[Regulating human interferon-gamma gene expression in marrow stromal cells in mice by Tet-off system].

PubMed

Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong

2008-01-01

We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.

Continuous in vivo infusion of interferon-gamma (IFN-gamma) enhances engraftment of syngeneic wild-type cells in Fanca-/- and Fancg-/- mice.

PubMed

Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade

2006-12-15

Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.

Reversible skeletal abnormalities in gamma-glutamyl transpeptidase-deficient mice

NASA Technical Reports Server (NTRS)

Levasseur, Regis; Barrios, Roberto; Elefteriou, Florent; Glass, Donald A 2nd; Lieberman, Michael W.; Karsenty, Gerard

2003-01-01

Gamma-glutamyl transpeptidase (GGT) is a widely distributed ectopeptidase responsible for the degradation of glutathione in the gamma-glutamyl cycle. This cycle is implicated in the metabolism of cysteine, and absence of GGT causes a severe intracellular decrease in this amino acid. GGT-deficient (GGT-/-) mice have multiple metabolic abnormalities and are dwarf. We show here that this latter phenotype is due to a decreased of the growth plate cartilage total height resulting from a proliferative defect of chondrocytes. In addition, analysis of vertebrae and tibiae of GGT-/- mice revealed a severe osteopenia. Histomorphometric studies showed that this low bone mass phenotype results from an increased osteoclast number and activity as well as from a marked decrease in osteoblast activity. Interestingly, neither osteoblasts, osteoclasts, nor chondrocytes express GGT, suggesting that the observed defects are secondary to other abnormalities. N-acetylcysteine supplementation has been shown to reverse the metabolic abnormalities of the GGT-/- mice and in particular to restore the level of IGF-1 and sex steroids in these mice. Consistent with these previous observations, N-acetylcysteine treatment of GGT-/- mice ameliorates their skeletal abnormalities by normalizing chondrocytes proliferation and osteoblastic function. In contrast, resorbtion parameters are only partially normalized in GGT-/- N-acetylcysteine-treated mice, suggesting that GGT regulates osteoclast biology at least partly independently of these hormones. These results establish the importance of cysteine metabolism for the regulation of bone remodeling and longitudinal growth.

Arthritis is developed in Borrelia-primed and -infected mice deficient of interleukin-17.

PubMed

Kuo, Joseph; Warner, Thomas F; Munson, Erik L; Nardelli, Dean T; Schell, Ronald F

2016-10-01

Interleukin-17 (IL-17) has been shown to participate in the development of Lyme arthritis in experimental mice. For example, neutralization of IL-17 with antibodies inhibits induction of arthritis in Borrelia-primed and -infected C57BL/6 wild-type mice. We hypothesized that mice lacking IL-17 would fail to develop Borrelia-induced arthritis. IL-17-deficient and wild-type C57BL/6 mice were primed with heat-inactivated Borrelia and then infected with viable spirochetes 3 weeks later. No swelling or major histopathological changes of the hind paws were detected in IL-17-deficient or wild-type mice that were primed with Borrelia or infected with viable spirochetes. By contrast, IL-17-deficient and wild-type mice that were primed and subsequently infected with heterologous Borrelia developed severe swelling and histopathological changes of the hind paws. In addition, Borrelia-primed and -infected IL-17-deficient mice exhibited elevated gamma-interferon (IFN-γ) levels in sera and increased frequencies of IFN-γ-expressing lymphocytes in popliteal lymph nodes compared to Borrelia-primed and -infected wild-type mice. These results demonstrate that IL-17 is not required for development of severe pathology in response to infection with Borrelia burgdorferi, but may contribute to disease through an interaction with IFN-γ. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Graft-versus-host disease causes failure of donor hematopoiesis and lymphopoiesis in interferon-gamma receptor-deficient hosts.

PubMed

Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude

2008-09-01

The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.

Partial interferon-gamma receptor 1 deficiency in a child with tuberculoid bacillus Calmette-Guérin infection and a sibling with clinical tuberculosis.

PubMed Central

Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L

1997-01-01

Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728

[Interferon. An overview of the state of basic research with special regard to interferon-gamma].

PubMed

Günther, G; Otto, B

1993-02-01

Interferons / An overview on the state of basic research with special regard to interferon-gamma Interferons are multifunctional glycoproteins with a broad range of antiviral, antiproliferative and immunoregulatory effects on the target cell. This review deals with the basics as well as with more recent developments in interferon research. A historic overview of 35 years of interferon research since the discovery of interferons by Isaacs and Lindenmann in 1957 introduces the most important milestones in this field and appreciates the work of the participating researchers. A brief description of the classification of interferons based on different tissue sources, different antigenic properties and different induction behaviour is made. The main part of this review focuses on human interferon-gamma. We discuss recent work on the structure-function relationship of interferon-gamma. The interferon-gamma receptor and its role in signal transduction is another part of this paper. The structure and length of the C-terminal region of interferon-gamma seems to be important for receptor binding and expression of biological activities. A conservative estimate is that the family of IFN-activated genes numbers 15-20 in most cells.

Mice with Pulmonary Tuberculosis Treated with Mycobacterium vaccae Develop Strikingly Enhanced Recall Gamma Interferon Responses to M. vaccae Cell Wall Skeleton▿

PubMed Central

Rodríguez-Güell, Elisabeth; Agustí, Gemma; Corominas, Mercè; Cardona, Pere-Joan; Luquin, Marina; Julián, Esther

2008-01-01

Whole heat-killed Mycobacterium vaccae is used as an immunotherapeutic agent in tuberculosis (TB), but the compound(s) that triggers its immunostimulatory ability is not known. Here, we show that among different subcellular fractions, the cell wall skeleton induced a prominent expression of gamma interferon in splenocytes from both non-TB and TB M. vaccae-treated mice. PMID:18337379

IFN-gamma receptor-deficient mice generate antiviral Th1-characteristic cytokine profiles but altered antibody responses.

PubMed

Schijns, V E; Haagmans, B L; Rijke, E O; Huang, S; Aguet, M; Horzinek, M C

1994-09-01

The lymphokine IFN-gamma is a pleiotropic immunomodulator and possesses intrinsic antiviral activity. We studied its significance in the development of antiviral immune responses by using IFN-gamma receptor-deficient (IFN-gamma R-/-) mice. After inoculation with live attenuated pseudorabies virus (PRV), the mutant mice showed no infectivity titers in various tissues, and transient viral Ag expression only in the spleen, similar as in wild-type mice. However, the absence of the IFN-gamma R resulted in increased proliferative splenocyte responses. The PRV-immune animals showed a normal IFN-gamma and IL-2 production, without detectable IL-4, and with decreased IL-10 secretion in response to viral Ag or Con A. Immunohistochemically, an increased ratio of IFN-gamma:IL-4-producing spleen cells was found. After immunization with either live attenuated or inactivated PRV, IFN-gamma R-/- mice produced significantly less antiviral Ab, and more succumbed to challenge infection than the intact control animals. The reduction in Ab titers in the mutant mice correlated with lower protection by their sera in transfer experiments. Our data demonstrate that ablation of the IFN-gamma receptor surprisingly does not inhibit the generation of antiviral Th1-type and increase Th2-type cytokine responses. However, it profoundly impairs the generation of protective antiviral Ab.

Coexposure of mice to trovafloxacin and lipopolysaccharide, a model of idiosyncratic hepatotoxicity, results in a unique gene expression profile and interferon gamma-dependent liver injury.

PubMed

Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A

2009-01-01

The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.

Monoclonal antibody against interferon gamma can prevent experimental cerebral malaria and its associated overproduction of tumor necrosis factor.

PubMed Central

Grau, G E; Heremans, H; Piguet, P F; Pointaire, P; Lambert, P H; Billiau, A; Vassalli, P

1989-01-01

Experimental cerebral malaria (ECM), a lethal hyperacute neurological syndrome associated with high blood levels of tumor necrosis factor, develops in genetically susceptible (CBA/Ca) mice 7 days after infection with Plasmodium berghei ANKA strain. Injections of neutralizing monoclonal antibody against recombinant murine interferon gamma, not later than 4 days after infection, markedly reduced the incidence of ECM and the elevation in serum levels of tumor necrosis factor. This treatment prevented the cerebral lesions (plugging of brain vessels by monocytes, lymphocytes, and parasitized erythrocytes). In contrast, the extent of macrophage infiltration in lymphoid organs (which is a characteristic feature of mice developing ECM), as well as the course of infection, remained unaffected by the antibody treatment. Protected mice died at a later time of severe anemia and overwhelming parasitemia, the usual outcome of P. berghei infection in mice that are not susceptible to ECM. The present data indicate that interferon gamma constitutes an important link in the cytokine network that leads to brain vessel inflammation in experimental malaria. It is proposed that interferon gamma released by activated CD4+ T cells acts by augmenting both production and action of tumor necrosis factor. PMID:2501793

Loss of the type I interferon pathway increases vulnerability of mice to genital herpes simplex virus 2 infection.

PubMed

Conrady, Christopher D; Halford, William P; Carr, Daniel J J

2011-02-01

The mouse model of genital herpes relies on medoxyprogesterone treatment of female mice to render the vaginal lumen susceptible to inoculation with herpes simplex virus 2 (HSV-2). In the present study, we report that mice deficient in the A1 chain of the type I interferon receptor (CD118(-/-)) are susceptible to HSV-2 in the absence of medroxyprogesterone preconditioning. In the absence of hormone pretreatment, 2,000 PFU of a clinical isolate of HSV-2 was sufficient to establish a productive infection in the vagina of 75% ± 17% and in the spinal cord of 71% ± 14% of CD118(-/-) mice, whereas the same dose of HSV-2 replicated to detectable levels in only 13% ± 13% of vaginal samples and 0% of spinal cord samples from wild-type mice, as determined at day 5 postinfection. The susceptibility to HSV-2 infection in the CD118(-/-) mice was associated with a significant reduction in the infiltration of HSV-specific cytotoxic T lymphocytes into the vaginal tissue, the local production of gamma interferon (IFN-γ), and the expression of T cell-recruiting chemokines CCL5, CXCL9, and CXCL10. Collectively, the results underscore the significant contribution of type I IFNs in resistance to genital HSV-2 infection.

Interferon-γ Inhibits Ebola Virus Infection.

PubMed

Rhein, Bethany A; Powers, Linda S; Rogers, Kai; Anantpadma, Manu; Singh, Brajesh K; Sakurai, Yasuteru; Bair, Thomas; Miller-Hunt, Catherine; Sinn, Patrick; Davey, Robert A; Monick, Martha M; Maury, Wendy

2015-01-01

Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.

Interferon-alpha and interferon-gamma modulate Fas-mediated apoptosis in mitomycin-C-resistant human Tenon's fibroblasts.

PubMed

Wang, Xiao Yang; Crowston, Jonathan G; White, Andrew J R; Zoellner, Hans; Healey, Paul R

2014-08-01

The aim of the study was to investigate, using a native mitomycin-C-resistant human Tenon's fibroblast cell line, the possibility that interferon-alpha and gamma could be used with Fas agonists as an alternative anti-fibrotic strategy to mitomycin-C in trabeculectomy. A clinically resistant and in vitro verified mitomycin-C-resistant human Tenon's fibroblast cell line was pretreated with interferon-alpha and interferon-gamma for 48 h before stimulation with an agonistic Fas antibody (CH11) for 2 days to induce cell death. Cell death assays were undertaken. Changes in apoptosis-related proteins were determined by flow cytometry and Western blot. Pretreatment with interferon-alpha or interferon-gamma for 48 h increased Fas, Fas-associated protein with death domain and caspase-8 expression. Protein expression was further increased by combined exposure to interferon-alpha and gamma. Pretreatment with cytokines had no effect on Fas-L and Bcl-2. Interferon-alpha alone did not change the rate of induced cell death. A combination of interferon-alpha and gamma synergistically increased the sensitivity of mitomycin-C-resistant human Tenon's fibroblast cell line to induced cell death. An antagonistic anti-Fas antibody (ZB4) completely blocked induced cell death. Broad caspase inhibitors specific for caspases-8 and -3 reduced induced deaths in interferon pretreated mitomycin-C-resistant human Tenon's fibroblast cell line in a dose-dependent manner. Interferon-alpha and interferon-gamma render mitomycin-C-resistant human Tenon's fibroblast cell line sensitive to Fas-mediated apoptosis. The mechanism involves increased death-inducing signalling complex formation by upregulation of Fas, Fas-associated protein with death domain and caspase-8 expression. © 2013 Royal Australian and New Zealand College of Ophthalmologists.

Interferon-gamma inhibits HIV-induced invasiveness of monocytes.

PubMed

Dhawan, S; Wahl, L M; Heredia, A; Zhang, Y; Epstein, J S; Meltzer, M S; Hewlett, I K

1995-12-01

HIV-infected monocytes form highly invasive network on basement membrane matrix and secrete high levels of 92-kd metalloproteinase (MMP-9), an enzyme that degrades basement membrane proteins. In the present study, using matrigel as a model basement membrane system, we demonstrate that treatment of human immunodeficiency virus (HIV)-infected monocytes with interferon-gamma at 50 U/ml inhibited the ability of infected monocytes to form an invasive network on matrigel and their invasion through the matrigel matrix. These effects were associated with a significant reduction in the levels of MMP-9 produced by HIV-infected monocytes treated with interferon-gamma 1 day prior to infection with HIV as compared with that of untreated HIV-infected monocytes. Monocytes treated with interferon-gamma 1 day after HIV infection showed the presence of integrated HIV sequences; however, the levels of MMP-9 were substantially lower than those produced by monocytes inoculated with live HIV, heat-inactivated HIV, or even the control uninfected monocytes. Exposure of monocytes to heat-inactivated HIV did not result in increased invasiveness or high MMP-9 production, suggesting that regulation of metalloproteinase by monocytes was independent of CD4-gp120 interactions and required active virus infection. Furthermore, addition of interferon-gamma to monocytes on day 10 after infection inhibited MMP-9 production by more than threefold with no significant reduction of virus replication. These results indicate that the mechanism of interferon-gamma-induced down-regulation of MMP-9 levels and reduced monocyte invasiveness may be mediated by a mechanism independent of antiviral activity of IFN-gamma in monocytes. Down-regulation of MMP-9 in HIV-infected monocytes by interferon-gamma may play an important role in the control of HIV pathogenesis.

Enhanced gamma interferon responses of mouse spleen cells following immunotherapy for tuberculosis relapse.

PubMed

Gil, Olga; Vilaplana, Cristina; Guirado, Evelyn; Díaz, Jorge; Cáceres, Neus; Singh, Mahavir; Cardona, Pere-Joan

2008-11-01

Gamma interferon responses of spleen cells in mice were examined during postchemotherapy relapse of intraperitoneally induced latent tuberculous infection. The mycobacterial extract RUTI, which prevented the relapse, significantly enhanced the immune responses to secreted and structural recombinant mycobacterial antigens, suggesting that RUTI-mediated protection was mediated by activated T cells.

Loss of the Type I Interferon Pathway Increases Vulnerability of Mice to Genital Herpes Simplex Virus 2 Infection ▿

PubMed Central

Conrady, Christopher D.; Halford, William P.; Carr, Daniel J. J.

2011-01-01

The mouse model of genital herpes relies on medoxyprogesterone treatment of female mice to render the vaginal lumen susceptible to inoculation with herpes simplex virus 2 (HSV-2). In the present study, we report that mice deficient in the A1 chain of the type I interferon receptor (CD118−/−) are susceptible to HSV-2 in the absence of medroxyprogesterone preconditioning. In the absence of hormone pretreatment, 2,000 PFU of a clinical isolate of HSV-2 was sufficient to establish a productive infection in the vagina of 75% ± 17% and in the spinal cord of 71% ± 14% of CD118−/− mice, whereas the same dose of HSV-2 replicated to detectable levels in only 13% ± 13% of vaginal samples and 0% of spinal cord samples from wild-type mice, as determined at day 5 postinfection. The susceptibility to HSV-2 infection in the CD118−/− mice was associated with a significant reduction in the infiltration of HSV-specific cytotoxic T lymphocytes into the vaginal tissue, the local production of gamma interferon (IFN-γ), and the expression of T cell-recruiting chemokines CCL5, CXCL9, and CXCL10. Collectively, the results underscore the significant contribution of type I IFNs in resistance to genital HSV-2 infection. PMID:21147921

Toxoplasma gondii infection inhibits Th17-mediated spontaneous development of arthritis in interleukin-1 receptor antagonist-deficient mice.

PubMed

Washino, Takuya; Moroda, Masataka; Iwakura, Yoichiro; Aosai, Fumie

2012-04-01

Interleukin 1 receptor antagonist (IL-1Ra)-deficient BALB/c mice develop spontaneous arthritis resembling human rheumatoid arthritis. We herein report that infection with Toxoplasma gondii, an intracellular protozoan, is capable of ameliorating the spontaneous development of arthritis in IL-1Ra-deficient mice. The onset of arthritis development was delayed and the severity score of arthritis was significantly suppressed in T. gondii-infected mice. Expression of IL-12p40 mRNA from CD11c(+) cells of mesenteric lymph nodes (mLN) and spleen markedly increased at 1 week after peroral infection. While CD11c(+) cells also produced IL-10, IL-1β, and IL-6, CD4(+) T cells from T. gondii-infected mice expressed significantly high levels of T-bet and gamma interferon (IFN-γ) mRNA in both mLN and spleen. Levels of GATA-3/IL-4 mRNA or RORγt/IL-17 mRNA decreased in the infected mice, indicating Th1 cell polarization and the reduction of Th2 and Th17 cell polarization. The severity of arthritis was related to Th1 cell polarization accompanied by Th17 cell reduction, demonstrating the protective role of the T. gondii-derived Th1 response against Th17 cell-mediated arthritis in IL-1Ra-deficient mice.

Interferon Gamma-1b Injection

MedlinePlus

... in people with severe, malignant osteopetrosis (an inherited bone disease). Interferon gamma-1b is in a class of ... you may have flu-like symptoms such as headache, fever, chills, muscle aches, and tiredness after your ...

2'-5' Oligoadenylate synthetase-like 1 (OASL1) deficiency in mice promotes an effective anti-tumor immune response by enhancing the production of type I interferons.

PubMed

Sim, Chan Kyu; Cho, Yeon Sook; Kim, Byung Soo; Baek, In-Jeoung; Kim, Young-Joon; Lee, Myeong Sup

2016-06-01

Type I interferon (IFN-I) plays a critical role in antiviral and antitumor defense. In our previous studies, we showed that IFN-I-inducible 2'-5' oligoadenylate synthetase-like 1 (OASL1) negatively regulates IFN-I production upon viral infection by specifically inhibiting translation of the IFN-I-regulating master transcription factor, interferon regulatory factor 7 (IRF7). In this study, we investigated whether OASL1 plays a negative role in the anti-tumor immune response by using OASL1-deficient (Oasl1 (-/-)) mice and transplantable syngeneic tumor cell models. We found that Oasl1 (-/-) mice demonstrate enhanced resistance to lung metastatic tumors and subcutaneously implanted tumors compared to wild-type (WT) mice. Additionally, we found that cytotoxic effector cells such as CD8(+) T cells (including tumor antigen-specific CD8(+) T cells) and NK cells as well as CD8α(+) DCs (the major antigen cross-presenting cells) were much more frequent (>fivefold) in the Oasl1 (-/-) mouse tumors. Furthermore, the cytotoxic effector cells in Oasl1 (-/-) mouse tumors seemed to be more functionally active. However, the proportion of immunosuppressive myeloid-derived suppressor cells within hematopoietic cells and of regulatory T cells within CD4(+) T cells in Oasl1 (-/-) mouse tumors did not differ significantly from that of WT mice. Tumor-challenged Oasl1 (-/-) mice expressed increased levels of IFN-I and IRF7 protein in the growing tumor, indicating that the enhanced antitumor immune response observed in Oasl1 (-/-) mice was caused by higher IFN-I production in Oasl1 (-/-) mice. Collectively, these results show that OASL1 deficiency promotes the antitumor immune response, and thus, OASL1 could be a good therapeutic target for treating tumors.

The effect of centaurein on interferon-{gamma} expression and Listeria infection in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, S.-L.; Department of Biological Science and Technology, National Chiao Tung University, 1001, Ta Hsueh Road, Hsinchu 300, Taiwan; Yeh, H.-H.

2007-02-15

We previously found that centaurein enhanced IFN-{gamma} transcription in T cells. Here, we demonstrate that centaurein increased the IFN-{gamma} expression in T and NK cells and the serum IFN-{gamma} level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-{gamma} but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-{gamma} expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection viamore » a modulation of IFN-{gamma} expression.« less

Perforin and gamma interferon expression are required for CD4+ and CD8+ T-cell-dependent protective immunity against a human parasite, Trypanosoma cruzi, elicited by heterologous plasmid DNA prime-recombinant adenovirus 5 boost vaccination.

PubMed

de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M

2009-10-01

A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.

Production of interferon-gamma by in vivo tumor-sensitized T cells: Association with active antitumor immunity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bursuker, I.; Pearce, M.T.

1990-02-01

The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less

Critical role of IFN-gamma in CFA-mediated protection of NOD mice from diabetes development.

PubMed

Mori, Yoshiko; Kodaka, Tetsuro; Kato, Takako; Kanagawa, Edith M; Kanagawa, Osami

2009-11-01

IFN-gamma signaling-deficient non-obese diabetic (NOD) mice develop diabetes with similar kinetics to those of wild-type NOD mice. However, the immunization of IFN-gamma signaling-deficient NOD mice with CFA failed to induce long-term protection, whereas wild-type NOD mice receiving CFA remained diabetes-free. CFA also failed to protect IFN-gamma receptor-deficient (IFN-gammaR(-/-)) NOD mice from the autoimmune rejection of transplanted islets, as it does in diabetic NOD mice, and from disease transfer by spleen cells from diabetic NOD mice. These data clearly show that the pro-inflammatory cytokine IFN-gamma is necessary for the CFA-mediated protection of NOD mice from diabetes. There is no difference in the T(h)1/T(h)17 balance between IFN-gammaR(-/-) NOD and wild-type NOD mice. There is also no difference in the total numbers and percentages of regulatory T (Treg) cells in the lymph node CD4(+) T-cell populations between IFN-gammaR(-/-) NOD and wild-type NOD mice. However, pathogenic T cells lacking IFN-gammaR are resistant to the suppressive effect of Treg cells, both in vivo and in vitro. Therefore, it is likely that CFA-mediated protection against diabetes development depends on a change in the balance between Treg cells and pathogenic T cells, and IFN-gamma signaling seems to control the susceptibility of pathogenic T cells to the inhibitory activity of Treg cells.

IgG3 deficiency extends lifespan and attenuates progression of glomerulonephritis in MRL/lpr mice

PubMed Central

2012-01-01

Background Antibodies of the IgG3 subclass have been implicated in the pathogenesis of the spontaneous glomerulonephritis observed in mice of the MRL/MpJ-Tnfrsf6lpr (MRL/lpr) inbred strain which have been widely studied as a model of systemic lupus erythematosus We have produced IgG3-deficient (-/-) mice with the MRL/lpr genetic background to determine whether IgG3 antibodies are necessary for or at least contributory to MRL/lpr-associated nephritis. Results The gamma3 genotype (+/+ vs. +/- vs. -/-) did not appear to significantly affect serum titers of IgG auto-antibodies specific for double-stranded DNA (dsDNA) or α-actinin. However, while substantial serum titers of IgG3 auto-antibodies specific for double-stranded DNA (dsDNA) or α-actinin were seen in gamma3 +/+ mice, somewhat lower serum titers of these IgG3 auto-antibodies were found in gamma3 +/- mice, and gamma3 -/- mice exhibited baseline concentrations of these auto-antibodies. Analysis of immunoglobulins eluted from snap-frozen kidneys obtained from mice of all three gamma3 genotypes at ~18 weeks of age revealed much higher quantities of IgG in the kidneys from gamma3 +/+ than gamma3 -/- mice, and most IgG eluted from +/+ mice was IgG3. The serum creatinine levels in gamma3 +/+ mice substantially exceeded those of age-matched gamma3 -/- mice after ~21 weeks of age. Histopathological examination of kidneys from mice sacrificed at pre-determined ages also revealed more extensive glomerulosclerosis in gamma3 +/+ or +/- mice than in -/- mice beginning at 21 weeks of age. Survival analysis for IgG3-deficient and IgG3-producing MRL/lpr mice revealed that gamma3 -/- mice lived significantly longer (p = 0.0006) than either gamma3 +/- or +/+ mice. Spontaneous death appeared to be due to irreversible renal failure, because > 85% of glomeruli in kidneys from mice that died spontaneously were obliterated by glomerulosclerosis. Conclusions The available evidence suggests that IgG3 deficiency partially protects MRL

Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.

PubMed Central

Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G

1996-01-01

The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817

Interferon-gamma and interlukin-4 patterns in BALB/c mice suffering from cutaneous leishmaniasis treated with cantharidin.

PubMed

Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

2014-06-01

Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. INFECTED BALB/C MICE WERE DIVIDED INTO FIVE GROUPS AS: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth.

Interferon-Gamma and Interlukin-4 Patterns in BALB/c Mice Suffering From Cutaneous Leishmaniasis Treated With Cantharidin

PubMed Central

Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

2014-01-01

Background: Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. Objectives: The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. Materials and Methods: Infected BALB/c mice were divided into five groups as: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. Results: The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. Conclusions: The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth. PMID:25371808

Lactobacillus plantarum 299V in the treatment and prevention of spontaneous colitis in interleukin-10-deficient mice.

PubMed

Schultz, Michael; Veltkamp, Claudia; Dieleman, Levinus A; Grenther, Wetonia B; Wyrick, Pricilla B; Tonkonogy, Susan L; Sartor, R Balfour

2002-03-01

Interleukin (IL)-10-deficient (IL-10-/-) mice develop colitis under specific pathogen-free (SPF) conditions and remain disease free if kept sterile (germ free [GF]). We used four different protocols that varied the time-points of oral administration of Lactobacillus plantarum 299v (L. plantarum) relative to colonization with SPF bacteria to determine whether L. plantarum could prevent and treat colitis induced by SPF bacteria in IL-10-/- mice and evaluated the effect of this probiotic organism on mucosal immune activation. Assessment of colitis included blinded histologic scores, measurements of secreted colonic immunoglobulin isotypes, IL-12 (p40 subunit), and interferon (IFN)-gamma production by anti-CD3-stimulated mesenteric lymph node cells. Treating SPF IL-10-/- mice with L. plantarum attenuated previously established colonic inflammation as manifested by decreased mucosal IL-12, IFN-gamma, and immunoglobulin G2a levels. Colonizing GF animals with L. plantarum and SPF flora simultaneously had no protective effects. Gnotobiotic IL-10-/- mice monoassociated with L. plantarum exhibited mild immune system activation but no colitis. Pretreatment of GF mice by colonization with L. plantarum, then exposure to SPF flora and continued probiotic therapy significantly decreased histologic colitis scores. These results demonstrate that L. plantarum can attenuate immune-mediated colitis and suggest a potential therapeutic role for this agent in clinical inflammatory bowel diseases.

Molecular characterization and development of Sarcocystis speeri sarcocysts in gamma interferon gene knockout mice.

PubMed

Dubey, J P; Verma, S K; Dunams, D; Calero-Bernal, R; Rosenthal, B M

2015-11-01

The North American opossum (Didelphis virginiana) is the definitive host for at least three named species of Sarcocystis: Sarcocystis falcatula, Sarcocystis neurona and Sarcocystis speeri. The South American opossums (Didelphis albiventris, Didelphis marsupialis and Didelphis aurita) are definitive hosts for S. falcatula and S. lindsayi. The sporocysts of these Sarcocystis species are similar morphologically. They are also not easily distinguished genetically because of the difficulties of DNA extraction from sporocysts and availability of distinguishing genetic markers. Some of these species can be distinguished by bioassay; S. neurona and S. speeri are infective to gamma interferon gene knockout (KO) mice, but not to budgerigars (Melopsittacus undulatus); whereas S. falcatula and S. lindsayi are infective to budgerigars but not to KO mice. The natural intermediate host of S. speeri is unknown. In the present study, development of sarcocysts of S. speeri in the KO mice is described. Sarcocysts were first seen at 12 days post-inoculation (p.i.), and they became macroscopic (up to 4 mm long) by 25 days p.i. The structure of the sarcocyst wall did not change from the time bradyzoites had formed at 50-220 days p.i. Sarcocysts contained unique villar protrusions, 'type 38'. The polymerase chain reaction amplifications and sequences analysis of three nuclear loci (18S rRNA, 28S rRNA and ITS1) and two mitochondrial loci (cox1 and cytb) of S. speeri isolate from an Argentinean opossum (D. albiventris) confirmed its membership among species of Sarcocystis and indicated an especially close relationship to another parasite in this genus that employs opossums as its definitive host, S. neurona. These results should be useful in finding natural intermediate host of S. speeri.

Thyroid epithelial cell hyperplasia in IFN-gamma deficient NOD.H-2h4 mice.

PubMed

Yu, Shiguang; Sharp, Gordon C; Braley-Mullen, Helen

2006-01-01

The role of inflammatory cells in thyroid epithelial cell (thyrocyte) hyperplasia is unknown. Here, we demonstrate that thyrocyte hyperplasia in IFN-gamma-/- NOD.H-2h4 mice has an autoimmune basis. After chronic exposure to increased dietary iodine, 60% of IFN-gamma-/- mice had severe thyrocyte hyperplasia with minimal or moderate lymphocyte infiltration, and thyroid dysfunction with reduced serum T4. All mice produced anti-thyroglobulin autoantibody. Some wild-type NOD.H-2h4 mice had isolated areas of thyrocyte hyperplasia with predominantly lymphocytic infiltration, whereas IL-4-/- and 50% of wild-type NOD.H-2h4 mice developed lymphocytic thyroiditis but no thyrocyte hyperplasia. Both thyroid infiltrating inflammatory cells and environmental factors (iodine) were required to induce thyrocyte hyperplasia. Splenocytes from IFN-gamma-/- mice with thyrocyte hyperplasia, but not splenocytes from naïve IFN-gamma-/- mice, induced hyperplasia in IFN-gamma-/- NOD.H-2h4.SCID mice. These results may provide clues for understanding the mechanisms underlying development of epithelial cell hyperplasia not only in thyroids but also in other tissues and organs.

CXCR6 promotes atherosclerosis by supporting T-cell homing, interferon-gamma production, and macrophage accumulation in the aortic wall.

PubMed

Galkina, Elena; Harry, Brian L; Ludwig, Andreas; Liehn, Elisa A; Sanders, John M; Bruce, Anthony; Weber, Christian; Ley, Klaus

2007-10-16

T lymphocytes are thought to be important in atherosclerosis, but very little is known about the mechanisms of lymphocyte recruitment into atherosclerosis-prone aortas. In this study we tested the hypothesis that CXCR6, a chemokine receptor that is expressed on a subset of CD4+ T helper 1 cells and natural killer T cells, is involved in lymphocyte homing into the aortic wall and modulates the development and progression of atherosclerosis. To investigate the role of CXCR6 in the development and progression of atherosclerosis, we bred CXCR6-deficient (CXCR6(GFP/GFP)) mice with apolipoprotein E-deficient (ApoE(-/-)) mice. We found that CXCR6(GFP/GFP)/ApoE(-/-) mice fed a Western diet for 17 weeks or a chow diet for 56 weeks had decreased atherosclerosis compared with ApoE(-/-) controls. Flow cytometry analysis of the aortas from CXCR6(GFP/GFP)/ApoE(-/-) mice showed that the reduction of atherosclerosis was accompanied by a decreased percentage of CXCR6+ T cells within the aortas. Short-term homing experiments demonstrated that CXCR6 is involved in the recruitment of CXCR6+ leukocytes into the atherosclerosis-prone aortic wall. The reduced percentage of CXCR6+ T cells within the aortas resulted in significantly diminished production of interferon-gamma and reduction of CD11b+/CD68+ macrophages in the aorta. These data provide evidence for a proatherosclerotic role of CXCR6. Absence of CXCR6 alters the recruitment of CXCR6+ leukocytes and modulates the local immune response within the aortic wall.

A lethal murine infection model for dengue virus 3 in AG129 mice deficient in type I and II interferon receptors leads to systemic disease.

PubMed

Sarathy, Vanessa V; White, Mellodee; Li, Li; Gorder, Summer R; Pyles, Richard B; Campbell, Gerald A; Milligan, Gregg N; Bourne, Nigel; Barrett, Alan D T

2015-01-15

The mosquito-borne disease dengue (DEN) is caused by four serologically and genetically related viruses, termed DENV-1 to DENV-4. Infection with one DENV usually leads to acute illness and results in lifelong homotypic immunity, but individuals remain susceptible to infection by the other three DENVs. The lack of a small-animal model that mimics systemic DEN disease without neurovirulence has been an obstacle, but DENV-2 models that resemble human disease have been recently developed in AG129 mice (deficient in interferon alpha/beta and interferon gamma receptor signaling). However, comparable DENV-1, -3, and -4 models have not been developed. We utilized a non-mouse-adapted DENV-3 Thai human isolate to develop a lethal infection model in AG129 mice. Intraperitoneal inoculation of six to eight-week-old animals with strain C0360/94 led to rapid, fatal disease. Lethal C0360/94 infection resulted in physical signs of illness, high viral loads in the spleen, liver, and large intestine, histological changes in the liver and spleen tissues, and increased serum cytokine levels. Importantly, the animals developed vascular leakage, thrombocytopenia, and leukopenia. Overall, we have developed a lethal DENV-3 murine infection model, with no evidence of neurotropic disease based on a non-mouse-adapted human isolate, which can be used to investigate DEN pathogenesis and to evaluate candidate vaccines and antivirals. This suggests that murine models utilizing non-mouse-adapted isolates can be obtained for all four DENVs. Dengue (DEN) is a mosquito-borne disease caused by four DENV serotypes (DENV-1, -2, -3, and -4) that have no treatments or vaccines. Primary infection with one DENV usually leads to acute illness followed by lifelong homotypic immunity, but susceptibility to infection by the other three DENVs remains. Therefore, a vaccine needs to protect from all four DENVs simultaneously. To date a suitable animal model to mimic systemic human illness exists only for DENV-2 in

[Expression of gamma interferon during HPV and Chlamydia trachomatis infection in cervical samples].

PubMed

Colín-Ferreyra, María Del Carmen; Mendieta-Zerón, Hugo; Romero-Figueroa, María Del Socorro; Martínez-Madrigal, Migdania; Martínez-Pérez, Sergio; Domínguez-García, María Victoria

2015-02-01

The aim of this study was to mesure the expression of gamma interferon in HPV and Chlamydia trachomatis infection in squamous intraepithelial lesions. Samples from 100 patients diagnosed by colposcopy with or without squamous intraepithelial lesions were used in the present study. Each patient was found to be infected by HPV and C.trachomatis. Relative gamma interferon mRNA expression was assessed using a real-time reverse transcriptase PCR assay (RT-PCR). The relative units of expression of gamma interferon mRNA were 13, 1.8 and 0.3, for HPV and C.trachomatis co-infection, or HPV or C.trachomatis infection, respectively. HPV and C.trachomatis could overstimulate the expression of gamma interferon. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.

PubMed

Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong

2017-05-12

Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.

Protease-Activated Receptor-2 Deficiency Attenuates Atherosclerotic Lesion Progression and Instability in Apolipoprotein E-Deficient Mice

PubMed Central

Zuo, Pengfei; Zuo, Zhi; Zheng, Yueyue; Wang, Xin; Zhou, Qianxing; Chen, Long; Ma, Genshan

2017-01-01

Inflammatory mechanisms are involved in the process of atherosclerotic plaque formation and rupture. Accumulating evidence suggests that protease-activated receptor (PAR)-2 contributes to the pathophysiology of chronic inflammation on the vasculature. To directly examine the role of PAR-2 in atherosclerosis, we generated apolipoprotein E/PAR-2 double-deficient mice. Mice were fed with high-fat diet for 12 weeks starting at ages of 6 weeks. PAR-2 deficiency attenuated atherosclerotic lesion progression with reduced total lesion area, reduced percentage of stenosis and reduced total necrotic core area. PAR-2 deficiency increased fibrous cap thickness and collagen content of plaque. Moreover, PAR-2 deficiency decreased smooth muscle cell content, macrophage accumulation, matrix metallopeptidase-9 expression and neovascularization in plaque. Relative quantitative PCR assay using thoracic aorta revealed that PAR-2 deficiency reduced mRNA expression of inflammatory molecules, such as vascular cell adhesion molecule-1, intercellular adhesion molecule-1, tumor necrosis factor (TNF)-α and monocyte chemoattractant protein (MCP)-1. In vitro experiment, we found that PAR-2 deficiency reduced mRNA expression of interferon-γ, interleukin-6, TNF-α and MCP-1 in macrophage under unstimulated and lipopolysaccharide-stimulated conditions. These results suggest that PAR-2 deficiency attenuates the progression and instability of atherosclerotic plaque. PMID:28959204

Fish oil feeding delays influenza virus clearance and impairs production of interferon-gamma and virus-specific immunoglobulin A in the lungs of mice.

PubMed

Byleveld, P M; Pang, G T; Clancy, R L; Roberts, D C

1999-02-01

Ingestion of fish oil can suppress the inflammatory response to injury and may impair host resistance to infection. To investigate the effect of a diet containing fish oil on immunity to viral infection, 148 BALB/c mice were fed diets containing 3 g/100 g of sunflower oil with either 17 g/100 g of fish oil or beef tallow for 14 d before intranasal challenge with live influenza virus. At d 1 and d 5 after infection, the mice fed fish oil had higher lung viral load and lower body weight (P < 0.05). In addition to the greater viral load and weight loss at d 5 after infection, the fish oil group consumed less food (P < 0.05) while the beef tallow group was clearing the virus, had regained their preinfection weights and was returning to their preinfection food consumption. The fish oil group had impaired production of lung interferon-gamma (IFN-gamma), serum immunoglobulin (Ig) G and lung IgA-specific antibodies (all P < 0. 05) although lung IFN-alpha/beta and the relative proportions of bronchial lymph node CD4+ and CD8+ T lymphocytes did not differ between groups after infection. The present study demonstrates a delay in virus clearance in mice fed fish oil associated with reduced IFN-gamma and antibody production and a greater weight loss and suppression of appetite following influenza virus infection. However, differences observed during the course of infection did not affect the ultimate outcome as both groups cleared the virus and returned to preinfection food consumption and body weight by d 7.

Rapid development of colitis in NSAID-treated IL-10-deficient mice.

