The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis

DTIC Science & Technology

2017-09-01

AWARD NUMBER: W81XWH-16-1-0537 TITLE: The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis PRINCIPAL INVESTIGATOR: Stanley...Sep 2016 - 31 Aug 2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis 5b...subsets that likely counteracts IL-2 regulator activity and contribute to the pathogenesis of RA. 15. SUBJECT TERMS Rheumatoid arthritis ; Autoimmunity; T

A randomized, double-blind, phase I/II trial of tumor necrosis factor and interferon-gamma for treatment of AIDS-related complex (Protocol 025 from the AIDS Clinical Trials Group).

PubMed

Agosti, J M; Coombs, R W; Collier, A C; Paradise, M A; Benedetti, J K; Jaffe, H S; Corey, L

1992-05-01

To determine safety and efficacy of tumor necrosis factor (TNF) and interferon-gamma (IFN gamma) in the treatment of patients with acquired immunodeficiency syndrome (AIDS)-related complex, a randomized, double-blind study was conducted. Twenty-five patients with AIDS-related complex and CD4 lymphocytes less than or equal to 500 x 10(6)/L attended an AIDS Clinical Trials Unit of a tertiary referral center. Patients were administered tumor necrosis factor (TNF) (10 micrograms/m2) or IFN gamma (10 micrograms/m2), or both intramuscularly three times weekly for 16 weeks. Side effects from all three preparations included fever, constitutional symptoms, and local reactions. No significant hematologic, hepatic, renal, or coagulation abnormalities were observed. CD4 lymphocyte counts, beta 2-microglobulin, p24 antigen levels, and anti-p24 antibody did not change significantly during therapy. Similarly, no significant change was noted in rates of HIV isolation from peripheral blood mononuclear cells or plasma. TNF and IFN gamma were tolerable after premedication with acetaminophen; however, no significant change in markers of human immunodeficiency virus infection was demonstrated. These cytokines alone do not appear to be of benefit, nor do they appear to hasten the progression of HIV infection.

Effect of gamma interferon on resolution of murine chlamydial genital infection.

PubMed Central

Rank, R G; Ramsey, K H; Pack, E A; Williams, D M

1992-01-01

Mice infected in the genital tract with the Chlamydia trachomatis agent of mouse pneumonitis were treated with monoclonal rat anti-gamma interferon (anti-IFN-gamma) antibody to determine whether IFN-gamma participated in the resolution of the infection. In two experiments, anti-IFN-gamma antibody treatment resulted in significantly prolonged infections. In support of these data, passive administration of recombinant IFN-gamma to chronically infected nu/nu mice was able to bring about resolution of the infection in some animals. PMID:1398955

Review of the recombinant human interferon gamma as an immunotherapeutic: Impacts of production platforms and glycosylation.

PubMed

Razaghi, Ali; Owens, Leigh; Heimann, Kirsten

2016-12-20

Human interferon gamma is a cytokine belonging to a diverse group of interferons which have a crucial immunological function against mycobacteria and a wide variety of viral infections. To date, it has been approved for treatment of chronic granulomatous disease and malignant osteopetrosis, and its application as an immunotherapeutic agent against cancer is an increasing prospect. Recombinant human interferon gamma, as a lucrative biopharmaceutical, has been engineered in different expression systems including prokaryotic, protozoan, fungal (yeasts), plant, insect and mammalian cells. Human interferon gamma is commonly expressed in Escherichia coli, marketed as ACTIMMUNE ® , however, the resulting product of the prokaryotic expression system is unglycosylated with a short half-life in the bloodstream; the purification process is tedious and makes the product costlier. Other expression systems also did not show satisfactory results in terms of yields, the biological activity of the protein or economic viability. Thus, the review aims to synthesise available information from previous studies on the production of human interferon gamma and its glycosylation patterns in different expression systems, to provide direction to future research in this field. Copyright © 2016 Elsevier B.V. All rights reserved.

Recent considerations in the use of recombinant interferon gamma for biological therapy of atopic dermatitis.

PubMed

Brar, Kanwaljit; Leung, Donald Y M

2016-01-01

Atopic dermatitis (AD) is the most common inflammatory skin disease in the general population. There are different endophenotypes of AD that likely have a unique immune and molecular basis, such as those who are predisposed to eczema herpeticum, or Staphylococcus aureus infections. In this review, we highlight the endophenotypes of AD where reduced interferon gamma expression may be playing a role. Additionally, we review the potential role of recombinant interferon gamma therapy in the treatment of atopic dermatitis and the particular phenotypes that may benefit from this treatment. Recombinant interferon gamma treatment will likely benefit the pediatric population with AD, as well as those with susceptibilities for skin infections. Future studies are needed to elucidate whether IFN-γ may reduce the prevalence of skin infection in AD.

Tumor necrosis factor alpha mediates resistance to Trypanosoma cruzi infection in mice by inducing nitric oxide production in infected gamma interferon-activated macrophages.

PubMed Central

Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q

1995-01-01

Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147

Alternative activation of STAT1 and STAT3 in response to interferon-gamma.

PubMed

Qing, Yulan; Stark, George R

2004-10-01

Interferon-gamma (IFNgamma) is a pluripotent cytokine whose major biological effects are mediated through a pathway in which STAT1 is the predominant and essential transcription factor. STAT3 can also be activated weakly by IFNgamma, but the mechanism of activation and function of STAT3 as a part of the interferon response are not known. Here we show that STAT3 activation is much stronger and more prolonged in STAT1-null mouse embryo fibroblasts than in wild-type cells. In response to IFNgamma, SRC-family kinases are required to activate STAT3 (but not STAT1) through tyrosine phosphorylation, whereas the receptor-bound kinases JAK1 and JAK2 are required to activate both STATs. Tyrosine 419 of the IFNgamma receptor subunit 1 (IFNGR1) is required to activate both STATs, suggesting that STAT1 and STAT3 compete with each other for the same receptor phosphotyrosine motif. Activated STAT3 can replace STAT1 in STAT1-null cells to drive the transcription of certain genes, for example, socs-3 and c/ebpdelta, which have gamma-activated sequence motifs in their promoters. Work from Ian Kerr's laboratory reveals that the gp130-linked interleukin-6 receptor, which usually activates STAT3 predominantly, activates STAT1 efficiently when STAT3 is absent. Because STAT1 and STAT3 have opposing biological effects (STAT3 is an oncogene, and STAT1 is a tumor suppressor), the reciprocal activation of these two transcription factors in response to IFNgamma or interleukin-6 suggests that their relative abundance, which may vary substantially in different normal cell types, under different conditions or in tumors is likely to have a major impact on how cells behave in response to different cytokines.

Evaluation of gamma interferon (IFN-gamma)-induced protein 10 (IP-10) responses for detection of cattle infected with Mycobacterium bovis: comparisons to IFN-gamma responses

USDA-ARS?s Scientific Manuscript database

Gamma interferon (IFN-gamma)-induced protein 10 (IP-10) has recently shown promise as a diagnostic biomarker of Mycobacterium tuberculosis infection of humans. The aim of the current study was to compare IP-10 and IFN-gamma responses upon Mycobacterium bovis infection in cattle using archived sample...

Inhibited interferon-gamma but normal interleukin-3 production from rats flown on the Space Shuttle

NASA Technical Reports Server (NTRS)

Gould, Cheryl L.; Lyte, Mark; Williams, Joann; Mandel, Adrian D.; Sonnenfeld, Gerald

1987-01-01

Rats were flown on Space Shuttle SL-3 for one week. When spleen cells were removed from these rats and challenged with concanavalin-A, interferon-gamma production was severely inhibited, while interleukin-3 production was unaffected compared to ground-based control rats. These data indicate that there is a defect in interferon-gamma production in rats that have been exposed to spaceflight. This defect could contribute to, and be one reason for, immunosuppression observed after spaceflight.

Interferon Gamma as a Biomarker of Exposure to Enteric Viruses

EPA Science Inventory

Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...

Plasmodium falciparum erythrocyte membrane protein-1 specifically suppresses early production of host interferon-gamma.

PubMed

D'Ombrain, Marthe C; Voss, Till S; Maier, Alexander G; Pearce, J Andrew; Hansen, Diana S; Cowman, Alan F; Schofield, Louis

2007-08-16

Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP-1) is a variable antigen expressed by P. falciparum, the malarial parasite. PfEMP-1, present on the surface of infected host erythrocytes, mediates erythrocyte binding to vascular endothelium, enabling the parasite to avoid splenic clearance. In addition, PfEMP-1 is proposed to regulate host immune responses via interactions with the CD36 receptor on antigen-presenting cells. We investigated the immunoregulatory function of PfEMP-1 by comparing host cell responses to erythrocytes infected with either wild-type parasites or transgenic parasites lacking PfEMP-1. We showed that PfEMP-1 suppresses the production of the cytokine interferon-gamma by human peripheral blood mononuclear cells early after exposure to P. falciparum. Suppression of this rapid proinflammatory response was CD36 independent and specific to interferon-gamma production by gammadelta-T, NK, and alphabeta-T cells. These data demonstrate a parasite strategy for downregulating the proinflammatory interferon-gamma response and further establish transgenic parasites lacking PfEMP-1 as powerful tools for elucidating PfEMP-1 functions.

Interferon-γ Inhibits Ebola Virus Infection.

PubMed

Rhein, Bethany A; Powers, Linda S; Rogers, Kai; Anantpadma, Manu; Singh, Brajesh K; Sakurai, Yasuteru; Bair, Thomas; Miller-Hunt, Catherine; Sinn, Patrick; Davey, Robert A; Monick, Martha M; Maury, Wendy

2015-01-01

Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.

Gamma Interferon-Induced T-Cell Loss in Virulent Mycobacterium avium Infection

PubMed Central

Flórido, Manuela; Pearl, John E.; Solache, Alejandra; Borges, Margarida; Haynes, Laura; Cooper, Andrea M.; Appelberg, Rui

2005-01-01

Infection by virulent Mycobacterium avium caused progressive severe lymphopenia in C57BL/6 mice due to increased apoptosis rates. T-cell depletion did not occur in gamma interferon (IFN-γ)-deficient mice which showed increased T-cell numbers and proliferation; in contrast, deficiency in nitric oxide synthase 2 did not prevent T-cell loss. Although T-cell loss was IFN-γ dependent, expression of the IFN-γ receptor on T cells was not required for depletion. Similarly, while T-cell loss was optimal if the T cells expressed IFN-γ, CD8+ T-cell depletion could occur in the absence of T-cell-derived IFN-γ. Depletion did not require that the T cells be specific for mycobacterial antigen and was not affected by deficiencies in the tumor necrosis factor receptors p55 or p75, the Fas receptor (CD95), or the respiratory burst enzymes or by forced expression of bcl-2 in hematopoietic cells. PMID:15908387

Ionizing radiation potentiates the induction of nitric oxide synthase by interferon-gamma (Ifn-gamma) or Ifn-gamma and lipopolysaccharide in bnl cl.2 murine embryonic liver cells: role of hydrogen peroxide.

PubMed

Yoo, J C; Pae, H O; Choi, B M; Kim, W I; Kim, J D; Kim, Y M; Chung, H T

2000-02-01

The effects of ionizing irradiation on the nitric oxide (NO) production in murine embryonic liver cell line, BNL CL.2 cells, were investigated. Various doses (5-40 Gy) of radiation made BNL CL.2 cells responsive to interferon-gamma alone for the production of NO in a dose-dependent manner. Small amounts of lipopolysaccharide (LPS) or tumor necrosis factor-alpha (TNF-alpha) synergized with IFN-gamma in the production of NO from irradiated BNL CL.2 cells, even though LPS or TNF-alpha alone did not induce NO production from the same cells. Immunoblots showed parallel induction of inducible nitric oxide synthase (iNOS). NO production in irradiated BNL CL.2 cells by IFN-gamma or IFN-gamma plus LPS was decreased by the addition of catalase, suggesting that H(2)O(2) produced by ionizing irradiation primed the cells to trigger NO production in response to IFN-gamma or IFN-gamma plus LPS. Furthermore, the treatment of nongamma-irradiated BNL CL.2 cells with H(2)O(2) made the cells responsive to IFN-gamma or IFN-gamma plus LPS for the production of NO. This study shows that ionizing irradiation has the ability to induce iNOS gene expression in responsive to IFN-gamma via the formation of H(2)O(2) in BNL CL.2 murine embryonic liver cells.

The immunomodulatory effects of interferon-gamma on mature B-lymphocyte responses.

PubMed

Jurado, A; Carballido, J; Griffel, H; Hochkeppel, H K; Wetzel, G D

1989-06-15

Interferon-gamma (IFN-gamma) exerts a broad spectrum of activities which affect the responses of mature B-cells. It strongly inhibits B-cell activation, acts as a B-cell growth factor (BCGF), and also induces final differentiation to immunoglobulin (Ig) production. IFN-gamma is deeply involved in the differential control of isotype expression, as it enhances IgG2a production and suppresses both IgG1 and IgE production. Although it is now possible to draw a general scheme of the effects of IFN-gamma on B-cells, a number of paradoxical results still exist in the field. In this manuscript, different experimental systems are analyzed in an attempt to explain these apparent paradoxes.

Effects of chicken interferon Gamma on Newcastle disease virus vaccine immunogenicity

USDA-ARS?s Scientific Manuscript database

More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFN') during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFN' wit...

Interferon-alpha and interferon-gamma sensitize human tenon fibroblasts to mitomycin-C.

PubMed

Wang, Xiao Yang; Crowston, Jonathan G; Zoellner, Hans; Healey, Paul R

2007-08-01

To investigate the effect of interferon (IFN)-alpha and IFN-gamma pretreatment on mitomycin C (MMC)-induced cell death in human Tenon fibroblasts (HTFs) and the mechanisms by which IFN-alpha and IFN-gamma modulate the susceptibility of HTFs to MMC. HTFs were pretreated with IFN-alpha and IFN-gamma for 48 hours before 5-minute application of 0.4 mg/mL MMC. Cell death after 48 hours was determined by Annexin V/propidium iodide (PI) staining and lactate dehydrogenase (LDH) release assay. Fas, Fas-ligand, and Bcl-2 expression were determined by flow cytometry. Fas associated death domain (FADD), Bax, cytochrome c, and caspase expression were determined by Western blot analysis and immunofluorescence staining. MMC treatment increased cell death and upregulated Fas and FADD expression, but had no effect on Fas-Ligand, Bax, Bcl-2, or cytochrome c. Neither IFN-alpha nor IFN-gamma alone induced HTF death, but each increased cell death 2 days after MMC treatment in a dose-dependent fashion. Combination IFN-alpha and IFN-gamma had a synergistic effect. IFN-alpha and IFN-gamma pretreatment increased Fas expression. Fas upregulation was associated with increased sensitivity to MMC. IFN pretreatment increased procaspase-8, procaspase-9, and procaspase-3 expression, and caspase-3 activation. Caspase-8, caspase-3, and broad caspase inhibitors, but not caspase-9 inhibitor, inhibited MMC-induced cell death in nonpretreated and IFN-pretreated cells. IFN-alpha and IFN-gamma enhance the susceptibility of HTFs to MMC-induced cell death through a Fas-mediated and a caspase-3-dependent pathway. Pretreatment with IFN primed HTFs to MMC, providing a potential means for initially slowing the healing response with IFN and subsequently terminating fibroblast activity through MMC-induced cell death.

Interferon-gamma enhances radiation-induced cell death via downregulation of Chk1

PubMed Central

Kim, Kwang Seok; Choi, Kyu Jin; Bae, Sangwoo

2012-01-01

Interferon-gamma (IFNγ) is a cytokine with roles in immune responses as well as in tumor control. Interferon is often used in cancer treatment together with other therapies. Here we report a novel approach to enhancement of cancer cell killing by combined treatment of IFNγ with ionizing radiation. We found that IFNγ treatment alone in HeLa cells induced phosphorylation of Chk1 in a time- and dose-dependent manner, and resulted in cell arrest. Moreover IFNγ treatment was correlated with attenuation of Chk1 as the treatment shortened protein half-life of Chk1. As Chk1 is an essential cell cycle regulator for viability after DNA damage, attenuation of Chk1 by IFNγ pre-treatment in HeLa cells resulted in increased cell death following ionizing radiation about 2-folds than ionizing radiation treatment alone whereas IFNγ treatment alone had little effect on cell death. X-linked inhibitor of apoptosis-associated factor 1 (XAF1), an IFN-induced gene, seems to partly regulate IFNγ-induced Chk1 destabilization and radiation sensitivity because transient depletion of XAF1 by siRNA prevented IFNγ-induced Chk1 attenuation and partly protected cells from IFNγ-enhanced radiation cell killing. Therefore the results provide a novel rationale to combine IFNγ pretreatment and DNA-damaging anti-cancer drugs such as ionizing radiation to enhance cancer cell killing. PMID:22825336

Interferon-gamma (INF-gamma) release test can detect cutaneous adverse effects to statins.

PubMed

Goldberg, Ilan; Isman, Gila; Shirazi, Idit; Brenner, Sarah

2009-12-01

An increasing number of cutaneous adverse effects are being reported as use of statins becomes more widespread. A study was undertaken to establish the relationship between statin and a cutaneous reaction by the in vitro interferon-gamma (INF-gamma) release test. The lymphocytes of 20 patients with suspected drug-induced skin reaction were incubated with and without the drug. The level of INF-gamma from the supernatant was measured by enzyme-linked immunosorbent assay (ELISA), and the increase calculated. Response was positive in 27 (21.43%) of the 126 drugs. Statin was the only drug with a positive response in 80% of those cases. Nine of 20 patients (45.0%) had complete resolution after discontinuation of the drug; 6 (30.0%) who replaced one drug by another statin had partial or no resolution; and 5 (20.0%) had no resolution despite cessation of statins of all kinds. A positive INF-gamma release test was found in patients who developed skin reactions while taking statins; the test's reliability was strengthened by prompt improvement following elimination of the suspected drug in the majority of patients.

Differential co-promoting activities of alpha, beta and gamma interferons in the murine skin two-stage carcinogenesis model.

PubMed

Reiners, J J; Cantu, A; Thai, G; Pavone, A

1993-03-01

SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed Central

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-01-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-04-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.

Transforming growth factor-beta controls T helper type 1 cell development through regulation of natural killer cell interferon-gamma.

PubMed

Laouar, Yasmina; Sutterwala, Fayyaz S; Gorelik, Leonid; Flavell, Richard A

2005-06-01

Interferon-gamma and interleukin 12 produced by the innate arm of the immune system are important regulators of T helper type 1 (T(H)1) cell development, but signals that negatively regulate their expression remain controversial. Here we show that transforming growth factor-beta (TGF-beta) controlled T(H)1 differentiation through the regulation of interferon-gamma produced by natural killer (NK) cells. Blockade of TGF-beta signaling in NK cells caused the accumulation of a large pool of NK cells secreting copious interferon-gamma, responsible for T(H)1 differentiation and protection from leishmania infection. In contrast, blockade of TGF-beta signaling in dendritic cells did not affect dendritic cell homeostasis or interleukin 12 production, thus indicating a previously undescribed demarcation of the function of TGF-beta in NK cells versus dendritic cells.

Interferon Gamma Messenger RNA Signature in Tumor Biopsies Predicts Outcomes in Patients with Non-Small-Cell Lung Carcinoma or Urothelial Cancer Treated with Durvalumab.

PubMed

Higgs, Brandon W; Morehouse, Christopher; Streicher, Katie L; Brohawn, Philip; Pilataxi, Fernanda; Gupta, Ashok; Ranade, Koustubh

2018-05-01

To identify a predictive biomarker for durvalumab, an anti-programmed death ligand 1 (PD-L1) monoclonal antibody. RNA sequencing of 97 advanced-stage non-small-cell lung carcinoma (NSCLC) biopsies from a nonrandomized phase 1b/2 clinical trial (1108/NCT01693562) were profiled to identify a predictive signature; 62 locally advanced or metastatic urothelial cancer (UC) tumors from the same study were profiled to confirm predictive utility of the signature. Thirty NSCLC patients provided pre- and posttreatment tumors for messenger RNA (mRNA) analysis. NSCLC with ≥25% tumor cells and UC with ≥25% tumor or immune cells stained for PD-L1 at any intensity were scored PD-L1 positive (PD-L1+). Kaplan-Meier and Cox proportional hazards analyses were used to adjust for gender, age, prior therapies, histology, ECOG, liver metastasis, and smoking. Tumor mutation burden (TMB) was calculated using data from The Cancer Genome Atlas (TCGA).  In the NSCLC discovery set, a four-gene interferon gamma (IFNγ)-positive (IFNγ+) signature comprising IFNγ, CD274, LAG3, and CXCL9 was associated with higher overall response rates, longer median progression-free survival, and overall survival compared with signature-low patients. IFNγ+-signature NSCLC patients had improved survival regardless of immunohistochemistry (IHC) PD-L1 status. These associations were replicated in a UC cohort. The IFNγ+ signature was induced twofold (P = 0.003) by durvalumab after 8 weeks of therapy in NSCLC patients, and baseline signature was associated with TMB but not survival in TCGA data.  The IFNγ+ mRNA signature may assist in identifying patients with improved outcomes to durvalumab, independent of PD-L1 assessed by IHC. Copyright ©2018, American Association for Cancer Research.

Enhancement of anticancer effect of interferon-γ gene transfer against interferon-γ-resistant tumor by depletion of tumor-associated macrophages.

PubMed

Kiyota, Tsuyoshi; Takahashi, Yuki; Watcharanurak, Kanitta; Nishikawa, Makiya; Ohara, Saori; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2014-05-05

Tumor-associated macrophages (TAMs) negatively affect the therapeutic effects of anticancer agents. To examine the role of TAMs in interferon (IFN)-γ gene therapy, we selected two types of solid tumors, which varied in the number of TAMs, and investigated the effects of IFN-γ gene transfer on tumor growth. Many TAMs were detected in the solid tumors of murine adenocarcinoma colon-26 cells, whereas few TAMs were detected in murine melanoma B16-BL6 cells. IFN-γ gene transfer hardly suppressed the growth of colon-26 tumors, whereas it was effective in suppressing the growth of B16-BL6 tumors. The antiproliferative effects of IFN-γ on cultured colon-26 cells were similar to those on cultured B16-BL6 cells. To evaluate the role of TAMs, we injected clodronate liposomes (CLs) modified with poly(ethylene glycol) (PEG) to functionally deplete TAMs in tumor-bearing mice. Repeated injections of PEG-CLs significantly retarded the growth of colon-26 tumors and combination with IFN-γ gene transfer further inhibited the growth. In contrast, PEG-CLs hardly retarded the growth of B16-BL6 tumors. These results clearly indicate that TAM depletion is effective in enhancing the therapeutic effect of IFN-γ in TAM-repleted and IFN-γ-resistant tumors.

Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

PubMed

Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

2008-08-01

The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

Clinical and diagnostic developments of a gamma interferon release assay for use in bovine tuberculosis control programs

USDA-ARS?s Scientific Manuscript database

Currently the Bovigam assay is used as an official supplemental test within the bovine tuberculosis eradication program. This assay measures interferon-gamma (IFN-gamma) produced by lymphocytes in response to specific antigens. The objectives of the present study were to evaluate two Mycobacterium ...

Intratumoral Delivery of Interferonγ-Secreting Mesenchymal Stromal Cells Repolarizes Tumor-Associated Macrophages and Suppresses Neuroblastoma Proliferation In Vivo.

PubMed

Relation, Theresa; Yi, Tai; Guess, Adam J; La Perle, Krista; Otsuru, Satoru; Hasgur, Suheyla; Dominici, Massimo; Breuer, Christopher; Horwitz, Edwin M

2018-06-01

Neuroblastoma, the most common extracranial solid tumor in childhood, remains a therapeutic challenge. However, one promising patient treatment strategy is the delivery of anti-tumor therapeutic agents via mesenchymal stromal cell (MSC) therapy. MSCs have been safely used to treat genetic bone diseases such as osteogenesis imperfecta, cardiovascular diseases, autoimmune diseases, and cancer. The pro-inflammatory cytokine interferon-gamma (IFNγ) has been shown to decrease tumor proliferation by altering the tumor microenvironment (TME). Despite this, clinical trials of systemic IFNγ therapy have failed due to the high blood concentration required and associated systemic toxicities. Here, we developed an intra-adrenal model of neuroblastoma, characterized by liver and lung metastases. We then engineered MSCs to deliver IFNγ directly to the TME. In vitro, these MSCs polarized murine macrophages to the M1 phenotype. In vivo, we attained a therapeutically active TME concentration of IFNγ without increased systemic concentration or toxicity. The TME-specific IFNγ reduced tumor growth rate and increased survival in two models of T cell deficient athymic nude mice. Absence of this benefit in NOD SCID gamma (NSG) immunodeficient mouse model indicates a mechanism dependent on the innate immune system. IL-17 and IL-23p19, both uniquely M1 polarization markers, transiently increased in the tumor interstitial fluid. Finally, the MSC vehicle did not promote tumor growth. These findings reveal that MSCs can deliver effective cytokine therapy directly to the tumor while avoiding systemic toxicity. This method transiently induces inflammatory M1 macrophage polarization, which reduces tumor burden in our novel neuroblastoma murine model. Stem Cells 2018;36:915-924. © AlphaMed Press 2018.

Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research

Cancer.gov

Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study

Double-blind trial of recombinant gamma-interferon versus placebo in the treatment of rheumatoid arthritis. 1989.

PubMed

Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D

2008-02-01

One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.

Enhanced gamma interferon responses of mouse spleen cells following immunotherapy for tuberculosis relapse.

PubMed

Gil, Olga; Vilaplana, Cristina; Guirado, Evelyn; Díaz, Jorge; Cáceres, Neus; Singh, Mahavir; Cardona, Pere-Joan

2008-11-01

Gamma interferon responses of spleen cells in mice were examined during postchemotherapy relapse of intraperitoneally induced latent tuberculous infection. The mycobacterial extract RUTI, which prevented the relapse, significantly enhanced the immune responses to secreted and structural recombinant mycobacterial antigens, suggesting that RUTI-mediated protection was mediated by activated T cells.

Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.

PubMed Central

Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G

1996-01-01

The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817

Interferon-gamma alone triggers the production of nitric oxide from serum-starved BNL CL.2, murine embryonic liver cells.

PubMed

Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T

1999-01-01

A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.

Disseminated Penicilliosis, Recurrent Bacteremic Nontyphoidal Salmonellosis, and Burkholderiosis Associated with Acquired Immunodeficiency Due to Autoantibody against Gamma Interferon ▿

PubMed Central

Tang, Bone Siu-Fai; Chan, Jasper Fuk-Woo; Chen, Min; Tsang, Owen Tak-Yin; Mok, M. Y.; Lai, Raymond Wai-Man; Lee, Rodney; Que, Tak-Lun; Tse, Herman; Li, Iris Wai-Sum; To, Kelvin Kai-Wang; Cheng, Vincent Chi-Chung; Chan, Eric Yuk-Tat; Zheng, Bojian; Yuen, Kwok-Yung

2010-01-01

Acquired immunodeficiency due to autoantibody against gamma interferon has recently been associated with opportunistic nontuberculous mycobacteriosis, especially among Southeast Asians. We report another 8 cases, all except one apparently immunocompetent hosts who suffered from concomitant or sequential infections by other intracellular pathogens causing penicilliosis, extraintestinal nontyphoidal salmonellosis, and burkholderiosis. The only case with an underlying immunodeficiency syndrome had systemic lupus erythematosus that was quiescent throughout the multiple infective episodes. Eight out of 10 (80.0%) patients with serological evidence of penicilliosis, 5 out of 7 (71.4%) with culture-positive extraintestinal nontyphoidal salmonellosis, 5 out of 28 (17.9%) with serological evidence of melioidosis, and 7 out of 13 (53.8%) with culture-positive nontuberculous mycobacteriosis possessed autoantibody against gamma interferon, whereas only 1 out of 100 patients with systemic lupus erythematosus did. Our study represents the first and largest case series linking this emerging immunodeficiency syndrome with these atypical infections in apparently immunocompetent hosts. Thus, we advocate that any patient with unexplained recurrent or polymicrobial infections due to these intracellular pathogens should be screened for acquired immunodeficiency due to autoantibody against gamma interferon. PMID:20445006

Interferon-gamma exerts its negative regulatory effect primarily on the earliest stages of murine erythroid progenitor cell development.

PubMed

Wang, C Q; Udupa, K B; Lipschitz, D A

1995-01-01

Interferon-gamma (INF-gamma) has been shown to suppress erythropoiesis and perhaps to contribute to the anemia of chronic disease. In this study we demonstrated that the concentration of INF gamma required to suppress murine burst forming unit-erythroid (BFU-E) growth was significantly less than that required to suppress colony forming unit-erythroid (CFU-E) growth. INF gamma acted at the most primitive step in erythroid progenitor cell differentiation and proliferation, as inhibition was maximal when added at the time of BFU-E culture initiation. Inhibition was progressively less if INF gamma addition was delayed after culture initiation. The effects of INF gamma on BFU-E did not require the presence of interleukin-1 alpha (IL-1 alpha), tumor necrosis factor-alpha (TNF alpha), or granulocyte macrophage colony stimulating factor (GM-CSF), as its effects were not neutralized by monoclonal antibodies against IL-1 alpha, TNF alpha, or GM-CSF. This applied whether INF gamma was added to culture with individual antibodies or with a combination of all three antibodies. INF gamma was not required for IL-1 alpha- or TNF alpha-induced suppression of BFU-E, as their effects were not neutralized by a monoclonal anti-INF gamma antibody. In contrast, GM-CSF-induced suppression of BFU-E was negated by the simultaneous addition of anti-INF gamma. We have previously shown that the addition of TNF alpha does not suppress BFU-E growth in cultures from marrow depleted of macrophages. Suppression did occur, however, if a small concentration of INF gamma that does not inhibit and increasing concentration of TNF alpha were added to culture, suggesting a synergistic effect between INF-gamma and TNF alpha. These observations suggest that INF gamma is a potent direct inhibitor of erythroid colony growth in vitro. It exerts its negative regulatory effect primarily on the earliest stages of erythroid progenitor cell differentiation and proliferation, as much higher doses are required to

[Aerosolized recombinant interferon-gamma prevent antigen-induced eosinophil recruitment in guinea pig trachea].

PubMed

Gao, Y; Chenping; Lin, X P

1997-10-01

In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.

Development of an aptamer beacon for detection of interferon-gamma.

PubMed

Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

2010-03-01

Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

Effect of gamma interferon on lung function of mustard gas exposed patients, after 15 years.

PubMed

Ghanei, Mostafa; Panahi, Yoones; Mojtahedzadeh, Mojtaba; Khalili, Ali Reza Hosseini; Aslani, Jafar

2006-01-01

Bronchiolitis has been known to be among the main the pathological features of lung lesions in Mustard Gas (MG) exposed patients. The purpose of this research was to evaluate the efficacy of interferon gamma-1b on the lung function in MG exposed patients with bronchiolitis. Thirty-six bronchiolitis patients, whose lung lesion had been diagnosed through High Resolution Computerized Tomography (HRCT) of the chest and also pathological study, were divided into two 18-member case and control groups. Both groups were receiving their conventional treatment (inhaled Felixotide and Servent). The case group were treated for 6 months with a combination of 200 microg of interferon gamma-1b (given three times per week subcutaneously) plus 7.5 mg of prednisolone (given once a day), while the control group received their previous conventional medications. Lung function was measured at base line and after 1, 3 and 6 months of treatment. In case and control groups, Forced Expiratory Volume in first second (FEV1) did not have statistical differences at the base line (49.3 +/- 2.9 and 48.7 +/- 4.1, respectively = 0.6), whereas a significant increase was seen in the case group (66.3 +/- 5.4) compared control group (57.3 +/- 8.6) at the subsequent months (P = 0.001 for the difference between the groups). Similar pattern of increase was observed in Forced Vital Capacity (FVC). The findings of this study indicate that a 6-month treatment with interferon gamma-1b plus a low-dose prednisolone is associated with an improvement in the lung function in mustard-gas exposed patients with bronchiolitis.

Gamma knife radiosurgery for cerebellopontine angle epidermoid tumors.

PubMed

El-Shehaby, Amr M N; Reda, Wael A; Abdel Karim, Khaled M; Emad Eldin, Reem M; Nabeel, Ahmed M

2017-01-01

Intracranial epidermoid tumors are commonly found in the cerebellopontine angle where they usually present with either trigeminal neuralgia or hemifacial spasm. Radiosurgery for these tumors has rarely been reported. The purpose of this study is to assess the safety and clinical outcome of the treatment of cerebellopontine epidermoid tumors with gamma knife radiosurgery. This is a retrospective study involving 12 patients harboring cerebellopontine angle epidermoid tumors who underwent 15 sessions of gamma knife radiosurgery. Trigeminal pain was present in 8 patients and hemifacial spasm in 3 patients. All cases with trigeminal pain were receiving medication and still uncontrolled. One patient with hemifacial spasm was medically controlled before gamma knife and the other two were not. Two patients had undergone surgical resection prior to gamma knife treatment. The median prescription dose was 11 Gy (10-11 Gy). The tumor volumes ranged from 3.7 to 23.9 cc (median 10.5 cc). The median radiological follow up was 2 years (1-5 years). All tumors were controlled and one tumor shrank. The median clinical follow-up was 5 years. The trigeminal pain improved or disappeared in 5 patients, and of these, 4 cases stopped their medication and one decreased it. The hemifacial spasm resolved in 2 patients who were able to stop their medication. Facial palsy developed in 1 patient and improved with conservative treatment. Transient diplopia was also reported in 2 cases. Gamma knife radiosurgery provides good clinical control for cerebellopontine angle epidermoid tumors.

Interferon-gamma induces apoptosis and augments the expression of Fas and Fas ligand by microglia in vitro.

PubMed

Badie, B; Schartner, J; Vorpahl, J; Preston, K

2000-04-01

Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.

Interferon-gamma of the giant panda (Ailuropoda melanoleuca): complementary DNA cloning, expression, and phylogenetic analysis.

PubMed

Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong

2010-01-01

Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

PubMed

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

Cloning, sequencing and expression of white rhinoceros (Ceratotherium simum) interferon-gamma (IFN-gamma) and the production of rhinoceros IFN-gamma specific antibodies.

PubMed

Morar, D; Tijhaar, E; Negrea, A; Hendriks, J; van Haarlem, D; Godfroid, J; Michel, A L; Rutten, V P M G

2007-01-15

Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-gamma) assay is used as a routine diagnostic tool to determine infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop reagents to set up a rhinoceros IFN-gamma (RhIFN-gamma) assay. The white rhinoceros IFN-gamma gene was cloned, sequenced and expressed as a mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-gamma shares a homology of 90% with equine IFN-gamma. Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant RhIFN-gamma were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that recombinant as well as native white rhinoceros IFN-gamma was recognised. This preliminary IFN-gamma enzyme-linked immunosorbent assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.

Gamma knife radiosurgery for cerebellopontine angle epidermoid tumors

PubMed Central

El-Shehaby, Amr M. N.; Reda, Wael A.; Abdel Karim, Khaled M.; Emad Eldin, Reem M.; Nabeel, Ahmed M.

2017-01-01

Background: Intracranial epidermoid tumors are commonly found in the cerebellopontine angle where they usually present with either trigeminal neuralgia or hemifacial spasm. Radiosurgery for these tumors has rarely been reported. The purpose of this study is to assess the safety and clinical outcome of the treatment of cerebellopontine epidermoid tumors with gamma knife radiosurgery. Methods: This is a retrospective study involving 12 patients harboring cerebellopontine angle epidermoid tumors who underwent 15 sessions of gamma knife radiosurgery. Trigeminal pain was present in 8 patients and hemifacial spasm in 3 patients. All cases with trigeminal pain were receiving medication and still uncontrolled. One patient with hemifacial spasm was medically controlled before gamma knife and the other two were not. Two patients had undergone surgical resection prior to gamma knife treatment. The median prescription dose was 11 Gy (10–11 Gy). The tumor volumes ranged from 3.7 to 23.9 cc (median 10.5 cc). Results: The median radiological follow up was 2 years (1–5 years). All tumors were controlled and one tumor shrank. The median clinical follow-up was 5 years. The trigeminal pain improved or disappeared in 5 patients, and of these, 4 cases stopped their medication and one decreased it. The hemifacial spasm resolved in 2 patients who were able to stop their medication. Facial palsy developed in 1 patient and improved with conservative treatment. Transient diplopia was also reported in 2 cases. Conclusion: Gamma knife radiosurgery provides good clinical control for cerebellopontine angle epidermoid tumors. PMID:29184709

Arthritis is inhibited in Borrelia-primed and infected interleukin-17A-deficient mice after administration of anti-gamma-interferon, anti-tumor necrosis factor alpha and anti-interleukin-6 antibodies.

PubMed

Kuo, Joseph; Warner, Thomas F; Schell, Ronald F

2017-08-31

The role that cytokines play in the induction of Lyme arthritis is gradually being delineated. We showed previously that severe arthritis developed in a T-cell-driven murine model, even in mice lacking interleukin-17A (IL-17A) and administered anti-gamma-interferon (IFN-γ) antibody. Increased levels of tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6), two pro-inflammatory cytokines, were detected in cultures of popliteal lymph node cells obtained from these mice. We hypothesized that concomitantly administered anti-IL-6, anti-TNF-α and anti-IFN-γ antibodies would inhibit the development of arthritis in IL-17A-deficient mice. Our results showed that swelling of the hind paws and histopathological changes consistent with arthritis were significantly reduced in IL-17A-deficient mice that administered the three anti-cytokine antibodies. These results suggest that treatment with multiple anti-cytokine antibodies can abrogate the induction of Lyme arthritis in mice. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Interferon action: two (2'-5')(A)n synthetases specified by distinct mRNAs in Ehrlich ascites tumor cells treated with interferon.

PubMed

St Laurent, G; Yoshie, O; Floyd-Smith, G; Samanta, H; Sehgal, P B; Lengyel, P

1983-05-01

(2'-5')(A)n synthetase and RNAase L (a latent endoribonuclease) are among the mediators of interferon action. The product of (2'-5')(A)n synthetase (i.e., (2'-5')(A)n) binds, and thereby activates RNAase L. Interferons induce in Ehrlich ascites tumor (EAT) cells two mRNAs (sizes 1.5 kb and 3.8 kb), which can be translated in Xenopus oocytes into (2'-5')(A)n synthetases of 20,000 to 30,000 daltons and 85,000 to 100,000 daltons, respectively. (2'-5')(A)n synthetases of corresponding sizes are induced by interferons in EAT cells. In the cell extract the bulk of the larger enzyme is in the cytoplasmic fraction, and the bulk of the smaller one in the nuclear fraction. The only known function of (2'-5')(A)n is the activation of RNAase L, and RNAase L can be selectively crosslinked to a (2'-5')(A)n derivative in a cytoplasmic extract from EAT cells. The same (2'-5')(A)n derivative can be crosslinked to several proteins in the nuclear extract of EAT cells, and some of these proteins are induced by interferon.

Gamma-ray irradiation enhanced boron-10 compound accumulation in murine tumors.

PubMed

Liu, Yong; Nagata, Kenji; Masunaga, Shin-ichiro; Suzuki, Minoru; Kashino, Genro; Kinashi, Yuko; Tanaka, Hiroki; Sakurai, Yoshinori; Maruhashi, Akira; Ono, Koji

2009-11-01

Previous studies have demonstrated that X-ray irradiation affects angiogenesis in tumors. Here, we studied the effects of gamma-ray irradiation on boron-10 compound accumulation in a murine tumor model. The mouse squamous cell carcinoma was irradiated with gamma-ray before BSH ((10)B-enriched borocaptate sodium) administration. Then, the boron-10 concentrations in tumor and normal muscle tissues were measured by prompt gamma-ray spectrometry (PGA). A tumor blood flow assay was performed, and cell killing effects of neutron irradiation with various combinations of BSH and gamma-rays were also examined. BSH concentrations of tumor tissues were 16.1 +/- 0.6 microg/g, 16.7 +/- 0.5 microg/g and 17.8 +/- 0.5 microg/g at 72 hours after gamma-ray irradiation at doses of 5, 10, and 20 Gy, compared with 13.1 +/- 0.5 microg/g in unirradiated tumor tissues. The enhancing inhibition of colony formation by neutron irradiation with BSH was also found after gamma-ray irradiation. In addition, increasing Hoechst 33342 perfusion was also observed. In this study, we demonstrated that gamma-ray irradiation enhances BSH accumulation in tumors. The present results suggest that the enhancement of (10)B concentration that occurs after gamma-ray irradiation may be due to the changes in the extracellular microenvironment, including in tumor vessels, induced by gamma-ray irradiation.

Gene expression and production of tumor necrosis factor alpha, interleukin 1, interleukin 6, and gamma interferon in C3H/HeN and C57BL/6N mice in acute Mycoplasma pulmonis disease.

PubMed Central

Faulkner, C B; Simecka, J W; Davidson, M K; Davis, J K; Schoeb, T R; Lindsey, J R; Everson, M P

1995-01-01

Studies were conducted to determine whether the production of various cytokines is associated with Mycoplasma pulmonis disease expression. Susceptible C3H/HeN and resistant C57BL/6N mice were inoculated intranasally with 10(7) CFU of virulent M. pulmonis UAB CT or avirulent M. pulmonis UAB T. Expression of genes for tumor necrosis factor alpha (TNF-alpha), interleukin 1 alpha (IL-1 alpha), IL-1 beta, IL-6, and gamma interferon (IFN-gamma) in whole lung tissue and TNF-alpha gene expression in bronchoalveolar lavage (BAL) cells was determined by reverse transcription-PCR using specific cytokine primers at various times postinoculation. In addition, concentrations of TNF-alpha, IL-1, IL-6, and IFN-gamma were determined in BAL fluid and serum samples at various times postinoculation. Our results showed that there was a sequential appearance of cytokines in the lungs of infected mice: TNF-alpha, produced primarily by BAL cells, appeared first, followed by IL-1 and IL-6, which were followed by IFN-gamma. Susceptible C3H/HeN mice had higher and more persistent concentrations of TNF-alpha and IL-6 in BAL fluid than did resistant C57BL/6N mice, indicating that TNF-alpha and possibly IL-6 are important factors in pathogenesis of acute M. pulmonis disease in mice. Serum concentrations of IL-6 were elevated in C3H/HeN mice, but not C57BL/6N mice, following infection with M. pulmonis, suggesting that IL-6 has both local and systemic effects in M. pulmonis disease. PMID:7558323

Coexposure of mice to trovafloxacin and lipopolysaccharide, a model of idiosyncratic hepatotoxicity, results in a unique gene expression profile and interferon gamma-dependent liver injury.

PubMed

Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A

2009-01-01

The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.

Interferon system in women with genital papillomavirus infection receiving immunomodulatory therapy.

PubMed

Rogovskaya, S I; Zhdanov, A V; Loginova, N S; Faizullin, L Z; Prilepskaya, V N; Van'ko, L V; Sukhikh, G T

2002-11-01

The interferon system was studied in women with genital papillomavirus infection. In most patients the interferon system was activated, while the ability of lymphocytes to respond to inductors decreased. Laserotherapy and immunomodulatory therapy with larifan, ridostin, and viferon for 1 month normalized blood interferon concentration (39.4% patients) and interferon-gamma production by lymphocytes in response to inductors (87.9% patients). After laser monotherapy these parameters returned to normal only in 13.2 and 7.6% patients, respectively. Correlation and regression analyses showed that changes in the interferon system were synchronized after immunomodulatory therapy. These data indicate that immunomodulatory therapy produces a complex effect on the interferon system. Measurements of blood interferon level can be used to predict the effect of further treatment with interferon-gamma inductors.

Potential mechanisms of cytosolic calcium modulation in interferon-gamma treated U937 cells

NASA Technical Reports Server (NTRS)

Klein, Jon B.; Mcleish, Kenneth R.; Sonnenfeld, Gerald; Dean, William L.

1987-01-01

The ability of interferon-gamma (IFN-gamma) to alter cytoplasmic Ca(2+) content in the monocytelike cell line U937 was investigated, using a slow Ca-channel blocker, diltiazem. In addition, the Ca-ATPase and the Ca-uptake activities were measured in isolated U937 membranes, together with the effect of inositol trisphosphate (IP3) upon the Ca(2+) release from Ca-loaded membranes. The addition of 50 U/ml INF-gamma to U937 cultures was found to increase internal Ca(2+) by about 100 percent within 3 min. The increase was significantly reduced by incubation in Ca-free buffer or by the addition of diltiazem. A crude membrane preparation from U937 cells was found to contain significant amounts of Ca-ATPase activity and to sequester Ca(2+) to a level of 8 nmol/mg in 30 sec; the addition of IP3 induced release of a portion of the sequestered Ca(2+) which was then resequestered. The results suggest that IFN-gamma causes an increase of cytoplasmic Ca(2+), in part, by the IP3-induced release from the internal storage sites and, in part, from the entry of extracellular Ca through slow channels.

The Predominant CD4+ Th1 Cytokine Elicited to Chlamydia trachomatis Infection in Women Is Tumor Necrosis Factor Alpha and Not Interferon Gamma

PubMed Central

Gupta, Kanupriya; Ogendi, Brian M. O.; Bakshi, Rakesh K.; Kapil, Richa; Press, Christen G.; Sabbaj, Steffanie; Lee, Jeannette Y.

2017-01-01

ABSTRACT Chlamydia trachomatis infection is the most prevalent bacterial sexually transmitted infection and can cause significant reproductive morbidity in women. There is insufficient knowledge of C. trachomatis-specific immune responses in humans, which could be important in guiding vaccine development efforts. In contrast, murine models have clearly demonstrated the essential role of T helper type 1 (Th1) cells, especially interferon gamma (IFN-γ)-producing CD4+ T cells, in protective immunity to chlamydia. To determine the frequency and magnitude of Th1 cytokine responses elicited to C. trachomatis infection in humans, we stimulated peripheral blood mononuclear cells from 90 chlamydia-infected women with C. trachomatis elementary bodies, Pgp3, and major outer membrane protein and measured IFN-γ-, tumor necrosis factor alpha (TNF-α)-, and interleukin-2 (IL-2)-producing CD4+ and CD8+ T-cell responses using intracellular cytokine staining. The majority of chlamydia-infected women elicited CD4+ TNF-α responses, with frequency and magnitude varying significantly depending on the C. trachomatis antigen used. CD4+ IFN-γ and IL-2 responses occurred infrequently, as did production of any of the three cytokines by CD8+ T cells. About one-third of TNF-α-producing CD4+ T cells coproduced IFN-γ or IL-2. In summary, the predominant Th1 cytokine response elicited to C. trachomatis infection in women was a CD4+ TNF-α response, not CD4+ IFN-γ, and a subset of the CD4+ TNF-α-positive cells produced a second Th1 cytokine. PMID:28100498

Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity

PubMed Central

1984-01-01

Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN

A short 2 week dose titration regimen reduces the severity of flu-like symptoms with initial interferon gamma-1b treatment.

PubMed

Devane, John G; Martin, Mary L; Matson, Mark A

2014-06-01

Flu-like symptoms (FLS) are commonly experienced by patients receiving interferon gamma-1b which may cause discontinuation or disruption of dosing during initial therapy or on re-initiation following a break in therapy. In contrast to Type I interferons, the impact of dose-titration on FLS has not been reported and is not a practice described or included in the approved prescribing information for interferon gamma-1b.The objective of this study was to assess the effect of a 2 week titration regimen on the severity of FLS during the initial 3 weeks of therapy with three times weekly subcutaneous injections of interferon gamma-1b. Healthy men and women were randomized into a double-blind, two-period, crossover study. Each study period was 3 weeks in duration and there was a minimum 15 day washout between treatment periods. Two treatment regimens were compared: No Titration dosing (full 50 mcg/m(2) subcutaneously [s.c.] three times weekly for 3 weeks) and Titration (15 mcg/m(2) s.c. three times weekly during week 1, 30 mcg/m(2) s.c. three times weekly during week 2 followed by the full dose of 50 mcg/m(2) s.c. three times weekly during week 3). Subjects remained in the clinic for at least 12 hours following each injection. FLS was based on a composite score for fever, chills, tiredness and muscle aches assessed at baseline and 4, 8 and 12 hours following each injection. Acetaminophen was allowed at the discretion of the PI. The primary endpoint was the change from baseline in FLS severity at 8 hours averaged over the 3 weeks of treatment. Additional endpoints included FLS at 4 and 12 hours, individual flu-like symptoms, rates of discontinuation, incidence of FLS and acetaminophen use. NCT 01929382. Of the 40 subjects randomized, there were 15 (37.5%) discontinuations. Titration resulted in a significant reduction in FLS severity at 8 hours (p = 0.023) averaged over the 3 week treatment period. The difference in 3 week FLS severity reflects differences

Interferon-γ Drives Treg Fragility to Promote Anti-tumor Immunity.

PubMed

Overacre-Delgoffe, Abigail E; Chikina, Maria; Dadey, Rebekah E; Yano, Hiroshi; Brunazzi, Erin A; Shayan, Gulidanna; Horne, William; Moskovitz, Jessica M; Kolls, Jay K; Sander, Cindy; Shuai, Yongli; Normolle, Daniel P; Kirkwood, John M; Ferris, Robert L; Delgoffe, Greg M; Bruno, Tullia C; Workman, Creg J; Vignali, Dario A A

2017-06-01

Regulatory T cells (T regs ) are a barrier to anti-tumor immunity. Neuropilin-1 (Nrp1) is required to maintain intratumoral T reg stability and function but is dispensable for peripheral immune tolerance. T reg -restricted Nrp1 deletion results in profound tumor resistance due to T reg functional fragility. Thus, identifying the basis for Nrp1 dependency and the key drivers of T reg fragility could help to improve immunotherapy for human cancer. We show that a high percentage of intratumoral NRP1 + T regs correlates with poor prognosis in melanoma and head and neck squamous cell carcinoma. Using a mouse model of melanoma where Nrp1-deficient (Nrp1 -/- ) and wild-type (Nrp1 +/+ ) T regs can be assessed in a competitive environment, we find that a high proportion of intratumoral Nrp1 -/- T regs produce interferon-γ (IFNγ), which drives the fragility of surrounding wild-type T regs , boosts anti-tumor immunity, and facilitates tumor clearance. We also show that IFNγ-induced T reg fragility is required for response to anti-PD1, suggesting that cancer therapies promoting T reg fragility may be efficacious. Copyright © 2017 Elsevier Inc. All rights reserved.

Executive Summary of the Guidelines for the Use of interferon-gamma Release Assays in the Diagnosis of Tuberculosis Infection.

PubMed

Santin, Miguel; García-García, José-María; Rigau, David; Altet, Neus; Anibarro, Luis; Casas, Irma; Díez, Nuria; García-Gasalla, Mercedes; Martínez-Lacasa, Xavier; Penas, Antón; Pérez-Escolano, Elvira; Sánchez, Francisca; Domínguez, José

2016-09-01

Interferon-gamma release assays are widely used for the diagnosis of tuberculosis infection in Spain. However, there is no consensus on their application in specific clinical scenarios. To develop a guide-line for their use, a panel of experts comprising specialists in infectious diseases, respiratory diseases, microbiology, pediatrics and preventive medicine, together with a methodologist, conducted a systematic literature search, summarized the findings, rated the quality of the evidence, and formulated recommendations following the Grading of Recommendations of Assessment Development and Evaluations methodology. This document provides evidence-based guidance on the use of interferon-gamma release assays for the diagnosis of tuberculosis infection in patients at risk of tuberculosis or suspected of having active disease. The guidelines will be applicable to specialist and primary care, and public health. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

Differential effects of human interferon alpha and interferon gamma on xenografted human thyroid tissue in severe combined immunodeficient mice and nude mice.

PubMed

Kawai, K; Enomoto, T; Fornasier, V; Resetkova, E; Volpé, R

1997-03-01

We have studied the in vivo effects of human interferon alpha (IFN-alpha) and interferon gamma (IFN-gamma) administration on human thyroid tissue xenografted into two mouse strains: severe combined immunodeficient (SCID) mice and nude mice. Human lymphocytes survive in SCID mice but are lysed in nude mice. Thyroid tissues from Graves' disease or Hashimoto's thyroiditis, or paranodular [normal, (N)] tissue was xenografted into SCID mice (0.8 g/mouse) pretreated with anti-asialo GM-1 antiserum and radiation and also into nude mice. One week after xenografting, SCID and nude mice were divided into three groups. Group A was treated with IFN-alpha intraperitoneally (2,000 units/mouse) three times weekly; group B was treated with IFN-gamma similarly; group C was treated with phosphate buffered saline (PBS) only (control). Autologous human peripheral blood mononuclear cells (PBMCs) were added to mice receiving N xenografts. Blood was taken every 2 weeks for levels of IgG and thyroid antibodies (TAb). After 6 weeks of treatment, mice were sacrificed, and xenograft thyrocyte histocompatibility leukocyte antigen (HLA-DR) and intercellular adhesion molecule (ICAM-1) expression were measured. In addition, thyrocyte cultures were stimulated in vitro with 200 units/ml of either IFN-alpha or IFN-gamma or PBS (control). SCID mice xenografted with autoimmune thyroid disease (AITD) in group A showed a significantly higher TAb production than group C, whereas in group B, TAb production was not statistically increased compared to control (group C). SCID mice xenografted with N did not produce TAb in any group, nor did nude mice xenografted with AITD. Thyrocyte HLA-DR expression was markedly increased in group A and B in SCID mice xenografted with Graves' disease, Hashimoto's thyroiditis, and N tissue compared to group C. In contrast, only group B (IFN-gamma) showed an increase in thyrocyte HLA-DR in nude mice. In the in vitro studies, only IFN-gamma (not IFN-alpha) stimulated

Dual specific oral tolerance induction using interferon gamma for IgE-mediated anaphylactic food allergy and the dissociation of local skin allergy and systemic oral allergy: tolerance or desensitization?

PubMed

Noh, G; Jang, E H

2014-01-01

Specific oral tolerance induction (SOTI) for IgE-mediated food allergy (IFA) can be successfully achieved using interfero gamma (classic SOTI). In this study, a tolerable dose was introduced during tolerance induction with interferon gamma (dual SOTI), and its effectiveness was evaluated. The study population comprised 25 IFA patients. Blood samples were taken for analysis, including complete blood count with differential counts of eosinophils, serum total IgE levels, and specific IgE for allergenic foods. Skin prick tests were conducted with the allergens. Oral food challenges were performed to diagnose IFA. Ten patients received dual SOTI, 5 received classic SOTI, 5 received SOTI without interferon gamma (original SOTI), and 5 were not treated (controls). Patients treated with dual SOTI and classic SOTI using interferon gamma became tolerant to the allergenic food. The tolerable dose was introduced successfully in dual SOTI. It was difficult to proceed with the same dosing protocol used for classic SOTI in cases treated with original SOTI. Following dual SOTI, the systemic reaction to oral intake subsided, but the local skin reaction to contact with the allergenic food persisted. Dual SOTI is an improved protocol for SOTI using interferon gamma for IFA.The local skin reaction and systemic reaction to oral intake were dissociated following dual SOTI. In cases of food allergy, tolerance appears to result from desensitization to allergens.

Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.

PubMed

Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F

2003-01-01

A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.

COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?

PubMed Central

Levick, Scott P.; Goldspink, Paul H.

2013-01-01

The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353

Vertebral osteomyelitis due to Aspergillus fumigatus in a patient with chronic granulomatous disease successfully treated with antifungal agents and interferon-gamma.

PubMed

Al-Tawfiq, Jaffar A; Al-Abdely, Hail M

2010-05-01

We report a case of invasive aspergillosis due to Aspergillus fumigatus involving the cervical and thoracic vertebrae and upper mediastinum of a 17 year-old Saudi male with chronic granulomatous disease (CGD). The patient did not respond to a long course of liposomal amphotericin B but did to surgical drainage and a combination of caspofungin and itraconazole with subsequent suppression with oral voriconazole. Fourteen months after the start of therapy, the patient had anterior dislocation of T2 thoracic vertebra with cord transection and quadriplegia. He was then treated intravenously with liquid itraconazole and interferon-gamma. The patient made a remarkable recovery over a 2-year period and was eventually able to walk independently. Thus, a combination of antifungals and interferon-gamma may have resulted in the positive outcome in this case.

Interleukin-12- and interferon-gamma-mediated natural killer cell activation by Agaricus blazei Murill.

PubMed

Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko

2007-06-01

Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.

Production and characterization of guinea pig recombinant gamma interferon and its effect on macrophage activation.

PubMed

Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N

2006-01-01

Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.

Continuous in vivo infusion of interferon-gamma (IFN-gamma) enhances engraftment of syngeneic wild-type cells in Fanca-/- and Fancg-/- mice.

PubMed

Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade

2006-12-15

Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.

Interferon Gamma in African Trypanosome Infections: Friends or Foes?

PubMed

Wu, Hui; Liu, Gongguan; Shi, Meiqing

2017-01-01

African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.

Tumor-induced thymic atrophy: alteration in interferons and Jak/Stats signaling pathways.

PubMed

Carrio, Roberto; Torroella-Kouri, Marta; Iragavarapu-Charyulu, Vijaya; Lopez, Diana M

2011-02-01

The thymus is the major site of T cell differentiation and a key organ of the immune system. Thym atrophy has been observed in several model systems including aging, and tumor development. Previous results from our laboratory have reported that the thymic atrophy seen in mammary tumor bearers is associated with a severe depletion of CD4+CD8+ double positive immature cells and changes in the levels of cytokines expressed in the thymus microenvironment. Cytokines regulate numerous aspects of hematopoiesis via activation of the Jak/Stat pathways. In the present study we have used our mammary tumor model to investigate whether changes in the levels of cytokines in the thymus could affect the normal expression of the aforementioned pathways. RNA and protein analysis revealed an overexpression of the different members of interferons, a downregulation of most of the Jak/Stat pathways, and an increased expression of several suppressors of cytokine signaling (SOSC) in the thymuses of tumor bearers. Together, our data suggest that the impaired Jak/Stat signaling pathways observed in the whole thymus of tumor-bearing mice could be contributing to the abnormal T cell development and apoptosis observed during the tumor-induced thymic atrophy.

Interferon-gamma promotes the survival and Fc epsilon RI-mediated histamine release in cultured human mast cells.

PubMed Central

Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T

1996-01-01

We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819

Equine interferon gamma synthesis in lymphocytes after in vivo infection and in vitro stimulation with EHV-1.

PubMed

Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H

2005-08-22

Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.

Pilot study of whole-blood gamma interferon response to the Vibrio cholerae toxin B subunit and resistance to enterotoxigenic Escherichia coli-associated diarrhea.

PubMed

Flores, Jose; DuPont, Herbert L; Paredes-Paredes, Mercedes; Aguirre-Garcia, M Magdalena; Rojas, Araceli; Gonzalez, Alexei; Okhuysen, Pablo C

2010-05-01

Enterotoxigenic Escherichia coli (ETEC), which produces heat-labile toxin (LT), is a common cause of travelers' diarrhea (TD). The B subunit of ETEC LT is immunologically related to the B subunit of Vibrio cholerae toxin (CT). In this pilot study we evaluated the whole-blood gamma interferon response to CT B in 17 U.S. adults traveling to Mexico. Only one of nine subjects who demonstrated a cellular immune response as determined by whole-blood gamma interferon production to CT B on arrival to Mexico developed diarrhea, whereas five of eight without a cellular response developed diarrhea. Markers of the cellular immune response to ETEC LT could help in identifying individuals immune to ETEC LT, and these markers deserve additional study.

A randomized phase II trial comparing two different sequence combinations of autologous vaccine and human recombinant interferon gamma and human recombinant interferon alpha2B therapy in patients with metastatic renal cell carcinoma: clinical outcome and analysis of immunological parameters.

PubMed

Schwaab, T; Heaney, J A; Schned, A R; Harris, R D; Cole, B F; Noelle, R J; Phillips, D M; Stempkowski, L; Ernstoff, M S

2000-04-01

The clinical observation of spontaneous regression in patients with renal cell carcinoma (RCC) and the response to various immunotherapeutic therapies strongly suggest a role for the host immune system in this disease. Prior studies showed that sequential administration of interferon (IFN) gamma and IFN alpha to RCC patients was safe. Clinical responses as well as immune changes in the peripheral blood mononuclear cell compartment were observed. Autologous tumor cell vaccines (AV) have also demonstrated activity in renal cell carcinoma. We hypothesize that the addition of AV to sequential IFN gamma and a therapy might improve the tumor-specific immune response by providing an appropriate source of antigen in the appropriate cytokine environment. To our knowledge, this is the first trial using AV combined with IFN alpha and IFN gamma. The purpose of this study was to evaluate the feasibility of manufacturing and administering (AV) from resected tumor samples, and administration of AV with combination IFN gamma and IFN alpha therapy. Finally, the impact on immunological parameters of these treatment options was assessed. Patients with metastatic RCC were randomly assigned to receive AV plus bCG along with a sequential administration of IFN gamma and a either together or after initiation of vaccine. Toxicity and clinical responses were evaluated. Modulations of the immune system were investigated by analyzing phenotype, cytokine mRNA expression, T cell proliferation and cytotoxicity in the peripheral blood mononuclear cell compartment. Fourteen patients with metastatic renal cell carcinoma were enrolled in this study; 9 were available for response evaluation. In a 70 day period, 3 (33%) showed mixed responses, 5 (56%) stable disease and 1 (11%) progression of disease. Toxicities were consistent with previous clinical reports. In the flow-cytometry phenotype analysis, stimulation of distinct subsets of circulating T-lymphocytes and a decrease of CD8+ T cell subsets was

CD4 T lymphocytes from patients with chronic fatigue syndrome have decreased interferon-gamma production and increased sensitivity to dexamethasone.

PubMed

Visser, J; Blauw, B; Hinloopen, B; Brommer, E; de Kloet, E R; Kluft, C; Nagelkerken, L

1998-02-01

A disturbed hypothalamus-pituitary-adrenal gland axis and alterations at the immune system level have been observed in patients with chronic fatigue syndrome (CFS). Glucocorticoids are known to modulate T cell responses; therefore, purified CD4 T cells from CFS patients were studied to determine whether they have an altered sensitivity to dexamethasone (DEX). CD4 T cells from CFS patients produced less interferon-gamma than did cells from controls; by contrast, interleukin-4 production and cell proliferation were comparable. With CD4 T cells from CFS patients (compared with cells from controls), a 10- to 20-fold lower DEX concentration was needed to achieve 50% inhibition of interleukin-4 production and proliferation, indicating an increased sensitivity to DEX in CFS patients. Surprisingly, interferon-gamma production in patients and controls was equally sensitive to DEX. A differential sensitivity of cytokines or CD4 T cell subsets to glucocorticoids might explain an altered immunologic function in CFS patients.

Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor

PubMed Central

Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian

2014-01-01

Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970

Gamma interferon-induced guanylate binding protein 1 is a novel actin cytoskeleton remodeling factor.

PubMed

Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael

2014-01-01

Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.

Interferon-gamma: biologic functions and HCV therapy (type I/II) (1 of 2 parts).

PubMed

Gattoni, A; Parlato, A; Vangieri, B; Bresciani, M; Derna, R

2006-01-01

This review is aimed at exhaustively presenting and discussing the interferon-gamma (IFN-gamma), a cytokine that plays an important role in inducing and modulating an array of immune responses. A review of the most significant and recent clinical trials was performed. Although IFN-gamma has some antiviral activity, it is much less active in this regard than type I IFNs. IFN-gamma is involved in the regulation of nearly all phases of the immune and inflammatory responses, including the activation and differentiation of T cells, B cells, NK cells, macrophages, and others. It is therefore best regarded as a distint immunoregulatory cytokine. IFN-gamma secretion is a hallmark of Th1 lymphocytes. It is also secreted by nearly all CD8 T cells, by some Th0 cells, and by NK cells. Each of these cell types secretes IFN-gamma only when activated, usually as part of immune response and especially in response to IL-2 and IL-12. IFN-gamma production is inhibited by IL-4, IL-10, TGFbeta, glucocorticoids, cyclosporin A and FK506. Nearly all cell types express the heterodimeric receptor for IFN-beta and respond to this cytokine by increasing the surface expression of class I MHC proteins. As a result, virtually any cell in the vicinity of an IFN-beta-secreting cell becomes more efficient at presenting endogenous antigens and hence a better target for cytotoxic killing if it harbors an intracellular pathogen. Unlike the type I IFNs, IFN-gamma also increases the expression of class II MHC proteins on professional APCs, and so promotes antigen presentation to helper T cells as well. It also induces de novo expression of class II MHC proteins on venular endothelial cells and on some other epithelial and connective tissue cells that do not otherwise express them, thus enabling these cell types to function as temporary APCs at sites of intense immune reactions. The effector functions of NK cells are to lyse virus-infected cells and to secrete IFN-gamma, which activates macrofages to

Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies

PubMed Central

Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D

2014-01-01

Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250

Tumor-derived exosomes modulate T cell function through transfer of RNA.

