of the Z {yields} {gamma}{psi} and Z {yields} {gamma}Y decays are calculated for different hypotheses on saturation of the sum rules. The lower bounds of {Sigma}{sub {psi}} BR(Z {yields} {gamma}{psi}) = 1.95 Multiplication-Sign 10{sup -7} and {Sigma}{sub {upsilon}} BR(Z {yields} {gamma}Y) = 7.23 Multiplication-Sign 10{sup -7} are found. Deviations from the lower bounds are discussed, including the possibilitymore » of BR(Z {yields} {gamma}J/{psi}(1S)) {approx} BR(Z {yields} {gamma}Y(1S)) {approx} 10{sup -6}, that could be probably measured in LHC. The angular distributions in the Z {yields} {gamma}{psi} and Z {yields} {gamma}Y decays are also calculated.« less
Makino, Mitsuhiro; Kitano, Yutaka; Komiyama, Chika; Hirohashi, Masaaki; Takasuna, Kiyoshi
2000-01-01
We investigated the mechanism by which human interferon-α (IFN-α) increases the immobility time in a forced swimming test, an animal model of depression.Central administration of IFN-α (0.05–50 IU per mouse, i.cist.) increased the immobility time in the forced swimming test in mice in a dose-dependent manner.Neither IFN-β nor -γ possessed any effect under the same experimental conditions.Pre-treatment with an opioid receptor antagonist, naloxone (1 mg kg−1, s.c.) inhibited the prolonged immobility time induced by IFN-α (60 KIU kg−1, i.v. or 50 IU per mouse. i.cist.).Peripheral administration of naloxone methiodide (1 mg kg−1, s.c.), which does not pass the blood–brain barrier, failed to block the effect of IFN-α, while intracisternal administration of naloxone methiodide (1 nmol per mouse) completely blocked.The effect of IFN-α was inhibited by a μ1-specific opioid receptor antagonist, naloxonazine (35 mg kg−1, s.c.) and a μ1/μ2 receptor antagonist, β-FNA (40 mg kg−1, s.c.). A selective δ-opioid receptor antagonist, naltrindole (3 mg kg−1, s.c.) and a κ-opioid receptor antagonist, nor-binaltorphimine (20 mg kg−1, s.c.), both failed to inhibit the increasing effect of IFN-α.These results suggest that the activator of the central opioid receptors of the μ1-subtype might be related to the prolonged immobility time of IFN-α, but δ and κ-opioid receptors most likely are not involved. PMID:10903965
Montanuy, Imma; Alejo, Ali; Alcami, Antonio
2011-01-01
Eradication of smallpox was accomplished 30 yr ago, but poxviral infections still represent a public health concern due to the potential release of variola virus or the emergence of zoonotic poxviruses, such as monkeypox virus. A critical determinant of poxvirus virulence is the inhibition of interferons (IFNs) by the virus-encoded type I IFN-binding protein (IFNα/βBP). This immunomodulatory protein is secreted and has the unique property of interacting with the cell surface in order to prevent IFN-mediated antiviral responses. However, the mechanism of its attachment to the cell surface remains unknown. Using surface plasmon resonance and cell-binding assays, we report that the IFNα/βBP from vaccinia virus, the smallpox vaccine, interacts with cell surface glycosaminoglycans (GAGs). Analysis of the contribution of different regions of the protein to cell surface binding demonstrated that clusters of basic residues in the first immunoglobulin domain mediate GAG interactions. Furthermore, mutation of the GAG-interaction motifs does not affect its IFN-binding and -blocking capacity. Functional conservation of GAG-binding sites is demonstrated for the IFNα/βBP from variola and monkeypox viruses, extending our understanding of immune modulation by the most virulent human poxviruses. These results are relevant for the design of improved vaccines and intervention strategies.—Montanuy, I., Alejo, A., Alcami, A. Glycosaminoglycans mediate retention of the poxvirus type I interferon binding protein at the cell surface to locally block interferon antiviral responses. PMID:21372110
Online fault diagnostics and testing of area gamma radiation monitor using wireless network
NASA Astrophysics Data System (ADS)
Reddy, Padi Srinivas; Kumar, R. Amudhu Ramesh; Mathews, M. Geo; Amarendra, G.
2017-07-01
Periodical surveillance, checking, testing, and calibration of the installed Area Gamma Radiation Monitors (AGRM) in the nuclear plants are mandatory. The functionality of AGRM counting electronics and Geiger-Muller (GM) tube is to be monitored periodically. The present paper describes the development of online electronic calibration and testing of the GM tube from the control room. Two electronic circuits were developed, one for AGRM electronic test and another for AGRM detector test. A dedicated radiation data acquisition system was developed using an open platform communication server and data acquisition software. The Modbus RTU protocol on ZigBee based wireless communication was used for online monitoring and testing. The AGRM electronic test helps to carry out the three-point electronic calibration and verification of accuracy. The AGRM detector test is used to verify the GM threshold voltage and the plateau slope of the GM tube in-situ. The real-time trend graphs generated during these tests clearly identified the state of health of AGRM electronics and GM tube on go/no-go basis. This method reduces the radiation exposures received by the maintenance crew and facilitates quick testing with minimum downtime of the instrument.
Physical principles of neutron-gamma materials monitoring
NASA Astrophysics Data System (ADS)
Pekarskii, G. Sh.
1986-03-01
The physical principles of secondary radiation methods in nondestructive testing are discussed. Among the techniques considered are: neutron activation analysis (NAA); the induced-radiation method; and quasialbedo recording of secondary gamma-radiation. Emphasis is given to the neutron-gamma method which consists of exposing test material to a neutron flux and recording the secondary gamma-radiation by means of a spectrometer. The limitations of the method in detecting local inhomogeneous defects (filled pores cracks, and inclusions) in metal layers and multicomponents materials are described, and some advantages of the method over NAA are discussed. Formulas are derived for estimating the optimum density of the gamma-ray flux which is received by the detector.