PubMed

Berg, Daniel J; Zhang, Juan; Weinstock, Joel V; Ismail, Hanan F; Earle, Keith A; Alila, Hector; Pamukcu, Rifat; Moore, Steven; Lynch, Richard G

2002-11-01

Interleukin (IL)-10 is an anti-inflammatory and immune regulatory cytokine. IL-10-deficient mice (IL-10(-/-)) develop chronic inflammatory bowel disease (IBD), indicating that endogenous IL-10 is a central regulator of the mucosal immune response. Prostaglandins are lipid mediators that may be important mediators of intestinal inflammation. In this study we assessed the role of prostaglandins in the regulation of mucosal inflammation in the IL-10(-/-) mouse model of IBD. Prostaglandin (PG) synthesis was inhibited with nonselective or cyclooxygenase (COX)-isoform selective inhibitors. Severity of inflammation was assessed histologically. Cytokine production was assessed by ribonuclease protection analysis and enzyme-linked immunosorbent assay. PGE(2) levels were assessed by enzyme immunoassay. COX-1 and COX-2 expression was assessed by Western blot analysis. Nonsteroidal anti-inflammatory drug (NSAID) treatment of wild-type mice had minimal effect on the colon. In contrast, NSAID treatment of 4-week-old IL-10(-/-) mice resulted in rapid development of colitis characterized by infiltration of the lamina propria with macrophages and interferon gamma-producing CD4(+) T cells. Colitis persisted after withdrawal of the NSAID. NSAID treatment decreased colonic PGE(2) levels by 75%. Treatment of IL-10(-/-) mice with sulindac sulfone (which does not inhibit PG production) did not induce colitis whereas the NSAID sulindac induced severe colitis. COX-1- or COX-2-selective inhibitors used alone did not induce IBD in IL-10(-/-) mice. However, the combination of COX-1- and COX-2-selective inhibitors did induce colitis. NSAID treatment of IL-10(-/-) mice results in the rapid development of severe, chronic IBD. Endogenous PGs are important inhibitors of the development of intestinal inflammation in IL-10(-/-) mice.

Alpha-beta T cells provide protection against lethal encephalitis in the murine model of VEEV infection

PubMed Central

Paessler, Slobodan; Yun, Nadezhda E.; Judy, Barbara M.; Dziuba, Natallia; Zacks, Michele A.; Grund, Anna H.; Frolov, Ilya; Campbell, Gerald A.; Weaver, Scott C.; Estes, D. Mark

2007-01-01

We evaluated the safety and immunogenicity of a chimeric alphavirus vaccine candidate in mice with selective immunodeficiencies. This vaccine candidate was highly attenuated in mice with deficiencies in the B and T cell compartments, as well as in mice with deficient gamma-interferon responsiveness. However, the level of protection varied among the strains tested. Wild type mice were protected against lethal VEEV challenge. In contrast, alpha/beta (αβ) TCR-deficient mice developed lethal encephalitis following VEEV challenge, while mice deficient in gamma/delta ( γδ) T cells were protected. Surprisingly, the vaccine potency was diminished by 50% in animals lacking interferon-gamma receptor alpha chain (R1)-chain and a minority of vaccinated immunoglobulin heavy chain-deficient (μMT) mice survived challenge, which suggests that neutralizing antibody may not be absolutely required for protection. Prolonged replication of encephalitic VEEV in the brain of pre-immunized mice is not lethal and adoptive transfer experiments indicate that CD3+ T cells are required for protection. PMID:17610927

Alpha-beta T cells provide protection against lethal encephalitis in the murine model of VEEV infection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paessler, Slobodan; Yun, Nadezhda E.; Judy, Barbara M.

2007-10-25

We evaluated the safety and immunogenicity of a chimeric alphavirus vaccine candidate in mice with selective immunodeficiencies. This vaccine candidate was highly attenuated in mice with deficiencies in the B and T cell compartments, as well as in mice with deficient gamma-interferon responsiveness. However, the level of protection varied among the strains tested. Wild type mice were protected against lethal VEEV challenge. In contrast, alpha/beta ({alpha}{beta}) TCR-deficient mice developed lethal encephalitis following VEEV challenge, while mice deficient in gamma/delta ({gamma}{delta}) T cells were protected. Surprisingly, the vaccine potency was diminished by 50% in animals lacking interferon-gamma receptor alpha chain (R1)-chainmore » and a minority of vaccinated immunoglobulin heavy chain-deficient ({mu}MT) mice survived challenge, which suggests that neutralizing antibody may not be absolutely required for protection. Prolonged replication of encephalitic VEEV in the brain of pre-immunized mice is not lethal and adoptive transfer experiments indicate that CD3{sup +} T cells are required for protection.« less

Plasma interferon-gamma and interleukin-10 concentrations in systemic meningococcal disease compared with severe systemic Gram-positive septic shock.

PubMed

Bjerre, Anna; Brusletto, Berit; Høiby, Ernst Arne; Kierulf, Peter; Brandtzaeg, Petter

2004-02-01

To analyze plasma interferon-gamma and interleukin-10 concentrations in patients with systemic meningococcal disease and patients with severe Gram-positive septic shock caused by Streptococcus pneumoniae or Staphylococcus aureus. To study the in vitro cytokine (interferon-gamma and interleukin-10) responses in a whole blood model boosted with heat-killed Neisseria meningitidis, S. pneumoniae, and S. aureus before and after treatment with recombinant interleukin-10 or recombinant interferon-gamma. Experimental study. Laboratory. Plasma samples were collected from patients with systemic meningococcal disease (n = 66) and patients with severe Gram-positive septic shock caused by S. pneumoniae (n = 4) or S. aureus (n = 3). Whole blood was boosted with heat-killed N. meningitidis, S. pneumoniae, and S. aureus (1 x 106 colony forming units/mL), and plasmas were analyzed for interleukin-10 or interferon-gamma at 0, 5, 12, and 24 hrs. Furthermore, recombinant interleukin-10 or recombinant interferon-gamma was added before bacteria, and the effect on the secretion of interferon-gamma and interleukin-10, respectively, was analyzed after 24 hrs. The median concentration of interferon-gamma was 15 pg/mL and of interleukin-10 was 10,269 pg/mL in patients with meningococcal septic shock (n = 24) compared with median interferon-gamma concentration of 3400 pg/mL and interleukin-10 concentration of 465 pg/mL in patients with severe Gram-positive shock (p =.001). Increased interferon-gamma concentrations were associated with case fatality (p =.011). In a whole blood model we demonstrated that 1 x 106 colony forming units/mL of N. meningitidis induced more interleukin-10 but less interferon-gamma than S. pneumoniae. S. aureus induced minimal secretion of both cytokines. Recombinant interleukin-10 efficiently down-regulated the secretion of interferon-gamma, and vice versa, as shown in a whole blood model. We speculate whether high concentrations of interleukin-10 contribute to the

Dietary Selenium Levels Affect Selenoprotein Expression and Support the Interferon-γ and IL-6 Immune Response Pathways in Mice

PubMed Central

Tsuji, Petra A.; Carlson, Bradley A.; Anderson, Christine B.; Seifried, Harold E.; Hatfield, Dolph L.; Howard, Michael T.

2015-01-01

Selenium is an essential element that is required to support a number of cellular functions and biochemical pathways. The objective of this study was to examine the effects of reduced dietary selenium levels on gene expression to assess changes in expression of non-selenoprotein genes that may contribute to the physiological consequences of selenium deficiency. Mice were fed diets that were either deficient in selenium or supplemented with selenium in the form of sodium selenite for six weeks. Differences in liver mRNA expression and translation were measured using a combination of ribosome profiling, RNA-Seq, microarrays, and qPCR. Expression levels and translation of mRNAs encoding stress-related selenoproteins were shown to be up-regulated by increased selenium status, as were genes involved in inflammation and response to interferon-γ. Changes in serum cytokine levels were measured which confirmed that interferon-γ, as well as IL-6, were increased in selenium adequate mice. Finally, microarray and qPCR analysis of lung tissue demonstrated that the selenium effects on immune function are not limited to liver. These data are consistent with previous reports indicating that adequate selenium levels can support beneficial immune responses, and further identify the IL-6 and interferon-γ pathways as being responsive to dietary selenium intake. PMID:26258789

Whole-exome sequencing reveals a rare interferon gamma receptor 1 mutation associated with myasthenia gravis.

PubMed

Qi, Guoyan; Liu, Peng; Gu, Shanshan; Yang, Hongxia; Dong, Huimin; Xue, Yinping

2018-04-01

Our study is aimed to explore the underlying genetic basis of myasthenia gravis. We collected a Chinese pedigree with myasthenia gravis, and whole-exome sequencing was performed on the two affected siblings and their parents. The candidate pathogenic gene was identified by bioinformatics filtering, which was further verified by Sanger sequencing. The homozygous mutation c.G40A (p.V14M) in interferon gamma receptor 1was identified. Moreover, the mutation was also detected in 3 cases of 44 sporadic myasthenia gravis patients. The p.V14M substitution in interferon gamma receptor 1 may affect the signal peptide function and the translocation on cell membrane, which could disrupt the binding of the ligand of interferon gamma and antibody production, contributing to myasthenia gravis susceptibility. We discovered that a rare variant c.G40A in interferon gamma receptor 1 potentially contributes to the myasthenia gravis pathogenesis. Further functional studies are needed to confirm the effect of the interferon gamma receptor 1 on the myasthenia gravis phenotype.

(PCG) Protein Crystal Growth Gamma-Interferon

NASA Technical Reports Server (NTRS)

1989-01-01

(PCG) Protein Crystal Growth Gamma-Interferon. Stimulates the body's immune system and is used clinically in the treatment of cancer. Potential as an anti-tumor agent against solid tumors as well as leukemia's and lymphomas. It has additional utility as an anti-ineffective agent, including antiviral, anti-bacterial, and anti-parasitic activities. Principal Investigator on STS-26 was Charles Bugg.

Hematopoietic stem cell gene therapy for IFNγR1 deficiency protects mice from mycobacterial infections.

PubMed

Hetzel, Miriam; Mucci, Adele; Blank, Patrick; Nguyen, Ariane Hai Ha; Schiller, Jan; Halle, Olga; Kühnel, Mark-Philipp; Billig, Sandra; Meineke, Robert; Brand, Daniel; Herder, Vanessa; Baumgärtner, Wolfgang; Bange, Franz-Christoph; Goethe, Ralph; Jonigk, Danny; Förster, Reinhold; Gentner, Bernhard; Casanova, Jean-Laurent; Bustamante, Jacinta; Schambach, Axel; Kalinke, Ulrich; Lachmann, Nico

2018-02-01

Mendelian susceptibility to mycobacterial disease is a rare primary immunodeficiency characterized by severe infections caused by weakly virulent mycobacteria. Biallelic null mutations in genes encoding interferon gamma receptor 1 or 2 ( IFNGR1 or IFNGR2 ) result in a life-threatening disease phenotype in early childhood. Recombinant interferon γ (IFN-γ) therapy is inefficient, and hematopoietic stem cell transplantation has a poor prognosis. Thus, we developed a hematopoietic stem cell (HSC) gene therapy approach using lentiviral vectors that express Ifnγr1 either constitutively or myeloid specifically. Transduction of mouse Ifnγr1 -/- HSCs led to stable IFNγR1 expression on macrophages, which rescued their cellular responses to IFN-γ. As a consequence, genetically corrected HSC-derived macrophages were able to suppress T-cell activation and showed restored antimycobacterial activity against Mycobacterium avium and Mycobacterium bovis Bacille Calmette-Guérin (BCG) in vitro. Transplantation of genetically corrected HSCs into Ifnγr1 -/- mice before BCG infection prevented manifestations of severe BCG disease and maintained lung and spleen organ integrity, which was accompanied by a reduced mycobacterial burden in lung and spleen and a prolonged overall survival in animals that received a transplant. In summary, we demonstrate an HSC-based gene therapy approach for IFNγR1 deficiency, which protects mice from severe mycobacterial infections, thereby laying the foundation for a new therapeutic intervention in corresponding human patients. © 2018 by The American Society of Hematology.

Interleukin-4 but not gamma interferon production correlates with the severity of murine cutaneous leishmaniasis.

PubMed Central

Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T

1993-01-01

For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376

Differential co-promoting activities of alpha, beta and gamma interferons in the murine skin two-stage carcinogenesis model.

PubMed

Reiners, J J; Cantu, A; Thai, G; Pavone, A

1993-03-01

SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.

Leukocyte Bim deficiency does not impact atherogenesis in ldlr -/- mice, despite a pronounced induction of autoimmune inflammation.

PubMed

Temmerman, Lieve; Westra, Marijke M; Bot, Ilze; van Vlijmen, Bart J M; van Bree, Niek; Bot, Martine; Habets, Kim L L; Keulers, Tom G H; van der Vlag, Johan; Cotter, Thomas G; van Berkel, Theo J C; Biessen, Erik A L

2017-06-08

Proapoptotic Bcl-2 family member Bim is particularly relevant for deletion of autoreactive and activated T and B cells, implicating Bim in autoimmunity. As atherosclerosis is a chronic inflammatory process with features of autoimmune disease, we investigated the impact of hematopoietic Bim deficiency on plaque formation and parameters of plaque stability. Bim -/- or wild type bone marrow transplanted ldlr -/- mice were fed a Western type diet (WTD) for 5 or 10 weeks, after which they were immunophenotyped and atherosclerotic lesions were analyzed. Bim -/- transplanted mice displayed splenomegaly and overt lymphocytosis. CD4 + and CD8 + T cells were more activated (increased CD69 and CD71 expression, increased interferon gamma production). B cells were elevated by 147%, with a shift towards the pro-atherogenic IgG-producing B2 cell phenotype, resulting in a doubling of anti-oxLDL IgG1 antibody titers in serum of bim -/- mice. Bim -/- mice displayed massive intraplaque accumulation of Ig complexes and of lesional T cells, although this did not translate in changes in plaque size or stability features (apoptotic cell and macrophage content). The surprising lack in plaque phenotype despite the profound pro-atherogenic immune effects may be attributable to the sharp reduction of serum cholesterol levels in WTD fed bim -/- mice.

Citrullus lanatus 'sentinel' (watermelon) extract reduces atherosclerosis in LDL receptor-deficient mice.

PubMed

Poduri, Aruna; Rateri, Debra L; Saha, Shubin K; Saha, Sibu; Daugherty, Alan

2013-05-01

Watermelon (Citrullus lanatus or C. lanatus) has many potentially bioactive compounds including citrulline, which may influence atherosclerosis. In this study, we determined the effects of C. lanatus, provided as an extract of the cultivar 'sentinel,' on hypercholesterolemia-induced atherosclerosis in mice. Male low-density lipoprotein receptor-deficient mice at 8 weeks old were given either C. lanatus 'sentinel' extract (2% vol/vol; n=10) or a mixture of matching carbohydrates (2% vol/vol; n=8) as the control in drinking water while being fed a saturated fat-enriched diet for 12 weeks ad libitum. Mice consuming C. lanatus 'sentinel' extract had significantly increased plasma citrulline concentrations. Systolic blood pressure was comparable between the two groups. Consumption of C. lanatus 'sentinel' extract led to lower body weight and fat mass without influencing lean mass. There were no differences in food and water intake and in urine output between the two groups. C. lanatus 'sentinel' extract administration decreased plasma cholesterol concentrations that were attributed to reductions of intermediate-/low-density lipoprotein cholesterol. Plasma concentrations of monocyte chemoattractant protein-1 and interferon-gamma were decreased and those of interleukin-10 were increased in mice consuming C. lanatus 'sentinel' extract. Intake of C. lanatus 'sentinel' extract resulted in reductions of atherosclerosis in both aortic arch and thoracic regions. In conclusion, consumption of C. lanatus 'sentinel' extract led to reduced body weight gain, decreased plasma cholesterol concentrations, improved homeostasis of pro- and anti-inflammatory cytokines, and attenuated development of atherosclerosis without affecting systolic blood pressure in hypercholesterolemic mice. Copyright © 2013 Elsevier Inc. All rights reserved.

IFN-gamma induction by SCG, 1,3-beta-D-glucan from Sparassis crispa, in DBA/2 mice in vitro.

PubMed

Harada, Toshie; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito

2002-12-01

Sparassis crispa Fr. in an edible mushroom recently cultivable in Japan. A branched beta-glucan from S. crispa (SCG) is a major 6-branched 1,3-beta-D-glucan showing antitumor activity. In this study, we examined interferon-gamma (IFN-gamma) induction by SCG from splenocytes in DBA/2 mice in vitro. In the splenocytes derived from almost all inbred strains of mice except for DBA/1 and DBA/2 mice, IFN-gamma production was not induced by SCG. The breeder and genders of DBA/2 mice showed no influence on IFN-gamma induction by SCG. On the other hand, the magnitude of IFN-gamma induction was lower in young mice than in their older counterparts. IFN-gamma was induced by SCG in adherent splenocytes, but IFN-gamma production was most significantly increased by SCG in instances involving coexistence of adherent and nonadherent splenocytes. In fact, inhibition of cell-cell contact reduced IFN-gamma induction by SCG. In addition, interleukin-12 p70 (IL-12p70) was induced by SCG in DBA/2 mice. It was suggested that soluble factors and cell-cell contact mediate synergistic effects on SCG-induced IFN-gamma production.

Sarcocystis neurona infection in gamma interferon gene knockout (KO) mice: comparative infectivity of sporocysts in two strains of KO mice, effect of trypsin digestion on merozoite viability, and infectivity of bradyzoites to KO mice and cell culture.

PubMed

Dubey, J P; Sundar, N; Kwok, O C H; Saville, W J A

2013-09-01

The protozoan Sarcocystis neurona is the primary cause of Equine Protozoal Myeloencephalitis (EPM). EPM or EPM-like illness has been reported in horses, sea otters, and several other mammals. The gamma interferon gene knockout (KO) mouse is often used as a model to study biology and discovery of new therapies against S. neurona because it is difficult to induce clinical EPM in other hosts, including horses. In the present study, infectivity of three life cycle stages (merozoites, bradyzoites, sporozoites) to KO mice and cell culture was studied. Two strains of KO mice (C57-black, and BALB/c-derived, referred here as black or white) were inoculated orally graded doses of S. neurona sporocysts; 12 sporocysts were infective to both strains of mice and all infected mice died or became ill within 70 days post-inoculation. Although there was no difference in infectivity of sporocysts to the two strains of KO mice, the disease was more severe in black mice. S. neurona bradyzoites were not infectious to KO mice and cell culture. S. neurona merozoites survived 120 min incubation in 0.25% trypsin, indicating that trypsin digestion can be used to recover S. neurona from tissues of acutely infected animals. Published by Elsevier B.V.

[Peptide Ala-Glu-Asp-Gly and interferon gamma: their role in immune response during aging].

PubMed

Lin'kova, N S; Kuznik, B I; Khavinson, V Kh

2012-01-01

The decrease of lymphocyte interferon gamma expression during aging is one of the main mechanisms leading to the immunodeficiency state in the elderly. Cell penetrating geroprotective peptide Ala-Glu-Asp-Gly has the capability to activate the proliferation of lymphocytes in thymus during its aging. The nucleotide sequence which is complementary contacted with peptide Ala-Glu-Asp-Gly was found in promoter region of interferon gamma gene. Thus, the immune protection of this peptide can be explained by its activation of the interferon gamma production in T-cells.

The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis

DTIC Science & Technology

2017-09-01

AWARD NUMBER: W81XWH-16-1-0537 TITLE: The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis PRINCIPAL INVESTIGATOR: Stanley...Sep 2016 - 31 Aug 2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis 5b...subsets that likely counteracts IL-2 regulator activity and contribute to the pathogenesis of RA. 15. SUBJECT TERMS Rheumatoid arthritis ; Autoimmunity; T

Granzyme A Deficiency Breaks Immune Tolerance and Promotes Autoimmune Diabetes Through a Type I Interferon-Dependent Pathway.

PubMed

Mollah, Zia U A; Quah, Hong Sheng; Graham, Kate L; Jhala, Gaurang; Krishnamurthy, Balasubramanian; Dharma, Joanna Francisca M; Chee, Jonathan; Trivedi, Prerak M; Pappas, Evan G; Mackin, Leanne; Chu, Edward P F; Akazawa, Satoru; Fynch, Stacey; Hodson, Charlotte; Deans, Andrew J; Trapani, Joseph A; Chong, Mark M W; Bird, Phillip I; Brodnicki, Thomas C; Thomas, Helen E; Kay, Thomas W H

2017-12-01

Granzyme A is a protease implicated in the degradation of intracellular DNA. Nucleotide complexes are known triggers of systemic autoimmunity, but a role in organ-specific autoimmune disease has not been demonstrated. To investigate whether such a mechanism could be an endogenous trigger for autoimmunity, we examined the impact of granzyme A deficiency in the NOD mouse model of autoimmune diabetes. Granzyme A deficiency resulted in an increased incidence in diabetes associated with accumulation of ssDNA in immune cells and induction of an interferon response in pancreatic islets. Central tolerance to proinsulin in transgenic NOD mice was broken on a granzyme A-deficient background. We have identified a novel endogenous trigger for autoimmune diabetes and an in vivo role for granzyme A in maintaining immune tolerance. © 2017 by the American Diabetes Association.

Gene expression and production of tumor necrosis factor alpha, interleukin 1, interleukin 6, and gamma interferon in C3H/HeN and C57BL/6N mice in acute Mycoplasma pulmonis disease.

PubMed Central

Faulkner, C B; Simecka, J W; Davidson, M K; Davis, J K; Schoeb, T R; Lindsey, J R; Everson, M P

1995-01-01

Studies were conducted to determine whether the production of various cytokines is associated with Mycoplasma pulmonis disease expression. Susceptible C3H/HeN and resistant C57BL/6N mice were inoculated intranasally with 10(7) CFU of virulent M. pulmonis UAB CT or avirulent M. pulmonis UAB T. Expression of genes for tumor necrosis factor alpha (TNF-alpha), interleukin 1 alpha (IL-1 alpha), IL-1 beta, IL-6, and gamma interferon (IFN-gamma) in whole lung tissue and TNF-alpha gene expression in bronchoalveolar lavage (BAL) cells was determined by reverse transcription-PCR using specific cytokine primers at various times postinoculation. In addition, concentrations of TNF-alpha, IL-1, IL-6, and IFN-gamma were determined in BAL fluid and serum samples at various times postinoculation. Our results showed that there was a sequential appearance of cytokines in the lungs of infected mice: TNF-alpha, produced primarily by BAL cells, appeared first, followed by IL-1 and IL-6, which were followed by IFN-gamma. Susceptible C3H/HeN mice had higher and more persistent concentrations of TNF-alpha and IL-6 in BAL fluid than did resistant C57BL/6N mice, indicating that TNF-alpha and possibly IL-6 are important factors in pathogenesis of acute M. pulmonis disease in mice. Serum concentrations of IL-6 were elevated in C3H/HeN mice, but not C57BL/6N mice, following infection with M. pulmonis, suggesting that IL-6 has both local and systemic effects in M. pulmonis disease. PMID:7558323

A novel mechanism of skin tumor promotion involving interferon-gamma (IFNγ)/signal transducer and activator of transcription-1 (Stat1) signaling.

PubMed

Bozeman, Ronald; Abel, Erika L; Macias, Everardo; Cheng, Tianyi; Beltran, Linda; DiGiovanni, John

2015-08-01

The current study was designed to explore the role of signal transducer and activator of transcription 1 (Stat1) during tumor promotion using the mouse skin multistage carcinogenesis model. Topical treatment with both 12-O-tetradecanoylphorbol-13-acetate (TPA) and 3-methyl-1,8-dihydroxy-9-anthrone (chrysarobin or CHRY) led to rapid phosphorylation of Stat1 on both tyrosine (Y701) and serine (S727) residues in epidermis. CHRY treatment also led to upregulation of unphosphorylated Stat1 (uStat1) at later time points. CHRY treatment also led to upregulation of interferon regulatory factor 1 (IRF-1) mRNA and protein, which was dependent on Stat1. Further analyses demonstrated that topical treatment with CHRY but not TPA upregulated interferon-gamma (IFNγ) mRNA in the epidermis and that the induction of both IRF-1 and uStat1 was dependent on IFNγ signaling. Stat1 deficient (Stat1(-/-) ) mice were highly resistant to skin tumor promotion by CHRY. In contrast, the tumor response (in terms of both papillomas and squamous cell carcinomas) was similar in Stat1(-/-) mice and wild-type littermates with TPA as the promoter. Maximal induction of both cyclooxygenase-2 and inducible nitric oxide synthase in epidermis following treatment with CHRY was also dependent on the presence of functional Stat1. These studies define a novel mechanism associated with skin tumor promotion by the anthrone class of tumor promoters involving upregulation of IFNγ signaling in the epidermis and downstream signaling through activated (phosphorylated) Stat1, IRF-1 and uStat1. © 2014 Wiley Periodicals, Inc.

Aneuploidy assessed by DNA index influences the effect of iron status on plasma and/or supernatant cytokine levels and progression of cells through the cell cycle in a mouse model.

PubMed

Kuvibidila, Solo; Porretta, Connie; Baliga, Surendra

2014-02-01

Aneuploidy, a condition associated with altered chromosome number, hence DNA index, is frequently seen in many diseases including cancers and affects immunity. Iron, an essential nutrient for humans, modulates the immune function and the proliferation of normal and cancer cells. To determine whether impaired immunity seen in iron-deficient subjects may be related to aneuploidy, we measured spleen cell DNA index, percent of cells in different phases of the cell cycle, plasma and/or supernatant IL-2, IL-10, IL-12, and interferon-gamma in control, pair-fed, iron-deficient, and iron-replete mice (N=20-22/group). The test and control diets differed only in iron content (0.09mmol/kg versus 0.9mmol/kg) and were fed for 68days. Mean levels of hemoglobin and liver iron stores of iron-deficient and iron-replete mice were 40-60% lower than those of control and pair-fed mice (P<0.05). Mean plasma levels of IL-10, interferon-gamma and percent of cells in S+G2/M phases were lower in mice with than in those without aneuploidy (P<0.05). Lowest plasma IL-12 and interferon-gamma concentrations were observed in iron-deficient mice with aneuploidy. Mean percents of cultures with aneuploidy and DNA indexes were higher in iron-deficient and iron-replete than in control and pair-fed mice likely due to delayed cell division (P<0.05). Aneuploidy decreased the concentration of IL-2 and interferon-gamma in baseline cultures while it increased that of interferon-gamma in anti-CD3 treated cultures. Aneuploidic indexes negatively correlated with cytokine levels, percents of cells in S+G2/M phases and indicators of iron status (P<0.05). Although chromosome cytogenetics was not performed, for the first time, we report that increased aneuploidy rate may modulate the immune function during iron-deficiency. Copyright © 2014. Published by Elsevier Ltd.

Estrogen receptor alpha deficiency modulates TLR ligand mediated PDC-TREM expression in plasmacytoid dendritic cells in lupus prone mice

PubMed Central

Scott, Jennifer L; Cunningham, Melissa A; Naga, Osama S; Wirth, Jena R; EuDaly, Jackie G; Gilkeson, Gary S

2016-01-01

Female lupus prone NZM2410 estrogen receptor alpha (ERα) deficient mice are protected from renal disease and have prolonged survival compared to wild type (WT) littermates, however the mechanism of protection is unknown. Plasmacytoid dendritic cells (pDCs) and type I interferon (IFN) drive lupus pathogenesis. Estrogen acting via ERα enhances both pDC development and IFN production. The objectives for this study were to determine if ERα modulates pDC function and IFN activity in pre-disease NZM2410 mice as a possible protective mechanism of ERα deficiency in lupus prone mice. We measured the effect of ERα deficiency on spleen pDC frequency, number, maturation, and activation state. ERα deficiency reduced type I IFN activity and the frequency of MHCII+ pDCs in the spleen without altering overall pDC frequency, number, or maturation state. Additionally, ERα deficient NZM2410 mice had a significantly decreased frequency of pDCs expressing PDC-TREM, a modulator of toll-like receptor (TLR) mediated IFN production. After in vitro TLR9 stimulation, ERα deficiency significantly reduced the expression of PDC-TREM on pDCs from both NZM2410 and C57BL/6 mice. Thus, we have identified a significant effect of ERα deficiency on pDCs in pre-disease NZM2410 mice, which may represent a mechanism by which ERα deficiency protects NZM2410 mice from lupus like disease. PMID:26553076

Interferon effects on protozoan infections

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Wirth, J.; Kierszenbaum, F.; Degee, A. L. W.; Mansfield, J. M.

1985-01-01

The effects of interferon (IFN) on mice infected with two different parasitic protozoans, Trypanosoma cruzi and Trypanosoma brucei rhodesiense, are investigated experimentally. The preparation of the cell cultures, IFN and assays, antibody, and the experimental procedures are described. It is observed that in cells treated with IFN-gamma there is an increased association of T. cruzi with murine macrophages and an increase in the killing of T. cruzi by IFN-gamma-treated murine macrophages. For spleen cells infected with T.b. rhodesiense in vitro, it is detected that live trypanosomes cannot induce IFN in cells from normal mice, but can in cells from immunized mice; and that trypanosome-lysates induce IFN in vitro in cells from normal mice. The data suggest that there is a two-step mechanism for mice against T. cruzi and T.b. rhodesiense.

Interferon-Induced Ifit2/ISG54 Protects Mice from Lethal VSV Neuropathogenesis

PubMed Central

Fensterl, Volker; Wetzel, Jaime L.; Ramachandran, Srividya; Ogino, Tomoaki; Stohlman, Stephen A.; Bergmann, Cornelia C.; Diamond, Michael S.; Virgin, Herbert W.; Sen, Ganes C.

2012-01-01

Interferon protects mice from vesicular stomatitis virus (VSV) infection and pathogenesis; however, it is not known which of the numerous interferon-stimulated genes (ISG) mediate the antiviral effect. A prominent family of ISGs is the interferon-induced with tetratricopeptide repeats (Ifit) genes comprising three members in mice, Ifit1/ISG56, Ifit2/ISG54 and Ifit3/ISG49. Intranasal infection with a low dose of VSV is not lethal to wild-type mice and all three Ifit genes are induced in the central nervous system of the infected mice. We tested their potential contributions to the observed protection of wild-type mice from VSV pathogenesis, by taking advantage of the newly generated knockout mice lacking either Ifit2 or Ifit1. We observed that in Ifit2 knockout (Ifit2 −/−) mice, intranasal VSV infection was uniformly lethal and death was preceded by neurological signs, such as ataxia and hind limb paralysis. In contrast, wild-type and Ifit1 −/− mice were highly protected and survived without developing such disease. However, when VSV was injected intracranially, virus replication and survival were not significantly different between wild-type and Ifit2−/− mice. When administered intranasally, VSV entered the central nervous system through the olfactory bulbs, where it replicated equivalently in wild-type and Ifit2 −/− mice and induced interferon-β. However, as the infection spread to other regions of the brain, VSV titers rose several hundred folds higher in Ifit2 −/− mice as compared to wild-type mice. This was not caused by a broadened cell tropism in the brains of Ifit2 −/− mice, where VSV still replicated selectively in neurons. Surprisingly, this advantage for VSV replication in the brains of Ifit2−/− mice was not observed in other organs, such as lung and liver. Pathogenesis by another neurotropic RNA virus, encephalomyocarditis virus, was not enhanced in the brains of Ifit2 −/− mice. Our study provides a clear demonstration of

Tumor necrosis factor alpha mediates resistance to Trypanosoma cruzi infection in mice by inducing nitric oxide production in infected gamma interferon-activated macrophages.

PubMed Central

Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q

1995-01-01

Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147

Review of the recombinant human interferon gamma as an immunotherapeutic: Impacts of production platforms and glycosylation.

PubMed

Razaghi, Ali; Owens, Leigh; Heimann, Kirsten

2016-12-20

Human interferon gamma is a cytokine belonging to a diverse group of interferons which have a crucial immunological function against mycobacteria and a wide variety of viral infections. To date, it has been approved for treatment of chronic granulomatous disease and malignant osteopetrosis, and its application as an immunotherapeutic agent against cancer is an increasing prospect. Recombinant human interferon gamma, as a lucrative biopharmaceutical, has been engineered in different expression systems including prokaryotic, protozoan, fungal (yeasts), plant, insect and mammalian cells. Human interferon gamma is commonly expressed in Escherichia coli, marketed as ACTIMMUNE ® , however, the resulting product of the prokaryotic expression system is unglycosylated with a short half-life in the bloodstream; the purification process is tedious and makes the product costlier. Other expression systems also did not show satisfactory results in terms of yields, the biological activity of the protein or economic viability. Thus, the review aims to synthesise available information from previous studies on the production of human interferon gamma and its glycosylation patterns in different expression systems, to provide direction to future research in this field. Copyright © 2016 Elsevier B.V. All rights reserved.

Role of T Cells and Gamma Interferon during Induction of Hypersensitivity to Lipopolysaccharide by Toxic Shock Syndrome Toxin 1 in Mice

PubMed Central

Dinges, Martin M.; Schlievert, Patrick M.

2001-01-01

The superantigenic function of toxic shock syndrome toxin 1 (TSST-1) is generally regarded as an important determinant of its lethal effects in humans or experimental animals. This study examined the role of superantigenicity in a BALB/c mouse model of lethal TSST-1-induced hypersensitivity to lipopolysaccharide (LPS). In this model, TSST-1 greatly potentiated both LPS-induced lethality, as well as LPS-induced serum tumor necrosis factor alpha (TNF-α) activity. Although BALB/c-SCID mice were resistant to these LPS enhancement effects of TSST-1, BALB/c-SCID mice reconstituted with T cells were completely susceptible to the enhancement effect of TSST-1 on LPS-induced serum TNF-α. Mice pretreated with cyclosporine (Cs) or neutralizing antibodies against gamma interferon (IFN-γ) did not develop lethal LPS hypersensitivity when injected with TSST-1, and these agents reduced the enhancement effect of TSST-1 on LPS-induced serum TNF-α by 99 and 85%, respectively. Cs pretreatment also completely inhibited the known capacity of TSST-1 to amplify LPS-induced levels of IFN-γ in serum. In contrast, mice given Cs after a priming injection of TSST-1, but before LPS, still exhibited lethal hypersensitivity to LPS. Cs given after TSST-1 also did not inhibit enhancement of LPS-induced serum TNF-α by TSST-1 but inhibited the enhancement effect of TSST-1 on LPS-induced serum IFN-γ by 50%. These experiments support the theory that TSST-1-induced hypersensitivity to LPS is mediated primarily by IFN-γ derived from superantigen-activated T cells. PMID:11179286

Recent considerations in the use of recombinant interferon gamma for biological therapy of atopic dermatitis.

PubMed

Brar, Kanwaljit; Leung, Donald Y M

2016-01-01

Atopic dermatitis (AD) is the most common inflammatory skin disease in the general population. There are different endophenotypes of AD that likely have a unique immune and molecular basis, such as those who are predisposed to eczema herpeticum, or Staphylococcus aureus infections. In this review, we highlight the endophenotypes of AD where reduced interferon gamma expression may be playing a role. Additionally, we review the potential role of recombinant interferon gamma therapy in the treatment of atopic dermatitis and the particular phenotypes that may benefit from this treatment. Recombinant interferon gamma treatment will likely benefit the pediatric population with AD, as well as those with susceptibilities for skin infections. Future studies are needed to elucidate whether IFN-γ may reduce the prevalence of skin infection in AD.

Evaluation of gamma interferon (IFN-gamma)-induced protein 10 (IP-10) responses for detection of cattle infected with Mycobacterium bovis: comparisons to IFN-gamma responses

USDA-ARS?s Scientific Manuscript database

Gamma interferon (IFN-gamma)-induced protein 10 (IP-10) has recently shown promise as a diagnostic biomarker of Mycobacterium tuberculosis infection of humans. The aim of the current study was to compare IP-10 and IFN-gamma responses upon Mycobacterium bovis infection in cattle using archived sample...

Development of a lion-specific interferon-gamma assay.

PubMed

Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G

2012-10-15

The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.

T-cell-dependent control of acute Giardia lamblia infections in mice.

PubMed

Singer, S M; Nash, T E

2000-01-01

We have studied immune mechanisms responsible for control of acute Giardia lamblia and Giardia muris infections in adult mice. Association of chronic G. lamblia infection with hypogammaglobulinemia and experimental infections of mice with G. muris have led to the hypothesis that antibodies are required to control these infections. We directly tested this hypothesis by infecting B-cell-deficient mice with either G. lamblia or G. muris. Both wild-type mice and B-cell-deficient mice eliminated the vast majority of parasites between 1 and 2 weeks postinfection with G. lamblia. G. muris was also eliminated in both wild-type and B-cell-deficient mice. In contrast, T-cell-deficient and scid mice failed to control G. lamblia infections, as has been shown previously for G. muris. Treatment of wild-type or B-cell-deficient mice with antibodies to CD4 also prevented elimination of G. lamblia, confirming a role for T cells in controlling infections. By infecting mice deficient in either alphabeta- or gammadelta-T-cell receptor (TCR)-expressing T cells, we show that the alphabeta-TCR-expressing T cells are required to control parasites but that the gammadelta-TCR-expressing T cells are not. Finally, infections in mice deficient in production of gamma interferon or interleukin 4 (IL-4) and mice deficient in responding to IL-4 and IL-13 revealed that neither the Th1 nor the Th2 subset is absolutely required for protection from G. lamblia. We conclude that a T-cell-dependent mechanism is essential for controlling acute Giardia infections and that this mechanism is independent of antibody and B cells.

Protective Role of Gamma Interferon during the Recall Response to Influenza Virus

PubMed Central

Bot, Adrian; Bot, Simona; Bona, Constantin A.

1998-01-01

During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110

Regulation by interferon alpha of immunoglobulin isotype selection and lymphokine production in mice

PubMed Central

1991-01-01

Antigens and infectious agents that stimulate interferon alpha(IFN- alpha) production in mice induce antibody responses that are predominantly of the immunoglobulin (Ig)G2a isotype and contain little or no IgE. This suggested the possibility that IFN-alpha might have a role in directing Ig isotype selection. Consistent with this possibility, we have found that injection of mice with recombinant mouse IFN-alpha suppresses IgE secretion, enhances IgG2a secretion, and has no independent effect on IgG1 secretion in mice stimulated with a foreign anti-IgD antibody. Injection of mice with polyinosinic acid.polycytidylic acid (poly I.C), an inducer of macrophage IFN-alpha production, also suppresses the anti-IgD antibody-induced IgE response and stimulates the IgG2a response; these effects are blocked by a sheep antibody that neutralizes mouse IFN-alpha/beta. Both recombinant IFN- alpha and poly I.C have maximum IgE suppressive and IgG2a stimulatory effects when injected early in the anti-IgD antibody-induced immune response. Addition of IFN-alpha to mouse B cells cultured with lipopolysaccharide (LPS) + interleukin 4 (IL-4) suppresses both IgG1 and IgE production, but much less potently than IFN-gamma. IFN-alpha suppresses anti-IgD antibody-induced increases in the level of splenic IL-4 mRNA, but enhances the anti-IgD antibody-induced increase in the splenic level of IFN-gamma mRNA. These results are consistent with the effect of IFN-alpha on Ig isotype expression in mice, as IL-4 stimulates IgE and suppresses IgG2a secretion while IFN-gamma exerts opposite effects. These observations suggest that antigen presenting cells, by secreting IFN-alpha early in the course of an immune response, can influence the nature of that response both through direct effects on B cells and by influencing the differentiation of T cells. PMID:1940796

Zika Virus Infection in Dexamethasone-immunosuppressed Mice Demonstrating Disseminated Infection with Multi-organ Involvement Including Orchitis Effectively Treated by Recombinant Type I Interferons.