PubMed

House, Imran G; Petley, Emma V; Beavis, Paul A

2018-03-01

Tumor cells can develop a variety of mechanisms to evade and subvert the immune system for their survival. Bland et al., in this edition of The FEBS Journal, make the novel finding that the tumor line B16F0 can deliver mRNA/miRNA loaded exosomes to cytotoxic T lymphocytes and alter their metabolic function and interferon gamma production. © 2018 Federation of European Biochemical Societies.

Development of a lion-specific interferon-gamma assay.

PubMed

Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G

2012-10-15

The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.

Graft-versus-host disease causes failure of donor hematopoiesis and lymphopoiesis in interferon-gamma receptor-deficient hosts.

PubMed

Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude

2008-09-01

The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.

The Effectiveness of Screening with Interferon-Gamma Release Assays in a University Health Care Setting with a Diverse Global Population

ERIC Educational Resources Information Center

Birch, Samantha J.; Golbeck, Amanda L.

2015-01-01

Objective: This analysis examined the effectiveness of utilizing interferon-gamma release assay (IGRA) technology in a TB (TB) screening program at a university. Participants: Participants were 2299 students at a Montana university who had presented to the university health center for TB screening during 2012 and 2013. Methods: A retrospective…

Dysregulation of Serum Gamma Interferon Levels in Vascular Chronic Q Fever Patients Provides Insights into Disease Pathogenesis

PubMed Central

Kremers, Marjolein N. T.; Hodemaekers, Hennie M.; Hagenaars, Julia C. J. P.; Koning, Olivier H. J.; Renders, Nicole H. M.; Hermans, Mirjam H. A.; de Klerk, Arja; Notermans, Daan W.; Wever, Peter C.; Janssen, Riny

2015-01-01

A large community outbreak of Q fever occurred in the Netherlands in the period 2007 to 2010. Some of the infected patients developed chronic Q fever, which typically includes pathogen dissemination to predisposed cardiovascular sites, with potentially fatal consequences. To identify the immune mechanisms responsible for ineffective clearance of Coxiella burnetii in patients who developed chronic Q fever, we compared serum concentrations of 47 inflammation-associated markers among patients with acute Q fever, vascular chronic Q fever, and past resolved Q fever. Serum levels of gamma interferon were strongly increased in acute but not in vascular chronic Q fever patients, compared to past resolved Q fever patients. Interleukin-18 levels showed a comparable increase in acute as well as vascular chronic Q fever patients. Additionally, vascular chronic Q fever patients had lower serum levels of gamma interferon-inducible protein 10 (IP-10) and transforming growth factor β (TGF-β) than did acute Q fever patients. Serum responses for these and other markers indicate that type I immune responses to C. burnetii are affected in chronic Q fever patients. This may be attributed to an affected immune system in cardiovascular patients, which enables local C. burnetii replication at affected cardiovascular sites. PMID:25924761

Interactions of the interferon system with cellular metabolism

NASA Technical Reports Server (NTRS)

Sonnenfeld, Gerald

1986-01-01

The results of studies concerning the interaction of the interferon (Inf) system with the activities of carcinogens, tumor promoters, and cytochrome P-450 are presented. The results show that the addition of a tumor promoter (TPA or 4-O-methyl-TPA) to a tissue culture enhances virus-induced Inf-gamma production, suggesting a potential value of tumor promoters in the biosynthesis of commercial Inf. On the other hand, the carcinogens were reported to inhibit the induction of Inf-alpha/beta in cultured cells and in intact animals (with no effect on the administered or preformed Inf). The demonstration of a correlation between the carcinogenic potential of a compound and its inhibitive effect on Inf production suggests a possible use of the Inf production assay in the evaluation of the carcinogenicity of chemicals. In addition, it was shown that the induction of Inf-alpha/beta as well as the administration of this Inf depresses the levels of rat liver cytochrome P-450 which is responsible for binding lipophilic drugs, steroids, and carcinogens, thus increasing the toxicity of the respective chemical.

Gamma-interferon causes a selective induction of the lysosomal proteases, cathepsins B and L, in macrophages

NASA Technical Reports Server (NTRS)

Lah, T. T.; Hawley, M.; Rock, K. L.; Goldberg, A. L.

1995-01-01

Previous studies have indicated that acid-optimal cysteine proteinase(s) in the endosomal-lysosomal compartments, cathepsins, play a critical role in the proteolytic processing of endocytosed proteins to generate the antigenic peptides presented to the immune system on major histocompatibility complex (MHC) class II molecules. The presentation of these peptides and the expression of MHC class II molecules by macrophages and lymphocytes are stimulated by gamma-interferon (gamma-IFN). We found that treatment of human U-937 monocytes with gamma-IFN increased the activities and the content of the two major lysosomal cysteine proteinases, cathepsins B and L. Assays of protease activity, enzyme-linked immunosorbant assays (ELISA) and immunoblotting showed that this cytokine increased the amount of cathepsin B 5-fold and cathepsin L 3-fold in the lysosomal fraction. By contrast, the aspartic proteinase, cathepsin D, in this fraction was not significantly altered by gamma-IFN treatment. An induction of cathepsins B and L was also observed in mouse macrophages, but not in HeLa cells. These results suggest coordinate regulation in monocytes of the expression of cathepsins B and L and MHC class II molecules. Presumably, this induction of cysteine proteases contributes to the enhancement of antigen presentation by gamma-IFN.

Electrochemical impedance spectroscopy based-on interferon-gamma detection

NASA Astrophysics Data System (ADS)

Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung

2014-03-01

Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.

Role of tumor necrosis factor in macrophage leishmanicidal activity in vitro and resistance to cutaneous leishmaniasis in vivo.

PubMed Central

Theodos, C M; Povinelli, L; Molina, R; Sherry, B; Titus, R G

1991-01-01

Recombinant human tumor necrosis factor (TNF) and purified murine TNF were both able to activate macrophages to destroy intracellular Leishmania major in vitro. In addition, parasitizing macrophages with L. major markedly increased the ability of the cells to produce TNF. Finally, when mice were vaccinated with an avirulent form of L. major, the animals produced large amounts of TNF but no gamma interferon in response to infection with virulent L. major. Treating these mice with a neutralizing anti-TNF antibody led to partial but not complete inhibition of the resistant state, which suggests that factors other than TNF and gamma interferon contribute to resistance to L. major. PMID:1906844

Influence of Anti-Mouse Interferon Serum on the Growth and Metastasis of Tumor Cells Persistently Infected with Virus and of Human Prostatic Tumors in Athymic Nude Mice

NASA Astrophysics Data System (ADS)

Reid, Lola M.; Minato, Nagahiro; Gresser, Ion; Holland, John; Kadish, Anna; Bloom, Barry R.

1981-02-01

Baby hamster kidney or HeLa cells form tumors in 100% of athymic nude mice. When such cells are persistently infected (PI) with RNA viruses, such as mumps or measles virus, the tumor cells either fail to grow or form circumscribed benign nodules. Neither the parental nor the virus PI tumor cells form invasive or metastatic lesions in nude mice. Previous studies have indicated a correlation between the susceptibility of virus-PI tumor cells in vitro and the cytolytic activity of natural killer (NK) cells and their failure to grow in vivo. Because interferon (IF) is the principal regulatory molecule governing the differentiation of NK cells, it was possible to test the relevance of the IF--NK cell system in vivo to restriction of tumor growth by treatment of nude mice with anti-IF globulin. This treatment was shown to reduce both IF production and NK activity in spleen cells. Both parental and virus-PI tumor cells grew and formed larger tumors in nude mice treated with anti-IF globulin than in control nude mice. The viral-PI tumor cells and the uninfected parental cells formed tumors in treated mice that were highly invasive and often metastatic. Some human tumor types have been notoriously difficult to establish as tumor lines in nude mice (e.g., primary human prostatic carcinomas). When transplanted into nude mice treated either with anti-IF globulin or anti-lymphocyte serum, two prostatic carcinomas grew and produced neoplasms with local invasiveness and some metastases. The results are consistent with the view that interferon may be important in restricting the growth, invasiveness, and metastases of tumor cells by acting indirectly through components of the immune system, such as NK cells.

Heterogeneity within populations of recombinant Chinese hamster ovary cells expressing human interferon-gamma.

PubMed

Coppen, S R; Newsam, R; Bull, A T; Baines, A J

1995-04-20

The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.

Structural analysis and localization of the carbohydrate moieties of a soluble human interferon gamma receptor produced in baculovirus-infected insect cells.

PubMed Central

Manneberg, M.; Friedlein, A.; Kurth, H.; Lahm, H. W.; Fountoulakis, M.

1994-01-01

A soluble form of the human interferon gamma receptor that is required for the identification of interferon gamma antagonists was expressed in baculovirus-infected insect cells. The protein carried N-linked carbohydrate and showed a heterogeneity on denaturing polyacrylamide gels. We investigated the utilization of the potential sites for N-linked glycosylation and the structure of the carbohydrate moieties of this soluble receptor. Amino acid sequence analysis and ion spray mass spectrometry revealed that of the five potential sites for N-linked glycosylation, Asn17 and Asn69 were always utilized, whereas Asn62 and Asn162 were utilized in approximately one-third of the protein population. Asn223 was never found to be glycosylated. The soluble receptor was treated with N-glycosidase F and the oligosaccharides released were analyzed by matrix-assisted laser desorption mass spectrometry, which showed that the protein carried six types of short carbohydrate chains. The predominant species was a hexasaccharide of molecular mass 1,039, containing a fucose subunit linked to the proximal N-acetylglucosamine residue: [formula: see text] PMID:8142896

Inhibited interferon production after space flight

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Gould, C. L.; Williams, J.; Mandel, A. D.

1988-01-01

Several studies have been performed in our laboratories indicating that interferon production may be impaired in rodents after space flight. Using an antiorthostatic suspension model that simulates some of the effects of microgravity seen during space flight, we have shown that interferon-alpha/beta production was inhibited. The inhibition was not due solely to the stress of suspension. The inhibited interferon production was transient, as suspended animals returned to normal caging recovered the ability to produce interferon. Antiorthostatic suspension of mice also resulted in a loss of resistance to infection with the diabetogenic strain of encephalomyocarditis virus, which correlated with the drop in interferon production. In rats flown in US Space Shuttle mission SL-3, interferon-gamma production was inhibited severely when spleen cells were challenged with concanavalin-A upon return to earth. In contrast, interleukin-3 production by these cells was normal. These results suggest that immune responses may be altered after antiorthostatic modeling or space flight, and the resistance to viral infections may be especially affected.

Borrelia-primed and -infected mice deficient of interleukin-17 develop arthritis after neutralization of gamma-interferon.

PubMed

Kuo, Joseph; Warner, Thomas F; Schell, Ronald F

2017-03-01

The immune mechanisms responsible for development of Lyme arthritis are partially understood with interleukin-17 (IL-17) and gamma-interferon (IFN-γ) playing a generally accepted role. Elevated levels of IL-17 and/or IFN-γ have been reported in samples from human Lyme arthritis patients and experimental mice. In addition, IL-17 and IFN-γ have been implicated in the onset of arthritis in Borrelia-primed and -infected C57BL/6 mice. Recently, we showed that IL-17-deficient mice developed swelling and histopathological changes consistent with arthritis in the presence of high levels of IFN-γ. We hypothesized that neutralization of IFN-γ in IL-17-deficient mice would inhibit Borrelia-induced arthritis. Our results, however, showed that swelling of the hind paws and histopathological changes of arthritis did not differ between Borrelia-primed and -infected IL-17-deficient and wild-type mice with or without neutralization of IFN-γ. We also found higher levels of tumor necrosis factor alpha (TNF-α) and IL-6 in the popliteal lymph node cells of Borrelia-primed and -infected IL-17-deficient mice after neutralization of IFN-γ. These results suggest that multiple cytokines interact in the development of Borrelia-induced arthritis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Mice with Pulmonary Tuberculosis Treated with Mycobacterium vaccae Develop Strikingly Enhanced Recall Gamma Interferon Responses to M. vaccae Cell Wall Skeleton▿

PubMed Central

Rodríguez-Güell, Elisabeth; Agustí, Gemma; Corominas, Mercè; Cardona, Pere-Joan; Luquin, Marina; Julián, Esther

2008-01-01

Whole heat-killed Mycobacterium vaccae is used as an immunotherapeutic agent in tuberculosis (TB), but the compound(s) that triggers its immunostimulatory ability is not known. Here, we show that among different subcellular fractions, the cell wall skeleton induced a prominent expression of gamma interferon in splenocytes from both non-TB and TB M. vaccae-treated mice. PMID:18337379

The Significance of Sensitive Interferon Gamma Release Assays for Diagnosis of Latent Tuberculosis Infection in Patients Receiving Tumor Necrosis Factor-α Antagonist Therapy.

PubMed

Jung, Yu Jung; Woo, Hye In; Jeon, Kyeongman; Koh, Won-Jung; Jang, Dong Kyoung; Cha, Hoon Suk; Koh, Eun Mi; Lee, Nam Yong; Kang, Eun-Suk

2015-01-01

We compared two interferon gamma release assays (IGRAs), QuantiFERON-TB Gold In-Tube (QFT-GIT) and T-SPOT.TB, for diagnosis of latent tuberculosis infection (LTBI) in patients before and while receiving tumor necrosis factor (TNF)-α antagonist therapy. This study evaluated the significance of sensitive IGRAs for LTBI screening and monitoring. Before starting TNF-α antagonist therapy, 156 consecutive patients with rheumatic diseases were screened for LTBI using QFT-GIT and T-SPOT.TB tests. According to our study protocol, QFT-GIT-positive patients received LTBI treatment. Patients positive by any IGRAs were subjected to follow-up IGRA tests after completing LTBI-treatment and/or during TNF-α antagonist therapy. At the initial LTBI screening, 45 (28.9%) and 70 (44.9%) patients were positive by QFT-GIT and T-SPOT.TB, respectively. The agreement rate between IGRA results was 78.8% (k = 0.56; 95% confidence interval [95% CI] = 0.43 to 0.68). Of 29 patients who were positive only by T-SPOT.TB in the initial screening, 83% (19/23) were persistently positive by T-SPOT.TB, while QFT-GIT testing showed that 36% (9/25) had conversion during TNF-α antagonist therapy. By the end of the follow-up period (218 to 1,264 days), four patients (4/137, 2.9%) developed active tuberculosis (TB) diseases during receiving TNF-α antagonist therapy. Among them, one was Q-T+, one was Q+T-, and the remaining two were Q-T- at the initial screening (Q, QuantiFERON-TB Gold In-Tube; T, T-SPOT.TB; +, positive; -, negative). Two (2/4, 50%) patients with TB reactivation had at least one prior risk factor consistent with previous TB infection. This study demonstrated the need to capitalize on sensitive IGRAs to monitor for LTBI in at-risk patients for a more sensitive diagnosis in countries with an intermediate TB burden.

[Regulating human interferon-gamma gene expression in marrow stromal cells in mice by Tet-off system].

PubMed

Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong

2008-01-01

We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.

Type I Interferons as Stimulators of DC-Mediated Cross-Priming: Impact on Anti-Tumor Response.

PubMed

Schiavoni, Giovanna; Mattei, Fabrizio; Gabriele, Lucia

2013-12-25

Induction of potent tumor-specific cytotoxic T-cell responses is a fundamental objective in anticancer therapeutic strategies. This event requires that antigen-presenting cells present tumor-associated antigens (Ag) on their MHC class-I molecule, in a process termed cross-presentation. Dendritic cells (DC) are particularly keen on this task and can induce the cross-priming of CD8(+) T cells, when exposed to danger or inflammatory signals that stimulate their activation. Type I interferons (IFN-I), a family of long-known immunostimulatory cytokines, have been proven to produce optimal activation signal for DC-induced cross-priming. Recent in vitro and in vivo evidences have suggested that IFN-I-stimulated cross-priming by DC against tumor-associated Ag is a key mechanism for cancer immunosurveillance and may be usefully exploited to boost anti-tumor CD8(+) T-cell responses. Here, we will review the cross-presentation properties of different DC subsets, with special focus on cell-associated and tumor Ag, and discuss how IFN-I can modify this function, with the aim of identifying more specific and effective strategies for improving anticancer responses.

Interleukin-4 but not gamma interferon production correlates with the severity of murine cutaneous leishmaniasis.

PubMed Central

Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T

1993-01-01

For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376

Impaired capacity for upregulation of MHC class II in tumor-associated microglia.

PubMed

Schartner, Jill M; Hagar, Aaron R; Van Handel, Michelle; Zhang, Leying; Nadkarni, Nivedita; Badie, Behnam

2005-09-01

Immunotherapy for malignant gliomas is being studied as a possible adjunctive therapy for this highly fatal disease. Thus far, inadequate understanding of brain tumor immunology has hindered the design of such therapies. For instance, the role of microglia and macrophages, which comprise a significant proportion of tumor-infiltrating inflammatory cells, in the regulation of the local anti-tumor immune response is poorly understood. To study the response of microglia and macrophages to known activators in brain tumors, we injected CpG oligodeoxynucleotide (ODN), interferon-gamma (IFN-gamma), and IFN-gamma/LPS into normal and intracranial RG2 glioma-bearing rodents. Microglia/macrophage infiltration and their surface expression of MHC class II B7.1 and B7.2 was examined by flow cytometry. Each agent evaluated yielded a distinct microglia/macrophage response: CpG ODN was the most potent inducer of microglia/macrophage infiltration and B7.1 expression, while IFN-gamma resulted in the highest MHC-II expression in both normal and tumors. Regardless of the agent injected, however, MHC-II induction was significantly muted in tumor microglia/macrophage as compared with normal brain. These data suggest that microglia/macrophage responsiveness to activators can vary in brain tumors when compared with normal brain. Understanding the mechanism of these differences may be critical in the development of novel immunotherapies for malignant glioma. (c) 2005 Wiley-Liss, Inc.

Treatment of epidermoid tumors with gamma knife radiosurgery: Case series.

PubMed

Vasquez, Javier A Jacobo; Fonnegra, Julio R; Diez, Juan C; Fonnegra, Andres

2016-01-01

Epidermoid tumors (ETs) are benign lesions that are treated mainly by means of surgical resection, with overall good results. External beam radiotherapy is an alternative treatment for those recurrent tumors, in which a second surgery might not be the best choice for the patient. A little information exists about the effectiveness of gamma knife radiosurgery for the treatment of newly diagnosed and recurrent ETs. We present three cases of ETs treated with gamma knife radiosurgery. Case 1 is a 21-year-old female with an ET located in the left cerebellopontine angle (CPA) with symptoms related to VIII cranial nerve dysfunction. Symptom control was achieved and maintained after single session radiosurgery with gamma knife. Case 2 is a 59-year-old female patient with the history of trigeminal neuralgia secondary to a recurrent ET located in the left CPA. Significant pain improvement was achieved after treatment with gamma knife radiosurgery. Case 3 is a 29-year-old male patient with a CPA ET causing long lasting trigeminal neuralgia, pain relief was achieved in this patient after gamma knife radiosurgery. Long-term symptom relief was achieved in all three cases proving that gamma knife radiosurgery is a good and safe alternative for patients with recurrent or nonsurgically treated ETs.

Leksell Gamma Knife radiosurgery of the jugulotympanic glomus tumor: long-term results.

PubMed

Liscak, Roman; Urgosik, Dusan; Chytka, Tomas; Simonova, Gabriela; Novotny, Josef; Vymazal, Josef; Guseynova, Khumar; Vladyka, Vilibald

2014-12-01

Glomus tumors usually display indolent behavior, and the effectiveness of radiation in stopping their growth can be assessed after long-term follow-up. Currently only midterm results of radiosurgery are available, so the authors included patients treated by Gamma Knife at least 10 years ago in this study to obtain a perspective of long-term results. During the period from 1992 to 2003, the Gamma Knife was used to treat 46 patients with glomus tumors. The age of the patients ranged from 21 to 79 years (median 56 years). Gamma Knife radiosurgery was the primary treatment in 17 patients (37%). Open surgery preceded radiosurgery in 46% of cases, embolization in 17%, and fractionated radiotherapy in 4%. The volume of the tumor ranged from 0.2 to 24.3 cm(3) (median 3.6 cm(3)). The minimal dose to the tumor margin ranged between 10 and 30 Gy (median 20 Gy). One patient was lost for follow-up after radiosurgery. Clinical follow-up was available in 45 patients and 44 patients were followed with MRI in a follow-up period that ranged from 12 to 217 months (median 118 months). Neurological deficits improved in 19 (42%) of 45 patients and deteriorated in 2 patients (4%). Tumor size decreased in 34 (77%) of 44 patients with imaging follow-up, while an increase in volume was observed in 1 patient (2%) 182 months after radiosurgery and Gamma Knife treatment was repeated. One patient underwent another Gamma Knife treatment for secondary induced meningioma close to the glomus tumor 98 months after initial radiosurgical treatment. Seven patients died 22-96 months after radiosurgery (median 48 months), all for unrelated reasons. Radiosurgery has proved to be a safe treatment with a low morbidity rate and a reliable long-term antiproliferative effect.

Treatment of trypanosome-infected mice with exogenous interferon, interferon inducers, or antibody to interferon

NASA Technical Reports Server (NTRS)

Degee, Antonie L. W.; Mansfield, John M.; Sonnenfeld, Gerald

1986-01-01

Earlier studies have demonstrated that mice resistant to Trypanosoma brucei rhodesiense (the B10.BR/SgSnJ strain) produces, upon infection by this parasite, two peaks of serum interferon (IFN), while the susceptible mice (C3HeB/FeJ) produces no IFN. In the present study, survival times were compared for B10.BR/SgSnJ, C3HeB/FeJ, and CBA/J (an intermediately resistant strain) mice that were injected, prior to infection with the parasite, with either of the following three preparations (1) IFN-gamma, (2) an antibody to IFN-gamma and (3) polyriboinosinic-polyribocytidylic acid (to induce IFN-alpha/beta). No effect on the survival times of mice by any of these preparations could be demonstrated, contrary to some previous reports.

Interferon-gamma improves impaired dentinogenic and immunosuppressive functions of irreversible pulpitis-derived human dental pulp stem cells

PubMed Central

Sonoda, Soichiro; Yamaza, Haruyoshi; Ma, Lan; Tanaka, Yosuke; Tomoda, Erika; Aijima, Reona; Nonaka, Kazuaki; Kukita, Toshio; Shi, Songtao; Nishimura, Fusanori; Yamaza, Takayoshi

2016-01-01

Clinically, irreversible pulpitis is treated by the complete removal of pulp tissue followed by replacement with artificial materials. There is considered to be a high potential for autologous transplantation of human dental pulp stem cells (DPSCs) in endodontic treatment. The usefulness of DPSCs isolated from healthy teeth is limited. However, DPSCs isolated from diseased teeth with irreversible pulpitis (IP-DPSCs) are considered to be suitable for dentin/pulp regeneration. In this study, we examined the stem cell potency of IP-DPSCs. In comparison with healthy DPSCs, IP-DPSCs expressed lower colony-forming capacity, population-doubling rate, cell proliferation, multipotency, in vivo dentin regeneration, and immunosuppressive activity, suggesting that intact IP-DPSCs may be inadequate for dentin/pulp regeneration. Therefore, we attempted to improve the impaired in vivo dentin regeneration and in vitro immunosuppressive functions of IP-DPSCs to enable dentin/pulp regeneration. Interferon gamma (IFN-γ) treatment enhanced in vivo dentin regeneration and in vitro T cell suppression of IP-DPSCs, whereas treatment with tumor necrosis factor alpha did not. Therefore, these findings suggest that IFN-γ may be a feasible modulator to improve the functions of impaired IP-DPSCs, suggesting that autologous transplantation of IFN-γ-accelerated IP-DPSCs might be a promising new therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:26775677

Annexin V Incorporated into Influenza Virus Particles Inhibits Gamma Interferon Signaling and Promotes Viral Replication

PubMed Central

Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten

2014-01-01

ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID

Gamma Interferon Release Assays for Detection of Mycobacterium tuberculosis Infection

PubMed Central

Denkinger, Claudia M.; Kik, Sandra V.; Rangaka, Molebogeng X.; Zwerling, Alice; Oxlade, Olivia; Metcalfe, John Z.; Cattamanchi, Adithya; Dowdy, David W.; Dheda, Keertan; Banaei, Niaz

2014-01-01

SUMMARY Identification and treatment of latent tuberculosis infection (LTBI) can substantially reduce the risk of developing active disease. However, there is no diagnostic gold standard for LTBI. Two tests are available for identification of LTBI: the tuberculin skin test (TST) and the gamma interferon (IFN-γ) release assay (IGRA). Evidence suggests that both TST and IGRA are acceptable but imperfect tests. They represent indirect markers of Mycobacterium tuberculosis exposure and indicate a cellular immune response to M. tuberculosis. Neither test can accurately differentiate between LTBI and active TB, distinguish reactivation from reinfection, or resolve the various stages within the spectrum of M. tuberculosis infection. Both TST and IGRA have reduced sensitivity in immunocompromised patients and have low predictive value for progression to active TB. To maximize the positive predictive value of existing tests, LTBI screening should be reserved for those who are at sufficiently high risk of progressing to disease. Such high-risk individuals may be identifiable by using multivariable risk prediction models that incorporate test results with risk factors and using serial testing to resolve underlying phenotypes. In the longer term, basic research is necessary to identify highly predictive biomarkers. PMID:24396134

Effect of treatment with interferon-gamma and concanavalin A on the course of infection of mice with Salmonella typhimurium strain LT-2

NASA Technical Reports Server (NTRS)

Gould, Cheryl L.; Sonnenfeld, Gerald

1987-01-01

The effect of pretreatment of mice with 34 units/day, for five days, of interferon-gamma (IFN-gamma) on the course of infection with LD50 of Salmonella typhimurium strain LT-2 was assessed, using two IFN preparations: (1) a hybridoma supernatant fluid containing concanavalin-A-induced IFN-gamma activity and (2) pure murine IFN-gamma produced by recombinant DNA technology. The hybridoma supernatant-treated Salmonella-infected mice were found to die faster than mice treated only with Salmonella. Pure murine IFN-gamma was found to protect infected mice significantly, with 95 percent of mice surviving LD50 infection. In contrast, the Salmonella-infected mice treated with hybridoma supernatant were found to die faster than the Salmonella-infected untreated controls. Mice treated with concanavalin A alone prior to infection with S. typhimurium died more quickly than the untreated infected controls, suggesting that contamination with concanavalin A had a detrimental effect on mice survival.

Use of interferon-gamma release assays in a health care worker screening program: experience from a tertiary care centre in the United States.

PubMed

Joshi, Manish; Monson, Thomas P; Woods, Gail L

2012-01-01

Interferon-gamma release assays including the QuantiFERON-TB Gold In-Tube test (QFT-GIT [Cellestis Ltd, Australia]) may be used in place of the tuberculin skin test (TST) in surveillance programs for Mycobacterium tuberculosis infection control. However, data on performance and practicality of the QFT-GIT in such programs for health care workers (HCWs) are limited. To assess the performance, practicality and reversion rate of the QFT-GIT among HCWs at a tertiary health care institution in the United States. Retrospective chart review of HCWs at Central Arkansas Veterans Healthcare System (Arkansas, USA) who underwent QFT-GIT testing as a part of their employee screening between November 1, 2008 and October 31, 2009. QFT-GIT was used to screen 3290 HCWs. The initial QFT-GIT was interpreted as positive for 129 (3.9%) HCWs, negative for 3155 (95.9%) and indeterminate for six (0.2%). Testing with QFT-GIT was repeated in 45 HCWs who had positive results on the initial test. The QFT-GIT reverted to negative in 18 (40.0%) HCWs, all of whom had negative TST status and initial interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL. The QFT-GIT test is feasible in large health care setting as an alternative to TST for M tuberculosis infection screening in HCWs but is not free from challenges. The major concerns are the high number of positive test results and high reversion rates on repeat testing, illustrating poor short-term reproducibility of positive QFT-GIT test results. These results suggest adopting a borderline zone between interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL, and cautious clinical interpretation of values in this range.

Type I Interferons as Stimulators of DC-Mediated Cross-Priming: Impact on Anti-Tumor Response

PubMed Central

Schiavoni, Giovanna; Mattei, Fabrizio; Gabriele, Lucia

2013-01-01

Induction of potent tumor-specific cytotoxic T-cell responses is a fundamental objective in anticancer therapeutic strategies. This event requires that antigen-presenting cells present tumor-associated antigens (Ag) on their MHC class-I molecule, in a process termed cross-presentation. Dendritic cells (DC) are particularly keen on this task and can induce the cross-priming of CD8+ T cells, when exposed to danger or inflammatory signals that stimulate their activation. Type I interferons (IFN-I), a family of long-known immunostimulatory cytokines, have been proven to produce optimal activation signal for DC-induced cross-priming. Recent in vitro and in vivo evidences have suggested that IFN-I-stimulated cross-priming by DC against tumor-associated Ag is a key mechanism for cancer immunosurveillance and may be usefully exploited to boost anti-tumor CD8+ T-cell responses. Here, we will review the cross-presentation properties of different DC subsets, with special focus on cell-associated and tumor Ag, and discuss how IFN-I can modify this function, with the aim of identifying more specific and effective strategies for improving anticancer responses. PMID:24400008

Use of Piezoelectric Immunosensors for Detection of Interferon-Gamma Interaction with Specific Antibodies in the Presence of Released-Active Forms of Antibodies to Interferon-Gamma

PubMed Central

Don, Elena; Farafonova, Olga; Pokhil, Suzanna; Barykina, Darya; Nikiforova, Marina; Shulga, Darya; Borshcheva, Alena; Tarasov, Sergey; Ermolaeva, Tatyana; Epstein, Oleg

2016-01-01

In preliminary ELISA studies where released-active forms (RAF) of antibodies (Abs) to interferon-gamma (IFNg) were added to the antigen-antibody system, a statistically significant difference in absorbance signals obtained in their presence in comparison to placebo was observed. A piezoelectric immunosensor assay was developed to support these data and investigate the effects of RAF Abs to IFNg on the specific interaction between Abs to IFNg and IFNg. The experimental conditions were designed and optimal electrode coating, detection circumstances and suitable chaotropic agents for electrode regeneration were selected. The developed technique was found to provide high repeatability, intermediate precision and specificity. The difference between the analytical signals of RAF Ab samples and those of the placebo was up to 50.8%, whereas the difference between non-specific controls and the placebo was within 5%–6%. Thus, the piezoelectric immunosensor as well as ELISA has the potential to be used for detecting the effects of RAF Abs to IFNg on the antigen-antibody interaction, which might be the result of RAF’s ability to modify the affinity of IFNg to specific/related Abs. PMID:26791304

Stress-induced alterations in interferon production and class II histocompatibility antigen expression

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Cunnick, J. E.; Armfield, A. V.; Wood, P. G.; Rabin, B. S.

1992-01-01

Mild electric foot-shock has been shown to be a stressor that can alter immune responses. Male Lewis rats were exposed to one session of 16 5.0-s 1.6-mA foot-shocks. Production of interferon-gamma by splenocytes in response to concanavalin-A was decreased in spleens from the shocked rats compared to control spleens. Spleen cells from rats treated with nadolol, a peripherally acting beta-adrenergic receptor antagonist, and then shocked, showed dose-dependent attenuation of the suppression of interferon-gamma production. This suggests that catecholamines mediate shock-induced suppression of interferon-gamma production. The percentage of splenic mononuclear cells expressing class II histocompatibility (Ia) antigens on their surfaces from spleens of shocked rats was determined by flow cytometry. Significantly decreased class II positive mononuclear cells were present in the spleens of shocked rats in comparison to the spleens of control rats. This may reflect an alteration of cell trafficking or decreased production of class II antigens.

Important role of interferon regulatory factor (IRF)-3 in the interferon response of mouse macrophages upon infection by Newcastle disease virus.

PubMed

Wilden, Holger; Schirrmacher, Volker; Fournier, Philippe

2011-08-01

Newcastle disease virus (NDV) is an interesting agent for activating innate immune activity in macrophages including secretion of TNF-α and IFN-α, upregulation of TRAIL and activation of NF-κB and iNOS. However, the molecular mechanism of such cellular activities remains largely unknown. Tumor selectivity of replication of NDV has been described to be linked to deviations in tumor cells of the type I interferon response. We therefore focused on the interferon response to NDV of macrophages as part of innate anti-viral and anti-tumor activity. In particular, we investigated the functional significance of the interferon regulatory factor genes (IRF)-3 and IRF-7. Deletion of the IRF-3 or IRF-7 gene was found to increase susceptibility of mouse macrophages to virus infection. Surprisingly, NDV replicated better in IRF-3 KO than in IRF-7 KO macrophages. Further analysis showed that IRF-3 KO macrophages have a lower basal and NDV-induced RIG-I expression in comparison to IRF-7 KO macrophages. This might explain why, in IRF-3 KO macrophages, the secretion of type I interferons after NDV infection is delayed, when compared to IRF-7 KO and wild-type macrophages. In addition, IRF-3 KO cells showed reduced NDV-induced levels of IRF-7. This effect could be prevented by priming the cells first by interferon-α. Further results indicated that an early production of type I interferon rather than high maximal levels at later time points are important for resistance to infection by NDV. In conclusion, these results demonstrate an important role of IRF-3 for the innate anti-viral response to NDV of mouse macrophages.

Prevalence of scrub typhus in pyrexia of unknown origin and assessment of interleukin-8, tumor necrosis factor-alpha, and interferon-gamma levels in scrub typhus-positive patients.

PubMed

Rizvi, Meher; Sultan, Asfia; Chowdhry, Madhav; Azam, Mohd; Khan, Fatima; Shukla, Indu; Khan, Haris M

2018-01-01

Scrub typhus is lesser known cause of fever of unknown origin in India. Even if there have been reports documenting the prevalence of scrub typhus in different parts of India, it is still an unknown entity, and clinicians usually do not consider it as differential diagnosis. The present study was performed to document the prevalence of scrub typhus among febrile patients in western part of Uttar Pradesh and to assess the clinical profile of infected patients on the one hand and knowledge, attitude, and practices among clinicians on the other. A total of 357 adult patients with fever of more than 5-day duration were recruited. All patients underwent complete physical examination, and detailed clinical history was elicited as per predesigned pro forma. After primary screening to rule out malaria, enteric fever, and leptospirosis infection, secondary screening for scrub typhus was done by rapid screen test and IgM ELISA. Scrub typhus infection was positive in 91 (25.5%) cases. The most common symptoms among the patients were fever (100%), pain in abdomen (79.1%), pedal edema 56 (61.5%), rash 44 (48.3%), headache 44 (48.3%), vomiting 42 (46.1%), constipation 33 (36.2%), cough 28 (30.7%), and lymphadenopathy 20 (21.9%). The median values of interleukin-8, interferon-gamma, and tumor necrosis factor-alpha in healthy controls were 15.54 pg/ml, 7.77 pg/ml, and 54.1 pg/ml, respectively, while the median values of these cytokines in scrub typhus-positive patients were 21.04 pg/ml, 8.74 pg/ml, and 73.8 pg/ml, respectively. Our results highlight that scrub typhus infection is an important cause of pyrexia of unknown origin, and active surveillance is necessary to assess the exact magnitude and distribution of the disease.

Individual and combined tumoricidal effects of dexamethasone and interferons on human leukocyte cell lines.

PubMed

Pan, L Y; Guyre, P M

1988-02-01

We investigated the influence of glucocorticoids on two effects of interferons (IFNs) which are thought to relate to their antitumor actions: cytotoxic activity and induction of HLA antigen expression. We treated human myeloid cell lines (U-937, HL-60, THP-1, K-562, and KG-1a), and T-(MOLT-4) and B- (Daudi) lymphoblastic cell lines with concentrations of IFN-alpha, IFN-gamma, and dexamethasone (Dex) which are commonly achieved in the circulation following therapeutic administration. The results show that for every cell line except Daudi, the greatest inhibition of cell growth occurred when IFN-gamma and Dex treatments were combined. The advantage of combined IFN-gamma and Dex treatment over treatment with either agent alone was most dramatic for the three cell lines (U-937, HL-60, and THP-1) which have monocytoid characteristics. There was also more growth inhibition by the combination of IFN-alpha and Dex than by either agent alone for all seven cell lines tested. The induction of HLA antigen expression by IFN-alpha and IFN-gamma, an effect which could increase recognition of the tumor cells by the immune system, was as great or greater in the presence of Dex as in its absence. These results demonstrate that glucocorticoids do not inhibit, and in some cases enhance, two effects of IFNs that appear to be related to their antitumor actions: inhibition of tumor cell proliferation and enhancement of HLA antigen expression.

[Gamma interferon: basics aspects, clinic significance and terapeutic uses].

PubMed

Mata-Espinosa, Dulce A; Hernández-Pando, Rogelio

2008-01-01

Interferons are a family of pleiotropic cytokines, their name was assigned because of their anti-replicative viral activity. IFNgamma or immune type II interferon does not share receptors with the type I interferon, its structure is different and its gene is located in different chromosome, although its biologic effects are similar. Along of several years of research, it has been found that IFNgamma enhances the transcription of genes involved in immunomodulation, antiviral responses and antitumoral activities. Regarding to the immune system, IFNgamma increases the cytotoxic and phagocytic activity of macrophages and upregulates the expression of major histocompatibility complex (MHC) class I and class II molecules in dendritics cells and other antigen presenting cells. IFNgamma also promotes the development and differentiation of naive CD4+ T lymphocytes to Th1 helper subset. Indeed, this cytokine has a key role in the control of bacterial, micotic, viral and parasitic infections. Depending of the micro-environment, IFNgamma has a dual role as pro or anti inflammatory cytokine. Novel therapeutic strategies are currently being developed with the aim to enhance the immune response or replace IFNgamma gene abnormal expression with beneficial results in humans, being recombinant IFNgamma safe and well tolerated.

Comparison of Tuberculin Skin Test result and interferon gamma response to human PPD in BCG scar positive and negative children.

PubMed

Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza

2014-03-01

The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.

Application of carbon-ion beams or gamma-rays on primary tumors does not change the expression profiles of metastatic tumors in an in vivo murine model.

PubMed

Tamaki, Tomoaki; Iwakawa, Mayumi; Ohno, Tatsuya; Imadome, Kaori; Nakawatari, Miyako; Sakai, Minako; Tsujii, Hirohiko; Nakano, Takashi; Imai, Takashi

2009-05-01

To clarify how carbon-ion radiotherapy (C-ion) on primary tumors affects the characteristics of subsequently arising metastatic tumor cells. Mouse squamous cell carcinomas, NR-S1, in synergic C3H/HeMsNrs mice were irradiated with a single dose of 5-50 Gy of C-ion (290 MeV per nucleon, 6-cm spread-out Bragg peak) or gamma-rays ((137)Cs source) as a reference beam. The volume of the primary tumors and the number of metastatic nodules in lung were studied, and histologic analysis and microarray analysis of laser-microdissected tumor cells were also performed. Including 5 Gy of C-ion and 8 Gy of gamma-rays, which did not inhibit the primary tumor growth, all doses used in this study inhibited lung metastasis significantly. Pathologic findings showed no difference among the metastatic tumor nodules in the nonirradiated, C-ion-irradiated, and gamma-ray-irradiated groups. Clustering analysis of expression profiles among metastatic tumors and primary tumors revealed a single cluster consisting of metastatic tumors different from their original primary tumors, indicating that the expression profiles of the metastatic tumor cells were not affected by the local application of C-ion or gamma-ray radiotherapy. We found no difference in the incidence and histology, and only small differences in expression profile, of distant metastasis between local C-ion and gamma-ray radiotherapy. The application of local radiotherapy per se or the type of radiotherapy applied did not influence the transcriptional changes caused by metastasis in tumor cells.

Secretion of interferon gamma from human immune cells is altered by exposure to tributyltin and dibutyltin.

PubMed

Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret

2015-05-01

Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h, and 6 day exposures to TBT (200 - 2.5 nM) and DBT (5 - 0.05 µM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from immune cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. © 2013 Wiley Periodicals, Inc.

Augmentation of immune cell activity against tumor cells by Rauwolfia radix.

PubMed

Jin, Guang-Bi; Hong, Tie; Inoue, Satoshi; Urano, Tomohiko; Cho, Shigefumi; Otsu, Koji; Kitahara, Maya; Ouchi, Yasuyoshi; Cyong, Jong-Chol

2002-08-01

In this study, we investigated the effect of Rauwolfia radix on heat shock protein (HSP) 70 expression and cytotoxicity against tumor cells in activated human T cells. When activated T cells were cultured with Rauwolfia radix for 18 h, HSP70 expression after heat shock was remarkably increased, and cytotoxicity against T98G tumor cells was augmented. Moreover, Rauwolfia radix also enhanced the cytotoxicity of heat shocked activated T cells against Molt-4 and T98G tumor cells. Secretions of interferon-gamma (IFN-gamma) and tumor necrosis alpha (TNF-alpha), due to Concanavalin A (Con A) stimulation, were increased by Rauwolfia radix in activated T cells. To investigate the antitumor effect in vivo, EL-4 tumor-bearing mice were administered with Rauwolfia radix in drinking water. The survival period of the Rauwolfia radix treatment group was significantly prolonged compared with that of the control group. Reserpine, the major active ingredient of Rauwolfia radix, also enhanced the cytotoxicity of activated T cells against Molt-4 and T98G tumor cells, and prolonged the survival period of EL-4 tumor-bearing mice. Taken together, our results suggest that Rauwolfia radix can enhance the activity of immune cells against tumor cells.

Human macrophage gamma interferon decreases gene expression but not replication of Mycobacterium tuberculosis: analysis of the host-pathogen reciprocal influence on transcription in a comparison of strains H37Rv and CMT97.

PubMed

Cappelli, G; Volpe, P; Sanduzzi, A; Sacchi, A; Colizzi, V; Mariani, F

2001-12-01

Mycobacterium tuberculosis is an intracellular pathogen that readily survives and replicates in human macrophages (MPhi). Host cells have developed different mycobactericidal mechanisms, including the production of inflammatory cytokines. The aim of this study was to compare the MPhi response, in terms of cytokine gene expression, to infection with the M. tuberculosis laboratory strain H37Rv and the clinical M. tuberculosis isolate CMT97. Both strains induce the production of interleukin-12 (IL-12) and IL-16 at comparable levels. However, the clinical isolate induces a significantly higher and more prolonged MPhi activation, as shown by reverse transcription-PCR analysis of IL-1beta, IL-6, IL-10, transforming growth factor beta, tumor necrosis factor alpha, and gamma interferon (IFN-gamma) transcripts. Interestingly, when IFN-gamma transcription is high, the number of M. tuberculosis genes expressed decreases and vice versa, whereas no mycobactericidal effect was observed in terms of bacterial growth. Expression of 11 genes was also studied in the two M. tuberculosis strains by infecting resting or activated MPhi and compared to bacterial intracellular survival. In both cases, a peculiar inverse correlation between expression of these genes and multiplication was observed. The number and type of genes expressed by the two strains differed significantly.

Interferon-gamma inhibits intestinal restitution by preventing gap junction communication between enterocytes.

PubMed

Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J

2007-06-01

Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.

Complementation of a mutant cell line: central role of the 91 kDa polypeptide of ISGF3 in the interferon-alpha and -gamma signal transduction pathways.

PubMed Central

Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M

1993-01-01

Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454

[Allergic asthma and interleukins 2, 4, 5, 6 and 12 and gamma interferon levels].

PubMed

Bastida Segura, Diana Lyzbeth; López Velásquez, Benjamin; Castrejón Vázquez, María Isabel; Galicia Tapía, Jorge; Cano Altamirano, Silvia; Miranda Feria, Alfonso Javier

2004-01-01

Asthma is an inflammatory chronic illness, in which mastocyt cells, basophils, T lymphocytes, eosinophils and cytokines play a role. Its association with the production of TH2 cytokines is not well known, but it is considered an aberrant immune response, yielding the activation and recruitment of a number of effector cells (mastocyts/eosinophils) and the appearance of clinical symptoms. To determine the serum values of the interleukins 2, 4, 5, 6 and 12 and gamma interferon in relation to the severity degree of asthma and the time of immunotherapy in patients with stable chronic allergic bronchial asthma. Clinical records of allergic asthmatic patients from the external consultation at Servicio de Alergia e Immunología Clínica were reviewed in a period of 12 months (1st January 2002 to 1st January 2003) and those of healthy volunteers, forming three groups: Group 1, allergic asthmatics with immunotherapy less than 24 months; Group 2, allergic asthmatics with more than 24 months of immunotherapy, and Group 3, healthy volunteers (control group). Previous informed consent, a serum sample was taken of all subjects. Ninety-two subjects were included: 41 (45%) allergic asthmatics and 51 (55%) healthy volunteers. Significant differences were found in interleukins 2, 4, 5, 6 and 12 levels between healthy volunteers and asthmatics without relating the immunotherapy time. In the total group gamma interferon levels were not found. A relation of interleukins Th2 levels with the severity degree of asthma was not found. Differences of serum interleukins Th1 and Th2 in allergic patients related to immunotherapy time were not significant; even though, irrespective of immunotherapy time, IgG levels were always high. Patients with allergic asthma have a predominance of serum interleukins Th2 and, despite of the immunotherapy, in the maintaining phase, these continue high, which may be due to an immune system dysregulation maybe including other factors. Immunotherapy continues

Effect of interferon-gamma on complement gene expression in different cell types.

PubMed

Lappin, D F; Guc, D; Hill, A; McShane, T; Whaley, K

1992-01-15

We have studied the expression of the complement components C2, C3, factor B, C1 inhibitor (C1-inh), C4-binding protein (C4-bp) and factor H in human peripheral blood monocytes, skin fibroblasts, umbilical vein endothelial cells (HUVEC) and the human hepatoma cell line G2 (Hep G2) in the absence and the presence of interferon-gamma (IFN-gamma). E.l.i.s.a. performed on culture fluids, run-on transcription assays, Northern blot and double-dilution dot-blot techniques confirmed that monocytes expressed all six components, whereas fibroblasts, HUVEC and HepG2 each expressed five of the six components. Fibroblasts and HUVEC did not synthesize C4-bp, and Hep G2 did not produce factor H. In addition to these differences, the synthesis rates of C3, C1-inh and factor H were not the same in all cell types. However, the synthesis rates of C2 and factor B were similar in all four cell types. The half-lives of the mRNAs were shorter in monocytes than in other cell types. Monocyte factor H mRNA had a half-life of 12 min in monocytes, compared with over 3 h in fibroblasts and HUVEC. The instability of factor H mRNA in monocytes may contribute to their low factor H secretion rate. IFN-gamma produced dose-dependent stimulation of C2, factor B, C1-inh, C4-bp and factor H synthesis by all cell types expressing these proteins, but decreased C3 synthesis in all four cell types. Cell-specific differences in the response to IFN-gamma were observed. The increased rates of transcription of the C1-inh and factor H genes in HUVEC were greater than in other cell types, while the increased rate of transcription of the C2, factor B and C1-inh genes in Hep G2 cells was less than in other cell types. IFN-gamma did not affect the stability of C3, factor H or C4 bp mRNAs, but increased the stability of factor B and C1-inh mRNAs and decreased the stability of C2 mRNA. Although these changes occurred in all four cell types studied, the half-life of C1-inh mRNA in monocytes was increased almost 4-fold

The role of regulatory T cells in the control of natural killer cells: relevance during tumor progression.

PubMed

Ghiringhelli, Francois; Ménard, Cédric; Martin, Francois; Zitvogel, Laurence

2006-12-01

Tumor immunosurveillance relies on cognate immune effectors [lymphocytes and interferon-gamma (IFN-gamma)] and innate immunity [natural killer (NK) cells, natural killer group 2, member D (NKG2D) ligands, perforin/granzyme, and tumor necrosis factor-related apoptosis-inducing ligand]. In parallel, tumor cells promote the expansion of CD4(+)CD25(+) regulatory T cells (Tregs) that counteract T-cell-based anti-tumor immunity. Moreover, accumulating evidence points to a critical role for Tregs in dampening NK cell immune responses. This review summarizes the findings showing that Tregs suppress NK cell effector functions in vitro and in vivo, i.e. homeostatic proliferation, cytotoxicity, and interleukin-12-mediated IFN-gamma production. The molecular mechanism involve selective expression of membrane-bound transforming growth factor-beta on Tregs, which downregulate NKG2D expression on NK cells in vitro and in vivo. The regulatory events dictating NK cell suppression by Tregs have been studied and are discussed. The pathological relevance of the Treg-NK cell interaction has been brought up in tumor models and in patients with cancer. Consequently, inhibition of Tregs through pharmacological interventions should be considered during NK-cell-based immunotherapy of cancer.

Association of monoclonal expansion of Epstein-Barr virus-negative CD158a+ NK cells secreting large amounts of gamma interferon with hemophagocytic lymphohistiocytosis.

PubMed

López-Alvarez, María R; Martínez-Sánchez, María V; Salgado-Cecilia, María G; Campillo, José A; Heine-Suñer, Damian; Villar-Permuy, Florentina; Fuster, José L; Bas, Agueda; Gil-Herrera, Juana; Muro, Manuel; García-Alonso, Ana M; Alvarez-López, María R; Minguela, Alfredo

2009-01-01

We report the first case of hemophagocytic lymphohistiocytosis (HLH) induced by the monoclonal expansion of Epstein-Barr virus (EBV)-negative NK cells. Consanguinity of the patient's parents made it necessary to discard familial HLH in the patient and her sister with identical HLA markers and demonstrate that no cause other than the expansion of NK cells, which secrete high levels of gamma interferon, was inducing HLH in this patient.

STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors.

PubMed

Deng, Liufu; Liang, Hua; Xu, Meng; Yang, Xuanming; Burnette, Byron; Arina, Ainhoa; Li, Xiao-Dong; Mauceri, Helena; Beckett, Michael; Darga, Thomas; Huang, Xiaona; Gajewski, Thomas F; Chen, Zhijian J; Fu, Yang-Xin; Weichselbaum, Ralph R

2014-11-20

Ionizing radiation-mediated tumor regression depends on type I interferon (IFN) and the adaptive immune response, but several pathways control I IFN induction. Here, we demonstrate that adaptor protein STING, but not MyD88, is required for type I IFN-dependent antitumor effects of radiation. In dendritic cells (DCs), STING was required for IFN-? induction in response to irradiated-tumor cells. The cytosolic DNA sensor cyclic GMP-AMP (cGAMP) synthase (cGAS) mediated sensing of irradiated-tumor cells in DCs. Moreover, STING was essential for radiation-induced adaptive immune responses, which relied on type I IFN signaling on DCs. Exogenous IFN-? treatment rescued the cross-priming by cGAS or STING-deficient DCs. Accordingly, activation of STING by a second messenger cGAMP administration enhanced antitumor immunity induced by radiation. Thus radiation-mediated antitumor immunity in immunogenic tumors requires a functional cytosolic DNA-sensing pathway and suggests that cGAMP treatment might provide a new strategy to improve radiotherapy. Copyright © 2014 Elsevier Inc. All rights reserved.

Roles of CD4+ T Cells and Gamma Interferon in Protective Immunity against Babesia microti Infection in Mice

PubMed Central

Igarashi, Ikuo; Suzuki, Reiko; Waki, Seiji; Tagawa, Yoh-Ichi; Seng, Seyha; Tum, Sothyra; Omata, Yoshitaka; Saito, Atsushi; Nagasawa, Hideyuki; Iwakura, Yohichiro; Suzuki, Naoyoshi; Mikami, Takeshi; Toyoda, Yutaka

1999-01-01

Babesia microti produces a self-limiting infection in mice, and recovered mice are resistant to reinfection. In the present study, the role of T cells in protective immunity against challenge infection was examined. BALB/c mice which recovered from primary infection showed strong protective immunity against challenge infection. In contrast, nude mice which failed to control the primary infection and were cured with an antibabesial drug did not show protection against challenge infection. Treatment of immune mice with anti-CD4 monoclonal antibody (MAb) diminished the protective immunity against challenge infection, but treatment with anti-CD8 MAb had no effect on the protection. Transfer of CD4+ T-cell-depleted spleen cells resulted in higher parasitemia than transfer of CD8+ T-cell-depleted spleen cells. A high level of gamma interferon (IFN-γ), which was produced by CD4+ T cells, was observed for the culture supernatant of spleen cells from immune mice, and treatment of immune mice with anti-IFN-γ MAb partially reduced the protection. Moreover, no protection against challenge infection was found in IFN-γ-deficient mice. On the other hand, treatment of immune mice with MAbs against interleukin-2 (IL-2), IL-4, or tumor necrosis factor alpha did not affect protective immunity. These results suggest essential requirements for CD4+ T cells and IFN-γ in protective immunity against challenge infection with B. microti. PMID:10417185

Interferon-gamma interferes with transforming growth factor-beta signaling through direct interaction of YB-1 with Smad3.

PubMed

Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao

2003-10-31

Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF

Sphingosine kinase inhibitor suppresses IL-18-induced interferon-gamma production through inhibition of p38 MAPK activation in human NK cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung

2008-09-12

Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less

Stress-induced release of HSC70 from human tumors.

PubMed

Barreto, Alfonso; Gonzalez, John Mario; Kabingu, Edith; Asea, Alexzander; Fiorentino, Susana

2003-04-01

In this study, we demonstrate that the pro-inflammatory cytokine interferon-gamma (IFN-gamma) induces the active release of the constitutive form of the 70-kDa heat shock protein (HSC70) from K562 erythroleukemic cells. Treatment of K562 cells with IFN-gamma induced the upregulation of the inducible form of the 70-kDa heat shock protein (HSP70), but not the constitutive form of HSC70 within the cytosol, in a proteasome-dependent manner. In addition, IFN-gamma induced the downregulation of surface-bound HSC70, but did not significantly alter surface-bound HSP70 expression. These findings indicate that HSC70 can be actively released from tumor cells and is indicative of a previously unknown mechanism by which immune modulators stimulate the release of intracellular HSC70. This mechanism may account for the potent chaperokine activity of heat shock proteins recently observed during heat shock protein-based immunotherapy against a variety of cancers.

Interferon-gamma receptor-deficiency renders mice highly susceptible to toxoplasmosis by decreased macrophage activation.

PubMed

Deckert-Schlüter, M; Rang, A; Weiner, D; Huang, S; Wiestler, O D; Hof, H; Schlüter, D

1996-12-01

Toxoplasma gondii may cause severe infections in immunocompromised patients including fetuses and those with AIDS. Among the factors mediating protection against T. gondii, IFN-gamma has gained special attention. To analyze the role of IFN-gamma in the early phase of toxoplasmosis, IFN-gamma receptor-deficient (IFN-gamma R0/0) mice were orally infected with low-virulent toxoplasms. IFN-gamma R0/0 mice died of the disease up to day 10 postinfection, whereas immunocompetent wild-type (WT) mice developed a chronic toxoplasmosis. Histopathology revealed that in IFN-gamma R0/0 mice, the parasite multiplied unrestrictedly in the small intestine, the intestinal lymphatic tissue, the liver, and the spleen. Ultimately, animals died of a necrotizing hepatitis. In WT mice, the same organs were effected, but multiplication of the parasite was effectively limited. Compared with WT mice, immunohistochemistry and flow cytometry demonstrated that in IFN-gamma R0/0 mice, macrophages were only marginally activated in response to the infection, as evidenced by a reduced expression of major histocompatability complex class II antigens. In addition, immunohistochemistry and RT-PCR showed a reduced production of the macrophage-derived cytokines tumor necrosis factor-alpha, inducible nitric oxide synthase, and IL-1 beta in the liver of IFN-gamma R0/0 mice. In contrast, activation of T cells, recruitment of immune cells to inflammatory foci, and anti-T. gondii IgM antibody production were unaffected by the mutation of the IFN-gamma R. Moreover, induction of IL-2, IL-4, and IL-10 mRNA transcripts in the liver was normal in IFN-gamma R0/0 mice. Adoptive transfer experiments revealed that the immune T cells of WT animals did not protect IFN-gamma R0/0 mice from lethal infection with highly virulent toxoplasms, whereas WT mice were significantly protected by the adoptive transfer. Based on these studies, we conclude that IFN-gamma is absolutely required for an efficient activation of

SU-E-T-81: A Study On Correlation Between Gamma Analysis for Midline and Lateralized Tumors Using VMAT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Syam; Anjana

Purpose: To evaluate the fluence for the midline and lateralized tumors for VMAT technique using 2D seven29 detector array combined with the Octavius phantom. Methods: 60 cases that are already being treated with volumetric modulated arc therapy (VMAT) have selected for this study. This includes tumors situated at the medial and lateral. Medial refers to the tumor situated at the midline of the body and lateral means toward the side or away from the midline of the body. Verification plans were created for each treatment plan in Varian Eclipse treatment planning system (version10, Varian medical systems, Palo Alto,CA) with themore » 2D Seven29 detector array and the Octavius phantom(PTW, Freiburg, Germany). Measurements were performed on a Varian Clinac 2100 iX, linear accelerator equipped with a millennium 120 leaf collimator. Analysis was done by comparing the fluence measured for the tumors situated on the midline and tumors situated laterally. Results: Fluence measured for all the delivered plans were analyzed using Verisoft software (PTW, Freiburg, Germany). The gamma pass percentage for midline tumors were found to be higher compared with the lateralized ones. The standard deviation between gamma values for midline and lateralized tumors is 2.18 and 3.5 respectively. Also the standard deviation between the point doses for midline and lateralized tumors is 0.38 and 0.29 respectively. The average gamma passing rate for midline tumors is 96.55% and for lateralized tumors are 94.94% for 3%DD and 3mm DTA criteria. From the T test, it was found that there is no significant difference between the gamma pass percentage between midline and lateralized tumors with p value of 0.28. Conclusion: There is no particular correlation found in the gamma pass criteria for midline and lateralized tumors.« less

Single-chain antigen recognition receptors that costimulate potent rejection of established experimental tumors.

PubMed

Haynes, Nicole M; Trapani, Joseph A; Teng, Michèle W L; Jackson, Jacob T; Cerruti, Loretta; Jane, Stephen M; Kershaw, Michael H; Smyth, Mark J; Darcy, Phillip K

2002-11-01

Tumor cells are usually weakly immunogenic as they largely express self-antigens and can down-regulate major histocompatability complex/peptide molecules and critical costimulatory ligands. The challenge for immunotherapies has been to provide vigorous immune effector cells that circumvent these tumor escape mechanisms and eradicate established tumors. One promising approach is to engineer T cells with single-chain antibody receptors, and since T cells require 2 distinct signals for optimal activation, we have compared the therapeutic efficacy of erbB2-reactive chimeric receptors that contain either T-cell receptor zeta (TCR-zeta) or CD28/TCR-zeta signaling domains. We have demonstrated that primary mouse CD8(+) T lymphocytes expressing the single-chain Fv (scFv)-CD28-zeta receptor have a greater capacity to secrete Tc1 cytokines, induce T-cell proliferation, and inhibit established tumor growth and metastases in vivo. The suppression of established tumor burden by cytotoxic T cells expressing the CD28/TCR-zeta chimera was critically dependent upon their interferon gamma (IFN-gamma) secretion. Our study has illustrated the practical advantage of engineering a T-cell signaling complex that codelivers CD28 activation, dependent only upon the tumor's expression of the appropriate tumor associated antigen.

The safety and efficacy of gamma knife surgery in management of glomus jugulare tumor

PubMed Central

2010-01-01

Background Glomus jugulare is a slowly growing, locally destructive tumor located in the skull base with difficult surgical access. The operative approach is, complicated by the fact that lesions may be both intra and extradural with engulfment of critical neurovascular structures. The tumor is frequently highly vascular, thus tumor resection entails a great deal of morbidity and not infrequent mortality. At timeslarge residual tumors are left behind. To decrease the morbidity associated with surgical resection of glomus jugulare, gamma knife surgery (GKS) was performed as an alternative in 13 patients to evaluate its safety and efficacy. Methods A retrospective review of 13 residual or unresectable glomus jagulare treated with GKS between 2004 and 2008.. Of these, 11 patients underwent GKS as the primary management and one case each was treated for postoperative residual disease and postembolization. The radiosurgical dose to the tumor margin ranged between 12-15 Gy. Results Post- gamma knife surgery and during the follow-up period twelve patients demonstrated neurological stability while clinical improvement was achieved in 5 patients. One case developed transient partial 7th nerve palsy that responded to medical treatment. In all patients radiographic MRI follow-up was obtained, the tumor size decreased in two cases and remained stable (local tumor control) in eleven patients. Conclusions Gamma knife surgery provids tumor control with a lowering of risk of developing a new cranial nerve injury in early follow-up period. This procedure can be safely used as a primary management tool in patients with glomus jugulare tumors, or in patients with recurrent tumors in this location. If long-term results with GKS are equally effective it will emerge as a good alternative to surgical resection. PMID:20819207

Gamma Knife radiosurgery for glomus jugulare tumors: a single-center series of 75 cases.

PubMed

Ibrahim, Ramez; Ammori, Mohannad B; Yianni, John; Grainger, Alison; Rowe, Jeremy; Radatz, Matthias

2017-05-01

OBJECTIVE Glomus jugulare tumors are rare indolent tumors that frequently involve the lower cranial nerves (CNs). Complete resection can be difficult and associated with lower CN injury. Gamma Knife radiosurgery (GKRS) has established its role as a noninvasive alternative treatment option for these often formidable lesions. The authors aimed to review their experience at the National Centre for Stereotactic Radiosurgery, Sheffield, United Kingdom, specifically the long-term tumor control rate and complications of GKRS for these lesions. METHODS Clinical and radiological data were retrospectively reviewed for patients treated between March 1994 and December 2010. Data were available for 75 patients harboring 76 tumors. The tumors in 3 patients were treated in 2 stages. Familial and/or hereditary history was noted in 12 patients, 2 of whom had catecholamine-secreting and/or active tumors. Gamma Knife radiosurgery was the primary treatment modality in 47 patients (63%). The median age at the time of treatment was 55 years. The median tumor volume was 7 cm 3 , and the median radiosurgical dose to the tumor margin was 18 Gy (range 12-25 Gy). The median duration of radiological follow-up was 51.5 months (range 12-230 months), and the median clinical follow-up was 38.5 months (range 6-223 months). RESULTS The overall tumor control rate was 93.4% with low CN morbidity. Improvement of preexisting deficits was noted in 15 patients (20%). A stationary clinical course and no progression of symptoms were noted in 48 patients (64%). Twelve patients (16%) had new symptoms or progression of their preexisting symptoms. The Kaplan-Meier actuarial tumor control rate was 92.2% at 5 years and 86.3% at 10 years. CONCLUSIONS Gamma Knife radiosurgery offers a risk-versus-benefit treatment option with very low CN morbidity and stable long-term results.

IL-1 or TNF receptor gene deletion delays onset of encephalopathy and attenuates brain edema in experimental acute liver failure.

PubMed

Bémeur, Chantal; Qu, Hong; Desjardins, Paul; Butterworth, Roger F

2010-01-01

Previous reports suggested that brain-derived proinflammatory cytokines are involved in the pathogenesis of hepatic encephalopathy (HE) and brain edema in acute liver failure (ALF). To further address this issue, expression of interleukin-1beta (IL-1beta), tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) mRNAs were measured in the brains of mice with acute liver failure resulting from exposure to azoxymethane. In addition, time to severe encephalopathy (coma) was assessed in mice lacking genes coding for interferon-gamma, the tumor necrosis factor receptor-1 or the interleukin-1 type 1 receptor. Interleukin-1beta, tumor necrosis factor-alpha and interferon-gamma expression were quantified using RT-PCR. Significant increases in interleukin-1beta and tumor necrosis factor-alpha mRNA were observed in the frontal cortex of azoxymethane-treated wild-type mice at coma stages of encephalopathy. Interferon-gamma, however, could not be detected in the brains of these animals. Onset of severe encephalopathy (coma) and brain edema in ALF mice were significantly delayed in interleukin-1 type 1 receptor or tumor necrosis factor receptor-1 knockout mice. Deletion of the interferon-gamma gene, on the other hand, had no significative effect on the neurological status or brain water content of acute liver failure mice. These results demonstrate that toxic liver injury resulting from exposure to azoxymethane is associated with selective induction of proinflammatory cytokines in the brain and that deletion of tumor necrosis factor receptor-1 or interlukin-1 type 1 receptor delays the onset of coma and brain edema in this model of acute liver failure. These findings further support a role for selective brain-derived cytokines in the pathogenesis of the cerebral complications in acute liver failure and suggest that anti-inflammatory strategies could be beneficial in their prevention. Copyright 2009 Elsevier Ltd. All rights reserved.