Physical principles of neutron-gamma materials monitoring
NASA Astrophysics Data System (ADS)
Pekarskii, G. Sh.
1985-07-01
The physical principles of secondary radiation methods in nondestructive testing are discussed. Among the techniques considered are: neutron activation analysis (NAA); the induced-radiation method; and quasialbedo recording of secondary gamma-radiation. Emphasis is given to the neutron-gamma method which consists of exposing test material to a neutron flux and recording the secondary gamma-radiation by means of a spectrometer. The limitations of the method in detecting local inhomogeneous defects (filled pores cracks, and inclusions) in metal layers and multicomponents materials are described, and some advantages of the method over NAA are discussed. Formulas are derived for estimating the optimum density of the gamma-ray flux which is received by the detector.
Bell's palsy during interferon alpha 2a treatment in a case with Behçet uveitis.
Yalçindağ, Fatime Nilüfer; Alay, Cem
2013-01-01
To present a case who developed Bell's palsy while using interferon alpha 2a for Behçet uveitis. A patient with Behçet disease presented with decreased vision in his right eye. Ophthalmic examination, fundus fluorescein angiography and optical coherence tomography were performed. After developing facial paralysis while on interferon therapy, the patient was referred to our neurology service for differential diagnosis and treatment. Examination of right eye revealed panuveitis with branch retinal vein occlusion, so high dose steroids were prescribed. In three days there was no improvement in terms of vitreous inflammation and so steroids were replaced with interferon. At the seventh month, patient experienced a facial paralysis. After eliminating other causes, including viral infections, trauma, cold exposure and neurological evaluation with cranial MRI, the patient was diagnosed to have Bell's palsy by a neurologist. Interferon was replaced with mycophenolate mofetil and the Bell's palsy was treated with oral steroids. It is important to be alert to both common and rare complications while treating with interferon.
Gamma-Ray, Cosmic Ray and Neutrino Tests of Lorentz Invariance and Quantum Gravity Models
NASA Technical Reports Server (NTRS)
Stecker, Floyd
2011-01-01
High-energy astrophysics observations provide the best possibilities to detect a very small violation of Lorentz invariance such as may be related to the structure of space-time near the Planck scale of approximately 10(exp -35) m. I will discuss here the possible signatures of Lorentz invariance violation (LIV) from observations of the spectra, polarization, and timing of gamma-rays from active galactic nuclei and gamma-ray bursts. Other sensitive tests are provided by observations of the spectra of ultrahigh energy cosmic rays and neutrinos. Using the latest data from the Pierre Auger Observatory one can already derive an upper limit of 4.5 x 10(exp -23) to the amount of LIV of at a proton Lorentz factor of approximately 2 x 10(exp 11). This result has fundamental implications for quantum gravity models. I will also discuss the possibilities of using more sensitive space based detection techniques to improve searches for LIV in the future.
The changing landscape of hepatitis C virus therapy: focus on interferon-free treatment.
Lam, Brian P; Jeffers, Thomas; Younoszai, Zahra; Fazel, Yousef; Younossi, Zobair M
2015-09-01
Chronic hepatitis C (CHC) affects over 185 million individuals worldwide, approximately 3% of the world's population. CHC can lead to quality of life impairment, cirrhosis, hepatocellular carcinoma (HCC), liver failure and liver-related death. While CHC has been associated with increases in HCC, liver-related mortality and all-cause mortality, being cured of CHC is associated with improvement in these outcomes. Older interferon-based regimens were complex and toxic and required 6-12 months of therapy, with cure rates averaging around 40-45% for HCV genotype 1. Newer interferon-free regimens are now available in the US, Europe, Japan and in other countries. These regimens have short durations, minimal side effects, low pill burden and efficacy approaching 90-100%. We may eventually see single-tablet regimens lasting no more than 4-6 weeks. This review will summarize the data regarding these interferon-free regimens, including Gilead's Harvoni (sofosbuvir/ledipasvir), AbbVie's Viekira Pak (paritaprevir/ritonavir/ombitasvir with dasabuvir), and Janssen's Olysio (simeprevir) with sofosbuvir. Some practical considerations as we move into an interferon-free era will also be discussed, such as patient adherence and drug-drug interactions.
The changing landscape of hepatitis C virus therapy: focus on interferon-free treatment
Lam, Brian P.; Jeffers, Thomas; Younoszai, Zahra; Fazel, Yousef
2015-01-01
Chronic hepatitis C (CHC) affects over 185 million individuals worldwide, approximately 3% of the world’s population. CHC can lead to quality of life impairment, cirrhosis, hepatocellular carcinoma (HCC), liver failure and liver-related death. While CHC has been associated with increases in HCC, liver-related mortality and all-cause mortality, being cured of CHC is associated with improvement in these outcomes. Older interferon-based regimens were complex and toxic and required 6–12 months of therapy, with cure rates averaging around 40–45% for HCV genotype 1. Newer interferon-free regimens are now available in the US, Europe, Japan and in other countries. These regimens have short durations, minimal side effects, low pill burden and efficacy approaching 90–100%. We may eventually see single-tablet regimens lasting no more than 4–6 weeks. This review will summarize the data regarding these interferon-free regimens, including Gilead’s Harvoni (sofosbuvir/ledipasvir), AbbVie’s Viekira Pak (paritaprevir/ritonavir/ombitasvir with dasabuvir), and Janssen’s Olysio (simeprevir) with sofosbuvir. Some practical considerations as we move into an interferon-free era will also be discussed, such as patient adherence and drug–drug interactions. PMID:26327920