PubMed

Chan, Jasper Fuk-Woo; Zhang, Anna Jinxia; Chan, Chris Chung-Sing; Yip, Cyril Chik-Yan; Mak, Winger Wing-Nga; Zhu, Houshun; Poon, Vincent Kwok-Man; Tee, Kah-Meng; Zhu, Zheng; Cai, Jian-Piao; Tsang, Jessica Oi-Ling; Chik, Kenn Ka-Heng; Yin, Feifei; Chan, Kwok-Hung; Kok, Kin-Hang; Jin, Dong-Yan; Au-Yeung, Rex Kwok-Him; Yuen, Kwok-Yung

2016-12-01

Disseminated or fatal Zika virus (ZIKV) infections were reported in immunosuppressed patients. Existing interferon-signaling/receptor-deficient mouse models may not be suitable for evaluating treatment effects of recombinant interferons. We developed a novel mouse model for ZIKV infection by immunosuppressing BALB/c mice with dexamethasone. Dexamethasone-immunosuppressed male mice (6-8weeks) developed disseminated infection as evidenced by the detection of ZIKV-NS1 protein expression and high viral loads in multiple organs. They had ≥10% weight loss and high clinical scores soon after dexamethasone withdrawal (10dpi), which warranted euthanasia at 12dpi. Viral loads in blood and most tissues at 5dpi were significantly higher than those at 12dpi (P<0.05). Histological examination revealed prominent inflammatory infiltrates in multiple organs, and CD45+ and CD8+ inflammatory cells were seen in the testis. These findings suggested that clinical deterioration occurred during viral clearance by host immune response. Type I interferon treatments improved clinical outcome of mice (100% vs 0% survival). Besides virus dissemination, inflammation of various tissues, especially orchitis, may be potential complications of ZIKV infection with significant implications on disease transmission and male fertility. Interferon treatment should be considered in patients at high risks for ZIKV-associated complications when the potential benefits outweigh the side effects of treatment. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Interferon-alpha/beta deficiency greatly exacerbates arthritogenic disease in mice infected with wild-type chikungunya virus but not with the cell culture-adapted live-attenuated 181/25 vaccine candidate

PubMed Central

Gardner, Christina L.; Burke, Crystal W.; Higgs, Stephen T.; Klimstra, William B.; Ryman, Kate D.

2012-01-01

In humans, chikungunya virus (CHIKV) infection causes fever, rash, and acute and persisting polyarthalgia/arthritis associated with joint swelling. We report a new CHIKV disease model in adult mice that distinguishes the wild-type CHIKV-LR strain from the live-attenuated vaccine strain (CHIKV-181/25). Although eight-week old normal mice inoculated in the hind footpad developed no hind limb swelling with either virus, CHIKV-LR replicated in musculoskeletal tissues and caused detectable inflammation. In mice deficient in STAT1-dependent interferon (IFN) responses, CHIKV-LR caused significant swelling of the inoculated and contralateral limbs and dramatic inflammatory lesions, while CHIKV-181/25 vaccine and another arthritogenic alphavirus, Sindbis, failed to induce swelling. IFN responses suppressed CHIKV-LR and CHIKV-181/25 replication equally in dendritic cells in vitro whereas macrophages were refractory to infection independently of STAT1-mediated IFN responses. Glycosaminoglycan (GAG) binding may be a CHIKV vaccine attenuation mechanism as CHIKV-LR infectivity was not dependent upon GAG, while CHIKV-181/25 was highly dependent. PMID:22305131

Impairment of Natural Killer Cytotoxic Activity and Interferon γ Production in Ccaat/Enhancer Binding Protein γ–Deficient Mice

PubMed Central

Kaisho, Tsuneyasu; Tsutsui, Hiroko; Tanaka, Takashi; Tsujimura, Tohru; Takeda, Kiyoshi; Kawai, Taro; Yoshida, Nobuaki; Nakanishi, Kenji; Akira, Shizuo

1999-01-01

We have investigated in vivo roles of CCAAT/enhancer binding protein γ (C/EBPγ) by gene targeting. C/EBPγ-deficient (C/EBPγ2/−) mice showed a high mortality rate within 48 h after birth. To analyze the roles of C/EBPγ in lymphoid lineage cells, bone marrow chimeras were established. C/EBPγ2/− chimeras showed normal T and B cell development. However, cytolytic functions of their splenic natural killer (NK) cells after stimulation with cytokines such as interleukin (IL)-12, IL-18, and IL-2 were significantly reduced as compared with those of control chimera NK cells. In addition, the ability of C/EBPγ−/− chimera splenocytes to produce interferon (IFN)-γ in response to IL-12 and/or IL-18 was markedly impaired. NK cells could be generated in vitro with normal surface marker expression in the presence of IL-15 from C/EBPγ2/− newborn spleen cells. However, they also showed lower cytotoxic activity and IFN-γ production when stimulated with IL-12 plus IL-18 than control NK cells, as observed in C/EBPγ2/− chimera splenocytes. In conclusion, our study reveals that C/EBPγ is a critical transcription factor involved in the functional maturation of NK cells. PMID:10587348

Inhibited interferon-gamma but normal interleukin-3 production from rats flown on the Space Shuttle

NASA Technical Reports Server (NTRS)

Gould, Cheryl L.; Lyte, Mark; Williams, Joann; Mandel, Adrian D.; Sonnenfeld, Gerald

1987-01-01

Rats were flown on Space Shuttle SL-3 for one week. When spleen cells were removed from these rats and challenged with concanavalin-A, interferon-gamma production was severely inhibited, while interleukin-3 production was unaffected compared to ground-based control rats. These data indicate that there is a defect in interferon-gamma production in rats that have been exposed to spaceflight. This defect could contribute to, and be one reason for, immunosuppression observed after spaceflight.

GPER Deficiency in Male Mice Results in Insulin Resistance, Dyslipidemia, and a Proinflammatory State

PubMed Central

Sharma, Geetanjali; Hu, Chelin; Brigman, Jonathan L.; Zhu, Gang; Hathaway, Helen J.

2013-01-01

Estrogen is an important regulator of metabolic syndrome, a collection of abnormalities including obesity, insulin resistance/glucose intolerance, hypertension, dyslipidemia, and inflammation, which together lead to increased risk of cardiovascular disease and diabetes. The role of the G protein-coupled estrogen receptor (GPER/GPR30), particularly in males, in these pathologies remains unclear. We therefore sought to determine whether loss of GPER contributes to aspects of metabolic syndrome in male mice. Although 6-month-old male and female GPER knockout (KO) mice displayed increased body weight compared with wild-type littermates, only female GPER KO mice exhibited glucose intolerance at this age. Weight gain in male GPER KO mice was associated with increases in both visceral and sc fat. GPER KO mice, however, exhibited no differences in food intake or locomotor activity. One-year-old male GPER KO mice displayed an abnormal lipid profile with higher cholesterol and triglyceride levels. Fasting blood glucose levels remained normal, whereas insulin levels were elevated. Although insulin resistance was evident in GPER KO male mice from 6 months onward, glucose intolerance was pronounced only at 18 months of age. Furthermore, by 2 years of age, a proinflammatory phenotype was evident, with increases in the proinflammatory and immunomodulatory cytokines IL-1β, IL-6, IL-12, TNFα, monocyte chemotactic protein-1, interferon γ-induced protein 10, and monokine induced by interferon gamma and a concomitant decrease in the adipose-specific cytokine adiponectin. In conclusion, our study demonstrates for the first time that in male mice, GPER regulates metabolic parameters associated with obesity and diabetes. PMID:23970785

GPER deficiency in male mice results in insulin resistance, dyslipidemia, and a proinflammatory state.

PubMed

Sharma, Geetanjali; Hu, Chelin; Brigman, Jonathan L; Zhu, Gang; Hathaway, Helen J; Prossnitz, Eric R

2013-11-01

Estrogen is an important regulator of metabolic syndrome, a collection of abnormalities including obesity, insulin resistance/glucose intolerance, hypertension, dyslipidemia, and inflammation, which together lead to increased risk of cardiovascular disease and diabetes. The role of the G protein-coupled estrogen receptor (GPER/GPR30), particularly in males, in these pathologies remains unclear. We therefore sought to determine whether loss of GPER contributes to aspects of metabolic syndrome in male mice. Although 6-month-old male and female GPER knockout (KO) mice displayed increased body weight compared with wild-type littermates, only female GPER KO mice exhibited glucose intolerance at this age. Weight gain in male GPER KO mice was associated with increases in both visceral and sc fat. GPER KO mice, however, exhibited no differences in food intake or locomotor activity. One-year-old male GPER KO mice displayed an abnormal lipid profile with higher cholesterol and triglyceride levels. Fasting blood glucose levels remained normal, whereas insulin levels were elevated. Although insulin resistance was evident in GPER KO male mice from 6 months onward, glucose intolerance was pronounced only at 18 months of age. Furthermore, by 2 years of age, a proinflammatory phenotype was evident, with increases in the proinflammatory and immunomodulatory cytokines IL-1β, IL-6, IL-12, TNFα, monocyte chemotactic protein-1, interferon γ-induced protein 10, and monokine induced by interferon gamma and a concomitant decrease in the adipose-specific cytokine adiponectin. In conclusion, our study demonstrates for the first time that in male mice, GPER regulates metabolic parameters associated with obesity and diabetes.

Plasmodium falciparum erythrocyte membrane protein-1 specifically suppresses early production of host interferon-gamma.

PubMed

D'Ombrain, Marthe C; Voss, Till S; Maier, Alexander G; Pearce, J Andrew; Hansen, Diana S; Cowman, Alan F; Schofield, Louis

2007-08-16

Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP-1) is a variable antigen expressed by P. falciparum, the malarial parasite. PfEMP-1, present on the surface of infected host erythrocytes, mediates erythrocyte binding to vascular endothelium, enabling the parasite to avoid splenic clearance. In addition, PfEMP-1 is proposed to regulate host immune responses via interactions with the CD36 receptor on antigen-presenting cells. We investigated the immunoregulatory function of PfEMP-1 by comparing host cell responses to erythrocytes infected with either wild-type parasites or transgenic parasites lacking PfEMP-1. We showed that PfEMP-1 suppresses the production of the cytokine interferon-gamma by human peripheral blood mononuclear cells early after exposure to P. falciparum. Suppression of this rapid proinflammatory response was CD36 independent and specific to interferon-gamma production by gammadelta-T, NK, and alphabeta-T cells. These data demonstrate a parasite strategy for downregulating the proinflammatory interferon-gamma response and further establish transgenic parasites lacking PfEMP-1 as powerful tools for elucidating PfEMP-1 functions.

Continuous in vivo infusion of interferon-gamma (IFN-γ) enhances engraftment of syngeneic wild-type cells in Fanca–/– and Fancg–/– mice

PubMed Central

Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J.; Critser, John; Arwert, Fre; Haneline, Laura S.; Clapp, D. Wade

2006-01-01

Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc–/– cells to interferon-gamma (IFN-γ), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc–/– mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca–/– and Fancg–/– mice are hypersensitive to IFN-γ and that in vivo infusion of IFN-γ at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-γ conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients. PMID:16946306

Anti-interferon-gamma antibodies in the treatment of autoimmune diseases.

PubMed

Skurkovich, Boris; Skurkovich, Simon

2003-02-01

Interferon (IFN)-gamma is an important immune regulator in normal immunity. When IFN gamma production is disturbed, various autoimmune diseases (ADs) can develop, in which we suggest that anti-IFN gamma could have a beneficial effect. Depending on the cell type in which IFN gamma synthesis is disturbed, different clinical manifestations may result. We have also proposed to remove tumor necrosis factor (TNF)-alpha, together with certain types of IFNs, to treat various ADs and AIDS, also an autoimmune condition. Anti-IFN gamma has been tested in several T-helper cell (Th1) ADs, including rheumatoid arthritis (RA), multiple sclerosis (MS), corneal transplant rejection, uveitis, Type I diabetes, schizophrenia (anti-IFN gamma and anti-TNF alpha), and various autoimmune skin diseases (alopecia areata, psoriasis vulgaris, vitiligo, pemphigus vulgaris and epidermolysis bullosa). A strong, sometimes striking, therapeutic response followed administration of anti-IFN gamma, indicating that it may be a promising therapy for Th1 ADs.

Role of interferon in resistance and immunity to protozoa

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Degee, A. L. W.; Mansfield, J. M.; Newsome, A. L.; Arnold, R. R.

1985-01-01

Production of interferon (I) in response to protozoan infection, and the interferon-mediated inhibition of parasite replication were studied in order to determine if these effects may be related to immunologic-mediated resistance of the hosts. Two extracellular parasites-Trypanosoma brucei rhodesiense and Naegleria fowlei were used. Upon infection with the trypanosome, only resistant strains of mice produced I. An early peak of alpha/beta I is followed by appearance of gamma I, which coincided with antibody production and a drop in parasitemia. In case of the amoeba, pretreatment of its suspension with alpha/beta I inhibits its replication in vitro, and appears to protect mice from the infection and the disease. It is proposed that production of interferon, with its regulatory effect on the immune responses, may play a major role in regulating the processes of protozoan-caused diseases.

Inhibited interferon production after space flight

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Gould, C. L.; Williams, J.; Mandel, A. D.

1988-01-01

Several studies have been performed in our laboratories indicating that interferon production may be impaired in rodents after space flight. Using an antiorthostatic suspension model that simulates some of the effects of microgravity seen during space flight, we have shown that interferon-alpha/beta production was inhibited. The inhibition was not due solely to the stress of suspension. The inhibited interferon production was transient, as suspended animals returned to normal caging recovered the ability to produce interferon. Antiorthostatic suspension of mice also resulted in a loss of resistance to infection with the diabetogenic strain of encephalomyocarditis virus, which correlated with the drop in interferon production. In rats flown in US Space Shuttle mission SL-3, interferon-gamma production was inhibited severely when spleen cells were challenged with concanavalin-A upon return to earth. In contrast, interleukin-3 production by these cells was normal. These results suggest that immune responses may be altered after antiorthostatic modeling or space flight, and the resistance to viral infections may be especially affected.

Interferon-gamma inhibits intestinal restitution by preventing gap junction communication between enterocytes.

PubMed

Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J

2007-06-01

Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.

The immunomodulatory effects of interferon-gamma on mature B-lymphocyte responses.

PubMed

Jurado, A; Carballido, J; Griffel, H; Hochkeppel, H K; Wetzel, G D

1989-06-15

Interferon-gamma (IFN-gamma) exerts a broad spectrum of activities which affect the responses of mature B-cells. It strongly inhibits B-cell activation, acts as a B-cell growth factor (BCGF), and also induces final differentiation to immunoglobulin (Ig) production. IFN-gamma is deeply involved in the differential control of isotype expression, as it enhances IgG2a production and suppresses both IgG1 and IgE production. Although it is now possible to draw a general scheme of the effects of IFN-gamma on B-cells, a number of paradoxical results still exist in the field. In this manuscript, different experimental systems are analyzed in an attempt to explain these apparent paradoxes.

Effects of chicken interferon Gamma on Newcastle disease virus vaccine immunogenicity

USDA-ARS?s Scientific Manuscript database

More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFN') during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFN' wit...

Strain differences in the somnogenic effects of interferon inducers in mice.

PubMed

Toth, L A

1996-12-01

Increased slow-wave sleep accompanies influenza infection in C57BL/6 mice but not BALB/c mice. These strains of mice possess different alleles of the genetic lucus If-1, which codes for high (If-1h; C57BL/6) and low (If-1(1); BALB/c) production of interferon (IFN), a putative sleep-inducing cytokine. To evaluate the contribution of the If-1 gene to differences in murine sleep propensity, sleep patterns were evaluated in mice treated with the IFN inducers polyinosinic:polycytidilic acid (pIC) or Newcastle disease virus (NDV), with influenza virus, or with murine interferon (IFN-alpha) or IFN-alpha/beta. As compared with baseline values, C57BL/6 mice exhibited increased slow-wave sleep after all three challenges, but BALB/c mice did not. Congenic B6.C-H28c mice, which bear the BALB/c allele for low IFN production on the C57BL/6 genetic background, showed enhanced slow-wave sleep after influenza infection but not after NDV. Exogenous IFN did not enhance slow-wave sleep in either C57BL/6 or BALB/c mice. These data suggest that the If-1 allele may influence the somnogenic responsiveness of mice under some conditions but that additional mechanisms may contribute to sleep enhancement during infectious disease.

Interferon-alpha and interferon-gamma sensitize human tenon fibroblasts to mitomycin-C.

PubMed

Wang, Xiao Yang; Crowston, Jonathan G; Zoellner, Hans; Healey, Paul R

2007-08-01

To investigate the effect of interferon (IFN)-alpha and IFN-gamma pretreatment on mitomycin C (MMC)-induced cell death in human Tenon fibroblasts (HTFs) and the mechanisms by which IFN-alpha and IFN-gamma modulate the susceptibility of HTFs to MMC. HTFs were pretreated with IFN-alpha and IFN-gamma for 48 hours before 5-minute application of 0.4 mg/mL MMC. Cell death after 48 hours was determined by Annexin V/propidium iodide (PI) staining and lactate dehydrogenase (LDH) release assay. Fas, Fas-ligand, and Bcl-2 expression were determined by flow cytometry. Fas associated death domain (FADD), Bax, cytochrome c, and caspase expression were determined by Western blot analysis and immunofluorescence staining. MMC treatment increased cell death and upregulated Fas and FADD expression, but had no effect on Fas-Ligand, Bax, Bcl-2, or cytochrome c. Neither IFN-alpha nor IFN-gamma alone induced HTF death, but each increased cell death 2 days after MMC treatment in a dose-dependent fashion. Combination IFN-alpha and IFN-gamma had a synergistic effect. IFN-alpha and IFN-gamma pretreatment increased Fas expression. Fas upregulation was associated with increased sensitivity to MMC. IFN pretreatment increased procaspase-8, procaspase-9, and procaspase-3 expression, and caspase-3 activation. Caspase-8, caspase-3, and broad caspase inhibitors, but not caspase-9 inhibitor, inhibited MMC-induced cell death in nonpretreated and IFN-pretreated cells. IFN-alpha and IFN-gamma enhance the susceptibility of HTFs to MMC-induced cell death through a Fas-mediated and a caspase-3-dependent pathway. Pretreatment with IFN primed HTFs to MMC, providing a potential means for initially slowing the healing response with IFN and subsequently terminating fibroblast activity through MMC-induced cell death.

Interferon-gamma (INF-gamma) release test can detect cutaneous adverse effects to statins.

PubMed

Goldberg, Ilan; Isman, Gila; Shirazi, Idit; Brenner, Sarah

2009-12-01

An increasing number of cutaneous adverse effects are being reported as use of statins becomes more widespread. A study was undertaken to establish the relationship between statin and a cutaneous reaction by the in vitro interferon-gamma (INF-gamma) release test. The lymphocytes of 20 patients with suspected drug-induced skin reaction were incubated with and without the drug. The level of INF-gamma from the supernatant was measured by enzyme-linked immunosorbent assay (ELISA), and the increase calculated. Response was positive in 27 (21.43%) of the 126 drugs. Statin was the only drug with a positive response in 80% of those cases. Nine of 20 patients (45.0%) had complete resolution after discontinuation of the drug; 6 (30.0%) who replaced one drug by another statin had partial or no resolution; and 5 (20.0%) had no resolution despite cessation of statins of all kinds. A positive INF-gamma release test was found in patients who developed skin reactions while taking statins; the test's reliability was strengthened by prompt improvement following elimination of the suspected drug in the majority of patients.

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed Central

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-01-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-04-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.

Bioluminescent Imaging Reveals Divergent Viral Pathogenesis in Two Strains of Stat1-Deficient Mice, and in αßγ Interferon Receptor-Deficient Mice

PubMed Central

Pasieka, Tracy Jo; Collins, Lynne; O'Connor, Megan A.; Chen, Yufei; Parker, Zachary M.; Berwin, Brent L.; Piwnica-Worms, David R.; Leib, David A.

2011-01-01

Pivotal components of the IFN response to virus infection include the IFN receptors (IFNR), and the downstream factor signal transducer and activator of transcription 1 (Stat1). Mice deficient for Stat1 and IFNR (Stat1−/− and IFNαßγR−/− mice) lack responsiveness to IFN and exhibit high sensitivity to various pathogens. Here we examined herpes simplex virus type 1 (HSV-1) pathogenesis in Stat1−/− mice and in IFNαßγR−/− mice following corneal infection and bioluminescent imaging. Two divergent and paradoxical patterns of infection were observed. Mice with an N-terminal deletion in Stat1 (129Stat1−/− (N-term)) had transient infection of the liver and spleen, but succumbed to encephalitis by day 10 post-infection. In stark contrast, infection of IFNαßγR−/− mice was rapidly fatal, with associated viremia and fulminant infection of the liver and spleen, with infected infiltrating cells being primarily of the monocyte/macrophage lineage. To resolve the surprising difference between Stat1−/− and IFNαßγR−/− mice, we infected an additional Stat1−/− strain deleted in the DNA-binding domain (129Stat1−/− (DBD)). These 129Stat1−/− (DBD) mice recapitulated the lethal pattern of liver and spleen infection seen following infection of IFNαßγR−/− mice. This lethal pattern was also observed when 129Stat1−/− (N-term) mice were infected and treated with a Type I IFN-blocking antibody, and immune cells derived from 129Stat1−/− (N-term) mice were shown to be responsive to Type I IFN. These data therefore show significant differences in viral pathogenesis between two commonly-used Stat1−/− mouse strains. The data are consistent with the hypothesis that Stat1−/− (N-term) mice have residual Type I IFN receptor-dependent IFN responses. Complete loss of IFN signaling pathways allows viremia and rapid viral spread with a fatal infection of the liver. This study underscores the importance of careful comparisons

Interaction between cytotoxic effects of gamma-radiation and folate deficiency in relation to choline reserves.

PubMed

Batra, Vipen; Devasagayam, Thomas Paul Asir

2009-01-08

The search for non-toxic radio-protective drugs has yielded many potential agents but most of these compounds have certain amount of toxicity. Recent studies have indicated that bio-molecules such as folate and choline might be of radio-protective value as they are, within broad dose ranges, non-toxic to humans and experimental animals. The objective of the present study was to investigate choline dependent adaptive response to potential synergistic cytotoxic effect of folate deficiency and gamma-radiation. Male Swiss mice maintained on folate sufficient diet (FSD) and folate free diet (FFD) based on AIN-93M formula, were subjected to 1-4Gy total body gamma-irradiation. To investigate liver DNA damage, apurinic/apyrimidinic sites (AP sites) were quantified. A significant increase in liver DNA AP sites with concomitant depletion of liver choline reserves was observed when gamma-radiation was combined with folate deficiency. Further work in this direction suggested that cytotoxic interaction between folate deficiency and gamma radiation might induce utilization of choline and choline containing moieties by modifying levels of key regulatory enzymes dihydrofolate reductase (DHFR) and choline oxidase (ChoOx). Another major finding of these studies is that significant liver damage at higher doses of radiation (3-4Gy), might release considerable amounts of choline reserves to serum. In conclusion, a plausible interpretation of the present studies is that folate deprivation and gamma-radiation interact to mobilize additional choline reserves of hepatic tissue, for redistribution to other organs, which could not be utilized by folate deficiency alone. Present results clearly indicated a distinct choline pool in liver and kidney tissues that could be utilized by folate deficient animals only under radiation stress conditions.

Irbesartan increased PPAR{gamma} activity in vivo in white adipose tissue of atherosclerotic mice and improved adipose tissue dysfunction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iwai, Masaru; Kanno, Harumi; Senba, Izumi

2011-03-04

Research highlights: {yields} Atherosclerotic apolipoprotein E-deficient (ApoEKO) mice were treated with irbesartan. {yields} Irbesartan decreased white adipose tissue weight without affecting body weight. {yields} DNA-binding for PPAR{gamma} was increased in white adipose tissue in vivo by irbesartan. {yields} Irbesartan increased adipocyte number in white adipose tissue. {yields} Irbesatan increased the expression of adiponectin and leptin in white adipose tissue. -- Abstract: The effect of the PPAR{gamma} agonistic action of an AT{sub 1} receptor blocker, irbesartan, on adipose tissue dysfunction was explored using atherosclerotic model mice. Adult male apolipoprotein E-deficient (ApoEKO) mice at 9 weeks of age were treated with amore » high-cholesterol diet (HCD) with or without irbesartan at a dose of 50 mg/kg/day for 4 weeks. The weight of epididymal and retroperitoneal adipose tissue was decreased by irbesartan without changing food intake or body weight. Treatment with irbesartan increased the expression of PPAR{gamma} in white adipose tissue and the DNA-binding activity of PPAR{gamma} in nuclear extract prepared from adipose tissue. The expression of adiponectin, leptin and insulin receptor was also increased by irbesartan. These results suggest that irbesartan induced activation of PPAR{gamma} and improved adipose tissue dysfunction including insulin resistance.« less

Transforming growth factor-beta controls T helper type 1 cell development through regulation of natural killer cell interferon-gamma.

PubMed

Laouar, Yasmina; Sutterwala, Fayyaz S; Gorelik, Leonid; Flavell, Richard A

2005-06-01

Interferon-gamma and interleukin 12 produced by the innate arm of the immune system are important regulators of T helper type 1 (T(H)1) cell development, but signals that negatively regulate their expression remain controversial. Here we show that transforming growth factor-beta (TGF-beta) controlled T(H)1 differentiation through the regulation of interferon-gamma produced by natural killer (NK) cells. Blockade of TGF-beta signaling in NK cells caused the accumulation of a large pool of NK cells secreting copious interferon-gamma, responsible for T(H)1 differentiation and protection from leishmania infection. In contrast, blockade of TGF-beta signaling in dendritic cells did not affect dendritic cell homeostasis or interleukin 12 production, thus indicating a previously undescribed demarcation of the function of TGF-beta in NK cells versus dendritic cells.

Perforin and Gamma Interferon Expression Are Required for CD4+ and CD8+ T-Cell-Dependent Protective Immunity against a Human Parasite, Trypanosoma cruzi, Elicited by Heterologous Plasmid DNA Prime-Recombinant Adenovirus 5 Boost Vaccination▿

PubMed Central

de Alencar, Bruna C. G.; Persechini, Pedro M.; Haolla, Filipe A.; de Oliveira, Gabriel; Silverio, Jaline C.; Lannes-Vieira, Joseli; Machado, Alexandre V.; Gazzinelli, Ricardo T.; Bruna-Romero, Oscar; Rodrigues, Mauricio M.

2009-01-01

A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4+ and CD8+ T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4+ and CD8+ T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-γ) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8+ T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-γ or IFN-γ/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-γ in the presence of highly cytotoxic T cells. Vaccinated IFN-γ-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-γ in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy. PMID:19651871

Type I interferon induces necroptosis in macrophages during infection with Salmonella enterica serovar Typhimurium

PubMed Central

Robinson, Nirmal; McComb, Scott; Mulligan, Rebecca; Dudani, Renu; Krishnan, Lakshmi; Sad, Subash

2014-01-01

Salmonella enterica serovar Typhimurium (S. Typhimurium) is a virulent pathogen that induces rapid host death. Here we observed that host survival after infection with S. Typhimurium was enhanced in the absence of type I interferon signaling, with improved survival of mice deficient in the receptor for type I interferons (Ifnar1−/− mice) that was attributed to macrophages. Although there was no impairment in cytokine expression or inflammasome activation in Ifnar1−/− macrophages, they were highly resistant to S. Typhimurium–induced cell death. Specific inhibition of the kinase RIP1or knockdown of the gene encoding the kinase RIP3 prevented the death of wild-type macrophages, which indicated that necroptosis was a mechanism of cell death. Finally, RIP3-deficient macrophages, which cannot undergo necroptosis, had similarly less death and enhanced control of S. Typhimurium in vivo. Thus, we propose that S. Typhimurium induces the production of type I interferon, which drives necroptosis of macrophages and allows them to evade the immune response. PMID:22922364

Intact TRL 9 and type I interferon signaling pathways are required to augment HSV-1 induced corneal CXCL9 and CXCL10

PubMed Central

Wuest, Todd; Austin, Bobbie Ann; Uematsu, Satoshi; Thapa, Manoj; Akira, Shizuo; Carr, Daniel J. J.

2006-01-01

Herpes simplex virus type 1 ocular infection elicits a potent inflammatory response including the production of the chemokines, CXCL9 and CXCL10, in mice. Since HSV-1 nucleic acid is recognized by pattern receptors including toll-like receptor (TLR) 9, we tested the hypothesis that TLR9 is necessary for the early augmentation of CXCL10 following HSV-1 infection. Similar to wild type controls, TLR9 deficient mice constitutively expressed CXCL10 in the cornea. Following infection or stimulation with the deoxycytidylate-phosphate-deoxyguanylate (CpG) motif, CXCL10 levels were significantly elevated in the cornea of wild type but not TLR9 or type I interferon receptor deficient mice. The reduced CXCL10 response in the cornea of TLR deficient mice was correlative with an increase in virus shedding and a reduction in neutrophil infiltration. This is the first report that shows enhanced CXCL10 expression following neurotropic viral replication requires both intact TLR 9 and type I interferon signaling pathways. PMID:16884784

Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels

NASA Technical Reports Server (NTRS)

Pierangeli, Silvia S.; Sonnenfeld, Gerald

1989-01-01

Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.

Gamma Interferon Production Is Critical for Protective Immunity to Infection with Blood-Stage Plasmodium berghei XAT but Neither NO Production nor NK Cell Activation Is Critical

PubMed Central

Yoneto, Toshihiko; Yoshimoto, Takayuki; Wang, Chrong-Reen; Takahama, Yasuhiro; Tsuji, Moriya; Waki, Seiji; Nariuchi, Hideo

1999-01-01

We have examined the roles of gamma interferon (IFN-γ), nitric oxide (NO), and natural killer (NK) cells in the host resistance to infection with the blood-stage malarial parasite Plasmodium berghei XAT, an irradiation-induced attenuated variant of the lethal strain P. berghei NK65. Although the infection with P. berghei XAT enhanced NK cell lytic activity of splenocytes, depletion of NK1.1+ cells caused by the treatment of mice with anti-NK1.1 antibody affected neither parasitemia nor IFN-γ production by their splenocytes. The P. berghei XAT infection induced a large amount of NO production by splenocytes during the first peak of parasitemia, while P. berghei NK65 infection induced a small amount. Unexpectedly, however, mice deficient in inducible nitric oxide synthase (iNOS−/−) cleared P. berghei XAT after two peaks of parasitemia were observed, as occurred for wild-type control mice. Although the infected iNOS−/− mouse splenocytes did not produce a detectable level of NO, they produced an amount of IFN-γ comparable to that produced by wild-type control mouse splenocytes, and treatment of these mice with neutralizing anti-IFN-γ antibody led to the progression of parasitemia and fatal outcome. CD4−/− mice infected with P. berghei XAT could not clear the parasite, and all these mice died with apparently reduced IFN-γ production. Furthermore, treatment with carrageenan increased the susceptibility of mice to P. berghei XAT infection. These results suggest that neither NO production nor NK cell activation is critical for the resistance to P. berghei XAT infection and that IFN-γ plays an important role in the elimination of malarial parasites, possibly by the enhancement of phagocytic activity of macrophages. PMID:10225894

Cystathionine-gamma-lyase deficient mice are protected against the development of multiorgan failure and exhibit reduced inflammatory response during burn.

PubMed

Ahmad, Akbar; Druzhyna, Nadiya; Szabo, Csaba

2017-08-01

Considering the role of H 2 S in critical illness, the aim of this study was to compare the outcome of burn in wild-type mice and in mice deficient in CSE, one of the principal mammalian H 2 S-generating enzymes. Animals were subjected to scald burn. Outcome variables included indices of organ injury, clinical chemistry parameters and plasma levels of inflammatory mediators. Plasma levels of H 2 S significantly increased in response to burn in wild-type mice, but remained unchanged in CSE -/- mice. Expression of the three H 2 S-producing enzymes (CSE, CBS and 3-MST) in the lung and liver, and the capacity of tissue homogenates to produce H 2 S, however, was not affected by burn. In CSE deficient mice there was a significant amelioration of burn-induced accumulation of myeloperoxidase levels in heart, lung, liver and kidney and significantly lower degree of malon dialdehyde accumulation in the heart, lung and kidney than in wild-type mice. CSE deficient mice, compared to wild-type mice, showed a significant attenuation of the burn-induced elevation in circulating alkaline aminotransferase and blood urea nitrogen and creatinine levels, indicative of protective effects of CSE deficiency against burn-induced hepatic, and renal functional impairment. Multiple burn-induced inflammatory mediators (TNF-α, IL-1β, IL-4, IL-6, IL-10 and IL-12) were significantly lower in the plasma of CSE -/- animals after burn than in the plasma of wild-type controls subjected to burns. In conclusion, CSE deficiency improves organ function and attenuates the inflammatory response in a murine model of burn. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

The role of T cell PPAR gamma in mice with experimental inflammatory bowel disease.

PubMed

Guri, Amir J; Mohapatra, Saroj K; Horne, William T; Hontecillas, Raquel; Bassaganya-Riera, Josep

2010-06-10

Peroxisome proliferator-activated receptor gamma (PPAR gamma) is a nuclear receptor whose activation has been shown to modulate macrophage and T cell-mediated inflammation. The objective of this study was to investigate the mechanisms by which the deletion of PPAR gamma in T cells modulates immune cell distribution and colonic gene expression and the severity of experimental IBD. PPAR gamma flfl; CD4 Cre+ (CD4cre) or Cre- (WT) mice were challenged with 2.5% dextran sodium sulfate in their drinking water for 0, 2, or 7 days. Mice were scored on disease severity both clinically and histopathologically. Flow cytometry was used to assess lymphocyte and macrophage populations in the blood, spleen, and mesenteric lymph nodes (MLN). Global gene expression in colonic mucosa was profiled using Affymetrix microarrays. The deficiency of PPAR gamma in T cells accelerated the onset of disease and body weight loss. Examination of colon histopathology revealed significantly greater epithelial erosion, leukocyte infiltration, and mucosal thickening in the CD4cre mice on day 7. CD4cre mice had more CD8+ T cells than WT mice and fewer CD4+ FoxP3+ regulatory T cells (Treg) and IL10+ CD4+ T cells in blood and MLN, respectively. Transcriptomic profiling revealed around 3000 genes being transcriptionally altered as a result of DSS challenge in CD4cre mice. These included up-regulated mRNA expression of adhesion molecules, proinflammatory cytokines interleukin-6 (IL-6) and IL-1beta, and suppressor of cytokine signaling 3 (SOCS-3) on day 7. Gene set enrichment analysis (GSEA) showed that the ribosome and Krebs cycle pathways were downregulated while the apoptosis pathway was upregulated in colons of mice lacking PPAR gamma in T cells. The expression of PPAR gamma in T cells is involved in preventing gut inflammation by regulating colonic expression of adhesion molecules and inflammatory mediators at later stages of disease while favoring the recruitment of Treg to the mucosal inductive

Helicobacter cinaedi Induced Typhlocolitis in Rag-2-Deficient Mice

PubMed Central

Shen, Zeli; Feng, Yan; Rickman, Barry; Fox, James G.

2015-01-01

Background Helicobacter cinaedi, an enterohepatic helicobacter species (EHS), is an important human pathogen and is associated with a wide range of diseases, especially in immunocompromised patients. It has been convincingly demonstrated that innate immune response to certain pathogenic enteric bacteria is sufficient to initiate colitis and colon carcinogenesis in recombinase-activating gene (Rag)-2-deficient mice model. To better understand the mechanisms of human IBD and its association with development of colon cancer, we investigated whether H. cinaedi could induce pathological changes noted with murine enterohepatic helicobacter infections in the Rag2−/− mouse model. Materials and Methods Sixty 129SvEv Rag2−/− mice mouse were experimentally or sham infected orally with H. cinaedi strain CCUG 18818. Gastrointestinal pathology and immune responses in infected and control mice were analyzed at 3, 6 and 9 months postinfection (MPI). H. cinaedi colonized the cecum, colon, and stomach in infected mice. Results H. cinaedi induced typhlocolitis in Rag2−/− mice by 3 MPI and intestinal lesions became more severe by 9 MPI. H. cinaedi was also associated with the elevation of proinflammatory cytokines, interferon-γ, tumor-necrosis factor-α, IL-1β, IL-10; iNOS mRNA levels were also upregulated in the cecum of infected mice. However, changes in IL-4, IL-6, Cox-2, and c-myc mRNA expressions were not detected. Conclusions Our results indicated that the Rag2−/− mouse model will be useful to continue investigating the pathogenicity of H. cinaedi, and to study the association of host immune responses in IBD caused by EHS. PMID:25381744

Clinical and diagnostic developments of a gamma interferon release assay for use in bovine tuberculosis control programs

USDA-ARS?s Scientific Manuscript database

Currently the Bovigam assay is used as an official supplemental test within the bovine tuberculosis eradication program. This assay measures interferon-gamma (IFN-gamma) produced by lymphocytes in response to specific antigens. The objectives of the present study were to evaluate two Mycobacterium ...

Interferon β induces clearance of mutant ataxin 7 and improves locomotion in SCA7 knock-in mice.

PubMed

Chort, Alice; Alves, Sandro; Marinello, Martina; Dufresnois, Béatrice; Dornbierer, Jean-Gabriel; Tesson, Christelle; Latouche, Morwena; Baker, Darren P; Barkats, Martine; El Hachimi, Khalid H; Ruberg, Merle; Janer, Alexandre; Stevanin, Giovanni; Brice, Alexis; Sittler, Annie

2013-06-01

We showed previously, in a cell model of spinocerebellar ataxia 7, that interferon beta induces the expression of PML protein and the formation of PML protein nuclear bodies that degrade mutant ataxin 7, suggesting that the cytokine, used to treat multiple sclerosis, might have therapeutic value in spinocerebellar ataxia 7. We now show that interferon beta also induces PML-dependent clearance of ataxin 7 in a preclinical model, SCA7(266Q/5Q) knock-in mice, and improves motor function. Interestingly, the presence of mutant ataxin 7 in the mice induces itself the expression of endogenous interferon beta and its receptor. Immunohistological studies in brains from two patients with spinocerebellar ataxia 7 confirmed that these modifications are also caused by the disease in humans. Interferon beta, administered intraperitoneally three times a week in the knock-in mice, was internalized with its receptor in Purkinje and other cells and translocated to the nucleus. The treatment induced PML protein expression and the formation of PML protein nuclear bodies and decreased mutant ataxin 7 in neuronal intranuclear inclusions, the hallmark of the disease. No reactive gliosis or other signs of toxicity were observed in the brain or internal organs. The performance of the SCA7(266Q/5Q) knock-in mice was significantly improved on two behavioural tests sensitive to cerebellar function: the Locotronic® Test of locomotor function and the Beam Walking Test of balance, motor coordination and fine movements, which are affected in patients with spinocerebellar ataxia 7. In addition to motor dysfunction, SCA7(266Q/5Q) mice present abnormalities in the retina as in patients: ataxin 7-positive neuronal intranuclear inclusions that were reduced by interferon beta treatment. Finally, since neuronal death does not occur in the cerebellum of SCA7(266Q/5Q) mice, we showed in primary cell cultures expressing mutant ataxin 7 that interferon beta treatment improves Purkinje cell survival.

Gamma Interferon Loaded onto Albumin Nanoparticles: In Vitro and In Vivo Activities against Brucella abortus▿

PubMed Central

Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.

2007-01-01

The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401

Lipoprotein lipase gene-deficient mice with hypertriglyceridaemia associated with acute pancreatitis.