Combination of hTERT knockdown and interferon-γ treatment inhibited angiogenesis and tumor progression in glioblastoma

PubMed Central

George, Joseph; Banik, Naren L.; Ray, Swapan K.

2009-01-01

Purpose The limitless invasive and proliferative capacities of tumor cells are associated with telomerase and expression of its catalytic component, human telomerase reverse transcriptase (hTERT). Interferon-γ (IFN-γ) modulates several cellular activities including signaling pathways and cell cycle through transcriptional regulation. Experimental Design Using a recombinant plasmid with hTERT siRNA cDNA, we down regulated hTERT during IFN-γ treatment in human glioblastoma SNB-19 and LN-18 cell lines and examined whether such a combination could inhibit angiogenesis and tumor growth in nude mice. In vitro angiogenesis assay was performed using co-culture of tumor cells with human microvascular endothelial cells. In vivo angiogenesis assay was performed using diffusion chambers under the dorsal skin of nude mice. In vivo imaging of intracerebral tumorigenesis and longitudinal solid tumor development studies were conducted in nude mice. Results In vitro and in vivo angiogenesis assays demonstrated inhibition of capillary-like network formation of microvascular endothelial cells and neovascularization under dorsal skin of nude mice, respectively. We observed inhibition of intracerebral tumorigenesis and subcutaneous solid tumor formation in nude mice after treatment with combination of hTERT siRNA and IFN-γ. Western blotting of solid tumor samples demonstrated significant down regulation of the molecules that regulate cell invasion, angiogenesis, and tumor progression. Conclusions Our study demonstrated that combination of hTERT siRNA and IFN-γ effectively inhibited angiogenesis and tumor progression through down regulation of molecules involved in these processes. Therefore, combination of hTERT siRNA and IFN-γ is a promising therapeutic strategy for controlling growth of human glioblastoma. PMID:19934306

Immunomodulatory intervention with Gamma interferon in mice with sepsis.

PubMed

Wang, Yu; Kong, Bing-Bing; Yang, Wen-Ping; Zhao, Xin; Zhang, Rong

2017-09-15

Sepsis-triggered immune paralysis including T-cell dysfunction increase susceptibility to infection. Gamma interferon (IFNg) exert beneficial effects in patients with sepsis. Herein, we speculated that IFNg may attenuate T-cell dysfunction induced by sepsis, although the mechanisms remain elusive. To test this hypothesis, we used a model based on cecal ligation and puncture (CLP) to induce sepsis in mice. Male C57BL/6 mice were pretreated with recombinant human IFNg (0.01μg/g of body weight) before CLP. The immunophenotyping of cell surface receptor expression, and regulatory T cells (CD4+CD25+Foxp3+) were quantified by flow cytometry. Immunohistochemical staining was performed to evaluate the loss of immune effector cells. Formation of IFNg and interleukin 4 (IL-4) in the spleen and plasma levels of TNF-α, IL-6, high-mobility group box 1 (HMGB1) were determined using enzyme-linked immunosorbent assay. IFNg markedly inhibited the reduction in cytokine secretion from lipopolysaccharide (LPS)-stimulated splenocytes. IFNg-treated mices had significantly decreased percentages of programmed cell death 1 (PD-1) receptors, increased the percentages of positive costimulatory receptor CD28 on CD4 T cells expressing. IFNg markedly reduced T-cell apoptosis through upregulating the expression of Bcl-2. CLP-induced formation of regulatory T cells in the spleen was abolished in IFNg -treated mices. Moreover, IFNg treatment reduced plasma levels of TNF-α, IL-6, HMGB1. IFNg can be a powerful regulator of immune function under sepsis conditions. Therefore, targeted immune-enhancement with IFNg may be a valid therapeutic approach in sepsis. Copyright © 2017 Elsevier Inc. All rights reserved.

Interleukin-7 gene-modified dendritic cells reduce pulmonary tumor burden in spontaneous murine bronchoalveolar cell carcinoma.

PubMed

Sharma, Sherven; Batra, Raj K; Yang, Seok Chul; Hillinger, Sven; Zhu, Li; Atianzar, Kimberly; Strieter, Robert M; Riedl, Karen; Huang, Min; Dubinett, Steven M

2003-11-01

The antitumor efficiency of dendritic cells transduced with an adenovirus vector expressing interleukin (IL)-7 (DC-AdIL-7) was evaluated in a murine model of spontaneous bronchoalveolar cell carcinoma. These transgenic mice (CC-10 TAg), expressing the SV40 large T antigen under the Clara cell promoter, develop bilateral multifocal pulmonary adenocarcinomas and die at 4 months as a result of progressive pulmonary tumor burden. Injection of DC-AdIL-7 in the axillary lymph node region (ALNR) weekly for 3 weeks led to a marked reduction in tumor burden with extensive lymphocytic infiltration of the tumors and enhanced survival. The antitumor responses were accompanied by the enhanced elaboration of interferon (IFN)-gamma and IL-12 as well as an increase in the antiangiogenic chemokines, IFN-gamma-inducible protein 10 (IP-10/CXCL10) and monokine induced by IFN-gamma (MIG/CXCL9). In contrast, production of the immunosuppressive mediators IL-10, transforming growth factor (TGF)-beta, prostaglandin E(2) (PGE(2)), and the proangiogenic modulator vascular endothelial growth factor (VEGF) decreased in response to DC-AdIL-7 treatment. Significant reduction in tumor burden in a model in which tumors develop in an organ-specific manner provides a strong rationale for further evaluation of DC-AdIL-7 in regulation of tumor immunity and its use in lung cancer genetic immunotherapy.

Adenoviral mediated interferon-alpha 2b gene therapy suppresses the pro-angiogenic effect of vascular endothelial growth factor in superficial bladder cancer.

PubMed

Adam, Liana; Black, Peter C; Kassouf, Wassim; Eve, Beryl; McConkey, David; Munsell, Mark F; Benedict, William F; Dinney, Colin P N

2007-05-01

Intravesical adenovirus mediated interferon-alpha gene transfer has a potent therapeutic effect against superficial human bladder carcinoma xenografts growing in the bladder of athymic nude mice. We determined whether the inhibition of angiogenesis might contribute to the antitumor effect. We treated several human urothelial carcinoma cells with adenovirus mediated interferon-alpha 2b and monitored its effects on the production of angiogenic factors using real-time reverse-transcription polymerase chain reaction, Western blotting, and immunohistochemical analysis and a gel shift based transcription factor array. To assess the role of adenovirus mediated interferon 2b in angiogenic activity we used in vitro invasion assays and evaluated the anti-angiogenic effects of adenovirus mediated interferon gene therapy in an orthotopic murine model of human superficial bladder cancer. In adenovirus mediated interferon-alpha infected 253J B-V cells vascular endothelial growth factor was decreased and anti-angiogenic interferon-gamma inducible protein 10 was up-regulated. In contrast, the addition of as much as 100,000 IU recombinant interferon had no apparent effect on vascular endothelial growth factor production. Conditioned medium derived from adenovirus mediated interferon 2b infected 253J B-V cells greatly decreased the invasive potential of human endothelial cells and down-regulated their matrix metalloproteinase 2 expression compared to controls. Furthermore, adenovirus mediated interferon 2b blocked pro-angiogenic nuclear signals, such as the transcription factors activating protein-1 and 2, stimulating protein-1, nuclear factor kappaB and c-myb. In vivo experiments revealed significant vascular endothelial growth factor down-regulation and decreased tumor vessel density in the adenovirus mediated interferon 2b treated group compared to controls. Treatment with adenovirus mediated interferon 2b increases the angiostatic activity of the bladder cancer microenvironment

Tumor induction in mice after local irradiation with single doses of either carbon-ion beams or gamma rays.

PubMed

Ando, Koichi; Koike, Sachiko; Ohmachi, Yasushi; Ando, Yutaka; Kobashi, Gen

2014-12-01

To determine the dose-dependent relative biological effectiveness (RBE) for tumor prevalence in mice receiving single localized doses to their right leg of either carbon ions (15, 45 or 75 keV/μm) or 137Cs gamma rays. A total of 1647 female C3H mice were irradiated to their hind legs with a localized dose of either reference gamma rays or 15, 45 or 75 keV/μm carbon-ion beams. Irradiated mice were evaluated for tumors twice a month during their three-year life span, and the dimensions of any tumors found were measured with a caliper. The tumor induction frequency was calculated by Kaplan-Meier analysis. The incidence of tumors from 50 Gy of 45 keV/μm carbon ions was marginally higher than those from 50 Gy of gamma rays. However, 60 Gy of 15 keV/μm carbon ions induced significantly fewer tumors than did gamma rays. RBE values of 0.87 + 0.12, 1.29 + 0.08 or 2.06 + 0.39 for lifetime tumorigenesis were calculated for 15, 45 or 75 keV/μm carbon-ion beams, respectively. Fibrosarcoma predominated, with no Linear Energy Transfer (LET)-dependent differences in the tumor histology. Experiments measuring the late effect of leg skin shrinkage suggested that the carcinogenic damage of 15 keV/μm carbon ions would be less than that of gamma rays. We conclude that patients receiving radiation doses to their normal tissues would face less risk of secondary tumor induction by carbon ions of intermediate LET values compared to equivalent doses of photons.

Perforin and gamma interferon expression are required for CD4+ and CD8+ T-cell-dependent protective immunity against a human parasite, Trypanosoma cruzi, elicited by heterologous plasmid DNA prime-recombinant adenovirus 5 boost vaccination.

PubMed

de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M

2009-10-01

A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.

STING-Dependent Interferon-λ1 Induction in HT29 Cells, a Human Colorectal Cancer Cell Line, After Gamma-Radiation.

PubMed

Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J

2018-05-01

To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.

Human Papilloma Virus Infection Does Not Predict Response to Interferon Therapy in Ocular Surface Squamous Neoplasia.

PubMed

Galor, Anat; Garg, Nisha; Nanji, Afshan; Joag, Madhura; Nuovo, Gerard; Palioura, Sotiria; Wang, Gaofeng; Karp, Carol L

2015-11-01

To identify the frequency of human papilloma virus (HPV) in ocular surface squamous neoplasia (OSSN) and to evaluate differences in clinical features and treatment response of tumors with positive versus negative HPV results. Retrospective case series. Twenty-seven patients with OSSN. Ocular surface squamous neoplasia specimens were analyzed for the presence of HPV. Clinical features and response to interferon were determined retrospectively and linked to the presence (versus absence) of HPV. Clinical characteristics of OSSN by HPV status. Twenty-one of 27 tumors (78%) demonstrated positive HPV results. The HPV genotypes identified included HPV-16 in 10 tumors (48%), HPV-31 in 5 tumors, HPV-33 in 1 tumor, HPV-35 in 2 tumors, HPV-51 in 2 tumors, and a novel HPV in 3 tumors (total of 23 tumors because 1 tumor had 3 identified genotypes). Tumors found in the superior limbus were more likely to show positive HPV results (48% vs. 0%; P=0.06, Fisher exact test). Tumors with positive HPV-16 results were larger (68 vs. 34 mm2; P=0.08, Mann-Whitney U test) and were more likely to have papillomatous morphologic features (50% vs. 12%; P=0.07, Fisher exact test) compared with tumors showing negative results for HPV-16. Human papilloma virus status was not found to be associated with response to interferon therapy (P=1.0, Fisher exact test). Metrics found to be associated with a nonfavorable response to interferon were male gender and tumors located in the superior conjunctivae. The presence of HPV in OSSN seems to be more common in lesions located in the nonexposed, superior limbus. Human papilloma virus presence does not seem to be required for a favorable response to interferon therapy. Copyright © 2015 American Academy of Ophthalmology. All rights reserved.

2'-5' Oligoadenylate synthetase-like 1 (OASL1) deficiency in mice promotes an effective anti-tumor immune response by enhancing the production of type I interferons.

PubMed

Sim, Chan Kyu; Cho, Yeon Sook; Kim, Byung Soo; Baek, In-Jeoung; Kim, Young-Joon; Lee, Myeong Sup

2016-06-01

Type I interferon (IFN-I) plays a critical role in antiviral and antitumor defense. In our previous studies, we showed that IFN-I-inducible 2'-5' oligoadenylate synthetase-like 1 (OASL1) negatively regulates IFN-I production upon viral infection by specifically inhibiting translation of the IFN-I-regulating master transcription factor, interferon regulatory factor 7 (IRF7). In this study, we investigated whether OASL1 plays a negative role in the anti-tumor immune response by using OASL1-deficient (Oasl1 (-/-)) mice and transplantable syngeneic tumor cell models. We found that Oasl1 (-/-) mice demonstrate enhanced resistance to lung metastatic tumors and subcutaneously implanted tumors compared to wild-type (WT) mice. Additionally, we found that cytotoxic effector cells such as CD8(+) T cells (including tumor antigen-specific CD8(+) T cells) and NK cells as well as CD8α(+) DCs (the major antigen cross-presenting cells) were much more frequent (>fivefold) in the Oasl1 (-/-) mouse tumors. Furthermore, the cytotoxic effector cells in Oasl1 (-/-) mouse tumors seemed to be more functionally active. However, the proportion of immunosuppressive myeloid-derived suppressor cells within hematopoietic cells and of regulatory T cells within CD4(+) T cells in Oasl1 (-/-) mouse tumors did not differ significantly from that of WT mice. Tumor-challenged Oasl1 (-/-) mice expressed increased levels of IFN-I and IRF7 protein in the growing tumor, indicating that the enhanced antitumor immune response observed in Oasl1 (-/-) mice was caused by higher IFN-I production in Oasl1 (-/-) mice. Collectively, these results show that OASL1 deficiency promotes the antitumor immune response, and thus, OASL1 could be a good therapeutic target for treating tumors.

Enhancing effects of gamma interferon on phagocytic cell association with and killing of Trypanosoma cruzi

NASA Technical Reports Server (NTRS)

Wirth, J. J.; Kierszenbaum, F.; Sonnenfeld, G.; Zlotnik, A.

1985-01-01

Results are reported from a study of the influence gamma interferon (GIFN) and interleukin 2 (IL2) have on the capability of P388D1 cells and mouse resident peritoneal macrophages (MPM) to attach to the blood-resident parasites Trypanosoma cruzi and kill them. Cultures of trypomastigote forms of the Tulahuen strain of T. cruzi grown in bovine serum were introduced into peritoneal cells of mice, along with P388D1 cells incubated with GIFN, IL2 and both. Control cells were also maintained. Statistical analysis were then performed on data on counts of the number of dead T. Cruzi cells. The GIFN enhanced the interaction of MPM and P388D1 cells with the surface of T. Cruzi, provided the interaction was given over 12 hr to take place. A depression of the cytotoxicity of P388D1 cells was attributed to mediation by H2O2, an effect partially offset by incubation with the lymphokine GIFN.

Association between level of interferon gamma and acid-fast bacillipositivity in pulmonary tuberculosis

NASA Astrophysics Data System (ADS)

Priwahyuningtyas, N. B.; Sinaga, B. Y. M.; Pandia, P.; Eyanoer, P. C.

2018-03-01

Tuberculosis is an infectious disease which caused by Mycobacterium tuberculosis (M. tuberculosis) that infected numerous organ especially the lung. A person’s immunity is very affecting for a person exposed to pulmonary tuberculosis. T-helper-1 cell (Th1) is very influential in the immune system especially in interfering intracellular bacterial infection. One of the cytokines known produced by Th1 cell is interferon gamma (IFN-γ) which is in eliminating M. tuberculosis. The study aims to identify the association between level of IFN-γ and AFB positivity in pulmonary tuberculosis patients in Medan. It is a case-control study. The subjects of the study were 60 new cases of pulmonary tuberculosis with AFB sputum smear- positive that never received ATT consisting 20 cases AFB (+1), 20 cases AFB (+2) and 20 cases AFB (+3).Samples were plasma collected from the venous blood of pulmonary tuberculosis patients. The plasma then underwent laboratory assay with ELISA techniques. Independent t-test was p<0.05 considered significant. Level of IFN-γ in TB AFB (+1) is higher than TB AFB (+2) and (+3), with thesignificant statistical result (p=0.001).

Interferon-gamma promoter hypomethylation and increased expression in chronic periodontitis

PubMed Central

Zhang, Shaoping; Crivello, Antonino; Offenbacher, Steven; Moretti, Antonio; Paquette, David W.; Barros, Silvana P.

2011-01-01

Aim The goal of this investigation was to determine whether epigenetic modifications in the IFNG promoter are associated with an increase of IFNG transcription in different stages of periodontal diseases. Materials and Methods DNA was extracted from gingival biopsy samples collected from 47 total sites from 47 different subjects: 23 periodontally healthy sites, 12 experimentally induced gingivitis sites and 12 chronic periodontitis sites. Levels of DNA methylation within the IFNG promoter containing six CpG dinucleotides were determined using pyrosequencing technology. Interferon gamma mRNA expression was analysed by quantitative polymerase chain reactions using isolated RNA from part of the biological samples mentioned above. Results The methylation level of all six analysed CpG sites within the IFNG promoter region in the periodontitis biopsies {52% [interquartile range, IQR (43.8%, 63%)]} was significantly lower than periodontally healthy samples {62% [IQR (51.3%, 74%)], p =0.007} and gingivitis biopsies {63% [IQR (55%, 74%)], p =0.02}. The transcriptional level of IFNG in periodontitis biopsies was 1.96-fold and significantly higher than tissues with periodontal health (p =0.04). Although the mRNA level from experimental gingivitis samples exhibited an 8.5-fold increase as compared with periodontally healthy samples, no significant methylation difference was observed in experimental gingivitis sample. Conclusions A hypomethylation profile within IFNG promoter region is related to an increase of IFNG transcription present in the chronic periodontitis biopsies, while such an increase of IFNG in experimentally induced gingivitis seems independent of promoter methylation alteration. PMID:20958339

Radiation-induced equilibrium is a balance between tumor cell proliferation and T cell-mediated killing

PubMed Central

Liang, Hua; Deng, Liufu; Chmura, Steven; Burnette, Byron; Liadis, Nicole; Darga, Thomas; Beckett, Michael A.; Lingen, Mark W.; Witt, MaryEllyn; Weichselbaum, Ralph R.; Fu, Yang-Xin

2013-01-01

Local failures following radiation therapy are multifactorial and the contributions of the tumor and the host are complex. Current models of tumor equilibrium suggest that a balance exists between cell birth and cell death due to insufficient angiogenesis, immune effects, or intrinsic cellular factors. We investigated whether host immune responses contribute to radiation induced tumor equilibrium in animal models. We report an essential role for immune cells and their cytokines in suppressing tumor cell regrowth in two experimental animal model systems. Depletion of T cells or neutralization of interferon-gamma reversed radiation-induced equilibrium leading to tumor regrowth. We also demonstrate that PD-L1 blockade augments T cell responses leading to rejection of tumors in radiation induced equilibrium. We identify an active interplay between tumor cells and immune cells that occurs in radiation-induced tumor equilibrium and suggest a potential role for disruption of the PD-L1/PD-1 axis in increasing local tumor control. PMID:23630355

Coordinated therapeutic effects of immune modulators and interferon.

PubMed Central

Cerutti, I; Chany, C

1983-01-01

Immune modulators injected 24 h before encephalomyocarditis virus significantly increase antiviral resistance in mice when interferon is administered 1 h after the virus. These immune modulators can be crude bacterial extracts or synthetic drugs. In some cases, the responses are additive; in others, they are clearly cooperative. To protect the mice against the development of 180 TG Crocker sarcomas, the association of bacterial extracts and interferon is highly effective under the condition that the drug concentrations and chronological order and number of injections are well defined. In contrast, the conjunction of interferon and synthetic immune modulators, in particular cimetidine, result in delayed tumor development with no significant change in the final survival rate in the experimental model described here. PMID:6315585

Role of interferon in resistance and immunity to protozoa

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Degee, A. L. W.; Mansfield, J. M.; Newsome, A. L.; Arnold, R. R.

1985-01-01

Production of interferon (I) in response to protozoan infection, and the interferon-mediated inhibition of parasite replication were studied in order to determine if these effects may be related to immunologic-mediated resistance of the hosts. Two extracellular parasites-Trypanosoma brucei rhodesiense and Naegleria fowlei were used. Upon infection with the trypanosome, only resistant strains of mice produced I. An early peak of alpha/beta I is followed by appearance of gamma I, which coincided with antibody production and a drop in parasitemia. In case of the amoeba, pretreatment of its suspension with alpha/beta I inhibits its replication in vitro, and appears to protect mice from the infection and the disease. It is proposed that production of interferon, with its regulatory effect on the immune responses, may play a major role in regulating the processes of protozoan-caused diseases.

Inhibition of human mast cell growth and differentiation by interferon gamma-1b.

PubMed

Kirshenbaum, A S; Worobec, A S; Davis, T A; Goff, J P; Semere, T; Metcalfe, D D

1998-03-01

In an effort to identify cytokines that inhibit human mast cell growth, we cultured HMC-1 cells and recombinant human stem cell factor (rhSCF)-dependent human bone marrow-derived mast cells (HBMCs) in the presence of interferon gamma (IFNgamma)-1b and interferon alpha (IFNalpha)-2b. HMC-1 cell numbers decreased in the presence of 1000 U/mL IFNgamma-1b but were unaffected by 1000 U/mL of IFNalpha-2b. HBMCs were then cultured for 0 to 7 days with 100 ng/mL rhSCF and 10 ng/mL recombinant human IL-3 (rhIL-3), followed by culture in rhSCF and administration of either 1000 U/mL IFNalpha-2b or 1000 U/mL IFNgamma-1b. HBMCs appearing in cultures with rhSCF alone or in combination with IFNalpha-2b were virtually identical in number through 8 weeks of culture. In cultures supplemented with IFNgamma-1b, HBMCs significantly decreased in number and incidence of granular metachromasia by 4 to 5 weeks (p<0.001). Similar results were obtained when human marrow was cultured from day 0 with rhSCF and IFNgamma-1b. Mature rhSCF-dependent HBMCs were also cultured at 5 weeks with rhSCF alone or in combination with IFNgamma-1b. Compared with cells cultured in rhSCF, mature 5-week HBMC cultures treated with rhSCF plus IFNgamma-1b revealed a decrease in mast cells, and those mast cells that remained had fewer toluidine blue- and tryptase-positive granules after 5 to 8 weeks. FACS analysis of rhSCF plus IFNgamma-1b-treated mature HBMCs revealed increased c-kit and Fc(epsilon)RI expression. Mast cell releasibility was not increased. IFNgamma-lb was thus able to suppress mast cell growth from CD34+ cells, suggesting that this agent should be considered as a candidate cytokine for the treatment of disorders of mast cell proliferation.

Secretion of Interferon gamma (IFNγ) from Human Immune Cells is Altered by Exposure to Tributyltin (TBT) and Dibutyltin (DBT)

PubMed Central

Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret

2013-01-01

Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and also alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h and 6 day exposures to TBT (200- 2.5 nM) and DBT (5- 0.05 μM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from NK cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. PMID:24357260

Anti-Tumor Effect of Steamed Codonopsis lanceolata in H22 Tumor-Bearing Mice and Its Possible Mechanism

PubMed Central

Li, Wei; Xu, Qi; He, Yu-Fang; Liu, Ying; Yang, Shu-Bao; Wang, Zi; Zhang, Jing; Zhao, Li-Chun

2015-01-01

Although previous studies confirmed that steaming and the fermentation process could significantly improve the cognitive-enhancement and neuroprotective effects of Codonopsis lanceolata, the anti-tumor efficacy of steamed C. lanceolata (SCL) and what mechanisms are involved remain largely unknown. The present study was designed to evaluate the anti-tumor effect in vivo of SCL in H22 tumor-bearing mice. The results clearly indicated that SCL could not only inhibit the tumor growth, but also prolong the survival time of H22 tumor-bearing mice. Besides, the serum levels of cytokines, such as interferon gamma (IFN-γ), tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-2 (IL-2), were enhanced by SCL administration. The observations of Hoechst 33258 staining demonstrated that SCL was able to induce tumor cell apoptosis. Finally, immunohistochemical analysis revealed that SCL treatment significantly increased Bax expression and decreased Bcl-2 and vascular endothelial growth factor (VEGF) expression of H22 tumor tissues in a dose-dependent manner. Moreover, LC/MS analysis of SCL indicated that it mainly contained lobetyolin and six saponins. Taken all together, the findings in the present study clearly demonstrated that SCL inhibited the H22 tumor growth in vivo at least partly via improving the immune functions, inducing apoptosis and inhibiting angiogenesis. PMID:26426041

Natural Killer Cells Control Tumor Growth by Sensing a Growth Factor.

PubMed

Barrow, Alexander D; Edeling, Melissa A; Trifonov, Vladimir; Luo, Jingqin; Goyal, Piyush; Bohl, Benjamin; Bando, Jennifer K; Kim, Albert H; Walker, John; Andahazy, Mary; Bugatti, Mattia; Melocchi, Laura; Vermi, William; Fremont, Daved H; Cox, Sarah; Cella, Marina; Schmedt, Christian; Colonna, Marco

2018-01-25

Many tumors produce platelet-derived growth factor (PDGF)-DD, which promotes cellular proliferation, epithelial-mesenchymal transition, stromal reaction, and angiogenesis through autocrine and paracrine PDGFRβ signaling. By screening a secretome library, we found that the human immunoreceptor NKp44, encoded by NCR2 and expressed on natural killer (NK) cells and innate lymphoid cells, recognizes PDGF-DD. PDGF-DD engagement of NKp44 triggered NK cell secretion of interferon gamma (IFN)-γ and tumor necrosis factor alpha (TNF-α) that induced tumor cell growth arrest. A distinctive transcriptional signature of PDGF-DD-induced cytokines and the downregulation of tumor cell-cycle genes correlated with NCR2 expression and greater survival in glioblastoma. NKp44 expression in mouse NK cells controlled the dissemination of tumors expressing PDGF-DD more effectively than control mice, an effect enhanced by blockade of the inhibitory receptor CD96 or CpG-oligonucleotide treatment. Thus, while cancer cell production of PDGF-DD supports tumor growth and stromal reaction, it concomitantly activates innate immune responses to tumor expansion. Copyright © 2017 Elsevier Inc. All rights reserved.

[The usefulness of in vitro interferon-gamma assay for differential diagnosis between intestinal tuberculosis and Crohns disease].

PubMed

Lee, Jung Nam; Ryu, Dong Yup; Park, Sung Han; You, Hyun Seok; Lee, Bong Eun; Kim, Dong Uk; Kim, Tae Oh; Heo, Jeong; Kim, Gwang Ha; Song, Geun Am; Kim, Suk; Park, Do Youn

2010-06-01

It is difficult to clinically and endoscopically differentiate intestinal tuberculosis (ITB) and Crohns disease (CD). The aim of this study was to evaluate the usefulness of in vitro interferon-gamma (INF-gamma) assay for differential diagnosis between ITB and CD. Sixty patients for whom differential diagnosis between ITB and CD was difficult were enrolled between January 2007 and January 2009. The INF-gamma-producing T-cell response to early secreted antigenic target 6 and culture filtrate protein 10 were measured by T-SPOT.TB blood test in vitro. We evaluated the usefulness of T-SPOT.TB blood test by comparing its results with the final diagnosis. Twenty and forty patients were revealed to be positive and negative in T-SPOT.TB blood test, respectively. Of the 20 patients found to be positive, 12 patients (60%) were finally diagnosed as ITB, 6 patients as CD, and 2 patients as Behcets enterocolitis. Of the 40 patients with negative results, 38 patients (95%) were diagnosed as CD; one as Behcets enterocolitis; one as nonspecific colitis; none as ITB. The sensitivity and specificity of T-SPOT.TB blood test for ITB were 100% and 83.3%, respectively. Positive and negative predictive values of T-SPOT.TB blood test for ITB were 60.0% and 100%, respectively. When differential diagnosis between ITB and CD is difficult, T-SPOT.TB blood test may be a helpful and rapid diagnostic tool to exclude ITB. Prospective large-scaled studies are required for further evaluation of the usefulness of T-SPOT.TB blood test for differential diagnosis between ITB and CD.

Interferon Gamma potentiates the injury caused by MPP(+) on SH-SY5Y cells, which is attenuated by the nitric oxide synthases inhibition.

PubMed

Titze-de-Almeida, Simoneide S; Lustosa, Cátia Faria; Horst, Camila Hillesheim; Bel, Elaine Del; Titze-de-Almeida, Ricardo

2014-12-01

This study examined whether the cytokine interferon (IFN) gamma plays a role in the injury of SH-SY5Y cells caused by MPP(+) (1-methyl-4-phenylpyridinium). First of all, IFN-gamma sensitized cells to the neurotoxin MPP(+), as determined by MTT (3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyltetrazolium bromide) assay. MPP(+)-injured cells showed higher reactive oxygen species (ROS) levels, which was reinforced by IFN-gamma. The injury triggered a marked expression of the neuronal NOS (nNOS) enzyme. L-NAME [N(ω)-nitro-L-arginine methyl ester, a non-specific NOS inhibitor] reestablished the cell viability after IFN-gamma challenging, and recovered cells from MPP(+) injury (95.0 vs. 84.7 %; P < 0.05). Seven-NI (7-nitroindazole, a nNOS inhibitor) protected cells against the injury by MPP(+) co-administered with IFN-gamma. Both inhibitors restrained the apoptosis of SH-SY5Y cells caused by MPP(+)/IFN-gamma. Regarding oxidative stress, L-NAME and 7-NI attenuated the increase in ROS levels caused by MPP(+) (45.3 or 48.4 vs. 87.9 %, P < 0.05). Indeed, L-NAME was more effective than 7-NI for reducing oxidative stress caused by MPP(+) under IFN-gamma exposition. The nNOS gene silencing by small-interfering RNAs recovered cells challenged by IFN-gamma (24 h), or MPP(+) (8 h). In conclusion, IFN-gamma sensitizes cells to MPP(+)-induced injury, also causing an increase in ROS levels. Pretreating cells with L-NAME or 7-NI reverts both the oxidative stress and apoptosis triggered by the neurotoxin MPP(+). Taking together, our data reinforce that IFN-gamma and NOS enzymes play a role in oxidative stress and dopaminergic cell death triggered by MPP(+).

Mitochondria-dependent and -independent mechanisms in tumour necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis are both regulated by interferon-gamma in human breast tumour cells.

PubMed Central

Ruiz-Ruiz, Carmen; López-Rivas, Abelardo

2002-01-01

Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL/APO-2L) induces apoptosis in a variety of tumour cells upon binding to death receptors TRAIL-R1 and TRAIL-R2. Here we describe the sensitization by interferon (IFN)-gamma to TRAIL-induced apoptosis in the breast tumour cell lines MCF-7 and MDA-MB231. IFN-gamma promoted TRAIL-mediated activation of caspase-8, Bcl-2 interacting domain death agonist (Bid) degradation, Bcl-2-associated X protein (Bax) translocation to mitochondria, cytochrome c release to the cytosol and activation of caspase-9 in these cell lines. No changes in the expression of TRAIL receptors were observed upon IFN-gamma treatment. Overexpression of Bcl-2 in MCF-7 cells completely inhibited IFN-gamma-induced sensitization to TRAIL-mediated cell death. Interestingly, TRAIL-induced apoptosis was also clearly enhanced by IFN-gamma in caspase-3-overexpressing MCF-7 cells, in the absence of Bax translocation to mitochondria and cytochrome c release to the cytosol. In summary, our results suggest that IFN-gamma facilitates TRAIL-induced activation of mitochondria-regulated as well as mitochondria-independent apoptotic pathways in breast tumour cells. PMID:11936954

Antitumor effect of interleukin (IL)-12 in the absence of endogenous IFN-gamma: a role for intrinsic tumor immunogenicity and IL-15.

PubMed

Gri, Giorgia; Chiodoni, Claudia; Gallo, Elena; Stoppacciaro, Antonella; Liew, Foo Y; Colombo, Mario P

2002-08-01

IFN-gamma knockout mice (GKO) rejected C26 colon carcinoma cells transduced to secrete interleukin(IL)-12 but do not reject similarly transduced TSA mammary adenocarcinoma (C26/12 and TSA/12 cells, respectively). To determine whether such difference could be because of a different tumor response to IFN-gamma, we injected BALB/c mice with TSA, C26, and their IL-12-transduced counterparts rendered unresponsive to IFN-gamma by stable transduction of a dominant negative (DN), truncated IFN-gamma receptor alpha chain. TSA/DN and C26/DN showed the same in vivo growth kinetics as parental cells, whereas coexpression of IL-12 induced rejection independent of tumor-cell responsiveness to IFN-gamma. This suggests that the role of IFN-gamma is primarily in activating the host immune response, which appears to depend on the intrinsic immunogenicity of the target tumor. C26 and TSA share a common tumor-associated antigen, yet C26 cells are more immunogenic than TSA. C26/12 expressed 10-fold higher levels of class I MHC molecules and induced higher CTL activity compared with TSA/12 cells in GKO mice. Moreover, whereas in GKO mice the TSA/12 tumor was associated with a greater number of infiltrating T cells, only those infiltrating C26/12 tumor expressed the activation marker OX40. The search for cytokine(s) that might contribute in determining the different T-cell response to these IL-12-transduced tumors in GKO mice revealed a role of IL-15. In situ hybridization showed IL-15 expression in C26/12 but not in TSA/12 tumors. In addition, injection of GKO mice with soluble IL-15 receptor-alpha to block IL-15 expression prevented rejection of C26/12 cells. Together, the results suggest that in the absence of IFN-gamma, IL-12 can exert antitumor activity through alternative mechanisms, depending on the tumor cell type and the availability of cytokines that can replace IFN-gamma in sustaining T-cell functions.

Evaluation of Gamma Interferon and Antibody Tuberculosis Tests in Alpacas

PubMed Central

Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

2012-01-01

We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a “test package,” although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations. PMID:22914362

Evaluation of gamma interferon and antibody tuberculosis tests in alpacas.

PubMed

Rhodes, Shelley; Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

2012-10-01

We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a "test package," although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations.

CMOS image sensor for detection of interferon gamma protein interaction as a point-of-care approach.

PubMed

Marimuthu, Mohana; Kandasamy, Karthikeyan; Ahn, Chang Geun; Sung, Gun Yong; Kim, Min-Gon; Kim, Sanghyo

2011-09-01

Complementary metal oxide semiconductor (CMOS)-based image sensors have received increased attention owing to the possibility of incorporating them into portable diagnostic devices. The present research examined the efficiency and sensitivity of a CMOS image sensor for the detection of antigen-antibody interactions involving interferon gamma protein without the aid of expensive instruments. The highest detection sensitivity of about 1 fg/ml primary antibody was achieved simply by a transmission mechanism. When photons are prevented from hitting the sensor surface, a reduction in digital output occurs in which the number of photons hitting the sensor surface is approximately proportional to the digital number. Nanoscale variation in substrate thickness after protein binding can be detected with high sensitivity by the CMOS image sensor. Therefore, this technique can be easily applied to smartphones or any clinical diagnostic devices for the detection of several biological entities, with high impact on the development of point-of-care applications.

Interferon-gamma and T-bet expression in a patient with toxoplasmic lymphadenopathy.

PubMed

Jöhrens, Korinna; Moos, Verena; Schneider, Thomas; Stein, Harald; Anagnostopoulos, Ioannis

2010-04-01

Infection with Toxoplasma gondii (TG) presents in some individuals as a self-limited disease with a predominant lymphadenopathy characterized by prominent B-cell activation. As this is in contrast to the in vitro based concept of a T(h)1-immune response against TG, we investigated native lymphoid tissue and peripheral blood of a patient with serologic evidence of toxoplasmosis to verify which cells show T(h)1-response features. High-level expression of T-bet in monocytoid B-cells, in germinal center B-cells, and in a lesser amount in T cells could be demonstrated by immunohistochemistry. In vitro stimulation of lymph node cells with either TG, staphylococcus enterotoxin B, or phorbol 12-myristate 13-acetate/ionomycin revealed an interferon-gamma expression in T-bet(+) B cells only in the patient and not in controls. Similar results were found for T-bet(+) T cells which were also present in controls. CD4(+) peripheral blood cells stimulated with TG antigens showed a TG-specific but attenuated T(h)1-reactivity in the patient associated with a reduced expression of IL-2 when compared with controls. We conclude that the pathogenesis and course of toxoplasmic lymphadenopathy is based on a T(h)1-cell defect, which becomes compensated by the B cells mounting a T(h)1-like immune response.

Application of genetically engineered Salmonella typhimurium for interferon-gamma-induced therapy against melanoma.

PubMed

Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo

2017-01-01

Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

Interferon-gamma regulates nucleoside transport systems in macrophages through signal transduction and activator of transduction factor 1 (STAT1)-dependent and -independent signalling pathways.

PubMed Central

Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio

2003-01-01

The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960

Correlations between endotoxin, interferon-gamma, biopterin and serum phospholipase A2-activities during lethal gram negative sepsis in rats.

PubMed

Hunsicker, A; Kullich, W; Weissenhofer, W; Lorenz, D; Petermann, J; Rokos, H; Schwesinger, G

1997-05-01

To establish a standardised reproducible animal model of intraperitoneal sepsis, and to investigate early immunoserological responses to find a mediator-based system for evaluation and grading of diffuse peritonitis in patients Prospective experimental study 4 Teaching hospitals, Germany and Austria 42 LEW. 1W rats, 12 of which acted as controls Gram negative sepsis was induced by intraperitoneal injection of 6 ml of a mixture of Escherichia coli (K1:H+) 10(10) organisms/ml, autogenous haemoglobin 2.9 ml (haemoglobin concentration 3%), 0.9% sodium chloride 3 ml, and suspension 0.1 ml. Control rats were given physiological saline 6 ml alone. Concentrations of endotoxin, interferon gamma (IFN-gamma), and biopterin, and serum phospholipase A2 (PLA2) activity. There were significant differences between the septic and control rats in concentrations of endotoxin (EU/ml) (median (interquartile range) 21.85 (2.02-159.5) compared with 0, p < 0.0001; IFN-gamma (pg/ml) 1263.0 (271.0-7575.0) compared with 101.0 (89.0-141.0), p < 0.0001; biopterin (nmol/L) 111.0 (66.4-156.3) compared with 53.7 (38.3-67.6), p < 0.001; and PLA2 (U/L) 163.0 (125.8-209.0) compared with 112.5 (88.5-126.5) p < 0.01. Measurements of concentrations of endotoxin, IFN-gamma, pteridines, and PLA2 activity may well be adequate markers for early recognition of sepsis, and perhaps for grading it during the first 6 hours after induction. The allow a clear distinction to be made between septic and non-septic disorders in 87% of cases.

Maximizing Tumor Immunity With Fractionated Radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schaue, Doerthe, E-mail: dschaue@mednet.ucla.edu; Ratikan, Josephine A.; Iwamoto, Keisuke S.

Purpose: Technologic advances have led to increased clinical use of higher-sized fractions of radiation dose and higher total doses. How these modify the pathways involved in tumor cell death, normal tissue response, and signaling to the immune system has been inadequately explored. Here we ask how radiation dose and fraction size affect antitumor immunity, the suppression thereof, and how this might relate to tumor control. Methods and Materials: Mice bearing B16-OVA murine melanoma were treated with up to 15 Gy radiation given in various-size fractions, and tumor growth followed. The tumor-specific immune response in the spleen was assessed by interferon-{gamma}more » enzyme-linked immunospot (ELISPOT) assay with ovalbumin (OVA) as the surrogate tumor antigen and the contribution of regulatory T cells (Tregs) determined by the proportion of CD4{sup +}CD25{sup hi}Foxp3{sup +} T cells. Results: After single doses, tumor control increased with the size of radiation dose, as did the number of tumor-reactive T cells. This was offset at the highest dose by an increase in Treg representation. Fractionated treatment with medium-size radiation doses of 7.5 Gy/fraction gave the best tumor control and tumor immunity while maintaining low Treg numbers. Conclusions: Radiation can be an immune adjuvant, but the response varies with the size of dose per fraction. The ultimate challenge is to optimally integrate cancer immunotherapy into radiation therapy.« less

Combined therapy with danazol, pegilated interferon, and ribavirin improves thrombocytopenia and liver injury in rats with fibrosis.

PubMed

Alvarez, Guillermo Cabrera; Madrid-Marina, Vicente; Jimenez-Mendez, Ricardo; Buitimea, Angel Leon; Román, Margarita Bahena; Cortez-Gomez, Rudyard; Esparza, Jorge Reyes; Rodríguez-Fragoso, Lourdes

2007-01-01

The aim of this study was to investigate the effects of combinations of pegilated-interferon (PEG-IFN), ribavirin, and danazol on thrombocytopenia and liver injury in rats with fibrosis. Male adult Wistar rats were treated with either mineral oil, danazol (0.83 mg/kg per day), PEG-interferon alpha-2a (PEG-IFN, 0.3 microg/ week) + ribavirin (12 mg/kg per day), PEG-IFN + ribavirin + danazol, CCl(4) (4 g/kg for eight weeks), CCl(4) + PEG-IFN + ribavirin, or CCl(4) + PEG-IFN + ribavirin+ danazol. The following assays were conducted: hematology, clinical chemistry, liver function, liver fibrosis, lymphocyte cytokine mRNA expression, and bone-marrow DNA content. Platelet counts were low in sham-treated animals and animals treated with PEG- IFN + ribavirin (30% and 25% respectively; P < 0.05). PEG-IFN + ribavirin + danazol reduced platelet counts of fibrotic animals by only 9% (P < 0.05). PEG- IFN + ribavirin reduced hepatic collagen content by 50%, whereas danazol + PEG-IFN + ribavirin reduced hepatic collagen content by 60% (P < 0.05). PEG-IFN + ribavirin reduced the total bilirubin concentration by 27%, alanine amino transferase (ALT) activity by 75% and gamma-glutamyl transpeptidase (gamma-GTP) activity by 74% (P < 0.05). In contrast, danazol + PEG-IFN + ribavirin reduced total bilirubin levels by 61%, alkaline phosphatase activity by 45%, ALT activity by 76%, and gamma-GTP activity by 74% (P < 0.05). The only treatment that increased interleukin 10 (IL-10) mRNA in fibrotic rats was PEG-IFN + ribavirin. However, danazol + PEG-IFN + ribavirin reduced the expression of IL-6, IL-10, tumor necrosis factor alpha and transforming growth factor ss. Bone-marrow DNA content was not altered by any treatment. In conclusion, PEG-IFN + ribavirin + danazol could be a new therapeutic option for patients with liver injury, fibrosis, and thrombocytopenia.

Natural killer cell activity, lymphocyte proliferation, and cytokine profile in tumor-bearing mice treated with MAPA, a magnesium aggregated polymer from Aspergillus oryzae.

PubMed

Justo, G Z; Durán, N; Queiroz, M L S

2003-08-01

The present study examined the effects of MAPA, an antitumor aggregated polymer of protein magnesium ammonium phospholinoleate-palmitoleate anhydride, isolated from Aspergillus oryzae, on concanavalin A (Con A)-induced spleen cell proliferation, cytokine production and on natural killer (NK) cell activity in Ehrlich ascites tumor-bearing mice. The Ehrlich ascites tumor (EAT) growth led to diminished mitogen-induced expansion of spleen cell populations and total NK activity. This was accompanied by striking spleen enlargement, with a marked increase in total cell counts. Moreover, a substantial enhancement in IL-10 levels, paralleled by a significant decrease in IL-2 was observed, while production of IL-4 and interferon-gamma (IFN-gamma) was not altered. Treatment of mice with 5 mg/kg MAPA for 7 days promoted spleen cell proliferation, IL-2 production and NK cell activity regardless of tumor outgrowth. In addition, MAPA treatment markedly enhanced IFN-gamma levels and reduced IL-10 production relative to EAT mice. A 35% reduction in splenomegaly with normal number of nucleated cells was also found. Altogether, our results suggest that MAPA directly and/or indirectly modulates immune cell activity, and probably disengages tumor-induced suppression of these responses. Clearly, MAPA has an impact and may delay tumor outgrowth through immunotherapeutic mechanisms.

Interferon effects on protozoan infections

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Wirth, J.; Kierszenbaum, F.; Degee, A. L. W.; Mansfield, J. M.

1985-01-01

The effects of interferon (IFN) on mice infected with two different parasitic protozoans, Trypanosoma cruzi and Trypanosoma brucei rhodesiense, are investigated experimentally. The preparation of the cell cultures, IFN and assays, antibody, and the experimental procedures are described. It is observed that in cells treated with IFN-gamma there is an increased association of T. cruzi with murine macrophages and an increase in the killing of T. cruzi by IFN-gamma-treated murine macrophages. For spleen cells infected with T.b. rhodesiense in vitro, it is detected that live trypanosomes cannot induce IFN in cells from normal mice, but can in cells from immunized mice; and that trypanosome-lysates induce IFN in vitro in cells from normal mice. The data suggest that there is a two-step mechanism for mice against T. cruzi and T.b. rhodesiense.

Chloroquine Engages the Immune System to Eradicate Irradiated Breast Tumors in Mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ratikan, Josephine Anna; Sayre, James William; Schaue, Dörthe, E-mail: dschaue@mednet.ucla.edu

2013-11-15

Purpose: This study used chloroquine to direct radiation-induced tumor cell death pathways to harness the antitumor activity of the immune system. Methods and Materials: Chloroquine given immediately after tumor irradiation increased the cure rate of MCaK breast cancer in C3H mice. Chloroquine blocked radiation-induced autophagy and drove MCaK cells into a more rapid apoptotic and more immunogenic form of cell death. Results: Chloroquine treatment made irradiated tumor vaccines superior at inducing strong interferon gamma-associated immune responses in vivo and protecting mice from further tumor challenge. In vitro, chloroquine slowed antigen uptake and degradation by dendritic cells, although T-cell stimulation wasmore » unaffected. Conclusions: This study illustrates a novel approach to improve the efficacy of breast cancer radiation therapy by blocking endosomal pathways, which enhances radiation-induced cell death within the field and drives antitumor immunity to assist therapeutic cure. The study illuminates and merges seemingly disparate concepts regarding the importance of autophagy in cancer therapy.« less

Biosynthesis and N-glycosylation of human interferon-gamma. Asn25 and Asn97 differ markedly in how efficiently they are glycosylated and in their oligosaccharide composition.

PubMed

Sareneva, T; Mørtz, E; Tölö, H; Roepstorff, P; Julkunen, I

1996-12-01

Interferon-gamma (IFN-gamma) is a secretory glycoprotein produced by T cells in response to antigenic or mitogenic stimuli. We studied the kinetics of the synthesis, N-glycosylation, and secretion of IFN-gamma in human CD8+ T lymphocytes stimulated via T-cell receptor. Highly elevated IFN-gamma mRNA levels were found as early as 1 h after stimulation. Maximal IFN-gamma protein synthesis was observed 2-4 h after induction and appeared to correlate to steady-state IFN-gamma mRNA levels. As analyzed by pulse/chase experiments, the secretion of IFN-gamma from T cells was very rapid, the secretion half-time being approximately 20-25 min. Inhibition of N-glycosylation by tunicamycin dramatically reduced the expression of IFN-gamma, but did not block its secretion. Natural IFN-gamma is heterogeneously glycosylated and doubly, singly, and unglycosylated forms exist. Experiments performed in a cell-free translation/glycosylation system with mutated IFN-gamma constructs lacking either one of the potential glycosylation sites suggested that Asn25 is more efficiently glycosylated than Asn97. Site-specific oligosaccharide analysis of natural IFN-gamma by glycosidase treatment followed by matrix-assisted-laser-desorption-ionization mass spectrometry revealed considerable variation in the carbohydrate structures, with more than 30 different forms. The glycans at Asn25 consisted of fucosylated, mainly complex-type oligosaccharides, whereas the glycans at Asn97 were more heterogeneous, with hybrid and high-mannose structures. Our results emphasize the essential role of N-linked glycans in the biology of IFN-gamma and show that there is a considerable heterogeneity in the individual sugar chains of this important human cytokine.

Histaminergic regulation of interferon-gamma (IFN-gamma) production by human natural killer (NK) cells.

PubMed

Asea, A; Hansson, M; Czerkinsky, C; Houze, T; Hermodsson, S; Strannegård, O; Hellstrand, K

1996-08-01

Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-gamma by CD3-/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-gamma production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-gamma production was operating on a pretranslational level, as indicated by the inability of enriched NK cells to accumulate IFN-gamma mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-gamma production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-gamma production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-gamma in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-gamma mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-gamma production by preventing monocyte-induced oxidative damage to NK cells.

C-Reactive Protein (CRP), Interferon Gamma-Inducible Protein 10 (IP-10), and Lipopolysaccharide (LPS) Are Associated with Risk of Tuberculosis after Initiation of Antiretroviral Therapy in Resource-Limited Settings

PubMed Central

Tenforde, Mark W.; Gupte, Nikhil; Dowdy, David W.; Asmuth, David M.; Balagopal, Ashwin; Pollard, Richard B.; Sugandhavesa, Patcharaphan; Lama, Javier R.; Pillay, Sandy; Cardoso, Sandra W.; Pawar, Jyoti; Santos, Breno; Riviere, Cynthia; Mwelase, Noluthando; Kanyama, Cecilia; Kumwenda, Johnstone; Hakim, James G.; Kumarasamy, Nagalingeswaran; Bollinger, Robert; Semba, Richard D.; Campbell, Thomas B.; Gupta, Amita

2015-01-01

Objective The association between pre-antiretroviral (ART) inflammation and immune activation and risk for incident tuberculosis (TB) after ART initiation among adults is uncertain. Design Nested case-control study (n = 332) within ACTG PEARLS trial of three ART regimens among 1571 HIV-infected, treatment-naïve adults in 9 countries. We compared cases (participants with incident TB diagnosed by 96 weeks) to a random sample of controls (participants who did not develop TB, stratified by country and treatment arm). Methods We measured pre-ART C-reactive protein (CRP), EndoCab IgM, ferritin, interferon gamma (IFN-γ), interleukin 6 (IL-6), interferon gamma-inducible protein 10 (IP-10), lipopolysaccharide (LPS), soluble CD14 (sCD14), tumor necrosis factor alpha (TNF-α), and CD4/DR+/38+ and CD8/DR+/38+ T cells. Markers were defined according to established cutoff definitions when available, 75th percentile of measured values when not, and detectable versus undetectable for LPS. Using logistic regression, we measured associations between biomarkers and incident TB, adjusting for age, sex, study site, treatment arm, baseline CD4 and log10 viral load. We assessed the discriminatory value of biomarkers using receiver operating characteristic (ROC) analysis. Results Seventy-seven persons (4.9%) developed incident TB during follow-up. Elevated baseline CRP (aOR 3.25, 95% CI: 1.55–6.81) and IP-10 (aOR 1.89, 95% CI: 1.05–3.39), detectable plasma LPS (aOR 2.39, 95% CI: 1.13–5.06), and the established TB risk factors anemia and hypoalbuminemia were independently associated with incident TB. In ROC analysis, CRP, albumin, and LPS improved discrimination only modestly for TB risk when added to baseline routine patient characteristics including CD4 count, body mass index, and prior TB. Conclusion Incident TB occurs commonly after ART initiation. Although associated with higher post-ART TB risk, baseline CRP, IP-10, and LPS add limited value to routine patient characteristics

Proliferation inhibitory effect of human alpha interferon on primary explants of Burkitt lymphoma: inverse relationship to patient survival.

PubMed

Ernberg, I; Einhorn, S; Strander, H; Klein, G

1981-11-01

Eleven biopsies from 9 patients with Burkitt's lymphoma were tested for their sensitivity to the cell multiplication inhibitory activity of interferon. Three were resistant to interferon while 8 were sensitive to various degrees. Different biopsies from the same patient did not differ in interferon sensitivity. These results indicate that Burkitt's lymphoma cells might be resistant to interferon already in vivo as previously shown for some derived cell lines tested in vitro. The results imply an inverse relationship between patient survival and interferon sensitivity of the tumor cells.

Partial interferon-gamma receptor 1 deficiency in a child with tuberculoid bacillus Calmette-Guérin infection and a sibling with clinical tuberculosis.

PubMed Central

Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L

1997-01-01

Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728

Designing of interferon-gamma inducing MHC class-II binders

PubMed Central

2013-01-01

Background The generation of interferon-gamma (IFN-γ) by MHC class II activated CD4+ T helper cells play a substantial contribution in the control of infections such as caused by Mycobacterium tuberculosis. In the past, numerous methods have been developed for predicting MHC class II binders that can activate T-helper cells. Best of author’s knowledge, no method has been developed so far that can predict the type of cytokine will be secreted by these MHC Class II binders or T-helper epitopes. In this study, an attempt has been made to predict the IFN-γ inducing peptides. The main dataset used in this study contains 3705 IFN-γ inducing and 6728 non-IFN-γ inducing MHC class II binders. Another dataset called IFNgOnly contains 4483 IFN-γ inducing epitopes and 2160 epitopes that induce other cytokine except IFN-γ. In addition we have alternate dataset that contains IFN-γ inducing and equal number of random peptides. Results It was observed that the peptide length, positional conservation of residues and amino acid composition affects IFN-γ inducing capabilities of these peptides. We identified the motifs in IFN-γ inducing binders/peptides using MERCI software. Our analysis indicates that IFN-γ inducing and non-inducing peptides can be discriminated using above features. We developed models for predicting IFN-γ inducing peptides using various approaches like machine learning technique, motifs-based search, and hybrid approach. Our best model based on the hybrid approach achieved maximum prediction accuracy of 82.10% with MCC of 0.62 on main dataset. We also developed hybrid model on IFNgOnly dataset and achieved maximum accuracy of 81.39% with 0.57 MCC. Conclusion Based on this study, we have developed a webserver for predicting i) IFN-γ inducing peptides, ii) virtual screening of peptide libraries and iii) identification of IFN-γ inducing regions in antigen (http://crdd.osdd.net/raghava/ifnepitope/). Reviewers This article was reviewed by Prof Kurt

Alternative mechanism by which IFN-gamma enhances tumor recognition: active release of heat shock protein 72.

PubMed

Bausero, Maria A; Gastpar, Robert; Multhoff, Gabriele; Asea, Alexzander

2005-09-01

IFN-gamma exhibits differential effects depending on the target and can induce cellular activation and enhance survival or mediate cell death via activation of apoptotic pathways. In this study, we demonstrate an alternative mechanism by which IFN-gamma enhances tumor recognition, mediated by the active release of Hsp72. We demonstrate that stimulation of 4T1 breast adenocarcinoma cells and K562 erythroleukemic cells with IFN-gamma triggers the cellular stress response, which results in the enhanced expression of total Hsp72 expression without a significant increase in cell death. Intracellular expression of Hsp72 was abrogated in cells stably transfected with a mutant hsf-1 gene. IFN-gamma-induced Hsp72 expression correlated with enhanced surface expression and consequent release of Hsp72 into the culture medium. Pretreatment of tumors with compounds known to the block the classical protein transport pathway, including monensin, brefeldin A, tunicamycin, and thapsigargin, did not significantly block Hsp72 release. However, pretreatment with intracellular calcium chelator BAPTA-AM or disruption of lipid rafts using methyl beta-cyclodextrin completely abrogated IFN-gamma-induced Hsp72 release. Biochemical characterization revealed that Hsp72 is released within exosomes and has the ability to up-regulate CD83 expression and stimulate IL-12 release by naive dendritic cells. Pretreatment with neutralizing mAb or depletion of Hsp72 completely abrogated its chaperokine function. Taken together, these findings are indicative of an additional previously unknown mechanism by which IFN-gamma promotes tumor surveillance and furthers our understanding of the central role of extracellular Hsp72 as an endogenous adjuvant and danger signal.

Gamma Knife Surgery for Metastatic Brain Tumors from Gynecologic Cancer.

PubMed

Matsunaga, Shigeo; Shuto, Takashi; Sato, Mitsuru

2016-05-01

The incidences of metastatic brain tumors from gynecologic cancer have increased. The results of Gamma Knife surgery (GKS) for the treatment of patients with brain metastases from gynecologic cancer (ovarian, endometrial, and uterine cervical cancers) were retrospectively analyzed to identify the efficacy and prognostic factors for local tumor control and survival. The medical records were retrospectively reviewed of 70 patients with 306 tumors who underwent GKS for brain metastases from gynecologic cancer between January 1995 and December 2013 in our institution. The primary cancers were ovarian in 33 patients with 147 tumors and uterine in 37 patients with 159 tumors. Median tumor volume was 0.3 cm(3). Median marginal prescription dose was 20 Gy. The local tumor control rates were 96.4% at 6 months and 89.9% at 1 year. There was no statistically significant difference between ovarian and uterine cancers. Higher prescription dose and smaller tumor volume were significantly correlated with local tumor control. Median overall survival time was 8 months. Primary ovarian cancer, controlled extracranial metastases, and solitary brain metastasis were significantly correlated with satisfactory overall survival. Median activities of daily living (ADL) preservation survival time was 8 months. Primary ovarian cancer, controlled extracranial metastases, and higher Karnofsky Performance Status score were significantly correlated with better ADL preservation. GKS is effective for control of tumor progression in patients with brain metastases from gynecologic cancer, and may provide neurologic benefits and preservation of the quality of life. Copyright © 2016 Elsevier Inc. All rights reserved.

Benign orbital apex tumors treated with multisession gamma knife radiosurgery.

PubMed

Goh, Alice Siew Ching; Kim, Yoon-Duck; Woo, Kyung In; Lee, Jung-Il

2013-03-01

The orbital apex is an important anatomic landmark that hosts numerous critical neurovascular structures. Tumor resection performed at this complex region poses a therapeutic challenge to orbital surgeons and often is associated with significant visual morbidity. This article reports the efficacy and safety of multisession gamma knife radiosurgery (GKRS) in benign, well-circumscribed tumors located at the orbital apex. Retrospective interventional case series. Five patients with visual disturbances resulting from a benign, well-circumscribed orbital apex tumor (3 cases of cavernous hemangioma and 2 cases of schwannoma). Each patient treated with GKRS with a total radiation dose of 20 Gy in 4 sessions (5 Gy in each session with an isodose line of 50%) delivered to the tumor margin. Best-corrected visual acuity, visual field changes, orbital imaging, tumor growth control, and side effects of radiation. All patients demonstrated improvement in visual acuity, pupillary responses, color vision, and visual field. Tumor shrinkage was observed in all patients and remained stable until the last follow-up. No adverse events were noted during or after the radiosurgery. None of the patients experienced any radiation-related ocular morbidity. From this experience, multisession GKRS seems to be an effective management strategy to treat solitary, benign, well-circumscribed orbital apex tumors. Copyright © 2013 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

[Interferons--its method of administration and adverse effect related to pharmacokinetics ].

PubMed

Furue, H

1984-02-01

The potential role of interferons in the treatment of malignant diseases is currently being evaluated. This paper reviews experimental and clinical findings regarding pharmacokinetics, method of administration, and side reactions of interferons. Interferon in the blood is rapidly cleared from the circulation. Intramuscular injection of alpha-interferon causes low but stable interferon levels in the blood. However, in the case of beta-interferon, interferon is never detected consistently in the blood after intramuscular or subcutaneous administration. The studies with animal models suggest that doses higher than those given in current clinical trials will be necessary to obtain clearly beneficial effects in human. The maximum safely tolerated daily dose is appreciably higher than that used in most previous studies, although even at this level, considerable toxicity may be encountered. Adequate method of administration, route, dose and interval are not yet established at all. Exact mechanism of anticancer activity is not yet well defined. The most frequent side reaction is fever. However, the exact mechanism to cause these side reactions is also not yet clarified. Dose limiting central nervous system toxicities, hypotension, hypocalcaemia etc. are occasionally encountered in some instances. Antibody to interferon is demonstrated in some cases. Purification of interferon does not always causes reduction of side reactions. The treatment of cancer cases with interferon has just started and there are many problems to be solved. However, therapeutic beneficial may be achieved in the treatment of malignant tumors by appropriate combinations of interferon with conventional treatment. More laboratory studies as well as carefully controlled clinical observations are warranted.

Mycobacterium tuberculosis infection in health care workers in rural India: comparison of a whole-blood interferon gamma assay with tuberculin skin testing.

PubMed

Pai, Madhukar; Gokhale, Kaustubh; Joshi, Rajnish; Dogra, Sandeep; Kalantri, Shriprakash; Mendiratta, Deepak K; Narang, Pratibha; Daley, Charles L; Granich, Reuben M; Mazurek, Gerald H; Reingold, Arthur L; Riley, Lee W; Colford, John M

2005-06-08

Mycobacterium tuberculosis infection in health care workers has not been adequately studied in developing countries using newer diagnostic tests. To estimate latent tuberculosis infection prevalence in health care workers using the tuberculin skin test (TST) and a whole-blood interferon gamma (IFN-gamma) assay; to determine agreement between the tests; and to compare their correlation with risk factors. A cross-sectional comparison study of 726 health care workers aged 18 to 61 years (median age, 22 years) with no history of active tuberculosis conducted from January to May 2004, at a rural medical school in India. A total of 493 (68%) of the health care workers had direct contact with patients with tuberculosis and 514 (71%) had BCG vaccine scars. Tuberculin skin testing was performed using 1-TU dose of purified protein derivative RT23, and the IFN-gamma assay was performed by measuring IFN-gamma response to early secreted antigenic target 6, culture filtrate protein 10, and a portion of tuberculosis antigen TB7.7. Agreement between TST and the IFN-gamma assay, and comparison of the tests with respect to their association with risk factors. A large proportion of the health care workers were latently infected; 360 (50%) were positive by either TST or IFN-gamma assay, and 226 (31%) were positive by both tests. The prevalence estimates of TST and IFN-gamma assay positivity were comparable (41%; 95% confidence interval [CI], 38%-45% and 40%; 95% CI, 37%-43%, respectively). Agreement between the tests was high (81.4%; kappa = 0.61; 95% CI, 0.56-0.67). Increasing age and years in the health profession were significant risk factors for both IFN-gamma assay and TST positivity. BCG vaccination had little impact on TST and IFN-gamma assay results. Our study showed high latent tuberculosis infection prevalence in Indian health care workers, high agreement between TST and IFN-gamma assay, and similar association between positive test results and risk factors. Although TST and

The effect of fermented milk on interferon production in malnourished children and in anorexia nervosa patients undergoing nutritional care.

PubMed

Solis, B; Nova, E; Gómez, S; Samartín, S; Mouane, N; Lemtouni, A; Belaoui, H; Marcos, A

2002-12-01

For several years cytokine production has been associated with infections but it was not suspected that some types of food could also induce cytokines, even in a state of non-infection. Lactic bacteria can induce interferon (IFN) production in human healthy subjects, thus, a better protection against infections would be expected. Therefore, we planned to evaluate the effect of two diets including yoghurt or milk on IFN-gamma production during nutritional recovery in two different situations of malnutrition: (1) children with diarrhoea; and (2) patients with anorexia nervosa (AN). Both the diet including yoghurt of that including milk seemed to increase IFN-gamma production at the end of nutritional recovery in the malnourished children with diarrhoea. The significance of interferon production and the lymphocyte subset increase should be explored to know if a better resistance against pathogens is related to them. Regulation of intestinal absorption and moderate stimulation of interferon production make the yoghurt-based diet a good choice in the nutritional care of children. In the same way, an increase in the IFN-gamma production was observed in AN patients consuming yoghurt. This increase of IFN-gamma production could be considered a biological marker to detect the effect of probiotics on the immune response, especially in the improvement of a deficient nutritional status.

Role of T Cells and Gamma Interferon during Induction of Hypersensitivity to Lipopolysaccharide by Toxic Shock Syndrome Toxin 1 in Mice

PubMed Central

Dinges, Martin M.; Schlievert, Patrick M.

2001-01-01

The superantigenic function of toxic shock syndrome toxin 1 (TSST-1) is generally regarded as an important determinant of its lethal effects in humans or experimental animals. This study examined the role of superantigenicity in a BALB/c mouse model of lethal TSST-1-induced hypersensitivity to lipopolysaccharide (LPS). In this model, TSST-1 greatly potentiated both LPS-induced lethality, as well as LPS-induced serum tumor necrosis factor alpha (TNF-α) activity. Although BALB/c-SCID mice were resistant to these LPS enhancement effects of TSST-1, BALB/c-SCID mice reconstituted with T cells were completely susceptible to the enhancement effect of TSST-1 on LPS-induced serum TNF-α. Mice pretreated with cyclosporine (Cs) or neutralizing antibodies against gamma interferon (IFN-γ) did not develop lethal LPS hypersensitivity when injected with TSST-1, and these agents reduced the enhancement effect of TSST-1 on LPS-induced serum TNF-α by 99 and 85%, respectively. Cs pretreatment also completely inhibited the known capacity of TSST-1 to amplify LPS-induced levels of IFN-γ in serum. In contrast, mice given Cs after a priming injection of TSST-1, but before LPS, still exhibited lethal hypersensitivity to LPS. Cs given after TSST-1 also did not inhibit enhancement of LPS-induced serum TNF-α by TSST-1 but inhibited the enhancement effect of TSST-1 on LPS-induced serum IFN-γ by 50%. These experiments support the theory that TSST-1-induced hypersensitivity to LPS is mediated primarily by IFN-γ derived from superantigen-activated T cells. PMID:11179286

Amelioration of skewed Th1/Th2 balance in tumor-bearing and asthma-induced mice by oral administration of Agaricus blazei extracts.