PubMed

Tang, Maochun; Zong, Pengfei; Zhang, Ting; Wang, Dongyan; Wang, Yuhui; Zhao, Yan

2016-10-01

To investigate the severity of pancreatitis in lipoprotein lipase (LPL)-deficient hypertriglyceridaemic (HTG) heterozygous mice and to establish an experimental animal model for HTG pancreatitis study. LPL-deficient HTG heterozygous mice were rescued by somatic gene transfer and mated with wild-type mice. The plasma amylase, triglyceride, and pathologic changes in the pancreas of the LPL-deficient HTG heterozygous mice were compared with those of wild-type mice to assess the severity of pancreatitis. In addition, acute pancreatitis (AP) was induced by caerulein (50 µg/kg) for further assessment. The levels of plasma amylase and triglyceride were significantly higher in the LPL-deficient HTG heterozygous mice. According to the pancreatic histopathologic scores, the LPL-deficient HTG heterozygous mice showed more severe pathologic damage than the wild-type mice. Lipoprotein lipase deficient heterozygous mice developed severe caerulein-induced pancreatitis. In addition, their high triglyceride levels were stable. Therefore, LPL-deficient HTG heterozygous mice are a useful experimental model for studying HTG pancreatitis.

Toll-like receptor 3 deficiency decreases epileptogenesis in a pilocarpine model of SE-induced epilepsy in mice.

PubMed

Gross, Adi; Benninger, Felix; Madar, Ravit; Illouz, Tomer; Griffioen, Kathleen; Steiner, Israel; Offen, Daniel; Okun, Eitan

2017-04-01

Epilepsy affects 60 million people worldwide. Despite the development of antiepileptic drugs, up to 35% of patients are drug refractory with uncontrollable seizures. Toll-like receptors (TLRs) are central components of the nonspecific innate inflammatory response. Because TLR3 was recently implicated in neuronal plasticity, we hypothesized that it may contribute to the development of epilepsy after status epilepticus (SE). To test the involvement of TLR3 in epileptogenesis, we used the pilocarpine model for SE in TLR3-deficient mice and their respective wild-type controls. In this model, a single SE event leads to spontaneous recurrent seizures (SRS). Two weeks after SE, mice were implanted with wireless electroencephalography (EEG) transmitters for up to 1 month. The impact of TLR3 deficiency on SE was assessed using separate cohorts of mice regarding EEG activity, seizure progression, hippocampal microglial distribution, and expression of the proinflammatory cytokines tumor necrosis factor (TNF)α and interferon (IFN)β. Our data indicate that TLR3 deficiency reduced SRS, microglial activation, and the levels of the proinflammatory cytokines TNFα and IFNβ, and increased survival following SE. This study reveals novel insights into the pathophysiology of epilepsy and the contribution of TLR3 to disease progression. Our results identify the TLR3 pathway as a potential future therapeutic target in SE. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

Myelin/oligodendrocyte glycoprotein–deficient (MOG-deficient) mice reveal lack of immune tolerance to MOG in wild-type mice

PubMed Central

Delarasse, Cécile; Daubas, Philippe; Mars, Lennart T.; Vizler, Csaba; Litzenburger, Tobias; Iglesias, Antonio; Bauer, Jan; Della Gaspera, Bruno; Schubart, Anna; Decker, Laurence; Dimitri, Dalia; Roussel, Guy; Dierich, Andrée; Amor, Sandra; Dautigny, André; Liblau, Roland; Pham-Dinh, Danielle

2003-01-01

We studied the immunological basis for the very potent encephalitogenicity of myelin/oligodendrocyte glycoprotein (MOG), a minor component of myelin in the CNS that is widely used to induce experimental autoimmune encephalomyelitis (EAE). For this purpose, we generated a mutant mouse lacking a functional mog gene. This MOG-deficient mouse presents no clinical or histological abnormalities, permitting us to directly assess the role of MOG as a target autoantigen in EAE. In contrast to WT mice, which developed severe EAE following immunization with whole myelin, MOG-deficient mice had a mild phenotype, demonstrating that the anti-MOG response is a major pathogenic component of the autoimmune response directed against myelin. Moreover, while MOG transcripts are expressed in lymphoid organs in minute amounts, both MOG-deficient and WT mice show similar T and B cell responses against the extracellular domain of MOG, including the immunodominant MOG 35–55 T cell epitope. Furthermore, no differences in the fine specificity of the T cell responses to overlapping peptides covering the complete mouse MOG sequence were observed between MOG+/+ and MOG–/– mice. In addition, upon adoptive transfer, MOG-specific T cells from WT mice and those from MOG-deficient mice are equally pathogenic. This total lack of immune tolerance to MOG in WT C57BL/6 mice may be responsible for the high pathogenicity of the anti-MOG immune response as well as the high susceptibility of most animal strains to MOG-induced EAE. PMID:12925695

Double-blind trial of recombinant gamma-interferon versus placebo in the treatment of rheumatoid arthritis. 1989.

PubMed

Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D

2008-02-01

One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Combined vitamin C and vitamin E deficiency worsens early atherosclerosis in apolipoprotein E-deficient mice.

PubMed

Babaev, Vladimir R; Li, Liying; Shah, Sanket; Fazio, Sergio; Linton, MacRae F; May, James M

2010-09-01

To assess the role of combined deficiencies of vitamins C and E on the earliest stages of atherosclerosis (an inflammatory condition associated with oxidative stress), 4 combinations of vitamin supplementation (low C/low E, low C/high E, high C/low E, and high C/high E) were studied in atherosclerosis-prone apolipoprotein E-deficient mice also unable to synthesize their own vitamin C (gulonolactone oxidase(-/-)); and to evaluate the effect of a more severe depletion of vitamin C alone in a second experiment using gulonolactone oxidase(-/-) mice carrying the hemizygous deletion of SVCT2 (the vitamin C transporter). After 8 weeks of a high-fat diet (16% lard and 0.2% cholesterol), atherosclerosis developed in the aortic sinus areas of mice in all diet groups. Each vitamin-deficient diet significantly decreased liver and brain contents of the corresponding vitamin. Combined deficiency of both vitamins increased lipid peroxidation, doubled plaque size, and increased plaque macrophage content by 2- to 3-fold in male mice, although only plaque macrophage content was increased in female mice. A more severe deficiency of vitamin C in gulonolactone oxidase(-/-) mice with defective cellular uptake of vitamin C increased both oxidative stress and atherosclerosis in apolipoprotein E(-/-) mice compared with littermates receiving a diet replete in vitamin C, again most clearly in males. Combined deficiencies of vitamins E and C are required to worsen early atherosclerosis in an apolipoprotein E-deficient mouse model. However, a more severe cellular deficiency of vitamin C alone promotes atherosclerosis when vitamin E is replete.

Interferon Response Factors 3 and 7 Protect against Chikungunya Virus Hemorrhagic Fever and Shock

PubMed Central

Rudd, Penny A.; Wilson, Jane; Gardner, Joy; Larcher, Thibaut; Babarit, Candice; Le, Thuy T.; Anraku, Itaru; Kumagai, Yutaro; Loo, Yueh-Ming; Gale, Michael; Akira, Shizuo; Khromykh, Alexander A.

2012-01-01

Chikungunya virus (CHIKV) infections can produce severe disease and mortality. Here we show that CHIKV infection of adult mice deficient in interferon response factors 3 and 7 (IRF3/7−/−) is lethal. Mortality was associated with undetectable levels of alpha/beta interferon (IFN-α/β) in serum, ∼50- and ∼10-fold increases in levels of IFN-γ and tumor necrosis factor (TNF), respectively, increased virus replication, edema, vasculitis, hemorrhage, fever followed by hypothermia, oliguria, thrombocytopenia, and raised hematocrits. These features are consistent with hemorrhagic shock and were also evident in infected IFN-α/β receptor-deficient mice. In situ hybridization suggested CHIKV infection of endothelium, fibroblasts, skeletal muscle, mononuclear cells, chondrocytes, and keratinocytes in IRF3/7−/− mice; all but the latter two stained positive in wild-type mice. Vaccination protected IRF3/7−/− mice, suggesting that defective antibody responses were not responsible for mortality. IPS-1- and TRIF-dependent pathways were primarily responsible for IFN-α/β induction, with IRF7 being upregulated >100-fold in infected wild-type mice. These studies suggest that inadequate IFN-α/β responses following virus infection can be sufficient to induce hemorrhagic fever and shock, a finding with implications for understanding severe CHIKV disease and dengue hemorrhagic fever/dengue shock syndrome. PMID:22761364

Lethal Zika Virus Disease Models in Young and Older Interferon α/β Receptor Knock Out Mice.

PubMed

Marzi, Andrea; Emanuel, Jackson; Callison, Julie; McNally, Kristin L; Arndt, Nicolette; Chadinha, Spencer; Martellaro, Cynthia; Rosenke, Rebecca; Scott, Dana P; Safronetz, David; Whitehead, Stephen S; Best, Sonja M; Feldmann, Heinz

2018-01-01

The common small animal disease models for Zika virus (ZIKV) are mice lacking the interferon responses, but infection of interferon receptor α/β knock out (IFNAR -/- ) mice is not uniformly lethal particularly in older animals. Here we sought to advance this model in regard to lethality for future countermeasure efficacy testing against more recent ZIKV strains from the Asian lineage, preferably the American sublineage. We first infected IFNAR -/- mice subcutaneously with the contemporary ZIKV-Paraiba strain resulting in predominantly neurological disease with ~50% lethality. Infection with ZIKV-Paraiba by different routes established a uniformly lethal model only in young mice (4-week old) upon intraperitoneal infection. However, intraperitoneal inoculation of ZIKV-French Polynesia resulted in uniform lethality in older IFNAR -/- mice (10-12-weeks old). In conclusion, we have established uniformly lethal mouse disease models for efficacy testing of antivirals and vaccines against recent ZIKV strains representing the Asian lineage.

Enhancing effects of gamma interferon on phagocytic cell association with and killing of Trypanosoma cruzi

NASA Technical Reports Server (NTRS)

Wirth, J. J.; Kierszenbaum, F.; Sonnenfeld, G.; Zlotnik, A.

1985-01-01

Results are reported from a study of the influence gamma interferon (GIFN) and interleukin 2 (IL2) have on the capability of P388D1 cells and mouse resident peritoneal macrophages (MPM) to attach to the blood-resident parasites Trypanosoma cruzi and kill them. Cultures of trypomastigote forms of the Tulahuen strain of T. cruzi grown in bovine serum were introduced into peritoneal cells of mice, along with P388D1 cells incubated with GIFN, IL2 and both. Control cells were also maintained. Statistical analysis were then performed on data on counts of the number of dead T. Cruzi cells. The GIFN enhanced the interaction of MPM and P388D1 cells with the surface of T. Cruzi, provided the interaction was given over 12 hr to take place. A depression of the cytotoxicity of P388D1 cells was attributed to mediation by H2O2, an effect partially offset by incubation with the lymphokine GIFN.

Gender Affects Skin Wound Healing in Plasminogen Deficient Mice

PubMed Central

Rønø, Birgitte; Engelholm, Lars Henning; Lund, Leif Røge; Hald, Andreas

2013-01-01

The fibrinolytic activity of plasmin plays a fundamental role in resolution of blood clots and clearance of extravascular deposited fibrin in damaged tissues. These vital functions of plasmin are exploited by malignant cells to accelerate tumor growth and facilitate metastases. Mice lacking functional plasmin thus display decreased tumor growth in a variety of cancer models. Interestingly, this role of plasmin has, in regard to skin cancer, been shown to be restricted to male mice. It remains to be clarified whether gender also affects other phenotypic characteristics of plasmin deficiency or if this gender effect is restricted to skin cancer. To investigate this, we tested the effect of gender on plasmin dependent immune cell migration, accumulation of hepatic fibrin depositions, skin composition, and skin wound healing. Gender did not affect immune cell migration or hepatic fibrin accumulation in neither wildtype nor plasmin deficient mice, and the existing differences in skin composition between males and females were unaffected by plasmin deficiency. In contrast, gender had a marked effect on the ability of plasmin deficient mice to heal skin wounds, which was seen as an accelerated wound closure in female versus male plasmin deficient mice. Further studies showed that this gender effect could not be reversed by ovariectomy, suggesting that female sex-hormones did not mediate the accelerated skin wound healing in plasmin deficient female mice. Histological examination of healed wounds revealed larger amounts of fibrotic scars in the provisional matrix of plasmin deficient male mice compared to female mice. These fibrotic scars correlated to an obstruction of cell infiltration of the granulation tissue, which is a prerequisite for wound healing. In conclusion, the presented data show that the gender dependent effect of plasmin deficiency is tissue specific and may be secondary to already established differences between genders, such as skin thickness and

Immunoregulatory actions of epithelial cell PPAR gamma at the colonic mucosa of mice with experimental inflammatory bowel disease.

PubMed

Mohapatra, Saroj K; Guri, Amir J; Climent, Montse; Vives, Cristina; Carbo, Adria; Horne, William T; Hontecillas, Raquel; Bassaganya-Riera, Josep

2010-04-20

Peroxisome proliferator-activated receptors are nuclear receptors highly expressed in intestinal epithelial cells (IEC) and immune cells within the gut mucosa and are implicated in modulating inflammation and immune responses. The objective of this study was to investigate the effect of targeted deletion of PPAR gamma in IEC on progression of experimental inflammatory bowel disease (IBD). In the first phase, PPAR gamma flfl; Villin Cre- (VC-) and PPAR gamma flfl; Villin Cre+ (VC+) mice in a mixed FVB/C57BL/6 background were challenged with 2.5% dextran sodium sulfate (DSS) in drinking water for 0, 2, or 7 days. VC+ mice express a transgenic recombinase under the control of the Villin-Cre promoter that causes an IEC-specific deletion of PPAR gamma. In the second phase, we generated VC- and VC+ mice in a C57BL/6 background that were challenged with 2.5% DSS. Mice were scored on disease severity both clinically and histopathologically. Flow cytometry was used to phenotypically characterize lymphocyte and macrophage populations in blood, spleen and mesenteric lymph nodes. Global gene expression analysis was profiled using Affymetrix microarrays. The IEC-specific deficiency of PPAR gamma in mice with a mixed background worsened colonic inflammatory lesions, but had no effect on disease activity (DAI) or weight loss. In contrast, the IEC-specific PPAR gamma null mice in C57BL/6 background exhibited more severe inflammatory lesions, DAI and weight loss in comparison to their littermates expressing PPAR gamma in IEC. Global gene expression profiling revealed significantly down-regulated expression of lysosomal pathway genes and flow cytometry results demonstrated suppressed production of IL-10 by CD4+ T cells in mesenteric lymph nodes (MLN) of IEC-specific PPAR gamma null mice. Our results demonstrate that adequate expression of PPAR gamma in IEC is required for the regulation of mucosal immune responses and prevention of experimental IBD, possibly by modulation of

Gamma rhythms link prefrontal interneuron dysfunction with cognitive inflexibility in Dlx5/6+/− mice

PubMed Central

Cho, Kathleen K.A.; Hoch, Renee; Lee, Anthony T.; Patel, Tosha; Rubenstein, John L.R.; Sohal, Vikaas S.

2015-01-01

SUMMARY Abnormalities in GABAergic interneurons, particularly fast-spiking interneurons (FSINs) that generate gamma (γ; ~30-120 Hz) oscillations, are hypothesized to disrupt prefrontal cortex (PFC)-dependent cognition in schizophrenia. Although γ rhythms are abnormal in schizophrenia, it remains unclear whether they directly influence cognition. Mechanisms underlying schizophrenia's typical post-adolescent onset also remain elusive. We addressed these issues using mice heterozygous for Dlx5/6, which regulate GABAergic interneuron development. In Dlx5/6+/− mice, FSINs become abnormal following adolescence, coinciding with the onset of cognitive inflexibility and deficient task-evoked γ oscillations. Inhibiting PFC interneurons in control mice reproduced these deficits, whereas stimulating them at γ-frequencies restored cognitive flexibility in adult Dlx5/6+/− mice. These pro-cognitive effects were frequency-specific and persistent. These findings elucidate a mechanism whereby abnormal FSIN development may contribute to the post-adolescent onset of schizophrenia endophenotypes. Furthermore, they demonstrate a causal, potentially therapeutic, role for PFC interneuron-driven gamma oscillations in cognitive domains at the core of schizophrenia. PMID:25754826

IGF-1 deficiency impairs cerebral myogenic autoregulation in hypertensive mice.

PubMed

Toth, Peter; Tucsek, Zsuzsanna; Tarantini, Stefano; Sosnowska, Danuta; Gautam, Tripti; Mitschelen, Matthew; Koller, Akos; Sonntag, William E; Csiszar, Anna; Ungvari, Zoltan

2014-12-01

Aging impairs autoregulatory protection in the brain, exacerbating hypertension-induced cerebromicrovascular injury, neuroinflammation, and development of vascular cognitive impairment. Despite the importance of the age-related decline in circulating insulin-like growth factor-1 (IGF-1) levels in cerebrovascular aging, the effects of IGF-1 deficiency on functional adaptation of cerebral arteries to high blood pressure remain elusive. To determine whether IGF-1 deficiency impairs autoregulatory protection, hypertension was induced in control and IGF-1-deficient mice (Igf1(f/f)+TBG-iCre-AAV8) by chronic infusion of angiotensin-II. In hypertensive control mice, cerebral blood flow (CBF) autoregulation was extended to higher pressure values and the pressure-induced tone of middle cerebral arteries (MCAs) was increased. In hypertensive IGF-1-deficient mice, autoregulation was markedly disrupted, and MCAs did not show adaptive increases in myogenic tone. In control mice, the mechanism of adaptation to hypertension involved upregulation of TRPC channels in MCAs and this mechanism was impaired in hypertensive IGF-1-deficient mice. Likely downstream consequences of cerebrovascular autoregulatory dysfunction in hypertensive IGF-1-deficient mice included exacerbated disruption of the blood-brain barrier and neuroinflammation (microglia activation and upregulation of proinflammatory cytokines and chemokines), which were associated with impaired hippocampal cognitive function. Collectively, IGF-1 deficiency impairs autoregulatory protection in the brain of hypertensive mice, potentially exacerbating cerebromicrovascular injury and neuroinflammation mimicking the aging phenotype.

Results of space experiment program "Interferon". II. Influence of spaceflight conditions on the activity of interferon preparations and interferon inducers ("Interferon II").

PubMed

Tálas, M; Bátkai, L; Stöger, I; Nagy, K; Hiros, L; Konstantinova, I; Kozharinov, V

1983-01-01

The influence of spaceflight conditions on the biological activity of HuIFN-alpha preparations (lyophilized, in solution and in ointment) and interferon inducers was studied. In antiviral activity no difference was observed between the samples kept aboard the spaceship and the controls kept under ground conditions. The interferon inducers poly I:C, poly G:C and gossipol placed in the space laboratory for 7 days maintained their interferon-inducing capacity. The circulating interferon level in mice was the same irrespective of the induction being performed with flight or ground-control samples of inducers.

Disseminated Penicilliosis, Recurrent Bacteremic Nontyphoidal Salmonellosis, and Burkholderiosis Associated with Acquired Immunodeficiency Due to Autoantibody against Gamma Interferon ▿

PubMed Central

Tang, Bone Siu-Fai; Chan, Jasper Fuk-Woo; Chen, Min; Tsang, Owen Tak-Yin; Mok, M. Y.; Lai, Raymond Wai-Man; Lee, Rodney; Que, Tak-Lun; Tse, Herman; Li, Iris Wai-Sum; To, Kelvin Kai-Wang; Cheng, Vincent Chi-Chung; Chan, Eric Yuk-Tat; Zheng, Bojian; Yuen, Kwok-Yung

2010-01-01

Acquired immunodeficiency due to autoantibody against gamma interferon has recently been associated with opportunistic nontuberculous mycobacteriosis, especially among Southeast Asians. We report another 8 cases, all except one apparently immunocompetent hosts who suffered from concomitant or sequential infections by other intracellular pathogens causing penicilliosis, extraintestinal nontyphoidal salmonellosis, and burkholderiosis. The only case with an underlying immunodeficiency syndrome had systemic lupus erythematosus that was quiescent throughout the multiple infective episodes. Eight out of 10 (80.0%) patients with serological evidence of penicilliosis, 5 out of 7 (71.4%) with culture-positive extraintestinal nontyphoidal salmonellosis, 5 out of 28 (17.9%) with serological evidence of melioidosis, and 7 out of 13 (53.8%) with culture-positive nontuberculous mycobacteriosis possessed autoantibody against gamma interferon, whereas only 1 out of 100 patients with systemic lupus erythematosus did. Our study represents the first and largest case series linking this emerging immunodeficiency syndrome with these atypical infections in apparently immunocompetent hosts. Thus, we advocate that any patient with unexplained recurrent or polymicrobial infections due to these intracellular pathogens should be screened for acquired immunodeficiency due to autoantibody against gamma interferon. PMID:20445006

Phenotypic consequences of deletion of the {gamma}{sub 3}, {alpha}{sub 5}, or {beta}{sub 3} subunit of the type A {gamma}-aminobutyric acid receptor in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Culia, C.T.; Stubbs, L.J.; Montgomery, C.S.

1994-03-29

Three genes (Gabrg3, Gabra5, and Gabrb3) encoding the {gamma}{sub 3}, {alpha}{sub 5}, and {beta}{sub 3} subunits of the type A {gamma}-aminobutyric acid receptor, respectively, are known to map near the pink-eyed dilution (p) locus in mouse chromosome 7. This region shares homology with a segment of human chromosome 15 that is implicated in Angelman syndrome, an inherited neurobehavioral disorder. By mapping Gabrg3-Gabra5-Gabrb3-telomere. Like Gabrb3, neither the Gabra5 nor Gabrg3 gene is functionally imprinted in adult mouse brain. Mice deleted for all three subunits die at birth with a cleft palate, although there are rare survivors ({approximately} 5%) that do notmore » have a cleft palate but do exhibit a neurological abnormality characterized by tremor, jerky gait, and runtiness. The authors have previously suggested that deficiency of the {beta}{sub 3} subunit may be responsible for the clefting defect. Most notably, however, in this report they describe mice carrying two overlapping, complementing p deletions that fail to express the {gamma}{sub 3} transcript, as well as mice from another line that express neither the {gamma}{sub 3} nor {alpha}{sub 5} transcripts. Surprisingly, mice from both of these lines are phenotypically normal and do not exhibit any of the neurological symptoms characteristic of the rare survivors that are deleted for all three ({gamma}{sub 3}, {alpha}{sub 5}, and {beta}{sub 3}) subunits. These mice therefore provide a whole-organism type A {gamma}-aminobutyric-acid receptor background that is devoid of any receptor subtypes that normally contain the {gamma}{sub 3} and/or {alpha}{sub 5} subunits. The absence of an overt neurological phenotype in mice lacking the {gamma}{sub 3} and/or {alpha}{sub 5} subunits also suggests that mutations in these genes are unlikely to provide useful animal models for Angelman syndrome in humans.« less

Utility of an interferon-gamma release assay for latent tuberculosis diagnosis in a case of bullous pemphigoid.

PubMed

Goodfellow, Alfred; Keeling, Douglas N; Hayes, Robert C; Webster, Duncan

2009-01-01

With increasing use of immunosuppressive therapy, including tumor necrosis factor alpha inhibitors, there is concern about infectious complications, including reactivation of latent Mycobacterium tuberculosis infection. Routine testing prior to administration of systemic immunosuppression includes the tuberculin skin test, which lacks sensitivity and specificity and may be difficult to interpret in the presence of extensive cutaneous disease. Treatment of individuals with latent tuberculosis infection is recommended when immunosuppressive medications are to be employed. We report a case in which a diagnosis of latent tuberculosis infection in a patient with extensive bullous pemphigoid was clarified by the use of an interferon-gamma release assay after equivocal tuberculin skin test results. Interferon-gamma release assays are useful adjuncts to the tuberculin skin test in the diagnosis of latent tuberculosis infection in the setting of extensive cutaneous disease.

[Aerosolized recombinant interferon-gamma prevent antigen-induced eosinophil recruitment in guinea pig trachea].

PubMed

Gao, Y; Chenping; Lin, X P

1997-10-01

In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.

Development of an aptamer beacon for detection of interferon-gamma.

PubMed

Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

2010-03-01

Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

Effect of gamma interferon on lung function of mustard gas exposed patients, after 15 years.

PubMed

Ghanei, Mostafa; Panahi, Yoones; Mojtahedzadeh, Mojtaba; Khalili, Ali Reza Hosseini; Aslani, Jafar

2006-01-01

Bronchiolitis has been known to be among the main the pathological features of lung lesions in Mustard Gas (MG) exposed patients. The purpose of this research was to evaluate the efficacy of interferon gamma-1b on the lung function in MG exposed patients with bronchiolitis. Thirty-six bronchiolitis patients, whose lung lesion had been diagnosed through High Resolution Computerized Tomography (HRCT) of the chest and also pathological study, were divided into two 18-member case and control groups. Both groups were receiving their conventional treatment (inhaled Felixotide and Servent). The case group were treated for 6 months with a combination of 200 microg of interferon gamma-1b (given three times per week subcutaneously) plus 7.5 mg of prednisolone (given once a day), while the control group received their previous conventional medications. Lung function was measured at base line and after 1, 3 and 6 months of treatment. In case and control groups, Forced Expiratory Volume in first second (FEV1) did not have statistical differences at the base line (49.3 +/- 2.9 and 48.7 +/- 4.1, respectively = 0.6), whereas a significant increase was seen in the case group (66.3 +/- 5.4) compared control group (57.3 +/- 8.6) at the subsequent months (P = 0.001 for the difference between the groups). Similar pattern of increase was observed in Forced Vital Capacity (FVC). The findings of this study indicate that a 6-month treatment with interferon gamma-1b plus a low-dose prednisolone is associated with an improvement in the lung function in mustard-gas exposed patients with bronchiolitis.

UCP2 deficiency helps to restrict the pathogenesis of experimental cutaneous and visceral leishmaniosis in mice.

PubMed

Carrión, Javier; Abengozar, M Angeles; Fernández-Reyes, María; Sánchez-Martín, Carlos; Rial, Eduardo; Domínguez-Bernal, Gustavo; González-Barroso, M Mar

2013-01-01

Uncoupling protein 2 (UCP2) is a mitochondrial transporter that has been shown to lower the production of reactive oxygen species (ROS). Intracellular pathogens such as Leishmania upregulate UCP2 and thereby suppress ROS production in infected host tissues, allowing the multiplication of parasites within murine phagocytes. This makes host UCP2 and ROS production potential targets in the development of antileishmanial therapies. Here we explore how UCP2 affects the outcome of cutaneous leishmaniosis (CL) and visceral leishmaniosis (VL) in wild-type (WT) C57BL/6 mice and in C57BL/6 mice lacking the UCP2 gene (UCP2KO). To investigate the effects of host UCP2 deficiency on Leishmania infection, we evaluated parasite loads and cytokine production in target organs. Parasite loads were significantly lower in infected UCP2KO mice than in infected WT mice. We also found that UCP2KO mice produced significantly more interferon-γ (IFN-γ), IL-17 and IL-13 than WT mice (P<0.05), suggesting that UCP2KO mice are resistant to Leishmania infection. In this way, UCP2KO mice were better able than their WT counterparts to overcome L. major and L. infantum infections. These findings suggest that upregulating host ROS levels, perhaps by inhibiting UPC2, may be an effective approach to preventing leishmaniosis.

Interferon-γ-Mediated Natural Killer Cell Activation by an Aqueous Panax ginseng Extract

PubMed Central

Takeda, Kazuyoshi; Okumura, Ko

2015-01-01

Panax ginseng extracts are used in traditional herbal medicines, particularly in eastern Asia, but their effect on natural killer (NK) cell activity is not completely understood. This study aimed to examine the effects of P. ginseng extracts on the cytotoxic activity of NK cells. We orally administered P. ginseng extracts or ginsenosides to wild-type (WT) C57BL/6 (B6) and BALB/c mice and to B6 mice deficient in either recombination activating gene 2 (RAG-2) or interferon-γ (IFN-γ). We then tested the cytotoxic activity of NK cells (of spleen and liver mononuclear cells) against NK-sensitive YAC-1 cells. Oral administration of P. ginseng aqueous extract augmented the cytotoxicity of NK cells in WT B6 and BALB/c mice and in RAG-2-deficient B6 mice, but not in IFN-γ-deficient B6 mice. This effect was only observed with the aqueous extract of P. ginseng. Interestingly, the ginsenosides Rb1 and Rg1 did not augment NK cell cytotoxicity. These results demonstrated that the aqueous P. ginseng extract augmented NK cell activation in vivo via an IFN-γ-dependent pathway. PMID:26649061

Interferon-gamma induces apoptosis and augments the expression of Fas and Fas ligand by microglia in vitro.

PubMed

Badie, B; Schartner, J; Vorpahl, J; Preston, K

2000-04-01

Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.

Combined Vitamin C and Vitamin E Deficiency Worsens Early Atherosclerosis in ApoE-Deficient Mice

PubMed Central

Babaev, Vladimir R.; Li, Liying; Shah, Sanket; Fazio, Sergio; Linton, MacRae F.; May, James M.

2010-01-01

Objective Atherosclerosis is an inflammatory condition associated with oxidative stress, but controversy persists regarding whether antioxidants such as vitamins C and E are preventative. To assess the role of combined deficiencies of vitamins C and E on the earliest stages of atherosclerosis, four combinations of vitamin supplementation (Low C/Low E, Low C/High E, High C/Low E, High C/High E) were studied in atherosclerosis-prone apolipoprotein E (apoE)-deficient mice also unable to synthesize their own vitamin C (gulo−/−). The effect of a more severe depletion of vitamin C alone was evaluated in a second experiment using gulo−/− mice carrying the hemizygous deletion of SVCT2, the vitamin C transporter. Methods and Results After 8 weeks on a high-fat diet (16% lard, 0.2% cholesterol), atherosclerosis developed in the aortic sinus areas of mice in all diet groups. Each vitamin-deficient diet significantly decreased liver and brain contents of the corresponding vitamin. Combined deficiency of both vitamins increased lipid peroxidation, doubled plaque size, and increased plaque macrophage content by 2-3-fold in males, although only plaque macrophage content was increased in females. A more severe deficiency of vitamin C in gulo−/− mice with defective cellular uptake of vitamin C increased both oxidative stress and atherosclerosis in apoE−/− mice compared to littermates on a diet replete in vitamin C, again most clearly in males. Conclusion Combined vitamin E and C deficiencies are required to worsen early atherosclerosis in an apoE-deficient mouse model. However, a more severe cellular deficiency of vitamin C alone promotes atherosclerosis when vitamin E is replete. PMID:20558818

Interferon-gamma of the giant panda (Ailuropoda melanoleuca): complementary DNA cloning, expression, and phylogenetic analysis.

PubMed

Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong

2010-01-01

Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

PubMed

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

Cloning, sequencing and expression of white rhinoceros (Ceratotherium simum) interferon-gamma (IFN-gamma) and the production of rhinoceros IFN-gamma specific antibodies.

PubMed

Morar, D; Tijhaar, E; Negrea, A; Hendriks, J; van Haarlem, D; Godfroid, J; Michel, A L; Rutten, V P M G

2007-01-15

Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-gamma) assay is used as a routine diagnostic tool to determine infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop reagents to set up a rhinoceros IFN-gamma (RhIFN-gamma) assay. The white rhinoceros IFN-gamma gene was cloned, sequenced and expressed as a mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-gamma shares a homology of 90% with equine IFN-gamma. Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant RhIFN-gamma were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that recombinant as well as native white rhinoceros IFN-gamma was recognised. This preliminary IFN-gamma enzyme-linked immunosorbent assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.

Interferon in resistance to bacterial and protozoan infections

NASA Technical Reports Server (NTRS)

Sonnenfeld, Gerald; Gould, Cheryl L.; Kierszenbaum, Felipe; Degee, Antonie L. W.; Mansfield, John M.

1986-01-01

The effects of genetic differences in mouse strains on the modulation of protozoan infections by interferon (IFN) were investigated. In one set of experiments, three different strains of mice were injected with T. cruzi, and their sera were assayed at five time intervals for IFN titer. A greater quantity of IFN was produced by mouse strains that were susceptible to T. cruzi infection than by the more resistant strain. In another set of experiments, spleen cell cultures from inbred strains of mice were challenged with an antigen made from T.b. rhodesiense. The cells from mice resistant to infection, produced greater amounts of IFN-gamma than did cells from the susceptible mice. In a third set of experiments, it was found that mice injected with T.b. rhodesiense before being infected with a diabetogenic virus (EMC-D) were resistant to the effects of the virus and did not produce virus-specific antibody.

B cell-deficient mice display markedly enhanced resistance to the intracellular bacterium Brucella abortus.

PubMed

Goenka, Radhika; Parent, Michelle A; Elzer, Philip H; Baldwin, Cynthia L

2011-04-15

Brucella species are facultative intracellular bacteria that cause lifelong infections in humans and livestock. Here we evaluated the contribution of B cells in control of murine brucellosis in the more susceptible BALB/c and the more resistant C57BL/6 mice by infecting B cell-deficient mice. Strikingly, in the absence of B cells in both C57BL/6 and BALB/c mice, 99% and 99.5% of the infection found in wild type mice was cleared, respectively. This augmented clearance was not reversed in either strain by passive transfer of immune serum. In C57BL/6 mice, the clearance of infection coincided with an increase in interferon γ (IFN-γ)-producing CD4 and CD8 T cells and a reduction in interleukin 10 (IL-10)-producing cells. In BALB/c mice, this clearance was IFN-γ-dependent, as B cell/IFN-γ dual knockout mice were unable to clear the infection, and was inversely related to the levels of transforming growth factor β (TGF-β). Furthermore, B cells were found to produce TGF-β and IL-10 during early stages of infection in BALB/c wild-type and C57BL/6 wild-type mice, respectively. Thus, we demonstrate that the establishment of the high plateau phase of infection is dependent on non-antibody-mediated B cell effector mechanisms, including B regulatory functions, during murine brucellosis. © The Author 2011. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved.

Establishment of a Bluetongue Virus Infection Model in Mice that Are Deficient in the Alpha/Beta Interferon Receptor

PubMed Central

Calvo-Pinilla, Eva; Rodríguez-Calvo, Teresa; Anguita, Juan; Sevilla, Noemí; Ortego, Javier

2009-01-01

Bluetongue (BT) is a noncontagious, insect-transmitted disease of ruminants caused by the bluetongue virus (BTV). A laboratory animal model would greatly facilitate the studies of pathogenesis, immune response and vaccination against BTV. Herein, we show that adult mice deficient in type I IFN receptor (IFNAR(−/−)) are highly susceptible to BTV-4 and BTV-8 infection when the virus is administered intravenously. Disease was characterized by ocular discharges and apathy, starting at 48 hours post-infection and quickly leading to animal death within 60 hours of inoculation. Infectious virus was recovered from the spleen, lung, thymus, and lymph nodes indicating a systemic infection. In addition, a lymphoid depletion in spleen, and severe pneumonia were observed in the infected mice. Furthermore, IFNAR(−/−) adult mice immunized with a BTV-4 inactivated vaccine showed the induction of neutralizing antibodies against BTV-4 and complete protection against challenge with a lethal dose of this virus. The data indicate that this mouse model may facilitate the study of BTV pathogenesis, and the development of new effective vaccines for BTV. PMID:19357779

Attenuated EAN in TNF-α Deficient Mice Is Associated with an Altered Balance of M1/M2 Macrophages

PubMed Central

Zhang, Hong-Liang; Hassan, Mohammed Y.; Zheng, Xiang-Yu; Azimullah, Sheikh; Quezada, Hernan Concha; Amir, Naheed; Elwasila, Mohamed; Mix, Eilhard; Adem, Abdu; Zhu, Jie

2012-01-01

The role of tumor necrosis factor (TNF)-α and its receptors in neuroautoimmune and neuroinflammatory diseases has been controversial. On the basis of our previous studies, we hereby aimed to further clarify TNF-α’s mechanism of action and to explore the potential role of TNF-α receptor (TNFR)1 as a therapeutic target in experimental autoimmune neuritis (EAN). EAN was induced by immunization with P0 peptide 180–199 in TNF-α knockout (KO) mice and anti-TNFR1 antibodies were used to treat EAN. Particularly, the effects of TNF-α deficiency and TNFR1 blockade on macrophage functions were investigated. The onset of EAN in TNF-α KO mice was markedly later than that in wild type (WT) mice. From day 14 post immunization, the clinical signs of TNF-α KO mice were significantly milder than those of their WT counterparts. Further, we showed that the clinical severity of WT mice treated with anti-TNFR1 antibodies was less severe than that of the control WT mice receiving PBS. Nevertheless, no difference with regard to the clinical signs of EAN or inflammatory infiltration in cauda equina was seen between TNF-α KO and WT mice with EAN after blockade of TNFR1. Although TNF-α deficiency did not alter the proliferation of lymphocytes in response to either antigenic or mitogenic stimuli, it down-regulated the production of interleukin (IL)-12 and nitric oxide (NO), and enhanced the production of IL-10 in macrophages. Increased ratio of regulatory T cells (Tregs) and reduced production of interferon (IFN)-γ in cauda equina infiltrating cells, and elevated levels of IgG2b antibodies against P0 peptide 180–199 in sera were found in TNF-α KO mice with EAN. In conclusion, TNF-α deficiency attenuates EAN via altering the M1/M2 balance of macrophages. PMID:22666471

Crucial role of gamma interferon-producing CD4+ Th1 cells but dispensable function of CD8+ T cell, B cell, Th2, and Th17 responses in the control of Brucella melitensis infection in mice.

PubMed

Vitry, Marie-Alice; De Trez, Carl; Goriely, Stanislas; Dumoutier, Laure; Akira, Shizuo; Ryffel, Bernhard; Carlier, Yves; Letesson, Jean-Jacques; Muraille, Eric

2012-12-01

Brucella spp. are facultative intracellular bacterial pathogens responsible for brucellosis, a worldwide zoonosis that causes abortion in domestic animals and chronic febrile disease associated with serious complications in humans. There is currently no approved vaccine against human brucellosis, and antibiotic therapy is long and costly. Development of a safe protective vaccine requires a better understanding of the roles played by components of adaptive immunity in the control of Brucella infection. The importance of lymphocyte subsets in the control of Brucella growth has been investigated separately by various research groups and remains unclear or controversial. Here, we used a large panel of genetically deficient mice to compare the importance of B cells, transporter associated with antigen processing (TAP-1), and major histocompatibility complex class II-dependent pathways of antigen presentation as well as T helper 1 (Th1), Th2, and Th17-mediated responses on the immune control of Brucella melitensis 16 M infection. We clearly confirmed the key function played by gamma interferon (IFN-γ)-producing Th1 CD4(+) T cells in the control of B. melitensis infection, whereas IFN-γ-producing CD8(+) T cells or B cell-mediated humoral immunity plays only a modest role in the clearance of bacteria during primary infection. In the presence of a Th1 response, Th2 or Th17 responses do not really develop or play a positive or negative role during the course of B. melitensis infection. On the whole, these results could improve our ability to develop protective vaccines or therapeutic treatments against brucellosis.

The effect of fermented milk on interferon production in malnourished children and in anorexia nervosa patients undergoing nutritional care.

PubMed

Solis, B; Nova, E; Gómez, S; Samartín, S; Mouane, N; Lemtouni, A; Belaoui, H; Marcos, A

2002-12-01

For several years cytokine production has been associated with infections but it was not suspected that some types of food could also induce cytokines, even in a state of non-infection. Lactic bacteria can induce interferon (IFN) production in human healthy subjects, thus, a better protection against infections would be expected. Therefore, we planned to evaluate the effect of two diets including yoghurt or milk on IFN-gamma production during nutritional recovery in two different situations of malnutrition: (1) children with diarrhoea; and (2) patients with anorexia nervosa (AN). Both the diet including yoghurt of that including milk seemed to increase IFN-gamma production at the end of nutritional recovery in the malnourished children with diarrhoea. The significance of interferon production and the lymphocyte subset increase should be explored to know if a better resistance against pathogens is related to them. Regulation of intestinal absorption and moderate stimulation of interferon production make the yoghurt-based diet a good choice in the nutritional care of children. In the same way, an increase in the IFN-gamma production was observed in AN patients consuming yoghurt. This increase of IFN-gamma production could be considered a biological marker to detect the effect of probiotics on the immune response, especially in the improvement of a deficient nutritional status.