PubMed

Takimoto, Hiroaki; Kato, Hanano; Kaneko, Masahiro; Kumazawa, Yoshio

2008-01-01

We showed in a previous study that hot-water extracts of Agaricus blazei (Agaricus extracts) had anti-tumor activity to Meth A fibrosarcoma, but it remains unclear whether the Agaricus extracts ameliorate the skewed balance of type-1 T helper (Th1) and type-2 T helper (Th2) cells. We examined whether Agaricus extracts effect the skewed Th1/Th2 balance in tumor-bearing and asthma-induced mice. When Meth A-bearing mice were given orally either Agaricus extracts or water once a day starting 5 days after tumor implantation, spleen T cells, prepared from tumor-bearing mice treated with Agaricus extracts, in response to anti-CD3 monoclonal antibody produced significantly higher levels of interferon gamma (IFN-gamma) than that of controls. The mRNA expression of IFN-gamma-inducing protein 10 and the frequency of CD69(+) or CD49d(+) cells, among activated T cells infiltrated into tumors, significantly increased in Agaricus-treated mice, compared with those of tumor-controls. In asthma-induced mice, treatment with the Agaricus extracts caused significant downregulation of OVA-specific antibody responses of IgG1 and IgE but not of IgG2a, and significantly decreased total cell numbers, levels of interleukin 5, and eosinophil numbers in bronchial alveolar lavage fluids. IFN-gamma production by anti-CD3-stimulated spleen cells, obtained from Agaricus-treated mice, significantly increased. Our results strongly suggest that oral administration of Agaricus extracts ameliorates the Th1/Th2 balance from the Th2-skewed conditions.

Successful Application of the Gamma-Interferon Assay in a Bovine Tuberculosis Eradication Program: The French Bullfighting Herd Experience.

PubMed

Keck, Nicolas; Boschiroli, Maria-Laura; Smyej, Florence; Vogler, Valérie; Moyen, Jean-Louis; Desvaux, Stéphanie

2018-01-01

In the French Camargue region, where bovine tuberculosis had been enzootic for several years in bullfighting cattle herds, the gamma-interferon (IFN) assay was used since 2003 in parallel with the intradermal test in order to increase overall disease detection sensitivity in infected herds. This study presents the results of a field-evaluation of the assay during a 10-year period (2004-2014) of disease control and surveillance program and explores the particular pattern of IFN assay results in bullfight herds in comparison to cattle from other regions of France. The low sensitivity [59.2% (50.6; 67.3)] of IFN assay using the tuberculin stimulation could be related to the poor gamma-IFN production from bullfight cattle blood cells which is significantly lower than in animals of conventional breeds. The characteristics of the assay were progressively adapted to the epidemiological situation and the desired strategic applications. Data analysis with a receiver operating characteristic curve based on a simple S/P value algorithm allowed for the determination of a new cutoff adapted for a global screening, giving a high specificity of 99.9% results and a high accuracy of the assay. Having regularly risen to above 5% since 2005, with a peak around 10% in 2010, the annual incidence dropped to under 1% in 2014. The positive predictive value relative to the bacteriological confirmation evolved during the years, from 33% in 2009 to 12% during the last screening period, a normal trend in a context of decreasing prevalence. The estimated rate of false-positive reactions during screening campaigns was 0.67%, confirming the high specificity of the test, measured in bTB negative herds, in this epidemiological context. The proportion of false-positive reactions decreased with the age and was higher in males than in females. Although these results indicate that the IFN assay is accurate in the field, it also emphasizes great differences between interferon quantities produced by

Lactic Acid Bacteria from Kefir Increase Cytotoxicity of Natural Killer Cells to Tumor Cells.

PubMed

Yamane, Takuya; Sakamoto, Tatsuji; Nakagaki, Takenori; Nakano, Yoshihisa

2018-03-27

The Japanese fermented beverage, homemade kefir, contains six lactic acid bacteria: Lactococcus. lactis subsp. Lactis , Lactococcus . lactis subsp. Cremoris , Lactococcus. Lactis subsp. Lactis biovar diacetylactis , Lactobacillus plantarum , Leuconostoc meseuteroides subsp. Cremoris and Lactobacillus casei . In this study, we found that a mixture of the six lactic acid bacteria from kefir increased the cytotoxicity of human natural killer KHYG-1 cells to human chronic myelogenous leukemia K562 cells and colorectal tumor HCT116 cells. Furthermore, levels of mRNA expression and secretion of IFN-γ (interferon gamma) increased in KHYG-1 cells that had been treated with the six lactic acid bacteria mixture from kefir. The results suggest that the six lactic acid bacteria mixture from kefir has strong effects on natural immunity and tumor cell cytotoxicity.

Peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor suppressor in hepatocellular carcinoma.

PubMed

Liu, Rui; Zhang, Haiyang; Zhang, Yan; Li, Shuang; Wang, Xinyi; Wang, Xia; Wang, Cheng; Liu, Bin; Zen, Ke; Zhang, Chen-Yu; Zhang, Chunni; Ba, Yi

2017-04-01

Peroxisome proliferator-activated receptor gamma coactivator-1 alpha plays a crucial role in regulating the biosynthesis of mitochondria, which is closely linked to the energy metabolism in various tumors. This study investigated the regulatory role of peroxisome proliferator-activated receptor gamma coactivator-1 alpha in the pathogenesis of hepatocellular carcinoma. In this study, the changes of peroxisome proliferator-activated receptor gamma coactivator-1 alpha messenger RNA levels between normal human liver and hepatocellular carcinoma tissue were examined by quantitative reverse transcription polymerase chain reaction. Knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by RNA interference in the human liver cell line L02, while overexpression of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha complementary DNA in the human hepatocarcinoma cell line HepG2. Cellular morphological changes were observed via optical and electron microscopy. Cellular apoptosis was determined by Hoechst 33258 staining. In addition, the expression levels of 21,400 genes in tissues and cells were detected by microarray. It was shown that peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression was significantly downregulated in hepatocellular carcinoma compared with normal liver tissues. After knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression in L02 cells, cells reverted to immature and dedifferentiated morphology exhibiting cancerous tendency. Apoptosis occurred in the HepG2 cells after transfection by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha. Microarray analysis showed consistent results. The results suggest that peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor

Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.

PubMed

Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y

2017-10-01

Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.

Gamma knife radiosurgery for vestibular schwannomas: tumor control and functional preservation in 70 patients.

PubMed

Arthurs, Benjamin J; Lamoreaux, Wayne T; Mackay, Alexander R; Demakas, John J; Giddings, Neil A; Fairbanks, Robert K; Cooke, Barton S; Elaimy, Ameer L; Peressini, Ben; Lee, Christopher M

2011-06-01

We present the previously unreported outcomes of 70 patients treated with Gamma knife radiosurgery for vestibular schwannoma (VS), including comprehensive analysis of clinical outcomes and the effects of lower marginal doses. We performed a retrospective study of patients treated for VS at Gamma knife of Spokane between 2003 and 2008. Endpoints measured include tumor control, hearing preservation, and facial nerve preservation, including the effect of tumor size and marginal dose. Statistical analysis was performed with Wilcoxon signed-rank test, paired Student t test, Mann-Whitney U test, Kendall's rank correlation, Fisher exact test, and Liddell's exact χ(2) test for matched pairs. With a mean follow-up of 26 months, 93.8% of tumors either shrank or remained static after receiving a mean marginal dose of 12.7 Gy. Tumor control was independent of marginal dose or tumor size. Hearing preservation was achieved in 64% of patients with serviceable function before the treatment. Hearing changes were independent of dose or tumor size. Preservation of good facial nerve function was achieved in 95% of patients. Post-treatment hydrocephalus occurred in 4.4% of patients, but no other significant morbidities were elucidated. In the treatment of VS, contemporary radiosurgical techniques and the use of marginal doses below 13 Gy offer excellent tumor control, at high rates relative to surgical intervention. These findings are independent of marginal dose and tumor size. Patients should be informed about the benefits and risks of radiosurgery and microsurgery before choosing an intervention. Further analysis of post-treatment outcomes should be encouraged as follow-up times increase and the treatment protocols continue to evolve.

MOLECULAR CLONING, SEQUENCING, EXPRESSION AND BIOLOGICAL ACTIVITY OF GIANT PANDA (AILUROPODA MELANOLEUCA) INTERFERON-GAMMA.

PubMed

Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun

2012-06-29

The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.

Respiratory Francisella tularensis live vaccine strain infection induces Th17 cells and prostaglandin E2, which inhibits generation of gamma interferon-positive T cells.

PubMed

Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A

2008-06-01

Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).

Adjuvant immunotherapy of feline fibrosarcoma with recombinant feline interferon-omega.

PubMed

Hampel, Verena; Schwarz, Bianca; Kempf, Christine; Köstlin, Roberto; Schillinger, Ulrike; Küchenhoff, Helmut; Fenske, Nora; Brill, Thomas; Hirschberger, Johannes

2007-01-01

Recombinant feline interferon-omega (rFeIFN-omega) was tested as a treatment option for cats with fibrosarcoma to assess safety and feasibility. Treatment with rFeIFN-omega in cats with fibrosarcoma is safe and feasible. Twenty domestic cats. In an open-labeled uncontrolled clinical trial 12 injections of 1 x 10(6) U/kg rFeIFN-omega were administered over a 5-week period: the 1st through 4th injections were given intratumorally, and the 5th through 12th injections were administered subcutaneously at the tumor excision site. Wide surgical excision of the tumors was carried out after the 4th injection and before the 5th injection of rFeIFN-omega. A Common Terminology Criteria for Adverse Events (CTCAE) analysis was conducted. Flow cytometry of fibrosarcoma cells after incubation with rFeIFN-omega and recombinant feline interferon-gamma was performed to assess the biological effect of rFeIFN-omega. Changes in blood cell count, increases in serum aspartate-amino-transferase activity, serum bilirubin concentration, serum creatinine and serum electrolyte concentrations, weight loss, anorexia, increased body temperature, and reduced general condition were observed but were mostly minor (grade 1 and 2) and self limiting. Eosinophilia (P = .025), neutropenia (P = .021), and weight loss (P < .001) were statistically correlated with rFeIFN-omega-treatment (analysis of parameters before treatment and after 3 injections of rFeIFN-omega). Flow cytometry of 5 unrelated feline fibrosarcoma cell lines showed increased expression of major histocompatibility complex (MHC) class I molecules (P = .026) in response to in vitro incubation with rFeIFN-omega, whereas expression of MHC class II molecules was not affected significantly. RFeIFN-omega for the treatment of feline fibrosarcoma is safe, well tolerated, and can be easily performed in practice. To assess the efficacy of the treatment, it should be tested in a placebo-controlled trial.

Gamma Interferon Loaded onto Albumin Nanoparticles: In Vitro and In Vivo Activities against Brucella abortus▿

PubMed Central

Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.

2007-01-01

The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401

Frequency of indeterminate results from an interferon-gamma release assay among HIV-infected individuals.

PubMed

Oliveira, Sandra Maria do Valle Leone de; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria

2017-01-01

To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. Avaliar a frequência de resultados indeterminados de um interferon-gamma release assay (IGRA, ensaio de liberação de interferon-gama) e os fatores relacionados com esses resultados em pessoas vivendo com HIV/AIDS (PVHA). Foram avaliadas 81 PVHA na região Centro-Oeste do Brasil, por meio do teste tuberculínico e de um IGRA. Informações a respeito de vari

Immunobiologic effects of cytokine gene transfer of the B16-BL6 melanoma.

PubMed

Strome, S E; Krauss, J C; Cameron, M J; Forslund, K; Shu, S; Chang, A E

1993-12-01

The genetic modification of tumors offers an approach to modulate the host immune response to relatively weak native tumor antigens. We examined the immunobiologic effects of various cytokine genes transferred into the poorly immunogenic B16-BL6 murine melanoma. Retroviral expression vectors containing cDNAs for interleukin 2, interleukin 4, interferon gamma, or a neomycin-resistant control were electroporated into a B16-BL6 tumor clone. Selected transfected clones were examined for in vitro cytokine secretion and in vivo tumorigenicity. When cells from individual clones were injected intradermally into syngeneic mice, the interleukin 4-secreting clone grew significantly slower than did the neomycin-resistant transfected control, while the growth of the interleukin 2- and interferon gamma-expressing clones was not affected. Despite minimal cytokine secretion by interferon gamma-transfected cells, these cells expressed upregulated major histocompatibility class I antigen and were more susceptible to lysis by allosensitized cytotoxic T lymphocytes compared with parental or neomycin-resistant transfected tumor targets. We observed diverse immunobiologic effects associated with cytokine gene transfer into the B16-BL6 melanoma. Interleukin 4 transfection of tumor resulted in decreased in vivo tumorigenicity that may be related to a host immune response. Further studies to evaluate the host T-cell response to these gene-modified tumors are being investigated.

Knockdown of hTERT and concurrent treatment with interferon-gamma inhibited proliferation and invasion of human glioblastoma cell lines

PubMed Central

George, Joseph; Banik, Naren L.; Ray, Swapan K.

2011-01-01

Human telomerase reverse transcriptase (hTERT) is the catalytic component of telomerase that facilitates tumor cell invasion and proliferation. Telomerase and hTERT are remarkably upregulated in majority of cancers including glioblastoma. Interferon-gamma (IFN-γ) modulates several cellular activities including cell cycle and multiplication through transcriptional regulation. The present investigation was designed to unravel the molecular mechanisms of the inhibition of cell proliferation, migration, and invasion of human glioblastoma SNB-19 and LN-18 cell lines after knockdown of hTERT using a plasmid vector based siRNA and concurrent treatment with IFN-γ. We observed more than 80% inhibition of cell proliferation, migration, and invasion of both cell lines after the treatment with combination of hTERT siRNA and IFN-γ. Our studies also showed accumulation of apoptotic cells in subG1 phase and an increase in cell population in G0/G1 with a reduction in G2/M phase indicating cell cycle arrest in G0/G1 phase for apoptosis. Semiquantitative and real-time RT-PCR analyses demonstrated significant downregulation of c- Myc and upregulation of p21 Waf1 and p27 Kip1. Western blotting confirmed the downregulation of the molecules involved in cell proliferation, migration, and invasion and also showed upregulation of cell cycle inhibitors. In conclusion, our study demonstrated that knockdown of hTERT siRNA and concurrent treatment with IFN-γ effectively inhibited cell proliferation, migration, and invasion in glioblastoma cells through downregulation of the molecules involved in these processes and cell cycle inhibition. Therefore, the combination of hTERT siRNA and IFN-γ offers a potential therapeutic strategy for controlling growth of human glioblastoma cells. PMID:20394835

Interferon-γ differentially modulates the impact of tumor necrosis factor-α on human endometrial stromal cells.

PubMed

Spratte, Julia; Oemus, Anne; Zygmunt, Marek; Fluhr, Herbert

2015-09-01

The pro-inflammatory T helper (Th)-1 cytokines, tumor necrosis factor-α (TNF-α) and interferon-γ (IFN-γ), are immunological factors relevant at the feto-maternal interface and involved in the pathophysiology of implantation disorders. The synergistic action of the two cytokines has been described with regard to apoptotic cell death and inflammatory responses in different cell types, but little is known regarding the human endometrium. Therefore, we examined the interaction of TNF-α and IFN-γ in human endometrial stromal cells (ESCs). ESCs were isolated from specimens obtained during hysterectomy and decidualized in vitro. Cells were incubated with TNF-α, IFN-γ or signaling-inhibitor. Insulin-like growth factor binding protein (IGFBP)-1, prolactin (PRL), leukemia inhibitory factor (LIF), interleukin (IL)-6, IL-8, regulated on activation normal T-cell expressed and secreted protein (RANTES) and monocyte chemotactic protein (MCP)-1 were measured using ELISA and real-time RT-PCR. Nuclear factor of transcription (NF)-κB and its inhibitor (IκBα) were analyzed by in-cell western assay and transcription factor assay. TNF-α inhibited and IFN-γ did not affect the decidualization of ESCs. In contrast, IFN-gamma differentially modulated the stimulating effect of TNF-alpha on cytokines by enhancing IL-6, RANTES and MCP-1 and attenuating LIF mRNA expression. These effects were time- and dose-dependent. IFN-γ had no impact on the initial activation of NF-κB signaling. Histone-deacetylase activity was involved in the modulating effect of IFN-γ on RANTES secretion. These observations showed a distinct pattern of interaction of the Th-1 cytokines, TNF-α and IFN-γ in the human endometrium, which could play an important role in the pathophysiology of implantation disorders. Copyright © 2015 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier Urban & Partner Sp. z

Establishment of a novel endothelial target mouse model of a typhus group rickettsiosis: evidence for critical roles for gamma interferon and CD8 T lymphocytes.

PubMed

Walker, D H; Popov, V L; Feng, H M

2000-09-01

A mouse model of typhus rickettsiosis that reproduces the hematogenous dissemination to the critical target organs, including brain, lungs, heart, and kidneys, primary endothelial and, to a lesser degree, macrophage intracellular rickettsial infection, and typical vascular-based lesions of louse-borne typhus and murine typhus was established. Intravenous inoculation of C3H/HeN mice with Rickettsia typhi caused disease with a duration of the incubation period and mortality rate that were dependent on the infective dose of rickettsiae. Lethal infection was associated with high concentrations of R. typhi in the lungs and brain, despite a brisker humoral immune response to the rickettsiae than in the sublethal infection. Gamma interferon and CD8 T lymphocytes were demonstrated to be crucial to clearance of the rickettsiae and recovery from infection in experiments in which specific monoclonal antibodies were administered to deplete these components. Death of animals depleted of gamma interferon or CD8 T lymphocytes was associated with overwhelming rickettsial infection demonstrated by titers of infectious rickettsiae and by immunohistochemistry. An effective antirickettsial immune response was associated with elevated serum concentrations of IL-12 on Day 5 and increased secretion of IL-12 by concanavalin-A-stimulated spleen cells on Day 5. Evidence for transient suppression of the immune response consisted of marked reduction in the secretion of IL-2 and IL-12 by concanavalin-A-stimulated spleen cells on Days 10 and 15. This model offers excellent opportunities for study of attenuation and pathogenetic mechanisms of typhus rickettsiae, which are established biologic weapons of potential use in bioterrorism.

Effect of recombinant human gamma interferon on intracellular activities of antibiotics against Listeria monocytogenes in the human macrophage cell line THP-1.

PubMed Central

Scorneaux, B; Ouadrhiri, Y; Anzalone, G; Tulkens, P M

1996-01-01

Listeria monocytogenes is a facultative intracellular pathogen which enters cells by endocytosis and reaches phagolysosomes from where it escapes and multiplies in the cytosol of untreated cells. Exposure of macrophages to gamma interferon (IFN-gamma) restricts L. monocytogenes to phagosomes and prevents its intracellular multiplication. We have tested whether IFN-gamma also modulates the susceptibility of L. monocytogenes to antibiotics. We selected drugs from three different classes displaying marked properties concerning their cellular accumulation and subcellular distribution, namely, ampicillin (not accumulated by cells but present in cytosol), azithromycin (largely accumulated by cells but mostly restricted to lysosomes), and sparfloxacin (accumulated to a fair extent but detected only in cytosol). We used a continuous line of myelomonocytic cells (THP-1 macrophages), which display specific surface receptors for IFN-gamma, and examined the activity of these antibiotics against L. monocytogenes Hly+ (virulent variant) and L. monocytogenes Hly- (a nonvirulent variant defective in hemolysin production). Untreated THP-1 and phorbol myristate acetate-differentiated THP-1 were permissive for infection and multiplication of intracellular L. monocytogenes Hly+ (virulent variant). All three antibiotics tested were bactericidal against this Listeria strain when added to an extracellular concentration of 10x their MIC. After preexposure of THP-1 to IFN-gamma, L. monocytogenes Hly+ was still phagocytosed but no longer grew intracellularly. The activity of ampicillin became almost undetectable (antagonistic effect), and that of azithromycin was unchanged (additive effect with that of IFN-gamma), whereas that of sparfloxacin was markedly enhanced (synergy). A similar behavior (lack of bacterial growth, associated with a loss of activity of ampicillin, an enhanced activity of sparfloxacin, and unchanged activity of azithromycin) was observed in cells infected with L

Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma.

PubMed

Magee, Kelsey E; Kelsey, Christina E; Kurzinski, Katherine L; Ho, Jonhan; Mlakar, Logan R; Feghali-Bostwick, Carol A; Torok, Kathryn S

2013-01-01

The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS.

Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma

PubMed Central

2013-01-01

Introduction The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. Methods The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). Results IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Conclusions Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS. PMID:24499523

Delayed translational silencing of ceruloplasmin transcript in gamma interferon-activated U937 monocytic cells: role of the 3' untranslated region

NASA Technical Reports Server (NTRS)

Mazumder, B.; Fox, P. L.

1999-01-01

Ceruloplasmin (Cp) is an acute-phase protein with ferroxidase, amine oxidase, and pro- and antioxidant activities. The primary site of Cp synthesis in human adults is the liver, but it is also synthesized by cells of monocytic origin. We have shown that gamma interferon (IFN-gamma) induces the synthesis of Cp mRNA and protein in monocytic cells. We now report that the induced synthesis of Cp is terminated by a mechanism involving transcript-specific translational repression. Cp protein synthesis in U937 cells ceased after 16 h even in the presence of abundant Cp mRNA. RNA isolated from cells treated with IFN-gamma for 24 h exhibited a high in vitro translation rate, suggesting that the transcript was not defective. Ribosomal association of Cp mRNA was examined by sucrose centrifugation. When Cp synthesis was high, i.e., after 8 h of IFN-gamma treatment, Cp mRNA was primarily associated with polyribosomes. However, after 24 h, when Cp synthesis was low, Cp mRNA was primarily in the nonpolyribosomal fraction. Cytosolic extracts from cells treated with IFN-gamma for 24 h, but not for 8 h, contained a factor which blocked in vitro Cp translation. Inhibitor expression was cell type specific and present in extracts of human cells of myeloid origin, but not in several nonmyeloid cells. The inhibitory factor bound to the 3' untranslated region (3'-UTR) of Cp mRNA, as shown by restoration of in vitro translation by synthetic 3'-UTR added as a "decoy" and detection of a binding complex by RNA gel shift analysis. Deletion mapping of the Cp 3'-UTR indicated an internal 100-nucleotide region of the Cp 3'-UTR that was required for complex formation as well as for silencing of translation. Although transcript-specific translational control is common during development and differentiation and global translational control occurs during responses to cytokines and stress, to our knowledge, this is the first report of translational silencing of a specific transcript following cytokine

Lactic Acid Bacteria from Kefir Increase Cytotoxicity of Natural Killer Cells to Tumor Cells

PubMed Central

Yamane, Takuya; Sakamoto, Tatsuji; Nakagaki, Takenori; Nakano, Yoshihisa

2018-01-01

The Japanese fermented beverage, homemade kefir, contains six lactic acid bacteria: Lactococcus. lactis subsp. Lactis, Lactococcus. lactis subsp. Cremoris, Lactococcus. Lactis subsp. Lactis biovar diacetylactis, Lactobacillus plantarum, Leuconostoc meseuteroides subsp. Cremoris and Lactobacillus casei. In this study, we found that a mixture of the six lactic acid bacteria from kefir increased the cytotoxicity of human natural killer KHYG-1 cells to human chronic myelogenous leukemia K562 cells and colorectal tumor HCT116 cells. Furthermore, levels of mRNA expression and secretion of IFN-γ (interferon gamma) increased in KHYG-1 cells that had been treated with the six lactic acid bacteria mixture from kefir. The results suggest that the six lactic acid bacteria mixture from kefir has strong effects on natural immunity and tumor cell cytotoxicity. PMID:29584690

Results of space experiment program "Interferon". II. Influence of spaceflight conditions on the activity of interferon preparations and interferon inducers ("Interferon II").

PubMed

Tálas, M; Bátkai, L; Stöger, I; Nagy, K; Hiros, L; Konstantinova, I; Kozharinov, V

1983-01-01

The influence of spaceflight conditions on the biological activity of HuIFN-alpha preparations (lyophilized, in solution and in ointment) and interferon inducers was studied. In antiviral activity no difference was observed between the samples kept aboard the spaceship and the controls kept under ground conditions. The interferon inducers poly I:C, poly G:C and gossipol placed in the space laboratory for 7 days maintained their interferon-inducing capacity. The circulating interferon level in mice was the same irrespective of the induction being performed with flight or ground-control samples of inducers.

Effects of Chicken Interferon Gamma on Newcastle Disease Virus Vaccine Immunogenicity

PubMed Central

Cardenas-Garcia, Stivalis; Dunwoody, Robert P.; Marcano, Valerie; Diel, Diego G.; Williams, Robert J.; Gogal, Robert M.; Brown, Corrie C.; Miller, Patti J.; Afonso, Claudio L.

2016-01-01

More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFNγ) during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFNγ with Newcastle disease virus (NDV) antigens were evaluated for their ability to enhance the avian immune response and their protective capacity upon challenge with virulent NDV. These systems consisted of: 1) a DNA vaccine expressing the Newcastle disease virus fusion (F) protein co-administered with a vector expressing the chIFNγ gene for in ovo and booster vaccination, 2) a recombinant Newcastle disease virus expressing the chIFNγ gene (rZJ1*L/IFNγ) used as a live vaccine delivered in ovo and into juvenile chickens, and 3) the same rZJ1*L/IFNγ virus used as an inactivated vaccine for juvenile chickens. Co-administration of chIFNγ with a DNA vaccine expressing the F protein resulted in higher levels of morbidity and mortality, and higher amounts of virulent virus shed after challenge when compared to the group that did not receive chIFNγ. The live vaccine system co-delivering chIFNγ did not enhanced post-vaccination antibody response, nor improved survival after hatch, when administered in ovo, and did not affect survival after challenge when administered to juvenile chickens. The low dose of the inactivated vaccine co-delivering active chIFNγ induced lower antibody titers than the groups that did not receive the cytokine. The high dose of this vaccine did not increase the antibody titers or antigen-specific memory response, and did not reduce the amount of challenge virus shed or mortality after challenge. In summary, regardless of the delivery system, chIFNγ, when administered simultaneously with the vaccine antigen, did not enhance Newcastle disease virus vaccine immunogenicity. PMID:27409587

T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.

PubMed

Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong

2017-05-12

Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.

Interferon gamma, an important marker of response to immune checkpoint blockade in non-small cell lung cancer and melanoma patients

PubMed Central

Karachaliou, Niki; Gonzalez-Cao, Maria; Crespo, Guillermo; Drozdowskyj, Ana; Aldeguer, Erika; Gimenez-Capitan, Ana; Teixido, Cristina; Molina-Vila, Miguel Angel; Viteri, Santiago; De Los Llanos Gil, Maria; Algarra, Salvador Martin; Perez-Ruiz, Elisabeth; Marquez-Rodas, Ivan; Rodriguez-Abreu, Delvys; Blanco, Remedios; Puertolas, Teresa; Royo, Maria Angeles; Rosell, Rafael

2018-01-01

Background: Programmed death-ligand 1 (PD-L1) may be induced by oncogenic signals or can be upregulated via interferon gamma (IFN-γ). We have explored whether the expression of IFNG, the gene encoding IFN-γ, is associated with clinical response to the immune checkpoint blockade in non-small cell lung cancer (NSCLC) and melanoma patients. The role of inflammation-associated transcription factors STAT3, IKBKE, STAT1 and other associated genes has also been examined. Methods: Total RNA from 17 NSCLC and 21 melanoma patients was analyzed by quantitative reverse transcription PCR. STAT3 and Rantes, YAP1 and CXCL5, DNMT1, RIG1 and TET1, EOMES, IFNG, PD-L1 and CTLA4, IKBKE and NFATC1 mRNA were examined. PD-L1 protein expression in tumor and immune cells and stromal infiltration of CD8+ T-cells were also evaluated. Progression-free survival and overall survival were estimated. Results: A total of 17 NSCLC patients received nivolumab and 21 melanoma patients received pembrolizumab. Progression-free survival with nivolumab was significantly longer in NSCLC patients with high versus low IFNG expression (5.1 months versus 2 months, p = 0.0124). Progression-free survival with pembrolizumab was significantly longer in melanoma patients with high versus low IFNG expression (5.0 months versus 1.9 months, p = 0.0099). Significantly longer overall survival was observed for melanoma patients with high versus low IFNG expression (not reached versus 10.2 months p = 0.0183). There was a trend for longer overall survival for NSCLC patients with high versus low IFNG expression. Conclusions: IFN-γ is an important marker for prediction of response to immune checkpoint blockade. Further research is warranted in order to validate whether IFNG is more accurate than PD-L1. PMID:29383037

Tuberculin Skin Tests versus Interferon-Gamma Release Assays in Tuberculosis Screening among Immigrant Visa Applicants.

PubMed

Chuke, Stella O; Yen, Nguyen Thi Ngoc; Laserson, Kayla F; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G; Whitworth, William C; Shah, J Jina; Painter, John A; Mazurek, Gerald H; Maloney, Susan A

2014-01-01

Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB.

Suppressing effect of low-dose gamma-ray irradiation on collagen-induced arthritis.

PubMed

Nakatsukasa, Hiroko; Tsukimoto, Mitsutoshi; Ohshima, Yasuhiro; Tago, Fumitoshi; Masada, Ayako; Kojima, Shuji

2008-07-01

We previously reported attenuation of autoimmune disease by low-dose gamma-ray irradiation in MRL-lpr/lpr mice. Here, we studied the effect of low-dose gamma-ray irradiation on collagen-induced arthritis (CIA) in DBA/1J mice. Mice were immunized with type II collagen, and exposed to low-dose gamma-rays (0.5 Gy per week for 5 weeks). Paw swelling, redness, and bone degradation were suppressed by irradiation, which also delayed the onset of pathological change and reduced the severity of the arthritis. Production of tumor necrosis factor-alpha, interferon-gamma, and interleukin-6, which play important roles in the onset of CIA, was suppressed by the irradiation. The level of anti-type II collagen antibody, which is essential for the onset of CIA, was also lower in irradiated CIA mice. The population of plasma cells was increased in CIA mice, but irradiation blocked this increase. Since regulatory T cells are known to be involved in suppression of autoimmune disease, the population of CD4(+)CD25(+)Foxp3(+) regulatory T cells was measured. Intriguingly, a significant increase of these regulatory T cells was found in irradiated CIA mice. Overall, our data suggest that low-dose gamma-ray irradiation could attenuate CIA through suppression of pro-inflammatory cytokines and autoantibody production, and induction of regulatory T cells.

Interferon γ limits the effectiveness of melanoma peptide vaccines.

PubMed

Cho, Hyun-Il; Lee, Young-Ran; Celis, Esteban

2011-01-06

The development of effective therapeutic vaccines to generate tumor-reactive cytotoxic T lymphocytes (CTLs) continues to be a top research priority. However, in spite of some promising results, there are no clear examples of vaccines that eradicate established tumors. Most vaccines are ineffective because they generate low numbers of CTLs and because numerous immunosuppressive factors abound in tumor-bearing hosts. We designed a peptide vaccine that produces large numbers of tumor-reactive CTLs in a mouse model of melanoma. Surprisingly, CTL tumor recognition and antitumor effects decreased in the presence of interferon γ (IFNγ), a cytokine that can provide therapeutic benefit. Tumors exposed to IFNγ evade CTLs by inducing large amounts of noncognate major histocompatibility complex class I molecules, which limit T-cell activation and effector function. Our results demonstrate that peptide vaccines can eradicate large, established tumors in circumstances under which the inhibitory activities of IFNγ are curtailed.

Protective Role of Gamma Interferon during the Recall Response to Influenza Virus

PubMed Central

Bot, Adrian; Bot, Simona; Bona, Constantin A.

1998-01-01

During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110

Study Protocol: Early Stereotactic Gamma Knife Radiosurgery to Residual Tumor After Surgery of Newly Diagnosed Glioblastoma (Gamma-GBM).

PubMed

Brehmer, Stefanie; Grimm, Mario Alexander; Förster, Alex; Seiz-Rosenhagen, Marcel; Welzel, Grit; Stieler, Florian; Wenz, Frederik; Groden, Christoph; Mai, Sabine; Hänggi, Daniel; Giordano, Frank Anton

2018-04-24

Glioblastoma (GBM) is the most common malignant brain tumor in adult patients. Tumor recurrence commonly occurs around the resection cavity, especially after subtotal resection (STR). Consequently, the extent of resection correlates with overall survival (OS), suggesting that depletion of postoperative tumor remnants will improve outcome. To assess safety and efficacy of adding stereotactic radiosurgery (SRS) to the standard treatment of GBM in patients with postoperative residual tumor. Gamma-GBM is a single center, open-label, prospective, single arm, phase II study that includes patients with newly diagnosed GBM (intraoperative via frozen sections) who underwent STR (residual tumor will be identified by native and contrast enhanced T1-weighted magnetic resonance imaging scans). All patients will receive SRS with 15 Gy (prescribed to the 50% isodose enclosing all areas of residual tumor) early (within 24-72 h) after surgery. Thereafter, all patients undergo standard-of-care therapy for GBM (radiochemotherapy with 60 Gy external beam radiotherapy [EBRT] plus concomitant temozolomide and 6 cycles of adjuvant temozolomide chemotherapy). The primary outcome is median progression-free survival, secondary outcomes are median OS, occurrence of radiation induced acute (<3 wk), early delayed (<3 mo), and late (>3 mo post-SRS) neurotoxicity and incidence of symptomatic radionecrosis. We expect to detect efficacy and safety signals by the immediate application of SRS to standard-of-care therapy in newly diagnosed GBM. Early postoperative SRS to areas of residual tumor could bridge the therapeutic gap between surgery and adjuvant therapies.

Engineered outer membrane vesicle is potent to elicit HPV16E7-specific cellular immunity in a mouse model of TC-1 graft tumor.

PubMed

Wang, Shijie; Huang, Weiwei; Li, Kui; Yao, Yufeng; Yang, Xu; Bai, Hongmei; Sun, Wenjia; Liu, Cunbao; Ma, Yanbing

2017-01-01

Currently, therapeutic tumor vaccines under development generally lack significant effects in human clinical trials. Exploring a powerful antigen delivery system is a potential approach to improve vaccine efficacy. We sought to explore engineered bacterial outer membrane vesicles (OMVs) as a new vaccine carrier for efficiently delivering tumor antigens and provoking robust antitumor immune responses. First, the tumoral antigen human papillomavirus type 16 early protein E7 (HPV16E7) was presented on Escherichia coli -derived OMVs by genetic engineering methods, acquiring the recombinant OMV vaccine. Second, the ability of recombinant OMVs delivering their components and the model antigen green fluorescent protein to antigen-presenting cells was investigated in the macrophage Raw264.7 cells and in bone marrow-derived dendritic cells in vitro. Third, it was evaluated in TC-1 graft tumor model in mice that the recombinant OMVs displaying HPV16E7 stimulated specific cellular immune response and intervened the growth of established tumor. E. coli DH5α-derived OMVs could be taken up rapidly by dendritic cells, for which vesicle structure has been proven to be important. OMVs significantly stimulated the expression of dendritic cellmaturation markers CD80, CD86, CD83 and CD40. The HPV16E7 was successfully embedded in engineered OMVs through gene recombinant techniques. Subcutaneous immunization with the engineered OMVs induced E7 antigen-specific cellular immune responses, as shown by the increased numbers of interferon-gamma-expressing splenocytes by enzyme-linked immunospot assay and interferon-gamma-expressing CD4 + and CD8 + cells by flow cytometry analyses. Furthermore, the growth of grafted TC-1 tumors in mice was significantly suppressed by therapeutic vaccination. The recombinant E7 proteins presented by OMVs were more potent than those mixed with wild-type OMVs or administered alone for inducing specific cellular immunity and suppressing tumor growth. The results

[Effects of recombinant human alpha-2b and gamma interferons on bone marrow megakaryocyte progenitors (CFU-Meg) from patients with chronic myelocytic leukemia].

PubMed

Tanabe, Y; Dan, K; Kuriya, S; Nomura, T

1989-10-01

The effects of recombinant human interferon (IFN) alpha-2b and gamma on the bone marrow megakaryocyte progenitors (CFU-Meg) were compared between eight patients in the chronic phase of Ph1-positive chronic myelocytic leukemia (CML) and five hematologically normal patients. CFU-Meg was assayed in plasma clot culture added with phytohemagglutinin-stimulated leukocyte-conditioned medium as a source of colony stimulating activity. The average count of CFU-Meg colonies formed from the bone marrow of CML patients was 5.5 times that of normal controls. Spontaneous CFU-Meg colonies were grown in seven of eight CML patients, but in none of five controls. Colony formation by CFU-Meg in CML as well as normal bone marrow was suppressed by the two preparations of IFN in a dose dependent fashion. Their suppressive influence on colonies from CFU-Meg was comparable between CML and normal bone marrow at lower concentrations, but was less marked for CML than normal bone marrow at higher concentrations. The formation of CFU-Meg colonies from CML bone marrow was more severely suppressed by IFN-gamma than IFN-alpha-2b. Depletion of either T lymphocytes or adherent cells from the CML bone marrow cells diminished the suppressive effects of IFN-gamma, but had no influence on the effects of IFN-alpha-2b.

Effects of interferon-gamma and lipopolysaccharide on macrophage iron metabolism are mediated by nitric oxide-induced degradation of iron regulatory protein 2.

PubMed

Kim, S; Ponka, P

2000-03-03

Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.

No changes in serum concentrations of interleukin 10 (IL-10) and interferon gamma (IF-gamma) before and after treatment of the thyroid eye disease (TED).

PubMed

Laban-Guceva, Nevenka; Antova, Magdalena; Bogoev, Milco

2007-11-01

TED is a severe eye disease leading in rare cases to decrease of sight, optic nerve compression and blindness. Recently, significant progresses in understanding the disease have been done. Nevertheless, the treatment of the disease, especially in its severe form remains challenging. Glucocorticoids (GC) have been the basis of the treatment for a long time. Orbital irradiation (OI) and optical decompression (OD) are also used in managing the severe forms of TED. Somatostatin, intravenous immunoglobulin have been also used, with conflicting results. Regarding the potential for the treatment of TED with cytokine antagonists, controlled clinical studies are not available. Since cytokines play an important role in the pathogenesis of the TED, they seemed to be logical choice for modern TED treatment. It has been shown that both Th1 (interleukin-2, tumor necrosis factor gamma, interleukin gamma) and Th2 (interleukin -4, -5, -10) profile T cells are activated in the TED. We therefore measured interleukin-gamma, IF-gamma and interleukin -10 (IL-10)(Th1 and Th2 pattern) to assess its relationship to the course of the disease. This paper shows that both Th1 (IL-2) and Th2 (IF-gamma) pathways represented by those two cytokines are not involved (IL-10 before 2.29+/-5.23 and after treatment 3.77+/-8.44; IF gamma before 0.50+/-0.24 and after treatment 0.35+/-0.19). No relationship to the response to treatment was found. GC resulted in positive response in 8/22 patients, OI (12 patients) given after CS therapy, resulted in a response in all patients. Increase in proptosis, loss of visual acuity is spite of CS treatment prompted OD in two patients, who both recovered visual acuity and proptosis fell under 25 mm Hertel.

Fabrication of fiber-optic localized surface plasmon resonance sensor and its application to detect antibody-antigen reaction of interferon-gamma

NASA Astrophysics Data System (ADS)

Jeong, Hyeon-Ho; Erdene, Norov; Lee, Seung-Ki; Jeong, Dae-Hong; Park, Jae-Hyoung

2011-12-01

A fiber-optic localized surface plasmon (FO LSPR) sensor was fabricated by gold nanoparticles (Au NPs) immobilized on the end-face of an optical fiber. When Au NPs were formed on the end-face of an optical fiber by chemical reaction, Au NPs aggregation occurred and the Au NPs were immobilized in various forms such as monomers, dimers, trimers, etc. The component ratio of the Au NPs on the end-face of the fabricated FO LSPR sensor was slightly changed whenever the sensors were fabricated in the same condition. Including this phenomenon, the FO LSPR sensor was fabricated with high sensitivity by controlling the density of Au NPs. Also, the fabricated sensors were measured for the resonance intensity for the different optical systems and analyzed for the effect on sensitivity. Finally, for application as a biosensor, the sensor was used for detecting the antibody-antigen reaction of interferon-gamma.

Antibodies elicited by the first non-viral prophylactic cancer vaccine show tumor-specificity and immunotherapeutic potential

PubMed Central

Lohmueller, Jason J.; Sato, Shuji; Popova, Lana; Chu, Isabel M.; Tucker, Meghan A.; Barberena, Roberto; Innocenti, Gregory M.; Cudic, Mare; Ham, James D.; Cheung, Wan Cheung; Polakiewicz, Roberto D.; Finn, Olivera J.

2016-01-01

MUC1 is a shared tumor antigen expressed on >80% of human cancers. We completed the first prophylactic cancer vaccine clinical trial based on a non-viral antigen, MUC1, in healthy individuals at-risk for colon cancer. This trial provided a unique source of potentially effective and safe immunotherapeutic drugs, fully-human antibodies affinity-matured in a healthy host to a tumor antigen. We purified, cloned, and characterized 13 IgGs specific for several tumor-associated MUC1 epitopes with a wide range of binding affinities. These antibodies bind hypoglycosylated MUC1 on human cancer cell lines and tumor tissues but show no reactivity against fully-glycosylated MUC1 on normal cells and tissues. We found that several antibodies activate complement-mediated cytotoxicity and that T cells carrying chimeric antigen receptors with the antibody variable regions kill MUC1+ target cells, express activation markers, and produce interferon gamma. Fully-human and tumor-specific, these antibodies are candidates for further testing and development as immunotherapeutic drugs. PMID:27545199

Identifying Mechanisms by Which Escherichia coli O157:H7 Subverts Interferon-γ Mediated Signal Transducer and Activator of Transcription-1 Activation

PubMed Central

Ho, Nathan K.; Crandall, Ian; Sherman, Philip M.

2012-01-01

Enterohemorrhagic Escherichia coli serotype O157:H7 is a food borne enteric bacterial pathogen that causes significant morbidity and mortality in both developing and industrialized nations. E. coli O157:H7 infection of host epithelial cells inhibits the interferon gamma pro-inflammatory signaling pathway, which is important for host defense against microbial pathogens, through the inhibition of Stat-1 tyrosine phosphorylation. The aim of this study was to determine which bacterial factors are involved in the inhibition of Stat-1 tyrosine phosphorylation. Human epithelial cells were challenged with either live bacteria or bacterial-derived culture supernatants, stimulated with interferon-gamma, and epithelial cell protein extracts were then analyzed by immunoblotting. The results show that Stat-1 tyrosine phosphorylation was inhibited by E. coli O157:H7 secreted proteins. Using sequential anion exchange and size exclusion chromatography, YodA was identified, but not confirmed to mediate subversion of the Stat-1 signaling pathway using isogenic mutants. We conclude that E. coli O157:H7 subverts Stat-1 tyrosine phosphorylation in response to interferon-gamma through a still as yet unidentified secreted bacterial protein. PMID:22253910

Persistently retained interferon-gamma responsiveness in individuals with a history of pulmonary tuberculosis.

PubMed

Seo, Kwang Won; Ahn, Jong-Joon; Ra, Seung Won; Kwon, Woon-Jung; Jegal, Yangjin

2014-06-01

The interferon gamma (IFN-γ) release assays (IGRAs) are the best method of detecting Mycobacterium tuberculosis infection. However, reports on IGRAs results obtained during and right after the treatment of tuberculosis (TB) have presented differing results. Some studies have shown declining responses, whereas other reports described persistent, fluctuating, or increasing responses. We postulated that the IGRA-positivity will decrease or revert long time after treatment of TB, and thus, evaluated the response of IGRA in subjects with a history of pulmonary TB. Seventy subjects (M:F = 51:19; age = 53.2 ± 11.8 years) underwent tuberculin skin tests (TSTs) and IGRA. The interval of time elapsed after the completion of anti-TB treatment was < 10 years for 16 subjects, 10-20 years for 13 subjects, 20-30 years for 16 subjects, and ≥ 30 years for 25 subjects. The TST was positive in 49 subjects (74%) and negative in 17 subjects (26%). The IGRA was positive in 52 subjects (74%) and negative in 18 subjects (26%). The IFN-γ level and the size of induration showed good correlation (r = 0.525, P < 0.001). However, the correlation between time elapsed after the completion of anti-TB treatment and the size of induration or that between time and the IFN-γ level was not significant. The TST and IGRA were positive in 72.7% and 68.0% of subjects ≥ 30 years after the treatment of pulmonary TB. In conclusion, majority of subjects with a history of pulmonary TB are IGRA-positive, even a few decades after the completion of anti-TB treatment.

Underlying pathways for interferon risk to type II diabetes mellitus.

PubMed

Abdel-Hamid, Nabil; Jubori, Taghreed Al; Farhan, Amaal; Mahrous, Mariam; Gouri, Adel; Awad, Ezzat; Breuss, Johannes

2013-11-01

It has been known that chronic liver treatments interfere with blood glucose metabolism. It was recognized that diabetes mellitus among chronic hepatitis C was greater in other types of chronic liver diseases. Hepatitis C directly promotes insulin resistance through the proteosomal degradation of insulin resistance substrate. It suppressed hepatocyte glucose uptake through down-regulation of surface expression of glucose transporter. Long-term exposure to cytokine over expression seems to be cytotoxic to both beta cells of the pancreas and to hepatocytes. Elevated tumor necrosis factor-a, or its neutralization, increased insulin sensitivity. Interferon-a may also elevate the serum level of interleukin-1 which is cytotoxic to pancreatic islet cells. Both diabetes mellitus and resistance to interferon-a therapy are abnormally mediated by over-expression of suppressor of cytokine signaling-1 in hepatocytes of chronic hepatitis C patients. These data suggest that interferon-a therapy should be administered with caution in patients showing any predisposition to Diabetes mellitus. Anti inflammatory therapy is critically recommended as a protector against disease development due to cytokine mediated Diabetes mellitus during hepatitis C therapy, since inflammation seems to be a main candidate to interferon suspected diabetogenesis.

Tumor-suppressive effects of natural-type interferon-β through CXCL10 in melanoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kobayashi, Hikaru; Nobeyama, Yoshimasa, E-mail: nobederm@jikei.ac.jp; Nakagawa, Hidemi

2015-08-21

Introduction: Type 1 interferon is in widespread use as adjuvant therapy to inhibit melanoma progression. Considering the tumor-suppressive effects of local administration of interferon-β (IFN-β) on lymphatic metastasis, the present study was conducted to identify melanoma-suppressive molecules that are up-regulated by IFN-β treatment of lymphatic endothelial cells. Materials and methods: Lymphatic endothelial cells, fibroblasts, and melanoma cells were treated with natural-type IFN-β, and melanoma cells were treated with CXCL10. Genome-wide oligonucleotide microarray analysis was performed using lymphatic endothelial cells with or without IFN-β treatment. Quantitative real-time reverse transcription-PCR and an enzyme-linked immunosorbent assay were performed to examine CXCL10 expression. Amore » proliferation assay was performed to examine the effects of IFN-β and CXCL10 in melanoma cells. Results: Genome-wide microarray analyses detected CXCL10 as a gene encoding a secretory protein that was up-regulated by IFN-β in lymphatic endothelial cells. IFN-β treatment significantly induced CXCL10 in dermal lymphatic endothelial cells and melanoma cells that are highly sensitive to IFN-β. CXCL10 reduced melanoma cell proliferation in IFN-β-sensitive cells as well as resistant cells. Melanoma cells in which CXCL10 was knocked down were sensitive to IFN-β. CXCR3-B, which encodes the CXCL10 receptor, was up-regulated in melanoma cells with high sensitivity to IFN-β and down-regulated in melanoma cells with medium to low sensitivity. Conclusions: Our data suggest that IFN-β suppresses proliferation and metastasis from the local lymphatic system and melanoma cells via CXCL10. Down-regulation of CXCR3-B by IFN-β may be associated with resistance to IFN-β. - Highlights: • We search melanoma-suppressive molecules induced by IFN-β. • IFN-β induces a high amount of CXCL10 from lymphatic endothelial cells. • CXCL10 induction level in melanoma cells is

Assessment of safety and interferon gamma responses of Mycobacterium bovis BCG vaccine in goat kids and milking goats.

PubMed

Pérez de Val, Bernat; Vidal, Enric; López-Soria, Sergio; Marco, Alberto; Cervera, Zoraida; Martín, Maite; Mercader, Irene; Singh, Mahavir; Raeber, Alex; Domingo, Mariano

2016-02-10

Vaccination of domestic animals has emerged as an alternative long-term strategy for the control of tuberculosis (TB). A trial under field conditions was conducted in a TB-free goat herd to assess the safety of the Mycobacterium bovis BCG vaccine. Eleven kids and 10 milking goats were vaccinated with BCG. Bacterial shedding and interferon gamma (IFN-γ) responses were monitored throughout the study. Comprehensive pathological examination and mycobacterial culture of target tissues were performed. BCG vaccine strain was only isolated from the draining lymph node of the injection site of a kid euthanized at week 8 post-vaccination. The remaining animals were euthanized at week 24. Six out of 20 showed small granulomas at the injection site. BCG shedding was not detected in either faeces or in milk throughout the study. All vaccinated kids showed BCG-induced IFN-γ responses at week 8 post-vaccination. BCG vaccination of goats showed no lack of biological safety for the animals, environment and public health, and local adverse reactions were negligible. Copyright © 2016 Elsevier Ltd. All rights reserved.

The role of interferon gamma release assays in the monitoring of response to anti-tuberculosis treatment in children.

PubMed

Shaik, Junaid; Pillay, Manormoney; Jeena, Prakash

2014-09-01

Successful control of childhood TB requires early diagnosis, effective chemotherapy and a method of evaluating the response to therapy. Identification of suitable biomarkers that predict the response to anti-TB therapy may allow the duration of treatment to be shortened. The majority of biomarker studies in paediatric TB have focused on the role of T cell-based interferon-gamma (IFN-γ) release assays (IGRAs) in the diagnosis of either latent or active disease. Little has been published on the role of IGRAs in the monitoring response to therapy in children. We reviewed the available literature to ascertain the value of IGRAs in the monitoring of response to anti-TB therapy in children. We explored the results of the few studies that have investigated the role of IGRAs as markers of response to anti-TB treatment in children. We conclude that the role of IGRAs as surrogate markers appears promising. Robust clinical trials are, however, needed to entrench the value of IGRAs as surrogate biomarkers of response to anti-TB therapy in children. Copyright © 2013 Elsevier Ltd. All rights reserved.

The effect of co-administration of DNA carrying chicken interferon-gamma gene on protection of chickens against infectious bursal disease by DNA-mediated vaccination.

PubMed

Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long

2006-11-17

The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.

Minimally cultured or selected autologous tumor-infiltrating lymphocytes after a lympho-depleting chemotherapy regimen in metastatic melanoma patients.

PubMed

Besser, Michal J; Shapira-Frommer, Ronnie; Treves, Avraham J; Zippel, Dov; Itzhaki, Orit; Schallmach, Ester; Kubi, Adva; Shalmon, Bruria; Hardan, Izhar; Catane, Raphael; Segal, Eran; Markel, Gal; Apter, Sara; Nun, Alon Ben; Kuchuk, Iryna; Shimoni, Avichai; Nagler, Arnon; Schachter, Jacob

2009-05-01

Adoptive cell therapy with autologous tumor-infiltrating lymphocytes (TIL) and high-dose interleukin-2 (IL-2), after nonmyeloablative chemotherapy, has been shown to result in tumor regression in half of refractory metastatic melanoma patients. In the present study, we describe 2 separate clinical protocols. Twelve patients were treated with "Selected"-TIL, as previously reported and 8 patients with the modified version of "Young"-TIL. Selected-TIL protocol required the establishment of multiple T-cell cultures from 1 patient and in vitro selection of cultures secreting interferon-gamma upon antigenic stimulation. In contrast, Young-TIL are minimally cultured T cells with superior in vitro features that do not require further selection. Two of 12 Selected-TIL patients experienced objective clinical responses (1 complete response, 1 partial response). Out of 8 treated Young-TIL patients, 1 experienced complete response, 2 partial response, and 4 patients had disease stabilization. Twenty-one of 33 enrolled Selected-TIL patients were excluded from the protocol, mainly as cultures failed the interferon-gamma selection criteria or due to clinical deterioration, compared with only 3 Young-TIL patients. Expected bone marrow suppression and high-dose IL-2 toxicity were transient. There was no treatment-related mortality. This study vindicates the feasibility and effectiveness of TIL technology and calls for further efforts to implement and enhance this modality. The use of minimally cultured, unselected Young-TIL enables the treatment of most enrolled patients. Although the cohort of Young-TIL patients treated so far is rather small and the follow-up short, the response rate is encouraging.

Gamma knife radiosurgery for glomus jugulare tumors: therapeutic advantages of minimalism in the skull base.

PubMed

Sharma, Manish S; Gupta, A; Kale, S S; Agrawal, D; Mahapatra, A K; Sharma, B S

2008-01-01

Glomus jugulare (GJ) tumors are paragangliomas found in the region of the jugular foramen. Surgery with/without embolization and conventional radiotherapy has been the traditional management option. To analyze the efficacy of gamma knife radiosurgery (GKS) as a primary or an adjunctive form of therapy. A retrospective analysis of patients who received GKS at a tertiary neurosurgical center was performed. Of the 1601 patients who underwent GKS from 1997 to 2006, 24 patients with GJ underwent 25 procedures. The average age of the cohort was 46.6 years (range, 22-76 years) and the male to female ratio was 1:2. The most common neurological deficit was IX, X, XI cranial nerve paresis (15/24). Fifteen patients received primary GKS. Mean tumor size was 8.7 cc (range 1.1-17.2 cc). The coverage achieved was 93.1% (range 90-97%) using a mean tumor margin dose of 16.4 Gy (range 12-25 Gy) at a mean isodose of 49.5% (range 45-50%). Thirteen patients (six primary and seven secondary) were available for follow-up at a median interval of 24 months (range seven to 48 months). The average tumor size was 7.9 cc (range 1.1-17.2 cc). Using a mean tumor margin dose of 16.3 Gy (range 12-20 Gy) 93.6% coverage (range 91-97%) was achieved. Six patients improved clinically. A single patient developed transient trigeminal neuralgia. Magnetic resonance imaging follow-up was available for 10 patients; seven recorded a decrease in size. There was no tumor progression. Gamma knife radiosurgery is a safe and effective primary and secondary modality of treatment for GJ.

Three-dimensional crystal structure of recombinant murine interferon-beta.

PubMed Central

Senda, T; Shimazu, T; Matsuda, S; Kawano, G; Shimizu, H; Nakamura, K T; Mitsui, Y

1992-01-01

The crystal structure of recombinant murine interferon-beta (IFN-beta) has been solved by the multiple isomorphous replacement method and refined to an R-factor of 20.5% against 2.6 A X-ray diffraction data. The structure shows a variant of the alpha-helix bundle with a new chain-folding topology, which seems to represent a basic structural framework of all the IFN-alpha and IFN-beta molecules belonging to the type I family. Functionally important segments of the polypeptide chain, as implied through numerous gene manipulation studies carried out so far, are spatially clustered indicating the binding site(s) to the receptor(s). Comparison of the present structure with those of other alpha-helical cytokine proteins, including porcine growth hormone, interleukin 2 and interferon gamma, indicated either a topological similarity in chain folding or a similar spatial arrangement of the alpha-helices. Images PMID:1505514

[Interleukin 8 and interferon gamma in ocular toxoplasmosis].

PubMed

Czepiel, Jacek; Biesiada, Grazyna; Sobczyk-Krupiarz, Iwona; Miklasszewska, Grazyna; Fedak, Danuta; Solnica, Bogdan; Mach, Tomasz; Garlicki, Aleksander

2011-01-01

Toxoplasmosis is one of the most common parasitic infections in the world, it is caused by Toxoplasma gondii. The infection is typically asymptomatic or the symptoms are very mild. Approximately 10% patients have limphadenopathy, involvement of the others organs, like eyes, nervous system, liver, heart, are observed more rarely. The aim of our study was to assess the level of selected cytokines in blood among patients with ocular toxoplasmosis. We have enrolled in the study 30 patients, 19-42 years old, treated for ocular toxoplasmosis, and 20 healthy volunteers, 20-48 years old, to the control group. Tests for blood morphology, C-reactive protein, the level of IL-8 and IFN-gamma were performed in all patients. The blood parameters in toxoplasmosis group were performed before antiparasitic treatment was given. The level of IFN-gamma in blood was lower among patients with ocular toxoplasmosis comparing with control group (1.52 vs. 4.18 pg/ml; p = 0.002). The level of IL-8 in blood was lower among patients with ocular toxoplasmosis comparing with control group (22.96 vs. 94.3 pg/ml; p = 0,007). There were no correlations between analyzed cytokines and blood morphology or CRP. The low level of IFN-gamma and IL-8 in blood is important factor leading to reactivation of the ocular toxoplasmosis.

Interferon-gamma and interleukin-10 profile of children with tuberculosis in North Sumatera, Indonesia

NASA Astrophysics Data System (ADS)

Daulay, R. S.; Daulay, R. M.

2018-03-01

Cellular immunity was mediated the host immune response against Mycobacterium tuberculosis, in which cytokine and T-helper (Th) 1 cells play an important role. Interferon-gamma (IFN-γ) is a leading cytokine involved in the immune response of tuberculosis (TB).The primary function of IFN-γ is to activate macrophages in opposition Mycobacterium tuberculosis. Contrast from IFN-γ, interleukin-10 (IL-10) is considered inhibitory cytokine, important to an adequate balance between inflammatory responses. To analyze cytokine profile, particularly IFN-γ and IL-10 of the children with TB in Indonesia, a cross-sectional study was conducted at two general hospitals and seven primary health care located in Medan and Batubara, North Sumatera, Indonesia. Among 51 children with TB disease and 51 healthy children, found that IFN-γ and IL-10 levels were lower in TB patients compared to healthy children. Statistically significant decreased production of the IFN-γ levels (p=0.042) were found in TB patients 9.41 (1.10-28.06) pg/ml contrast to healthy children 6.30 (1.30-89.76) pg/ml. Homologue finding of the IL-10 levels were also found in TB patients 4.93 (0.22-48.01) pg/ml and 4.93 (0.07-81.60) pg/ml in healthy children, but not statistically significant (p=0.784). High levels of IL-10 were not proven to suppress the levels production of IFN-γ in TB patients.

Household food insecurity is associated with low interferon-gamma levels in pregnant Indian women.

PubMed

Vaidya, A; Bhosale, R; Sambarey, P; Suryavanshi, N; Young, S; Mave, V; Kanade, S; Kulkarni, V; Deshpande, P; Balasubramanian, U; Elf, J; Gupte, N; Gupta, A; Mathad, J S

2017-07-01

Over 20% of tuberculosis (TB) cases during pregnancy occur in India. To determine the association between household food insecurity and interferon-gamma (IFN-γ) levels in pregnancy. Pregnant women in India were administered the Household Food Insecurity Access Scale (HFIAS) questionnaire and underwent an IFN-γ release assay. Logistic regression was used to identify factors associated with food insecurity. Of 538 women, 60 (11%) had household food insecurity, 47 (78%) of which were moderate or severe food insecure. After mitogen stimulation, moderate or severe food insecure women had a median IFN-γ concentration of 4.2 IU/ml (IQR 2.2-9.8) vs. 8.4 IU/ml (IQR 3.0-10) in women with no or mild food insecurity (P = 0.03). In multivariate analysis, higher IFN-γ concentrations were associated with human immunodeficiency virus infection (OR 1.3, 95%CI 0.51-2.1, P = 0.001), and inversely associated with moderate or severe food insecurity (OR -1.6, 95%CI -2.9 to -0.27, P = 0.02) and the number of adults in the household (OR -0.08, 95%CI -0.16 to -0.01, P = 0.03). There was no association between food insecurity and IFN-γ response to Mycobacterium tuberculosis antigen. Food insecurity in pregnancy is associated with low IFN-γ levels. There was no association between food insecurity and IFN-γ response to M. tuberculosis antigen, but our study was underpowered to detect this outcome.

Robust Protection against Highly Virulent Foot-and-Mouth Disease Virus in Swine by Combination Treatment with Recombinant Adenoviruses Expressing Porcine Alpha and Gamma Interferons and Multiple Small Interfering RNAs

PubMed Central

Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Se-Kyung; You, Su-Hwa; Kim, Taeseong; Tark, Dongseob; Lee, Hyang-Sim; Seo, Min-Goo; Kim, Byounghan

2015-01-01

ABSTRACT Because the currently available vaccines against foot-and-mouth disease (FMD) provide no protection until 4 to 7 days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is the application of antiviral agents. Combination treatment strategies have been used to enhance the efficacy of antiviral agents, and such strategies may be advantageous in overcoming viral mechanisms of resistance to antiviral treatments. We have developed recombinant adenoviruses (Ads) for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) targeting FMDV mRNAs encoding nonstructural proteins. The antiviral effects of Ad-porcine IFN-αγ and Ad-3siRNA expression were tested in combination in porcine cells, suckling mice, and swine. We observed enhanced antiviral effects in porcine cells and mice as well as robust protection against the highly pathogenic strain O/Andong/SKR/2010 and increased expression of cytokines in swine following combination treatment. In addition, we showed that combination treatment was effective against all serotypes of FMDV. Therefore, we suggest that the combined treatment with Ad-porcine IFN-αγ and Ad-3siRNA may offer fast-acting antiviral protection and be used with a vaccine during the period that the vaccine does not provide protection against FMD. IMPORTANCE The use of current foot-and-mouth disease (FMD) vaccines to induce rapid protection provides limited effectiveness because the protection does not become effective until a minimum of 4 days after vaccination. Therefore, during outbreaks antiviral agents remain the only available treatment to confer rapid protection and reduce the spread of foot-and-mouth disease virus (FMDV) in livestock until vaccine-induced protective immunity can become effective. Interferons (IFNs) and small interfering RNAs (siRNAs) have been reported to be effective antiviral agents against

Autonomous parvoviruses neither stimulate nor are inhibited by the type I interferon response in human normal or cancer cells.