Deficiency in Nrf2 transcription factor decreases adipose tissue mass and hepatic lipid accumulation in leptin-deficient mice.

PubMed

Xu, Jialin; Donepudi, Ajay C; More, Vijay R; Kulkarni, Supriya R; Li, Liya; Guo, Liangran; Yan, Bingfang; Chatterjee, Tapan; Weintraub, Neal; Slitt, Angela L

2015-02-01

To evaluate whether Nrf2 deficiency impacts insulin resistance and lipid accumulation in liver and white adipose tissue. Lep(ob/ob) mice (OB) with targeted Nrf2 deletion (OB-Nrf2KO) were generated. Pathogenesis of obesity and type 2 diabetes was measured in C57BL/6J, Nrf2KO, OB, and OB-Nrf2KO mice. Hepatic lipid content, lipid clearance, and very low-density lipoprotein (VLDL) secretion were determined between OB and OB-Nrf2KO mice. OB-Nrf2KO mice exhibited decreased white adipose tissue mass and decreased adipogenic and lipogenic gene expression compared with OB mice. Nrf2 deficiency prolonged hyperglycemia in response to glucose challenge, which was paralleled by reduced insulin-stimulated Akt phosphorylation. In OB mice, Nrf2 deficiency decreased hepatic lipid accumulation, decreased peroxisome proliferator-activated receptor γ expression and nicotinamide adenine dinucleotide phosphate (NADPH) content, and enhanced VLDL secretion. However, this observation was opposite in lean mice. Additionally, OB-Nrf2KO mice exhibited increased plasma triglyceride content, decreased HDL-cholesterol content, and enhanced apolipoprotein B expression, suggesting Nrf2 deficiency caused dyslipidemia in these mice. Nrf2 deficiency in Lep(ob/ob) mice reduced white adipose tissue mass and prevented hepatic lipid accumulation but induced insulin resistance and dyslipidemia. This study indicates a dual role of Nrf2 during metabolic dysregulation-increasing lipid accumulation in liver and white adipose tissue but preventing lipid accumulation in obese mice. © 2014 The Obesity Society.

Circadian Behaviour in Neuroglobin Deficient Mice

PubMed Central

Hundahl, Christian A.; Fahrenkrug, Jan; Hay-Schmidt, Anders; Georg, Birgitte; Faltoft, Birgitte; Hannibal, Jens

2012-01-01

Neuroglobin (Ngb), a neuron-specific oxygen-binding globin with an unknown function, has been proposed to play a key role in neuronal survival. We have previously shown Ngb to be highly expressed in the rat suprachiasmatic nucleus (SCN). The present study addresses the effect of Ngb deficiency on circadian behavior. Ngb-deficient and wild-type (wt) mice were placed in running wheels and their activity rhythms, endogenous period and response to light stimuli were investigated. The effect of Ngb deficiency on the expression of Period1 (Per1) and the immediate early gene Fos was determined after light stimulation at night and the neurochemical phenotype of Ngb expressing neurons in wt mice was characterized. Loss of Ngb function had no effect on overall circadian entrainment, but resulted in a significantly larger phase delay of circadian rhythm upon light stimulation at early night. A light-induced increase in Per1, but not Fos, gene expression was observed in Ngb-deficient mice. Ngb expressing neurons which co-stored Gastrin Releasing Peptide (GRP) and were innervated from the eye and the geniculo-hypothalamic tract expressed FOS after light stimulation. No PER1 expression was observed in Ngb-positive neurons. The present study demonstrates for the first time that the genetic elimination of Ngb does not affect core clock function but evokes an increased behavioural response to light concomitant with increased Per1 gene expression in the SCN at early night. PMID:22496809

Circadian behaviour in neuroglobin deficient mice.

PubMed

Hundahl, Christian A; Fahrenkrug, Jan; Hay-Schmidt, Anders; Georg, Birgitte; Faltoft, Birgitte; Hannibal, Jens

2012-01-01

Neuroglobin (Ngb), a neuron-specific oxygen-binding globin with an unknown function, has been proposed to play a key role in neuronal survival. We have previously shown Ngb to be highly expressed in the rat suprachiasmatic nucleus (SCN). The present study addresses the effect of Ngb deficiency on circadian behavior. Ngb-deficient and wild-type (wt) mice were placed in running wheels and their activity rhythms, endogenous period and response to light stimuli were investigated. The effect of Ngb deficiency on the expression of Period1 (Per1) and the immediate early gene Fos was determined after light stimulation at night and the neurochemical phenotype of Ngb expressing neurons in wt mice was characterized. Loss of Ngb function had no effect on overall circadian entrainment, but resulted in a significantly larger phase delay of circadian rhythm upon light stimulation at early night. A light-induced increase in Per1, but not Fos, gene expression was observed in Ngb-deficient mice. Ngb expressing neurons which co-stored Gastrin Releasing Peptide (GRP) and were innervated from the eye and the geniculo-hypothalamic tract expressed FOS after light stimulation. No PER1 expression was observed in Ngb-positive neurons. The present study demonstrates for the first time that the genetic elimination of Ngb does not affect core clock function but evokes an increased behavioural response to light concomitant with increased Per1 gene expression in the SCN at early night.

Behavioral Characteristics of Ubiquitin-Specific Peptidase 46-Deficient Mice

PubMed Central

Imai, Saki; Kano, Makoto; Nonoyama, Keiko; Ebihara, Shizufumi

2013-01-01

We have previously identified Usp46, which encodes for ubiquitin-specific peptidase 46, as a quantitative trait gene affecting the immobility time of mice in the tail suspension test (TST) and forced swimming test. The mutation that we identified was a 3-bp deletion coding for lysine (Lys 92), and mice with this mutation (MT mice), as well as Usp46 KO mice exhibited shorter TST immobility times. Behavioral pharmacology suggests that the gamma aminobutyric acid A (GABAA) receptor is involved in regulating TST immobility time. In order to understand how far Usp46 controls behavioral phenotypes, which could be related to mental disorders in humans, we subjected Usp46 MT and KO mice to multiple behavioral tests, including the open field test, ethanol preference test, ethanol-induced loss of righting reflex test, sucrose preference test, novelty-suppressed feeding test, marble burying test, and novel object recognition test. Although behavioral phenotypes of the Usp46 MT and KO mice were not always identical, deficiency of Usp46 significantly affected performance in all these tests. In the open field test, activity levels were lower in Usp46 KO mice than wild type (WT) or MT mice. Both MT and KO mice showed lower ethanol preference and shorter recovery times after ethanol administration. Compared to WT mice, Usp46 MT and KO mice exhibited decreased sucrose preference, took longer latency periods to bite pellets, and buried more marbles in the sucrose preference test, novelty-suppressed feeding test, and marble burying test, respectively. In the novel object recognition test, neither MT nor KO mice showed an increase in exploration of a new object 24 hours after training. These findings indicate that Usp46 regulates a wide range of behavioral phenotypes that might be related to human mental disorders and provides insight into the function of USP46 deubiquitinating enzyme in the neural system. PMID:23472206

Adipose tissue deficiency of hormone-sensitive lipase causes fatty liver in mice

PubMed Central

Yang, Hao; Wang, Shu Pei; Mitchell, Grant A.

2017-01-01

Fatty liver is a major health problem worldwide. People with hereditary deficiency of hormone-sensitive lipase (HSL) are reported to develop fatty liver. In this study, systemic and tissue-specific HSL-deficient mice were used as models to explore the underlying mechanism of this association. We found that systemic HSL deficient mice developed fatty liver in an age-dependent fashion between 3 and 8 months of age. To further explore the mechanism of fatty liver in HSL deficiency, liver-specific HSL knockout mice were created. Surprisingly, liver HSL deficiency did not influence liver fat content, suggesting that fatty liver in HSL deficiency is not liver autonomous. Given the importance of adipose tissue in systemic triglyceride metabolism, we created adipose-specific HSL knockout mice and found that adipose HSL deficiency, to a similar extent as systemic HSL deficiency, causes age-dependent fatty liver in mice. Mechanistic study revealed that deficiency of HSL in adipose tissue caused inflammatory macrophage infiltrates, progressive lipodystrophy, abnormal adipokine secretion and systemic insulin resistance. These changes in adipose tissue were associated with a constellation of changes in liver: low levels of fatty acid oxidation, of very low density lipoprotein secretion and of triglyceride hydrolase activity, each favoring the development of hepatic steatosis. In conclusion, HSL-deficient mice revealed a complex interorgan interaction between adipose tissue and liver: the role of HSL in the liver is minimal but adipose tissue deficiency of HSL can cause age-dependent hepatic steatosis. Adipose tissue is a potential target for treating the hepatic steatosis of HSL deficiency. PMID:29232702

Adipose tissue deficiency of hormone-sensitive lipase causes fatty liver in mice.

PubMed

Xia, Bo; Cai, Guo He; Yang, Hao; Wang, Shu Pei; Mitchell, Grant A; Wu, Jiang Wei

2017-12-01

Fatty liver is a major health problem worldwide. People with hereditary deficiency of hormone-sensitive lipase (HSL) are reported to develop fatty liver. In this study, systemic and tissue-specific HSL-deficient mice were used as models to explore the underlying mechanism of this association. We found that systemic HSL deficient mice developed fatty liver in an age-dependent fashion between 3 and 8 months of age. To further explore the mechanism of fatty liver in HSL deficiency, liver-specific HSL knockout mice were created. Surprisingly, liver HSL deficiency did not influence liver fat content, suggesting that fatty liver in HSL deficiency is not liver autonomous. Given the importance of adipose tissue in systemic triglyceride metabolism, we created adipose-specific HSL knockout mice and found that adipose HSL deficiency, to a similar extent as systemic HSL deficiency, causes age-dependent fatty liver in mice. Mechanistic study revealed that deficiency of HSL in adipose tissue caused inflammatory macrophage infiltrates, progressive lipodystrophy, abnormal adipokine secretion and systemic insulin resistance. These changes in adipose tissue were associated with a constellation of changes in liver: low levels of fatty acid oxidation, of very low density lipoprotein secretion and of triglyceride hydrolase activity, each favoring the development of hepatic steatosis. In conclusion, HSL-deficient mice revealed a complex interorgan interaction between adipose tissue and liver: the role of HSL in the liver is minimal but adipose tissue deficiency of HSL can cause age-dependent hepatic steatosis. Adipose tissue is a potential target for treating the hepatic steatosis of HSL deficiency.

Application of genetically engineered Salmonella typhimurium for interferon-gamma-induced therapy against melanoma.

PubMed

Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo

2017-01-01

Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

Protective effects of granulocyte colony-stimulating factor on endotoxin shock in mice with retrovirus-induced immunodeficiency syndrome.

PubMed

Toki, S; Hiromatsu, K; Aoki, Y; Makino, M; Yoshikai, Y

1997-10-01

Mice with retrovirus-induced murine acquired immunodeficiency syndrome (MAIDS) were hypersensitive to lipopolysaccharide (LPS)-induced lethal shock accompanied by marked elevations of systematic interleukin 1beta (IL-beta) and interferon gamma (IFN-gamma) after LPS challenge. Pretreatment with 10 microg of recombinant human granulocyte colony-stimulating factor (rhG-CSF) protected MAIDS mice from hypersensitivity to LPS-induced lethal shock and this protection was concomitant with suppression of IFN-gamma production. Copyright 1997 Academic Press Limited.

Analysis of glomerulosclerosis and atherosclerosis in lecithin cholesterol acyltransferase-deficient mice.

PubMed

Lambert, G; Sakai, N; Vaisman, B L; Neufeld, E B; Marteyn, B; Chan, C C; Paigen, B; Lupia, E; Thomas, A; Striker, L J; Blanchette-Mackie, J; Csako, G; Brady, J N; Costello, R; Striker, G E; Remaley, A T; Brewer, H B; Santamarina-Fojo, S

2001-05-04

To evaluate the biochemical and molecular mechanisms leading to glomerulosclerosis and the variable development of atherosclerosis in patients with familial lecithin cholesterol acyl transferase (LCAT) deficiency, we generated LCAT knockout (KO) mice and cross-bred them with apolipoprotein (apo) E KO, low density lipoprotein receptor (LDLr) KO, and cholesteryl ester transfer protein transgenic mice. LCAT-KO mice had normochromic normocytic anemia with increased reticulocyte and target cell counts as well as decreased red blood cell osmotic fragility. A subset of LCAT-KO mice accumulated lipoprotein X and developed proteinuria and glomerulosclerosis characterized by mesangial cell proliferation, sclerosis, lipid accumulation, and deposition of electron dense material throughout the glomeruli. LCAT deficiency reduced the plasma high density lipoprotein (HDL) cholesterol (-70 to -94%) and non-HDL cholesterol (-48 to -85%) levels in control, apoE-KO, LDLr-KO, and cholesteryl ester transfer protein-Tg mice. Transcriptome and Western blot analysis demonstrated up-regulation of hepatic LDLr and apoE expression in LCAT-KO mice. Despite decreased HDL, aortic atherosclerosis was significantly reduced (-35% to -99%) in all mouse models with LCAT deficiency. Our studies indicate (i) that the plasma levels of apoB containing lipoproteins rather than HDL may determine the atherogenic risk of patients with hypoalphalipoproteinemia due to LCAT deficiency and (ii) a potential etiological role for lipoproteins X in the development of glomerulosclerosis in LCAT deficiency. The availability of LCAT-KO mice characterized by lipid, hematologic, and renal abnormalities similar to familial LCAT deficiency patients will permit future evaluation of LCAT gene transfer as a possible treatment for glomerulosclerosis in LCAT-deficient states.

Vulnerable atherosclerotic plaque morphology in apolipoprotein E-deficient mice unable to make ascorbic Acid.

PubMed

Nakata, Yukiko; Maeda, Nobuyo

2002-03-26

Oxidative stress is thought to play an important role in atherogenesis, suggesting that antioxidants could prevent coronary artery disease. However, the efficacy of vitamin C in reducing atherosclerosis is debatable in humans and has not been tested rigorously in animals. Gulo(-/-)Apoe(-/-) mice were used to test a hypothesis that chronic vitamin C deficiency enhances the initiation and development of atherosclerosis. These mice are dependent on dietary vitamin C because of the lack of L-gulonolactone-gamma-oxidase and are prone to develop atherosclerosis because of lacking apolipoprotein E. Beginning at 6 weeks of age, the Gulo(-/-)Apoe(-/-) mice were fed regular chow or Western-type diets containing high fat and supplemented with either 0.033 g or 3.3 g/L of vitamin C in their drinking water. This regimen produced mice with chronically low vitamin C (average 1.5 microg/mL in plasma) or high vitamin C (average 10 to 30 microg/mL in plasma). Morphometric analysis showed that within each sex, age, and diet group, the sizes of the atherosclerotic plaques were not different between low vitamin C mice and high vitamin C mice. However, advanced plaques in the low vitamin C mice had significantly reduced amounts of Sirius red-staining collagen (36.4+/-2.2% versus 54.8+/-2.3%, P<0.0001), larger necrotic cores within the plaques, and reduced fibroproliferation and neovascularization in the aortic adventitia. Chronic vitamin C deficiency does not influence the initiation or progression of atherosclerotic plaques but severely compromises collagen deposition and induces a type of plaque morphology that is potentially vulnerable to rupture.

Protective Effect of 940 nm Laser on Gamma-Irradiated Mice

PubMed Central

Efremova, Yulia; Navratil, Leos

2015-01-01

Abstract Objective: The purpose of this study was to investigate the radioprotective features of 940 nm laser on the life span of mice, and absolute counts of blood cells and their proportions in gamma-irradiated mice. Background data: An important feature of laser light is activation of mitotic division and differentiation of cells, which may be useful in activation of hematopoiesis in gamma-irradiated organisms. Materials and methods: Mice were randomly assigned to 11 groups according to the type(s) of influence. Generally, mice were irradiated in three different ways: with laser at different fluences, with gamma irradiation, or by combination of laser at different fluences and gamma irradiation in a different order. Mice were treated with 940 nm laser at 3, 12, or 18 J/cm2 and/or a lethal dose of gamma irradiation (8.7 Gy). Each group was randomly subdivided into two subgroups, in which the life span of the mice and blood cell counts (on 12th and 45th day after gamma irradiation) were analyzed. Results: Laser (940 nm) at a fluence of 3 J/cm2 significantly prolonged the life span of gamma-irradiated mice (p<0.05). In the same group, counts of white blood cells, lymphocytes, and neutrophils were higher on day 12 than in the gamma group. On day 45 after gamma irradiation, some signs of hematopoiesis repair were found in blood. There were no significant differences in counts of erythrocytes, monocytes, neutrophils, or the proportion of neutrophils between this group and the control group. Conclusions: In summary, 940 nm laser at a fluence of 3 J/cm2 demonstrates radioprotective features in an experiment with lethally irradiated mice. Mechanisms responsible for this effect will be investigated in further studies. PMID:25654740

Mice deficient in LRG-47 display enhanced susceptibility to Trypanosoma cruzi infection associated with defective hemopoiesis and intracellular control of parasite growth.

PubMed

Santiago, Helton C; Feng, Carl G; Bafica, Andre; Roffe, Ester; Arantes, Rosa M; Cheever, Allen; Taylor, Gregory; Vieira, Leda Q; Vierira, Leda Q; Aliberti, Julio; Gazzinelli, Ricardo T; Sher, Alan

2005-12-15

IFN-gamma is known to be required for host control of intracellular Trypanosoma cruzi infection in mice, although the basis of its protective function is poorly understood. LRG-47 is an IFN-inducible p47GTPase that has been shown to regulate host resistance to intracellular pathogens. To investigate the possible role of LRG-47 in IFN-gamma-dependent control of T. cruzi infection, LRG-47 knockout (KO) and wild-type (WT) mice were infected with the Y strain of this parasite, and host responses were analyzed. When assayed on day 12 after parasite inoculation, LRG-47 KO mice, in contrast to IFN-gamma KO mice, controlled early parasitemia almost as effectively as WT animals. However, the infected LRG-47 KO mice displayed a rebound in parasite growth on day 15, and all succumbed to the infection by day 19. Additional analysis indicated that LRG-47-deficient mice exhibit unimpaired proinflammatory responses throughout the infection. Instead, reactivated disease in the KO animals was associated with severe splenic and thymic atrophy, anemia, and thrombocytopenia not observed in their WT counterparts. In addition, in vitro studies revealed that IFN-gamma-stimulated LRG-47 KO macrophages display defective intracellular killing of amastigotes despite normal expression of TNF and NO synthetase type 2 and that both NO synthetase type 2 and LRG-47 are required for optimum IFN-gamma-dependent restriction of parasite growth. Together, these data establish that LRG-47 can influence pathogen control by simultaneously regulating macrophage-microbicidal activity and hemopoietic function.

Endoplasmic Reticulum Stress-induced Hepatocellular Death Pathways Mediate Liver Injury and Fibrosis via Stimulator of Interferon Genes*

PubMed Central

Iracheta-Vellve, Arvin; Petrasek, Jan; Gyongyosi, Benedek; Satishchandran, Abhishek; Lowe, Patrick; Kodys, Karen; Catalano, Donna; Calenda, Charles D.; Kurt-Jones, Evelyn A.; Fitzgerald, Katherine A.; Szabo, Gyongyi

2016-01-01

Fibrosis, driven by inflammation, marks the transition from benign to progressive stages of chronic liver diseases. Although inflammation promotes fibrogenesis, it is not known whether other events, such as hepatocyte death, are required for the development of fibrosis. Interferon regulatory factor 3 (IRF3) regulates hepatocyte apoptosis and production of type I IFNs. In the liver, IRF3 is activated via Toll-like receptor 4 (TLR4) signaling or the endoplasmic reticulum (ER) adapter, stimulator of interferon genes (STING). We hypothesized that IRF3-mediated hepatocyte death is an independent determinant of chemically induced liver fibrogenesis. To test this, we performed acute or chronic CCl4 administration to WT and IRF3-, Toll/Interleukin-1R (TIR) domain-containing adapter-inducing interferon-β (TRIF)-, TRIF-related adaptor molecule (TRAM)-, and STING-deficient mice. We report that acute CCl4 administration to WT mice resulted in early ER stress, activation of IRF3, and type I IFNs, followed by hepatocyte apoptosis and liver injury, accompanied by liver fibrosis upon repeated administration of CCl4. Deficiency of IRF3 or STING prevented hepatocyte death and fibrosis both in acute or chronic CCl4. In contrast, mice deficient in type I IFN receptors or in TLR4 signaling adaptors, TRAM or TRIF, upstream of IRF3, were not protected from hepatocyte death and/or fibrosis, suggesting that the pro-apoptotic role of IRF3 is independent of TLR signaling in fibrosis. Hepatocyte death is required for liver fibrosis with causal involvement of STING and IRF3. Thus, our results identify that IRF3, by its association with STING in the presence of ER stress, couples hepatocyte apoptosis with liver fibrosis and indicate that innate immune signaling regulates outcomes of liver fibrosis via modulation of hepatocyte death in the liver. PMID:27810900

Energy homeostasis in leptin deficient Lepob/ob mice.

PubMed

Skowronski, Alicja A; Ravussin, Yann; Leibel, Rudolph L; LeDuc, Charles A

2017-01-01

Maintenance of reduced body weight is associated both with reduced energy expenditure per unit metabolic mass and increased hunger in mice and humans. Lowered circulating leptin concentration, due to decreased fat mass, provides a primary signal for this response. However, leptin deficient (Lepob/ob) mice (and leptin receptor deficient Zucker rats) reduce energy expenditure following weight reduction by a necessarily non-leptin dependent mechanisms. To identify these mechanisms, Lepob/ob mice were fed ad libitum (AL group; n = 21) or restricted to 3 kilocalories of chow per day (CR group, n = 21). After losing 20% of initial weight (in approximately 2 weeks), the CR mice were stabilized at 80% of initial body weight for two weeks by titrated refeeding, and then released from food restriction. CR mice conserved energy (-17% below predicted based on body mass and composition during the day; -52% at night); and, when released to ad libitum feeding, CR mice regained fat and lean mass (to AL levels) within 5 weeks. CR mice did so while their ad libitum caloric intake was equal to that of the AL animals. While calorically restricted, the CR mice had a significantly lower respiratory exchange ratio (RER = 0.89) compared to AL (0.94); after release to ad libitum feeding, RER was significantly higher (1.03) than in the AL group (0.93), consistent with their anabolic state. These results confirm that, in congenitally leptin deficient animals, leptin is not required for compensatory reduction in energy expenditure accompanying weight loss, but suggest that the hyperphagia of the weight-reduced state is leptin-dependent.

Transcriptional analysis of immune-related gene expression in p53-deficient mice with increased susceptibility to influenza A virus infection.

PubMed

Yan, Wenjun; Wei, Jianchao; Deng, Xufang; Shi, Zixue; Zhu, Zixiang; Shao, Donghua; Li, Beibei; Wang, Shaohui; Tong, Guangzhi; Ma, Zhiyong

2015-08-18

p53 is a tumor suppressor that contributes to the host immune response against viral infections in addition to its well-established protective role against cancer development. In response to influenza A virus (IAV) infection, p53 is activated and plays an essential role in inhibiting IAV replication. As a transcription factor, p53 regulates the expression of a range of downstream responsive genes either directly or indirectly in response to viral infection. We compared the expression profiles of immune-related genes between IAV-infected wild-type p53 (p53WT) and p53-deficient (p53KO) mice to gain an insight into the basis of p53-mediated antiviral response. p53KO and p53WT mice were infected with influenza A/Puerto Rico/8/1934 (PR8) strain. Clinical symptoms and body weight changes were monitored daily. Lung specimens of IAV-infected mice were collected for analysis of virus titers and gene expression profiles. The difference in immune-related gene expression levels between IAV-infected p53KO and p53WT mice was comparatively determined using microarray analysis and confirmed by quantitative real-time reverse transcription polymerase chain reaction. p53KO mice showed an increased susceptibility to IAV infection compared to p53WT mice. Microarray analysis of gene expression profiles in the lungs of IAV-infected mice indicated that the increased susceptibility was associated with significantly changed expression levels in a range of immune-related genes in IAV-infected p53KO mice. A significantly attenuated expression of Ifng (encoding interferon (IFN)-gamma), Irf7 (encoding IFN regulator factor 7), and antiviral genes, such as Mx2 and Eif2ak2 (encoding PKR), were observed in IAV-infected p53KO mice, suggesting an impaired IFN-mediated immune response against IAV infection in the absence of p53. In addition, dysregulated expression levels of proinflammatory cytokines and chemokines, such as Ccl2 (encoding MCP-1), Cxcl9, Cxcl10 (encoding IP-10), and Tnf, were detected

Choline Deficiency Causes Colonic Type II Natural Killer T (NKT) Cell Loss and Alleviates Murine Colitis under Type I NKT Cell Deficiency

PubMed Central

Sagami, Shintaro; Ueno, Yoshitaka; Tanaka, Shinji; Fujita, Akira; Niitsu, Hiroaki; Hayashi, Ryohei; Hyogo, Hideyuki; Hinoi, Takao; Kitadai, Yasuhiko; Chayama, Kazuaki

2017-01-01

Serum levels of choline and its derivatives are lower in patients with inflammatory bowel disease (IBD) than in healthy individuals. However, the effect of choline deficiency on the severity of colitis has not been investigated. In the present study, we investigated the role of choline deficiency in dextran sulfate sodium (DSS)-induced colitis in mice. Methionine-choline-deficient (MCD) diet lowered the levels of type II natural killer T (NKT) cells in the colonic lamina propria, peritoneal cavity, and mesenteric lymph nodes, and increased the levels of type II NKT cells in the livers of wild-type B6 mice compared with that in mice fed a control (CTR) diet. The gene expression pattern of the chemokine receptor CXCR6, which promotes NKT cell accumulation, varied between colon and liver in a manner dependent on the changes in the type II NKT cell levels. To examine the role of type II NKT cells in colitis under choline-deficient conditions, we assessed the severity of DSS-induced colitis in type I NKT cell-deficient (Jα18-/-) or type I and type II NKT cell-deficient (CD1d-/-) mice fed the MCD or CTR diets. The MCD diet led to amelioration of inflammation, decreases in interferon (IFN)-γ and interleukin (IL)-4 secretion, and a decrease in the number of IFN-γ and IL-4-producing NKT cells in Jα18-/- mice but not in CD1d-/- mice. Finally, adaptive transfer of lymphocytes with type II NKT cells exacerbated DSS-induced colitis in Jα18-/- mice with MCD diet. These results suggest that choline deficiency causes proinflammatory type II NKT cell loss and alleviates DSS-induced colitis. Thus, inflammation in DSS-induced colitis under choline deficiency is caused by type II NKT cell-dependent mechanisms, including decreased type II NKT cell and proinflammatory cytokine levels. PMID:28095507

Choline Deficiency Causes Colonic Type II Natural Killer T (NKT) Cell Loss and Alleviates Murine Colitis under Type I NKT Cell Deficiency.

PubMed

Sagami, Shintaro; Ueno, Yoshitaka; Tanaka, Shinji; Fujita, Akira; Niitsu, Hiroaki; Hayashi, Ryohei; Hyogo, Hideyuki; Hinoi, Takao; Kitadai, Yasuhiko; Chayama, Kazuaki

2017-01-01

Serum levels of choline and its derivatives are lower in patients with inflammatory bowel disease (IBD) than in healthy individuals. However, the effect of choline deficiency on the severity of colitis has not been investigated. In the present study, we investigated the role of choline deficiency in dextran sulfate sodium (DSS)-induced colitis in mice. Methionine-choline-deficient (MCD) diet lowered the levels of type II natural killer T (NKT) cells in the colonic lamina propria, peritoneal cavity, and mesenteric lymph nodes, and increased the levels of type II NKT cells in the livers of wild-type B6 mice compared with that in mice fed a control (CTR) diet. The gene expression pattern of the chemokine receptor CXCR6, which promotes NKT cell accumulation, varied between colon and liver in a manner dependent on the changes in the type II NKT cell levels. To examine the role of type II NKT cells in colitis under choline-deficient conditions, we assessed the severity of DSS-induced colitis in type I NKT cell-deficient (Jα18-/-) or type I and type II NKT cell-deficient (CD1d-/-) mice fed the MCD or CTR diets. The MCD diet led to amelioration of inflammation, decreases in interferon (IFN)-γ and interleukin (IL)-4 secretion, and a decrease in the number of IFN-γ and IL-4-producing NKT cells in Jα18-/- mice but not in CD1d-/- mice. Finally, adaptive transfer of lymphocytes with type II NKT cells exacerbated DSS-induced colitis in Jα18-/- mice with MCD diet. These results suggest that choline deficiency causes proinflammatory type II NKT cell loss and alleviates DSS-induced colitis. Thus, inflammation in DSS-induced colitis under choline deficiency is caused by type II NKT cell-dependent mechanisms, including decreased type II NKT cell and proinflammatory cytokine levels.

Histaminergic regulation of interferon-gamma (IFN-gamma) production by human natural killer (NK) cells.

PubMed

Asea, A; Hansson, M; Czerkinsky, C; Houze, T; Hermodsson, S; Strannegård, O; Hellstrand, K

1996-08-01

Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-gamma by CD3-/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-gamma production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-gamma production was operating on a pretranslational level, as indicated by the inability of enriched NK cells to accumulate IFN-gamma mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-gamma production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-gamma production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-gamma in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-gamma mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-gamma production by preventing monocyte-induced oxidative damage to NK cells.

A comparison of mucosal inflammatory responses to Giardia muris in resistant B10 and susceptible BALB/c mice.

PubMed

Venkatesan, P; Finch, R G; Wakelin, D

1997-03-01

In the first three weeks of primary Giardia muris infections B10 mice clear infection more rapidly than BALB/c mice. There is evidence that interferon-gamma contributes to the relative resistance of B10 mice. The nature of the functional contribution of interferon-gamma is unclear and does not relate to the secretory or serum antibody response. Mucosal inflammatory events in these strains have been studied. Apart from a small rise in both strains of goblet cell and mucosal mast cell numbers, associated with release of mast cell protease-1 in serum, no inflammatory infiltrate was observed at the time trophozoites were cleared from the intestinal lumen. Inhibition of mast cell products (5-hydroxytryptamine and histamine) by cyproheptadine enhanced the intensity of infection in both strains. The relative resistance of B10 mice could not be explained in terms of the mucosal inflammatory response.

Interferon system in women with genital papillomavirus infection receiving immunomodulatory therapy.

PubMed

Rogovskaya, S I; Zhdanov, A V; Loginova, N S; Faizullin, L Z; Prilepskaya, V N; Van'ko, L V; Sukhikh, G T

2002-11-01

The interferon system was studied in women with genital papillomavirus infection. In most patients the interferon system was activated, while the ability of lymphocytes to respond to inductors decreased. Laserotherapy and immunomodulatory therapy with larifan, ridostin, and viferon for 1 month normalized blood interferon concentration (39.4% patients) and interferon-gamma production by lymphocytes in response to inductors (87.9% patients). After laser monotherapy these parameters returned to normal only in 13.2 and 7.6% patients, respectively. Correlation and regression analyses showed that changes in the interferon system were synchronized after immunomodulatory therapy. These data indicate that immunomodulatory therapy produces a complex effect on the interferon system. Measurements of blood interferon level can be used to predict the effect of further treatment with interferon-gamma inductors.

Disturbed hepatic carbohydrate management during high metabolic demand in medium-chain acyl-CoA dehydrogenase (MCAD)-deficient mice.

PubMed

Herrema, Hilde; Derks, Terry G J; van Dijk, Theo H; Bloks, Vincent W; Gerding, Albert; Havinga, Rick; Tietge, Uwe J F; Müller, Michael; Smit, G Peter A; Kuipers, Folkert; Reijngoud, Dirk-Jan

2008-06-01

Medium-chain acyl-coenzyme A (CoA) dehydrogenase (MCAD) catalyzes crucial steps in mitochondrial fatty acid oxidation, a process that is of key relevance for maintenance of energy homeostasis, especially during high metabolic demand. To gain insight into the metabolic consequences of MCAD deficiency under these conditions, we compared hepatic carbohydrate metabolism in vivo in wild-type and MCAD(-/-) mice during fasting and during a lipopolysaccharide (LPS)-induced acute phase response (APR). MCAD(-/-) mice did not become more hypoglycemic on fasting or during the APR than wild-type mice did. Nevertheless, microarray analyses revealed increased hepatic peroxisome proliferator-activated receptor gamma coactivator-1alpha (Pgc-1alpha) and decreased peroxisome proliferator-activated receptor alpha (Ppar alpha) and pyruvate dehydrogenase kinase 4 (Pdk4) expression in MCAD(-/-) mice in both conditions, suggesting altered control of hepatic glucose metabolism. Quantitative flux measurements revealed that the de novo synthesis of glucose-6-phosphate (G6P) was not affected on fasting in MCAD(-/-) mice. During the APR, however, this flux was significantly decreased (-20%) in MCAD(-/-) mice compared with wild-type mice. Remarkably, newly formed G6P was preferentially directed toward glycogen in MCAD(-/-) mice under both conditions. Together with diminished de novo synthesis of G6P, this led to a decreased hepatic glucose output during the APR in MCAD(-/-) mice; de novo synthesis of G6P and hepatic glucose output were maintained in wild-type mice under both conditions. APR-associated hypoglycemia, which was observed in wild-type mice as well as MCAD(-/-) mice, was mainly due to enhanced peripheral glucose uptake. Our data demonstrate that MCAD deficiency in mice leads to specific changes in hepatic carbohydrate management on exposure to metabolic stress. This deficiency, however, does not lead to reduced de novo synthesis of G6P during fasting alone, which may be due to the

B-vitamin deficiency is protective against DSS-induced colitis in mice

PubMed Central

Benight, Nancy M.; Stoll, Barbara; Chacko, Shaji; da Silva, Vanessa R.; Marini, Juan C.; Gregory, Jesse F.; Stabler, Sally P.

2011-01-01

Vitamin deficiencies are common in patients with inflammatory bowel disease (IBD). Homocysteine (Hcys) is a thrombogenic amino acid produced from methionine (Met), and its increase in patients with IBD indicates a disruption of Met metabolism; however, the role of Hcys and Met metabolism in IBD is not well understood. We hypothesized that disrupted Met metabolism from a B-vitamin-deficient diet would exacerbate experimental colitis. Mice were fed a B6-B12-deficient or control diet for 2 wk and then treated with dextran sodium sulfate (DSS) to induce colitis. We monitored disease activity during DSS treatment and collected plasma and tissue for analysis of inflammatory tissue injury and Met metabolites. We also quantified Met cycle activity by measurements of in vivo Met kinetics using [1-13C-methyl-2H3]methionine infusion in similarly treated mice. Unexpectedly, we found that mice given the B-vitamin-deficient diet had improved clinical outcomes, including increased survival, weight maintenance, and reduced disease scores. We also found lower histological disease activity and proinflammatory gene expression (TNF-α and inducible nitric oxide synthase) in the colon in deficient-diet mice. Metabolomic analysis showed evidence that these effects were associated with deficient B6, as markers of B12 function were only mildly altered. In vivo methionine kinetics corroborated these results, showing that the deficient diet suppressed transsulfuration but increased remethylation. Our findings suggest that disrupted Met metabolism attributable to B6 deficiency reduces the inflammatory response and disease activity in DSS-challenged mice. These results warrant further human clinical studies to determine whether B6 deficiency and elevated Hcys in patients with IBD contribute to disease pathobiology. PMID:21596995

Molecular stress response in the CNS of mice after systemic exposureto interferon-alpha, ionizing radiation and ketamine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lowe, Xiu R.; Marchetti, Francesco; Lu, Xiaochen

2009-03-03

We previously showed that the expression of troponin T1 (Tnnt 1) was induced in the central nervous system (CNS) of adultmice 30 min after treatment with ketamine, a glutamate N-methyl-D-aspartic acid (NMDA) receptor antagonist. We hypothesized that Tnnt 1 expression may be an early molecular biomarker of stress response in the CNS of mice. To further evaluate this hypothesis, we investigated the regional expression of Tnnt 1 in the mouse brain using RNA in situ hybridization 4 h after systemic exposure to interferon-a (IFN-a) and gamma ionizing radiation, both of which have be associated with wide ranges of neuropsychiatric complications.more » Adult B6C3F1 male mice were treated with either human IFN-a (a single i.p. injection at 1 x 105 IU/kg) or whole body gamma-radiation (10 cGy or 2 Gy). Patterns of Tnnt 1 transcript expression were compared in various CNS regions after IFN-a, radiation and ketamine treatments (previous study). Tnnt 1 expression was consistently induced in pyramidal neurons of cerebral cortex and hippocampus after all treatment regimens including 10 cGy of ionizing radiation. Regional expression of Tnnt 1 was induced in Purkinje cells of cerebellum after ionizing radiation and ketamine treatment; but not after IFN-a treatment. None of the three treatments induced Tnnt 1 expression in glial cells. The patterns of Tnnt 1 expression in pyramidal neurons of cerebral cortex andhippocampus, which are both known to play important roles in cognitive function, memory and emotion, suggest that the expression of Tnnt 1 may be an early molecular biomarker of induced CNS stress.« less

Absence of Wip1 partially rescues Atm deficiency phenotypes in mice

PubMed Central

Darlington, Yolanda; Nguyen, Thuy-Ai; Moon, Sung-Hwan; Herron, Alan; Rao, Pulivarthi; Zhu, Chengming; Lu, Xiongbin; Donehower, Lawrence A.

2011-01-01

Wildtype p53-Induced Phosphatase 1 (WIP1) is a serine/threonine phosphatase that dephosphorylates proteins in the ataxia telangiectasia mutated (ATM)-initiated DNA damage response pathway. WIP1 may play a homeostatic role in ATM signaling by returning the cell to a normal pre-stress state following completion of DNA repair. To better understand the effects of WIP1 on ATM signaling, we crossed Atm-deficient mice to Wip1-deficient mice and characterized phenotypes of the double knockout progeny. We hypothesized that the absence of Wip1 might rescue Atm deficiency phenotypes. Atm null mice, like ATM-deficient humans with the inherited syndrome ataxia telangiectasia, exhibit radiation sensitivity, fertility defects, and are T-cell lymphoma prone. Most double knockout mice were largely protected from lymphoma development and had a greatly extended lifespan compared to Atm null mice. Double knockout mice had increased p53 and H2AX phosphorylation and p21 expression compared to their Atm null counterparts, indicating enhanced p53 and DNA damage responses. Additionally, double knockout splenocytes displayed reduced chromosomal instability compared to Atm null mice. Finally, doubly null mice were partially rescued from infertility defects observed in Atm null mice. These results indicate that inhibition of WIP1 may represent a useful strategy for cancer treatment in general and A-T patients in particular. PMID:21765465

Potential mechanisms of cytosolic calcium modulation in interferon-gamma treated U937 cells

NASA Technical Reports Server (NTRS)

Klein, Jon B.; Mcleish, Kenneth R.; Sonnenfeld, Gerald; Dean, William L.