PubMed

Paglino, Justin C; Andres, Wells; van den Pol, Anthony N

2014-05-01

Members of the genus Parvovirus are small, nonenveloped single-stranded DNA viruses that are nonpathogenic in humans but have potential utility as cancer therapeutics. Because the innate immune response to parvoviruses has received relatively little attention, we compared the response to parvoviruses to that of several other types of viruses in human cells. In normal human glia, fibroblasts, or melanocytes, vesicular stomatitis virus evoked robust beta interferon (IFN-β) responses. Cytomegalovirus, pseudorabies virus, and Sindbis virus all evoked a 2-log-unit or greater upregulation of IFN-β in glia; in contrast, LuIII and MVMp parvoviruses did not evoke a detectable IFN-β or interferon-stimulated gene (ISG; MX1, oligoadenylate synthetase [OAS], IFIT-1) response in the same cell types. The lack of response raised the question of whether parvoviral infection can be attenuated by IFN; interestingly, we found that IFN did not decrease parvovirus (MVMp, LuIII, and H-1) infectivity in normal human glia, fibroblasts, or melanocytes. The same was true in human cancers, including glioma, sarcoma, and melanoma. Similarly, IFN failed to attenuate transduction by the dependovirus vector adeno-associated virus type 2. Progeny production of parvoviruses was also unimpaired by IFN in both glioma and melanoma, whereas vesicular stomatitis virus replication was blocked. Sarcoma cells with upregulated IFN signaling that show high levels of resistance to other viruses showed strong infection by LuIII. Unlike many other oncolytic viruses, we found no evidence that impairment of innate immunity in cancer cells plays a role in the oncoselectivity of parvoviruses in human cells. Parvoviral resistance to the effects of IFN in cancer cells may constitute an advantage in the virotherapy of some tumors. Understanding the interactions between oncolytic viruses and the innate immune system will facilitate employing these viruses as therapeutic agents in cancer patients. The cancer

Autonomous Parvoviruses neither Stimulate nor Are Inhibited by the Type I Interferon Response in Human Normal or Cancer Cells

PubMed Central

Paglino, Justin C.; Andres, Wells

2014-01-01

ABSTRACT Members of the genus Parvovirus are small, nonenveloped single-stranded DNA viruses that are nonpathogenic in humans but have potential utility as cancer therapeutics. Because the innate immune response to parvoviruses has received relatively little attention, we compared the response to parvoviruses to that of several other types of viruses in human cells. In normal human glia, fibroblasts, or melanocytes, vesicular stomatitis virus evoked robust beta interferon (IFN-β) responses. Cytomegalovirus, pseudorabies virus, and Sindbis virus all evoked a 2-log-unit or greater upregulation of IFN-β in glia; in contrast, LuIII and MVMp parvoviruses did not evoke a detectable IFN-β or interferon-stimulated gene (ISG; MX1, oligoadenylate synthetase [OAS], IFIT-1) response in the same cell types. The lack of response raised the question of whether parvoviral infection can be attenuated by IFN; interestingly, we found that IFN did not decrease parvovirus (MVMp, LuIII, and H-1) infectivity in normal human glia, fibroblasts, or melanocytes. The same was true in human cancers, including glioma, sarcoma, and melanoma. Similarly, IFN failed to attenuate transduction by the dependovirus vector adeno-associated virus type 2. Progeny production of parvoviruses was also unimpaired by IFN in both glioma and melanoma, whereas vesicular stomatitis virus replication was blocked. Sarcoma cells with upregulated IFN signaling that show high levels of resistance to other viruses showed strong infection by LuIII. Unlike many other oncolytic viruses, we found no evidence that impairment of innate immunity in cancer cells plays a role in the oncoselectivity of parvoviruses in human cells. Parvoviral resistance to the effects of IFN in cancer cells may constitute an advantage in the virotherapy of some tumors. IMPORTANCE Understanding the interactions between oncolytic viruses and the innate immune system will facilitate employing these viruses as therapeutic agents in cancer patients

Interferon-gamma and interlukin-4 patterns in BALB/c mice suffering from cutaneous leishmaniasis treated with cantharidin.

PubMed

Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

2014-06-01

Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. INFECTED BALB/C MICE WERE DIVIDED INTO FIVE GROUPS AS: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth.

Interferon-Gamma and Interlukin-4 Patterns in BALB/c Mice Suffering From Cutaneous Leishmaniasis Treated With Cantharidin

PubMed Central

Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

2014-01-01

Background: Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. Objectives: The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. Materials and Methods: Infected BALB/c mice were divided into five groups as: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. Results: The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. Conclusions: The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth. PMID:25371808

Anti-Tumor Effect of Adipose Tissue Derived-Mesenchymal Stem Cells Expressing Interferon-β and Treatment with Cisplatin in a Xenograft Mouse Model for Canine Melanoma

PubMed Central

Ahn, Jin ok; Lee, Hee woo; Seo, Kyoung won; Kang, Sung keun; Ra, Jeong chan; Youn, Hwa young

2013-01-01

Adipose tissue-derived mesenchymal stem cells (AT-MSCs) are attractive cell-therapy vehicles for the delivery of anti-tumor molecules into the tumor microenvironment. The innate tropism of AT-MSCs for tumors has important implications for effective cellular delivery of anti-tumor molecules, including cytokines, interferon, and pro-drugs. The present study was designed to determine the possibility that the combination of stem cell-based gene therapy with low-dose cisplatin would improve therapeutic efficacy against canine melanoma. The IFN-β transduced canine AT-MSCs (cAT-MSC-IFN-β) inhibited the growth of LMeC canine melanoma cells in direct and indirect in vitro co-culture systems. In animal experiments using BALB/c nude mouse xenografts, which developed by injecting LMeC cells, the combination treatment of cAT-MSC-IFN-β and low-dose cisplatin significantly reduced tumor volume compared with the other treatment groups. Fluorescent microscopic analysis with a TUNEL (terminal deoxynucleotidyl transferase-mediated nick-end labeling) assay of tumor section provided evidence for homing of cAT-MSC-IFN-β to the tumor site and revealed that the combination treatment of cAT-MSC-IFN-β with low-dose cisplatin induced high levels of cell apoptosis. These findings may prove useful in further explorations of the application of these combined approaches to the treatment of malignant melanoma and other tumors. PMID:24040358

Identification and Characterization of Neospora caninum Cyclophilin That Elicits Gamma Interferon Production

PubMed Central

Tuo, Wenbin; Fetterer, Raymond; Jenkins, Mark; Dubey, J. P.

2005-01-01

Gamma interferon (IFN-γ) response is essential to the development of a host protective immunity in response to infections by intracellular parasites. Neosporosis, an infection caused by the intracellular protozoan parasite Neospora caninum, is fatal when there is a complete lack of IFN-γ in the infected host. However, the mechanism by which IFN-γ is elicited by the invading parasite is unclear. This study has identified a microbial protein in the N. caninum tachyzoite N. caninum cyclophilin (NcCyP) as a major component of the parasite responsible for the induction of IFN-γ production by bovine peripheral blood mononuclear cells (PBMC) and antigen-specific CD4+ T cells. NcCyP has high sequence homology (86%) with Toxoplasma gondii 18-kDa CyP with a calculated molecular mass of 19.4 kDa. NcCyP is a secretory protein with a predicted signal peptide of 17 amino acids. Abundant NcCyP was detected in whole-cell N. caninum tachyzoite lysate antigen (NcAg) and N. caninum tachyzoite culture supernatant. In N. caninum tachyzoite culture supernatant, three NcCyP bands of 19, 22, and 24 kDa were identified. NcAg stimulated high levels of IFN-γ production by PBMC and CD4+ T cells. The IFN-γ-inducing effect of NcAg was blocked by cyclosporine, a specific ligand for CyP, in a dose-dependent manner. Furthermore, cyclosporine abolished IFN-γ production by PBMC from naïve cows as well as PBMC and CD4+ T cells from infected/immunized cows. These results indicate that the N. caninum tachyzoite naturally produces a potent IFN-γ-inducing protein, NcCyP, which may be important for parasite survival as well as host protection. PMID:16041025

Novel biomarker identification using metabolomic profiling to differentiate radiation necrosis and recurrent tumor following Gamma Knife radiosurgery.

PubMed

Lu, Alex Y; Turban, Jack L; Damisah, Eyiyemisi C; Li, Jie; Alomari, Ahmed K; Eid, Tore; Vortmeyer, Alexander O; Chiang, Veronica L

2017-08-01

OBJECTIVE Following an initial response of brain metastases to Gamma Knife radiosurgery, regrowth of the enhancing lesion as detected on MRI may represent either radiation necrosis (a treatment-related inflammatory change) or recurrent tumor. Differentiation of radiation necrosis from tumor is vital for management decision making but remains difficult by imaging alone. In this study, gas chromatography with time-of-flight mass spectrometry (GC-TOF) was used to identify differential metabolite profiles of the 2 tissue types obtained by surgical biopsy to find potential targets for noninvasive imaging. METHODS Specimens of pure radiation necrosis and pure tumor obtained from patient brain biopsies were flash-frozen and validated histologically. These formalin-free tissue samples were then analyzed using GC-TOF. The metabolite profiles of radiation necrosis and tumor samples were compared using multivariate and univariate statistical analysis. Statistical significance was defined as p ≤ 0.05. RESULTS For the metabolic profiling, GC-TOF was performed on 7 samples of radiation necrosis and 7 samples of tumor. Of the 141 metabolites identified, 17 (12.1%) were found to be statistically significantly different between comparison groups. Of these metabolites, 6 were increased in tumor, and 11 were increased in radiation necrosis. An unsupervised hierarchical clustering analysis found that tumor had elevated levels of metabolites associated with energy metabolism, whereas radiation necrosis had elevated levels of metabolites that were fatty acids and antioxidants/cofactors. CONCLUSIONS To the authors' knowledge, this is the first tissue-based metabolomics study of radiation necrosis and tumor. Radiation necrosis and recurrent tumor following Gamma Knife radiosurgery for brain metastases have unique metabolite profiles that may be targeted in the future to develop noninvasive metabolic imaging techniques.

Added value of interferon-gamma release assays in screening for tuberculous infection in the Netherlands.

PubMed

Erkens, C G M; Dinmohamed, A G; Kamphorst, M; Toumanian, S; van Nispen-Dobrescu, R; Alink, M; Oudshoorn, N; Mensen, M; van den Hof, S; Borgdorff, M; Verver, S

2014-04-01

Interferon-gamma release assays (IGRAs) are reported to be more specific for the diagnosis of latent tuberculous infection (LTBI) than the tuberculin skin test (TST). The two-step procedure, TST followed by an IGRA, is reported to be cost-effective in high-income countries, but it requires more financial resources. To assess the added value of IGRA compared to TST alone in the Netherlands. Test results and background data on persons tested with an IGRA were recorded by the Public Municipal Health Services in a web-based database. The number of persons diagnosed with LTBI using different screening algorithms was calculated. In those tested with an IGRA, at least 60% of persons who would have been diagnosed with LTBI based on TST alone had a negative IGRA. Among those with a TST reaction below the cut-off for the diagnosis of LTBI, 13% had a positive IGRA. For 41% of persons tested with an IGRA after TST, the IGRA influenced whether or not an LTBI diagnosis would be made. With the IGRA as reference standard, a high proportion of persons in low-prevalence settings are treated unnecessarily for LTBI if tested with TST alone, while a small proportion eligible for preventive treatment are missed. Incremental costs of the two-step strategy seem to be balanced by the improved targeting of preventive treatment.

Stimulated peripheral production of interferon-gamma is related to fatigue and depression in multiple sclerosis.

PubMed

Pokryszko-Dragan, A; Frydecka, I; Kosmaczewska, A; Ciszak, L; Bilińska, M; Gruszka, E; Podemski, R; Frydecka, D

2012-10-01

The aim of the study was to evaluate the stimulated production of interferon-gamma (IFNγ) by peripheral CD3+CD4+ T lymphocytes in patients with multiple sclerosis (MS) with regard to the degree of fatigue, and to investigate relationships between immunological parameters, level of depression and clinical variables. Forty MS patients (30 women, 10 men, aged 22-60 years): 20 fatigued and 20 non-fatigued were involved in the study. Fatigue was evaluated using the Fatigue Severity Scale (FSS) and Modified Fatigue Impact Scale (MFIS), depression level - using Beck Depression Inventory (BDI). Production of IFNγ by stimulated peripheral blood CD3+CD4+ T lymphocytes, assessed using flow cytometry, was compared between MS patients with different levels of fatigue and controls. Correlations were searched out between immunological findings and BDI, age, duration and course of MS, relapse rate, disability (assessed in Expanded Disability Status Scale - EDSS) and its progression. Stimulated production of IFNγ by CD3+CD4+ T lymphocytes was higher in severely fatigued patients in comparison with non-fatigued ones and controls, tended to correlate with FSS and MFIS, and correlated with BDI. No relationships were found between immunological findings and disease-related variables. Stimulated production of IFNγ by peripheral CD3+CD4+ T lymphocytes is related to fatigue and depression in MS patients. Copyright © 2012 Elsevier B.V. All rights reserved.

Tuberculin Skin Tests versus Interferon-Gamma Release Assays in Tuberculosis Screening among Immigrant Visa Applicants

PubMed Central

Chuke, Stella O.; Yen, Nguyen Thi Ngoc; Laserson, Kayla F.; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G.; Whitworth, William C.; Shah, J. Jina; Painter, John A.; Mazurek, Gerald H.; Maloney, Susan A.

2014-01-01

Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB. PMID:24738031

The tuberculin skin test increases the responses measured by T cell interferon-gamma release assays.

PubMed

Vilaplana, C; Ruiz-Manzano, J; Gil, O; Cuchillo, F; Montané, E; Singh, M; Spallek, R; Ausina, V; Cardona, P J

2008-06-01

RUTI is a vaccine consisting of Mycobacterium tuberculosis bacilli grown in stress conditions that is fragmented, detoxified and liposomed. RUTI was designed to shorten the treatment of latent tuberculosis infection (LTBI) with isoniazid from 9 months to just 1 month, by additional treatment with two inoculations of RUTI 4 weeks apart. During the validation process for monitoring the immunogenicity of administration of RUTI in a Phase I clinical trial, the question arose whether to introduce the tuberculin skin test (TST) in the screening of non-LTBI volunteers. This study was designed to evaluate the effect of TST on subsequent different T-cell interferon-gamma release assay (TIGRA) responses, using a spectrum of M. tuberculosis-related antigens (ESAT-6, CFP-10, 16 kDa, 19 kDa, MPT64, Ag 85B, 38 kDa, hsp65, PPD and BCG). The results showed an increase in post-TST response even in non-LTBI subjects for most antigens tested, as measured both by whole blood assay (WBA) and ELISPOT. Increased ELISPOT response decreased toward pre-TST levels within 1 month whereas the WBA response did not. Taking into account that there is no definitive correlation between TST and TIGRA tests to diagnose LTBI and the feasibility that TST might alter the immune monitoring included in clinical trials, these data suggest that TST determination should be carefully planned to avoid any interference with TIGRA.

Reversal in fatigued athletes of a defect in interferon gamma secretion after administration of Lactobacillus acidophilus.

PubMed

Clancy, R L; Gleeson, M; Cox, A; Callister, R; Dorrington, M; D'Este, C; Pang, G; Pyne, D; Fricker, P; Henriksson, A

2006-04-01

Fatigue and impaired performance in athletes is well recognised and has been loosely linked to "overtraining". Reduced concentration of IgA in the saliva and increased shedding of Epstein Barr virus (EBV) have been associated with intense training in elite athletes. To determine whether athletes presenting with fatigue and impaired performance had an immune defect relevant to defective containment of EBV infection, and whether a probiotic preparation (Lactobacillus acidophilus) shown to enhance mucosal immunity in animal models could reverse any detected abnormality. The fatigued athletes had clinical characteristics consistent with re-activation of EBV infection and significantly (p = 0.02) less secretion of interferon (IFN) gamma from blood CD4 positive T cells. After one month of daily capsules containing 2 x 10(10) colony forming units of L acidophilus, secretion of IFNgamma from T cells had increased significantly (p = 0.01) to levels found in healthy control athletes. A significant (p = 0.03) increase in salivary IFNgamma concentrations in healthy control athletes after the one month course of L acidophilus demonstrated in man the capacity for this probiotic to enhance the mucosal IFNgamma concentration. This is the first evidence of a T cell defect in fatigued athletes, and of its reversal following probiotic therapy.

SU-E-T-471: Improvement of Gamma Knife Treatment Planning Through Tumor Control Probability for Metastatic Brain Tumors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Z; Feng, Y; Lo, S

2015-06-15

Purpose: The dose–volume histogram (DVH) has been normally accepted as a tool for treatment plan evaluation. However, spatial information is lacking in DVH. As a supplement to the DVH in three-dimensional treatment planning, the differential DVH (DDVH) provides the spatial variation, the size and magnitude of the different dose regions within a region of interest, which can be incorporated into tumor control probability model. This study was to provide a method in evaluating and improving Gamma Knife treatment planning. Methods: 10 patients with brain metastases from different primary tumors including melanoma (#1,#4,#5, #10), breast cancer (#2), prostate cancer (#3) andmore » lung cancer (#6–9) were analyzed. By using Leksell GammaPlan software, two plans were prepared for each patient. Special attention was given to the DDVHs that were different for different plans and were used for a comparison between two plans. Dose distribution inside target and tumor control probability (TCP) based on DDVH were calculated, where cell density and radiobiological parameters were adopted from literature. The plans were compared based on DVH, DDVH and TCP. Results: Using DVH, the coverage and selectivity were the same between plans for 10 patients. DDVH were different between two plans for each patient. The paired t-test showed no significant difference in TCP between the two plans. For brain metastases from melanoma (#1, #4–5), breast cancer (#2) and lung cancer (#6–8), the difference in TCP was less than 5%. But the difference in TCP was about 6.5% for patient #3 with the metastasis from prostate cancer, 10.1% and 178.7% for two patients (#9–10) with metastasis from lung cancer. Conclusion: Although DVH provides average dose–volume information, DDVH provides differential dose– volume information with respect to different regions inside the tumor. TCP provides radiobiological information and adds additional information on improving treatment planning as well as

Cytotoxic T lymphocyte-dependent tumor growth inhibition by a vascular endothelial growth factor-superantigen conjugate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Qingwen; State Key Laboratory of Genetic Engineering, Fudan University, Shanghai 200433; Jiang, Songmin

2012-11-02

Highlights: Black-Right-Pointing-Pointer We construct and purify a fusion protein VEGF-SEA. Black-Right-Pointing-Pointer VEGF-SEA strongly repressed the growth of murine solid sarcoma 180 (S180) tumors. Black-Right-Pointing-Pointer T cells driven by VEGF-SEA were accumulated around tumor cells bearing VEGFR by mice image model. Black-Right-Pointing-Pointer VEGF-SEA can serve as a tumor targeting agent and sequester CTLs into the tumor site. Black-Right-Pointing-Pointer The induced CTLs could release the cytokines, perforins and granzyme B to kill the tumor cells. -- Abstract: T cells are major lymphocytes in the blood and passengers across the tumor vasculature. If these T cells are retained in the tumor site, amore » therapeutic potential will be gained by turning them into tumor-reactive cytotoxic T lymphocytes (CTLs). A fusion protein composed of human vascular endothelial growth factor (VEGF) and staphylococcal enterotoxin A (SEA) with a D227A mutation strongly repressed the growth of murine solid sarcoma 180 (S180) tumors (control versus VEGF-SEA treated with 15 {mu}g, mean tumor weight: 1.128 g versus 0.252 g, difference = 0.876 g). CD4{sup +} and CD8{sup +} T cells driven by VEGF-SEA were accumulated around VEGFR expressing tumor cells and the induced CTLs could release the tumoricidal cytokines, such as interferon-gamma (IFN-gamma) and tumor necrosis factor-alpha (TNF-alpha). Meanwhile, intratumoral CTLs secreted cytolytic pore-forming perforin and granzyme B proteins around tumor cells, leading to the death of tumor cells. The labeled fusion proteins were gradually targeted to the tumor site in an imaging mice model. These results show that VEGF-SEA can serve as a tumor targeting agent and sequester active infiltrating CTLs into the tumor site to kill tumor cells, and could therefore be a potential therapeutical drug for a variety of cancers.« less

Reproducibility of Interferon Gamma (IFN-γ) Release Assays. A Systematic Review

PubMed Central

Tagmouti, Saloua; Slater, Madeline; Benedetti, Andrea; Kik, Sandra V.; Banaei, Niaz; Cattamanchi, Adithya; Metcalfe, John; Dowdy, David; van Zyl Smit, Richard; Dendukuri, Nandini

2014-01-01

Rationale: Interferon gamma (IFN-γ) release assays for latent tuberculosis infection result in a larger-than-expected number of conversions and reversions in occupational screening programs, and reproducibility of test results is a concern. Objectives: Knowledge of the relative contribution and extent of the individual sources of variability (immunological, preanalytical, or analytical) could help optimize testing protocols. Methods: We performed a systematic review of studies published by October 2013 on all potential sources of variability of commercial IFN-γ release assays (QuantiFERON-TB Gold In-Tube and T-SPOT.TB). The included studies assessed test variability under identical conditions and under different conditions (the latter both overall and stratified by individual sources of variability). Linear mixed effects models were used to estimate within-subject SD. Measurements and Main Results: We identified a total of 26 articles, including 7 studies analyzing variability under the same conditions, 10 studies analyzing variability with repeat testing over time under different conditions, and 19 studies reporting individual sources of variability. Most data were on QuantiFERON (only three studies on T-SPOT.TB). A considerable number of conversions and reversions were seen around the manufacturer-recommended cut-point. The estimated range of variability of IFN-γ response in QuantiFERON under identical conditions was ±0.47 IU/ml (coefficient of variation, 13%) and ±0.26 IU/ml (30%) for individuals with an initial IFN-γ response in the borderline range (0.25–0.80 IU/ml). The estimated range of variability in noncontrolled settings was substantially larger (±1.4 IU/ml; 60%). Blood volume inoculated into QuantiFERON tubes and preanalytic delay were identified as key sources of variability. Conclusions: This systematic review shows substantial variability with repeat IFN-γ release assays testing even under identical conditions, suggesting that reversions

Synergistic induction of apoptosis in primary rat decidual cells by INF-gamma and TNF.

PubMed

Almeida, A; Correia-da-Silva, G; Cepa, M; Bell, S C; Teixeira, N A

2007-03-01

In the rat, in response to blastocyst implantation, stromal cells of the endometrium proliferate and differentiate into decidual cells, forming the decidua. After reaching its maximum development, the decidua undergoes regression. This phenomenon appears to be due to an active process involving apoptosis. As there is sparse knowledge concerning the mechanisms of induction of decidual cell death, the potential role of cytokines present in the uterine environment during pregnancy, such as tumor necrosis factor (TNF) and interferon-gamma (INF-gamma) was explored in primary cultures of rat decidual cells. The effects of these factors upon cellular viability, nuclear morphologic alterations, expression, and enzymatic activities of the effector caspases-3/7 were evaluated. The results obtained demonstrated that in contrast to TNF, which did not induce any alteration, INF-gamma and in association with TNF caused a decrease in cell viability and an increase in the appearance of apoptotic bodies in a time-dependent manner that was augmented in the co-presence of TNF. An increase in caspase-3/7 activities after 12 hr of TNF/INF-gamma treatment was also observed. These findings suggest that INF-gamma expressed in the uterine environment may play an important role in regulating apoptosis through potential synergistic mechanisms with TNF and thereby modulate decidual stability and regression during pregnancy. (c) 2006 Wiley-Liss, Inc.

TNF blockade induces a dysregulated type I interferon response without autoimmunity in paradoxical psoriasis.

PubMed

Conrad, Curdin; Di Domizio, Jeremy; Mylonas, Alessio; Belkhodja, Cyrine; Demaria, Olivier; Navarini, Alexander A; Lapointe, Anne-Karine; French, Lars E; Vernez, Maxime; Gilliet, Michel

2018-01-02

Although anti-tumor necrosis factor (TNF) agents are highly effective in the treatment of psoriasis, 2-5% of treated patients develop psoriasis-like skin lesions called paradoxical psoriasis. The pathogenesis of this side effect and its distinction from classical psoriasis remain unknown. Here we show that skin lesions from patients with paradoxical psoriasis are characterized by a selective overexpression of type I interferons, dermal accumulation of plasmacytoid dendritic cells (pDC), and reduced T-cell numbers, when compared to classical psoriasis. Anti-TNF treatment prolongs type I interferon production by pDCs through inhibition of their maturation. The resulting type I interferon overexpression is responsible for the skin phenotype of paradoxical psoriasis, which, unlike classical psoriasis, is independent of T cells. These findings indicate that paradoxical psoriasis represents an ongoing overactive innate inflammatory process, driven by pDC-derived type I interferon that does not lead to T-cell autoimmunity.

Neopterin formation and tryptophan degradation by a human myelomonocytic cell line (THP-1) upon cytokine treatment.

PubMed

Werner-Felmayer, G; Werner, E R; Fuchs, D; Hausen, A; Reibnegger, G; Wachter, H

1990-05-15

Determination of neopterin [D-erythro-6-(1',2',3'-trihydroxypropyl)pterin] in body fluids is a powerful diagnostic tool in a variety of diseases in which activation of cellular immune mechanisms is involved, such as certain malignancies, allograft rejection, and autoimmune and infectious diseases. In vitro, neopterin is released into the supernatant by peripheral blood-derived monocytes/macrophages upon stimulation with gamma-interferon. In parallel, cleavage of tryptophan by indoleamine 2,3-dioxygenase is induced. We report here that the human myelomonocytic cell line THP-1 forms neopterin and degrades tryptophan upon treatment with gamma-interferon. Like in macrophages alpha-interferon and beta-interferon induce these pathways only to a much smaller degree. The action of interferons is enhanced by cotreatment with tumor necrosis factor alpha, lipopolysaccharide, or dexamethasone. gamma-Interferon-induced neopterin formation and indoleamine 2,3-dioxygenase activity are increased by raising extracellular tryptophan concentrations. The pattern of intracellularly formed pteridines upon stimulation with gamma-interferon shows the unique characteristics of human monocytes/macrophages. Neopterin, monapterin, and biopterin are produced in a 50:2:1 ratio. Thus, the THP-1 cell line provides a permanent, easily accessible in vitro system for studying the induction and mechanism of neopterin formation.

Myxoma virus M-T7, a secreted homolog of the interferon-gamma receptor, is a critical virulence factor for the development of myxomatosis in European rabbits.

PubMed

Mossman, K; Nation, P; Macen, J; Garbutt, M; Lucas, A; McFadden, G

1996-01-01

Myxoma virus is a leporipoxvirus of New World rabbits (Sylvilagus sp.) that induces a rapidly lethal infection known as myxomatosis in the European rabbit (Oryctolagus cuniculus). Like all poxviruses, myxoma virus encodes a plethora of proteins to circumvent or inhibit a variety of host antiviral immune mechanisms. M-T7, the most abundantly secreted protein of myxoma virus-infected cells, was originally identified as an interferon-gamma receptor homolog (Upton, Mossman, and McFadden, Science 258, 1369-1372, 1992). Here, we demonstrate that M-T7 is dispensable for virus replication in cultured cells but is a critical virulence factor for virus pathogenesis in European rabbits. Disruption of both copies of the M-T7 gene in myxoma virus was achieved by the deletion of 372 bp of M-T7 coding sequences, replacement with a selectable marker, p7.5Ecogpt, and selection of a recombinant virus (vMyxlac-T7gpt) resistant to mycophenolic acid. vMyxlac-T7gpt expressed no detectable M-T7 protein and infected cells supernatants were devoid of any detectable interferon-gamma binding activities. Immunohistochemical staining with anti-beta-galactosidase and anti-CD43 antibodies demonstrated that in vMyxlac-T7gpt-infected rabbits the loss of M-T7 not only caused a dramatic reduction in disease symptoms and viral dissemination to secondary sites, but also dramatically influenced host leukocyte behavior. Notably, primary lesions in wild-type virus infections were generally underlayed by large masses of inflammatory cells that did not effectively migrate into the dermal sites of viral replication, whereas in vMyxlac-T7gpt infections this apparent block to leukocyte influx was relieved. A second major phenotypic distinction noted for the M-T7 knockout virus was the extensive activation of lymphocytes in secondary immune organs, particularly the spleen and lymph nodes, by Day 4 of the infection. This is in stark contrast to infection by wild-type myxoma virus, which results in relatively

Antiproliferative Properties of Type I and Type II Interferon

PubMed Central

Bekisz, Joseph; Baron, Samuel; Balinsky, Corey; Morrow, Angel; Zoon, Kathryn C.

2010-01-01

The clinical possibilities of interferon (IFN) became apparent with early studies demonstrating that it was capable of inhibiting tumor cells in culture and in vivo using animal models. IFN gained the distinction of being the first recombinant cytokine to be licensed in the USA for the treatment of a malignancy in 1986, with the approval of IFN-α2a (Hoffman-La Roche) and IFN-α2b (Schering-Plough) for the treatment of Hairy Cell Leukemia. In addition to this application, other approved antitumor applications for IFN-α2a are AIDS-related Kaposi’s Sarcoma and Chronic Myelogenous Leukemia (CML) and other approved antitumor applications for IFN-α2b are Malignant Melanoma, Follicular Lymphoma, and AIDS-related Kapoisi’s Sarcoma. In the ensuing years, a considerable number of studies have been conducted to establish the mechanisms of the induction and action of IFN’s anti-tumor activity. These include identifying the role of Interferon Regulatory Factor 9 (IRF9) as a key factor in eliciting the antiproliferative effects of IFN-α as well as identifying genes induced by IFN that are involved in recognition of tumor cells. Recent studies also show that IFN-activated human monocytes can be used to achieve >95% eradication of select tumor cells. The signaling pathways by which IFN induces apoptosis can vary. IFN treatment induces the tumor suppressor gene p53, which plays a role in apoptosis for some tumors, but it is not essential for the apoptotic response. IFN-α also activates phosphatidylinositol 3-kinase (PI3K), which is associated with cell survival. Downstream of PI3K is the mammalian target of rapamycin (mTOR) which, in conjunction with PI3K, may act in signaling induced by growth factors after IFN treatment. This paper will explore the mechanisms by which IFN acts to elicit its antiproliferative effects and more closely examine the clinical applications for the anti-tumor potential of IFN. PMID:20664817

Dynamic gamma knife radiosurgery

NASA Astrophysics Data System (ADS)

Luan, Shuang; Swanson, Nathan; Chen, Zhe; Ma, Lijun

2009-03-01

Gamma knife has been the treatment of choice for various brain tumors and functional disorders. Current gamma knife radiosurgery is planned in a 'ball-packing' approach and delivered in a 'step-and-shoot' manner, i.e. it aims to 'pack' the different sized spherical high-dose volumes (called 'shots') into a tumor volume. We have developed a dynamic scheme for gamma knife radiosurgery based on the concept of 'dose-painting' to take advantage of the new robotic patient positioning system on the latest Gamma Knife C™ and Perfexion™ units. In our scheme, the spherical high dose volume created by the gamma knife unit will be viewed as a 3D spherical 'paintbrush', and treatment planning reduces to finding the best route of this 'paintbrush' to 'paint' a 3D tumor volume. Under our dose-painting concept, gamma knife radiosurgery becomes dynamic, where the patient moves continuously under the robotic positioning system. We have implemented a fully automatic dynamic gamma knife radiosurgery treatment planning system, where the inverse planning problem is solved as a traveling salesman problem combined with constrained least-square optimizations. We have also carried out experimental studies of dynamic gamma knife radiosurgery and showed the following. (1) Dynamic gamma knife radiosurgery is ideally suited for fully automatic inverse planning, where high quality radiosurgery plans can be obtained in minutes of computation. (2) Dynamic radiosurgery plans are more conformal than step-and-shoot plans and can maintain a steep dose gradient (around 13% per mm) between the target tumor volume and the surrounding critical structures. (3) It is possible to prescribe multiple isodose lines with dynamic gamma knife radiosurgery, so that the treatment can cover the periphery of the target volume while escalating the dose for high tumor burden regions. (4) With dynamic gamma knife radiosurgery, one can obtain a family of plans representing a tradeoff between the delivery time and the

Gastrointestinal Carcinoid Tumors (PDQ®)—Health Professional Version

Cancer.gov

Gastrointestinal carcinoid tumor treatment often includes resection of the primary tumor and local lymph nodes. Other treatment options include somatostatin analogs, interferons, treatment of hepatic masses, radionuclides, and symptomatic therapy. Get detailed information in this clinician summary.

Role of Gamma Interferon in the Pathogenesis of Severe Schistosomiasis in Interleukin-4-Deficient Mice

PubMed Central

La Flamme, Anne Camille; Patton, Elisabeth A.; Pearce, Edward J.

2001-01-01

In the absence of interleukin-4 (IL-4), infection with Schistosoma mansoni leads to a severe fatal disease rather than the chronic survivable condition that occurs in wild-type (WT) mice. Because the sustained production of NO most closely correlates to weight loss and fatality in infected IL-4−/− mice and because gamma interferon (IFN-γ) is an important inducer of inducible NO synthase, infected IL-4−/− mice were treated with anti-IFN-γ antibodies to determine the role of IFN-γ during schistosomiasis in WT and IL-4−/− animals. When IFN-γ was neutralized, Th2 responses were enhanced and NO production was reduced in both WT and IL-4−/− mice. The decreased NO production correlated with a rescue of proliferation in splenocytes from infected IL-4−/− mice. Furthermore, the neutralization of IFN-γ in vivo improved the gross appearance of the liver and led to a reduction in granuloma size in infected IL-4−/− but not WT mice. However, the neutralization of IFN-γ in vivo did not affect the development of severe disease in infected IL-4−/− mice. These results suggest that while the increased production of IFN-γ does lead to some of the pathology observed in infected IL-4−/− mice, it is not ultimately responsible for cachexia and death. PMID:11705919

Effects of peritoneal fluid from endometriosis patients on interferon-gamma-induced protein-10 (CXCL10) and interleukin-8 (CXCL8) released by neutrophils and CD4+ T cells.

PubMed

Kim, Ji-Yeon; Lee, Dong-Hyung; Joo, Jong-Kil; Jin, Jun-O; Wang, Ji-Won; Hong, Young-Seoub; Kwak, Jong-Young; Lee, Kyu-Sup

2009-09-01

Intraperitoneal immuno-inflammatory changes may be associated with the pathogenesis of endometriosis. We evaluated the effects of peritoneal fluid obtained from patients with endometriosis (ePF) on the release of interferon-gamma-induced protein-10 (IP-10/CXCL10) and interleukin-8 (IL-8/CXCL8) by neutrophils, CD4(+) T cells, and monocytes. Neutrophils, CD4(+) T cells, and monocytes were cultured with ePF and the chemokine levels in the supernatants were then measured using enzyme-linked immunosorbent assay. The addition of ePF to cultures of CD4(+) T cells led to a significant increase in the release of IP-10 when compared with control PF without endometriosis (cPF). There was a positive correlation between the levels of IL-8 and IP-10 in ePF (R = 0.89, P = 0.041), but not between the levels of IP-10 and IL-8 released by neutrophils, CD4(+) T cells, and monocytes. The levels of IP-10 in ePF were positively correlated with the release of IP-10 by ePF-treated neutrophils (R = 0.89, P < 0.001), CD4(+) T cells (R = 0.93, P < 0.001), and monocytes (R = 0.70, P = 0.01). Moreover, the addition of ePF significantly enhanced the interferon-gamma-induced release of IP-10 by nuetrophils and CD4(+) T cells. These findings suggest that neutrophils and T cells release differential levels of IP-10 and IL-8 in response to stimulation with ePF, and that these cells are a major source of IP-10 in the PF of endometriosis patients.

Prediction of cellular radiosensitivity from DNA damage induced by gamma-rays and carbon ion irradiation in canine tumor cells.

PubMed

Wada, Seiichi; Van Khoa, Tran; Kobayashi, Yasuhiko; Funayama, Tomoo; Ogihara, Kikumi; Ueno, Shunji; Ito, Nobuhiko

2005-11-01

Diseases of companion animals are shifting from infectious diseases to neoplasms (cancer), and since radiation therapy is one of the effective choices available for cancer treatment, the application of radiotherapy in veterinary medicine is likely to increase. However tumor tissues have different radiosensitivities, and therefore it is important to determine the intrinsic radiosensitivity of tumors in individual patients in advance of radiotherapy. We have studied the relationship between the surviving cell fraction measured by a clonogenic assay and DNA double strand breaks detected by a comet assay under neutral conditions in three canine tumor cell lines, after gamma-ray and carbon ion irradiation. In all the cell lines, cell death assessed by the clonogenic assay was much higher following irradiation with carbon ions than with gamma-rays. The initial and residual (4 hr) DNA damage due to gamma-ray and carbon ion irradiation were higher in a radiosensitive cell line than in a radioresistant cell line. The surviving cell fraction at 2 Gy (SF2) showed a tendency for correlation with both the initial and residual DNA damage. In particular, the residual damage per Gy was significantly correlated with SF2, regardless of the type of radiation. This indicates that cellular radiosensitivity can be predicted by detection of radiation-induced residual DNA damage.

Tuberculosis screening of new hospital employees: compliance, clearance to work time, and cost using tuberculin skin test and interferon-gamma release assays.

PubMed

Foster-Chang, Sarah A; Manning, Mary L; Chandler, Laura

2014-11-01

Selection of the most suitable test(s) for detection of Mycobacterium tuberculosis (TB) infection should be based on purpose, setting, effectiveness, and cost. Two tests are available to screen for latent TB: the tuberculin skin test (TST) and the more recent interferon-gamma release assays (IGRAs). Based on the administrative, logistic, and technical ease of use, an IGRA trial was initiated by the occupational health department at an urban Veteran's Administration health care facility for TB screening of new employees. As a result, new employees completing the pre-placement process within the organization's designated 14 days increased from 77% to 97%, new employee clearance to work time decreased from 13.18 to 5.91 days, and new employee TB screening costs were reduced by 40%. The IGRA is an acceptable alternative to the TST and has significant potential to improve the process of pre-placement TB screening. Copyright 2014, SLACK Incorporated.

Fish oil feeding delays influenza virus clearance and impairs production of interferon-gamma and virus-specific immunoglobulin A in the lungs of mice.

PubMed

Byleveld, P M; Pang, G T; Clancy, R L; Roberts, D C

1999-02-01

Ingestion of fish oil can suppress the inflammatory response to injury and may impair host resistance to infection. To investigate the effect of a diet containing fish oil on immunity to viral infection, 148 BALB/c mice were fed diets containing 3 g/100 g of sunflower oil with either 17 g/100 g of fish oil or beef tallow for 14 d before intranasal challenge with live influenza virus. At d 1 and d 5 after infection, the mice fed fish oil had higher lung viral load and lower body weight (P < 0.05). In addition to the greater viral load and weight loss at d 5 after infection, the fish oil group consumed less food (P < 0.05) while the beef tallow group was clearing the virus, had regained their preinfection weights and was returning to their preinfection food consumption. The fish oil group had impaired production of lung interferon-gamma (IFN-gamma), serum immunoglobulin (Ig) G and lung IgA-specific antibodies (all P < 0. 05) although lung IFN-alpha/beta and the relative proportions of bronchial lymph node CD4+ and CD8+ T lymphocytes did not differ between groups after infection. The present study demonstrates a delay in virus clearance in mice fed fish oil associated with reduced IFN-gamma and antibody production and a greater weight loss and suppression of appetite following influenza virus infection. However, differences observed during the course of infection did not affect the ultimate outcome as both groups cleared the virus and returned to preinfection food consumption and body weight by d 7.

Peroxisome proliferator-activated receptor gamma agonist troglitazone induces colon tumors in normal C57BL/6J mice and enhances colonic carcinogenesis in Apc1638 N/+ Mlh1+/- double mutant mice.

PubMed

Yang, Kan; Fan, Kun-Hua; Lamprecht, Sergio A; Edelmann, Winfried; Kopelovich, Levy; Kucherlapati, Raju; Lipkin, Martin

2005-09-10

The role of the nuclear peroxisome proliferator-activated receptor-gamma (PPAR-gamma) in colon tumorigenesis remains controversial. Notwithstanding evidence that PPAR-gamma ligands impede murine colorectal carcinogenesis, PPAR-gamma agonists have been shown to enhance in vivo tumor formation in mouse models of human colon cancer. Our study was designed to determine whether troglitazone (TGZ) induces colonic tumor formation in normal C57BL/6J mice and enhances colorectal carcinogenesis in double mutant Apc1638N/+ Mlh1+/- mice fed a standard AIN-76A diet. We report herein that not only does TGZ enhance carcinogenesis in the large intestine of mutant mice predisposed to intestinal carcinogenesis but TGZ also induces colonic tumors in normal mice without gene targeting or carcinogen administration. This observation indicates that preexisting mutational events are not necessary for induction of colonic tumors by activated PPAR-gamma in vivo. (c) 2005 Wiley-Liss, Inc.

Effect of interferons and other biological response modifiers (BRMS) on macrophage-mediated inhibition of Listeria monocytogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badger, A.M.; Swift, B.; Sung, C.P.

1986-03-05

Recombinant murine gamma interferon (IFN-..gamma..) activates oil elicited C57BL/6 peritoneal macrophages to inhibit the growth of Listeria. Maximum activity is obtained with 10-20 units/ml, can be demonstrated in the absence of antibiotics and is not due to LPS contamination. Studies of the kinetics of this phenomenon demonstrate that a 30 minute incubation with IFN-..gamma.. is sufficient to initiate the antiproliferative state and full activity can be obtained with a 4 hour incubation. Alpha/beta interferon (IFN-..cap alpha../..beta..) is also active but requires 100X more units to obtain equivalent activity. The evaluation of a number of other BRMS demonstrated that MDP andmore » LPS could stimulate phagocytosis of Listeria but could not inhibit their growth. Bestatin, tuftsin, Con A, A23187 and Poly I:C did not stimulate either phagocytosis or growth inhibitory activity. These compounds were also tested for their ability to enhance the release of superoxide anion from PMA stimulated macrophages. With the exception of tuftsin and bestatin all of the BRMS tested were able to enhance the production of oxidative burst products confirming the findings of others of the dissociation between the two functions.« less

Polyfunctional cytokine responses by central memory CD4*T cells in response to bovine tuberculosis

USDA-ARS?s Scientific Manuscript database

CD4 T cells are crucial in immunity to tuberculosis (TB). Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), interleukin-2 (IL-2) and tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB. Mycobacterium bovis in...

Polyfunctional cytokine responses by central memory CD4+T cells in response to bovine tuberculosis

USDA-ARS?s Scientific Manuscript database

CD4 T cells are crucial in immunity to tuberculosis (TB). Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), interleukin-2 (IL-2) and tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB and HIV. Mycobacterium ...

Polyfunctional CD4 T cells in the response to bovine tuberculosis

USDA-ARS?s Scientific Manuscript database

Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), interleukin-2 (IL-2) and tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB and HIV. However, the assessment of this response in bovine infections was not fe...

Tumor-associated mesenchymal stem cells inhibit naïve T cell expansion by blocking cysteine export from dendritic cells.

PubMed

Ghosh, Tithi; Barik, Subhasis; Bhuniya, Avishek; Dhar, Jesmita; Dasgupta, Shayani; Ghosh, Sarbari; Sarkar, Madhurima; Guha, Ipsita; Sarkar, Koustav; Chakrabarti, Pinak; Saha, Bhaskar; Storkus, Walter J; Baral, Rathindranath; Bose, Anamika

2016-11-01

Mesenchymal stem cells (MSCs) represent an important cellular constituent of the tumor microenvironment, which along with tumor cells themselves, serve to regulate protective immune responses in support of progressive disease. We report that tumor MSCs prevent the ability of dendritic cells (DC) to promote naïve CD4(+) and CD8(+) T cell expansion, interferon gamma secretion and cytotoxicity against tumor cells, which are critical to immune-mediated tumor eradication. Notably, tumor MSCs fail to prevent DC-mediated early T cell activation events or the ability of responder T cells to produce IL-2. The immunoregulatory activity of tumor MSCs is IL-10- and STAT3-dependent, with STAT3 repressing DC expression of cystathionase, a critical enzyme that converts methionine-to-cysteine. Under cysteine-deficient priming conditions, naïve T cells exhibit defective cellular metabolism and proliferation. Bioinformatics analyses as well as in vitro observations suggest that STAT3 may directly bind to a GAS-like motif within the cystathionase promoter (-269 to -261) leading to IL-10-STAT3 mediated repression of cystathionase gene transcription. Our collective results provide evidence for a novel mechanism of tumor MSC-mediated T cell inhibition within tumor microenvironment. © 2016 UICC.

Human Monocytes in the Presence of Interferons Alpha2a and Gamma Are Potent Killers of Serous Ovarian Cancer Cell Lines in Combination with Paclitaxel and Carboplatin

PubMed Central

Johnson, Chase L.; Zoon, Kathryn C.

2015-01-01

Interferons (IFNs) play an important role in immune surveillance of tumors; however, their efficacy in the treatment of malignancies has been limited. Monocytes are mononuclear phagocytes that are critical to the generation of an innate immune response to tumors. The authors and others have shown that treatment of tumor cell lines in vitro and in vivo with human monocytes primed with type I and type II IFNs results in killing. We now expand on this work, in an extended panel of ovarian cancer cell lines. In this study, we hypothesized that there would be variable sensitivity amongst cell lines to the killing properties of monocytes and IFNs. To this end, we explored the interactions of IFN primed monocytes in conjunction with the standard of therapy for ovarian cancer, taxane, and platinum-based chemotherapeutics. Using 6 ovarian cancer cell lines, we demonstrated that there is variation from cell line to cell line in the ability of IFN-α2a and IFN-γ primed monocytes to synergistically kill target tumor cells, and further, there is an additive killing effect when target cells are treated with both IFN primed monocytes and chemotherapy. PMID:25068849

The effect of centaurein on interferon-{gamma} expression and Listeria infection in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, S.-L.; Department of Biological Science and Technology, National Chiao Tung University, 1001, Ta Hsueh Road, Hsinchu 300, Taiwan; Yeh, H.-H.

2007-02-15

We previously found that centaurein enhanced IFN-{gamma} transcription in T cells. Here, we demonstrate that centaurein increased the IFN-{gamma} expression in T and NK cells and the serum IFN-{gamma} level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-{gamma} but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-{gamma} expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection viamore » a modulation of IFN-{gamma} expression.« less

Comparison of Cytomegalovirus (CMV) Enzyme-Linked Immunosorbent Spot and CMV Quantiferon Gamma Interferon-Releasing Assays in Assessing Risk of CMV Infection in Kidney Transplant Recipients

PubMed Central

Saldan, Alda; Mengoli, Carlo; Fiscon, Marta; Silvestre, Cristina; Fallico, Loredana; Peracchi, Marta; Furian, Lucrezia; Cusinato, Riccardo; Bonfante, Luciana; Rossi, Barbara; Marchini, Francesco; Sgarabotto, Dino; Rigotti, Paolo; Palù, Giorgio

2013-01-01

Assessing cytomegalovirus (CMV)-specific cell-mediated immunity (CMI) represents an appealing strategy for identifying transplant recipients at risk of infection. In this study, we compared two gamma interferon-releasing assays (IGRAs), Quantiferon-CMV and CMV enzyme-linked immunosorbent spot (ELISPOT), to determine the ability of each test to predict protective CMV-specific T-cell responses. Two hundred twenty-one Quantiferon-CMV and ELISPOT tests were conducted on 120 adult kidney transplant recipients (KTRs), including 100 CMV-seropositive transplant recipients (R+) and 20 CMV-seronegative transplant recipients of a CMV-positive donor (D+/R−). As a control cohort, 39 healthy adult subjects (including 33 CMV-seropositive and 6 CMV-seronegative subjects) were enrolled. CMV IgG serology was used as a reference for both tests. In the CMV-seropositive individuals, the ELISPOT and Quantiferon-CMV assays provided 46% concordance with the serology, 12% discordance, 18% disagreement between ELISPOT or Quantiferon-CMV and the serology, and 24% gray areas when one or both tests resulted in weak positives. None of the CMV-seronegative subjects showed detectable responses in the ELISPOT or the Quantiferon-CMV test. In transplant recipients, both the ELISPOT and Quantiferon-CMV assays positively correlated with each other and negatively correlated with CMV DNAemia in a significant way (P < 0.05). During the antiviral prophylaxis, all 20 D+/R− KTRs we examined displayed undetectable Quantiferon-CMV and ELISPOT results, and there was no evidence of CMV seroconversion. The receiving operator curve (ROC) statistical analysis revealed similar specificities and sensitivities in predicting detectable viremia (areas under the curve [AUC], 0.66 and 0.62 for Quantiferon-CMV and ELISPOT, respectively). ELISPOT and Quantiferon-CMV values of >150 spots/200,000 peripheral blood mononuclear cells (PBMCs) and >1 to 6 IU gamma interferon (IFN-γ) were associated with protection from CMV

Human Atopic Dermatitis Complicated by Eczema Herpeticum is Associated with Abnormalities in Gamma Interferon Response

PubMed Central

Leung, Donald YM; Gao, Pei-Song; Grigoryev, Dmitry N; Rafaels, Nicholas M; Streib, Joanne E; Howell, Michael D; Taylor, Patricia A; Boguniewicz, Mark; Canniff, Jennifer; Armstrong, Brian; Zaccaro, Daniel J; Schneider, Lynda C; Hata, Tissa R; Hanifin, Jon M; Beck, Lisa A; Weinberg, Adriana; Barnes, Kathleen C

2011-01-01

Background The basis for increased susceptibility of atopic dermatitis (AD) patients to develop disseminated viral skin infections such as eczema herpeticum (ADEH+) is poorly understood. Objective We sought to determine whether atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Methods GeneChip profiling was used to identify differences in gene expression of peripheral blood mononuclear cells (PBMC) from patients with a history of ADEH+ as compared to ADEH− and non-atopic controls. Key differences in protein expression were verified by ELISPOT and/or ELISA. Clinical relevance was further demonstrated by a mouse model of disseminated viral skin infection and genetic association analysis for genetic variants in IFNG and IFNGR1 and ADEH among 435 cases and controls. Results We demonstrate by global gene expression analysis selective transcriptomic changes within the interferon (IFN) superfamily of PBMCs from ADEH+ subjects reflecting low IFNγ and IFNγ receptor gene expression. IFNγ protein production was also significantly lower in ADEH+ (N=24) compared to ADEH− (N=20) and non-atopic (NA; N=20) controls. IFNγ receptor knockout (KO) mice developed disseminated viral skin infection after epicutaneous challenge with vaccinia virus (VV). Genetic variants in IFNG and IFNGR1 SNPs were significantly associated with ADEH (112 cases, 166 controls) and IFNγ production: a 2-SNP (A–G) IFNGR1 haplotype (rs10457655 and rs7749390) showed the strongest association with a reduced risk of ADEH+ ((13.2% ADEH+ vs 25.5% ADEH−, P = 0.00057). Conclusions ADEH+ patients have reduced IFNγ production, and IFNG and IFNGR1 SNPs are significantly associated with ADEH+ and may contribute to an impaired immune response to herpes simplex virus (HSV). Clinical Implications Atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Capsule summary Using genomic

Induction of tumor necrosis factor by Legionella pneumophila.

PubMed Central

Blanchard, D K; Djeu, J Y; Klein, T W; Friedman, H; Stewart, W E

1987-01-01

Mice were inoculated with Legionella pneumophila via an intratracheal route to establish an experimental model of infection. Lung lavage fluid obtained from infected mice contained a cytolytic factor identified as tumor necrosis factor (TNF). Peak levels of TNF were produced at about 24 h postinfection and rapidly declined thereafter. Treatment of the mice with dextran sulfate before inoculation with the bacteria resulted in lowered amounts of TNF in the lung lavage fluid, suggesting that macrophages were responsible for production of the cytokine. Furthermore, cultures of adherent lung leukocytes and a macrophage cell line, PU 5-1.8, were stimulated to produce TNF by exposure to Legionella antigens. In addition, adherent lung leukocytes from Legionella-infected mice spontaneously released TNF into the culture supernatant. Inoculation of mice with saline or latex particles failed to induce TNF in vivo, indicating that bacterial antigens or products were the stimulating signals. Since there was no detectable TNF activity in sera at any time after intratracheal inoculation, TNF production appeared to be confined to the site of infection. Pretreatment of PU 5-1.8 cultures with gamma interferon, which was detected in the lung lavage fluid before TNF, resulted in augmented TNF production, suggesting cooperativity may exist between the two cytokines, either in the pathogenicity of the bacterium or in a possible immunomodulatory function of TNF and interferon during infection. PMID:2433220

[Effectiveness of interferon-gamma release assays in the tuberculosis contact investigation of elderly people].

PubMed

Seto, Junji; Ahiko, Tadayuki

2014-04-01

To confirm the effectiveness of interferon-gamma release assays (IGRAs) in the tuberculosis (TB) contact investigation of elderly people, we analyzed the results of the QuantiFERON TB Gold in tube (QFT-3G) test, which is a commercially available IGRA. We analyzed the results of the QFT-3G test in 2,420 subjects who were in close contact with TB patients. We investigated subjects with latent TB infection and those showing the onset of TB among the QFT-3G-positive subjects. The QFT-3G-positive rate was 7.3% (95% confidence interval, 6.2%-8.3%). In addition, we demonstrated that the QFT-3G-positive rate increased with age (P < 0.001). The QFT-3G-positive rate was high, particularly in elderly people (> or = 60 years), but the rate was significantly lower than the predicted prevalence of TB infection. Therefore, it was assumed that the QFT-3G test does not always provide a positive result, even in cases of subjects with a previous TB infection. Furthermore, data from the QFT-3G-positive subjects indicated that approximately one half of subjects aged 60-69 years, approximately one-third of those aged 70-79 years, and approximately one-quarter of those aged over 80 years have had recent TB infections. In conclusion, the results of the QFT-3G test in elderly people need to be carefully evaluated according to the contact situation with TB patients; nevertheless, the QFT-3G test is useful for the screening of latent TB infection in elderly people who were in close contact with TB patients.

Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.

PubMed

Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G

2010-04-15

Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.

Polyfunctional CD4 T cells in the response to bovine tuberculosis

USDA-ARS?s Scientific Manuscript database

CD4 T cells are crucial in immunity to tuberculosis (TB). Polyfunctional CD4 T cells simultaneously produce interferon-gamma (IFN-gamma), Interleukin-2 (IL-2) and Tumor necrosis factor-alpha (TNF-alpha) and play relevant roles in several chronic infections, including human TB and HIV. However, the a...

Interferon modulation of c-myc expression in cloned Daudi cells: relationship to the phenotype of interferon resistance.

PubMed

Dron, M; Modjtahedi, N; Brison, O; Tovey, M G

1986-05-01

Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells.

Cytokine secretion induced by superantigens in peripheral blood mononuclear cells, lamina propria lymphocytes, and intraepithelial lymphocytes.

PubMed Central

Sperber, K; Silverstein, L; Brusco, C; Yoon, C; Mullin, G E; Mayer, L

1995-01-01

Superantigens are potent inducers of T-cell proliferation and induce a broad range of cytokines, including tumor necrosis factor (TNF), gamma interferon, and interleukin 2 (IL-2). In the present study, we compared the abilities of different staphylococcal superantigens (staphylococcal enterotoxin B [SEB], staphylococcal enterotoxin E [SEE], and toxic shock syndrome toxin 1 [TSST-1]) to stimulate distinct cytokine profiles in peripheral blood mononuclear cells (PBMC), lamina propria lymphocytes (LPL), and intraepithelial lymphocytes (IEL). One million PBMC, LPL, and IEL were stimulated with various concentrations of superantigen (10 to 0.001 ng/ml) for 24, 48, and 72 h. Maximum cytokine production by PBMC, LPL, and IEL was observed for all three superantigens at 48 h at a concentration of 1 ng/ml. In PBMC, SEE and TSST-1 stimulated more IL-2 and gamma interferon than SEB. SEE and TSST-1 also stimulated more TNF and IL-4 production than SEB. In contrast, SEB stimulated more IL-6 than either SEE or TSST-1. In LPL, there was no SEE-induced IL-2 or IL-4 production, but IL-6, TNF, and gamma interferon were induced. SEB similarly induced no IL-2 or gamma interferon from the LPL, but IL-4, IL-6, and TNF were detected. TSST-1 stimulation of LPL resulted in IL-2 and TNF production but no IL-4, IL-6, or gamma interferon. In IEL, SEE induced no IL-2, IL-4, or gamma interferon but produced IL-6 and TNF, while SEB stimulation resulted in no IL-2 or gamma interferon but did result in detectable IL-4, IL-6, and TNF. Taken together, these data indicate that there are significant differences in the cytokine profiles induced by superantigens in LPL and IEL compared with those in PBMC, and these differences may relate to differences in activation requirements. PMID:7583927

Siglec-1 inhibits RSV-induced interferon gamma production by adult T cells in contrast to newborn T cells.

PubMed

Jans, Jop; Unger, Wendy W J; Vissers, Marloes; Ahout, Inge M L; Schreurs, Inge; Wickenhagen, Arthur; de Groot, Ronald; de Jonge, Marien I; Ferwerda, Gerben

2018-04-01

Interferon gamma (IFN-γ) plays an important role in the antiviral immune response during respiratory syncytial virus (RSV) infections. Monocytes and T cells are recruited to the site of RSV infection, but it is unclear whether cell-cell interactions between monocytes and T cells regulate IFN-γ production. In this study, micro-array data identified the upregulation of sialic acid-binding immunoglobulin-type lectin 1 (Siglec-1) in human RSV-infected infants. In vitro, RSV increased expression of Siglec-1 on healthy newborn and adult monocytes. RSV-induced Siglec-1 on monocytes inhibited IFN-γ production by adult CD4 + T cells. In contrast, IFN-γ production by RSV in newborns was not affected by Siglec-1. The ligand for Siglec-1, CD43, is highly expressed on adult CD4 + T cells compared to newborns. Our data show that Siglec-1 reduces IFN-γ release by adult T cells possibly by binding to the highly expressed CD43. The Siglec-1-dependent inhibition of IFN-γ in adults and the low expression of CD43 on newborn T cells provides a better understanding of the immune response against RSV in early life and adulthood. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Smad7 Protein Induces Interferon Regulatory Factor 1-dependent Transcriptional Activation of Caspase 8 to Restore Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL)-mediated Apoptosis

PubMed Central

Hong, Suntaek; Kim, Hye-Youn; Kim, Jooyoung; Ha, Huyen Trang; Kim, Young-Mi; Bae, Eunjin; Kim, Tae Hyung; Lee, Kang Choon; Kim, Seong-Jin

2013-01-01

Smad7 has been known as a negative regulator for the transforming growth factor-β (TGF-β) signaling pathway through feedback regulation. However, Smad7 has been suspected to have other biological roles through the regulation of gene transcription. By screening differentially regulated genes, we found that the caspase 8 gene was highly up-regulated in Smad7-expressing cells. Smad7 was able to activate the caspase 8 promoter through recruitment of the interferon regulatory factor 1 (IRF1) transcription factor to the interferon-stimulated response element (ISRE) site. Interaction of Smad7 on the caspase 8 promoter was confirmed with electrophoretic mobility shift assay and chromatin immunoprecipitation experiment. Interestingly, Smad7 did not directly interact with the ISRE site, but it increased the binding activity of IRF1 with ISRE. These results support that Smad7 recruits IRF1 protein on the caspase 8 promoter and functions as a transcriptional coactivator. To confirm the biological significance of caspase 8 up-regulation, we tested tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL)-mediated cell death assay in breast cancer cells. Smad7 in apoptosis-resistant MCF7 cells markedly sensitized the cells to TRAIL-induced cell death by restoring the caspase cascade. Furthermore, restoration of caspase 8-mediated apoptosis pathway repressed the tumor growth in the xenograft model. In conclusion, we suggest a novel role for Smad7 as a transcriptional coactivator for caspase 8 through the interaction with IRF1 in regulation of the cell death pathway. PMID:23255602

Adrenal tuberculosis after a pheochromocytoma: a misleading tumoral presentation.

PubMed

Hiéronimus, S; Bernard, J-L; Chevallier, P; Chevallier, A; Chyderiotis, G; Fenichel, P; Landraud, L

2007-06-01

Adrenal gland involvement could account for 6% of active tuberculosis. The diagnosis of this extrapulmonary form of tuberculosis is difficult, especially when presenting as unilateral adrenal tumor. This report describes an unusual case of adrenal tuberculosis presenting as a tumor occurring shortly after surgical removal of an adrenal pheochromocytoma located in the opposite gland, in a 63-year-old woman with a previous history of breast cancer. At initial presentation, the patient suffered from symptomatic paroxysmal hypertension. A pheochromocytoma in the left adrenal was diagnosed and resected. One year later, while physical examination and biological parameters were unremarkable, an enhanced adrenal computed tomography (CT) scan showed a right adrenal mass mimicking the CT features of the resected pheochromocytoma. A peripheral tissular rim delineating a central hypodensity characterized this tumor. Magnetic resonance imaging (MRI) showed the same findings on gadolinium-enhanced T1-weighted slices, while the mass was not seen on T2-weighted images. No tumoral signal loss was observed on out of phase images when using the in phase-out of phase T1-weighted sequence. Because of the tumoral evolution and the uncertainty of the nature of that lesion, the patient underwent a second adrenalectomy. Definitive diagnosis was provided by culture of tissue sample, which resulted in the identification of Mycobacterium tuberculosis. In an era of tuberculosis resurgence, this unusual case underscores the necessity of keeping in mind adrenal tuberculosis as a possible differential diagnosis in adrenal tumors of uncertainty nature. It stresses the importance of culture of biopsy tumor, whenever feasible, to avoid unnecessary operations. In the near future, interferon-gamma assay could be a valuable means to recognize extrapulmonary forms of tuberculosis.

Evaluation of pre- and posttransplantation serum interferon-gamma and soluble CD30 for predicting liver allograft rejection.

PubMed

Kim, K H; Oh, E-J; Jung, E-S; Park, Y-J; Choi, J Y; Kim, D-G; Lee, K Y; Kang, C S

2006-06-01

The aim of the present study was to identify whether the serum interferon-gamma (IFNgamma), a Th1 cytokine, or soluble CD30 (sCD30), a marker for activation of Th2 cytokine-producing T cells, predict acute cellular rejection episodes among liver graft patients. Pretransplant and posttransplant sera from 32 living donor liver transplant recipients obtained on days 1, 3, and 7 after surgery were tested for serum IFNgamma and sCD30 concentrations using commercial enzyme-linked immunosorbent assay kits. Recipients with an acute rejection episode (ARE) (n=14) displayed significantly higher IFNgamma concentrations pretransplant than did the patients with no ARE (n=18) (P<.05). The pretransplant serum levels of sCD30 were not different between the non-ARE and ARE groups. However, in comparison with the non-ARE group, who showed steadily decreasing serum sCD30 levels after transplantation, 12 among the 14 patients in the ARE group showed increasing sCD30 levels from day 1 to day 3 after transplantation (P<.05). These results suggest that the sCD30 increment during the early period after liver transplantation affects the immune response of rejection. This observation emphasizes the clinical relevance of serum sCD30, in addition to serum IFNgamma, as predictive markers for acute liver graft rejection.

Interferon modulation of c-myc expression in cloned Daudi cells: relationship to the phenotype of interferon resistance.

PubMed Central

Dron, M; Modjtahedi, N; Brison, O; Tovey, M G

1986-01-01

Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells. Images PMID:3785169

Contradictory results in interferon research

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.

1984-01-01

Several reports on immunologically related interferon research, both in the areas of basic science and clinical research, are briefly reviewed, and it is noted that in many cases the results obtained are contradictory. It is argued, however, that the contradictory results are not surprising since interferon is a biological response modifier and has been known to produce opposite results even when the same interferon prepartion is used. It is emphasized that dosage, timing, route, and other experimental conditions are essential factors in planning immunological studies with interferon. Careful planning of future experiments with interferon should be required to prevent the possible generation of effects that are opposite to those expected.

Interferon Alfa-2b Injection

MedlinePlus

Interferon alfa-2b injection is used to treat a number of conditions.Interferon alfa-2b injection is used alone or in combination ... lymphoma (NHL; a slow-growing blood cancer). Interferon alfa-2b is in a class of medications called ...

Myeloid interferon-γ receptor deficiency does not affect atherosclerosis in LDLR(-/-) mice.

PubMed

Boshuizen, Marieke C S; Neele, Annette E; Gijbels, Marion J J; van der Velden, Saskia; Hoeksema, Marten A; Forman, Ruth A; Muller, Werner; Van den Bossche, Jan; de Winther, Menno P J

2016-03-01

Atherosclerosis is a chronic lipid-driven inflammatory disease of the arterial wall. Interferon gamma (IFNγ) is an important immunomodulatory cytokine and a known pro-atherosclerotic mediator. However, cell-specific targeting of IFNγ or its signaling in atherosclerosis development has not been studied yet. As macrophages are important IFNγ targets, we here addressed the involvement of myeloid IFNγ signaling in murine atherosclerosis. Bone marrow was isolated from interferon gamma receptor 2 chain (IFNγR2) wildtype and myeloid IFNγR2 deficient mice and injected into lethally irradiated LDLR(-/-) mice. After recovery mice were put on a high fat diet for 10 weeks after which atherosclerotic lesion analysis was performed. In addition, the accompanying liver inflammation was assessed. Even though absence of myeloid IFNγ signaling attenuated the myeloid IFNγ response, no significant differences in atherosclerotic lesion size or phenotype were found. Also, when examining the liver inflammatory state no effects of IFNγR2 deficiency could be observed. Overall, our data argue against a role for myeloid IFNγR2 in atherosclerosis development. Since myeloid IFNγ signaling seems to be nonessential throughout atherogenesis, it is important to understand the mechanisms by which IFNγ acts in atherogenesis. In the future new studies should be performed considering other cell-specific targets. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.

PubMed

Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K

2005-01-20

Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.

Tumor cell-intrinsic PD-L1 promotes tumor-initiating cell generation and functions in melanoma and ovarian cancer

PubMed Central

Gupta, Harshita B; Clark, Curtis A; Yuan, Bin; Sareddy, Gangadhara; Pandeswara, Srilakshmi; Padron, Alvaro S; Hurez, Vincent; Conejo-Garcia, José; Vadlamudi, Ratna; Li, Rong; Curiel, Tyler J

2016-01-01

As tumor PD-L1 provides signals to anti-tumor PD-1+ T cells that blunt their functions, αPD-1 and αPD-L1 antibodies have been developed as anti-cancer immunotherapies based on interrupting this signaling axis. However, tumor cell-intrinsic PD-L1 signals also regulate immune-independent tumor cell proliferation and mTOR signals, among other important effects. Tumor-initiating cells (TICs) generate carcinomas, resist treatments and promote relapse. We show here that in murine B16 melanoma and ID8agg ovarian carcinoma cells, TICs express more PD-L1 versus non-TICs. Silencing PD-L1 in B16 and ID8agg cells by shRNA (‘PD-L1lo’) reduced TIC numbers, the canonical TIC genes nanog and pou5f1 (oct4), and functions as assessed by tumorosphere development, immune-dependent and immune-independent tumorigenesis, and serial transplantability in vivo. Strikingly, tumor PD-L1 sensitized TIC to interferon-γ and rapamycin in vitro. Cell-intrinsic PD-L1 similarly drove functional TIC generation, canonical TIC gene expression and sensitivity to interferon-γ and rapamycin in human ES2 ovarian cancer cells. Thus, tumor-intrinsic PD-L1 signals promote TIC generation and virulence, possibly by promoting canonical TIC gene expression, suggesting that PD-L1 has novel signaling effects on cancer pathogenesis and treatment responses. PMID:28798885

Pre-immune state induced by chicken interferon gamma inhibits the replication of H1N1 human and H9N2 avian influenza viruses in chicken embryo fibroblasts.

PubMed

Yuk, Seong-Su; Lee, Dong-Hun; Park, Jae-Keun; Tseren-Ochir, Erdene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon

2016-04-27

Interferon gamma (IFN-γ), an immunoregulatory cytokine, is known to control many microbial infections. In a previous study, chicken interferon gamma (chIFN-γ) was found to be up-regulated following avian influenza virus (AIV) infection in specific pathogen-free chickens. We aimed to investigate whether the pre-immune state induced by chIFN-γ could generate an antiviral response against influenza virus. We generated a chIFN-γ-expressing plasmid and transfected it into chicken embryo fibroblasts (CEFs) and then infected the cells with human origin H1N1 or avian origin H9N2 influenza viruses. Viral titers of culture medium were evaluated in MDCK cell and the viral RNA and IFN-stimulated genes (ISGs) were then quantified by real-time reverse transcriptase polymerase. To further evaluate the role of the antiviral effect of chIFN-γ by using a backward approach, synthetic small interfering RNAs (siRNA) targeting chIFN-γ were used to suppress chIFN-γ. The chIFN-γ-stimulated CEFs inhibited the replication of viral RNA (vRNA) and showed a mild decrease in the infectious virus load released in the culture medium. Compared to the mock-transfected control, the messenger RNA (mRNA) levels of type I IFNs and IFN-stimulated genes were up-regulated in the cells expressing chIFN-γ. After treatment with the siRNA, we detected a higher expression of viral genes than that observed in the mock-transfected control. Our results suggest that apart from the important role played by chIFN-γ in the antiviral state generated against influenza virus infection, the pre-immune state induced by chIFN-γ can be helpful in mitigating the propagation of influenza virus.

Frequency of indeterminate results from an interferon-gamma release assay among HIV-infected individuals

PubMed Central

de Oliveira, Sandra Maria do Valle Leone; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria

2017-01-01

ABSTRACT Objective: To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). Methods: We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Results: Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. Conclusions: The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. PMID:28746533

Molecular characterization and development of Sarcocystis speeri sarcocysts in gamma interferon gene knockout mice.

PubMed

Dubey, J P; Verma, S K; Dunams, D; Calero-Bernal, R; Rosenthal, B M

2015-11-01

The North American opossum (Didelphis virginiana) is the definitive host for at least three named species of Sarcocystis: Sarcocystis falcatula, Sarcocystis neurona and Sarcocystis speeri. The South American opossums (Didelphis albiventris, Didelphis marsupialis and Didelphis aurita) are definitive hosts for S. falcatula and S. lindsayi. The sporocysts of these Sarcocystis species are similar morphologically. They are also not easily distinguished genetically because of the difficulties of DNA extraction from sporocysts and availability of distinguishing genetic markers. Some of these species can be distinguished by bioassay; S. neurona and S. speeri are infective to gamma interferon gene knockout (KO) mice, but not to budgerigars (Melopsittacus undulatus); whereas S. falcatula and S. lindsayi are infective to budgerigars but not to KO mice. The natural intermediate host of S. speeri is unknown. In the present study, development of sarcocysts of S. speeri in the KO mice is described. Sarcocysts were first seen at 12 days post-inoculation (p.i.), and they became macroscopic (up to 4 mm long) by 25 days p.i. The structure of the sarcocyst wall did not change from the time bradyzoites had formed at 50-220 days p.i. Sarcocysts contained unique villar protrusions, 'type 38'. The polymerase chain reaction amplifications and sequences analysis of three nuclear loci (18S rRNA, 28S rRNA and ITS1) and two mitochondrial loci (cox1 and cytb) of S. speeri isolate from an Argentinean opossum (D. albiventris) confirmed its membership among species of Sarcocystis and indicated an especially close relationship to another parasite in this genus that employs opossums as its definitive host, S. neurona. These results should be useful in finding natural intermediate host of S. speeri.

The Jak-STAT pathway stimulated by interferon alpha or interferon beta.

PubMed

Horvath, Curt M

2004-11-23

Type I interferons, such as interferon alpha and interferon beta (IFN-alpha and beta), signal through a Janus kinase (Jak) to signal transduction and activator of transcription (STAT) pathway to stimulate gene expression. In response to ligand binding, the receptors dimerize, Jaks phosphorylate STAT1 and STAT2, which then dimerize and interact with a third transcriptional regulator IFN regulatory factor 9 (IRF9) to stimulate gene expression. IFN-alpha is the main innate antiviral cytokine and is essential for effective immune response to viral infection. The animation shows activation of STAT-responsive gene expression in response to type I IFNs.

MHC class I, beta2 microglobulin, and the INF-gamma receptor are upregulated in aged motoneurons.

PubMed

Edström, Erik; Kullberg, Susanna; Ming, Yu; Zheng, Huaiyu; Ulfhake, Brun

2004-12-15

During aging, spinal cord motoneurons show characteristic changes including the loss of afferent boutons, a selective process that associates with gliosis and behavioral motor impairment. Evidence suggests that the major histocompatibility complex Class I (MHC I) system may be involved in synaptic plasticity of neurons during development and regeneration. In search of a mechanism governing senescent changes in synaptic connectivity, we report evidence for increased expression of MHC I and beta2 microglobulin (beta2M) in motoneurons and glial-like profiles of 30-month-old rats. The regulatory signal(s) for MHC I expression in normal neurons remains unresolved but among tentative molecules are cytokines such as interferon-gamma (INF-gamma) and tumor necrosis factor alpha (TNF-alpha). Interestingly, aged motoneurons, overlapping with those showing increased levels of MHC I, contained increased levels of INF-gamma receptor message. INF-gamma mRNA was detected at low levels in most (8/9) of the aged spinal cords but only infrequently (2/9) in young adult spinal cords; however, the cellular localization of INF-gamma mRNA could not be determined. Our data also indicates that TNF-alpha is upregulated in the senescent spinal cord but that TNF-alpha immunoreactive protein does not associate with motoneurons. We report evidence for an increased expression of MHC I and beta2M in senescent spinal motoneurons and discuss the possibility that this regulation associates with INF-gamma or changes in neurotrophin signaling and neuron activity in senescence. (c) 2004 Wiley-Liss, Inc.

Cerebrospinal fluid interferon-gamma-inducible protein 10 (IP-10, CXCL10) in HIV-1 infection.

PubMed

Cinque, Paola; Bestetti, Arabella; Marenzi, Roberta; Sala, Serena; Gisslen, Magnus; Hagberg, Lars; Price, Richard W

2005-11-01

Interferon-gamma-inducible protein (IP-10 or CXCL10) is a potent chemoattractant and has been suggested to enhance retrovirus infection and mediate neuronal injury. In order to assess this chemokine in central nervous system (CNS) HIV infection, we measured the cerebrospinal fluid (CSF) and plasma concentrations of CXCL10 by immunoassay in samples derived from 97 HIV-infected subjects across a spectrum of immunological progression and CNS complications and from 16 HIV seronegative control subjects studied at three clinical centers between 1994 and 2001. We also examined changes in the CSF and plasma CXCL10 concentrations in 30 subjects starting and three stopping antiretroviral therapy. CSF CXCL10 concentrations: (1) correlated with CSF HIV RNA and white blood cell (WBC) counts, but not with blood CXCL10, HIV RNA, or CD4 counts; (2) were increased in subjects with primary and asymptomatic HIV infections and AIDS dementia complex, but less frequently in those with more advanced infection, with or without CNS opportunistic diseases except cytomegalovirus encephalitis; (3) decreased in subjects starting antiretroviral in association with decreases in CSF and plasma HIV RNA and CSF WBCs; and (4) conversely, increased in subjects stopping treatment in parallel with CSF HIV RNA and WBCs. These results confirm that CSF CXCL10 associates closely with both CSF HIV and WBCs and suggest that this chemokine may be both a response to and contributing determinant of local infection. High CSF levels may be useful in the diagnosis of ADC in subjects with advanced immunosuppression in whom CMV encephalitis has been ruled out, though this issue requires further study.

Ultrastructural study of the noninvolved urothelium of tumor-bearing patients after two years of intravesical interferon therapy.

PubMed

Stravoravdi, P; Natsis, K; Kirtsis, P; Retalis, G; Konstandinidis, E; Polyzonis, M

1996-01-01

Seventeen patients with transitional cell carcinoma of the urinary bladder were studied. Twelve patients did not have a recurrence 2 years after a transurethral resection (TUR) followed by interferon (IFN)-alpha 2b treatment. This observation led us to study the ultrastructural morphology of the noninvolved urothelium in 8 of the above 12 patients. All patients had a primary solitary grade I or II tumor. Topical therapy was started after TUR. Each patient received a total of 22 instillations of 50 MU IFN-alpha 2b in 12 months according to the standard procedure. After the first year, a repetitive dose of 50 MU IFN-alpha 2b was administered every 2 months for a period of 1 more year. At the end of therapy, certain ultrastructural modifications were observed indicating a partial restoration of the urothelium: the existence of asymmetric unit membrane, a well-developed Golgi apparatus and an increase of the filaments. The cells were joined to each other with well-developed tight junctions. Tubuloreticular inclusions were also observed. Prevention of recurrence by restoring the morphology of the noninvolved urothelium in response to IFN treatment deserves further examination.

Effects of interferon on antibody formation

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.

1984-01-01

Studies of the effects of interferon on primary and secondary antibody responses and of the relationship of interferon to other cytokines, or cell products, are presented. Dosage- and timing-dependent immunoenhancing and immunosuppressive activities of interferon are documented for mouse spleen cell cultures and for mice infected with murine hepatitis virus (MHV-3). A possibility that altered interferon production might lead to immunopathological disorders, such as lupus erythematosus, AIDS, arthritis, etc., is discussed. Latest technological developments are presented that indicate that interferon does apparently play a major role in the regulation of antibody responses.

Tumor Necrosis Factor-Like Weak Inducer of Apoptosis Activates Type I Interferon Signals in Lupus Nephritis.

PubMed

Xue, Leixi; Liu, Lei; Huang, Jun; Wen, Jian; Yang, Ru; Bo, Lin; Tang, Mei; Zhang, Yi; Liu, Zhichun

2017-01-01

Type I interferon (IFN) plays a central role in pathogenesis of systemic lupus erythematosus (SLE); tumor necrosis factor-like weak inducer of apoptosis (TWEAK) has been associated with a pathogenic role in lupus nephritis (LN). Thus we investigated whether TWEAK could induce the activation of type I IFN pathway in LN. We examined this in patient-derived peripheral blood mononuclear cells (PBMCs) as well as MRL/lpr mice, a murine LN model. Relative to the control cohorts, MRL/lpr mice showed severe histological changes, high index levels of renal damage, and elevated expression of type I IFN-inducible genes. After shRNA suppression of TWEAK, we observed that renal damage was significantly attenuated and expression of type I IFN-inducible genes was reduced in MRL/lpr mice. In parallel, siRNA of TWEAK also significantly reduced the expression of type I IFN-inducible genes in PBMCs relative to control transfections. In PBMCs, TWEAK stimulation also led to expression of type I IFN-inducible genes. Our results illustrate a novel regulatory role of TWEAK, in which its activity positively regulates type I IFN pathway in LN based on preclinical models. Our findings suggest TWEAK could act as a critical target in preventing renal damage in patients with LN.

Immune Response Following Photodynamic Therapy For Bladder Cancer

NASA Astrophysics Data System (ADS)

Raymond K.

1989-06-01

This study was undertaken to determine if photodynamic therapy (PDT) produces an immunologic response in patients treated for bladder cancer. Gamma interferon, interleukin 1-beta, interleukin 2 and tumor necrosis factor-alpha were assayed in the urine of four patients treated with photodynamic therapy for bladder cancer, in seven patients undergoing transurethral procedures, and in five healthy control subjects. Quantifiable concentrations of all cytokines, except gamma interferon, were measured in urine samples from the PDT patients treated with the highest light energies, while no urinary cytokines were found in the PDT patient who received the lowest light energy or in the control subjects. These findings suggest that a local immunologic response may occur following PDT for bladder cancer. Such an immunologic response activated by PDT may be an additional mechanism involved in bladder tumor destruction.

HLA-DRB1 and HLA-DQB1 Are Associated with Adult-Onset Immunodeficiency with Acquired Anti-Interferon-Gamma Autoantibodies

PubMed Central

Pithukpakorn, Manop; Roothumnong, Ekkapong; Angkasekwinai, Nasikarn; Suktitipat, Bhoom; Assawamakin, Anunchai; Luangwedchakarn, Voravich; Umrod, Pinklow; Thongnoppakhun, Wanna; Foongladda, Suporn; Suputtamongkol, Yupin

2015-01-01

Recently a newly identified clinical syndrome of disseminated non-tuberculous mycobacterial diseases (with or without other opportunistic infections in adult patients who were previously healthy, has been recognized in association with an acquired autoantibody to interferon-gamma. This syndrome is emerging as an important cause of morbidity and mortality, especially among people of Asian descent. Trigger for the production of this autoantibody remains unknown, but genetic factors are strongly suspected to be involved. We compared HLA genotyping between 32 patients with this clinical syndrome, and 38 controls. We found that this clinical syndrome was associated with very limited allele polymorphism, with HLA-DRB1 and DQB1 alleles, especially HLA-DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02. Odds ratio of DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02 were 7.03 (95% CI, 2.18–22.69, P<0.0001, 9.06 (95% CI, 2.79–29.46, P<0.0001), 6.68 (95% CI, 2.29–19.52, P = 0.0004), and 6.64 (95% CI, 2.30–19.20, P = 0.0004), respectively. Further investigation is warranted to provide better understanding on pathogenesis of this association. PMID:26011559

Mink parvoviruses and interferons: in vitro studies.

PubMed Central

Wiedbrauk, D L; Bloom, M E; Lodmell, D L

1986-01-01

Although interferons can inhibit the replication of a number of viruses, little is known about their ability to inhibit parvovirus replication. Therefore, in vitro experiments were done to determine if Aleutian disease virus and mink enteritis virus, two autonomously replicating mink parvoviruses, induced interferon, were sensitive to the effects of interferon, or inhibited the production of interferon. The results indicated that these parvoviruses neither induced nor were sensitive to the effects of interferon. Furthermore, preexisting parvovirus infections did not inhibit poly(I).poly(C)-induced interferon production. This independence from the interferon system may, therefore, be a general property of the autonomously replicating parvoviruses. PMID:2431162

The interferons.

PubMed Central

Toy, J L

1983-01-01

An overview of the interferons is presented. A description of something of what is known about them is given, including: their genes; their protein structures and characteristics; their mechanisms of actions; and their varied biological effects emphasising particularly their immunomodulatory actions. Finally, a brief summary is made of the current status of human clinical studies that have been conducted with interferons in the oncological and viral fields, mentioning also recent findings in patients who have the acquired immunodeficiency syndrome (AIDS). PMID:6193915

Changes in serum hepatitis C virus RNA in interferon nonresponders retreated with interferon plus ribavirin: a preliminary report.

PubMed

Nyberg, L; Albrecht, J; Glue, P; Gianelli, G; Zambas, D; Elliot, M; Conrad, A; McHutchison, J

1999-06-01

Ribavirin, a nucleoside analogue, inhibits replication of RNA and DNA viruses and may control hepatitis C virus (HCV) infection through modulation of anti-inflammatory and antiviral actions. Ribavirin monotherapy has no effect on serum HCV RNA levels. In combination with interferon, this agent appears to enhance the efficacy of interferon. The aim of this study was to monitor serum HCV RNA levels early during therapy with interferon and ribavirin compared with that previously seen in the same patients during interferon monotherapy. Five patients who previously showed no response to therapy with interferon alfa 3 MU three times weekly for 6 months were retreated with the identical dose of interferon alfa 2b in combination with oral ribavirin 1,000 mg/day. Serum HCV RNA levels were monitored at baseline, week 4, week 8, and week 12 of therapy by a quantitative multicycle polymerase chain reaction assay. In the first 8 to 12 weeks, serum HCV RNA levels showed a greater decrease in all patients when retreated with combination therapy compared with interferon alone. Mean (+/- SEM) serum HCV RNA levels for interferon therapy alone were 3.3 +/- 0.95, 1.2 +/- 0.95, 1.6 +/- 1.2, and 2.3 +/- 1.2 x 10(6) copies/ml at week 0, 4, 8, and 12, respectively. This was compared with 3.3 +/- 0.83, 0.3 +/- 0.2, 0.03 +/- 0.02, and 0.15 +/- 0.14 x 10(6), respectively, for the interferon and ribavirin group (p < 0.07 at week 8). Two of five patients had undetectable serum HCV RNA during combination therapy. Combination therapy with interferon and ribavirin in prior interferon nonresponders reduces serum HCV RNA levels compared with interferon alone. This may suggest some additional antiviral effect of ribavirin when given with interferon.

Private sector tuberculosis prevention in the US: Characteristics associated with interferon-gamma release assay or tuberculin skin testing.

PubMed

Stockbridge, Erica L; Miller, Thaddeus L; Carlson, Erin K; Ho, Christine

2018-01-01

To determine whether latent tuberculosis infection risk factors are associated with an increased likelihood of latent tuberculosis infection testing in the US private healthcare sector. A national sample of medical and pharmacy claims representing services rendered January 2011 through December 2013 for 3,997,986 commercially insured individuals in the US who were 0 to 64 years of age. We used multivariable logistic regression models to determine whether TB/LTBI risk factors were associated with an increased likelihood of Interferon-Gamma Release Assay (IGRA) or Tuberculin Skin Test (TST) testing in the private sector. 4.31% (4.27-4.34%) received at least one TST/IGRA test between 2011 and 2013 while 1.69% (1.67-1.72%) received a TST/IGRA test in 2013. Clinical risk factors associated with a significantly increased likelihood of testing included HIV, immunosuppressive therapy, exposure to tuberculosis, a history of tuberculosis, diabetes, tobacco use, end stage renal disease, and alcohol use disorder. Other significant variables included gender, age, asthma, the state tuberculosis rate, population density, and percent of foreign-born persons in a county. Private sector TST/IGRA testing is not uncommon and testing varies with clinical risk indicators. Thus, the private sector can be a powerful resource in the fight against tuberculosis. Analyses of administrative data can inform how best to leverage private sector healthcare toward tuberculosis prevention activities.

Conjunctival papilloma caused by human papillomavirus type 11 treated with systemic interferon in a five-year-old boy.

PubMed

Okan, Gökhan; Ayan, Inci; Karslioğlu, Safak; Altiok, Ender; Yenmiş, Güven; Vural, Gürcan

2010-01-01

Conjunctival papilloma is a benign tumor of the conjunctival mucosa. In childhood, papilloma represents 7-10% of conjunctival tumors. Human papillomavirus (HPV)-6 and HPV-11 are the major HPV types responsible for conjunctival lesions. A five-year-old boy with a two-year history of conjunctival papilloma caused by HPV type 11 treated with systemic interferon alpha is reported and the literature is reviewed.

Dependency of the effect of a vascular disrupting agent on sensitivity to tirapazamine and gamma-ray irradiation upon the timing of its administration and tumor size, with reference to the effect on intratumor quiescent cells.

PubMed

Masunaga, Shin-ichiro; Nagasawa, Hideko; Nagata, Kenji; Suzuki, Minoru; Uto, Yoshihiro; Hori, Hitoshi; Kinashi, Yuko; Ono, Koji

2007-01-01

The effect of vascular disrupting agent ZD6126 with time on the sensitivity to the hypoxic cytotoxin tirapazamine (TPZ) and gamma-rays was examined in large and small solid tumors. Mice bearing SCC VII tumors 1 or 1.5 cm in diameter received 5-bromo-2'-deoxyuridine (BrdU) continuously to label all proliferating (P) cells, followed by injection with or without ZD6126. In the absence of ZD6126, or 1 or 24 h following ZD6126 injection, the response to TPZ or gamma-ray irradiation in quiescent (Q) cells was assessed in terms of induced micronucleus (MN) frequency using immunofluorescence staining for BrdU. The MN frequency in the total cell population was determined from the tumors not pretreated with BrdU. Another group of tumor-bearing mice received a series of test doses of gamma-rays while alive or after tumor clamping to obtain hypoxic fractions (HFs) in the tumors. One hour after ZD6126 injection, both small and large tumors showed lower and higher sensitivity, and 24 h after, higher and lower sensitivity, to gamma-rays and TPZ, respectively, than the tumors not treated with ZD6126. Further, they showed larger and smaller HFs 1 and 24 h after ZD6126 injection, respectively. Without ZD6126 and 1 h after injection, small tumors were more sensitive to gamma-rays and less sensitive to TPZ than large tumors, probably due to the smaller HFs than large tumors. In contrast, 24 h after the injection, these differences in sensitivity and the HF between small and large tumors were reversed. The changes in sensitivity and the size of the HF were more marked in the total cell population than in Q cells. Following ZD6126 treatment, in terms of tumor control, especially large tumors and total tumor cell population, administering TPZ 1 h later and gamma-ray irradiation 24 h later were effective. Intratumor physiologic factors such as the size of the HF, depending on the time after ZD6126 injection, have to be taken into account when combining another treatment with ZD6126.

The importance of communication in promoting voluntary participation in an experimental trial: A qualitative study based on the assessment of the gamma-interferon test for the diagnosis of bovine tuberculosis in France

PubMed Central

Dufour, Barbara; Praud, Anne

2017-01-01

Understanding the factors leading each stakeholder to participate in an experimental trial is a key element for improving trial set-up and for identifying selection bias in statistical analyses. An experimental protocol, validated by the European Commission, was developed in France to assess the ability of the gamma-interferon test in terms of accuracy to replace the second intradermal skin test in cases of suspected bovine tuberculosis. Implemented between 2013 and 2015, this experimental trial was based on voluntary participation. To determine and understand the motivation or reluctance of farmers to take part in this trial, we carried out a sociological survey in France. Our study was based on semi-structured interviews with the farmers and other stakeholders involved. The analysis of findings demonstrated that shortening the lock-up period during tuberculosis suspicion, following the use of a gamma-interferon test, was an important aim and a genuine challenge for the animal health stakeholders. However, some farmers did not wish to continue the trial because it could potentially have drastic consequences for them. Moreover, misunderstandings and confusion concerning the objectives and consequences of the trial led stakeholders to reject it forcefully. Based on our results, we offer some recommendations: clear and appropriate communication tools should be prepared to explain the protocol and its aims. In addition, these types of animal health trials should be designed with the stakeholders’ interests in mind. This study provides a better understanding of farmer motivations and stakeholder influences on trial participation and outcomes. The findings can be used to help design trials so that they promote participation by farmers and by all animal health stakeholders in general. PMID:28973018

Gamma-Klotho exhibits multiple roles in tumor growth of human bladder cancer.

PubMed

Hori, Shunta; Miyake, Makito; Tatsumi, Yoshihiro; Morizawa, Yosuke; Nakai, Yasushi; Onishi, Sayuri; Onishi, Kenta; Iida, Kota; Gotoh, Daisuke; Tanaka, Nobumichi; Fujimoto, Kiyohide

2018-04-13

Alpha-Klotho (KLα) and beta-Klotho (KLβ) have recently been reported to correlate with cancer prognosis in some malignancies and we previously reported the association between KLα, KLβ, and urothelial carcinoma of the bladder (UCB), indicating that KLβ acts as a tumor promoter. However, the association between gamma-Klotho (KLγ) and cancer prognosis remains unclear. In the present study, we evaluated the association between KLγ and UCB. To evaluate the effect of KLγ on human bladder cancer cell lines in vitro assays were performed. Exogenous KLγ increased the ability of human bladder cancer cells to proliferate, migrate, invade, form colonies, and provide anchorage-independent growth potential. In in vivo assays, eighteen mice bearing xenografts inoculated using UM-UC-3, were randomly divided into three groups and treated with a small interfering RNA (siRNA) by intratumoral administration once a week for four weeks. Knockdown of KLγ with siRNA led to a dramatic change in tumor growth and suggested that KLγ had effects on tumor growth, including promotion of cell proliferation, inhibition of apoptosis, and enhancement of the epithelial-mesenchymal transition. To confirm the study, human tissue samples were used and patients were divided into two groups according to KLγ expression level. High expression of KLγ was significantly associated with higher stage and grade cancer and the presence of lymphovascular invasion compared to patients with lower expression of KLγ. Our results suggest that KLγ plays an important role in tumor invasion and progression and these results may lead to the development of new therapies and diagnostic methods for UCB.

Gamma-Klotho exhibits multiple roles in tumor growth of human bladder cancer

PubMed Central

Hori, Shunta; Miyake, Makito; Tatsumi, Yoshihiro; Morizawa, Yosuke; Nakai, Yasushi; Onishi, Sayuri; Onishi, Kenta; Iida, Kota; Gotoh, Daisuke; Tanaka, Nobumichi; Fujimoto, Kiyohide

2018-01-01

Alpha-Klotho (KLα) and beta-Klotho (KLβ) have recently been reported to correlate with cancer prognosis in some malignancies and we previously reported the association between KLα, KLβ, and urothelial carcinoma of the bladder (UCB), indicating that KLβ acts as a tumor promoter. However, the association between gamma-Klotho (KLγ) and cancer prognosis remains unclear. In the present study, we evaluated the association between KLγ and UCB. To evaluate the effect of KLγ on human bladder cancer cell lines in vitro assays were performed. Exogenous KLγ increased the ability of human bladder cancer cells to proliferate, migrate, invade, form colonies, and provide anchorage-independent growth potential. In in vivo assays, eighteen mice bearing xenografts inoculated using UM-UC-3, were randomly divided into three groups and treated with a small interfering RNA (siRNA) by intratumoral administration once a week for four weeks. Knockdown of KLγ with siRNA led to a dramatic change in tumor growth and suggested that KLγ had effects on tumor growth, including promotion of cell proliferation, inhibition of apoptosis, and enhancement of the epithelial-mesenchymal transition. To confirm the study, human tissue samples were used and patients were divided into two groups according to KLγ expression level. High expression of KLγ was significantly associated with higher stage and grade cancer and the presence of lymphovascular invasion compared to patients with lower expression of KLγ. Our results suggest that KLγ plays an important role in tumor invasion and progression and these results may lead to the development of new therapies and diagnostic methods for UCB. PMID:29731962

Ultrasound-mediated interferon {beta} gene transfection inhibits growth of malignant melanoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamaguchi, Kazuki; Department of Anatomy, Fukuoka University School of Medicine, 7-45-1 Nanakuma, Jonan-ku, Fukuoka City 814-0180; Feril, Loreto B., E-mail: ferilism@yahoo.com

2011-07-22

Highlights: {yields} Successful ultrasound-mediated transfection of melanoma (C32) cells with IFN-{beta} genes both in vitro and in vivo. {yields} Ultrasound-mediated IFN-{beta} transfection inhibited proliferation of melanoma cells in vitro. {yields} Ultrasound-mediated IFN-{beta} transfection inhibited melanoma tumor growth in vivo. -- Abstract: We investigated the effects of ultrasound-mediated transfection (sonotransfection) of interferon {beta} (IFN-{beta}) gene on melanoma (C32) both in vitro and in vivo. C32 cells were sonotransfected with IFN-{beta} in vitro. Subcutaneous C32 tumors in mice were sonicated weekly immediately after intra-tumor injection with IFN-{beta} genes mixed with microbubbles. Successful sonotransfection with IFN-{beta} gene in vitro was confirmed by ELISA,more » which resulted in C32 growth inhibition. In vivo, the growth ratio of tumors transfected with IFN-{beta} gene was significantly lower than the other experimental groups. These results may lead to a new method of treatment against melanoma and other hard-to-treat cancers.« less

Detection of bacterial pyrogens on the basis of their effects on gamma interferon-mediated formation of neopterin or nitrite in cultured monocyte cell lines.

PubMed Central

Werner-Felmayer, G; Baier-Bitterlich, G; Fuchs, D; Hausen, A; Murr, C; Reibnegger, G; Werner, E R; Wachter, H

1995-01-01

In a number of mammalian cell types, pteridine biosynthesis from guanosine 5'-triphosphate and formation of nitric oxide from L-arginine are induced by gamma interferon (IFN-gamma) and bacterial lipopolysaccharide (LPS). We assessed the possibility of using such metabolic alterations for the in vitro detection of pyrogens. Products from gram-negative and gram-positive bacteria and related synthetic compounds were tested for their potential to induce either of these pathways. Stimulation of pteridine biosynthesis was monitored as the formation of neopterin in the human myelomonocytic cell line THP-1. The formation of nitric oxide was determined as nitrite in murine J774A.1 macrophage cultures. The substances tested included toxic and detoxified parts of LPS and lipid A from Escherichia coli, Salmonella typhimurium, Salmonella minnesota, and Klebsiella pneumoniae as well as lipoteichoic acid and toxic shock syndrome toxin 1 from Staphylococcus aureus. Furthermore, two cell wall compounds from Mycobacterium tuberculosis, trehalose 6,6'-dimycolate and N-acetylmuramyl-L-alanyl-D-isoglutamine, which are active components of Freund's adjuvant, were used. When applied as a single stimulus, only the whole LPS molecule potently stimulated neopterin or nitrite formation. Lipid A and products from gram-positive bacteria were weakly active. For neopterin formation, lipid A required the presence of fetal calf serum. Besides detoxified LPS and independently from the presence of serum, all bacterial compounds tested strongly increased the effects mediated by IFN-gamma. Our results show that bacterial pyrogens can be detected by monitoring the formation of neopterin or nitrite. This may provide a basis for the development of an in vitro assay for the detection of pyrogenic contamination with the aim of replacing the currently used animal test. PMID:7664177

An interferon signature identified by RNA-sequencing of mammary tissues varies across the estrous cycle and is predictive of metastasis-free survival

DOE PAGES

Snijders, Antoine M.; Langley, Sasha; Mao, Jian-Hua; ...

2014-06-30

The concept that a breast cancer patient's menstrual stage at the time of tumor surgery influences risk of metastases remains controversial. The scarcity of comprehensive molecular studies of menstrual stage-dependent fluctuations in the breast provides little insight. To gain a deeper understanding of the biological changes in mammary tissue and blood during the menstrual cycle and to determine the influence of environmental exposures, such as low-dose ionizing radiation (LDIR), we used the mouse to characterize estrous-cycle variations in mammary gene transcripts by RNA-sequencing, peripheral white blood cell (WBC) counts and plasma cytokine levels. We identified an estrous-variable and hormone-dependent genemore » cluster enriched for Type-1 interferon genes. Cox regression identified a 117-gene signature of interferon-associated genes, which correlated with lower frequencies of metastasis in breast cancer patients. LDIR (10cGy) exposure had no detectable effect on mammary transcripts. However, peripheral WBC counts varied across the estrous cycle and LDIR exposure reduced lymphocyte counts and cytokine levels in tumor-susceptible mice. Our finding of variations in mammary Type-1 interferon and immune functions across the estrous cycle provides a mechanism by which timing of breast tumor surgery during the menstrual cycle may have clinical relevance to a patient's risk for distant metastases.« less

An interferon signature identified by RNA-sequencing of mammary tissues varies across the estrous cycle and is predictive of metastasis-free survival

DOE Office of Scientific and Technical Information (OSTI.GOV)

Snijders, Antoine M.; Langley, Sasha; Mao, Jian-Hua

The concept that a breast cancer patient's menstrual stage at the time of tumor surgery influences risk of metastases remains controversial. The scarcity of comprehensive molecular studies of menstrual stage-dependent fluctuations in the breast provides little insight. To gain a deeper understanding of the biological changes in mammary tissue and blood during the menstrual cycle and to determine the influence of environmental exposures, such as low-dose ionizing radiation (LDIR), we used the mouse to characterize estrous-cycle variations in mammary gene transcripts by RNA-sequencing, peripheral white blood cell (WBC) counts and plasma cytokine levels. We identified an estrous-variable and hormone-dependent genemore » cluster enriched for Type-1 interferon genes. Cox regression identified a 117-gene signature of interferon-associated genes, which correlated with lower frequencies of metastasis in breast cancer patients. LDIR (10cGy) exposure had no detectable effect on mammary transcripts. However, peripheral WBC counts varied across the estrous cycle and LDIR exposure reduced lymphocyte counts and cytokine levels in tumor-susceptible mice. Our finding of variations in mammary Type-1 interferon and immune functions across the estrous cycle provides a mechanism by which timing of breast tumor surgery during the menstrual cycle may have clinical relevance to a patient's risk for distant metastases.« less

[Association between Fok I vitamin D receptor (VDR) gene polymorphism and plasmatic concentrations of transforming growth factor-beta1 and interferon gamma in type 1 diabetes mellitus].

PubMed

López, Tatiana; García, Diego; Angel, Bárbara; Carrasco, Elena; Codner, Ethel; Ugarte, Francisca; Pérez-Bravo, Francisco

2008-02-02

In order to assess whether Fok I vitamin D receptor gene (VDR) polymorphism is involved in the genetic susceptibility of type 1 diabetes, a case-control study was conducted and VDR genotypes were related to serum concentrations of 25(OH) vitamin D and cytokines transforming growth factor beta1 (TGF-beta1) and interferon gamma (INF-gamma). 151 incident cases of type 1 diabetes and 182 non related healthy controls from Santiago were studied for VDR polymorphisms in peripheral blood DNA. Exon 2 (Fok I) segments were amplified by polimerase chain reaction and analyzed by means of restriction fragment length polymorphism to determine each corresponding genotype. Differences for allele, genotype and serological markers as 25(OH) vitamin D, TGF-beta1 and INF-gamma levels distribution between patients and controls were analyzed. Fok I polymorphism distribution analysis showed no differences between patients and controls. Among diabetics, higher levels of TGF-beta1 (median, 282.6 pg/ml; range, 131.8-3,031.4) were observed compared with healthy children (median, 232.2 pg/ml; range, 135.7-506.5) (p < 0.0038). Similar results were observed for INF-gamma concentrations (median, 121.1 pg/ml, and range, 5.3-228.8, in cases, and median, 89.6 pg/ml, and range, 10.9-117.2 in controls) (p < 0.0004). The diabetic carriers of the ff genotype showed low levels of 25(OH) vitamin D compared with the carriers of the F allele: mean (standard deviation), 23.1 (5.9) versus 27.9 (10.3) ng/ml (p < 0.03). A similar result was observed for TGF-beta1 concentrations in diabetic carriers of ff genotype and patients carriers of the F allele (298.5 versus 276.6; p < 0.05). Fok I polymorphism of VDR could have a marginal role in the immunologic disturbance in type 1 diabetes.

Effects of positive results for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA on results of caudal fold tuberculin test and interferon-gamma assay for tuberculosis in cattle.

PubMed

Dunn, John R; Kaneene, John B; Grooms, Daniel L; Bolin, Steven R; Bolin, Carole A; Bruning-Fann, Colleen S

2005-02-01

To determine whether cattle testing positive for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA were more likely to have false-positive responses on the caudal fold tuberculin (CFT) test or interferon-gamma (IFN-gamma) assay for Mycobacterium bovis than cattle testing negative for M paratuberculosis. 1043 cattle from 10 herds in Michigan. Feces and blood samples for plasma were collected from cattle > or =24 months old on the day the CFT test was read. Fecal samples were submitted for microbial culture for M paratuberculosis. Plasma samples were tested for antibody against M paratuberculosis, and IFN-gamma after stimulation with purified protein derivative tuberculin from M bovis or M avium. Of 1043 cattle, 180 (17.3%) had positive CFT test results (suspects) and 8 (0.8%) had positive IFN-gamma assay results after stimulation with purified protein derivative tuberculin from M bovis. Forty-five (4.3%) and 115 (11.0%) cattle tested positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA, respectively. Cattle with positive responses for M paratuberculosis appeared to have an increased likelihood of false-positive results on the CFT test, although this association was not significant. No significant association was detected among cattle testing positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA and positive CFT test and IFN-gamma assay results for M bovis.

Plasma interferon-gamma-inducible protein-10 (IP-10) levels during acute hepatitis C virus infection

PubMed Central

Grebely, Jason; Feld, Jordan J.; Applegate, Tanya; Matthews, Gail V.; Hellard, Margaret; Sherker, Alana; Petoumenos, Kathy; Zang, Geng; Shaw, Ineke; Yeung, Barbara; George, Jacob; Teutsch, Suzy; Kaldor, John M.; Cherepanov, Vera; Bruneau, Julie; Shoukry, Naglaa H.; Lloyd, Andrew R.; Dore, Gregory J.

2013-01-01

Systemic levels of interferon-gamma-inducible protein-10 (IP-10) are predictive of treatment-induced clearance in chronic HCV. In the present study, factors associated with plasma IP-10 levels at the time of acute HCV detection and the association between IP-10 levels and spontaneous clearance were assessed in three cohorts of acute HCV infection. Among 300 individuals, 245 (181 male, 47 HIV+) were HCV RNA+ at acute HCV detection. In adjusted analysis, factors independently associated with IP-10 levels ≥150 pg/mL (median level) included HCV RNA levels >6 log IU/mL, HIV co-infection and non-Aboriginal ethnicity. Among 245 HCV RNA+ at acute HCV detection, 214 were untreated (n=137) or had persistent infection (infection duration ≥26 weeks) at treatment initiation (n=77). Spontaneous clearance occurred in 14% (29 of 214). Individuals without spontaneous clearance had significantly higher mean plasma IP-10 levels at the time of acute HCV detection than those with clearance (248±32 vs. 142±22 pg/mL, P=0.008). The proportion of individuals with spontaneous clearance was 0% (0 of 22, P=0.048) and 16% (27 of 165) and in those in those with and without plasma IP-10 levels ≥380 pg/mL. In adjusted analyses, favourable IL28B genotype was associated with spontaneous clearance, while higher HCV RNA level was independently associated with lower odds of spontaneous clearance. Conclusion High IP-10 levels at acute HCV detection were associated with failure to spontaneously clear HCV. Patients with acute HCV and high baseline IP-10 levels, particularly >380 pg/mL, should be considered for early therapeutic intervention, and those with low levels should defer therapy for potential spontaneous clearance. PMID:23325615

Long-term effectiveness and safety of stereotactic gamma knife surgery as a primary sole treatment in the management of glomus jagulare tumor.

PubMed

Hafez, Raef F A; Morgan, Magad S; Fahmy, Osama M; Hassan, Hamdy T

2018-05-01

This study aims to report and confirm long-term effectiveness and safety of stereotactic Gamma Knife Surgery as a primary sole treatment in the management of 40 glomus jagulare tumors patients. Retrospective analysis of clinical and radiological outcomes of 40 GJTs consecutive patients treated with GKS as primary sole treatment at International Medical Center (IMC), Cairo-Egypt from the beginning of 2005 till the end of 2014,with mean follow-up period of 84 months (range 36-156 months), mean tumor volume was 6.5 cc, and mean peripheral radiation dose of 15 Gy, to mean isodose curve of 38%. The most common neurological deficit at initial evaluation was bulbar symptoms in 24 patients, followed by pulsatile tinnitus in 22, deterioration of hearing in 20 patients. The overall clinical control achieved in 92.5% of patients, while actuarial tumor size control rate post- GKS was 97.5% at 3 years, 97% at 5 years and 92% at 10 years of follow-up period. Gamma knife surgery could be used effectively and safely as a primary sole treatment tool in the management of glomus jugulare tumors. Copyright © 2018 Elsevier B.V. All rights reserved.

Effect of aged garlic extract on immune responses to experimental fibrosarcoma tumor in BALB/c mice.

PubMed

Tabari, M Abouhosseini; Ebrahimpour, S

2014-01-01

Aged garlic extract (AGE) has many biological activities including radical scavenging, antioxidative and immunomodulative effects. In this research work, the antitumor and immunomodulatory effects of AGE against fibrosarcoma implanted tumor were studied. WEHI-164 fibrosarcoma cells were implanted subcutaneously on day 0 into the right flank of 40 BALB/c mice at age of 8 weeks. Mice were randomly categorized in two separate groups: First received AGE (100 mg/kg, IP), second group as the control group received phosphate buffered saline. Treatments were carried out 3 times/week. Tumor growth was measured and morbidity was recorded. Subpopulations of CD4+/CD8+ T cells were determined using flow cytometry. WEHI-164 cell specific cytotoxicity of splenocytes and in vitro production of interferon gamma (IFN-γ) and interleukin-4 cytokines were measured. The mice received AGE had significantly longer survival time compared with the control mice. The inhibitory effect on tumor growth was seen in AGE treated mice. The CD4+/CD8+ ratio and in vitro IFN-γ production of splenocytes were significantly increased in AGE group. WEHI-164 specific cytotoxicity of splenocytes from AGE mice was also significantly increased at 25:1 E: T ratio. Administration of AGE resulted in improved immune responses against experimentally implanted fibrosarcoma tumors in BALB/c mice. AGE showed significant effects on inhibition of tumor growth and longevity of survival times.

Expression of LIGHT/TNFSF14 Combined with Vaccination against Human Papillomavirus Type 16 E7 Induces Significant Tumor Regression

PubMed Central

Kanodia, Shreya; Da Silva, Diane M.; Karamanukyan, Tigran; Bogaert, Lies; Fu, Yang-Xin; Kast, W. Martin

2010-01-01

LIGHT, a ligand for the lymphotoxin-beta receptor, establishes lymphoid-like tissues inside tumor sites and recruits naïve T-cells into the tumor. However, whether these infiltrating T-cells are specific for tumor antigens is not known. We hypothesized that therapy with LIGHT can expand functional tumor-specific CD8+ T-cells that can be boosted using HPV16E6E7-Venezuelan Equine Encephalitis Virus Replicon Particles (HPV16-VRP) and that this combined therapy can eradicate HPV16-induced tumors. Our data show that forced expression of LIGHT in tumors results in an increase in expression of interferon gamma (IFNg) and chemottractant cytokines such as IL-1a, MIG and MIP-2 within the tumor and that this tumor microenvironment correlates with an increase in frequency of tumor-infiltrating CD8+ T-cells. Forced expression of LIGHT also results in the expansion of functional T-cells that recognize multiple tumor-antigens, including HPV16 E7, and these T-cells prevent the outgrowth of tumors upon secondary challenge. Subsequent boosting of E7-specific T-cells by vaccination with HPV16-VRP significantly increases their frequency in both the periphery and the tumor, and leads to the eradication of large well-established tumors, for which either treatment alone is not successful. These data establish the safety of Ad-LIGHT as a therapeutic intervention in pre-clinical studies and suggest that patients with HPV16+ tumors may benefit from combined immunotherapy with LIGHT and antigen-specific vaccination. PMID:20460520

Value of sentinel lymph node biopsy and adjuvant interferon treatment in thick (>4 mm) cutaneous melanoma: an observational study.

PubMed

Morera-Sendra, Natalia; Tejera-Vaquerizo, Antonio; Traves, Víctor; Requena, Celia; Bolumar, Isidro; Pla, Angel; Vázquez, Carlos; Soriano, Virtudes; Nagore, Eduardo

2016-01-01

The role of sentinel lymph node biopsy and the benefit of immunotherapy with interferon in thick (>4 mm) melanomas remain uncertain. Our aim was to assess the value of both sentinel lymph node (SLN) biopsy and immunotherapy in the prognosis of thick melanomas. A retrospective study based on a computerized patient database in which patients have been prospectively collected since 2005 was performed. Age, sex, location, Breslow thickness, tumor ulceration, regression, Clark level, tumor infiltrating lymphocytes, tumor mitotic rate, microscopic satellite and vascular invasion were included in the analysis. Disease-free (DFS), disease-specific (DSS) and overall (OS) survivals were evaluated by the Kaplan-Meier method and Cox regression analysis. A series of 141 patients with melanomas thicker than 4 mm were included. Multivariate regression showed a worse prognosis in SLN-positive patients with respect to SLN biopsy-negative patients (DFS, hazard ratio [HR] 2, p = 0.04; DSS, HR 2.2, p = 0.002; OS, HR 2.4, p = 0.02). The observational group was shown to have a worse prognosis than the SLN-positive group but was very similar to the clinically positive group. Immunotherapy with high-dose interferon showed a protective effect (DFS, HR 0.5, p = 0.02; DSS, HR 0.3, p = 0.001; OS, HR 0.3, p = 0.001). Our data indicate that SLN biopsy and adjuvant interferon should be considered for patients with thick melanomas.

Immune-system-dependent anti-tumor activity of a plant-derived polyphenol rich fraction in a melanoma mouse model

PubMed Central

Gomez-Cadena, A; Urueña, C; Prieto, K; Martinez-Usatorre, A; Donda, A; Barreto, A; Romero, P; Fiorentino, S

2016-01-01

Recent findings suggest that part of the anti-tumor effects of several chemotherapeutic agents require an intact immune system. This is in part due to the induction of immunogenic cell death. We have identified a gallotannin-rich fraction, obtained from Caesalpinia spinosa (P2Et) as an anti-tumor agent in both breast carcinoma and melanoma. Here, we report that P2Et treatment results in activation of caspase 3 and 9, mobilization of cytochrome c and externalization of annexin V in tumor cells, thus suggesting the induction of apoptosis. This was preceded by the onset of autophagy and the expression of immunogenic cell death markers. We further demonstrate that P2Et-treated tumor cells are highly immunogenic in vaccinated mice and induce immune system activation, clearly shown by the generation of interferon gamma (IFN-γ) producing tyrosine-related protein 2 antigen-specific CD8+ T cells. Moreover, the tumor protective effects of P2Et treatment were abolished in immunodeficient mice, and partially lost after CD4 and CD8 depletion, indicating that P2Et's anti-tumor activity is highly dependent on immune system and at least in part of T cells. Altogether, these results support the hypothesis that the gallotannin-rich fraction P2Et's anti-tumor effects are mediated to a great extent by the endogenous immune response following to the exposure to immunogenic dying tumor cells. PMID:27253407

PI3K{gamma} activation by CXCL12 regulates tumor cell adhesion and invasion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Monterrubio, Maria; Mellado, Mario; Carrera, Ana C.

Tumor dissemination is a complex process, in which certain steps resemble those in leukocyte homing. Specific chemokine/chemokine receptor pairs have important roles in both processes. CXCL12/CXCR4 is the most commonly expressed chemokine/chemokine receptor pair in human cancers, in which it regulates cell adhesion, extravasation, metastatic colonization, angiogenesis, and proliferation. All of these processes require activation of signaling pathways that include G proteins, phosphatidylinositol-3 kinase (PI3K), JAK kinases, Rho GTPases, and focal adhesion-associated proteins. We analyzed these pathways in a human melanoma cell line in response to CXCL12 stimulation, and found that PI3K{gamma} regulates tumor cell adhesion through mechanisms different frommore » those involved in cell invasion. Our data indicate that, following CXCR4 activation after CXCL12 binding, the invasion and adhesion processes are regulated differently by distinct downstream events in these signaling cascades.« less

No Love Lost Between Viruses and Interferons.

PubMed

Fensterl, Volker; Chattopadhyay, Saurabh; Sen, Ganes C

2015-11-01

The interferon system protects mammals against virus infections. There are several types of interferons, which are characterized by their ability to inhibit virus replication and resultant pathogenesis by triggering both innate and cell-mediated immune responses. Virus infection is sensed by a variety of cellular pattern-recognition receptors and triggers the synthesis of interferons, which are secreted by the infected cells. In uninfected cells, cell surface receptors recognize the secreted interferons and activate intracellular signaling pathways that induce the expression of interferon-stimulated genes; the proteins encoded by these genes inhibit different stages of virus replication. To avoid extinction, almost all viruses have evolved mechanisms to defend themselves against the interferon system. Consequently, a dynamic equilibrium of survival is established between the virus and its host, an equilibrium that can be shifted to the host's favor by the use of exogenous interferon as a therapeutic antiviral agent.

Spirulina lipopolysaccharides inhibit tumor growth in a Toll-like receptor 4-dependent manner by altering the cytokine milieu from interleukin-17/interleukin-23 to interferon-γ

PubMed Central

Okuyama, Hiromi; Tominaga, Akira; Fukuoka, Satoshi; Taguchi, Takahiro; Kusumoto, Yutaka; Ono, Shiro

2017-01-01

Th17 cells and the cytokine they produce, interleukin (IL)-17, play an important role in tumor progression in humans and in mice. IL-6 and IL-23 are critical cytokines for the differentiation and propagation of Th17 cells, respectively. Bacterial lipopolysaccharides (LPS) are known to stimulate immune cells to produce such inflammatory cytokines. Contrary to Escherichia coli (E. coli) LPS, LPS from Spirulina has low toxicity and barely induces in vivo production of IL-6 and IL-23 in mice. We examined the antitumor effects of Spirulina LPS compared to E. coli LPS in an MH134 hepatoma model. Administration of Spirulina LPS suppressed tumor growth in C3H/HeN mice, but not in Toll-like receptor 4 (TLR4)-mutant C3H/HeJ mice, by reducing serum levels of IL-17 and IL-23, while increasing interferon (IFN)-γ levels. The antitumor activity and IFN-γ production were mediated by T cells. Moreover, in vitro experiments showed that Spirulina LPS impaired the antigen-presenting function that supports the generation of IL-17-producing cells in a toll-like receptor (TLR)4-dependent manner. Of note, injection of anti-IL-17 antibody in tumor-bearing C3H/HeN mice in the absence of Spirulina LPS markedly suppressed tumor growth and augmented IFN-γ responses. Thus, our results support the notion that IFN-γ and IL-17/IL-23 mutually regulate Th17 and Th1 responses in tumor-bearing hosts, and Spirulina LPS modulates the balance of the IFN-γ-IL-17/IL-23 axis towards IFN-γ production, which leads to tumor inhibition. Furthermore, Spirulina LPS effectively inhibited the spontaneous development of mammary tumors. This study has important implications for the exploitation of TLR-based immunomodulators for cancer immunotherapy. PMID:28075473

Gastrointestinal Carcinoid Tumors Treatment (PDQ®)—Patient Version

Cancer.gov

Gastrointestinal (GI) carcinoid tumor treatment options include surgery, radiation therapy, chemotherapy, and hormone therapy. Treatment for carcinoid syndrome includes hormonal treatment, interferon, and other medications to control symptoms. Learn more in this expert-reviewed information summary.

[Plasma levels of interferon gamma and interleukin 10 in patients with lymphonodular toxoplasmosis].

PubMed

Bielec, D; Patorska-Mach, E; Semczuk, G; Toruń, E

1997-01-01

The concentrations of IFN gamma and IL 10 in plasma of sixteen patients with toxoplasmic lymphadenopathy were measured. These examinations were carried out two times in the interval of a month. We found increased level of IFN gamma and normal concentrations of IL 10 in both of these terms.

Adoptive transfer of gene-engineered CD4+ helper T cells induces potent primary and secondary tumor rejection.

PubMed

Moeller, Maria; Haynes, Nicole M; Kershaw, Michael H; Jackson, Jacob T; Teng, Michele W L; Street, Shayna E; Cerutti, Loretta; Jane, Stephen M; Trapani, Joseph A; Smyth, Mark J; Darcy, Phillip K

2005-11-01

Because CD4+ T cells play a key role in aiding cellular immune responses, we wanted to assess whether increasing numbers of gene-engineered antigen-restricted CD4+ T cells could enhance an antitumor response mediated by similarly gene-engineered CD8+ T cells. In this study, we have used retroviral transduction to generate erbB2-reactive mouse T-cell populations composed of various proportions of CD4+ and CD8+ cells and then determined the antitumor reactivity of these mixtures. Gene-modified CD4+ and CD8+ T cells were shown to specifically secrete Tc1 (T cytotoxic-1) or Tc2 cytokines, proliferate, and lyse erbB2+ tumor targets following antigen ligation in vitro. In adoptive transfer experiments using severe combined immunodeficient (scid) mice, we demonstrated that injection of equivalent numbers of antigen-specific engineered CD8+ and CD4+ T cells led to significant improvement in survival of mice bearing established lung metastases compared with transfer of unfractionated (largely CD8+) engineered T cells. Transferred CD4+ T cells had to be antigen-specific (not just activated) and secrete interferon gamma (IFN-gamma) to potentiate the antitumor effect. Importantly, antitumor responses in these mice correlated with localization and persistence of gene-engineered T cells at the tumor site. Strikingly, mice that survived primary tumor challenge could reject a subsequent rechallenge. Overall, this study has highlighted the therapeutic potential of using combined transfer of antigen-specific gene-modified CD8+ and CD4+ T cells to significantly enhance T-cell adoptive transfer strategies for cancer therapy.

The elephant interferon gamma assay: a contribution to diagnosis of tuberculosis in elephants.

PubMed

Angkawanish, T; Morar, D; van Kooten, P; Bontekoning, I; Schreuder, J; Maas, M; Wajjwalku, W; Sirimalaisuwan, A; Michel, A; Tijhaar, E; Rutten, V

2013-11-01

Mycobacterium tuberculosis (M. tb) has been shown to be the main causative agent of tuberculosis in elephants worldwide. M. tb may be transmitted from infected humans to other species including elephants and vice versa, in case of prolonged intensive contact. An accurate diagnostic approach covering all phases of the infection in elephants is required. As M. tb is an intracellular pathogen and cell-mediated immune (CMI) responses are elicited early after infection, the skin test is the CMI assay of choice in humans and cattle. However, this test is not applicable in elephants. The interferon gamma (IFN-γ) assay is considered a good alternative for the skin test in general, validated for use in cattle and humans. This study was aimed at development of an IFN-γ assay applicable for diagnosis of tuberculosis in elephants. Recombinant elephant IFN-γ (rEpIFN-γ) produced in eukaryotic cells was used to immunize mice and generate the monoclonal antibodies. Hybridomas were screened for IFN-γ-specific monoclonal antibody production and subcloned, and antibodies were isotyped and affinity purified. Western blot confirmed recognition of the rEpIFN-γ. The optimal combination of capture and detection antibodies selected was able to detect rEpIFN-γ in concentrations as low as 1 pg/ml. The assay was shown to be able to detect the native elephant IFN-γ, elicited in positive-control cultures (pokeweed mitogen (PWM), phorbol myristate acetate plus ionomycin (PMA/I)) of both Asian and African elephant whole-blood cultures (WBC). Preliminary data were generated using WBC from non-infected elephants, a M. tb infection-suspected elephant and a culture-confirmed M. tb-infected elephant. The latter showed measurable production of IFN-γ after stimulation with ESAT6/CFP10 PPDB and PPDA in concentration ranges as elicited in WBC by Mycobacterium tuberculosis complex (MTBC)-specific antigens in other species. Hence, the IFN-γ assay presented potential as a diagnostic tool for the

[Fish interferon response and its molecular regulation: a review].

PubMed

Zhang, Yibing; Gui, Jianfang

2011-05-01

Interferon response is the first line of host defense against virus infection. Recent years have witnessed tremendous progress in understanding of fish innate response to virus infection, especially in fish interferon antiviral response. A line of fish genes involved in interferon antiviral response have been identified and functional studies further reveal that fish possess an IFN antiviral system similar to mammals. However, fish virus-induced interferon genes contain introns similar to mammalian type III interferon genes although they encode proteins similar to type I interferons, which makes it hard to understand the evolution of vertebrate interferon genes directly resulting in a debate on nomenclature of fish interferon genes. Actually, fish display some unique mechanisms underlying interferon antiviral response. This review documents the recent progress on fish interferon response and its molecular mechanism.

Semiquantitative Analysis Using Thallium-201 SPECT for Differential Diagnosis Between Tumor Recurrence and Radiation Necrosis After Gamma Knife Surgery for Malignant Brain Tumors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsunaga, Shigeo, E-mail: shigeo-m@mui.biglobe.ne.jp; Shuto, Takashi; Takase, Hajime

Purpose: Semiquantitative analysis of thallium-201 chloride single photon emission computed tomography ({sup 201}Tl SPECT) was evaluated for the discrimination between recurrent brain tumor and delayed radiation necrosis after gamma knife surgery (GKS) for metastatic brain tumors and high-grade gliomas. Methods and Materials: The medical records were reviewed of 75 patients, including 48 patients with metastatic brain tumor and 27 patients with high-grade glioma who underwent GKS in our institution, and had suspected tumor recurrence or radiation necrosis on follow-up neuroimaging and deteriorating clinical status after GKS. Analysis of {sup 201}Tl SPECT data used the early ratio (ER) and the delayedmore » ratio (DR) calculated as tumor/normal average counts on the early and delayed images, and the retention index (RI) as the ratio of DR to ER. Results: A total of 107 tumors were analyzed with {sup 201}Tl SPECT. Nineteen lesions were removed surgically and histological diagnoses established, and the other lesions were evaluated with follow-up clinical and neuroimaging examinations after GKS. The final diagnosis was considered to be recurrent tumor in 65 lesions and radiation necrosis in 42 lesions. Semiquantitative analysis demonstrated significant differences in DR (P=.002) and RI (P<.0001), but not in ER (P=.372), between the tumor recurrence and radiation necrosis groups, and no significant differences between metastatic brain tumors and high-grade gliomas in all indices (P=.926 for ER, P=.263 for DR, and P=.826 for RI). Receiver operating characteristics analysis indicated that RI was the most informative index with the optimum threshold of 0.775, which provided 82.8% sensitivity, 83.7% specificity, and 82.8% accuracy. Conclusions: Semiquantitative analysis of {sup 201}Tl SPECT provides useful information for the differentiation between tumor recurrence and radiation necrosis in metastatic brain tumors and high-grade gliomas after GKS, and the RI may be the

Effects of isolation on interferon production and hematological and immunological parameters

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Measel, J.; Loken, M. R.; Degioanni, J.; Follini, S.; Galvagno, A.; Montalbini, M.

1992-01-01

A 27-year-old woman was maintained in an isolated state for 131 days in Carlsbad Caverns, New Mexico. Her diet was vitamin D-depleted. Determinations on the effects of such isolation on levels and activities of peripheral blood cells that are important for hematological homeostasis and immunological function were carried out. Throughout the duration of the study, the percentage of lymphoid cells that expressed CD3, CD4, CD8, CD19, Leu 8, and other markers remained relatively constant although the absolute numbers of these cells varied. Although the percentage of natural killer (NK) cells did not vary, the activity of these cells did change. NK cell activity became elevated as the isolation study progressed. Production of interferon-gamma (IFN-gamma) in response to mitogen stimulation was higher than expected throughout the isolation periods, but returned to the normal range after termination of the isolation. Red and white cell counts dropped significantly upon entering isolation, but soon returned to normal.

Radiation-Induced Chromosomal Aberrations and Immunotherapy: Micronuclei, Cytosolic DNA, and Interferon-Production Pathway.

PubMed

Durante, Marco; Formenti, Silvia C

2018-01-01

Radiation-induced chromosomal aberrations represent an early marker of late effects, including cell killing and transformation. The measurement of cytogenetic damage in tissues, generally in blood lymphocytes, from patients treated with radiotherapy has been studied for many years to predict individual sensitivity and late morbidity. Acentric fragments are lost during mitosis and create micronuclei (MN), which are well correlated to cell killing. Immunotherapy is rapidly becoming a most promising new strategy for metastatic tumors, and combination with radiotherapy is explored in several pre-clinical studies and clinical trials. Recent evidence has shown that the presence of cytosolic DNA activates immune response via the cyclic GMP-AMP synthase/stimulator of interferon genes pathway, which induces type I interferon transcription. Cytosolic DNA can be found after exposure to ionizing radiation either as MN or as small fragments leaking through nuclear envelope ruptures. The study of the dependence of cytosolic DNA and MN on dose and radiation quality can guide the optimal combination of radiotherapy and immunotherapy. The role of densely ionizing charged particles is under active investigation to define their impact on the activation of the interferon pathway.

Long-term outcome of gamma knife radiosurgery for metastatic brain tumors originating from lung cancer

PubMed Central

Bir, Shyamal C.; Ambekar, Sudheer; Bollam, Papireddy; Nanda, Anil

2014-01-01

Background: Gamma knife radiosurgery (GKRS) has emerged as an important treatment option for metastasis brain tumors (MBTs). However, the long-term outcome of GKRS on MBTs originating from lung carcinoma is not well understood. The treatment of MBTs derived from lung cancer with GKRS at our institution is reviewed. Methods: We performed a retrospective review (2000-2013) of 173 patients with MBTs from lung cancer who received GKRS. Out of 173 patients, 38 patients had recurrent tumors after microsurgical resection and whole brain radiotherapy (WBT). Results: GKRS in MBTs metastasized from lung carcinoma showed significant variations in tumor growth control (decreased in 79 [45.7%] patients, arrested growth in 54 [31.2%] patients, and increased tumor size in 40 [23.1%] patients). The median survival in the study population was 14 months. Overall survival after 3 years was 25%, whereas progression-free survival after 3 years was 45%. The predictive factors for improving survival in the patients with MBTs were recursive partitioning analysis (RPA) class I (P = 0.005), absence of hydrocephalus (P = 0.001), Karnofsky performance scale (KPS) >70 (P = 0.007), age ≤65 (P = 0.041), tumor size ≤3 cm (P = 0.023), controlled primary tumor (P = 0.049), and single number of MBTS (P = 0.044). Conclusion: Long-term follow-up revealed that GKRS offers a high rate of tumor control and good overall survival period in both new and recurrent patients with MBTs originating from lung carcinoma. Thus, GKRS is an effective treatment option for new patients with MBTs from lung cancer, as well as an adjuvant therapy in patients with recurrent MBTs derived from lung cancer. PMID:25289169

Relative biologic effectiveness in terms of tumor response of {sup 125}I implants compared with {sup 60}Co gamma rays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lehnert, Shirley; Reniers, Brigitte; Verhaegen, Frank

2005-09-01

Purpose: To measure the relative biologic effectiveness (RBE) for {sup 125}I seeds compared with external beam radiotherapy using a clinically relevant in vivo system. Methods and Materials: Photon emission from a detailed source model was simulated using the Monte Carlo code MCNP4C, sampling from a {sup 125}I spectrum. The mouse RIF-1 tumor was treated with either temporary implant of an {sup 125}I seed or with {sup 60}Co gamma rays. The tumors were always the same size at the initiation of treatment, and the endpoint was growth inhibition. Results: The dose-response curve for both modalities was close to linear and wasmore » independent of the initial {sup 125}I activity (dose rate) for the range investigated. Calculation of the RBE for tumor response requires assigning a unique value for the tumor dose that is not homogenous but depends on the distance from the {sup 125}I source. Because tumor regrowth will depend on the subpopulation of cells that have the greatest probability of survival (i.e., those at the greatest distance from the {sup 125}I source), one approach is to use the dose to this population. On this basis, the RBE for {sup 125}I compared with {sup 60}Co gamma rays is 1.5. If the {sup 125}I dose is computed as the average dose to the tumor, corrected for the dose that is wasted as overkill in the cell population closest to the center of the {sup 125}I seed, the RBE is 1.4. Conclusion: The result, an RBE of 1.4-1.5 is similar to findings obtained by other methods, supporting the validity of this approach to derive an RBE with validity in a clinical context.« less

Role of β-Interferon Inducer (DEAE-Dextran) in Tumorigenesis by VEGF and NOTCH1 Inhibition along with Apoptosis Induction.