1987-01-01

The ability of interferon-gamma (IFN-gamma) to alter cytoplasmic Ca(2+) content in the monocytelike cell line U937 was investigated, using a slow Ca-channel blocker, diltiazem. In addition, the Ca-ATPase and the Ca-uptake activities were measured in isolated U937 membranes, together with the effect of inositol trisphosphate (IP3) upon the Ca(2+) release from Ca-loaded membranes. The addition of 50 U/ml INF-gamma to U937 cultures was found to increase internal Ca(2+) by about 100 percent within 3 min. The increase was significantly reduced by incubation in Ca-free buffer or by the addition of diltiazem. A crude membrane preparation from U937 cells was found to contain significant amounts of Ca-ATPase activity and to sequester Ca(2+) to a level of 8 nmol/mg in 30 sec; the addition of IP3 induced release of a portion of the sequestered Ca(2+) which was then resequestered. The results suggest that IFN-gamma causes an increase of cytoplasmic Ca(2+), in part, by the IP3-induced release from the internal storage sites and, in part, from the entry of extracellular Ca through slow channels.

Photic Resetting and Entrainment in CLOCK-Deficient Mice

PubMed Central

Dallmann, Robert; DeBruyne, Jason P.; Weaver, David R.

2012-01-01

Mice lacking CLOCK protein have a relatively subtle circadian phenotype, including a slightly shorter period in constant darkness, differences in phase resetting after 4-hr light pulses in the early and late night, and a variably advanced phase angle of entrainment in a light-dark (LD) cycle (DeBruyne et al., Neuron 50:465–477, 2006). The present series of experiments was conducted to more fully characterize the circadian phenotype of Clock−/− mice under various lighting conditions. A phase-response curve (PRC) to 4-hour light pulses in free-running mice was conducted; the results confirm that Clock−/− mice exhibit very large phase advances after 4 hrs light pulses in the late subjective night, but have relatively normal responses to light at other phases. The abnormal shape of the PRC to light may explain the tendency of CLOCK-deficient mice to begin activity before lights-out when housed in a 12 hrs light: 12 hrs dark lighting schedule. To assess this relationship further, Clock−/− and wild-type control mice were entrained to skeleton lighting cycles (1L:23D, and 1L:10D:1L:12D). Comparing entrainment under the two types of skeleton photoperiods revealed that exposure to 1 hr light in the morning leads to a phase advance of activity onset (expressed the following afternoon) in Clock−/− mice, but not in the controls. Constant light typically causes an intensity-dependent increase in circadian period in mice, but this did not occur in CLOCK-deficient mice. The failure of Clock−/− mice to respond to the period-lengthening effect of constant light likely results from the increased functional impact of light falling in the phase advance zone of the PRC. Collectively, these experiments reveal that alterations in the response of CLOCK-deficient mice to light in several paradigms are likely due to an imbalance in the shape of the PRC to light. PMID:21921293

Aldose Reductase-Deficient Mice Develop Nephrogenic Diabetes Insipidus

PubMed Central

Ho, Horace T. B.; Chung, Sookja K.; Law, Janice W. S.; Ko, Ben C. B.; Tam, Sidney C. F.; Brooks, Heddwen L.; Knepper, Mark A.; Chung, Stephen S. M.

2000-01-01

Aldose reductase (ALR2) is thought to be involved in the pathogenesis of various diseases associated with diabetes mellitus, such as cataract, retinopathy, neuropathy, and nephropathy. However, its physiological functions are not well understood. We developed mice deficient in this enzyme and found that they had no apparent developmental or reproductive abnormality except that they drank and urinated significantly more than their wild-type littermates. These ALR2-deficient mice exhibited a partially defective urine-concentrating ability, having a phenotype resembling that of nephrogenic diabetes insipidus. PMID:10913167

PLAG1 deficiency impairs spermatogenesis and sperm motility in mice.

PubMed

Juma, Almas R; Grommen, Sylvia V H; O'Bryan, Moira K; O'Connor, Anne E; Merriner, D Jo; Hall, Nathan E; Doyle, Stephen R; Damdimopoulou, Pauliina E; Barriga, Daniel; Hart, Adam H; Van de Ven, Wim J M; De Groef, Bert

2017-07-13

Deficiency in pleomorphic adenoma gene 1 (PLAG1) leads to reduced fertility in male mice, but the mechanism by which PLAG1 contributes to reproduction is unknown. To investigate the involvement of PLAG1 in testicular function, we determined (i) the spatial distribution of PLAG1 in the testis using X-gal staining; (ii) transcriptomic consequences of PLAG1 deficiency in knock-out and heterozygous mice compared to wild-type mice using RNA-seq; and (iii) morphological and functional consequences of PLAG1 deficiency by determining testicular histology, daily sperm production and sperm motility in knock-out and wild-type mice. PLAG1 was sparsely expressed in germ cells and in Sertoli cells. Genes known to be involved in spermatogenesis were downregulated in the testes of knock-out mice, as well as Hsd17b3, which encodes a key enzyme in androgen biosynthesis. In the absence of Plag1, a number of genes involved in immune processes and epididymis-specific genes were upregulated in the testes. Finally, loss of PLAG1 resulted in significantly lowered daily sperm production, in reduced sperm motility, and in several animals, in sloughing of the germinal epithelium. Our results demonstrate that the subfertility seen in male PLAG1-deficient mice is, at least in part, the result of significantly reduced sperm output and sperm motility.

Ablation of phosphoinositide 3-kinase-gamma reduces the severity of acute pancreatitis.

PubMed

Lupia, Enrico; Goffi, Alberto; De Giuli, Paolo; Azzolino, Ornella; Bosco, Ornella; Patrucco, Enrico; Vivaldo, Maria Cristina; Ricca, Marco; Wymann, Matthias P; Hirsch, Emilio; Montrucchio, Giuseppe; Emanuelli, Giorgio

2004-12-01

In pancreatic acini, the G-protein-activated phosphoinositide 3-kinase-gamma (PI3K gamma) regulates several key pathological responses to cholecystokinin hyperstimulation in vitro. Thus, using mice lacking PI3K gamma, we studied the function of this enzyme in vivo in two different models of acute pancreatitis. The disease was induced by supramaximal concentrations of cerulein and by feeding mice a choline-deficient/ethionine-supplemented diet. Although the secretive function of isolated pancreatic acini was identical in mutant and control samples, in both models, genetic ablation of PI3K gamma significantly reduced the extent of acinar cell injury/necrosis. In agreement with a protective role of apoptosis in pancreatitis, PI3K gamma-deficient pancreata showed an increased number of apoptotic acinar cells, as determined by terminal dUTP nick-end labeling and caspase-3 activity. In addition, neutrophil infiltration within the pancreatic tissue was also reduced, suggesting a dual action of PI3K gamma, both in the triggering events within acinar cells and in the subsequent neutrophil recruitment and activation. Finally, the lethality of the choline-deficient/ethionine-supplemented diet-induced pancreatitis was significantly reduced in mice lacking PI3K gamma. Our results thus suggest that inhibition of PI3K gamma may be of therapeutic value in acute pancreatitis.

Interferon-gamma regulates nucleoside transport systems in macrophages through signal transduction and activator of transduction factor 1 (STAT1)-dependent and -independent signalling pathways.

PubMed Central

Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio

2003-01-01

The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960

Rescue of a recombinant Machupo virus from cloned cDNAs and in vivo characterization in interferon (αβ/γ) receptor double knockout mice.

PubMed

Patterson, Michael; Seregin, Alexey; Huang, Cheng; Kolokoltsova, Olga; Smith, Jennifer; Miller, Milagros; Smith, Jeanon; Yun, Nadezhda; Poussard, Allison; Grant, Ashley; Tigabu, Bersabeh; Walker, Aida; Paessler, Slobodan

2014-02-01

Machupo virus (MACV) is the etiological agent of Bolivian hemorrhagic fever (BHF), a reemerging and neglected tropical disease associated with high mortality. The prototypical strain of MACV, Carvallo, was isolated from a human patient in 1963, but minimal in vitro and in vivo characterization has been reported. To this end, we utilized reverse genetics to rescue a pathogenic MACV from cloned cDNAs. The recombinant MACV (rMACV) had in vitro growth properties similar to those of the parental MACV. Both viruses caused similar disease development in alpha/beta and gamma interferon receptor knockout mice, including neurological disease development and high mortality. In addition, we have identified a novel murine model with mortality and neurological disease similar to BHF disease reported in humans and nonhuman primates.

Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity

PubMed Central

1984-01-01

Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN

A short 2 week dose titration regimen reduces the severity of flu-like symptoms with initial interferon gamma-1b treatment.

PubMed

Devane, John G; Martin, Mary L; Matson, Mark A

2014-06-01

Flu-like symptoms (FLS) are commonly experienced by patients receiving interferon gamma-1b which may cause discontinuation or disruption of dosing during initial therapy or on re-initiation following a break in therapy. In contrast to Type I interferons, the impact of dose-titration on FLS has not been reported and is not a practice described or included in the approved prescribing information for interferon gamma-1b.The objective of this study was to assess the effect of a 2 week titration regimen on the severity of FLS during the initial 3 weeks of therapy with three times weekly subcutaneous injections of interferon gamma-1b. Healthy men and women were randomized into a double-blind, two-period, crossover study. Each study period was 3 weeks in duration and there was a minimum 15 day washout between treatment periods. Two treatment regimens were compared: No Titration dosing (full 50 mcg/m(2) subcutaneously [s.c.] three times weekly for 3 weeks) and Titration (15 mcg/m(2) s.c. three times weekly during week 1, 30 mcg/m(2) s.c. three times weekly during week 2 followed by the full dose of 50 mcg/m(2) s.c. three times weekly during week 3). Subjects remained in the clinic for at least 12 hours following each injection. FLS was based on a composite score for fever, chills, tiredness and muscle aches assessed at baseline and 4, 8 and 12 hours following each injection. Acetaminophen was allowed at the discretion of the PI. The primary endpoint was the change from baseline in FLS severity at 8 hours averaged over the 3 weeks of treatment. Additional endpoints included FLS at 4 and 12 hours, individual flu-like symptoms, rates of discontinuation, incidence of FLS and acetaminophen use. NCT 01929382. Of the 40 subjects randomized, there were 15 (37.5%) discontinuations. Titration resulted in a significant reduction in FLS severity at 8 hours (p = 0.023) averaged over the 3 week treatment period. The difference in 3 week FLS severity reflects differences

PPAR{alpha} deficiency augments a ketogenic diet-induced circadian PAI-1 expression possibly through PPAR{gamma} activation in the liver

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oishi, Katsutaka, E-mail: k-ooishi@aist.go.jp; Uchida, Daisuke; Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki

Research highlights: {yields} PPAR{alpha} deficiency augments a ketogenic diet-induced circadian PAI-1 expression. {yields} Hepatic expressions of PPAR{gamma} and PCG-1{alpha} are induced by a ketogenic diet. {yields} PPAR{gamma} antagonist attenuates a ketogenic diet-induced PAI-1 expression. {yields} Ketogenic diet advances the phase of circadian clock in a PPAR{alpha}-independent manner. -- Abstract: An increased level of plasminogen activator inhibitor-1 (PAI-1) is considered a risk factor for cardiovascular diseases, and PAI-1 gene expression is under the control of molecular circadian clocks in mammals. We recently showed that PAI-1 expression is augmented in a phase-advanced circadian manner in mice fed with a ketogenic diet (KD).more » To determine whether peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) is involved in hypofibrinolytic status induced by a KD, we examined the expression profiles of PAI-1 and circadian clock genes in PPAR{alpha}-null KD mice. Chronic administration of bezafibrate induced the PAI-1 gene expression in a PPAR{alpha}-dependent manner. Feeding with a KD augmented the circadian expression of PAI-1 mRNA in the hearts and livers of wild-type (WT) mice as previously described. The KD-induced mRNA expression of typical PPAR{alpha} target genes such as Cyp4A10 and FGF21 was damped in PPAR{alpha}-null mice. However, plasma PAI-1 concentrations were significantly more elevated in PPAR{alpha}-null KD mice in accordance with hepatic mRNA levels. These observations suggest that PPAR{alpha} activation is dispensable for KD-induced PAI-1 expression. We also found that hyperlipidemia, fatty liver, and the hepatic expressions of PPAR{gamma} and its coactivator PCG-1{alpha} were more effectively induced in PPAR{alpha}-null, than in WT mice on a KD. Furthermore, KD-induced hepatic PAI-1 expression was significantly suppressed by supplementation with bisphenol A diglycidyl ether, a PPAR{gamma} antagonist, in both WT and PPAR

Executive Summary of the Guidelines for the Use of interferon-gamma Release Assays in the Diagnosis of Tuberculosis Infection.

PubMed

Santin, Miguel; García-García, José-María; Rigau, David; Altet, Neus; Anibarro, Luis; Casas, Irma; Díez, Nuria; García-Gasalla, Mercedes; Martínez-Lacasa, Xavier; Penas, Antón; Pérez-Escolano, Elvira; Sánchez, Francisca; Domínguez, José

2016-09-01

Interferon-gamma release assays are widely used for the diagnosis of tuberculosis infection in Spain. However, there is no consensus on their application in specific clinical scenarios. To develop a guide-line for their use, a panel of experts comprising specialists in infectious diseases, respiratory diseases, microbiology, pediatrics and preventive medicine, together with a methodologist, conducted a systematic literature search, summarized the findings, rated the quality of the evidence, and formulated recommendations following the Grading of Recommendations of Assessment Development and Evaluations methodology. This document provides evidence-based guidance on the use of interferon-gamma release assays for the diagnosis of tuberculosis infection in patients at risk of tuberculosis or suspected of having active disease. The guidelines will be applicable to specialist and primary care, and public health. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

Dual specific oral tolerance induction using interferon gamma for IgE-mediated anaphylactic food allergy and the dissociation of local skin allergy and systemic oral allergy: tolerance or desensitization?

PubMed

Noh, G; Jang, E H

2014-01-01

Specific oral tolerance induction (SOTI) for IgE-mediated food allergy (IFA) can be successfully achieved using interfero gamma (classic SOTI). In this study, a tolerable dose was introduced during tolerance induction with interferon gamma (dual SOTI), and its effectiveness was evaluated. The study population comprised 25 IFA patients. Blood samples were taken for analysis, including complete blood count with differential counts of eosinophils, serum total IgE levels, and specific IgE for allergenic foods. Skin prick tests were conducted with the allergens. Oral food challenges were performed to diagnose IFA. Ten patients received dual SOTI, 5 received classic SOTI, 5 received SOTI without interferon gamma (original SOTI), and 5 were not treated (controls). Patients treated with dual SOTI and classic SOTI using interferon gamma became tolerant to the allergenic food. The tolerable dose was introduced successfully in dual SOTI. It was difficult to proceed with the same dosing protocol used for classic SOTI in cases treated with original SOTI. Following dual SOTI, the systemic reaction to oral intake subsided, but the local skin reaction to contact with the allergenic food persisted. Dual SOTI is an improved protocol for SOTI using interferon gamma for IFA.The local skin reaction and systemic reaction to oral intake were dissociated following dual SOTI. In cases of food allergy, tolerance appears to result from desensitization to allergens.

Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.

PubMed

Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F

2003-01-01

A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.

Impaired social recognition memory in Recombination Activating Gene 1-deficient mice

PubMed Central

McGowan, Patrick O.; Hope, Thomas A.; Meck, Warren H.; Kelsoe, Garnett; Williams, Christina L.

2012-01-01

The Recombination Activating Genes (RAGs) encode two enzymes that play key roles in the adaptive immune system. RAG1 and RAG2 mediate VDJ recombination, a process necessary for the maturation of B- and T-cells. Interestingly, RAG1 is also expressed in the brain, particularly in areas of high neural density such as the hippocampus, although its function is unknown. We tested evidence that RAG1 plays a role in brain function using a social recognition memory task, an assessment of the acquisition and retention of conspecific identity. In a first experiment, we found that RAG1-deficient mice show impaired social recognition memory compared to mice wildtype for the RAG1 allele. In a second experiment, by breeding to homogenize background genotype we found that RAG1-deficient mice show impaired social recognition memory relative to heterozygous or RAG2-deficient littermates. Because RAG1 and RAG2 null mice are both immunodeficient, the results suggest that the memory impairment is not an indirect effect of immunological dysfunction. RAG1-deficient mice show normal habituation to non-socially derived odors and habituation to an open-field, indicating that the observed effect is not likely a result of a general deficit in habituation to novelty. These data trace the origin of the impairment in social recognition memory in RAG1-deficient mice to the RAG1 gene locus and implicate RAG1 in memory formation. PMID:21354115

Inner ear dysfunction in caspase-3 deficient mice

PubMed Central

2011-01-01

Background Caspase-3 is one of the most downstream enzymes activated in the apoptotic pathway. In caspase-3 deficient mice, loss of cochlear hair cells and spiral ganglion cells coincide closely with hearing loss. In contrast with the auditory system, details of the vestibular phenotype have not been characterized. Here we report the vestibular phenotype and inner ear anatomy in the caspase-3 deficient (Casp3-/-) mouse strain. Results Average ABR thresholds of Casp3-/- mice were significantly elevated (P < 0.05) compared to Casp3+/- mice and Casp3+/+ mice at 3 months of age. In DPOAE testing, distortion product 2F1-F2 was significantly decreased (P < 0.05) in Casp3-/- mice, whereas Casp3+/- and Casp3+/+ mice showed normal and comparable values to each other. Casp3-/- mice were hyperactive and exhibited circling behavior when excited. In lateral canal VOR testing, Casp3-/- mice had minimal response to any of the stimuli tested, whereas Casp3+/- mice had an intermediate response compared to Casp3+/+ mice. Inner ear anatomical and histological analysis revealed gross hypomorphism of the vestibular organs, in which the main site was the anterior semicircular canal. Hair cell numbers in the anterior- and lateral crista, and utricle were significantly smaller in Casp3-/- mice whereas the Casp3+/- and Casp3+/+ mice had normal hair cell numbers. Conclusions These results indicate that caspase-3 is essential for correct functioning of the cochlea as well as normal development and function of the vestibule. PMID:21988729

Respiratory Francisella tularensis live vaccine strain infection induces Th17 cells and prostaglandin E2, which inhibits generation of gamma interferon-positive T cells.

PubMed

Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A

2008-06-01

Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).

COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?

PubMed Central

Levick, Scott P.; Goldspink, Paul H.

2013-01-01

The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353

Robust Protection against Highly Virulent Foot-and-Mouth Disease Virus in Swine by Combination Treatment with Recombinant Adenoviruses Expressing Porcine Alpha and Gamma Interferons and Multiple Small Interfering RNAs

PubMed Central

Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Se-Kyung; You, Su-Hwa; Kim, Taeseong; Tark, Dongseob; Lee, Hyang-Sim; Seo, Min-Goo; Kim, Byounghan

2015-01-01

ABSTRACT Because the currently available vaccines against foot-and-mouth disease (FMD) provide no protection until 4 to 7 days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is the application of antiviral agents. Combination treatment strategies have been used to enhance the efficacy of antiviral agents, and such strategies may be advantageous in overcoming viral mechanisms of resistance to antiviral treatments. We have developed recombinant adenoviruses (Ads) for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) targeting FMDV mRNAs encoding nonstructural proteins. The antiviral effects of Ad-porcine IFN-αγ and Ad-3siRNA expression were tested in combination in porcine cells, suckling mice, and swine. We observed enhanced antiviral effects in porcine cells and mice as well as robust protection against the highly pathogenic strain O/Andong/SKR/2010 and increased expression of cytokines in swine following combination treatment. In addition, we showed that combination treatment was effective against all serotypes of FMDV. Therefore, we suggest that the combined treatment with Ad-porcine IFN-αγ and Ad-3siRNA may offer fast-acting antiviral protection and be used with a vaccine during the period that the vaccine does not provide protection against FMD. IMPORTANCE The use of current foot-and-mouth disease (FMD) vaccines to induce rapid protection provides limited effectiveness because the protection does not become effective until a minimum of 4 days after vaccination. Therefore, during outbreaks antiviral agents remain the only available treatment to confer rapid protection and reduce the spread of foot-and-mouth disease virus (FMDV) in livestock until vaccine-induced protective immunity can become effective. Interferons (IFNs) and small interfering RNAs (siRNAs) have been reported to be effective antiviral agents against

Fucosylation Deficiency in Mice Leads to Colitis and Adenocarcinoma.

PubMed

Wang, Yiwei; Huang, Dan; Chen, Kai-Yuan; Cui, Min; Wang, Weihuan; Huang, Xiaoran; Awadellah, Amad; Li, Qing; Friedman, Ann; Xin, William W; Di Martino, Luca; Cominelli, Fabio; Miron, Alex; Chan, Ricky; Fox, James G; Xu, Yan; Shen, Xiling; Kalady, Mathew F; Markowitz, Sanford; Maillard, Ivan; Lowe, John B; Xin, Wei; Zhou, Lan

2017-01-01

De novo synthesis of guanosine diphosphate (GDP)-fucose, a substrate for fucosylglycans, requires sequential reactions mediated by GDP-mannose 4,6-dehydratase (GMDS) and GDP-4-keto-6-deoxymannose 3,5-epimerase-4-reductase (FX or tissue specific transplantation antigen P35B [TSTA3]). GMDS deletions and mutations are found in 6%-13% of colorectal cancers; these mostly affect the ascending and transverse colon. We investigated whether a lack of fucosylation consequent to loss of GDP-fucose synthesis contributes to colon carcinogenesis. FX deficiency and GMDS deletion produce the same biochemical phenotype of GDP-fucose deficiency. We studied a mouse model of fucosylation deficiency (Fx-/- mice) and mice with the full-length Fx gene (controls). Mice were placed on standard chow or fucose-containing diet (equivalent to a control fucosylglycan phenotype). Colon tissues were collected and analyzed histologically or by enzyme-linked immunosorbent assays to measure cytokine levels; T cells also were collected and analyzed. Fecal samples were analyzed by 16s ribosomal RNA sequencing. Mucosal barrier function was measured by uptake of fluorescent dextran. We transplanted bone marrow cells from Fx-/- or control mice (Ly5.2) into irradiated 8-week-old Fx-/- or control mice (Ly5.1). We performed immunohistochemical analyses for expression of Notch and the hes family bHLH transcription factor (HES1) in colon tissues from mice and a panel of 60 human colorectal cancer specimens (27 left-sided, 33 right-sided). Fx-/- mice developed colitis and serrated-like lesions. The intestinal pathology of Fx-/- mice was reversed by addition of fucose to the diet, which restored fucosylation via a salvage pathway. In the absence of fucosylation, dysplasia appeared and progressed to adenocarcinoma in up to 40% of mice, affecting mainly the right colon and cecum. Notch was not activated in Fx-/- mice fed standard chow, leading to decreased expression of its target Hes1. Fucosylation deficiency

Vertebral osteomyelitis due to Aspergillus fumigatus in a patient with chronic granulomatous disease successfully treated with antifungal agents and interferon-gamma.

PubMed

Al-Tawfiq, Jaffar A; Al-Abdely, Hail M

2010-05-01

We report a case of invasive aspergillosis due to Aspergillus fumigatus involving the cervical and thoracic vertebrae and upper mediastinum of a 17 year-old Saudi male with chronic granulomatous disease (CGD). The patient did not respond to a long course of liposomal amphotericin B but did to surgical drainage and a combination of caspofungin and itraconazole with subsequent suppression with oral voriconazole. Fourteen months after the start of therapy, the patient had anterior dislocation of T2 thoracic vertebra with cord transection and quadriplegia. He was then treated intravenously with liquid itraconazole and interferon-gamma. The patient made a remarkable recovery over a 2-year period and was eventually able to walk independently. Thus, a combination of antifungals and interferon-gamma may have resulted in the positive outcome in this case.

A small animal peripheral challenge model of yellow fever using interferon-receptor deficient mice and the 17D-204 vaccine strain.

PubMed

Thibodeaux, Brett A; Garbino, Nina C; Liss, Nathan M; Piper, Joseph; Blair, Carol D; Roehrig, John T

2012-05-02

Yellow fever virus (YFV), a member of the genus Flavivirus, is a mosquito-borne pathogen that requires wild-type (wt), virulent strains to be handled at biosafety level (BSL) 3, with HEPA-filtration of room air exhaust (BSL3+). YFV is found in tropical regions of Africa and South America and causes severe hepatic disease and death in humans. Despite the availability of effective vaccines (17D-204 or 17DD), YFV is still responsible for an estimated 200,000 cases of illness and 30,000 deaths annually. Besides vaccination, there are no other prophylactic or therapeutic strategies approved for use in human YF. Current small animal models of YF require either intra-cranial inoculation of YF vaccine to establish infection, or use of wt strains (e.g., Asibi) in order to achieve pathology. We have developed and characterized a BSL2, adult mouse peripheral challenge model for YFV infection in mice lacking receptors for interferons α, β, and γ (strain AG129). Intraperitoneal challenge of AG129 mice with 17D-204 is a uniformly lethal in a dose-dependent manner, and 17D-204-infected AG129 mice exhibit high viral titers in both brain and liver suggesting this infection is both neurotropic and viscerotropic. Furthermore the use of a mouse model permitted the construction of a 59-biomarker multi-analyte profile (MAP) using samples of brain, liver, and serum taken at multiple time points over the course of infection. This MAP serves as a baseline for evaluating novel therapeutics and their effect on disease progression. Changes (4-fold or greater) in serum and tissue levels of pro- and anti-inflammatory mediators as well as other factors associated with tissue damage were noted in AG129 mice infected with 17D-204 as compared to mock-infected control animals. Published by Elsevier Ltd.

Production and characterization of guinea pig recombinant gamma interferon and its effect on macrophage activation.

PubMed

Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N

2006-01-01

Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.

Interferon regulatory factor 8-deficiency determines massive neutrophil recruitment but T cell defect in fast growing granulomas during tuberculosis.

PubMed

Rocca, Stefano; Schiavoni, Giovanna; Sali, Michela; Anfossi, Antonio Giovanni; Abalsamo, Laura; Palucci, Ivana; Mattei, Fabrizio; Sanchez, Massimo; Giagu, Anna; Antuofermo, Elisabetta; Fadda, Giovanni; Belardelli, Filippo; Delogu, Giovanni; Gabriele, Lucia

2013-01-01

Following Mycobacterium tuberculosis (Mtb) infection, immune cell recruitment in lungs is pivotal in establishing protective immunity through granuloma formation and neogenesis of lymphoid structures (LS). Interferon regulatory factor-8 (IRF-8) plays an important role in host defense against Mtb, although the mechanisms driving anti-mycobacterial immunity remain unclear. In this study, IRF-8 deficient mice (IRF-8⁻/⁻) were aerogenously infected with a low-dose Mtb Erdman virulent strain and the course of infection was compared with that induced in wild-type (WT-B6) counterparts. Tuberculosis (TB) progression was examined in both groups using pathological, microbiological and immunological parameters. Following Mtb exposure, the bacterial load in lungs and spleens progressed comparably in the two groups for two weeks, after which IRF-8⁻/⁻ mice developed a fatal acute TB whereas in WT-B6 the disease reached a chronic stage. In lungs of IRF-8⁻/⁻, uncontrolled growth of pulmonary granulomas and impaired development of LS were observed, associated with unbalanced homeostatic chemokines, progressive loss of infiltrating T lymphocytes and massive prevalence of neutrophils at late infection stages. Our data define IRF-8 as an essential factor for the maintenance of proper immune cell recruitment in granulomas and LS required to restrain Mtb infection. Moreover, IRF-8⁻/⁻ mice, relying on a common human and mouse genetic mutation linked to susceptibility/severity of mycobacterial diseases, represent a valuable model of acute TB for comparative studies with chronically-infected congenic WT-B6 for dissecting protective and pathological immune reactions.

Interferon Regulatory Factor 8-Deficiency Determines Massive Neutrophil Recruitment but T Cell Defect in Fast Growing Granulomas during Tuberculosis

PubMed Central

Sali, Michela; Anfossi, Antonio Giovanni; Abalsamo, Laura; Palucci, Ivana; Mattei, Fabrizio; Sanchez, Massimo; Giagu, Anna; Antuofermo, Elisabetta; Fadda, Giovanni; Belardelli, Filippo; Delogu, Giovanni; Gabriele, Lucia

2013-01-01

Following Mycobacterium tuberculosis (Mtb) infection, immune cell recruitment in lungs is pivotal in establishing protective immunity through granuloma formation and neogenesis of lymphoid structures (LS). Interferon regulatory factor-8 (IRF-8) plays an important role in host defense against Mtb, although the mechanisms driving anti-mycobacterial immunity remain unclear. In this study, IRF-8 deficient mice (IRF-8−/−) were aerogenously infected with a low-dose Mtb Erdman virulent strain and the course of infection was compared with that induced in wild-type (WT-B6) counterparts. Tuberculosis (TB) progression was examined in both groups using pathological, microbiological and immunological parameters. Following Mtb exposure, the bacterial load in lungs and spleens progressed comparably in the two groups for two weeks, after which IRF-8−/− mice developed a fatal acute TB whereas in WT-B6 the disease reached a chronic stage. In lungs of IRF-8−/−, uncontrolled growth of pulmonary granulomas and impaired development of LS were observed, associated with unbalanced homeostatic chemokines, progressive loss of infiltrating T lymphocytes and massive prevalence of neutrophils at late infection stages. Our data define IRF-8 as an essential factor for the maintenance of proper immune cell recruitment in granulomas and LS required to restrain Mtb infection. Moreover, IRF-8−/− mice, relying on a common human and mouse genetic mutation linked to susceptibility/severity of mycobacterial diseases, represent a valuable model of acute TB for comparative studies with chronically-infected congenic WT-B6 for dissecting protective and pathological immune reactions. PMID:23717393

Attenuated progression of diet-induced steatohepatitis in glutathione-deficient mice

PubMed Central

Haque, Jamil A; McMahan, Ryan S; Campbell, Jean S; Shimizu-Albergine, Masami; Wilson, Angela M; Botta, Dianne; Bammler, Theo K; Beyer, Richard P; Montine, Thomas J; Yeh, Matthew M; Kavanagh, Terrance J; Fausto, Nelson

2011-01-01

In nonalcoholic fatty liver disease (NAFLD), depletion of hepatic antioxidants may contribute to the progression of steatosis to nonalcoholic steatohepatitis (NASH) by increasing oxidative stress that produces lipid peroxidation, inflammation, and fibrosis. We investigated whether depletion of glutathione (GSH) increases NASH-associated hepatic pathology in mice fed a diet deficient in methionine and choline (MCD diet). Wild-type (wt) mice and genetically GSH-deficient mice lacking the modifier subunit of glutamate cysteine ligase (Gclm null mice), the rate-limiting enzyme for de novo synthesis of GSH, were fed the MCD diet, a methionine/choline-sufficient diet, or standard chow for 21 days. We assessed NASH-associated hepatic pathology, including steatosis, fibrosis, inflammation, and hepatocyte ballooning, and used the NAFLD Scoring System to evaluate the extent of changes. We measured triglyceride levels, determined the level of lipid peroxidation products, and measured by qPCR the expression of mRNAs for several proteins associated with lipid metabolism, oxidative stress, and fibrosis. MCD-fed GSH-deficient Gclm null mice were to a large extent protected from MCD diet-induced excessive fat accumulation, hepatocyte injury, inflammation, and fibrosis. Compared with wt animals, MCD-fed Gclm null mice had much lower levels of F2-isoprostanes, lower expression of acyl-CoA oxidase, carnitine palmitoyltransferase 1a, uncoupling protein-2, stearoyl-coenzyme A desaturase-1, transforming growth factor-β, and plas-minogen activator inhibitor-1 mRNAs, and higher activity of catalase, indicative of low oxidative stress, inhibition of triglyceride synthesis, and lower expression of profibrotic proteins. Global gene analysis of hepatic RNA showed that compared with wt mice, the livers of Gclm null mice have a high capacity to metabolize endogenous and exogenous compounds, have lower levels of lipogenic proteins, and increased antioxidant activity. Thus, metabolic adaptations

Sick sinus syndrome in HCN1-deficient mice.

PubMed

Fenske, Stefanie; Krause, Stefanie C; Hassan, Sami I H; Becirovic, Elvir; Auer, Franziska; Bernard, Rebekka; Kupatt, Christian; Lange, Philipp; Ziegler, Tilman; Wotjak, Carsten T; Zhang, Henggui; Hammelmann, Verena; Paparizos, Christos; Biel, Martin; Wahl-Schott, Christian A

2013-12-17

Sinus node dysfunction (SND) is a major clinically relevant disease that is associated with sudden cardiac death and requires surgical implantation of electric pacemaker devices. Frequently, SND occurs in heart failure and hypertension, conditions that lead to electric instability of the heart. Although the pathologies of acquired SND have been studied extensively, little is known about the molecular and cellular mechanisms that cause congenital SND. Here, we show that the HCN1 protein is highly expressed in the sinoatrial node and is colocalized with HCN4, the main sinoatrial pacemaker channel isoform. To characterize the cardiac phenotype of HCN1-deficient mice, a detailed functional characterization of pacemaker mechanisms in single isolated sinoatrial node cells, explanted beating sinoatrial node preparation, telemetric in vivo electrocardiography, echocardiography, and in vivo electrophysiology was performed. On the basis of these experiments we demonstrate that mice lacking the pacemaker channel HCN1 display congenital SND characterized by bradycardia, sinus dysrhythmia, prolonged sinoatrial node recovery time, increased sinoatrial conduction time, and recurrent sinus pauses. As a consequence of SND, HCN1-deficient mice display a severely reduced cardiac output. We propose that HCN1 stabilizes the leading pacemaker region within the sinoatrial node and hence is crucial for stable heart rate and regular beat-to-beat variation. Furthermore, we suggest that HCN1-deficient mice may be a valuable genetic disease model for human SND.

Effects of interferon on antibody formation

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.

1984-01-01

Studies of the effects of interferon on primary and secondary antibody responses and of the relationship of interferon to other cytokines, or cell products, are presented. Dosage- and timing-dependent immunoenhancing and immunosuppressive activities of interferon are documented for mouse spleen cell cultures and for mice infected with murine hepatitis virus (MHV-3). A possibility that altered interferon production might lead to immunopathological disorders, such as lupus erythematosus, AIDS, arthritis, etc., is discussed. Latest technological developments are presented that indicate that interferon does apparently play a major role in the regulation of antibody responses.

Effect of Interferon, Polyacrylic Acid, and Polymethacrylic Acid on Tail Lesions in Mice Infected with Vaccinia Virus

PubMed Central

De Clercq, E.; De Somer, P.

1968-01-01

Intravenous inoculation of mice with vaccinia virus produced characteristic lesions of the tail surface which were suppressed by intraperitoneal administration of interferon and polyacrylic acid (PAA). Polymethacrylic acid (PMAA) stimulated the formation of vaccinia virus lesions. For full activity, both interferon and PAA must be given prior to infection. PAA was still significantly effective at small dose levels (3 mg/kg) and achieved protection for at least 4 weeks. Protection increased with increasing molecular weight of the polymer. The mode of action of PAA is discussed. PMID:5676405

Interleukin-18 deficiency protects against renal interstitial fibrosis in aldosterone/salt-treated mice.

PubMed

Tanino, Akiko; Okura, Takafumi; Nagao, Tomoaki; Kukida, Masayoshi; Pei, Zuowei; Enomoto, Daijiro; Miyoshi, Ken-Ichi; Okamura, Haruki; Higaki, Jitsuo

2016-10-01

Interleukin (IL)-18 is a member of the IL-1 family of cytokines and was described originally as an interferon γ-inducing factor. Aldosterone plays a central role in the regulation of sodium and potassium homoeostasis by binding to the mineralocorticoid receptor and contributes to kidney and cardiovascular damage. Aldosterone has been reported to induce IL-18, resulting in cardiac fibrosis with induced IL-18-mediated osteopontin (OPN). We therefore hypothesized that aldosterone-induced renal fibrosis via OPN may be mediated by IL-18. To verify this hypothesis, we compared mice deficient in IL-18 and wild-type (WT) mice in a model of aldosterone/salt-induced hypertension. IL-18(-/-) and C57BL/6 WT mice were used for the uninephrectomized aldosterone/salt hypertensive model, whereas NRK-52E cells (rat kidney epithelial cells) were used in an in vitro model. In the present in vivo study, IL-18 protein expression was localized in medullary tubules in the WT mice, whereas in aldosterone-infused WT mice this expression was up-regulated markedly in the proximal tubules, especially in injured and dilated tubules. This renal damage caused by aldosterone was attenuated significantly by IL-18 knockout with down-regulation of OPN expression. In the present in vitro study, aldosterone directly induced IL-18 gene expression in renal tubular epithelial cells in a concentration- and time-dependent manner. These effects were inhibited completely by spironolactone. IL-18 may be a key mediator of aldosterone-induced renal fibrosis by inducing OPN, thereby exacerbating renal interstitial fibrosis. Inhibition of IL-18 may therefore provide a potential target for therapeutic intervention aimed at preventing the progression of renal injury. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

Myostatin deficiency partially rescues the bone phenotype of osteogenesis imperfecta model mice.

PubMed

Oestreich, A K; Carleton, S M; Yao, X; Gentry, B A; Raw, C E; Brown, M; Pfeiffer, F M; Wang, Y; Phillips, C L

2016-01-01

Mice with osteogenesis imperfecta (+/oim), a disorder of bone fragility, were bred to mice with muscle over growth to test whether increasing muscle mass genetically would improve bone quality and strength. The results demonstrate that femora from mice carrying both mutations have greater mechanical integrity than their +/oim littermates. Osteogenesis imperfecta is a heritable connective tissue disorder due primarily to mutations in the type I collagen genes resulting in skeletal deformity and fragility. Currently, there is no cure, and therapeutic strategies encompass the use of antiresorptive pharmaceuticals and surgical bracing, with limited success and significant potential for adverse effects. Bone, a mechanosensing organ, can respond to high mechanical loads by increasing new bone formation and altering bone geometry to withstand increased forces. Skeletal muscle is a major source of physiological loading on bone, and bone strength is proportional to muscle mass. To test the hypothesis that congenic increases in muscle mass in the osteogenesis imperfecta murine model mouse (oim) will improve their compromised bone quality and strength, heterozygous (+/oim) mice were bred to mice deficient in myostatin (+/mstn), a negative regulator of muscle growth. The resulting adult offspring were evaluated for hindlimb muscle mass, and bone microarchitecture, physiochemistry, and biomechanical integrity. +/oim mice deficient in myostatin (+/mstn +/oim) were generated and demonstrated that myostatin deficiency increased body weight, muscle mass, and biomechanical strength in +/mstn +/oim mice as compared to +/oim mice. Additionally, myostatin deficiency altered the physiochemical properties of the +/oim bone but did not alter bone remodeling. Myostatin deficiency partially improved the reduced femoral bone biomechanical strength of adult +/oim mice by increasing muscle mass with concomitant improvements in bone microarchitecture and physiochemical properties.

Loss of the interferon-γ-inducible regulatory immunity-related GTPase (IRG), Irgm1, causes activation of effector IRG proteins on lysosomes, damaging lysosomal function and predicting the dramatic susceptibility of Irgm1-deficient mice to infection.