PubMed

Bakrania, Anita K; Variya, Bhavesh C; Patel, Snehal S

2017-01-01

As a novel target for breast cancer, interferon inducers have found its role as anti-angiogenic agents with diethylaminoethyl dextran (DEAE-Dextran) being a molecule used for centuries as a transfection agent. Our results herein offer an explanation for the emergence of DEAE-Dextran as an anti-tumor agent for TNBC with in-depth mechanistic approach as an anti-angiogenic molecule. DEAE-Dextran has found to possess cytotoxic activity demonstrated during the various in vitro cytotoxicity assays; moreover, as an anti-oxidant, DEAE-Dextran has shown to possess excellent reactive oxygen species scavenging activity. The interferon inducing capacity of DEAE-Dextran was determined qualitatively as well as quantitatively specifically demonstrating overexpression of β-interferon. As a measure of anti-proliferative activity, DEAE-Dextran exhibited reduced ki67, p53, and PCNA levels. Also, overexpression of CK5/6 and p63 in DEAE-Dextran treated animals indicated improvement in breast cell morphology along with an improvement in cell-cell adhesion by virtue of upregulation of β-catenin and E-cadherin. Anti-angiogenic property of DEAE-Dextran was concluded by the downregulation of CD31, VEGF, and NOTCH1 both in vivo and in vitro . Further, apoptosis due to DEAE-Dextran, initially determined by downregulation of Bcl2, was confirmed with flow cytometry. Overall, results are defensive of DEAE-Dextran as an emerging anti-tumor agent with mechanisms pertaining to β-interferon induction with probable VEGF and NOTCH1 inhibition as well as apoptosis which still needs to be studied in further depth.

Role of β-Interferon Inducer (DEAE-Dextran) in Tumorigenesis by VEGF and NOTCH1 Inhibition along with Apoptosis Induction

PubMed Central

Bakrania, Anita K.; Variya, Bhavesh C.; Patel, Snehal S.

2017-01-01

As a novel target for breast cancer, interferon inducers have found its role as anti-angiogenic agents with diethylaminoethyl dextran (DEAE-Dextran) being a molecule used for centuries as a transfection agent. Our results herein offer an explanation for the emergence of DEAE-Dextran as an anti-tumor agent for TNBC with in-depth mechanistic approach as an anti-angiogenic molecule. DEAE-Dextran has found to possess cytotoxic activity demonstrated during the various in vitro cytotoxicity assays; moreover, as an anti-oxidant, DEAE-Dextran has shown to possess excellent reactive oxygen species scavenging activity. The interferon inducing capacity of DEAE-Dextran was determined qualitatively as well as quantitatively specifically demonstrating overexpression of β-interferon. As a measure of anti-proliferative activity, DEAE-Dextran exhibited reduced ki67, p53, and PCNA levels. Also, overexpression of CK5/6 and p63 in DEAE-Dextran treated animals indicated improvement in breast cell morphology along with an improvement in cell–cell adhesion by virtue of upregulation of β-catenin and E-cadherin. Anti-angiogenic property of DEAE-Dextran was concluded by the downregulation of CD31, VEGF, and NOTCH1 both in vivo and in vitro. Further, apoptosis due to DEAE-Dextran, initially determined by downregulation of Bcl2, was confirmed with flow cytometry. Overall, results are defensive of DEAE-Dextran as an emerging anti-tumor agent with mechanisms pertaining to β-interferon induction with probable VEGF and NOTCH1 inhibition as well as apoptosis which still needs to be studied in further depth. PMID:29311933

Controlling nuclear JAKs and STATs for specific gene activation by IFN{gamma}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea

2011-07-08

Highlights: {yields} Gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interact with the promoter region of IFN{gamma}-associated genes along with transcription factor STAT1{alpha}. {yields} We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. {yields} The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interacted with the promoter region of IFN{gamma}-activated genes along with transcription factor STAT1{alpha}. Recent studies have suggested that activated Janus kinases pJAK2 andmore » pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFN{gamma}. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFN{gamma} treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The {beta}-actin gene, which is not activated by IFN{gamma}, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFN{gamma} treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFN{gamma} treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFN{gamma

Microgravity

NASA Image and Video Library

1989-02-03

(PCG) Protein Crystal Growth Gamma-Interferon. Stimulates the body's immune system and is used clinically in the treatment of cancer. Potential as an anti-tumor agent against solid tumors as well as leukemia's and lymphomas. It has additional utility as an anti-ineffective agent, including antiviral, anti-bacterial, and anti-parasitic activities. Principal Investigator on STS-26 was Charles Bugg.

Combination alpha-interferon and lamivudine therapy for alpha-interferon-resistant chronic hepatitis B infection: results of a pilot study.

PubMed

Mutimer, D; Naoumov, N; Honkoop, P; Marinos, G; Ahmed, M; de Man, R; McPhillips, P; Johnson, M; Williams, R; Elias, E; Schalm, S

1998-06-01

Alpha-interferon achieves seroconversion in about one third of naive patients. Attempts to achieve seroconversion in patients who have previously failed alpha-interferon have proved disappointing. Combination chemotherapy (alpha-interferon with a nucleoside analogue) might provide a treatment alternative for these patients. We have undertaken a phase 2 study in 20 patients who had previously failed at least one course of alpha-interferon. The study was designed to assess the safety, tolerability and efficacy of the combination. All patients were treated for 16 weeks with alpha-interferon in combination with 12 or 16 weeks of Lamivudine (3'TC). Patients were followed for 16 weeks post-treatment. Pharmacokinetic studies were performed to identify/exclude significant pharmacokinetic drug interaction. The combination was well tolerated, and side-effects of the combination were indistinguishable from the recognised side-effects of alpha-interferon. Pharmacokinetic studies performed on days 1 and 29 did not show any significant interaction. All patients achieved HBV DNA clearance during treatment, but 19 relapsed at the end of treatment. HBeAg/anti-HBe seroconversion was observed for four patients, but was sustained for a single patient (who also had sustained DNA clearance). Combination therapy with alpha-interferon and lamivudine given for 16 weeks appears safe and is well tolerated. However, for this group of patients who had previously failed interferon monotherapy, the efficacy of combination interferon/lamivudine therapy appears disappointing, and other treatment strategies should be investigated.

One-step synthesis of gene carrier via gamma irradiation and its application in tumor gene therapy

PubMed Central

Kim, Eun-Ji; Heo, Hun; Park, Jong-Seok; Gwon, Hui-Jeong; Lim, Youn-Mook; Jang, Mi-Kyeong

2018-01-01

Introduction Although numerous studies have been conducted with the aim of developing drug-delivery systems, chemically synthesized gene carriers have shown limited applications in the biomedical fields due to several problems, such as low-grafting yields, undesirable reactions, difficulties in controlling the reactions, and high-cost production owing to multi-step manufacturing processes. Materials and methods We developed a 1-step synthesis process to produce 2-aminoethyl methacrylate-grafted water-soluble chitosan (AEMA-g-WSC) as a gene carrier, using gamma irradiation for simultaneous synthesis and sterilization, but no catalysts or photoinitiators. We analyzed the AEMA graft site on WSC using 2-dimensional nuclear magnetic resonance spectroscopy (2D NMR; 1H and 13C NMR), and assayed gene transfection effects in vitro and in vivo. Results We revealed selective grafting of AEMA onto C6-OH groups of WSC. AEMA-g-WSC effectively condensed plasmid DNA to form polyplexes in the size range of 170 to 282 nm. AEMA-g-WSC polyplexes in combination with psi-hBCL2 (a vector expressing short hairpin RNA against BCL2 mRNA) inhibited tumor cell proliferation and tumor growth in vitro and in vivo, respectively, by inducing apoptosis. Conclusion The simple grafting process mediated via gamma irradiation is a promising method for synthesizing gene carriers. PMID:29416333

Interferon gamma peptidomimetic targeted to hepatic stellate cells ameliorates acute and chronic liver fibrosis in vivo.

PubMed

Bansal, Ruchi; Prakash, Jai; De Ruiter, Marieke; Poelstra, Klaas

2014-04-10

Hepatic stellate cells play a crucial role in the pathogenesis of hepatic fibrosis. Thus, pharmacological inhibition of pro-fibrotic activities of these cells might lead to an effective therapy for this disease. Among the potent anti-fibrotics, interferon gamma (IFNγ), a proinflammatory cytokine, is highly efficacious but it failed in clinical trials due to the poor efficacy and multiple adverse effects attributed to the ubiquitous IFNγ receptor (IFNγR) expression. To resolve these drawbacks, we chemically synthesized a chimeric molecule containing (a) IFNγ signaling peptide (IFNγ peptidomimetic, mimγ) that retains the agonistic activities of IFNγ but lacks an extracellular receptor recognition sequence for IFNγR; coupled via heterobifunctional PEG linker to (b) bicyclic platelet derived growth factor beta receptor (PDGFβR)-binding peptide (BiPPB) to induce internalization into the stellate cells that express PDGFβR. The synthesized targeted IFNγ peptidomimetic (mimγ-BiPPB) was extensively investigated for its anti-fibrotic and adverse effects in acute and chronic CCl4-induced liver fibrosis models in mice. Treatment with mimγ-BiPPB, after the onset of disease, markedly inhibited both early and established hepatic fibrosis as reflected by a reduced intrahepatic α-SMA, desmin and collagen-I mRNA expression and protein levels. While untargeted mimγ and BiPPB had no effect, and native IFNγ only induced a moderate reduction. Additionally, no off-target effects, e.g. systemic inflammation, were found with mimγ-BiPPB, which were substantially observed in mice treated with native IFNγ. The present study highlights the beneficial effects of a novel BiPPB mediated cell-specific targeting of IFNγ peptidomimetic to the disease-inducing cells and therefore represents a highly potential therapeutic approach to treat fibrotic diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

IFN-gamma synergizes with LPS to induce nitric oxide biosynthesis through glycogen synthase kinase-3-inhibited IL-10.

PubMed

Lin, Chiou-Feng; Tsai, Cheng-Chieh; Huang, Wei-Ching; Wang, Chi-Yun; Tseng, Hsiang-Chi; Wang, Yi; Kai, Jui-In; Wang, Szu-Wen; Cheng, Yi-Lin

2008-10-15

Interferon-gamma (IFN-gamma) plays a crucial role in innate immunity and inflammation. It causes the synergistic effect on endotoxin lipopolysaccharide (LPS)-stimulated inducible nitric oxide synthase (iNOS)/NO biosynthesis; however, the mechanism remains unclear. In the present study, we investigated the effects of glycogen synthase kinase-3 (GSK-3)-mediated inhibition of anti-inflammatory interleukin-10 (IL-10). We found, in LPS-stimulated macrophages, that IFN-gamma increased iNOS expression and NO production in a time-dependent manner. In addition, ELISA analysis showed the upregulation of tumor necrosis factor-alpha and regulated on activation, normal T expressed and secreted, and the downregulation of IL-10. RT-PCR further showed changes in the IL-10 mRNA level as well. Treating cells with recombinant IL-10 showed a decrease in IFN-gamma/LPS-induced iNOS/NO biosynthesis, whereas anti-IL-10 neutralizing antibodies enhanced this effect, suggesting that IL-10 acts in an anti-inflammatory role. GSK-3-inhibitor treatment blocked IFN-gamma/LPS-induced iNOS/NO biosynthesis but upregulated IL-10 production. Inhibiting GSK-3 using short-interference RNA showed similar results. Additionally, treating cells with anti-IL-10 neutralizing antibodies blocked these effects. We further showed that inhibiting GSK-3 increased phosphorylation of transcription factor cyclic AMP response element binding protein. Inhibiting protein tyrosine kinase Pyk2, an upstream regulator of GSK-3beta, caused inhibition on IFN-gamma/LPS-induced GSK-3beta phosphorylation at tyrosine 216 and iNOS/NO biosynthesis. Taken together, these findings reveal the involvement of GSK-3-inhibited IL-10 on the induction of iNOS/NO biosynthesis by IFN-gamma synergized with LPS. (c) 2008 Wiley-Liss, Inc.

Dynamic Changes in Pro- and Anti-Inflammatory Cytokine Profiles and Gamma Interferon Receptor Signaling Integrity Correlate with Tuberculosis Disease Activity and Response to Curative Treatment▿

PubMed Central

Sahiratmadja, Edhyana; Alisjahbana, Bachti; de Boer, Tjitske; Adnan, Iskandar; Maya, Anugrah; Danusantoso, Halim; Nelwan, Ronald H. H.; Marzuki, Sangkot; van der Meer, Jos W. M.; van Crevel, Reinout; van de Vosse, Esther; Ottenhoff, Tom H. M.

2007-01-01

Pro- and anti-inflammatory cytokines and their signaling pathways play key roles in protection from and pathogenesis of mycobacterial infection, and their balance and dynamic changes may control or predict clinical outcome. Peripheral blood cells' capacity to produce proinflammatory (tumor necrosis factor alpha [TNF-α], interleukin-12/23p40 [IL-12/23p40], and gamma interferon [IFN-γ]) and anti-inflammatory (IL-10) cytokines in response to Mycobacterium tuberculosis or unrelated stimuli (lipopolysaccharide, phytohemagglutinin) was studied in 93 pulmonary tuberculosis (TB) patients and 127 healthy controls from Indonesia. Their cells' ability to respond to IFN-γ was examined to investigate whether M. tuberculosis infection can also inhibit IFN-γ receptor (IFN-γR) signaling. Although there was interindividual variability in the observed responses, the overall results revealed that M. tuberculosis-induced TNF-α and IFN-γ levels showed opposite trends. Whereas TNF-α production was higher in active-TB patients than in controls, IFN-γ production was strongly depressed during active TB, correlated inversely with TB disease severity, and increased during therapy. By contrast, mitogen-induced IFN-γ production, although lower in patients than in controls, did not change during treatment, suggesting an M. tuberculosis-specific and reversible component in the depression of IFN-γ. Depressed IFN-γ production was not due to decreased IL-12/IL-23 production. Importantly, IFN-γ-inducible responses were also significantly depressed during active TB and normalized during treatment, revealing disease activity-related and reversible impairment in IFN-γR signaling in TB. Finally, IFN-γ/IL-10 ratios significantly correlated with TB cure. Taken together, these results show that M. tuberculosis-specific stimulation of IFN-γ (but not TNF-α) production and IFN-γR signaling are significantly depressed in active TB, correlate with TB disease severity and activity, and

Ginsenoside Rc from Panax ginseng exerts anti-inflammatory activity by targeting TANK-binding kinase 1/interferon regulatory factor-3 and p38/ATF-2.

PubMed

Yu, Tao; Yang, Yanyan; Kwak, Yi-Seong; Song, Gwan Gyu; Kim, Mi-Yeon; Rhee, Man Hee; Cho, Jae Youl

2017-04-01

Ginsenoside Rc (G-Rc) is one of the major protopanaxadiol-type saponins isolated from Panax ginseng , a well-known medicinal herb with many beneficial properties including anticancer, anti-inflammatory, antiobesity, and antidiabetic effects. In this study, we investigated the effects of G-Rc on inflammatory responses in vitro and examined the mechanisms of these effects. The in vitro inflammation system used lipopolysaccharide-treated macrophages, tumor necrosis factor-α/interferon-γ-treated synovial cells, and HEK293 cells transfected with various inducers of inflammation. G-Rc significantly inhibited the expression of macrophage-derived cytokines, such as tumor necrosis factor-α and interleukin-1β. G-Rc also markedly suppressed the activation of TANK-binding kinase 1/IκB kinase ε/interferon regulatory factor-3 and p38/ATF-2 signaling in activated RAW264.7 macrophages, human synovial cells, and HEK293 cells. G-Rc exerts its anti-inflammatory actions by suppressing TANK-binding kinase 1/IκB kinase ε/interferon regulatory factor-3 and p38/ATF-2 signaling.

Effects of type I/type II interferons and transforming growth factor-beta on B-cell differentiation and proliferation. Definition of costimulation and cytokine requirements for immunoglobulin synthesis and expression.

PubMed

Estes, D M; Tuo, W; Brown, W C; Goin, J

1998-12-01

In this report, we sought to determine the role of selected type I interferons [interferon-alpha (IFN-alpha) and interferon-tau (IFN-tau)], IFN-gamma and transforming growth factor-beta (TGF-beta) in the regulation of bovine antibody responses. B cells were stimulated via CD40 in the presence or absence of B-cell receptor (BCR) cross-linking. IFN-alpha enhanced IgM, IgG2 and IgA responses but did not enhance IgG1 responses. BCR signalling alone was more effective at inducing IgG2 responses with IFN-alpha than dual cross-linking with CD40. Recombinant ovine IFN-tau was less effective at inducing IgG2 responses when compared with IFN-alpha, though IgA responses were similar in magnitude following BCR cross-linking. At higher concentrations, IFN-tau enhanced IgA responses greater than twofold over the levels observed with IFN-alpha. Previous studies have shown that addition of IFN-gamma to BCR or pokeweed mitogen-activated bovine B cells stimulates IgG2 production. However, following CD40 stimulation alone, IFN-gamma was relatively ineffective at stimulating high-rate synthesis of any non-IgM isotype. Dual cross-linking via CD40 and the BCR resulted in decreased synthesis of IgM with a concomitant increase in IgA and similar levels of IgG2 production to those obtained via the BCR alone. We also assessed the effects of endogenous and exogenous TGF-beta on immunoglobulin synthesis by bovine B cells. Exogenous TGF-beta stimulates both IgG2 and IgA production following CD40 and BCR cross-linking in the presence of IL-2. Blocking endogenous TGF-beta did not inhibit the up-regulation of IgG2 or IgA by interferons.

A Multiprotein Binding Interface in an Intrinsically Disordered Region of the Tumor Suppressor Protein Interferon Regulatory Factor-1*

PubMed Central

Narayan, Vikram; Halada, Petr; Hernychová, Lenka; Chong, Yuh Ping; Žáková, Jitka; Hupp, Ted R.; Vojtesek, Borivoj; Ball, Kathryn L.

2011-01-01

The interferon-regulated transcription factor and tumor suppressor protein IRF-1 is predicted to be largely disordered outside of the DNA-binding domain. One of the advantages of intrinsically disordered protein domains is thought to be their ability to take part in multiple, specific but low affinity protein interactions; however, relatively few IRF-1-interacting proteins have been described. The recent identification of a functional binding interface for the E3-ubiquitin ligase CHIP within the major disordered domain of IRF-1 led us to ask whether this region might be employed more widely by regulators of IRF-1 function. Here we describe the use of peptide aptamer-based affinity chromatography coupled with mass spectrometry to define a multiprotein binding interface on IRF-1 (Mf2 domain; amino acids 106–140) and to identify Mf2-binding proteins from A375 cells. Based on their function as known transcriptional regulators, a selection of the Mf2 domain-binding proteins (NPM1, TRIM28, and YB-1) have been validated using in vitro and cell-based assays. Interestingly, although NPM1, TRIM28, and YB-1 all bind to the Mf2 domain, they have differing amino acid specificities, demonstrating the degree of combinatorial diversity and specificity available through linear interaction motifs. PMID:21245151

A multiprotein binding interface in an intrinsically disordered region of the tumor suppressor protein interferon regulatory factor-1.

PubMed

Narayan, Vikram; Halada, Petr; Hernychová, Lenka; Chong, Yuh Ping; Žáková, Jitka; Hupp, Ted R; Vojtesek, Borivoj; Ball, Kathryn L

2011-04-22

The interferon-regulated transcription factor and tumor suppressor protein IRF-1 is predicted to be largely disordered outside of the DNA-binding domain. One of the advantages of intrinsically disordered protein domains is thought to be their ability to take part in multiple, specific but low affinity protein interactions; however, relatively few IRF-1-interacting proteins have been described. The recent identification of a functional binding interface for the E3-ubiquitin ligase CHIP within the major disordered domain of IRF-1 led us to ask whether this region might be employed more widely by regulators of IRF-1 function. Here we describe the use of peptide aptamer-based affinity chromatography coupled with mass spectrometry to define a multiprotein binding interface on IRF-1 (Mf2 domain; amino acids 106-140) and to identify Mf2-binding proteins from A375 cells. Based on their function as known transcriptional regulators, a selection of the Mf2 domain-binding proteins (NPM1, TRIM28, and YB-1) have been validated using in vitro and cell-based assays. Interestingly, although NPM1, TRIM28, and YB-1 all bind to the Mf2 domain, they have differing amino acid specificities, demonstrating the degree of combinatorial diversity and specificity available through linear interaction motifs.

Increased expression of IRF8 in tumor cells inhibits the generation of Th17 cells and predicts unfavorable survival of diffuse large B cell lymphoma patients.

PubMed

Zhong, Weijie; Xu, Xin; Zhu, Zhigang; Du, Qinghua; Du, Hong; Yang, Li; Ling, Yanying; Xiong, Huabao; Li, Qingshan

2017-07-25

The immunological pathogenesis of diffuse large B cell lymphoma (DLBCL) remains elusive. Searching for new prognostic markers of DLBCL is a crucial focal point for clinical scientists. The aim of the present study was to examine the prognostic value of interferon regulatory factor 8 (IRF8) expression and its effect on the development of Th17 cells in the tumor microenvironment of DLBCL patients. Flow cytometry, immunohistochemistry, and quantitative real-time PCR were used to detect the distribution of Th17 cells and related cytokines and IRF8 in tumor tissues from DLBCL patients. Two DLBCL cell lines (OCI-LY10 and OCI-LY1) with IRF8 knockdown or overexpression and two human B lymphoblast cell lines were co-cultured with peripheral blood mononuclear cells (PBMCs) in vitro to determine the effect of IRF8 on the generation of Th17 cells. Quantitative real-time PCR and Western blotting were used to investigate the involvement of retinoic acid receptor-related orphan receptor gamma t (RORγt) in the effect of IRF8 on Th17 cell generation. The survival of 67 DLBCL patients was estimated using the Kaplan-Meier method and log-rank analysis. The percentage of Th17 cells was lower in DLBCL tumor tissues than in PBMCs and corresponding adjacent benign tissues. Relative expression of interleukin (IL)-17A was lower, whereas that of interferon (IFN)-γ was higher in tumor tissues than in benign tissues. Co-culture with DLBCL cell lines inhibited the generation of Th17 cells in vitro. IRF8 upregulation was detected in DLBCL tumor tissues, and it was associated with decreased DLBCL patient survival. Investigation of the underlying mechanism suggested that IRF8 upregulation in DLBCL, through an unknown mechanism, inhibited Th17 cell generation by suppressing RORγt in neighboring CD4+ T cells. Tumor cells may express soluble or membrane-bound factors that inhibit the expression of RORγt in T cells within the tumor microenvironment. Our findings suggest that IRF8 expression could

[The expression of interferon-lambda1 in CHO cell].

PubMed

Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu

2013-06-01

To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.

Risk of tuberculosis among air passengers estimated by interferon gamma release assay: survey of contact investigations, Japan, 2012 to 2015

PubMed Central

Ota, Masaki; Kato, Seiya

2017-01-01

Although the World Health Organization recommends contact investigations around air travel-associated sputum smear-positive tuberculosis (TB) patients, evidence suggests that the information thus obtained may have overestimated the risk of TB infection because it involved some contacts born in countries with high TB burden who were likely to have been infected with TB in the past, or because tuberculin skin tests were used, which are less specific than the interferon gamma release assay (IGRA) particularly in areas where Bacillus Calmette-Guérin (BCG) vaccination coverage is high. We conducted a questionnaire survey on air travel-associated TB contact investigations in local health offices of Japan from 2012 to 2015, focusing on IGRA positivity. Among 651 air travel-associated TB contacts, average positivity was 3.8% (95% confidence interval (CI): 2.5–5.6) with a statistically significant increasing trend with older age (p < 0.0094). Positivity among 0–34 year-old contacts was 1.0% (95% CI: 0.12–3.5%), suggesting their risk of TB infection is as small as among Japanese young adults with low risk of TB infection (positivity: 0.85–0.90%). Limiting the contact investigation to fewer passengers (within two seats surrounding the index case, rather than two rows) seems reasonable in the case of aircraft with many seats per row. PMID:28367799

Natural killer cells promote tissue injury and systemic inflammatory responses during fatal Ehrlichia-induced toxic shock-like syndrome.

PubMed

Stevenson, Heather L; Estes, Mark D; Thirumalapura, Nagaraja R; Walker, David H; Ismail, Nahed

2010-08-01

Human monocytotropic ehrlichiosis is caused by Ehrlichia chaffeensis, a Gram-negative bacterium lacking lipopolysaccharide. We have shown that fatal murine ehrlichiosis is associated with CD8(+)T cell-mediated tissue damage, tumor necrosis factor-alpha, and interleukin (IL)-10 overproduction, and CD4(+)Th1 hyporesponsiveness. In this study, we examined the relative contributions of natural killer (NK) and NKT cells in Ehrlichia-induced toxic shock. Lethal ehrlichial infection in wild-type mice induced a decline in NKT cell numbers, and late expansion and migration of activated NK cells to the liver, a main infection site that coincided with development of hepatic injury. The spatial and temporal changes in NK and NKT cells in lethally infected mice correlated with higher NK cell cytotoxic activity, higher expression of cytotoxic molecules such as granzyme B, higher production of interferon-gamma and tumor necrosis factor-alpha, increased hepatic infiltration with CD8alphaCD11c(+) dendritic cells and CD8(+)T cells, decreased splenic CD4(+)T cells, increased serum concentrations of IL-12p40, IL-18, RANTES, and monocyte chemotactic protein-1, and elevated production of IL-18 by liver mononuclear cells compared with nonlethally infected mice. Depletion of NK cells prevented development of severe liver injury, decreased serum levels of interferon-gamma, tumor necrosis factor-alpha, and IL-10, and enhanced bacterial elimination. These data indicate that NK cells promote immunopathology and defective anti-ehrlichial immunity, possibly via decreasing the protective immune response mediated by interferon-gamma producing CD4(+)Th1 and NKT cells.

A medical oncologist's approach to immunotherapy for advanced renal tumors: is nephrectomy indicated?

PubMed

Cooney, Matthew M; Remick, Scot C; Vogelzang, Nicholas J

2004-02-01

Metastatic renal cell carcinoma is highly resistant to systemic therapy. Although interleukin-2 and interferon remain the most active agents for this disease, long-term survival rates remain poor. Two phase 3 trials, European Organization Research and Treatment of Cancer 30947 and Southwest Oncology Group 8949, have demonstrated a survival benefit of nephrectomy followed by interferon versus interferon alone in patients having an excellent performance status (PS 0 and 1). Removal of the primary tumor followed by interferon is not recommended for patients with a moderate or poor PS (PS 2-4). Even with this aggressive approach, most patients eventually will die from their kidney cancer; therefore, every patient with metastatic disease should be considered for enrollment into clinical trials.

Analyzing the Utilization of Interferon-Gamma Screening for Tuberculosis at Recruit Training Command, Great Lakes

DTIC Science & Technology

2006-05-31

the project through a business case analysis conducted on this same subject. CAPT Monestersky, Preventive Medicine; LCDR Jacobs, Occupational Medicine...TB and LTBI (Taylor, Nolan, & Blumberg , Interferon-y screening for TB 8 2005). They are based on science founded in the 1 9 th century. The current...identify individuals who may not be suitable for service. For the majority who are suitable, the "P" days allow time to complete necessary business

Intracystic interferon-alpha in pediatric craniopharyngioma patients: an international multicenter assessment on behalf of SIOPE and ISPN.

PubMed

Kilday, John-Paul; Caldarelli, Massimo; Massimi, Luca; Chen, Robert Hsin-Hung; Lee, Yi Yen; Liang, Muh-Lii; Parkes, Jeanette; Naiker, Thuran; van Veelen, Marie-Lise; Michiels, Erna; Mallucci, Conor; Pettorini, Benedetta; Meijer, Lisethe; Dorfer, Christian; Czech, Thomas; Diezi, Manuel; Schouten-van Meeteren, Antoinette Y N; Holm, Stefan; Gustavsson, Bengt; Benesch, Martin; Müller, Hermann L; Hoffmann, Anika; Rutkowski, Stefan; Flitsch, Joerg; Escherich, Gabriele; Grotzer, Michael; Spoudeas, Helen A; Azquikina, Kristian; Capra, Michael; Jiménez-Guerra, Rolando; MacDonald, Patrick; Johnston, Donna L; Dvir, Rina; Constantini, Shlomi; Kuo, Meng-Fai; Yang, Shih-Hung; Bartels, Ute

2017-10-01

Craniopharyngiomas are frequent hypothalamo-pituitary tumors in children, presenting predominantly as cystic lesions. Morbidity from conventional treatment has focused attention on intracystic drug delivery, hypothesized to cause fewer clinical consequences. However, the efficacy of intracystic therapy remains unclear. We report the retrospective experiences of several global centers using intracystic interferon-alpha. European Société Internationale d'Oncologie Pédiatrique and International Society for Pediatric Neurosurgery centers were contacted to submit a datasheet capturing pediatric patients with cystic craniopharyngiomas who had received intracystic interferon-alpha. Patient demographics, administration schedules, adverse events, and outcomes were obtained. Progression was clinical or radiological (cyst reaccumulation, novel cysts, or solid growth). Fifty-six children (median age, 6.3 y) from 21 international centers were identified. Median follow-up from diagnosis was 5.1 years (0.3-17.7 y). Lesions were cystic (n = 22; 39%) or cystic/solid (n = 34; 61%). Previous progression was treated in 43 (77%) patients before interferon use. In such cases, further progression was delayed by intracystic interferon compared with the preceding therapy for cystic lesions (P = 0.0005). Few significant attributable side effects were reported. Progression post interferon occurred in 42 patients (median 14 mo; 0-8 y), while the estimated median time to definitive therapy post interferon was 5.8 (1.8-9.7) years. Intracystic interferon-alpha can delay disease progression and potentially offer a protracted time to definitive surgery or radiotherapy in pediatric cystic craniopharyngioma, yet demonstrates a favorable toxicity profile compared with other therapeutic modalities-important factors for this developing age group. A prospective, randomized international clinical trial assessment is warranted. © The Author(s) 2017. Published by Oxford University Press on behalf of

Beyond Tryptophan Synthase: Identification of Genes That Contribute to Chlamydia trachomatis Survival during Gamma Interferon-Induced Persistence and Reactivation

PubMed Central

Muramatsu, Matthew K.; Brothwell, Julie A.; Stein, Barry D.; Putman, Timothy E.; Rockey, Daniel D.

2016-01-01

Chlamydia trachomatis can enter a viable but nonculturable state in vitro termed persistence. A common feature of C. trachomatis persistence models is that reticulate bodies fail to divide and make few infectious progeny until the persistence-inducing stressor is removed. One model of persistence that has relevance to human disease involves tryptophan limitation mediated by the host enzyme indoleamine 2,3-dioxygenase, which converts l-tryptophan to N-formylkynurenine. Genital C. trachomatis strains can counter tryptophan limitation because they encode a tryptophan-synthesizing enzyme. Tryptophan synthase is the only enzyme that has been confirmed to play a role in interferon gamma (IFN-γ)-induced persistence, although profound changes in chlamydial physiology and gene expression occur in the presence of persistence-inducing stressors. Thus, we screened a population of mutagenized C. trachomatis strains for mutants that failed to reactivate from IFN-γ-induced persistence. Six mutants were identified, and the mutations linked to the persistence phenotype in three of these were successfully mapped. One mutant had a missense mutation in tryptophan synthase; however, this mutant behaved differently from previously described synthase null mutants. Two hypothetical genes of unknown function, ctl0225 and ctl0694, were also identified and may be involved in amino acid transport and DNA damage repair, respectively. Our results indicate that C. trachomatis utilizes functionally diverse genes to mediate survival during and reactivation from persistence in HeLa cells. PMID:27430273

Tumor cell-derived microparticles: a new form of cancer vaccine.

PubMed

Zhang, Huafeng; Huang, Bo

2015-08-01

For cancer vaccines, tumor antigen availability is currently not an issue due to technical advances. However, the generation of optimal immune stimulation during vaccination is challenging. We have recently demonstrated that tumor cell-derived microparticles (MP) can function as a new form of potent cancer vaccine by efficiently activating type I interferon pathway in a cGAS/STING dependent manner.

Essential Cell-Autonomous Role for Interferon (IFN) Regulatory Factor 1 in IFN-γ-Mediated Inhibition of Norovirus Replication in Macrophages

PubMed Central

Maloney, Nicole S.; Thackray, Larissa B.; Goel, Gautam; Hwang, Seungmin; Duan, Erning; Vachharajani, Punit; Xavier, Ramnik

2012-01-01

Noroviruses (NVs) cause the majority of cases of epidemic nonbacterial gastroenteritis worldwide and contribute to endemic enteric disease. However, the molecular mechanisms responsible for immune control of their replication are not completely understood. Here we report that the transcription factor interferon regulatory factor 1 (IRF-1) is required for control of murine NV (MNV) replication and pathogenesis in vivo. This led us to studies documenting a cell-autonomous role for IRF-1 in gamma interferon (IFN-γ)-mediated inhibition of MNV replication in primary macrophages. This role of IRF-1 in the inhibition of MNV replication by IFN-γ is independent of IFN-αβ signaling. While the signal transducer and activator of transcription STAT-1 was also required for IFN-γ-mediated inhibition of MNV replication in vitro, class II transactivator (CIITA), interferon regulatory factor 3 (IRF-3), and interferon regulatory factor 7 (IRF-7) were not required. We therefore hypothesized that there must be a subset of IFN-stimulated genes (ISGs) regulated by IFN-γ in a manner dependent only on STAT-1 and IRF-1. Analysis of transcriptional profiles of macrophages lacking various transcription factors confirmed this hypothesis. These studies identify a key role for IRF-1 in IFN-γ-dependent control of norovirus infection in mice and macrophages. PMID:22973039

Rapid activation of the interferon system in vivo.

PubMed Central

Dianzani, F; Gullino, P; Baron, S

1978-01-01

Experiments were carried out to study the kinetics of local interferon production in the subcutaneous tissues of rats stimulated with Newcastle disease virus. Specifically, the interferon produced and released in the extracellular fluids was collected at various intervals of time in micropore chambers implanted into the subcutaneous tissue of rats. Interferon was detected at moderate titers 1 h after induction, and it was present at high titer at 2 h. The interferon levels remained remarkably high in the samples collected after 3, 5, and 24 h, and in some rats it was still detectable after 48 and 72 h. Since control experiments showed that it requires 2 to 3 h for interferon to penetrate the chambers, it may be concluded that high concentrations of interferon are present in the extracellular fluid within 1 h of induction. The evaluation of the kinetics of production and of the concentrations attained in the extracellular fluid suggests that in a solid tissue a cell infected by a potent interferon inducer may produce interferon early enough and in sufficient quantity to protect neighboring cells before the production of progeny virions. PMID:669799

Anti-tumor immune response correlates with neurological symptoms in a dog with spontaneous astrocytoma treated by gene and vaccine therapy.

PubMed

Pluhar, G Elizabeth; Grogan, Patrick T; Seiler, Charlie; Goulart, Michelle; Santacruz, Karen S; Carlson, Cathy; Chen, Wei; Olin, Mike R; Lowenstein, Pedro R; Castro, Maria G; Haines, Stephen J; Ohlfest, John R

2010-04-26

Gene therapy and vaccination have been tested in malignant glioma patients with modest, albeit encouraging results. The combination of these therapies has demonstrated synergistic efficacy in murine models but has not been reported in large animals. Gemistocytic astrocytoma (GemA) is a low-grade glioma that typically progresses to lethal malignancy despite conventional therapies. Until now there has been no useful animal model of GemA. Here we report the treatment of a dog with spontaneous GemA using the combination of surgery, intracavitary adenoviral interferon gamma (IFNgamma) gene transfer, and vaccination with glioma cell lysates mixed with CpG oligodeoxynucleotides. Surgical tumor debulking and delivery of Ad-IFNgamma into the resection cavity were performed. Autologous tumor cells grew slowly in culture, necessitating vaccination with allogeneic tumor lysate in four of the five vaccinations. Transient left-sided blindness and hemiparesis occurred following the fourth and fifth vaccinations. These neurological symptoms correlated with a peak in the levels of tumor-reactive IgG and CD8(+) T cells measured in the blood. All symptoms resolved and this dog remains tumor-free over 450 days following surgery. This case report preliminarily demonstrates the feasibility of treating dogs with spontaneous glioma using immune-based therapy and warrants further study using this therapeutic approach. Copyright 2010 Elsevier Ltd. All rights reserved.

Human B cells fail to secrete type I interferons upon cytoplasmic DNA exposure.

PubMed

Gram, Anna M; Sun, Chenglong; Landman, Sanne L; Oosenbrug, Timo; Koppejan, Hester J; Kwakkenbos, Mark J; Hoeben, Rob C; Paludan, Søren R; Ressing, Maaike E

2017-11-01

Most cells are believed to be capable of producing type I interferons (IFN I) as part of an innate immune response against, for instance, viral infections. In macrophages, IFN I is potently induced upon cytoplasmic exposure to foreign nucleic acids. Infection of these cells with herpesviruses leads to triggering of the DNA sensors interferon-inducible protein 16 (IFI16) and cyclic GMP-AMP (cGAMP) synthase (cGAS). Thereby, the stimulator of interferon genes (STING) and the downstream molecules TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3) are sequentially activated culminating in IFN I secretion. Human gamma-herpesviruses, such as Epstein-Barr virus (EBV), exploit B cells as a reservoir for persistent infection. In this study, we investigated whether human B cells, similar to macrophages, engage the cytoplasmic DNA sensing pathway to induce an innate immune response. We found that the B cells fail to secrete IFN I upon cytoplasmic DNA exposure, although they express the DNA sensors cGAS and IFI16 and the signaling components TBK1 and IRF3. In primary human B lymphocytes and EBV-negative B cell lines, this deficiency is explained by a lack of detectable levels of the central adaptor protein STING. In contrast, EBV-transformed B cell lines did express STING, yet both these lines as well as STING-reconstituted EBV-negative B cells did not produce IFN I upon dsDNA or cGAMP stimulation. Our combined data show that the cytoplasmic DNA sensing pathway is dysfunctional in human B cells. This exemplifies that certain cell types cannot induce IFN I in response to cytoplasmic DNA exposure providing a potential niche for viral persistence. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

In vivo induction of interferon gamma expression in grey horses with metastatic melanoma resulting from direct injection of plasmid DNA coding for equine interleukin 12.

PubMed

Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K

2011-11-01

Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.

Type I Interferon Receptor Expression in Human Pancreatic and Periampullary Cancer Tissue.

PubMed

Booy, Stephanie; Hofland, Leo J; Waaijers, A Marlijn; Croze, Ed; van Koetsveld, Peter M; de Vogel, Lisette; Biermann, Katharina; van Eijck, Casper H J

2015-01-01

Interferons (IFNs) have several anticancer mechanisms. A number of clinical trials have been conducted regarding adjuvant IFN-α therapy in pancreatic cancer. Type I IFNs exert their effect via the type I IFN receptor (IFNAR-1, IFNAR-2c). The aims of the present study were to determine the type I IFN receptor expression in pancreatic and periampullary cancer tissues and to study its relation with clinicopathological factors. Receptor expression was determined by immunohistochemistry in paraffin-embedded cancer tissue of 47 pancreatic and 54 periampullary cancer patients. The results demonstrated that 91.5% of the pancreatic tumors and 88.9% of the periampullary tumors showed expression of IFNAR-1, of which 23.4% and 13.0% were strongly positive, respectively. Regarding IFNAR-2c expression, 68.1% of the pancreatic tumors and 68.5% of the periampullary tumors were positive, of which 4.3% of the pancreatic tumors and none of the periampullary tumors had a strong expression. No statistically significant associations were found between type I IFN receptor expression and clinicopathological factors or survival. Type I IFN receptors are expressed in pancreatic and periampullary cancer tissues although with great intertumoral and intratumoral variability. A small proportion of both tumors showed a strong expression of the IFNAR-1; only a very small percentage of the pancreatic tumors showed strong expression of the IFNAR-2c.

Effect of homeopathic treatment on gene expression in Copenhagen rat tumor tissues.

PubMed

Thangapazham, Rajesh L; Rajeshkumar, N V; Sharma, Anuj; Warren, Jim; Singh, Anoop K; Ives, John A; Gaddipati, Jaya P; Maheshwari, Radha K; Jonas, Wayne B

2006-12-01

Increasing evidence suggests that the inability to undergo apoptosis is an important factor in the development and progression of prostate cancer. Agents that induce apoptosis may inhibit tumor growth and provide therapeutic benefit. In a recent study, the authors found that certain homeopathic treatments produced anticancer effects in an animal model. In this study, the authors examined the immunomodulating and apoptotic effects of these remedies. The authors investigated the effect of a homeopathic treatment regimen containing Conium maculatum, Sabal serrulata, Thuja occidentalis, and a MAT-LyLu Carcinosin nosode on the expression of cytokines and genes that regulate apoptosis. This was assessed in prostate cancer tissues, extracted from animals responsive to these drugs, using ribonuclease protection assay or reverse transcription polymerase chain reaction. There were no significant changes in mRNA levels of the apoptotic genes bax, bcl-2, bcl-x, caspase-1, caspase-2, caspase-3, Fas, FasL, or the cytokines interleukin (IL)-1alpha, IL-1beta, tumor necrosis factor (TNF)-beta, IL-3, IL-4, IL-5, IL-6, IL-10, TNF-alpha, IL-2, and interferon-gamma in prostate tumor and lung metastasis after treatment with homeopathic medicines. This study indicates that treatment with the highly diluted homeopathic remedies does not alter the gene expression in primary prostate tumors or in lung metastasis. The therapeutic effect of homeopathic treatments observed in the in vivo experiments cannot be explained by mechanisms based on distinct alterations in gene expression related to apoptosis or cytokines. Future research should explore subtle modulations in the expression of multiple genes in different biological pathways.

[Effects of interferon-gamma on cytotoxicity of murine activated macrophages against murine glioma cells].

PubMed

Ohyama, K; Kikuchi, H; Oda, Y; Moritake, K; Yamasaki, T

1993-06-01

We studied the effects of mouse IFN-gamma on the cytotoxic activity of murine activated macrophages (M phi) against mouse VM-Glioma cells (H-2b). Activated M phi were obtained from peritoneal exudate cells of mice from four strains, C57BL/6 (H-2b), C3H/He(H-2k), DBA/2 (H-2d), and BALB/c (H-2d), following intraperitoneal injection of (1) LPS 200 micrograms, (2) BCG 200 micrograms, (3) C. parvum 200 micrograms, or (4) MDP 350 micrograms 7 days prior to 20-hr 51Cr release-assay. Of the various combination of mouse strains and activating agents tested, that of activated M phi of the C3H/He mouse with induction by LPS had the most tumoricidal effect against the glioma cells, which was not MHC restricted. Although LPS-activated M phi underwent marked loss of cytotoxicity following initiation of in vitro culture, this 24 hr pretreatment with IFN-gamma inhibited this reduction in tumoricidal effects in a dose-dependent fashion. On the other hand, 24 hr pretreatment of target cells with IFN-gamma did not increase their susceptibility to lysis by activated M phi. These findings suggest that IFN-gamma augments the in vitro tumoricidal activation of M phi; This effect appears to be unrelated to any influence of IFN-gamma on target sensitivity to lysis by macrophages.

Rare ADAR and RNASEH2B variants and a type I interferon signature in glioma and prostate carcinoma risk and tumorigenesis.

PubMed

Beyer, Ulrike; Brand, Frank; Martens, Helge; Weder, Julia; Christians, Arne; Elyan, Natalie; Hentschel, Bettina; Westphal, Manfred; Schackert, Gabriele; Pietsch, Torsten; Hong, Bujung; Krauss, Joachim K; Samii, Amir; Raab, Peter; Das, Anibh; Dumitru, Claudia A; Sandalcioglu, I Erol; Hakenberg, Oliver W; Erbersdobler, Andreas; Lehmann, Ulrich; Reifenberger, Guido; Weller, Michael; Reijns, Martin A M; Preller, Matthias; Wiese, Bettina; Hartmann, Christian; Weber, Ruthild G

2017-12-01

In search of novel germline alterations predisposing to tumors, in particular to gliomas, we studied a family with two brothers affected by anaplastic gliomas, and their father and paternal great-uncle diagnosed with prostate carcinoma. In this family, whole-exome sequencing yielded rare, simultaneously heterozygous variants in the Aicardi-Goutières syndrome (AGS) genes ADAR and RNASEH2B co-segregating with the tumor phenotype. AGS is a genetically induced inflammatory disease particularly of the brain, which has not been associated with a consistently increased cancer risk to date. By targeted sequencing, we identified novel ADAR and RNASEH2B variants, and a 3- to 17-fold frequency increase of the AGS mutations ADAR,c.577C>G;p.(P193A) and RNASEH2B,c.529G>A;p.(A177T) in the germline of familial glioma patients as well as in test and validation cohorts of glioblastomas and prostate carcinomas versus ethnicity-matched controls, whereby rare RNASEH2B variants were significantly more frequent in familial glioma patients. Tumors with ADAR or RNASEH2B variants recapitulated features of AGS, such as calcification and increased type I interferon expression. Patients carrying ADAR or RNASEH2B variants showed upregulation of interferon-stimulated gene (ISG) transcripts in peripheral blood as seen in AGS. An increased ISG expression was also induced by ADAR and RNASEH2B variants in tumor cells and was blocked by the JAK inhibitor Ruxolitinib. Our data implicate rare variants in the AGS genes ADAR and RNASEH2B and a type I interferon signature in glioma and prostate carcinoma risk and tumorigenesis, consistent with a genetic basis underlying inflammation-driven malignant transformation in glioma and prostate carcinoma development.

Stimulatory role of interleukin 10 in CD8+ T cells through STATs in gastric cancer.

PubMed

Xi, Jianjun; Xu, Mingzheng; Song, Zongchang; Li, Hongqiang; Xu, Shumin; Wang, Chunmei; Song, Haihan; Bai, Jianwen

2017-05-01

CD8 + T cells are considered to be critical in tumor surveillance and elimination. Increased CD8 + T cell frequency and function is associated with better prognosis in cancer patients. Interleukin 10 is a cytokine with controversial roles in CD8 + T cell-mediated anti-tumor immunity. We therefore examined the interleukin 10 expression and consumption in CD8 + T cells harvested from the peripheral blood and resected tumors of gastric cancer patients of stages II-IV. We found that the gastric cancer patients presented significantly elevated frequencies of interleukin 10-expressing cells in both CD4 + and CD8 + T cells compared to healthy controls. But distinctive from the interleukin 10-expressing CD4 + T cells, which increased in frequency in advanced cancer, the interleukin 10-expressing CD8 + T cells did not increase with cancer stage in the peripheral blood and actually decreased with cancer stage in resected tumor. Interleukin 10 and interleukin 10 receptor expression was also enriched in interferon gamma-expressing activated CD8 + T cells. Compared to interleukin 10-nonexpressing CD8 + T cells, interleukin 10 receptor-expressing CD8 + T cells secreted significantly elevated interferon gamma levels. Treatment of anti-CD3/CD28-stimulated, purified CD8 + T cells with interleukin 10 alone could significantly enhance CD8 + T cell survival, an effect dependent on interleukin 10 receptor expression. Interleukin 10 also increased CD8 + T cell proliferation synergistically with interferon gamma but not alone. Analysis of downstream signal transducer and activator of transcription molecules showed that interleukin 10 treatment significantly increased the phosphorylation of signal transducer and activator of transcription 3 and signal transducer and activator of transcription 1 to lesser extent. Together, these results demonstrate that interleukin 10 possessed stimulatory roles in activated CD8 + T cells from gastric cancer patients.

Prospective randomized controlled study of interferon-alpha in preventing hepatocellular carcinoma recurrence after medical ablation therapy for primary tumors.

PubMed

Lin, Shi-Ming; Lin, Chun-Jung; Hsu, Chao-Wei; Tai, Dar-In; Sheen, I-Shyan; Lin, Deng-Yn; Liaw, Yun-Fan

2004-01-15

Hepatocellular carcinoma (HCC) recurrence after ablation therapy for primary tumors is common. To evaluate the effectiveness of interferon-alpha (IFN-alpha) in preventing HCC recurrence, 30 eligible patients were randomized into three groups: 11 patients treated with three mega units (MU) of IFN-alpha three times weekly for 24 months (IFN-alpha-continuous group), 9 patients treated with 3 MU of IFN-alpha daily for 10 days every month for 6 months followed by 3 MU of IFN-alpha daily for 10 days every 3 months for a further 18 months (IFN-alpha-intermittent group), and 10 patients who received no IFN-alpha therapy (control group). The three groups were comparable in terms of etiology, demographics, and laboratory data at entry and HCC characteristics. After a median follow-up of 27 months (range 4-53 months), 9 patients (90%) in the control group and 9 patients (45%) in 2 treatment groups (6 patients in the IFN-alpha-continuous group and 3 patients in the IFN-alpha-intermittent group) developed an HCC recurrence (P = 0.021). Cumulative HCC recurrence rates in the IFN-alpha-intermittent, IFN-alpha-continuous, and control groups were 22.2%, 27.3%, and 40% at the end of 1 year and 33.3%, 54.6%, and 90% at the end of 4 years (P = 0.0375), respectively (control vs. IFN-alpha-intermittent group, P = 0.0123; vs. IFN-alpha-continuous group, P = 0.0822). If both IFN-alpha groups were combined, the cumulative HCC recurrence rate of the patients treated with IFN-alpha and the control group was 25% and 40% at the end of 1 year and 47% and 90% at the end of 4 years, respectively (P = 0.0135). The data suggested that IFN-alpha therapy may reduce HCC recurrence after medical ablation therapy for primary tumors. Copyright 2003 American Cancer Society.

Interferon-gamma increased epithelial barrier function via upregulating claudin-7 expression in human submandibular gland duct epithelium.

PubMed

Abe, Ayumi; Takano, Kenichi; Kojima, Takashi; Nomura, Kazuaki; Kakuki, Takuya; Kaneko, Yakuto; Yamamoto, Motohisa; Takahashi, Hiroki; Himi, Tetsuo

2016-06-01

Tight junctions (TJs) are necessary for salivary gland function and may serve as indicators of salivary gland epithelial dysfunction. IgG4-related disease (IgG4-RD) is a newly recognized fibro-inflammatory condition which disrupts the TJ associated epithelial barrier. The salivary glands are one of the most frequently involved organs in IgG4-RD, however, changes of the TJ associated epithelial barrier in salivary gland duct epithelium is poorly understood. Here, we investigated the regulation and function of TJs in human submandibular gland ductal epithelial cells (HSDECs) in normal and IgG4-RD. We examined submandibular gland (SMG) tissue from eight control individuals and 22 patients with IgG4-RD and established an HSDEC culture system. Immunohistochemistry, immunocytochemistry, western blotting, and measurement of transepithelial electrical resistance (TER) were performed. Claudin-4, claudin-7, occludin, and JAM-A were expressed at the apical side of the duct epithelium in submandibular gland (SMG) tissue and at the cell borders in HSDECs of normal and IgG4-RD. The expression and distribution of TJs in SMG tissue were not different in control individuals and patients with IgG4-RD in vivo and in vitro. Although interferon-gamma (IFNγ) generally disrupts the integrity and function of TJs, as manifested by decreased epithelial barrier function, IFNγ markedly increased the epithelial barrier function of HSDECs via upregulation of claudin-7 expression in HSDECs from patients with IgG4-RD. This is the first report showing an IFNγ-dependent increase in epithelial barrier function in the salivary gland duct epithelium. Our results provide insights into the functional significance of TJs in salivary gland duct epithelium in physiological and pathological conditions, including IgG4-RD.

Cooperative Regulation of the Interferon Regulatory Factor-1 Tumor Suppressor Protein by Core Components of the Molecular Chaperone Machinery*

PubMed Central

Narayan, Vikram; Eckert, Mirjam; Zylicz, Alicja; Zylicz, Maciej; Ball, Kathryn L.

2009-01-01

Our understanding of the post-translational processes involved in regulating the interferon regulatory factor-1 (IRF-1) tumor suppressor protein is limited. The introduction of mutations within the C-terminal Mf1 domain (amino acids 301–325) impacts on IRF-1-mediated gene repression and growth suppression as well as the rate of IRF-1 degradation. However, nothing is known about the proteins that interact with this region to modulate IRF-1 function. A biochemical screen for Mf1-interacting proteins has identified an LXXLL motif that is required for binding of Hsp70 family members and cooperation with Hsp90 to regulate IRF-1 turnover and activity. These conclusions are supported by the finding that Hsp90 inhibitors suppress IRF-1-dependent transcription shortly after treatment, although at later time points inhibition of Hsp90 leads to an Hsp70-dependent depletion of nuclear IRF-1. Conversely, the half-life of IRF-1 is increased by Hsp90 in an ATPase-dependent manner leading to the accumulation of nuclear but not cytoplasmic IRF-1. This study begins to elucidate the role of the Mf1 domain of IRF-1 in orchestrating the recruitment of regulatory factors that can impact on both its turnover and transcriptional activity. PMID:19502235

Establishment of quality assurance for respiratory-gated radiotherapy using a respiration-simulating phantom and gamma index: Evaluation of accuracy taking into account tumor motion and respiratory cycle

NASA Astrophysics Data System (ADS)

Lee, Jae-Seung; Im, In-Chul; Kang, Su-Man; Goo, Eun-Hoe; Baek, Seong-Min

2013-11-01

The purpose of this study is to present a new method of quality assurance (QA) in order to ensure effective evaluation of the accuracy of respiratory-gated radiotherapy (RGR). This would help in quantitatively analyzing the patient's respiratory cycle and respiration-induced tumor motion and in performing a subsequent comparative analysis of dose distributions, using the gamma-index method, as reproduced in our in-house developed respiration-simulating phantom. Therefore, we designed a respiration-simulating phantom capable of reproducing the patient's respiratory cycle and respiration-induced tumor motion and evaluated the accuracy of RGR by estimating its pass rates. We applied the gamma index passing criteria of accepted error ranges of 3% and 3 mm for the dose distribution calculated by using the treatment planning system (TPS) and the actual dose distribution of RGR. The pass rate clearly increased inversely to the gating width chosen. When respiration-induced tumor motion was 12 mm or less, pass rates of 85% and above were achieved for the 30-70% respiratory phase, and pass rates of 90% and above were achieved for the 40-60% respiratory phase. However, a respiratory cycle with a very small fluctuation range of pass rates failed to prove reliable in evaluating the accuracy of RGR. Therefore, accurate and reliable outcomes of radiotherapy will be obtainable only by establishing a novel QA system using the respiration-simulating phantom, the gamma-index analysis, and a quantitative analysis of diaphragmatic motion, enabling an indirect measurement of tumor motion.

Interferon-gamma +874 T/A and interleukin-10 -1082 A/G single nucleotide polymorphism in Egyptian children with tuberculosis.

PubMed

Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M

2010-10-01

The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.

CXCR6 promotes atherosclerosis by supporting T-cell homing, interferon-gamma production, and macrophage accumulation in the aortic wall.

PubMed

Galkina, Elena; Harry, Brian L; Ludwig, Andreas; Liehn, Elisa A; Sanders, John M; Bruce, Anthony; Weber, Christian; Ley, Klaus

2007-10-16

T lymphocytes are thought to be important in atherosclerosis, but very little is known about the mechanisms of lymphocyte recruitment into atherosclerosis-prone aortas. In this study we tested the hypothesis that CXCR6, a chemokine receptor that is expressed on a subset of CD4+ T helper 1 cells and natural killer T cells, is involved in lymphocyte homing into the aortic wall and modulates the development and progression of atherosclerosis. To investigate the role of CXCR6 in the development and progression of atherosclerosis, we bred CXCR6-deficient (CXCR6(GFP/GFP)) mice with apolipoprotein E-deficient (ApoE(-/-)) mice. We found that CXCR6(GFP/GFP)/ApoE(-/-) mice fed a Western diet for 17 weeks or a chow diet for 56 weeks had decreased atherosclerosis compared with ApoE(-/-) controls. Flow cytometry analysis of the aortas from CXCR6(GFP/GFP)/ApoE(-/-) mice showed that the reduction of atherosclerosis was accompanied by a decreased percentage of CXCR6+ T cells within the aortas. Short-term homing experiments demonstrated that CXCR6 is involved in the recruitment of CXCR6+ leukocytes into the atherosclerosis-prone aortic wall. The reduced percentage of CXCR6+ T cells within the aortas resulted in significantly diminished production of interferon-gamma and reduction of CD11b+/CD68+ macrophages in the aorta. These data provide evidence for a proatherosclerotic role of CXCR6. Absence of CXCR6 alters the recruitment of CXCR6+ leukocytes and modulates the local immune response within the aortic wall.

Interleukin-6, interleukin-8, and soluble tumor necrosis factor receptor-I in the cord blood as predictors of chronic lung disease in premature infants.

PubMed

An, Hiromi; Nishimaki, Shigeru; Ohyama, Makiko; Haruki, Atsushi; Naruto, Takuya; Kobayashi, Naoki; Sugai, Toshiyuki; Kobayashi, Yoshinori; Mori, Masaaki; Seki, Kazuo; Yokota, Shumpei

2004-11-01

In order to predict the late-development of chronic lung disease of prematurity (CLD), cytokines in the cord blood were assessed in this study. Eighteen premature infants with CLD were enrolled. Cord blood plasma levels of cytokines of these infants and 12 control infants without CLD were measured including interleukin (IL)-1beta, IL-2, IL-4, IL-6, IL-8, IL-10, interferon (IFN)-gamma, tumor necrosis factor (TNF)-alpha, soluble TNF receptor-I, and soluble IL-6 receptor using a cytometric bead array and an enzyme-linked immunosorbent assay. The cord blood IL-6, IL-8, and sTNFR-I levels were significantly elevated in CLD infants compared with those in control (P < .05). IL-1beta, IL-2, IL-4, IL-10, and IFN-gamma were undetectable in both groups. CLD infants with maternal chorioamnionitis had higher IL-6 than those without chorioamnionitis (P < .01). In CLD infants, IL-6 was higher in the infants who required prolonged oxygen therapy (P < .05). Elevated inflammatory cytokines in the cord blood are associated with the progression to CLD.

Exploring the effects of low-level laser therapy on fibroblasts and tumor cells following gamma radiation exposure.

PubMed

Ramos Silva, Camila; Cabral, Fernanda Viana; de Camargo, Claudinei Francisco Morais; Núñez, Silvia Cristina; Mateus Yoshimura, Tania; de Lima Luna, Arthur Cássio; Maria, Durvanei Augusto; Ribeiro, Martha Simões

2016-12-01

Ionizing radiation (IR) induces DNA damage and low-level laser therapy (LLLT) has been investigated to prevent or repair detrimental outcomes resulting from IR exposure. Few in vitro studies, however, explore the biological mechanisms underlying those LLLT benefits. Thus, in this work, fibroblasts and tumor cells are submitted to IR with doses of 2.5 Gy and 10 Gy. After twenty-four-h, the cells are exposed to LLLT with fluences of 30 J cm -2 , 90 J cm -2 , and 150 J cm -2 . Cellular viability, cell cycle phases, cell proliferation index and senescence are evaluated on days 1 and 4 after LLLT irradiation. For fibroblasts, LLLT promotes - in a fluence-dependent manner - increments in cell viability and proliferation, while a reduction in the senescence was observed. Regarding tumor cells, no influences of LLLT on cell viability are noticed. Whereas LLLT enhances cell populations in S and G 2 /M cell cycle phases for both cellular lines, a decrease in proliferation and increase in senescence was verified only for tumor cells. Putting together, the results suggest that fibroblasts and tumor cells present different responses to LLLT following exposure to gamma-radiation, and these promising results should stimulate further investigations. Senescence of tumor cells and fibroblasts on the 4 th day after ionizing radiation (IR) and low-level laser therapy (LLLT) exposures. The number of senescent cells increased significantly for tumor cells (a) while for fibroblasts no increment was observed (b). The blue collor indicates senescence activity. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Evasion of interferon responses by Ebola and Marburg viruses.

PubMed

Basler, Christopher F; Amarasinghe, Gaya K

2009-09-01

The filoviruses, Ebola virus (EBOV) and Marburg virus (MARV), cause frequently lethal viral hemorrhagic fever. These infections induce potent cytokine production, yet these host responses fail to prevent systemic virus replication. Consistent with this, filoviruses have been found to encode proteins VP35 and VP24 that block host interferon (IFN)-alpha/beta production and inhibit signaling downstream of the IFN-alpha/beta and the IFN-gamma receptors, respectively. VP35, which is a component of the viral nucleocapsid complex and plays an essential role in viral RNA synthesis, acts as a pseudosubstrate for the cellular kinases IKK-epsilon and TBK-1, which phosphorylate and activate interferon regulatory factor 3 (IRF-3) and interferon regulatory factor 7 (IRF-7). VP35 also promotes SUMOylation of IRF-7, repressing IFN gene transcription. In addition, VP35 is a dsRNA-binding protein, and mutations that disrupt dsRNA binding impair VP35 IFN-antagonist activity while leaving its RNA replication functions intact. The phenotypes of recombinant EBOV bearing mutant VP35s unable to inhibit IFN-alpha/beta demonstrate that VP35 IFN-antagonist activity is critical for full virulence of these lethal pathogens. The structure of the VP35 dsRNA-binding domain, which has recently become available, is expected to provide insight into how VP35 IFN-antagonist and dsRNA-binding functions are related. The EBOV VP24 protein inhibits IFN signaling through an interaction with select host cell karyopherin-alpha proteins, preventing the nuclear import of otherwise activated STAT1. It remains to be determined to what extent VP24 may also modulate the nuclear import of other host cell factors and to what extent this may influence the outcome of infection. Notably, the Marburg virus VP24 protein does not detectably block STAT1 nuclear import, and, unlike EBOV, MARV infection inhibits STAT1 and STAT2 phosphorylation. Thus, despite their similarities, there are fundamental differences by which

[Interferon alpha-2b modified with polyethylene glycol].

PubMed

Wu, Yingxin; Zhai, Yanqin; Lei, Jiandu; Ma, Guanghui; Su, Zhiguo

2008-09-01

In order to obtain a more stable PEGylated interferon alpha-2b, and prolong its half life, interferon alpha-2b (IFN alpha-2b) was modified with monomethoxy polyethylene glycol propionaldehyde (mPEG-ALD) 20000. It was found that the optimized reaction condition for the maximum bioactivity and highest PEGylation degree of the mono PEGylated interferon alpha-2b was as follows: in 20 mmol/L, pH 6.5, citric acid and sodium dihydrogen phosphate buffer, the concentration of IFN alpha-2b was 4 mg/mL, and the molar ratio of PEG/IFN alpha-2b was 8:1, and the reaction time was 20 h at 4 degrees C. Under the optimized reaction condition, the mono PEGylation degree reached to 55%. Ion exchange chromatography was used to separate and purify mono PEGylated interferon alpha-2b from the reaction mixture. The purity of mono PEGylated interferon alpha-2b was higher than 97% characterized by HPLC. The bioactivity of the mono PEGylated interferon alpha-2b was 13.4% of the native IFN alpha-2b, while its half life in SD rat is much longer than the native IFN alpha-2b. The mono PEGylated interferon alpha-2b is also stable in aqueous.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Features of Postoperative Immune Suppression Are Reversible With Interferon Gamma and Independent of Interleukin-6 Pathways.

PubMed

Longbottom, E Rebecca; Torrance, Hew D T; Owen, Helen C; Fragkou, Paraskevi C; Hinds, Charles J; Pearse, Rupert M; O'Dwyer, Michael J

2016-08-01

The aim of this study was to evaluate the role of interleukin (IL)-6 pathways in postoperative immune suppression and to assess the reversibility of this phenomenon. The postoperative period is characterized by increased IL-6 production and features of immune suppression. In vitro, IL-6 mediates anti-inflammatory effects through inhibition of interferon gamma (IFN-γ) pathways. The significance of the immunomodulatory effects of IL-6 in the clinical setting of postoperative immune suppression remains unclear. Patients over 45 years old undergoing elective surgery, involving the gastrointestinal tract, were recruited. IL-6 levels were assayed using an enzyme linked immunosorbent assay preoperatively, and at 24 and 48 hours. Peripheral blood mononuclear cells from healthy volunteers were cultured in perioperative serum and CD14Human Leukocyte Antigen-DR (HLA-DR) [monocyte HLA-DR (mHLA-DR)] geometric mean florescent intensity was measured in the presence and absence of IL-6 neutralizing antibody and recombinant IFN-γ. Of the 108 patients, 41 developed a postoperative infection. The IL-6 levels increased 19-fold from the preoperative sample to 24 hours postoperatively (P < 0.0001). Higher IL-6 levels at 24 (P = 0.0002) and 48 hours (P = 0.003) were associated with subsequent postoperative infectious complications. mHLA-DR mean florescent intensity fell when healthy peripheral blood mononuclear cells were cultured with postoperative serum compared with preoperative serum (P = 0.008). This decrease was prevented by the presence of IFN-γ in the culture media, but not by the presence of IL-6-neutralizing antibody. IL-6 levels increase after a major surgery and are associated with an increased susceptibility to postoperative infections. Serum obtained from postoperative patients induces an immunosuppressive response, reflected in reduced mHLA-DR levels, mediated through IL-6 independent pathways and is reversible with IFN-γ. These data may have

Continuous in vivo infusion of interferon-gamma (IFN-γ) enhances engraftment of syngeneic wild-type cells in Fanca–/– and Fancg–/– mice

PubMed Central

Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J.; Critser, John; Arwert, Fre; Haneline, Laura S.; Clapp, D. Wade

2006-01-01

Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc–/– cells to interferon-gamma (IFN-γ), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc–/– mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca–/– and Fancg–/– mice are hypersensitive to IFN-γ and that in vivo infusion of IFN-γ at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-γ conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients. PMID:16946306

Gamma Knife treatment of low-grade gliomas in children.

PubMed

Ekşi, Murat Şakir; Yılmaz, Baran; Akakın, Akın; Toktaş, Zafer Orkun; Kaur, Ahmet Cemil; Demir, Mustafa Kemal; Kılıç, Türker

2015-11-01

Low-grade gliomas have good overall survival rates in pediatric patients compared to adults. There are some case series that reported the effectiveness and safety of Gamma Knife radiosurgery, yet they are limited in number of patients. We aimed to review the relevant literature for pediatric low-grade glial tumors treated with stereotactic radiosurgery, specifically Gamma Knife radiosurgery, and to present an exemplary case. A 6-year-old boy was admitted to clinic due to head trauma. He was alert, cooperative, and had no obvious motor or sensorial deficit. A head CT scan depicted a hypodense zone at the right caudate nucleus. The brain magnetic resonance imaging (MRI) depicted a mass lesion at the same location. A stereotactic biopsy was performed. Histopathological diagnosis was low-grade astrocytoma (grade II, World Health Organization (WHO) classification, 2007). Gamma Knife radiosurgery was applied to the tumor bed. Tumor volume was 21.85 cm(3). Fourteen gray was given to 50% isodose segment of the lesion (maximal dose of 28 Gy). The tumor has disappeared totally in 4 months, and the patient was tumor-free 21 months after the initial treatment. The presented literature review represents mostly single-center experiences with different patient and treatment characteristics. Accordingly, a mean/median margin dose of 11.3-15 Gy with Gamma Knife radiosurgery (GKRS) is successful in treatment of pediatric and adult low-grade glial tumor patients. However, prospective studies with a large cohort of pediatric patients should be conducted to make a more comprehensive conclusion for effectiveness and safety of GKRS in pediatric low-grade glial tumors.

Gamma irradiation reduces the immunological toxicity of doxorubicin, anticancer drug

NASA Astrophysics Data System (ADS)

Kim, Jae-Hun; Sung, Nak-Yun; Raghavendran, H. Balaji; Yoon, Yohan; Song, Beom-Seok; Choi, Jong-il; Yoo, Young-Choon; Byun, Myung-Woo; Hwang, Young-Jeong; Lee, Ju-Woon

2009-07-01

Doxorubicin (DOX) is a widely used anticancer agent, but exhibits some immunological toxicity to patients during chemotherapy. The present study was conducted to evaluate the effect of gamma irradiation on the immunological response and the inhibition activity on in vivo tumor mass of DOX. The results showed that DOX irradiated at 10 and 20 kGy reduce the inhibition of mouse peritoneal macrophage proliferation and induce the release of cytokines (TNF-α and IL-6) when compared with non-irradiated DOX. The cytotoxicity against human breast (MCF-7), murine colon adenocarcinoma (Colon 26) and human monocytic (THP-1) tumor cell were not significantly different between non-irradiated and irradiated DOX ( P<0.05). In vivo study on the tumor mass inhibition, gamma-irradiated DOX showed a considerable inhibition of tumor mass and this effect was statistically non-significant as compared with non-irradiated DOX. In conclusion, gamma irradiation could be regarded as a potential method for reducing the immunological toxicity of DOX. Further researches is needed to reveal the formation and activity of radiolysis products by gamma irradiation.

IFN-{gamma} sensitizes MIN6N8 insulinoma cells to TNF-{alpha}-induced apoptosis by inhibiting NF-{kappa}B-mediated XIAP upregulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Hun Sik; Kim, Sunshin; Lee, Myung-Shik

2005-10-28

Although X-linked inhibitor of apoptosis protein (XIAP) is an important intracellular suppressor of apoptosis in a variety of cell types, its role in cytokine-induced pancreatic {beta}-cell apoptosis remains unclear. Here, we found that: (i) XIAP level was inversely correlated with tumor necrosis factor (TNF)-{alpha}-induced apoptosis in MIN6N8 insulinoma cells; (ii) adenoviral XIAP overexpression abrogated the TNF-{alpha}-induced apoptosis through inhibition of caspase activity; (iii) downregulation of XIAP by antisense oligonucleotide or Smac peptide sensitized MIN6N8 cells to TNF-{alpha}-induced apoptosis; (iv) XIAP expression was induced by TNF-{alpha} through a nuclear factor-{kappa}B (NF-{kappa}B)-dependent pathway, and interferon (IFN)-{gamma} prevented such an induction in amore » manner independent of NF-{kappa}B, which presents a potential mechanism underlying cytotoxic IFN-{gamma}/TNF-{alpha} synergism. Taken together, our results suggest that XIAP is an important modulator of TNF-{alpha}-induced apoptosis of MIN6N8 cells, and XIAP regulation in pancreatic {beta}-cells might play an important role in pancreatic {beta}-cell apoptosis and in the pathogenesis of type 1 diabetes.« less

Interferon-based treatment of chronic hepatitis C.

PubMed

Souvignet, Claude; Lejeune, Olivier; Trepo, Christian

2007-01-01

The treatment of patients with chronic hepatitis C has rapidly evolved in the past 10 years centered on the use of interferon alpha 2 as an antiviral and immunomodulatory agent against hepatitis C virus. Firstly used as a monotherapy associated with a deceiving long-term efficacy, interferon alpha was then combined with ribavirin, a nucleoside analog with large antiviral properties. Combination of both drugs dramatically improved the efficacy of treatment with 50% of patients reaching a sustained viral response, characterized by the final eradication of the virus from the infected individual. Surprisingly, this synergistic effect remains greatly unexplained. The third step consisted in the use of pegylated interferon in order to adapt its pharmacokinetics and to allow a better efficacy with a more tolerable dosing schedule: once weekly subcutaneous injection instead of thrice weekly. Pegylated interferon combined with ribavirin during 24-48 weeks of treatment is the current standard of care with nearly 60% of sustained virologic response, overall. Development of new forms of interferon alpha are on the way with promising preliminary results.

A minimally invasive treatment option for large metastatic brain tumors: long-term results of two-session Gamma Knife stereotactic radiosurgery

PubMed Central

2014-01-01

Background Large brain metastases (BM) remain a significant cause of morbidity and death for cancer patients despite current advances in multimodality therapies. The goal of the present study was to evaluate the efficacy and limitations of 2-session Gamma Knife stereotactic radiosurgery (SRS) for patients with large BM. Methods This is a prospective, open-label and single arm study analyzing 58 consecutive patients who received 2-session SRS for large BM (≥ 10 mL). The median age was 66 years, and the median Karnofsky performance status (KPS) score was 70. SRS was the initial treatment in 51 large tumors (84%) and was used as salvage after failed prior treatments for 10 tumors (16%). The fraction protocol was 20-30 Gy given in 2 fractions with 3–4 weeks between fractions. Overall survival (OS) and neurological death (ND), local tumor control and KPS were analyzed. Results The median follow-up time was 9.0 months. One- and 2-year OS rates were 47% and 20%, respectively. The median OS time was 11.8 months (95% CI: 5.5-15.6). The causes of death were intracranial local progression in 5 cases, meningeal carcinomatosis in 3 and progression of the primary lesion in 39. One- and 2-year ND-free survival rates were 91% and 84%, respectively. In 52 of 61 large BM (85%) with sufficient radiological follow-up data, 6- and 12-month local tumor control rates were 85% and 64%, respectively. The mean KPS improved from 70 at the 1st SRS to 82 at the 2nd; the first follow-up mean KPS was 87 (P < 0.001). Symptomatic radiation injury developed and required conservative treatment in 3 patients (5%). Conclusions Long-term follow-up showed that two-session Gamma Knife SRS achieved durable tumor control rates as well as acceptable treatment-related morbidity. This treatment method may potentially merit being offered to patients with large BM who are in poor condition or are otherwise ineligible for standard care. PMID:24917309

Stability of human interferon-beta 1: oligomeric human interferon-beta 1 is inactive but is reactivated by monomerization.

PubMed

Utsumi, J; Yamazaki, S; Kawaguchi, K; Kimura, S; Shimizu, H

1989-10-05

Human interferon-beta 1 is extremely stable is a low ionic strength solution of pH 2 such as 10 mM HCl at 37 degrees C. However, the presence of 0.15 M NaCl led to a remarkable loss of antiviral activity. The molecular-sieve high-performance liquid chromatography revealed that, whereas completely active human interferon-beta 1 eluted as a 25 kDa species (monomeric form), the inactivated preparation eluted primarily as a 90 kDa species (oligomeric form). The specific activity (units per mg protein) of the oligomeric form was approx. 10% of that of the monomeric form. This observation shows that oligomeric human interferon-beta 1 is apparently in an inactive form. When the oligomeric eluate was resolved by polyacrylamide gel containing sodium dodecyl sulphate (SDS), it appeared to be monomeric under non-reducing conditions. Monomerization of the oligomeric human interferon-beta 1 by treatment with 1% SDS, fully regenerated its antiviral activity. These results suggest that the inactivation of the human interferon-beta 1 preparation was caused by its oligomerization via hydrophobic interactions without the formation of intermolecular disulphide bonds. These oligomers can be dissociated by SDS to restore biological activity.

Adoptive transfer of natural killer cells promotes the anti-tumor efficacy of T cells.

PubMed

Goding, Stephen R; Yu, Shaohong; Bailey, Lisa M; Lotze, Michael T; Basse, Per H

2017-04-01

The density of NK cells in tumors correlates positively with prognosis in many types of cancers. The average number of infiltrating NK cells is, however, quite modest (approximately 30 NK cells/sq.mm), even in tumors deemed to have a "high" density of infiltrating NK cells. It is unclear how such low numbers of tumor-infiltrating NK cells can influence outcome. Here, we used ovalbumin-expressing tumor cell lines and TCR transgenic, OVA-specific cytotoxic T lymphocytes (OT-I-CTLs) to determine whether the simultaneous attack by anti-tumor CTLs and IL-2-activated NK (A-NK) cells synergistically increases the overall tumor cell kill and whether upregulation of tumor MHC class-I by NK cell-derived interferon-gamma (IFNγ) improves tumor-recognition and kill by anti-tumor CTLs. At equal E:T ratios, A-NK cells killed OVA-expressing tumor cells better than OT-I-CTLs. The cytotoxicity against OVA-expressing tumor cells increased by combining OT-I-CTLs and A-NK cells, but the increase was additive rather than synergistic. A-NK cells adenovirally-transduced to produce IL-12 (A-NK IL-12 ) produced high amounts of IFNγ. The addition of a low number of A-NK IL-12 cells to OT-I-CTLs resulted in a synergistic, albeit modest, increase in overall cytotoxicity. Pre-treatment of tumor cells with NK cell-conditioned medium increased tumor MHC expression and sensitivity to CTL-mediated killing. Pre-treatment of CTLs with NK cell-conditioned medium had no effect on CTL cytotoxicity. In vivo, MHC class-I expression by OVA-expressing B16 melanoma lung metastases increased significantly within 24-48h after adoptive transfer of A-NK IL-12 cells. OT-I-CTLs and A-NK IL-12 cells localized selectively and equally well into OVA-expressing B16 lung metastases and treatment of mice bearing 7-days-old OVA-B16 lung metastases with both A-NK IL-12 cells and OT-I-CTLs lead to a significant prolongation of survival. Thus, an important function of tumor-infiltrating NK cells may be to increase tumor

Prenatal Dexamethasone and Postnatal High-Fat Diet Decrease Interferon Gamma Production through an Age-Dependent Histone Modification in Male Sprague-Dawley Rats

PubMed Central

Yu, Hong-Ren; Tain, You-Lin; Sheen, Jiunn-Ming; Tiao, Mao-Meng; Chen, Chih-Cheng; Kuo, Ho-Chang; Hung, Pi-Lien; Hsieh, Kai-Sheng; Huang, Li-Tung

2016-01-01

Overexposure to prenatal glucocorticoid (GC) disturbs hypothalamic-pituitary-adrenocortical axis-associated neuroendocrine metabolism and susceptibility to metabolic syndrome. A high-fat (HF) diet is a major environmental factor that can cause metabolic syndrome. We aimed to investigate whether prenatal GC plus a postnatal HF diet could alter immune programming in rat offspring. Pregnant Sprague-Dawley rats were given intraperitoneal injections of dexamethasone or saline at 14–21 days of gestation. Male offspring were then divided into four groups: vehicle, prenatal dexamethasone exposure, postnatal HF diet (VHF), and prenatal dexamethasone exposure plus a postnatal HF diet (DHF). The rats were sacrificed and adaptive immune function was evaluated. Compared to the vehicle, the DHF group had lower interferon gamma (IFN-γ) production by splenocytes at postnatal day 120. Decreases in H3K9 acetylation and H3K36me3 levels at the IFN-γ promoter correlated with decreased IFN-γ production. The impaired IFN-γ production and aberrant site-specific histone modification at the IFN-γ promoter by prenatal dexamethasone treatment plus a postnatal HF diet resulted in resilience at postnatal day 180. Prenatal dexamethasone and a postnatal HF diet decreased IFN-γ production through a site-specific and an age-dependent histone modification. These findings suggest a mechanism by which prenatal exposure to GC and a postnatal environment exert effects on fetal immunity programming. PMID:27669212

CD40 dependent exacerbation of immune mediated hepatitis by hepatic CD11b+ Gr-1+ myeloid derived suppressor cells in tumor bearing mice

PubMed Central

Kapanadze, Tamar; Medina-Echeverz, José; Gamrekelashvili, Jaba; Weiss, Jonathan M.; Wiltrout, Robert H.; Kapoor, Veena; Hawk, Nga; Terabe, Masaki; Berzofsky, Jay A.; Manns, Michael P.; Wang, Ena; Marincola, Francesco M.; Korangy, Firouzeh; Greten, Tim F.

2015-01-01

Immunosuppressive CD11b+Gr-1+ myeloid-derived suppressor cells (MDSC) accumulate in the livers of tumor-bearing mice. We studied hepatic MDSC in two murine models of immune mediated hepatitis. Unexpectedly, treatment of tumor bearing mice with Concanavalin A or α-Galactosylceramide resulted in increased ALT and AST serum levels in comparison to tumor free mice. Adoptive transfer of hepatic MDSC into naïve mice exacerbated Concanavalin A induced liver damage. Hepatic CD11b+Gr-1+ cells revealed a polarized pro-inflammatory gene signature after Concanavalin A treatment. An interferon gamma- dependent up-regulation of CD40 on hepatic CD11b+Gr-1+ cells along with an up-regulation of CD80, CD86, and CD1d after Concanavalin A treatment was observed. Concanavalin A treatment resulted in a loss of suppressor function by tumor-induced CD11b+Gr-1+ MDSC as well as enhanced reactive oxygen species-mediated hepatotoxicity. CD40 knockdown in hepatic MDSC led to increased arginase activity upon Concanavalin A treatment and lower ALT/AST serum levels. Finally, blockade of arginase activity in Cd40−/− tumor-induced myeloid cells resulted in exacerbation of hepatitis and increased reactive oxygen species production in vivo. Our findings indicate that in a setting of acute hepatitis, tumor-induced hepatic MDSC act as pro-inflammatory immune effector cells capable of killing hepatocytes in a CD40-dependent manner. PMID:25616156

RT-06GAMMA KNIFE SURGERY AFTER NAVIGATION-GUIDED ASPIRATION FOR CYSTIC METASTATIC BRAIN TUMORS

PubMed Central

Chiba, Yasuyoshi; Mori, Kanji; Toyota, Shingo; Kumagai, Tetsuya; Yamamoto, Shota; Sugano, Hirofumi; Taki, Takuyu

2014-01-01

Metastatic brain tumors over 3 cm in diameter (volume of 14.1ml) are generally considered poor candidates for Gamma Knife surgery (GKS). We retrospectively assessed the method and efficacy of GKS for large cystic metastatic brain tumors after navigation-guided aspiration under local anesthesia. From September 2007 to April 2014, 38 cystic metastatic brain tumors in 32 patients (12 males, 20 females; mean age, 63.2 years) were treated at Kansai Rosai Hospital. The patients were performed navigation-guided cyst aspiration under local anesthesia, then at the day or the next day, were performed GKS and usually discharged on the day. The methods for preventing of leptomeningeal dissemination are following: 1) puncture from the place whose cerebral thickness is 1 cm or more; 2) avoidance of Ommaya reservoir implantation; and 3) placement of absorbable gelatin sponge to the tap tract. Tumor volume, including the cystic component, decreased from 25.4 ml (range 8.7-84.7 ml) to 11.4 ml (range 2.9-36.7 ml) following aspiration; the volume reduction was approximately 51.6%. Follow-up periods in the study population ranged from 0 to 24 months (median 3.5 months). The overall median survival was 6.7 months. There was no leptomeningeal dissemination related to the aspiration. One patient experienced radiation necrosis after GKS, one patient experienced re-aspiration by failure of aspiration, and two patients experienced surgical resections and one patient experienced re-aspiration by cyst regrowth after GKS. Long-term hospitalization is not desirable for the patients with brain metastases. In japan, Long-term hospitalization is required for surgical resection or whole brain radiation therapy, but only two days hospitalization is required for GKS after navigation-guided aspiration at our hospital. This GKS after navigation-guided aspiration is more effective and less invasive than surgical resection or whole brain radiation therapy.

Interferon in resistance to bacterial and protozoan infections

NASA Technical Reports Server (NTRS)

Sonnenfeld, Gerald; Gould, Cheryl L.; Kierszenbaum, Felipe; Degee, Antonie L. W.; Mansfield, John M.

1986-01-01

The effects of genetic differences in mouse strains on the modulation of protozoan infections by interferon (IFN) were investigated. In one set of experiments, three different strains of mice were injected with T. cruzi, and their sera were assayed at five time intervals for IFN titer. A greater quantity of IFN was produced by mouse strains that were susceptible to T. cruzi infection than by the more resistant strain. In another set of experiments, spleen cell cultures from inbred strains of mice were challenged with an antigen made from T.b. rhodesiense. The cells from mice resistant to infection, produced greater amounts of IFN-gamma than did cells from the susceptible mice. In a third set of experiments, it was found that mice injected with T.b. rhodesiense before being infected with a diabetogenic virus (EMC-D) were resistant to the effects of the virus and did not produce virus-specific antibody.

Serum profile of cytokines interferon gamma and interleukin-10 in ewes subjected to artificial insemination by cervical retraction.

PubMed

Alvares, C T G; Cruz, J F; Romano, C C; Brandão, F Z

2016-04-15

This study evaluated the influence of artificial insemination (AI) by cervical retraction (CRI) on serum levels of interferon gamma (IFNγ) and interleukin-10 (IL-10) in ewes. Synchronized pluriparous Santa Inês ewes were subjected to natural mating (NM, n = 8) and AI, which was performed for a fixed time (55 ± 1 hour) by CRI (n = 8) or laparoscopy (n = 8). Ewes were classified as pregnant, with return to estrus (RE) or with embryonic loss (EL). Blood samples were collected on Day 0, Day 3, Day 5, Day 12, and Day 17 (Day 0 = AI/NM) for progesterone dosage and cytokines were quantified from Day 0 to Day 12. Progesterone levels were constant, except for a decrease in ewes with RE at Day 17 (P < 0.05). Regardless of the reproductive method used, there was no difference in the IFNγ and IL-10 levels at any time, with averages of 642.1, 713.2, and 741.2 pg/mL for IFNγ and 667.1, 616.8, and 721.1 pg/mL for IL-10 when using CRI, laproscopy, and NM, respectively. Regarding the physiological status, ewes with EL had lower serum levels of IFNγ and IL-10 than pregnant ewes and ewes with RE, regardless of the reproductive method used, with averages of 769.1, 714.9, and 555.7 pg/mL for IFNγ and 713.8, 699.3, and 578.7 pg/mL for IL-10 in pregnant ewes, ewes with RE and EL, respectively (P < 0.01). In conclusion, AI by CRI in Santa Inês ewes does not alter the profile of serum cytokines IFNγ and IL-10 and does not induce an inflammatory reaction that can compromise pregnancy. Copyright © 2016 Elsevier Inc. All rights reserved.

Parasite-mediated upregulation of NK cell-derived gamma interferon protects against severe highly pathogenic H5N1 influenza virus infection.

PubMed

O'Brien, Kevin B; Schultz-Cherry, Stacey; Knoll, Laura J

2011-09-01

Outbreaks of influenza A viruses are associated with significant human morbidity worldwide. Given the increasing resistance to the available influenza drugs, new therapies for the treatment of influenza virus infection are needed. An alternative approach is to identify products that enhance a protective immune response. In these studies, we demonstrate that infecting mice with the Th1-inducing parasite Toxoplasma gondii prior to highly pathogenic avian H5N1 influenza virus infection led to decreased lung viral titers and enhanced survival. A noninfectious fraction of T. gondii soluble antigens (STAg) elicited an immune response similar to that elicited by live parasites, and administration of STAg 2 days after H5N1 influenza virus infection enhanced survival, lowered viral titers, and reduced clinical disease. STAg administration protected H5N1 virus-infected mice lacking lymphocytes, suggesting that while the adaptive immune response was not required for enhanced survival, it was necessary for STAg-mediated viral clearance. Mechanistically, we found that administration of STAg led to increased production of gamma interferon (IFN-γ) from natural killer (NK) cells, which were both necessary and sufficient for survival. Further, administration of exogenous IFN-γ alone enhanced survival from H5N1 influenza virus infection, although not to the same level as STAg treatment. These studies demonstrate that a noninfectious T. gondii extract enhances the protective immune response against severe H5N1 influenza virus infections even when a single dose is administered 2 days postinfection.

Interferon-alpha in the treatment of multiple myeloma.

PubMed

Khoo, Teh Liane; Vangsted, Annette Juul; Joshua, Douglas; Gibson, John

2011-03-01

Interferons are soluble proteins produced naturally by cells in response to viruses. It has both anti-proliferative and immunomodulating properties and is one of the first examples of a biological response modifier use to treat the haematological malignancy multiple myeloma. Interferon has been used in this clinical practice for over thirty years. However, despite considerable efforts, numerous clinical trials and two large meta-analysis, its exact role in the management of multiple myeloma still remains unclear. Its role in the treatment of multiple myeloma has been as a single induction agent, a co-induction agent with other chemotherapy regimens, and as maintenance therapy after conventional chemotherapy or complete remission after autologous or allogeneic transplantation. Interferon as a single induction agent or co-induction agent with other chemotherapy agents appears only to have minimal benefit in myeloma. Its role as maintenance therapy in the plateau phase of myeloma also remains uncertain. More recently, the use of interferon must now compete with the "new drugs"--thalidomide, lenalidomide and bortezomib in myeloma treatment. Will there be a future role of interferon in the treatment of multiple myeloma or will interferon be resigned to the history books remains to be seen.

Gamma-irradiated bacterial preparation having anti-tumor activity

DOEpatents

Vass, Arpad A.; Tyndall, Richard L.; Terzaghi-Howe, Peggy

1999-01-01

A bacterial preparation from Pseudomonas species isolated #15 ATCC 55638 that has been exposed to gamma radiation exhibits cytotoxicity that is specific for neoplastic carcinoma cells. A method for obtaining a bacterial preparation having antitumor activity consists of suspending a bacterial isolate in media and exposing the suspension to gamma radiation. A bacterial preparation of an aged culture of an amoeba-associated bacteria exhibits anti-reverse transcriptase activity. A method for obtaining a bacterial preparation having anti-reverse transcriptase activity from an amoeba-associated bacterial isolate grown to stationary phase is disclosed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakaeda, Yoshiichi; Hiroi, Miki; Shimojima, Takahiro

Sulindac, a non-steroidal anti-inflammatory drug, has been shown to exert an anti-tumor effect on several types of cancer. To determine the effect of sulindac on intracellular signaling pathways in host immune cells such as macrophages, we investigated the effect of the drug on interferon gamma (IFN{gamma})-induced expression of signal transducer and activator of transcription 1 (STAT1) and other genes in mouse macrophage-like cell line RAW264.7 cells. Sulindac, but not aspirin or sodium salicylate, inhibited IFN{gamma}-induced expression of the CXC ligand 9 (CXCL9) mRNA, a chemokine for activated T cells, whereas the interferon-induced expression of CXCL10 or IFN regulatory factor-1 wasmore » not affected by sulindac. Luciferase reporter assay demonstrated that sulindac inhibited IFN{gamma}-induced promoter activity of the CXCL9 gene. Surprisingly, sulindac had no inhibitory effect on IFN{gamma}-induced STAT1 activation; however, constitutive nuclear factor {kappa}B activity was suppressed by the drug. These results indicate that sulindac selectively inhibited IFN{gamma}-inducible gene expression without inhibiting STAT1 activation.« less

Effect of carprofen administration during banding or burdizzo castration of bulls on plasma cortisol, in vitro interferon-gamma production, acute-phase proteins, feed intake, and growth.

PubMed

Pang, W Y; Earley, B; Sweeney, T; Crowe, M A

2006-02-01

The objective of this study was to determine the effect of carprofen (C) administration before banding or burdizzo castration of bulls on cortisol, in vitro interferon-gamma (IFN-gamma) production, acute-phase proteins, feed intake, and growth. Fifty Holstein Friesian bulls (5.5 mo old; 191 +/- 3.7 kg) were blocked by weight and assigned randomly to 1 of 5 treatments (n = 10/treatment): 1) untreated control (2) banding castration at 0 min (Band); 3) Band following an i.v. injection of 1.4 mg/kg of BW of C at -20 min (Band+C); 4) Burdizzo castration at 0 min (Burd); or 5) Burd following 1.4 mg/kg of BW of C at -20 min (Burd+C). Castration acutely increased plasma cortisol concentrations compared with control; no significant differences occurred in peak and interval to peak cortisol responses between Band and Band+C or Burd and Burd+C groups. The administration of C in Band+C reduced (P < 0.05) the cortisol concentration between 6 and 12 h postcastration compared with Band animals. Overall, the integrated cortisol response was greater (P < 0.05) in the castrates than in control, whereas C treatments tended to reduce this response compared with Band (P = 0.08) and Burd (P = 0.07), respectively. Plasma fibrinogen was elevated in Band animals on d 14 and in Burd animals on d 3 and 14. Carprofen administration reduced Band- and Burd-induced fibrinogen production on d 14 and 3, respectively. Plasma haptoglobin was elevated in Band animals on d 3 and 35 compared with control, and C administration was effective in reducing the haptoglobin elevation on d 35 in Band+C compared with Band. There were no differences among treatments in in vitro IFN-gamma production induced by concanavalin A and phytohemagglutinin on d 1 and 2. Overall from d -1 to 16, there were no DMI differences among treatments. From d -1 to 35, there were no ADG differences among treatments. In conclusion, banding and burdizzo castration increased plasma cortisol with no change in in vitro IFN-gamma

Application of tissue-specific NK and NKT cell activity for tumor immunotherapy

PubMed Central

Subleski, Jeff J.; Wiltrout, Robert H.; Weiss, Jonathan M.

2009-01-01

Natural killer (NK) and NKT cells are a first line of defense against pathogens and transformed cells. However, dysregulation of their function can lead to autoimmune disease. A better understanding of the mechanisms controlling NK and NKT effector function should lead to the development of improved strategies for the treatment of many diseases. The site in which NK and NKT cells reside should be taken into account, because accumulating evidence suggests that the tissue microenvironment strongly influences their function. In this regard, the liver represents a unique immunologic organ in which the balance between the need for tolerance and the ability to respond rapidly to pathogens and tissue injury is tightly regulated. NK cells in the liver have augmented cytolytic activity as compared to other organs, which is consistent with a role for liver-associated NK cells in being critical effector cells for inhibiting tumor metastasis in the liver. Several studies also suggest that hepatic NKT cells have different functions than those in other organs. Whereas splenic and thymic NKT cells have been shown to suppress diabetes development, facilitate the induction of systemic tolerance and are regulated by IL-4 and other Th2 cytokines, certain subsets of NKT cells in the liver are important sources of Th1 cytokines such as Interferon gamma, and are the primary mediators of anti-tumor responses. The unique properties and roles as critical effector cells make NK and NKT cells within the liver microenvironment attractive targets of immunotherapeutic approaches that have the goal of controlling tumor metastasis in the liver. PMID:19682859

Specificity, cross-talk and adaptation in Interferon signaling

NASA Astrophysics Data System (ADS)

Zilman, Anton

Innate immune system is the first line of defense of higher organisms against pathogens. It coordinates the behavior of millions of cells of multiple types, achieved through numerous signaling molecules. This talk focuses on the signaling specificity of a major class of signaling molecules - Type I Interferons - which are also used therapeutically in the treatment of a number of diseases, such as Hepatitis C, multiple sclerosis and some cancers. Puzzlingly, different Interferons act through the same cell surface receptor but have different effects on the target cells. They also exhibit a strange pattern of temporal cross-talk resulting in a serious clinical problem - loss of response to Interferon therapy. We combined mathematical modeling with quantitative experiments to develop a quantitative model of specificity and adaptation in the Interferon signaling pathway. The model resolves several outstanding experimental puzzles and directly affects the clinical use of Type I Interferons in treatment of viral hepatitis and other diseases.

Transfer of interferon alfa into human breast milk.

PubMed

Kumar, A R; Hale, T W; Mock, R E

2000-08-01

Originally assumed to be antiviral substances, the efficacy of interferons in a number of pathologies, including malignancies, multiple sclerosis, and other immune syndromes, is increasingly recognized. This study provides data on the transfer of interferon alfa (2B) into human milk of a patient receiving massive intravenous doses for the treatment of malignant melanoma. Following an intravenous dose of 30 million IU, the amount of interferon transferred into human milk was only slightly elevated (1551 IU/mL) when compared to control milk (1249 IU/mL). These data suggest that even following enormous doses, interferon is probably too large in molecular weight to transfer into human milk in clinically relevant amounts.

Gamma-irradiated bacterial preparation having anti-tumor activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vass, A.A.; Tyndall, R.L.; Terzaghi-Howe, P.

1999-11-16

This application describes a bacterial preparation from Pseudomonas species isolated {number{underscore}sign}15 ATCC 55638 that has been exposed to gamma radiation exhibits cytotoxicity that is specific for neoplastic carcinoma cells. A method for obtaining a bacterial preparation having antitumor activity consists of suspending a bacterial isolate in media and exposing the suspension to gamma radiation. A bacterial preparation of an aged culture of an amoeba-associated bacteria exhibits anti-reverse transcriptase activity. A method for obtaining a bacterial preparation having anti-reverse transcriptase activity from an amoeba-associated bacterial isolate grown to stationary phase is disclosed.

Interferon in lyssavirus infection.

PubMed

Rieder, Martina; Finke, Stefan; Conzelmann, Karl-Klaus

2012-01-01

Rabies is a zoonosis still claiming more than 50 000 human deaths per year. Typically, human cases are due to infection with rabies virus, the prototype of the Lyssavirus genus, but sporadic cases of rabies-like encephalitis caused by other lyssaviruses have been reported. In contrast to rabies virus, which has an extremely broad host range including many terrestrial warm-blooded animals, rabies-related viruses are associated predominantly with bats and rarely infect terrestrial species. In spite of a very close genetic relationship of rabies and rabies-related viruses, the factors determining the limited host range of rabies-related viruses are not clear. In the past years the importance of viral countermeasures against the host type I interferon system for establishment of an infection became evident. The rabies virus phosphoprotein (P) has emerged as a critical factor required for paralysing the signalling cascades leading to transcriptional activation of interferon genes as well as interferon signalling pathways, thereby limiting expression of antiviral and immune stimulatory genes. Comparative studies would be of interest in order to determine whether differential abilities of the lyssavirus P proteins contribute to the restricted host range of lyssaviruses.

INF-gamma rearranges membrane topography of MHC-I and ICAM-1 in colon carcinoma cells.

PubMed

Bacsó, Zsolt; Bene, László; Damjanovich, László; Damjanovich, Sándor

2002-01-18

Flow-cytometric fluorescence energy transfer (FCET) measurements between fluorescently labeled cell surface MHC-I and ICAM-1 molecules indicated similar receptor patterns in the plasma membrane of interferon-gamma (INF-gamma)-treated colon carcinoma cells as those observed earlier at the surface of lymphoid cells. INF-gamma activation significantly increased the density of MHC-I and ICAM-1 proteins in the membrane. This increase in receptor density was accompanied by decreased proximity level of the homo-associated MHC-I receptors. Hetero-association of MHC-I and ICAM-1 molecules was increased by INF-gamma treatment. INF-gamma changed neither hetero- nor homo-association of transferrin receptors. By staining the sphingomyelin/cholesterol-enriched lipid microdomains with fluorescently labeled cholera toxin B subunit, we found an increase in the amount of lipid-raft associated G(M1)-gangliosides due to INF-gamma treatment. Confocal microscopic results and FCET measurements show that MHC-I and ICAM-1 are components of G(M1)-ganglioside containing lipid-rafts and also support an increase in the size of these lipid-rafts upon INF-gamma treatment.

Interferon-gamma, macrophages, and virus spread after HSV-1 injection.

PubMed

Cathcart, Heather M; Zheng, Mei; Covar, Jason J; Liu, Yi; Podolsky, Robert; Atherton, Sally S

2011-06-07

After uniocular anterior chamber (AC) injection of HSV-1, the anterior segment of BALB/c mice becomes inflamed and infected; however, virus does not spread from the anterior segment to cause retinitis in the injected eye. The purpose of these studies was to determine whether interferon (IFN-)-γ and Mac-1(+) cells play a role in preventing direct anterior-to-posterior spread of HSV-1 in the injected eye. One AC of adult female BALB/c mice was injected with HSV-1 (KOS). The location of IFN-α, IFN-β, and IFN-γ in the injected eye was determined by immunofluorescence, and mRNA expression was quantified by qPCR. Injected eyes of IFN-γ knockout or clodronate-treated macrophage-depleted mice were examined to determine whether the absence of IFN-γ or Mac-1(+) macrophages affected the sites or timing of virus spread. IFN-α, IFN-β, and IFN-γ were observed in the anterior segment of injected eyes through 72 hours and mRNA levels of IFN-β and IFN-γ were increased in virus-infected eyes 48 to 120 hours after infection. However, the absence of IFN-γ or macrophages did not affect either the sites or the timing of HSV-1 infection in injected eyes. Protection of the retina of the injected eye does not depend on a single cell type or cytokine. In addition, in the eye, as in other sites of the body, there are redundancies in the innate response to virus infection.

Interferon Induced Transfer of Viral Resistance

DTIC Science & Technology

1981-02-01

necseeary and Identify by block number) - Interferon, Cell Communication, Resistance Transfer, Viruses , Antibody Production, Polypeptide Hormones...lymphocytes and the foreign cells, but not mycoplasmas or endogenous viruses , appears to be required for induction. The kinetics of production of leukocyte...interferon by nonsensitized lymphocytes in response to foreign cells is similar to that induced by viruses . We have shown that a component probably of Vie

Interferon Induced Transfer of Viral Resistance

DTIC Science & Technology

1982-02-01

released from the cell membrane. We have also shown that CM’s activity is removed by a gelatin /sepharose affinity column which selectively binds...interferon preparation adsorbing to the WISH cells, interferon was subjected to gelatin /sepharose affinity chromatography to remove endogenous...caused an increase in the amount of H-.amnino acids incorporated into a gelatin binding protein, presumably fibronectin. This suggests that in addition to

miR-502 inhibits cell proliferation and tumor growth in hepatocellular carcinoma through suppressing phosphoinositide 3-kinase catalytic subunit gamma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Suling, E-mail: suling_chen86@163.com; Li, Fang; Chai, Haiyun

2015-08-21

MicroRNAs (miRNAs) play a key role in carcinogenesis and tumor progression in hepatocellular carcinoma (HCC). In the present study, we demonstrated that miR-502 significantly inhibits HCC cell proliferation in vitro and tumor growth in vivo. G1/S cell cycle arrest and apoptosis of HCC cells were induced by miR-502. Phosphoinositide 3-kinase catalytic subunit gamma (PIK3CG) was identified as a direct downstream target of miR-502 in HCC cells. Notably, overexpression of PIK3CG reversed the inhibitory effects of miR-502 in HCC cells. Our findings suggest that miR-502 functions as a tumor suppressor in HCC via inhibition of PI3KCG, supporting its utility as a promising therapeuticmore » gene target for this tumor type. - Highlights: • miR-502 suppresses HCC cell proliferation in vitro and tumorigenicity in vivo. • miR-502 regulates cell cycle and apoptosis in HCC cells. • PIK3CG is a direct target of miR-502. • miR-502 and PIK3CG expression patterns are inversely correlated in HCC tissues.« less

Regression of Established Human Papillomavirus Type 16 (HPV-16) Immortalized Tumors In Vivo by Vaccinia Viruses Expressing Different Forms of HPV-16 E7 Correlates with Enhanced CD8+ T-Cell Responses That Home to the Tumor Site

PubMed Central

Lamikanra, Abigail; Pan, Zhen-Kun; Isaacs, Stuart N.; Wu, Tzyy-Choou; Paterson, Yvonne

2001-01-01

Using vaccinia virus as a live vector, we show that the expression of human papillomavirus type 16 (HPV-16) E7 fused to a nonhemolytic portion of the Listeria monocytogenes virulence factor, listeriolysin O (LLO), induces an immune response that causes the regression of established HPV-16 immortalized tumors in C57BL/6 mice. The vaccinia virus construct expressing LLO fused to E7 (VacLLOE7) was compared with two previously described vaccinia virus constructs: one that expresses unmodified E7 (VacE7) and another that expresses E7 in a form designed to direct it to intracellular lysosomal compartments and improve major histocompatibility complex class II-restricted responses (VacSigE7LAMP-1). C57BL/6 mice bearing established HPV-16 immortalized tumors of 5 or 8 mm were treated with each of these vaccines. Fifty percent of the mice treated with VacLLOE7 remained tumor free 2 months after tumor inoculation, whereas 12 to 25% of the mice were tumor free after treatment with VacSigE7LAMP-1 (depending on the size of the tumor). No mice were tumor free in the group given VacE7. Compared to VacE7, VacSigE7LAMP-1 and VacLLOE7 resulted in increased numbers of H2-Db-specific tetramer-positive CD8+ T cells in mouse spleens that produced gamma interferon and tumor necrosis factor alpha upon stimulation with RAHYNIVTF peptide. In addition, the highest frequency of tetramer-positive T cells was seen in the tumor sites of mice treated with VacLLOE7. An increased efficiency of E7-specific lysis by splenocytes from mice immunized with VacLLOE7 was also observed. These results indicate that the fusion of E7 with LLO not only enhances antitumor therapy by improving the tumoricidal function of E7-specific CD8+ T cells but may also increase the number of antigen-specific CD8+ T cells in the tumor, the principle site of antigen expression. PMID:11559797

Promotion of interferon-gamma production by natural killer cells via suppression of murine peritoneal macrophage prostaglandin E₂ production using intravenous anesthetic propofol.

PubMed

Inada, Takefumi; Kubo, Kozue; Shingu, Koh

2010-10-01

Propofol is an intravenous anesthetic, widely used for general anesthesia during surgery, which inevitably involves tissue trauma with inflammation. At sites of inflammation, prostanoids, especially prostaglandin E₂ (PGE₂), are abundant. This study addresses the effect of propofol on macrophage PGE₂ production. Using thioglycollate-elicited murine peritoneal macrophages, propofol (7.5-30 μM) suppressed lipopolysaccharide-induced PGE₂ production. The suppression was via the direct inhibition of cyclooxygenase (COX) enzyme activity and due neither to the downregulation of COX expression nor the inhibition of arachidonic acid release from plasma membranes. In macrophage:natural killer (NK) cell co-culture, propofol dramatically increased interferon-gamma (IFN-γ) production, and the actions of propofol were mimicked by a selective COX-2 inhibitor, NS-398, as well as the selective EP4 receptor antagonist L-161,982, suggesting a role of PGE₂ suppression in the upregulation of IFN-γ production. Furthermore, in purified NK cell culture, PGE₂ directly suppressed the production of IFN-γ by activated NK cells, which was reversed by selective inhibition of EP4 activity. Taken together, our results show that, in macrophage:NK cell co-culture, propofol, through the suppression of macrophage PGE₂ production, upregulates NK cell IFN-γ production by alleviating EP4 receptor-mediated suppression of IFN-γ production. Propofol may potentially exert considerable influence on inflammation and immunity by suppressing PGE₂ synthesis. Copyright © 2010 Elsevier B.V. All rights reserved.

Allocation of Interferon Gamma mRNA Positive Cells in Caecum Hallmarks a Protective Trait Against Histomonosis.

PubMed

Kidane, Fana Alem; Mitra, Taniya; Wernsdorf, Patricia; Hess, Michael; Liebhart, Dieter

2018-01-01

Histomonosis is a parasitic disease of gallinaceous birds characterized by necrotic lesions in cacum and liver that usually turns fatal in turkeys while it is less severe in chickens. Vaccination using in vitro attenuated Histomonas meleagridis has been experimentally shown to confer protection against histomonosis. The protective mechanisms that underpin the vaccine-induced immune response are not resolved so far. Therefore, the actual study aimed to evaluate the location and quantitative distribution patterns of signature cytokines of type 1 [interferon gamma (IFN-γ)] or type 2 [interleukin (IL)-13] immune responses in vaccinated or infected hosts. An intergroup and interspecies difference in the spatial and temporal distribution patterns of cytokine mRNA positive cells was evident. Quantification of cells showed a significantly decreased percentage of IFN-γ mRNA positive cells at 4 days post-inoculation (DPI) in caeca of turkeys inoculated exclusively with the attenuated or the virulent inocula, compared to control birds. The decrement was followed by a surge of cells expressing mRNA for IFN-γ or IL-13, reaching a peak of increment at 10 DPI. By contrast, turkeys challenged following vaccination showed a slight increment of cecal IFN-γ mRNA positive cells at 4 DPI after which positive cell counts became comparable to control birds. The increase in infected birds was accompanied by an extensive distribution of positively stained cells up to the muscularis layer of cecal tissue whereas the vaccine group maintained an intact mucosal structure. In chickens, the level of changes of positive cells was generally lower compared to turkeys. However, control chickens were found with a higher percentage of IFN-γ mRNA positive cells in cecum compared to their turkey counterparts indicating a higher resistance to histomonosis, similar to the observation in immunized turkeys. In chickens, it could be shown that the changes of cytokine-positive cells were related to

[Conjunctival squamous cell carcinoma: paradoxical response to interferon eyedrops].

PubMed

Mata, E; Conesa, E; Castro, M; Martínez, L; de Pablo, C; González, M L

2014-07-01

A 67 year-old male seen for a longstanding corneal-conjunctival tumor. topical interferon α2b (IFN-α2b) 10 U/ml. A significant increase in lesion size was observed after 8 weeks. A surgical excision with cryotherapy was then performed. Pathological examination confirmed the diagnosis of squamous cell carcinoma. At this time the patient was found to have a positive HIV serology. Conjunctival intraepithelial neoplasia (CIN) is a pre-cancerous lesion of the ocular surface. Medical treatment of CIN is essentially with IFN-α2b due to its antiviral/antitumor properties. In patients with HIV, treatment response could be paradoxical. We recommend serology for HIV before treatment with topical IFN-α2b. Copyright © 2012 Sociedad Española de Oftalmología. Published by Elsevier Espana. All rights reserved.

Beta-interferon inhibits cell infection by Trypanosoma cruzi

NASA Technical Reports Server (NTRS)

Kierszenbaum, F.; Sonnenfeld, G.

1984-01-01

Beta interferon has been shown to inhibit the capacity of bloodstream forms of the flagellate Trypanosoma cruzi, the causative agent of Chagas' disease, to associate with and infect mouse peritoneal macrophages and rat heart myoblasts. The inhibitory effect was abrogated in the presence of specific antibodies to the interferon. Pretreatment of the parasites with interferon reduced their infectivity for untreated host cells, whereas pretreament of either type of host cell did not affect the interaction. The effect of interferon on the trypanosomes was reversible; the extent of the inhibitory effect was significantly reduced afer 20 min, and was undetectable after 60 min when macrophages were used as host cells. For the myoblasts, 60 min elapsed before the inhibitory effect began to subside and 120 min elapsed before it became insignificant or undetectable.

Natural Killer Cells and Helicobacter pylori Infection: Bacterial Antigens and Interleukin-12 Act Synergistically To Induce Gamma Interferon Production

PubMed Central

Yun, Cheol H.; Lundgren, Anna; Azem, Josef; Sjöling, Åsa; Holmgren, Jan; Svennerholm, Ann-Mari; Lundin, B. Samuel

2005-01-01

Helicobacter pylori is known to induce a local immune response, which is characterized by activation of lymphocytes and the production of IFN-γ in the stomach mucosa. Since not only T cells, but also natural killer (NK) cells, are potent producers of gamma interferon (IFN-γ), we investigated whether NK cells play a role in the immune response to H. pylori infection. Our results showed that NK cells were present in both the gastric and duodenal mucosae but that H. pylori infection did not affect the infiltration of NK cells into the gastrointestinal area. Furthermore, we could show that NK cells could be activated directly by H. pylori antigens, as H. pylori bacteria, as well as lysate from H. pylori, induced the secretion of IFN-γ by NK cells. NK cells were also activated without direct contact when separated from the bacteria by an epithelial cell layer, indicating that the activation of NK cells by H. pylori can also occur in vivo, in the infected stomach mucosa. Moreover, the production of IFN-γ by NK cells was greatly enhanced when a small amount of interleukin-12 (IL-12) was added, and this synergistic effect was associated with increased expression of the IL-12 receptor β2. It was further evident that bacterial lysate alone was sufficient to induce the activation of cytotoxicity-related molecules. In conclusion, we demonstrated that NK cells are present in the gastroduodenal mucosa of humans and that NK cells produce high levels of IFN-γ when stimulated with a combination of H. pylori antigen and IL-12. We propose that NK cells play an active role in the local immune response to H. pylori infection. PMID:15731046

CD8+ T Cell Exhaustion, Suppressed Gamma Interferon Production, and Delayed Memory Response Induced by Chronic Brucella melitensis Infection

PubMed Central

Durward-Diioia, Marina; Harms, Jerome; Khan, Mike; Hall, Cherisse; Smith, Judith A.

2015-01-01

Brucella melitensis is a well-adapted zoonotic pathogen considered a scourge of mankind since recorded history. In some cases, initial infection leads to chronic and reactivating brucellosis, incurring significant morbidity and economic loss. The mechanism by which B. melitensis subverts adaptive immunological memory is poorly understood. Previous work has shown that Brucella-specific CD8+ T cells express gamma interferon (IFN-γ) and can transition to long-lived memory cells but are not polyfunctional. In this study, chronic infection of mice with B. melitensis led to CD8+ T cell exhaustion, manifested by programmed cell death 1 (PD-1) and lymphocyte activation gene 3 (LAG-3) expression and a lack of IFN-γ production. The B. melitensis-specific CD8+ T cells that produced IFN-γ expressed less IFN-γ per cell than did CD8+ cells from uninfected mice. Both memory precursor (CD8+ LFA1HI CD127HI KLRG1LO) and long-lived memory (CD8+ CD27HI CD127HI KLRG1LO) cells were identified during chronic infection. Interestingly, after adoptive transfer, mice receiving cells from chronically infected animals were able to contain infection more rapidly than recipients of cells from acutely infected or uninfected donors, although the proportions of exhausted CD8+ T cells increased after adoptive transfer in both challenged and unchallenged recipients. CD8+ T cells of challenged recipients initially retained the stunted IFN-γ production found prior to transfer, and cells from acutely infected mice were never seen to transition to either memory subset at all time points tested, up to 30 days post-primary infection, suggesting a delay in the generation of memory. Here we have identified defects in Brucella-responsive CD8+ T cells that allow chronic persistence of infection. PMID:26416901

How Methodologic Differences Affect Results of Economic Analyses: A Systematic Review of Interferon Gamma Release Assays for the Diagnosis of LTBI

PubMed Central

Oxlade, Olivia; Pinto, Marcia; Trajman, Anete; Menzies, Dick

2013-01-01

Introduction Cost effectiveness analyses (CEA) can provide useful information on how to invest limited funds, however they are less useful if different analysis of the same intervention provide unclear or contradictory results. The objective of our study was to conduct a systematic review of methodologic aspects of CEA that evaluate Interferon Gamma Release Assays (IGRA) for the detection of Latent Tuberculosis Infection (LTBI), in order to understand how differences affect study results. Methods A systematic review of studies was conducted with particular focus on study quality and the variability in inputs used in models used to assess cost-effectiveness. A common decision analysis model of the IGRA versus Tuberculin Skin Test (TST) screening strategy was developed and used to quantify the impact on predicted results of observed differences of model inputs taken from the studies identified. Results Thirteen studies were ultimately included in the review. Several specific methodologic issues were identified across studies, including how study inputs were selected, inconsistencies in the costing approach, the utility of the QALY (Quality Adjusted Life Year) as the effectiveness outcome, and how authors choose to present and interpret study results. When the IGRA versus TST test strategies were compared using our common decision analysis model predicted effectiveness largely overlapped. Implications Many methodologic issues that contribute to inconsistent results and reduced study quality were identified in studies that assessed the cost-effectiveness of the IGRA test. More specific and relevant guidelines are needed in order to help authors standardize modelling approaches, inputs, assumptions and how results are presented and interpreted. PMID:23505412

Detection of Wilms' tumor antigen--specific CTL in tumor-draining lymph nodes of patients with early breast cancer.

PubMed

Gillmore, Roopinder; Xue, Shao-An; Holler, Angelika; Kaeda, Jaspal; Hadjiminas, Dimitri; Healy, Vourneen; Dina, Roberto; Parry, Suzanne C; Bellantuono, Ilaria; Ghani, Yasmeen; Coombes, R Charles; Waxman, Jonathan; Stauss, Hans J

2006-01-01

The Wilms' tumor antigen (WT1) is overexpressed in approximately 90% of breast tumors and, thus, is a potential target antigen for the immunotherapy of breast cancer. We have tested the working hypotheses that WT1 can be immunogenic in patients with breast cancer and can stimulate CTL of sufficient avidity to kill tumor cells. Paired tumor-draining lymph node and peripheral blood samples were analyzed from five HLA-A2-positive patients with stage I/II breast cancer. Fluorescent HLA-A*0201/WT1 tetramers were used to quantify WT1-specific CTL and the functional capacity of the CTL was assessed using cytotoxicity assays and intracellular cytokine staining. WT1 tetramer-binding T cells expanded from all lymph node samples but none of the corresponding peripheral blood samples. Functional assays were carried out on T cells from the patient who had yielded the highest frequency of HLA-A*0201/WT1 tetramer-positive cells. The cytotoxicity assays showed WT1 peptide--specific killing activity of the CTL, whereas intracellular cytokine staining confirmed that the tetramer--positive T cells produced IFN-gamma after stimulation with WT1 peptide. These WT1-specific T cells killed HLA-A2-positive breast cancer cell lines treated with IFN-gamma but no killing was observed with untreated tumor cells. These results show that WT1-specific CTL can be expanded from the tumor-draining lymph nodes of breast cancer patients and that they can display peptide-specific effector function. However, the CTL only killed IFN-gamma-treated tumor targets expressing high levels of HLA-A2 and not tumor cells with low HLA expression. This suggests that induction of autologous WT1-specific CTL may offer only limited tumor protection and that strategies that allow a high level of peptide/MHC complex presentation and/or improve CTL avidity may be required.

Interferon for the treatment of genital warts: a systematic review

PubMed Central

2009-01-01

Background Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. Methods We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis Results 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the

Interferon for the treatment of genital warts: a systematic review.

PubMed

Yang, Jin; Pu, Yu-Guo; Zeng, Zhong-Ming; Yu, Zhi-Jian; Huang, Na; Deng, Qi-Wen

2009-09-21

Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the recurrence rate of the two

Inflammation activates the interferon signaling pathways in taste bud cells.

PubMed

Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan

2007-10-03

Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.

[Alpha-interferon and mental disorders].

PubMed

Debien, C; De Chouly De Lenclave, M B; Foutrein, P; Bailly, D

2001-01-01

The interferon alpha stands as a reference both in oncology and virology. But its efficiency is limited by frequent somatic as well as neuropsychic side effects. As a matter of fact, the reduction or the ending of a chemotherapy treatment come chiefly from the psychiatric complications caused by the use of interferon. For about 30% of patients, various psychic disorders are noticed: personality disorders, mood disorders, anxiety states, suicidal tendencies, manic and psychotic symptoms. We thus propose a review which shall be completed by a discussion on wether the interferon is responsible or not of the appearance of the described mental disorders. We shall conclude with a synthesis of the proposed practical management when confronted with such disorders. Psychiatric complications under interferon-Alpha. The appearance of psychiatric complications caused by interferon has been the subject of many publications. They have also raised the question of the toxicity mechanism which is still misunderstood today. This toxicity appears to be dose-dependent with variations depending on the daily dose given, the mode of administration, the combination with other chemotherapy treatments, the concomitance with a cerebral radiotherapy or a medical history of psychiatric disorders. Most of these effects occur after three weeks of treatment but non specific neuropsychic symptoms can be observed earlier. Non specific symptoms. They appear early but are difficult to detect, though they bring together a whole lot of clinical signs: asthenia, irritability, psychomotor slowdown, depressive mood or even a real "subsyndromic" depressive syndrome, anorexia, decline of the libido, concentration and attention problems, dizzy spells and headaches. Some authors have described intense and fluctuating of personality, mixing anxiety, irritability and disorder of drive control. Depression. Depression is the most frequently found psychiatric pathology in studies but the real frequency of clear

Use of FTA gene guard filter paper for the storage and transportation of tumor cells for molecular testing.

PubMed

Dobbs, Larry J; Madigan, Merle N; Carter, Alexis B; Earls, Lori

2002-01-01

Efficient methods of storing tumor specimens for molecular testing are needed in the modern surgical pathology laboratory. The FTA Gene Guard system is a novel method for the collection and room temperature storage of blood samples for DNA testing. The method uses index card-sized filter papers that provide an ideal medium on which to store tumor specimens for DNA testing. To determine whether FTA filter paper can be used in the surgical pathology laboratory to store tumor cells for DNA testing. Cell suspensions were prepared from 60 surgical specimens, and DNA was extracted either immediately or after storage on FTA paper. The DNA extracted by each method was tested by polymerase chain reaction (PCR) for the beta-globin and interferon gamma genes, and the results were compared. Fifteen lymph node specimens stored on FTA paper were then tested for immunoglobulin heavy chain (IgH) gene rearrangement by PCR, and these results were compared with those obtained for immediately extracted DNA. University medical center. The DNA extracted from cells stored on FTA paper performed as well in the PCR as the freshly extracted DNA in nearly all cases (>95%). The results of tests for IgH gene rearrangements showed 100% concordance between the 2 methods of DNA extraction.Conclusion.-Cells from surgical specimens can be stored on FTA paper for extended lengths of time, and DNA can be extracted from these cells for PCR-based testing. FTA filter paper is a reliable medium for the storage and/or transport of tumor cells for PCR-based DNA analysis.

Tolerability and efficacy of gamma knife radiosurgery on hepatocellular carcinoma with portal vein tumor thrombosis

PubMed Central

Lu, Xiao-Jie; Dong, Jing; Ji, Li-Juan; Xiao, Li-Xin; Ling, Chang-Quan; Zhou, Jun

2016-01-01

This is a retrospective study on the safety and efficacy of gamma knife radiosurgery (GKR) in treating hepatocellular carcinoma (HCC) with portal vein tumor thrombosis (PVTT). Patients with confirmed HCC and PVTT were allocated into two groups based on the treatments they received (palliative or GKR). A total of 138 patients were included (74 in the palliative group, 64 in GKR group). No significant differences in baseline characteristics existed between the two groups. Treatment-related adverse events (AEs) were recorded and compared between groups. The majority of AEs were mild to moderate and subsided naturally or after medication. There was no AE-induced death. The influences of baseline characteristics and treatment options on patients' OS were analyzed. The median OS of patients in the palliative and GKR group were 3.0 months (95% CI: 2.719-3.281) and 6.1 months (95% CI: 4.706-7.494) respectively (p = 0.003). Multivariate analysis revealed that GKR treatment, performance status 0-1, Child A, smaller tumor diameter and monolobar distribution were significant favorable prognosticators. Subgroup analyses showed OS benefit of GKR regardless of PVTT location (main or branch of PVTT). In conclusion, GKR is well tolerated in selected HCC-PVTT patients and can confer OS benefit, which needs validation in future prospective studies. PMID:26473291

MicroRNA203a suppresses glioma tumorigenesis through an ATM-dependent interferon response pathway

PubMed Central

Yang, Chuan He; Wang, Yinan; Sims, Michelle; Cai, Chun; He, Ping; Häcker, Hans; Yue, Junming; Cheng, Jinjun; Boop, Frederick A.; Pfeffer, Lawrence M.

2017-01-01

Glioblastoma (GBM) is a deadly and incurable brain tumor. Although microRNAs (miRNAs) play critical roles in regulating the cancer cell phenotype, the underlying mechanisms of how they regulate tumorigenesis are incompletely understood. We previously showed that miR-203a is expressed at relatively low levels in GBM patients, and ectopic miR-203a expression in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by interferon (IFN) or temozolomide in vitro, and inhibited GBM tumorigenesis in vivo. Here we show that ectopic expression of miR-203a in GBM cell lines promotes the IFN response pathway as evidenced by increased IFN production and IFN-stimulated gene (ISG) expression, and high basal tyrosine phosphorylation of multiple STAT proteins. Importantly, we identified that miR-203a directly suppressed the protein levels of ataxia-telangiectasia mutated (ATM) kinase that negatively regulates IFN production. We found that high ATM expression in GBM correlates with poor patient survival and that ATM expression is inversely correlated with miR-203a expression. Knockout of ATM expression and inhibition of ATM function in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by therapeutic agents in vitro, and markedly suppressed GBM tumor growth and promoted animal survival. In contrast, restoring ATM levels in GBM cells ectopically expressing miR-203a increased tumorigenicity and decreased animal survival. Our study suggests that low miR-203a expression in GBM suppresses the interferon response through an ATM-dependent pathway. PMID:29348882

MicroRNA203a suppresses glioma tumorigenesis through an ATM-dependent interferon response pathway.

PubMed

Yang, Chuan He; Wang, Yinan; Sims, Michelle; Cai, Chun; He, Ping; Häcker, Hans; Yue, Junming; Cheng, Jinjun; Boop, Frederick A; Pfeffer, Lawrence M

2017-12-22

Glioblastoma (GBM) is a deadly and incurable brain tumor. Although microRNAs (miRNAs) play critical roles in regulating the cancer cell phenotype, the underlying mechanisms of how they regulate tumorigenesis are incompletely understood. We previously showed that miR-203a is expressed at relatively low levels in GBM patients, and ectopic miR-203a expression in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by interferon (IFN) or temozolomide in vitro , and inhibited GBM tumorigenesis in vivo . Here we show that ectopic expression of miR-203a in GBM cell lines promotes the IFN response pathway as evidenced by increased IFN production and IFN-stimulated gene (ISG) expression, and high basal tyrosine phosphorylation of multiple STAT proteins. Importantly, we identified that miR-203a directly suppressed the protein levels of ataxia-telangiectasia mutated (ATM) kinase that negatively regulates IFN production. We found that high ATM expression in GBM correlates with poor patient survival and that ATM expression is inversely correlated with miR-203a expression. Knockout of ATM expression and inhibition of ATM function in GBM cell lines inhibited cell proliferation and migration, increased sensitivity to apoptosis induced by therapeutic agents in vitro , and markedly suppressed GBM tumor growth and promoted animal survival. In contrast, restoring ATM levels in GBM cells ectopically expressing miR-203a increased tumorigenicity and decreased animal survival. Our study suggests that low miR-203a expression in GBM suppresses the interferon response through an ATM-dependent pathway.

Downregulation of Interleukin-18-Mediated Cell Signaling and Interferon Gamma Expression by the Hepatitis B Virus e Antigen

PubMed Central

Jegaskanda, S.; Ahn, S. H.; Skinner, N.; Thompson, A. J.; Ngyuen, T.; Holmes, J.; De Rose, R.; Navis, M.; Winnall, W. R.; Kramski, M.; Bernardi, G.; Bayliss, J.; Colledge, D.; Sozzi, V.; Visvanathan, K.; Locarnini, S. A.; Kent, S. J.

2014-01-01

ABSTRACT The mechanisms by which hepatitis B virus (HBV) establishes and maintains chronic hepatitis B infection (CHB) are poorly defined. Innate immune responses play an important role in reducing HBV replication and pathogenesis. HBV has developed numerous mechanisms to escape these responses, including the production of the secreted hepatitis B e antigen (HBeAg), which has been shown to regulate antiviral toll-like receptor (TLR) and interleukin-1 (IL-1) signaling. IL-18 is a related cytokine that inhibits HBV replication in hepatoma cell lines and in the liver through the induction of gamma interferon (IFN-γ) by NK cells and T cells. We hypothesized that HBV or HBV proteins inhibit IFN-γ expression by NK cells as an accessory immunomodulatory function. We show that HBeAg protein inhibits the NF-κB pathway and thereby downregulates NK cell IFN-γ expression. Additionally, IFN-γ expression was significantly inhibited by exposure to serum from individuals with HBeAg-positive but not HBeAg-negative chronic HBV infection. Further, we show that the HBeAg protein suppresses IL-18-mediated NF-κB signaling in NK and hepatoma cells via modulation of the NF-κB pathway. Together, these findings show that the HBeAg inhibits IL-18 signaling and IFN-γ expression, which may play an important role in the establishment and/or maintenance of persistent HBV infection. IMPORTANCE It is becoming increasingly apparent that NK cells play a role in the establishment and/or maintenance of chronic hepatitis B infection. The secreted HBeAg is an important regulator of innate and adaptive immune responses. We now show that the HBeAg downregulates NK cell-mediated IFN-γ production and IL-18 signaling, which may contribute to the establishment of infection and/or viral persistence. Our findings build on previous studies showing that the HBeAg also suppresses the TLR and IL-1 signaling pathways, suggesting that this viral protein is a key regulator of antiviral innate immune responses

Nuclear receptor ERR alpha and coactivator PGC-1 beta are effectors of IFN-gamma-induced host defense.

PubMed

Sonoda, Junichiro; Laganière, Josée; Mehl, Isaac R; Barish, Grant D; Chong, Ling-Wa; Li, Xiangli; Scheffler, Immo E; Mock, Dennis C; Bataille, Alain R; Robert, Francois; Lee, Chih-Hao; Giguère, Vincent; Evans, Ronald M

2007-08-01

Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.

Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

PubMed

Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-09-01

The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

Long-Term Results of Gamma Knife Radiosurgery for Intracranial Meningioma

PubMed Central

Jang, Chang Ki; Jung, Hyun Ho; Chang, Jong Hee; Chang, Jin Woo; Park, Yong Gou

2015-01-01

Background The predominant treatment modality for meningioma is surgical resection. However, gamma knife radiosurgery is also an important treatment modality for meningioma that is small or cannot be completely removed because of its location. In this study, we evaluated the effectiveness and long-term results of radiosurgical treatment for meningioma in our institution. Methods We studied 628 patients (130 men and 498 women) who underwent gamma knife radiosurgery for intracranial meningioma, which is radiologically diagnosed, from Jan 2008 to Nov 2012. We included patients with single lesion meningioma, and followed up after 6 months with imaging, and then at 24 months with a clinical examination. Patients with high-grade meningioma or multiple meningiomas were excluded. We analyzed each of the factors associated with progression free survival. The median patient's age was 56.8 years. Maximal dosage was 27.8 Gy and marginal dosage was 13.9 Gy. Results The overall tumor control rate was 95%. Twenty-eight patients (4.4%) showed evidence of tumor recurrence. Ninety-eight patients (15%) developed peritumoral edema (PTE) after gamma-knife surgery; two of them (2%) underwent surgical resections due to PTE. Nine patients had craniotomy and tumor removal after gamma knife surgery. Conclusion Gamma knife surgery for intracranial meningioma has proven to be a safe and effective treatment tool with successful long-term outcomes. Gamma knife radiosurgery can be especially effective in cases of remnant meningioma after surgical resection or where PTE is not present. PMID:26605265