PubMed

Maric-Biresev, Jelena; Hunn, Julia P; Krut, Oleg; Helms, J Bernd; Martens, Sascha; Howard, Jonathan C

2016-04-20

The interferon-γ (IFN-γ)-inducible immunity-related GTPase (IRG), Irgm1, plays an essential role in restraining activation of the IRG pathogen resistance system. However, the loss of Irgm1 in mice also causes a dramatic but unexplained susceptibility phenotype upon infection with a variety of pathogens, including many not normally controlled by the IRG system. This phenotype is associated with lymphopenia, hemopoietic collapse, and death of the mouse. We show that the three regulatory IRG proteins (GMS sub-family), including Irgm1, each of which localizes to distinct sets of endocellular membranes, play an important role during the cellular response to IFN-γ, each protecting specific membranes from off-target activation of effector IRG proteins (GKS sub-family). In the absence of Irgm1, which is localized mainly at lysosomal and Golgi membranes, activated GKS proteins load onto lysosomes, and are associated with reduced lysosomal acidity and failure to process autophagosomes. Another GMS protein, Irgm3, is localized to endoplasmic reticulum (ER) membranes; in the Irgm3-deficient mouse, activated GKS proteins are found at the ER. The Irgm3-deficient mouse does not show the drastic phenotype of the Irgm1 mouse. In the Irgm1/Irgm3 double knock-out mouse, activated GKS proteins associate with lipid droplets, but not with lysosomes, and the Irgm1/Irgm3(-/-) does not have the generalized immunodeficiency phenotype expected from its Irgm1 deficiency. The membrane targeting properties of the three GMS proteins to specific endocellular membranes prevent accumulation of activated GKS protein effectors on the corresponding membranes and thus enable GKS proteins to distinguish organellar cellular membranes from the membranes of pathogen vacuoles. Our data suggest that the generalized lymphomyeloid collapse that occurs in Irgm1(-/-) mice upon infection with a variety of pathogens may be due to lysosomal damage caused by off-target activation of GKS proteins on lysosomal

Pancreatic SEC23B deficiency is sufficient to explain the perinatal lethality of germline SEC23B deficiency in mice

PubMed Central

Khoriaty, Rami; Everett, Lesley; Chase, Jennifer; Zhu, Guojing; Hoenerhoff, Mark; McKnight, Brooke; Vasievich, Matthew P.; Zhang, Bin; Tomberg, Kärt; Williams, John; Maillard, Ivan; Ginsburg, David

2016-01-01

In humans, loss of function mutations in SEC23B result in Congenital Dyserythropoietic Anemia type II (CDAII), a disease limited to defective erythroid development. Patients with two nonsense SEC23B mutations have not been reported, suggesting that complete SEC23B deficiency might be lethal. We previously reported that SEC23B-deficient mice die perinatally, exhibiting massive pancreatic degeneration and that mice with hematopoietic SEC23B deficiency do not exhibit CDAII. We now show that SEC23B deficiency restricted to the pancreas is sufficient to explain the lethality observed in mice with global SEC23B-deficiency. Immunohistochemical stains demonstrate an acinar cell defect but normal islet cells. Mammalian genomes contain two Sec23 paralogs, Sec23A and Sec23B. The encoded proteins share ~85% amino acid sequence identity. We generate mice with pancreatic SEC23A deficiency and demonstrate that these mice survive normally, exhibiting normal pancreatic weights and histology. Taken together, these data demonstrate that SEC23B but not SEC23A is essential for murine pancreatic development. We also demonstrate that two BAC transgenes spanning Sec23b rescue the lethality of mice homozygous for a Sec23b gene trap allele, excluding a passenger gene mutation as the cause of the pancreatic lethality, and indicating that the regulatory elements critical for Sec23b pancreatic function reside within the BAC transgenes. PMID:27297878

A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

PubMed

Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

2006-03-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

Interferon Gamma in African Trypanosome Infections: Friends or Foes?

PubMed

Wu, Hui; Liu, Gongguan; Shi, Meiqing

2017-01-01

African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.

Crimean-Congo hemorrhagic fever virus infection is lethal for adult type I interferon receptor-knockout mice.

PubMed

Bereczky, Sándor; Lindegren, Gunnel; Karlberg, Helen; Akerström, Sara; Klingström, Jonas; Mirazimi, Ali

2010-06-01

Crimean-Congo hemorrhagic fever virus (CCHFV) poses a great threat to public health due to its high mortality, transmission and geographical distribution. To date, there is no vaccine or specific treatment available and the knowledge regarding its pathogenesis is highly limited. Using a small-animal model system, this study showed that adult mice missing the type I interferon (IFN) receptor (IFNAR(-/-)) were susceptible to CCHFV and developed an acute disease with fatal outcome. In contrast, infection of wild-type mice (129 Sv/Ew) was asymptomatic. Viral RNA was found in all analysed organs of the infected mice, but the amount of CCHFV RNA was significantly higher in the IFNAR(-/-) mice than in the wild-type mice. Furthermore, the liver of IFNAR(-/-) mice was enlarged significantly, showing that IFN is important for limiting virus spread and protecting against liver damage in mice.

Impaired IL-13-mediated functions of macrophages in STAT6-deficient mice.

PubMed

Takeda, K; Kamanaka, M; Tanaka, T; Kishimoto, T; Akira, S

1996-10-15

IL-13 shares many biologic responses with IL-4. In contrast to well-characterized IL-4 signaling pathways, which utilize STAT6 and 4PS/IRS2, IL-13 signaling pathways are poorly understood. Recent studies performed with STAT6-deficient mice have demonstrated that STAT6 plays an essential role in IL-4 signaling. In this study, the functions of peritoneal macrophages of STAT6-deficient mice in response to IL-13 were analyzed. In STAT6-deficient mice, neither morphologic changes nor augmentation of MHC class II expression in response to IL-13 was observed. In addition, IL-13 did not decrease the nitric oxide production by activated macrophages. Taken together, these results suggest that the macrophage functions in response to IL-13 were impaired in STAT6-deficient mice, indicating that IL-13 and IL-4 share the signaling pathway via STAT6.

Divergent Roles of Interferon-γ and Innate Lymphoid Cells in Innate and Adaptive Immune Cell-Mediated Intestinal Inflammation.

PubMed

Brasseit, Jennifer; Kwong Chung, Cheong K C; Noti, Mario; Zysset, Daniel; Hoheisel-Dickgreber, Nina; Genitsch, Vera; Corazza, Nadia; Mueller, Christoph

2018-01-01

Aberrant interferon gamma (IFNγ) expression is associated with the pathogenesis of numerous autoimmune- and inflammatory disorders, including inflammatory bowel diseases (IBD). However, the requirement of IFNγ for the pathogenesis of chronic intestinal inflammation remains controversial. The aim of this study was thus to investigate the role of IFNγ in experimental mouse models of innate and adaptive immune cell-mediated intestinal inflammation using genetically and microbiota-stabilized hosts. While we find that IFNγ drives acute intestinal inflammation in the anti-CD40 colitis model in an innate lymphoid cell (ILC)-dependent manner, IFNγ secreted by both transferred CD4 T cells and/or cells of the lymphopenic Rag1 -/- recipient mice was dispensable for CD4 T cell-mediated colitis. In the absence of IFNγ, intestinal inflammation in CD4 T cell recipient mice was associated with enhanced IL17 responses; consequently, targeting IL17 signaling in IFNγ-deficient mice reduced T cell-mediated colitis. Intriguingly, in contrast to the anti-CD40 model of colitis, depletion of ILC in the Rag1 -/- recipients of colitogenic CD4 T cells did not prevent induction of colonic inflammation. Together, our findings demonstrate that IFNγ represents an essential, or a redundant, pro-inflammatory cytokine for the induction of intestinal inflammation, depending on the experimental mouse model used and on the nature of the critical disease inducing immune cell populations involved.

Interferon-gamma promotes the survival and Fc epsilon RI-mediated histamine release in cultured human mast cells.

PubMed Central

Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T

1996-01-01

We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819

Establishment of a novel endothelial target mouse model of a typhus group rickettsiosis: evidence for critical roles for gamma interferon and CD8 T lymphocytes.

PubMed

Walker, D H; Popov, V L; Feng, H M

2000-09-01

A mouse model of typhus rickettsiosis that reproduces the hematogenous dissemination to the critical target organs, including brain, lungs, heart, and kidneys, primary endothelial and, to a lesser degree, macrophage intracellular rickettsial infection, and typical vascular-based lesions of louse-borne typhus and murine typhus was established. Intravenous inoculation of C3H/HeN mice with Rickettsia typhi caused disease with a duration of the incubation period and mortality rate that were dependent on the infective dose of rickettsiae. Lethal infection was associated with high concentrations of R. typhi in the lungs and brain, despite a brisker humoral immune response to the rickettsiae than in the sublethal infection. Gamma interferon and CD8 T lymphocytes were demonstrated to be crucial to clearance of the rickettsiae and recovery from infection in experiments in which specific monoclonal antibodies were administered to deplete these components. Death of animals depleted of gamma interferon or CD8 T lymphocytes was associated with overwhelming rickettsial infection demonstrated by titers of infectious rickettsiae and by immunohistochemistry. An effective antirickettsial immune response was associated with elevated serum concentrations of IL-12 on Day 5 and increased secretion of IL-12 by concanavalin-A-stimulated spleen cells on Day 5. Evidence for transient suppression of the immune response consisted of marked reduction in the secretion of IL-2 and IL-12 by concanavalin-A-stimulated spleen cells on Days 10 and 15. This model offers excellent opportunities for study of attenuation and pathogenetic mechanisms of typhus rickettsiae, which are established biologic weapons of potential use in bioterrorism.

Suppressing effect of low-dose gamma-ray irradiation on collagen-induced arthritis.

PubMed

Nakatsukasa, Hiroko; Tsukimoto, Mitsutoshi; Ohshima, Yasuhiro; Tago, Fumitoshi; Masada, Ayako; Kojima, Shuji

2008-07-01

We previously reported attenuation of autoimmune disease by low-dose gamma-ray irradiation in MRL-lpr/lpr mice. Here, we studied the effect of low-dose gamma-ray irradiation on collagen-induced arthritis (CIA) in DBA/1J mice. Mice were immunized with type II collagen, and exposed to low-dose gamma-rays (0.5 Gy per week for 5 weeks). Paw swelling, redness, and bone degradation were suppressed by irradiation, which also delayed the onset of pathological change and reduced the severity of the arthritis. Production of tumor necrosis factor-alpha, interferon-gamma, and interleukin-6, which play important roles in the onset of CIA, was suppressed by the irradiation. The level of anti-type II collagen antibody, which is essential for the onset of CIA, was also lower in irradiated CIA mice. The population of plasma cells was increased in CIA mice, but irradiation blocked this increase. Since regulatory T cells are known to be involved in suppression of autoimmune disease, the population of CD4(+)CD25(+)Foxp3(+) regulatory T cells was measured. Intriguingly, a significant increase of these regulatory T cells was found in irradiated CIA mice. Overall, our data suggest that low-dose gamma-ray irradiation could attenuate CIA through suppression of pro-inflammatory cytokines and autoantibody production, and induction of regulatory T cells.

Obstructive Lymphangitis Precedes Colitis in Murine Norovirus-Infected Stat1-Deficient Mice.

PubMed

Seamons, Audrey; Treuting, Piper M; Meeker, Stacey; Hsu, Charlie; Paik, Jisun; Brabb, Thea; Escobar, Sabine S; Alexander, Jonathan S; Ericsson, Aaron; Smith, Jason G; Maggio-Price, Lillian

2018-05-17

Murine norovirus (MNV) is an RNA virus that can prove lethal in mice with impaired innate immunity. We found that MNV-4 infection of Stat1 -/- mice was not lethal, but produced a 100% penetrant, previously undescribed lymphatic phenotype characterized by chronic-active lymphangitis with hepatitis, splenitis, and chronic cecal and colonic inflammation. Lesion pathogenesis progressed from early ileal enteritis and regional dilated lymphatics to lymphangitis, granulomatous changes in the liver and spleen, and, ultimately, typhlocolitis. Lesion development was neither affected by antibiotics nor reproduced by infection with another enteric RNA virus, rotavirus. MNV-4 infection in Stat1 -/- mice decreased expression of vascular endothelial growth factor (Vegf) receptor 3, Vegf-c, and Vegf-d and increased interferon (Ifn)-γ, tumor necrosis factor-α, and inducible nitric oxide synthase. However, anti-IFN-γ and anti-tumor necrosis factor-α antibody treatment did not attenuate the histologic lesions. Studies in Ifnαβγr -/- mice suggested that canonical signaling via interferon receptors did not cause MNV-4-induced disease. Infected Stat1 -/- mice had increased STAT3 phosphorylation and expressed many STAT3-regulated genes, consistent with our findings of increased myeloid cell subsets and serum granulocyte-specific colony-stimulating factor, which are also associated with increased STAT3 activity. In conclusion, in Stat1 -/- mice, MNV-4 induces lymphatic lesions similar to those seen in Crohn disease as well as hepatitis, splenitis, and typhlocolitis. MNV-4-infected Stat1 -/- mice may be a useful model to study mechanistic associations between viral infections, lymphatic dysfunction, and intestinal inflammation in a genetically susceptible host. Copyright © 2018 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Equine interferon gamma synthesis in lymphocytes after in vivo infection and in vitro stimulation with EHV-1.

PubMed

Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H

2005-08-22

Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.

Pilot study of whole-blood gamma interferon response to the Vibrio cholerae toxin B subunit and resistance to enterotoxigenic Escherichia coli-associated diarrhea.

PubMed

Flores, Jose; DuPont, Herbert L; Paredes-Paredes, Mercedes; Aguirre-Garcia, M Magdalena; Rojas, Araceli; Gonzalez, Alexei; Okhuysen, Pablo C

2010-05-01

Enterotoxigenic Escherichia coli (ETEC), which produces heat-labile toxin (LT), is a common cause of travelers' diarrhea (TD). The B subunit of ETEC LT is immunologically related to the B subunit of Vibrio cholerae toxin (CT). In this pilot study we evaluated the whole-blood gamma interferon response to CT B in 17 U.S. adults traveling to Mexico. Only one of nine subjects who demonstrated a cellular immune response as determined by whole-blood gamma interferon production to CT B on arrival to Mexico developed diarrhea, whereas five of eight without a cellular response developed diarrhea. Markers of the cellular immune response to ETEC LT could help in identifying individuals immune to ETEC LT, and these markers deserve additional study.

SAP deficiency mitigated atherosclerotic lesions in ApoE(-/-) mice.

PubMed

Zheng, Lingyun; Wu, Teng; Zeng, Cuiling; Li, Xiangli; Li, Xiaoqiang; Wen, Dingwen; Ji, Tianxing; Lan, Tian; Xing, Liying; Li, Jiangchao; He, Xiaodong; Wang, Lijing

2016-01-01

Serum amyloid P conpoent (SAP), a member of the pentraxin family, interact with pathogens and cell debris to promote their removal by macrophages and neutrophils and is co-localized with atherosclerotic plaques in patients. However, the exact mechanism of SAP in atherogenesis is still unclear. We investigated whether SAP influence macrophage recruitment and foam cell formation and ultimately affect atherosclerotic progression. we generated apoE(-/-); SAP(-/-) (DKO) mice and fed them western diet for 4 and 8 weeks to characterize atherosclerosis development. SAP deficiency effectively reduced plaque size both in the aorta (p = 0.0006 for 4 wks; p = 0.0001 for 8 wks) and the aortic root (p = 0.0061 for 4 wks; p = 0.0079 for 8wks) compared with apoE(-/-) mice. Meanwhile, SAP deficiency inhibited oxLDL-induced foam cell formation (p = 0.0004) compared with apoE(-/-) mice and SAP treatment increases oxLDL-induced foam cell formation (p = 0.002) in RAW cells. Besides, SAP deficiency reduced macrophages recruitment (p = 0.035) in vivo and in vitro (p = 0.026). Furthermore, SAP treatment enhanced CD36 (p = 0.007) and FcγRI (p = 0.031) expression induced by oxLDL through upregulating JNK and p38 MAPK phosphorylation whereas specific JNK1/2 inhibitor reduced CD36 (p = 0.0005) and FcγRI (P = 0.0007) expression in RAW cell. SAP deficiency also significantly decreased the expression of M1 and M2 macrophage markers and inflammatory cytokines in oxLDL-induced macrophages. SAP deficiency mitigated foam cell formation and atherosclerotic development in apoE(-/-) mice, due to reduction in macrophages recruitment, polarization and pro-inflammatory cytokines and inhibition the CD36/FcγR-dependent signaling pathway. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Inhibitory effect of interferon-γ on experimental tooth movement in mice.

PubMed

Kohara, Haruka; Kitaura, Hideki; Yoshimatsu, Masako; Fujimura, Yuji; Morita, Yukiko; Eguchi, Toshiko; Yoshida, Noriaki

2012-09-01

The aim of this study was to investigate the effects of interferon (IFN)-γ on experimental tooth movement in mice using a murine experimental tooth movement model. An Ni-Ti closed-coil spring was inserted between the upper-anterior alveolar bones and the upper-left first molars in mice. We evaluated the relationship between local Ifn-γ mRNA levels and orthodontic tooth movement. In other experiments, IFN-γ was injected adjacent to each first molar every other day during tooth movement. After 12 days, the amount of tooth movement was measured. Tartrate-resistant acid phosphatase (TRAP)-positive cells at the pressure side of each experimental tooth were counted as osteoclasts. Local Ifn-γ mRNA expression increased with orthodontic tooth movement. The number of TRAP-positive cells increased on the pressure side of the first molar. In contrast, the degree of tooth movement and the number of TRAP-positive cells on the pressure side in IFN-γ-injected mice were less than those of control mice. IFN-γ was induced in experimental tooth movement, and could inhibit mechanical force-loaded osteoclastogenesis and tooth movement. These results suggest that IFN-γ might be useful in controlling orthodontic tooth movement because of its inhibitory action on excessive osteoclastogenesis during this movement.

CD4 T lymphocytes from patients with chronic fatigue syndrome have decreased interferon-gamma production and increased sensitivity to dexamethasone.

PubMed

Visser, J; Blauw, B; Hinloopen, B; Brommer, E; de Kloet, E R; Kluft, C; Nagelkerken, L

1998-02-01

A disturbed hypothalamus-pituitary-adrenal gland axis and alterations at the immune system level have been observed in patients with chronic fatigue syndrome (CFS). Glucocorticoids are known to modulate T cell responses; therefore, purified CD4 T cells from CFS patients were studied to determine whether they have an altered sensitivity to dexamethasone (DEX). CD4 T cells from CFS patients produced less interferon-gamma than did cells from controls; by contrast, interleukin-4 production and cell proliferation were comparable. With CD4 T cells from CFS patients (compared with cells from controls), a 10- to 20-fold lower DEX concentration was needed to achieve 50% inhibition of interleukin-4 production and proliferation, indicating an increased sensitivity to DEX in CFS patients. Surprisingly, interferon-gamma production in patients and controls was equally sensitive to DEX. A differential sensitivity of cytokines or CD4 T cell subsets to glucocorticoids might explain an altered immunologic function in CFS patients.

Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies

PubMed Central

Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D

2014-01-01

Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250

Gamma-Terpinene Modulates Acute Inflammatory Response in Mice.

PubMed

Ramalho, Theresa Raquel de Oliveira; Oliveira, Maria Talita Pacheco de; Lima, Ana Luisa de Araujo; Bezerra-Santos, Claudio Roberto; Piuvezam, Marcia Regina

2015-09-01

The monoterpene gamma-terpinene is a natural compound present in essential oils of a wide variety of plants, including the Eucalyptus genus, which has been reported to possess anti-inflammatory activity. The goal of this study was to evaluate the effect of gamma-terpinene on several in vivo experimental models of acute inflammation. Swiss mice were pretreated with gamma-terpinene and subjected to protocols of paw edema with different phlogistic agents such as carrageenan, prostaglandin-E2, histamine, or bradykinin. The microvascular permeability was measured by intraperitoneal injection of acetic acid and measuring the amount of protein extravasation. Carrageenan-induced peritonitis was used to analyze the effect of gamma-terpinene on inflammatory cell migration and cytokine production. We also developed an acute lung injury protocol to define the anti-inflammatory effect of gamma-terpinene. Mice pretreated with gamma-terpinene displayed reduced paw edema induced by carrageenan from 1-24 h after challenge. A similar reduction was observed when gamma-terpinene was administered after stimulation with PGE2, bradykinin, and histamine. Treatment with gamma-terpinene also inhibited fluid extravasation in the acetic acid model of microvascular permeability. In a carrageenan-induced peritonitis model, gamma-terpinene treatment reduced neutrophil migration as well as the production of interleukin-1β and tumor necrosis factor-α when compared to nontreated animals, and in the acute lung injury protocol, gamma-terpinene diminished the neutrophil migration into lung tissue independently of the total protein extravasation in the lung. These data demonstrate that, in different models of inflammation, treatment with gamma-terpinene alleviated inflammatory parameters such as edema and pro-inflammatory cytokine production, as well as cell migration into the inflamed site, and that this monoterpene has anti-inflammatory properties. Georg Thieme Verlag KG Stuttgart · New York.

DIETARY FOLATE DEFICIENCY ENHANCES ARSENIC-INDUCED MICRONUCLEUS FORMATION IN MICE

EPA Science Inventory

Dietary folate deficiency enhances arsenic-induced micronucleus formation in mice.

Folate deficiency increases background levels ofDNA damage and can enhance the mutagenicity of chemical agents. Duplicate experiments were performed to investigate the effect of dietary...

CD8+ T Cell Exhaustion, Suppressed Gamma Interferon Production, and Delayed Memory Response Induced by Chronic Brucella melitensis Infection

PubMed Central

Durward-Diioia, Marina; Harms, Jerome; Khan, Mike; Hall, Cherisse; Smith, Judith A.

2015-01-01

Brucella melitensis is a well-adapted zoonotic pathogen considered a scourge of mankind since recorded history. In some cases, initial infection leads to chronic and reactivating brucellosis, incurring significant morbidity and economic loss. The mechanism by which B. melitensis subverts adaptive immunological memory is poorly understood. Previous work has shown that Brucella-specific CD8+ T cells express gamma interferon (IFN-γ) and can transition to long-lived memory cells but are not polyfunctional. In this study, chronic infection of mice with B. melitensis led to CD8+ T cell exhaustion, manifested by programmed cell death 1 (PD-1) and lymphocyte activation gene 3 (LAG-3) expression and a lack of IFN-γ production. The B. melitensis-specific CD8+ T cells that produced IFN-γ expressed less IFN-γ per cell than did CD8+ cells from uninfected mice. Both memory precursor (CD8+ LFA1HI CD127HI KLRG1LO) and long-lived memory (CD8+ CD27HI CD127HI KLRG1LO) cells were identified during chronic infection. Interestingly, after adoptive transfer, mice receiving cells from chronically infected animals were able to contain infection more rapidly than recipients of cells from acutely infected or uninfected donors, although the proportions of exhausted CD8+ T cells increased after adoptive transfer in both challenged and unchallenged recipients. CD8+ T cells of challenged recipients initially retained the stunted IFN-γ production found prior to transfer, and cells from acutely infected mice were never seen to transition to either memory subset at all time points tested, up to 30 days post-primary infection, suggesting a delay in the generation of memory. Here we have identified defects in Brucella-responsive CD8+ T cells that allow chronic persistence of infection. PMID:26416901

Inflammation and airway hyperresponsiveness after chlorine exposure are prolonged by Nrf2 deficiency in mice.

PubMed

Ano, Satoshi; Panariti, Alice; Allard, Benoit; O'Sullivan, Michael; McGovern, Toby K; Hamamoto, Yoichiro; Ishii, Yukio; Yamamoto, Masayuki; Powell, William S; Martin, James G

2017-01-01

Chlorine gas (Cl 2 ) is a potent oxidant and trigger of irritant induced asthma. We explored NF-E2-related factor 2 (Nrf2)-dependent mechanisms in the asthmatic response to Cl 2 , using Nrf2-deficient mice, buthionine sulfoximine (BSO), an inhibitor of glutathione (GSH) synthesis and sulforaphane (SFN), a phytochemical regulator of Nrf2. Airway inflammation and airway hyperresponsiveness (AHR) were assessed 24 and 48h after a 5-min nose-only exposure to 100ppm Cl 2 of Nrf2-deficient and wild type Balb/C mice treated with BSO or SFN. Animals were anesthetized, paralyzed and mechanically ventilated (FlexiVent™) and challenged with aerosolized methacholine. Bronchoalveolar lavage (BAL) was performed and lung tissues were harvested for assessment of gene expression. Cl 2 exposure induced a robust AHR and an intense neutrophilic inflammation that, although similar in Nrf2-deficient mice and wild-type mice at 24h after Cl 2 exposure, were significantly greater at 48h post exposure in Nrf2-deficient mice. Lung GSH and mRNA for Nrf2-dependent phase II enzymes (NQO-1 and GPX2) were significantly lower in Nrf2-deficient than wild-type mice after Cl 2 exposure. BSO reduced GSH levels and promoted Cl 2 -induced airway inflammation in wild-type mice, but not in Nrf2-deficient mice, whereas SFN suppressed Cl 2 -induced airway inflammation in wild-type but not in Nrf2-deficient mice. AHR was not affected by either BSO or SFN at 48h post Cl 2 exposure. Nrf2-dependent phase II enzymes play a role in the resolution of airway inflammation and AHR after Cl 2 exposure. Moderate deficiency of GSH affects the magnitude of acute inflammation but not AHR. Copyright © 2016 Elsevier Inc. All rights reserved.

Deficiency in plasmacytoid dendritic cells and type I interferon signalling prevents diet-induced obesity and insulin resistance in mice.

PubMed

Hannibal, Tine D; Schmidt-Christensen, Anja; Nilsson, Julia; Fransén-Pettersson, Nina; Hansen, Lisbeth; Holmberg, Dan

2017-10-01

Obesity is associated with glucose intolerance and insulin resistance and is closely linked to the increasing prevalence of type 2 diabetes. In mouse models of diet-induced obesity (DIO) and type 2 diabetes, an increased fat intake results in adipose tissue expansion and the secretion of proinflammatory cytokines. The innate immune system not only plays a crucial role in obesity-associated chronic low-grade inflammation but it is also proposed to play a role in modulating energy metabolism. However, little is known about how the modulation of metabolism by the immune system may promote increased adiposity in the early stages of increased dietary intake. Here we aimed to define the role of type I IFNs in DIO and insulin resistance. Mice lacking the receptor for IFN-α (IFNAR -/- ) and deficient in plasmacytoid dendritic cells (pDCs) (B6.E2-2 fl/fl .Itgax-cre) were fed a diet with a high fat content or normal chow. The mice were analysed in vivo and in vitro using cellular, biochemical and molecular approaches. We found that the development of obesity was inhibited by an inability to respond to type I IFNs. Furthermore, the development of obesity and insulin resistance in this model was associated with pDC recruitment to the fatty tissues and liver of obese mice (a 4.3-fold and 2.7-fold increase, respectively). Finally, we demonstrated that the depletion of pDCs protects mice from DIO and from developing obesity-associated metabolic complications. Our results provide genetic evidence that pDCs, via type I IFNs, regulate energy metabolism and promote the development of obesity.

Cyclocreatine treatment improves cognition in mice with creatine transporter deficiency.

PubMed

Kurosawa, Yuko; Degrauw, Ton J; Lindquist, Diana M; Blanco, Victor M; Pyne-Geithman, Gail J; Daikoku, Takiko; Chambers, James B; Benoit, Stephen C; Clark, Joseph F

2012-08-01

The second-largest cause of X-linked mental retardation is a deficiency in creatine transporter (CRT; encoded by SLC6A8), which leads to speech and language disorders with severe cognitive impairment. This syndrome, caused by the absence of creatine in the brain, is currently untreatable because CRT is required for creatine entry into brain cells. Here, we developed a brain-specific Slc6a8 knockout mouse (Slc6a8-/y) as an animal model of human CRT deficiency in order to explore potential therapies for this syndrome. The phenotype of the Slc6a8-/y mouse was comparable to that of human patients. We successfully treated the Slc6a8-/y mice with the creatine analog cyclocreatine. Brain cyclocreatine and cyclocreatine phosphate were detected after 9 weeks of cyclocreatine treatment in Slc6a8-/y mice, in contrast to the same mice treated with creatine or placebo. Cyclocreatine-treated Slc6a8-/y mice also exhibited a profound improvement in cognitive abilities, as seen with novel object recognition as well as spatial learning and memory tests. Thus, cyclocreatine appears promising as a potential therapy for CRT deficiency.

Fluorosis increases the risk of postmenopausal osteoporosis by stimulating interferon γ.

PubMed

Lv, Yun-Gang; Kang, Li; Wu, Guangyao

2016-10-14

Estrogen deficiency in postmenopausal women frequently activates osteoclasts (OC), accelerates bone resorption, and leads to osteoporosis (OP). Previous studies have demonstrated that interferon γ (IFNγ) could increase bone resorption and may be involved in postmenopausal OP. Fluorosis also increased the risk of fractures and dental fluorosis, and fluoride may enhance osteoclast formation and induce osteoclastic bone destruction in postmenopausal women, but the underlying mechanisms are as yet unknown. Here, we show that serum fluoride and IFNγ levels are negatively correlated with bone mineral density (BMD) in postmenopausal women residing in a fluorotic area. Estrogen suppresses IFNγ, which is elevated by fluoride, playing a pivotal role in triggering bone loss in estrogen-deficient conditions. In vitro, IFNγ is inhibited by estrogen treatment and increased by fluoride in Raw264.7 cell, an osteoclast progenitor cell line. In ovariectomized (Ovx) mice, estrogen loss and IFNγ promote OC activation and subsequent bone loss in vivo. However, IFNγ deficiency prevents bone loss in Ovx mice even in fluoride conditions. Interestingly, fluoride fails to increase IFNγ expression in estrogen receptor α (ERα)-deficient conditions, but not in ERβ-deficient conditions. These findings demonstrate that fluorosis increases the bone loss in postmenopausal OP through an IFNγ-dependent mechanism. IFNγ signaling activates OC and aggravates estrogen deficiency inducing OP. Thus, stimulation of IFNγ production is a pivotal ''upstream'' mechanism by which fluoride promotes bone loss. Suppression of IFNγ levels may constitute a therapeutic approach for preventing bone loss. Copyright © 2016 Elsevier Inc. All rights reserved.

DNA repair kinetics in SCID mice Sertoli cells and DNA-PKcs-deficient mouse embryonic fibroblasts.

PubMed

Ahmed, Emad A; Vélaz, Eukene; Rosemann, Michael; Gilbertz, Klaus-P; Scherthan, Harry

2017-03-01

Noncycling and terminally differentiated (TD) cells display differences in radiosensitivity and DNA damage response. Unlike other TD cells, Sertoli cells express a mixture of proliferation inducers and inhibitors in vivo and can reenter the cell cycle. Being in a G 1 -like cell cycle stage, TD Sertoli cells are expected to repair DSBs by the error-prone nonhomologous end-joining pathway (NHEJ). Recently, we have provided evidence for the involvement of Ku-dependent NHEJ in protecting testis cells from DNA damage as indicated by persistent foci of the DNA double-strand break (DSB) repair proteins phospho-H2AX, 53BP1, and phospho-ATM in TD Sertoli cells of Ku70-deficient mice. Here, we analyzed the kinetics of 53BP1 foci induction and decay up to 12 h after 0.5 Gy gamma irradiation in DNA-PKcs-deficient (Prkdc scid ) and wild-type Sertoli cells. In nonirradiated mice and Prkdc scid Sertoli cells displayed persistent DSBs foci in around 12 % of cells and a fivefold increase in numbers of these DSB DNA damage-related foci relative to the wild type. In irradiated mice, Prkdc scid Sertoli cells showed elevated levels of DSB-indicating foci in 82 % of cells 12 h after ionizing radiation (IR) exposure, relative to 52 % of irradiated wild-type Sertoli cells. These data indicate that Sertoli cells respond to and repair IR-induced DSBs in vivo, with repair kinetics being slow in the wild type and inefficient in Prkdc scid . Applying the same dose of IR to Prdkc -/- and Ku -/- mouse embryonic fibroblast (MEF) cells revealed a delayed induction of 53BP1 DSB-indicating foci 5 min post-IR in Prdkc -/- cells. Inefficient DSB repair was evident 7 h post-IR in DNA-PKcs-deficient cells, but not in Ku -/- MEFs. Our data show that quiescent Sertoli cells repair genotoxic DSBs by DNA-PKcs-dependent NEHJ in vivo with a slower kinetics relative to somatic DNA-PKcs-deficient cells in vitro, while DNA-PKcs deficiency caused inefficient DSB repair at later time points post-IR in both

The Effectiveness of Screening with Interferon-Gamma Release Assays in a University Health Care Setting with a Diverse Global Population

ERIC Educational Resources Information Center

Birch, Samantha J.; Golbeck, Amanda L.

2015-01-01

Objective: This analysis examined the effectiveness of utilizing interferon-gamma release assay (IGRA) technology in a TB (TB) screening program at a university. Participants: Participants were 2299 students at a Montana university who had presented to the university health center for TB screening during 2012 and 2013. Methods: A retrospective…

Characterization and functional analysis of cellular immunity in mice with biotinidase deficiency.

PubMed

Pindolia, Kirit; Li, Hong; Cardwell, Cisley; Wolf, Barry

2014-05-01

Biotinidase deficiency is an autosomal recessively inherited metabolic disorder that can be easily and effectively treated with pharmacological doses of the vitamin, biotin. Untreated children with profound biotinidase deficiency may exhibit neurological, cutaneous and cellular immunological abnormalities, specifically candida infections. To better understand the immunological dysfunction in some symptomatic individuals with biotinidase deficiency, we studied various aspects of immunological function in a genetically engineered knock-out mouse with biotinidase deficiency. The mouse has no detectable biotinidase activity and develops neurological and cutaneous symptoms similar to those seen in symptomatic children with the disorder. Mice with profound biotinidase deficiency on a biotin-restricted diet had smaller thymuses and spleens than identical mice fed a biotin-replete diet or wildtype mice on either diet; however, the organ to body weight ratios were not significantly different. Thymus histology was normal. Splenocyte subpopulation study showed a significant increase in CD4 positive cells. In addition, in vitro lymphocyte proliferation assays consistently showed diminished proliferation in response to various immunological stimuli. Not all symptomatic individuals with profound biotinidase deficiency develop immunological dysfunction; however, our results do show significant alterations in cellular immunological function that may contribute and/or provide a mechanism(s) for the cellular immunity abnormalities in individuals with biotinidase deficiency. Copyright © 2014 Elsevier Inc. All rights reserved.

Dysregulation of Serum Gamma Interferon Levels in Vascular Chronic Q Fever Patients Provides Insights into Disease Pathogenesis

PubMed Central

Kremers, Marjolein N. T.; Hodemaekers, Hennie M.; Hagenaars, Julia C. J. P.; Koning, Olivier H. J.; Renders, Nicole H. M.; Hermans, Mirjam H. A.; de Klerk, Arja; Notermans, Daan W.; Wever, Peter C.; Janssen, Riny

2015-01-01

A large community outbreak of Q fever occurred in the Netherlands in the period 2007 to 2010. Some of the infected patients developed chronic Q fever, which typically includes pathogen dissemination to predisposed cardiovascular sites, with potentially fatal consequences. To identify the immune mechanisms responsible for ineffective clearance of Coxiella burnetii in patients who developed chronic Q fever, we compared serum concentrations of 47 inflammation-associated markers among patients with acute Q fever, vascular chronic Q fever, and past resolved Q fever. Serum levels of gamma interferon were strongly increased in acute but not in vascular chronic Q fever patients, compared to past resolved Q fever patients. Interleukin-18 levels showed a comparable increase in acute as well as vascular chronic Q fever patients. Additionally, vascular chronic Q fever patients had lower serum levels of gamma interferon-inducible protein 10 (IP-10) and transforming growth factor β (TGF-β) than did acute Q fever patients. Serum responses for these and other markers indicate that type I immune responses to C. burnetii are affected in chronic Q fever patients. This may be attributed to an affected immune system in cardiovascular patients, which enables local C. burnetii replication at affected cardiovascular sites. PMID:25924761

Ionizing radiation potentiates the induction of nitric oxide synthase by interferon-gamma (Ifn-gamma) or Ifn-gamma and lipopolysaccharide in bnl cl.2 murine embryonic liver cells: role of hydrogen peroxide.

PubMed

Yoo, J C; Pae, H O; Choi, B M; Kim, W I; Kim, J D; Kim, Y M; Chung, H T

2000-02-01

The effects of ionizing irradiation on the nitric oxide (NO) production in murine embryonic liver cell line, BNL CL.2 cells, were investigated. Various doses (5-40 Gy) of radiation made BNL CL.2 cells responsive to interferon-gamma alone for the production of NO in a dose-dependent manner. Small amounts of lipopolysaccharide (LPS) or tumor necrosis factor-alpha (TNF-alpha) synergized with IFN-gamma in the production of NO from irradiated BNL CL.2 cells, even though LPS or TNF-alpha alone did not induce NO production from the same cells. Immunoblots showed parallel induction of inducible nitric oxide synthase (iNOS). NO production in irradiated BNL CL.2 cells by IFN-gamma or IFN-gamma plus LPS was decreased by the addition of catalase, suggesting that H(2)O(2) produced by ionizing irradiation primed the cells to trigger NO production in response to IFN-gamma or IFN-gamma plus LPS. Furthermore, the treatment of nongamma-irradiated BNL CL.2 cells with H(2)O(2) made the cells responsive to IFN-gamma or IFN-gamma plus LPS for the production of NO. This study shows that ionizing irradiation has the ability to induce iNOS gene expression in responsive to IFN-gamma via the formation of H(2)O(2) in BNL CL.2 murine embryonic liver cells.

Amelioration of Behavioral Abnormalities in BH4-deficient Mice by Dietary Supplementation of Tyrosine

PubMed Central

Kwak, Sang Su; Jeong, Mikyoung; Choi, Ji Hye; Kim, Daesoo; Min, Hyesun; Yoon, Yoosik; Hwang, Onyou; Meadows, Gary G.; Joe, Cheol O.

2013-01-01

This study reports an amelioration of abnormal motor behaviors in tetrahydrobiopterin (BH4)-deficient Spr −/− mice by the dietary supplementation of tyrosine. Since BH4 is an essential cofactor for the conversion of phenylalanine into tyrosine as well as the synthesis of dopamine neurotransmitter within the central nervous system, the levels of tyrosine and dopamine were severely reduced in brains of BH4-deficient Spr −/− mice. We found that Spr −/− mice display variable ‘open-field’ behaviors, impaired motor functions on the ‘rotating rod’, and dystonic ‘hind-limb clasping’. In this study, we report that these aberrant motor deficits displayed by Spr −/− mice were ameliorated by the therapeutic tyrosine diet for 10 days. This study also suggests that dopamine deficiency in brains of Spr −/− mice may not be the biological feature of aberrant motor behaviors associated with BH4 deficiency. Brain levels of dopamine (DA) and its metabolites in Spr −/− mice were not substantially increased by the dietary tyrosine therapy. However, we found that mTORC1 activity severely suppressed in brains of Spr −/− mice fed a normal diet was restored 10 days after feeding the mice the tyrosine diet. The present study proposes that brain mTORC1 signaling pathway is one of the potential targets in understanding abnormal motor behaviors associated with BH4-deficiency. PMID:23577163

Alopecia of IFN-gamma knockout mouse as a model for disturbance of the hair cycle: a unique arrest of the hair cycle at the anagen phase accompanied by mitosis.

PubMed

Hirota, Ryuichiro; Tajima, Sadao; Yoneda, Yukio; Tamayama, Takumi; Watanabe, Masahito; Ueda, Kouichi; Kubota, Takahiro; Yoshida, Ryotaro

2002-09-01

Interferon-gamma(-/-) (IFN-gamma(-/-)) and IFN-gamma(+/+) C57BL/6 mice (3 weeks of age) completed the production of morphogenesis-derived hair. Around 6 weeks of age, however, most of the IFN-gamma(-/-) but none of the IFN-gamma(+/+) mice began to lose hairs in the dorsal and occipital areas in the absence of inflammatory reactions, and the alopecia was sustained for at least several 10-week periods of observation. A single subcutaneous injection of IFN-gamma to IFN-gamma(-/-) mice at 3, but not 4, 5, or 8 weeks of age could protect all the mice from alopecia, revealing that the lack of IFN-gamma around 3 weeks of age is directly responsible for the alopecia. Histologic features showed that the hair follicles of the IFN-gamma(+/+) mice passed through the anagen (4-5 weeks of age) and catagen/telogen ( approximately 6 weeks of age) phases, whereas those of IFN-gamma(-/-) mice (5 weeks of age or older) stayed in the anagen phase. TUNEL and bromodeoxyuridine experiments suggested that an arrest with unlimited DNA synthesis of the hair cycle in the anagen phase by the lack of IFN-gamma-dependent apoptosis in the midfollicle region and diffuse shedding of previously formed hair induced alopecia in IFN-gamma(-/-) mice.

Interferon-λ restricts West Nile virus neuroinvasion by tightening the blood-brain barrier.

PubMed

Lazear, Helen M; Daniels, Brian P; Pinto, Amelia K; Huang, Albert C; Vick, Sarah C; Doyle, Sean E; Gale, Michael; Klein, Robyn S; Diamond, Michael S

2015-04-22

Although interferon-λ [also known as type III interferon or interleukin-28 (IL-28)/IL-29] restricts infection by several viruses, its inhibitory mechanism has remained uncertain. We used recombinant interferon-λ and mice lacking the interferon-λ receptor (IFNLR1) to evaluate the effect of interferon-λ on infection with West Nile virus, an encephalitic flavivirus. Cell culture studies in mouse keratinocytes and dendritic cells showed no direct antiviral effect of exogenous interferon-λ, even though expression of interferon-stimulated genes was induced. We observed no differences in West Nile virus burden between wild-type and Ifnlr1(-/-) mice in the draining lymph nodes, spleen, or blood. We detected increased West Nile virus infection in the brain and spinal cord of Ifnlr1(-/-) mice, yet this was not associated with a direct antiviral effect in mouse neurons. Instead, we observed an increase in blood-brain barrier permeability in Ifnlr1(-/-) mice. Treatment of mice with pegylated interferon-λ2 resulted in decreased blood-brain barrier permeability, reduced West Nile virus infection in the brain without affecting viremia, and improved survival against lethal virus challenge. An in vitro model of the blood-brain barrier showed that interferon-λ signaling in mouse brain microvascular endothelial cells increased transendothelial electrical resistance, decreased virus movement across the barrier, and modulated tight junction protein localization in a protein synthesis- and signal transducer and activator of transcription 1 (STAT1)-independent manner. Our data establish an indirect antiviral function of interferon-λ in which noncanonical signaling through IFNLR1 tightens the blood-brain barrier and restricts viral neuroinvasion and pathogenesis. Copyright © 2015, American Association for the Advancement of Science.

Deficiency of angiotensinogen in hepatocytes markedly decreases blood pressure in lean and obese male mice.

PubMed

Yiannikouris, Frederique; Wang, Yu; Shoemaker, Robin; Larian, Nika; Thompson, Joel; English, Victoria L; Charnigo, Richard; Su, Wen; Gong, Ming; Cassis, Lisa A

2015-10-01

We recently demonstrated that adipocyte deficiency of angiotensinogen (AGT) ablated high-fat diet-induced elevations in plasma angiotensin II (Ang II) concentrations and obesity-hypertension in male mice. Hepatocytes are the predominant source of systemic AGT. Therefore, in this study, we defined the contribution of hepatocyte-derived AGT to obesity-induced elevations in plasma AGT concentrations and hypertension. Male Agt(fl/fl) mice expressing albumin-driven Cre recombinase were bred to female Agt(fl/fl) mice to generate Agt(fl/fl) or hepatocyte AGT-deficient male mice (Agt(Alb)). Mice were fed a low-fat or high-fat diet for 16 weeks. Hepatocyte AGT deficiency had no significant effect on body weight. Plasma AGT concentrations were increased in obese Agt(fl/fl) mice. Hepatocyte AGT deficiency markedly reduced plasma AGT and Ang II concentrations in lean and obese mice. Moreover, hepatocyte AGT deficiency reduced the content and release of AGT from adipose explants. Systolic blood pressure was markedly decreased in lean (by 18 mm Hg) and obese Agt(Alb) mice (by 54 mm Hg) compared with Agt(fl/fl) controls. To define mechanisms, we quantified effects of Ang II on mRNA abundance of megalin, an AGT uptake transporter, in 3T3-L1 adipocytes. Ang II stimulated adipocyte megalin mRNA abundance and decreased media AGT concentrations. These results demonstrate that hepatocytes are the predominant source of systemic AGT in both lean and obese mice. Moreover, reductions in plasma angiotensin concentrations in obese hepatocyte AGT-deficient mice may have limited megalin-dependent uptake of AGT into adipocytes for the production of Ang II in the development of obesity-hypertension. © 2015 American Heart Association, Inc.

Alternative activation of STAT1 and STAT3 in response to interferon-gamma.

PubMed

Qing, Yulan; Stark, George R

2004-10-01

Interferon-gamma (IFNgamma) is a pluripotent cytokine whose major biological effects are mediated through a pathway in which STAT1 is the predominant and essential transcription factor. STAT3 can also be activated weakly by IFNgamma, but the mechanism of activation and function of STAT3 as a part of the interferon response are not known. Here we show that STAT3 activation is much stronger and more prolonged in STAT1-null mouse embryo fibroblasts than in wild-type cells. In response to IFNgamma, SRC-family kinases are required to activate STAT3 (but not STAT1) through tyrosine phosphorylation, whereas the receptor-bound kinases JAK1 and JAK2 are required to activate both STATs. Tyrosine 419 of the IFNgamma receptor subunit 1 (IFNGR1) is required to activate both STATs, suggesting that STAT1 and STAT3 compete with each other for the same receptor phosphotyrosine motif. Activated STAT3 can replace STAT1 in STAT1-null cells to drive the transcription of certain genes, for example, socs-3 and c/ebpdelta, which have gamma-activated sequence motifs in their promoters. Work from Ian Kerr's laboratory reveals that the gp130-linked interleukin-6 receptor, which usually activates STAT3 predominantly, activates STAT1 efficiently when STAT3 is absent. Because STAT1 and STAT3 have opposing biological effects (STAT3 is an oncogene, and STAT1 is a tumor suppressor), the reciprocal activation of these two transcription factors in response to IFNgamma or interleukin-6 suggests that their relative abundance, which may vary substantially in different normal cell types, under different conditions or in tumors is likely to have a major impact on how cells behave in response to different cytokines.

Cyclocreatine treatment improves cognition in mice with creatine transporter deficiency

PubMed Central

Kurosawa, Yuko; DeGrauw, Ton J.; Lindquist, Diana M.; Blanco, Victor M.; Pyne-Geithman, Gail J.; Daikoku, Takiko; Chambers, James B.; Benoit, Stephen C.; Clark, Joseph F.

2012-01-01

The second-largest cause of X-linked mental retardation is a deficiency in creatine transporter (CRT; encoded by SLC6A8), which leads to speech and language disorders with severe cognitive impairment. This syndrome, caused by the absence of creatine in the brain, is currently untreatable because CRT is required for creatine entry into brain cells. Here, we developed a brain-specific Slc6a8 knockout mouse (Slc6a8–/y) as an animal model of human CRT deficiency in order to explore potential therapies for this syndrome. The phenotype of the Slc6a8–/y mouse was comparable to that of human patients. We successfully treated the Slc6a8–/y mice with the creatine analog cyclocreatine. Brain cyclocreatine and cyclocreatine phosphate were detected after 9 weeks of cyclocreatine treatment in Slc6a8–/y mice, in contrast to the same mice treated with creatine or placebo. Cyclocreatine-treated Slc6a8–/y mice also exhibited a profound improvement in cognitive abilities, as seen with novel object recognition as well as spatial learning and memory tests. Thus, cyclocreatine appears promising as a potential therapy for CRT deficiency. PMID:22751104

Clonal hematopoiesis associated with TET2 deficiency accelerates atherosclerosis development in mice.

PubMed

Fuster, José J; MacLauchlan, Susan; Zuriaga, María A; Polackal, Maya N; Ostriker, Allison C; Chakraborty, Raja; Wu, Chia-Ling; Sano, Soichi; Muralidharan, Sujatha; Rius, Cristina; Vuong, Jacqueline; Jacob, Sophia; Muralidhar, Varsha; Robertson, Avril A B; Cooper, Matthew A; Andrés, Vicente; Hirschi, Karen K; Martin, Kathleen A; Walsh, Kenneth

2017-02-24

Human aging is associated with an increased frequency of somatic mutations in hematopoietic cells. Several of these recurrent mutations, including those in the gene encoding the epigenetic modifier enzyme TET2, promote expansion of the mutant blood cells. This clonal hematopoiesis correlates with an increased risk of atherosclerotic cardiovascular disease. We studied the effects of the expansion of Tet2 -mutant cells in atherosclerosis-prone, low-density lipoprotein receptor-deficient ( Ldlr -/- ) mice. We found that partial bone marrow reconstitution with TET2-deficient cells was sufficient for their clonal expansion and led to a marked increase in atherosclerotic plaque size. TET2-deficient macrophages exhibited an increase in NLRP3 inflammasome-mediated interleukin-1β secretion. An NLRP3 inhibitor showed greater atheroprotective activity in chimeric mice reconstituted with TET2-deficient cells than in nonchimeric mice. These results support the hypothesis that somatic TET2 mutations in blood cells play a causal role in atherosclerosis. Copyright © 2017, American Association for the Advancement of Science.

Clonal hematopoiesis associated with TET2 deficiency accelerates atherosclerosis development in mice

PubMed Central

Fuster, José J.; MacLauchlan, Susan; Zuriaga, María A.; Polackal, Maya N.; Ostriker, Allison C.; Chakraborty, Raja; Wu, Chia-Ling; Sano, Soichi; Muralidharan, Sujatha; Rius, Cristina; Vuong, Jacqueline; Jacob, Sophia; Muralidhar, Varsha; Robertson, Avril A. B.; Cooper, Matthew A.; Andrés, Vicente; Hirschi, Karen K.; Martin, Kathleen A.; Walsh, Kenneth

2017-01-01

Human aging is associated with an increased frequency of somatic mutations in hematopoietic cells. Several of these recurrent mutations, including those in the gene encoding the epigenetic modifier enzyme TET2, promote expansion of the mutant blood cells. This clonal hematopoiesis correlates with an increased risk of atherosclerotic cardiovascular disease. We studied the effects of the expansion of Tet2-mutant cells in atherosclerosis-prone, low-density lipoprotein receptor–deficient (Ldlr−/−) mice. We found that partial bone marrow reconstitution with TET2-deficient cells was sufficient for their clonal expansion and led to a marked increase in atherosclerotic plaque size. TET2-deficient macrophages exhibited an increase in NLRP3 inflammasome–mediated interleukin-1β secretion. An NLRP3 inhibitor showed greater atheroprotective activity in chimeric mice reconstituted with TET2-deficient cells than in nonchimeric mice. These results support the hypothesis that somatic TET2 mutations in blood cells play a causal role in atherosclerosis. PMID:28104796

Human adaptive immune system Rag2-/-gamma(c)-/- mice.

PubMed

Chicha, Laurie; Tussiwand, Roxane; Traggiai, Elisabetta; Mazzucchelli, Luca; Bronz, Lucio; Piffaretti, Jean-Claude; Lanzavecchia, Antonio; Manz, Markus G

2005-06-01

Although many biologic principles are conserved in mice and humans, species-specific differences exist, for example, in susceptibility and response to pathogens, that often do not allow direct implementation of findings in experimental mice to humans. Research in humans, however, for ethical and practical reasons, is largely restricted to in vitro assays that lack components and the complexity of a living organism. To nevertheless study the human hematopoietic and immune system in vivo, xenotransplantation assays have been developed that substitute human components to small animals. Here, we summarize our recent findings that transplantation of human cord blood CD34(+) cells to newborn Rag2(-/-)gamma(c)(-/-) mice leads to de novo development of major functional components of the human adaptive immune system. These human adaptive immune system Rag2(-/-)gamma(c)(-/-) (huAIS-RG) mice can now be used as a technically straightforward preclinical model to evaluate in vivo human adaptive immune system development as well as immune responses, for example, to vaccines or live infectious pathogens.

Gamma-interferon causes a selective induction of the lysosomal proteases, cathepsins B and L, in macrophages

NASA Technical Reports Server (NTRS)

Lah, T. T.; Hawley, M.; Rock, K. L.; Goldberg, A. L.

1995-01-01

Previous studies have indicated that acid-optimal cysteine proteinase(s) in the endosomal-lysosomal compartments, cathepsins, play a critical role in the proteolytic processing of endocytosed proteins to generate the antigenic peptides presented to the immune system on major histocompatibility complex (MHC) class II molecules. The presentation of these peptides and the expression of MHC class II molecules by macrophages and lymphocytes are stimulated by gamma-interferon (gamma-IFN). We found that treatment of human U-937 monocytes with gamma-IFN increased the activities and the content of the two major lysosomal cysteine proteinases, cathepsins B and L. Assays of protease activity, enzyme-linked immunosorbant assays (ELISA) and immunoblotting showed that this cytokine increased the amount of cathepsin B 5-fold and cathepsin L 3-fold in the lysosomal fraction. By contrast, the aspartic proteinase, cathepsin D, in this fraction was not significantly altered by gamma-IFN treatment. An induction of cathepsins B and L was also observed in mouse macrophages, but not in HeLa cells. These results suggest coordinate regulation in monocytes of the expression of cathepsins B and L and MHC class II molecules. Presumably, this induction of cysteine proteases contributes to the enhancement of antigen presentation by gamma-IFN.

Type III Interferon-Mediated Signaling Is Critical for Controlling Live Attenuated Yellow Fever Virus Infection In Vivo

PubMed Central

Douam, Florian; Soto Albrecht, Yentli E.; Hrebikova, Gabriela; Sadimin, Evita; Davidson, Christian; Kotenko, Sergei V.

2017-01-01

ABSTRACT Yellow fever virus (YFV) is an arthropod-borne flavivirus, infecting ~200,000 people worldwide annually and causing about 30,000 deaths. The live attenuated vaccine strain, YFV-17D, has significantly contributed in controlling the global burden of yellow fever worldwide. However, the viral and host contributions to YFV-17D attenuation remain elusive. Type I interferon (IFN-α/β) signaling and type II interferon (IFN-γ) signaling have been shown to be mutually supportive in controlling YFV-17D infection despite distinct mechanisms of action in viral infection. However, it remains unclear how type III IFN (IFN-λ) integrates into this antiviral system. Here, we report that while wild-type (WT) and IFN-λ receptor knockout (λR−/−) mice were largely resistant to YFV-17D, deficiency in type I IFN signaling resulted in robust infection. Although IFN-α/β receptor knockout (α/βR−/−) mice survived the infection, mice with combined deficiencies in both type I signaling and type III IFN signaling were hypersusceptible to YFV-17D and succumbed to the infection. Mortality was associated with viral neuroinvasion and increased permeability of the blood-brain barrier (BBB). α/βR−/− λR−/− mice also exhibited distinct changes in the frequencies of multiple immune cell lineages, impaired T-cell activation, and severe perturbation of the proinflammatory cytokine balance. Taken together, our data highlight that type III IFN has critical immunomodulatory and neuroprotective functions that prevent viral neuroinvasion during active YFV-17D replication. Type III IFN thus likely represents a safeguard mechanism crucial for controlling YFV-17D infection and contributing to shaping vaccine immunogenicity. PMID:28811340

Interferon-gamma enhances radiation-induced cell death via downregulation of Chk1

PubMed Central

Kim, Kwang Seok; Choi, Kyu Jin; Bae, Sangwoo

2012-01-01

Interferon-gamma (IFNγ) is a cytokine with roles in immune responses as well as in tumor control. Interferon is often used in cancer treatment together with other therapies. Here we report a novel approach to enhancement of cancer cell killing by combined treatment of IFNγ with ionizing radiation. We found that IFNγ treatment alone in HeLa cells induced phosphorylation of Chk1 in a time- and dose-dependent manner, and resulted in cell arrest. Moreover IFNγ treatment was correlated with attenuation of Chk1 as the treatment shortened protein half-life of Chk1. As Chk1 is an essential cell cycle regulator for viability after DNA damage, attenuation of Chk1 by IFNγ pre-treatment in HeLa cells resulted in increased cell death following ionizing radiation about 2-folds than ionizing radiation treatment alone whereas IFNγ treatment alone had little effect on cell death. X-linked inhibitor of apoptosis-associated factor 1 (XAF1), an IFN-induced gene, seems to partly regulate IFNγ-induced Chk1 destabilization and radiation sensitivity because transient depletion of XAF1 by siRNA prevented IFNγ-induced Chk1 attenuation and partly protected cells from IFNγ-enhanced radiation cell killing. Therefore the results provide a novel rationale to combine IFNγ pretreatment and DNA-damaging anti-cancer drugs such as ionizing radiation to enhance cancer cell killing. PMID:22825336

Interferon-gamma, macrophages, and virus spread after HSV-1 injection.

PubMed

Cathcart, Heather M; Zheng, Mei; Covar, Jason J; Liu, Yi; Podolsky, Robert; Atherton, Sally S

2011-06-07

After uniocular anterior chamber (AC) injection of HSV-1, the anterior segment of BALB/c mice becomes inflamed and infected; however, virus does not spread from the anterior segment to cause retinitis in the injected eye. The purpose of these studies was to determine whether interferon (IFN-)-γ and Mac-1(+) cells play a role in preventing direct anterior-to-posterior spread of HSV-1 in the injected eye. One AC of adult female BALB/c mice was injected with HSV-1 (KOS). The location of IFN-α, IFN-β, and IFN-γ in the injected eye was determined by immunofluorescence, and mRNA expression was quantified by qPCR. Injected eyes of IFN-γ knockout or clodronate-treated macrophage-depleted mice were examined to determine whether the absence of IFN-γ or Mac-1(+) macrophages affected the sites or timing of virus spread. IFN-α, IFN-β, and IFN-γ were observed in the anterior segment of injected eyes through 72 hours and mRNA levels of IFN-β and IFN-γ were increased in virus-infected eyes 48 to 120 hours after infection. However, the absence of IFN-γ or macrophages did not affect either the sites or the timing of HSV-1 infection in injected eyes. Protection of the retina of the injected eye does not depend on a single cell type or cytokine. In addition, in the eye, as in other sites of the body, there are redundancies in the innate response to virus infection.

Melanocortin 1 Receptor Deficiency Promotes Atherosclerosis in Apolipoprotein E-/- Mice.

PubMed

Rinne, Petteri; Kadiri, James J; Velasco-Delgado, Mauricio; Nuutinen, Salla; Viitala, Miro; Hollmén, Maija; Rami, Martina; Savontaus, Eriika; Steffens, Sabine

2018-02-01

The MC1-R (melanocortin 1 receptor) is expressed by monocytes and macrophages where it mediates anti-inflammatory actions. MC1-R also protects against macrophage foam cell formation primarily by promoting cholesterol efflux through the ABCA1 (ATP-binding cassette transporter subfamily A member 1) and ABCG1 (ATP-binding cassette transporter subfamily G member 1). In this study, we aimed to investigate whether global deficiency in MC1-R signaling affects the development of atherosclerosis. Apoe -/- (apolipoprotein E deficient) mice were crossed with recessive yellow (Mc1r e/e ) mice carrying dysfunctional MC1-R and fed a high-fat diet to induce atherosclerosis. Apoe -/- Mc1r e/e mice developed significantly larger atherosclerotic lesions in the aortic sinus and in the whole aorta compared with Apoe -/- controls. In terms of plaque composition, MC1-R deficiency was associated with less collagen and smooth muscle cells and increased necrotic core, indicative of more vulnerable lesions. These changes were accompanied by reduced Abca1 and Abcg1 expression in the aorta. Furthermore, Apoe -/- Mc1r e/e mice showed a defect in bile acid metabolism that aggravated high-fat diet-induced hypercholesterolemia and hepatic lipid accumulation. Flow cytometric analysis of leukocyte profile revealed that dysfunctional MC1-R enhanced arterial accumulation of classical Ly6C high monocytes and macrophages, effects that were evident in mice fed a normal chow diet but not under high-fat diet conditions. In support of enhanced arterial recruitment of Ly6C high monocytes, these cells had increased expression of L-selectin and P-selectin glycoprotein ligand 1. The present study highlights the importance of MC1-R in the development of atherosclerosis. Deficiency in MC1-R signaling exacerbates atherosclerosis by disturbing cholesterol handling and by increasing arterial monocyte accumulation. © 2017 The Authors.

Colitis and Colon Cancer in WASP-Deficient Mice Require Helicobacter Spp.

PubMed Central

Nguyen, Deanna D.; Muthupalani, Suresh; Goettel, Jeremy A.; Eston, Michelle A.; Mobley, Melissa; Taylor, Nancy S.; McCabe, Amanda; Marin, Romela; Snapper, Scott B.; Fox, James G.

2014-01-01

Background Wiskott-Aldrich Syndrome protein (WASP)-deficient patients and mice are immunodeficient and can develop inflammatory bowel disease. The intestinal microbiome is critical to the development of colitis in most animal models, in which, Helicobacter spp. have been implicated in disease pathogenesis. We sought to determine the role of Helicobacter spp. in colitis development in WASP-deficient (WKO) mice. Methods Feces from WKO mice raised under specific pathogen free conditions were evaluated for the presence of Helicobacter spp., after which, a subset of mice were rederived in Helicobacter spp.-free conditions. Helicobacter spp.-free WKO animals were subsequently infected with Helicobacter bilis. Results Helicobacter spp. were detected in feces from WKO mice. After re-derivation in Helicobacter spp.-free conditions, WKO mice did not develop spontaneous colitis but were susceptible to radiation-induced colitis. Moreover, a T-cell transfer model of colitis dependent on WASP-deficient innate immune cells also required Helicobacter spp. colonization. Helicobacter bilis infection of rederived WKO mice led to typhlitis and colitis. Most notably, several H. bilis-infected animals developed dysplasia with 10% demonstrating colon carcinoma, which was not observed in uninfected controls. Conclusions Spontaneous and T-cell transfer, but not radiation-induced, colitis in WKO mice is dependent on the presence of Helicobacter spp. Furthermore, H. bilis infection is sufficient to induce typhlocolitis and colon cancer in Helicobacter spp.-free WKO mice. This animal model of a human immunodeficiency with chronic colitis and increased risk of colon cancer parallels what is seen in human colitis and implicates specific microbial constituents in promoting immune dysregulation in the intestinal mucosa. PMID:23820270

CD8 T cells protect adult naive mice from JEV-induced morbidity via lytic function

PubMed Central

Chawla, Amanpreet Singh; Agrawal, Tanvi; Biswas, Moanaro; Vrati, Sudhanshu; Rath, Satyajit; George, Anna; Medigeshi, Guruprasad R.

2017-01-01

Following Japanese encephalitis virus (JEV) infection neutralizing antibodies are shown to provide protection in a significant proportion of cases, but not all, suggesting additional components of immune system might also contribute to elicit protective immune response. Here we have characterized the role of T cells in offering protection in adult mice infected with JEV. Mice lacking α/β–T cells (TCRβ–null) are highly susceptible and die over 10–18 day period as compared to the wild-type (WT) mice which are resistant. This is associated with high viral load, higher mRNA levels of proinflammatory cytokines and breach in the blood-brain-barrier (BBB). Infected WT mice do not show a breach in BBB; however, in contrast to TCRβ-null, they show the presence of T cells in the brain. Using adoptive transfer of cells with specific genetic deficiencies we see that neither the presence of CD4 T cells nor cytokines such as IL-4, IL-10 or interferon-gamma have any significant role in offering protection from primary infection. In contrast, we show that CD8 T cell deficiency is more critical as absence of CD8 T cells alone increases mortality in mice infected with JEV. Further, transfer of T cells from beige mice with defects in granular lytic function into TCRβ-null mice shows poor protection implicating granule-mediated target cell lysis as an essential component for survival. In addition, for the first time we report that γ/δ-T cells also make significant contribution to confer protection from JEV infection. Our data show that effector CD8 T cells play a protective role during primary infection possibly by preventing the breach in BBB and neuronal damage. PMID:28151989

CD8 T cells protect adult naive mice from JEV-induced morbidity via lytic function.

PubMed

Jain, Nidhi; Oswal, Neelam; Chawla, Amanpreet Singh; Agrawal, Tanvi; Biswas, Moanaro; Vrati, Sudhanshu; Rath, Satyajit; George, Anna; Bal, Vineeta; Medigeshi, Guruprasad R

2017-02-01

Following Japanese encephalitis virus (JEV) infection neutralizing antibodies are shown to provide protection in a significant proportion of cases, but not all, suggesting additional components of immune system might also contribute to elicit protective immune response. Here we have characterized the role of T cells in offering protection in adult mice infected with JEV. Mice lacking α/β-T cells (TCRβ-null) are highly susceptible and die over 10-18 day period as compared to the wild-type (WT) mice which are resistant. This is associated with high viral load, higher mRNA levels of proinflammatory cytokines and breach in the blood-brain-barrier (BBB). Infected WT mice do not show a breach in BBB; however, in contrast to TCRβ-null, they show the presence of T cells in the brain. Using adoptive transfer of cells with specific genetic deficiencies we see that neither the presence of CD4 T cells nor cytokines such as IL-4, IL-10 or interferon-gamma have any significant role in offering protection from primary infection. In contrast, we show that CD8 T cell deficiency is more critical as absence of CD8 T cells alone increases mortality in mice infected with JEV. Further, transfer of T cells from beige mice with defects in granular lytic function into TCRβ-null mice shows poor protection implicating granule-mediated target cell lysis as an essential component for survival. In addition, for the first time we report that γ/δ-T cells also make significant contribution to confer protection from JEV infection. Our data show that effector CD8 T cells play a protective role during primary infection possibly by preventing the breach in BBB and neuronal damage.

Inbred Strain-Specific Effects of Exercise in Wild Type and Biglycan Deficient Mice

PubMed Central

Wallace, Joseph M.; Golcuk, Kurtulus; Morris, Michael D.; Kohn, David H.

2010-01-01

Biglycan (bgn)-deficient mice (KO) have defective osteoblasts which lead to changes in the amount and quality of bone. Altered tissue strength in C57BL6/129 (B6;129) KO mice, a property which is independent of tissue quantity, suggests that deficiencies in tissue quality are responsible. However, the response to bgn-deficiency is inbred strain-specific. Mechanical loading influences bone matrix quality in addition to any increase in bone mass or change in bone formation activity. Since many diseases influence the mechanical integrity of bone through altered tissue quality, loading may be a way to prevent and treat extracellular matrix deficiencies. C3H/He (C3H) mice consistently have a less vigorous response to mechanical loading vs. other inbred strains. It was therefore hypothesized that the bones from both wild type (WT) and KO B6;129 mice would be more responsive to exercise than the bones from C3H mice. To test these hypotheses at 11 weeks of age, following 21 consecutive days of exercise, we investigated cross-sectional geometry, mechanical properties, and tissue composition in the tibiae of male mice bred on B6;129 and C3H backgrounds. This study demonstrated inbred strain-specific compositional and mechanical changes following exercise in WT and KO mice, and showed evidence of genotype-specific changes in bone in response to loading in a gene disruption model. This study further shows that exercise can influence bone tissue composition and/or mechanical integrity without changes in bone geometry. Together, these data suggest that exercise may represent a possible means to alter tissue quality and mechanical deficiencies caused by many diseases of bone. PMID:20033775

Arterial thrombosis is accelerated in mice deficient in histidine-rich glycoprotein.

PubMed

Vu, Trang T; Zhou, Ji; Leslie, Beverly A; Stafford, Alan R; Fredenburgh, James C; Ni, Ran; Qiao, Shengjun; Vaezzadeh, Nima; Jahnen-Dechent, Willi; Monia, Brett P; Gross, Peter L; Weitz, Jeffrey I

2015-04-23

Factor (F) XII, a key component of the contact system, triggers clotting via the intrinsic pathway, and is implicated in propagating thrombosis. Although nucleic acids are potent activators, it is unclear how the contact system is regulated to prevent uncontrolled clotting. Previously, we showed that histidine-rich glycoprotein (HRG) binds FXIIa and attenuates its capacity to trigger coagulation. To investigate the role of HRG as a regulator of the intrinsic pathway, we compared RNA- and DNA-induced thrombin generation in plasma from HRG-deficient and wild-type mice. Thrombin generation was enhanced in plasma from HRG-deficient mice, and accelerated clotting was restored to normal with HRG reconstitution. Although blood loss after tail tip amputation was similar in HRG-deficient and wild-type mice, carotid artery occlusion after FeCl3 injury was accelerated in HRG-deficient mice, and HRG administration abrogated this effect. To confirm that HRG modulates the contact system, we used DNase, RNase, and antisense oligonucleotides to characterize the FeCl3 model. Whereas DNase or FVII knockdown had no effect, carotid occlusion was abrogated with RNase or FXII knockdown, confirming that FeCl3-induced thrombosis is triggered by RNA in a FXII-dependent fashion. Therefore, in a nucleic acid-driven model, HRG inhibits thrombosis by modulating the intrinsic pathway of coagulation. © 2015 by The American Society of Hematology.

Arterial thrombosis is accelerated in mice deficient in histidine-rich glycoprotein

PubMed Central

Vu, Trang T.; Zhou, Ji; Leslie, Beverly A.; Stafford, Alan R.; Fredenburgh, James C.; Ni, Ran; Qiao, Shengjun; Vaezzadeh, Nima; Jahnen-Dechent, Willi; Monia, Brett P.; Gross, Peter L.; Weitz, Jeffrey I.

2015-01-01

Factor (F) XII, a key component of the contact system, triggers clotting via the intrinsic pathway, and is implicated in propagating thrombosis. Although nucleic acids are potent activators, it is unclear how the contact system is regulated to prevent uncontrolled clotting. Previously, we showed that histidine-rich glycoprotein (HRG) binds FXIIa and attenuates its capacity to trigger coagulation. To investigate the role of HRG as a regulator of the intrinsic pathway, we compared RNA- and DNA-induced thrombin generation in plasma from HRG-deficient and wild-type mice. Thrombin generation was enhanced in plasma from HRG-deficient mice, and accelerated clotting was restored to normal with HRG reconstitution. Although blood loss after tail tip amputation was similar in HRG-deficient and wild-type mice, carotid artery occlusion after FeCl3 injury was accelerated in HRG-deficient mice, and HRG administration abrogated this effect. To confirm that HRG modulates the contact system, we used DNase, RNase, and antisense oligonucleotides to characterize the FeCl3 model. Whereas DNase or FVII knockdown had no effect, carotid occlusion was abrogated with RNase or FXII knockdown, confirming that FeCl3-induced thrombosis is triggered by RNA in a FXII-dependent fashion. Therefore, in a nucleic acid–driven model, HRG inhibits thrombosis by modulating the intrinsic pathway of coagulation. PMID:25691157

Altered small intestinal absorptive enzyme activities in leptin-deficient obese mice: influence of bowel resection.

PubMed

Kiely, James M; Noh, Jae H; Svatek, Carol L; Pitt, Henry A; Swartz-Basile, Deborah A

2006-07-01

Residual bowel increases absorption after massive small bowel resection. Leptin affects intestinal adaptation, carbohydrate, peptide, and lipid handling. Sucrase, peptidase, and acyl coenzyme A:monoacylglycerol acyltransferase (MGAT) are involved in carbohydrate, protein, and lipid absorption. We hypothesized that leptin-deficient obese mice would have altered absorptive enzymes compared with controls before and after small bowel resection. Sucrase, peptidase (aminopeptidase N [ApN], dipeptidyl peptidase IV [DPPIV]), and MGAT activities were determined from lean control (C57BL/6J, n = 16) and leptin-deficient (Lep(ob), n = 16) mice small bowel before and after 50% resection. Ileal sucrase activity was greater in obese mice before and after resection. Jejunal ApN and DPPIV activities were lower for obese mice before resection; ileal ApN activity was unaltered after resection for both strains. Resection increased DPPIV activity in both strains. Jejunal MGAT in obese mice decreased postresection. In both strains, ileal MGAT activity decreased after resection, and obese mice had greater activity in remnant ileum. After small bowel resection, leptin-deficient mice have increased sucrase activity and diminished ileal ApN, DPPIV, and MGAT activity compared with controls. Therefore, we conclude that leptin deficiency alters intestinal enzyme activity in unresected animals and after small bowel resection. Altered handling of carbohydrate, protein, and lipid may contribute to obesity and diabetes in leptin-deficient mice.

Electrochemical impedance spectroscopy based-on interferon-gamma detection

NASA Astrophysics Data System (ADS)

Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung

2014-03-01

Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.

Gab3-deficient mice exhibit normal development and hematopoiesis and are immunocompetent.

PubMed

Seiffert, Martina; Custodio, Joseph M; Wolf, Ingrid; Harkey, Michael; Liu, Yan; Blattman, Joseph N; Greenberg, Philip D; Rohrschneider, Larry R

2003-04-01

Gab proteins are intracellular scaffolding and docking molecules involved in signaling pathways mediated by various growth factor, cytokine, or antigen receptors. Gab3 has been shown to act downstream of the macrophage colony-stimulating factor receptor, c-Fms, and to be important for macrophage differentiation. To analyze the physiological role of Gab3, we used homologous recombination to generate mice deficient in Gab3. Gab3(-/-) mice develop normally, are visually indistinguishable from their wild-type littermates, and are healthy and fertile. To obtain a detailed expression pattern of Gab3, we generated Gab3-specific monoclonal antibodies. Immunoblotting revealed a predominant expression of Gab3 in lymphocytes and bone marrow-derived macrophages. However, detailed analysis demonstrated that hematopoiesis in mice lacking Gab3 is not impaired and that macrophages develop in normal numbers and exhibit normal function. The lack of Gab3 expression during macrophage differentiation is not compensated for by increased levels of Gab1 or Gab2 mRNA. Furthermore, Gab3-deficient mice have no major immune deficiency in T- and B-lymphocyte responses to protein antigens or during viral infection. In addition, allergic responses in Gab3-deficient mice appeared to be normal. Together, these data demonstrate that loss of Gab3 does not result in detectable defects in normal mouse development, hematopoiesis, or immune system function.

Single dose of an adenovirus vectored mouse interferon-α protects mice from lethal EV71 challenge.

PubMed

Sun, Jialei; Ennis, Jane; Turner, Jeffrey D; Chu, Justin Jang Hann

2016-10-01

Enterovirus 71 (EV71) causes hand-foot-and-mouth diseases as well as neurological complications in young children. Interferon (IFN) can inhibit the replication of many viruses with low cytotoxic effects. Previously, an adenovirus vectored mouse interferon-α (DEF201), subtype 5, was generated by Wu et al, 2007. In this study, the antiviral effects of DEF201 against EV71 were evaluated in a murine model. 6-day-old BALB/c mice were administered a single dose of DEF201 before or after infection with lethal dose of EV71. The survival rate, clinical symptoms, tissue viral loads and histology pathogenesis were evaluated. IFN gene expression following a single dose of DEF201 maintained high concentrations of 100-9000 pg/mL for more than 7 days in mice serum. Pre-infection administration of a single dose of 10 6  PFU of DEF201 offered full protection of the mice against EV71 infection compared with the empty Ad5 vector control. In addition, virus load in DEF201-treated mice muscle tissue was significantly decreased as compared with empty vector control. Histopathology analysis revealed that DEF201 significantly prevented the development of severe tissue damage with reduction of viral antigen in the murine muscle tissue. Post-infection treatment at 6 h offered full protection and partial protection at 12 h, indicating that DEF201 could be used as an anti-EV71 therapeutic agent in early stage of EV71 infection. In addition, our study showed that DEF201 enhanced the neutralization ability of serum in EV71-vaccinated mice, implying that DEF201 could promote the production of specific anti-EV71 antibodies. In conclusion, single dose of DEF201 is highly efficacious as a prophylactic agent against EV71 infection in vivo. Copyright © 2016 Elsevier B.V. All rights reserved.

Comparison of antibody and cytokine responses to primary Giardia muris infection in H-2 congenic strains of mice.

PubMed

Venkatesan, P; Finch, R G; Wakelin, D

1996-11-01

The course of primary infections with Giardia muris differs between BALB and B10 H-2 congenic strains of mice. In the first 3 weeks of infection, there is a more rapid decline in intestinal trophozoite and fecal cyst counts in B10 strains than in BALB strains. To determine whether this difference could be explained by variation in specific antibody responses, both secretory immunoglobulin A (IgA) and serum antibody responses were compared between these strains. No significant differences in the timing, titer, or specificity of secretory or serum antibodies were found. However, on comparing specific anti-G. muris serum IgG subclass responses, we found that B10 strains produced IgG2a while BALB strains produced IgG1, suggesting differential involvement of T helper 1 and 2 subsets of lymphocytes. When cells harvested from mesenteric lymph nodes were stimulated with concanavalin A in vitro, both gamma interferon and interleukin-5 were secreted by cells from B10 mice, but only interleukin-5 was secreted by cells from BALB/c mice. Specific blockade of gamma interferon by monoclonal antibody administered to B10 mice resulted in an enhanced intensity of infection.

Local and Systemic Response of Mice to Interferon-α1 -Transfected Friend Leukemia Cells

PubMed Central

Gabriele, Lucia; Kaido, Thomas; Woodrow, David; Moss, Jill; Ferrantini, Maria; Proletti, Enrico; Santodonato, Laura; Rozera, Carmela; Maury, Chantal; Gresser, Ion

1995-01-01

DBA/2 mice were injected subcutaneously with an interferon (IFN)-α/-resistant line of Friend erythroleukemia cells (FLC) transfected with the mouse IFN-α1 gene. These tumor cells produced IFN constitutively, and mice had persistently high levels of IFN in the circulation. We examined the IFN-induced host mechanisms responsible for the local inhibition of growth of these IFN-α-transfected FLC and some of the unusual systemic effects of constant interferonemia such as extramedullary hematopoiesis in the liver, an increase in myeloid cells in the spleen, and persistently elevated splenic natural killer (NK) cell activity. In addition, both DBA/2 +/bg and beige mice developed a rapid and specific resistance to intravenous challenge with parental FLC In previous experiments DBA/2 beige mice could not be protected by exogenous IFN-α/β. The differences in the response of mice to the constitutive production of IFN-α by IFN-α-transfected tumor cells and their response to exogenous IFN is discussed in terms of the effects of IFN on the host and of antitumor therapy. ImagesFigure 2Figure 3Figure 4Figure 5Figure 6 PMID:7639337

Circadian clock-deficient mice as a tool for exploring disease etiology.

PubMed

Doi, Masao

2012-01-01

One of the most significant conceptual changes brought about by the analysis of circadian clock-deficient mice is that abnormalities in the circadian clock are linked not only to sleep arousal disorder but also to a wide variety of common diseases, including hypertension, diabetes, obesity, and cancer. It has recently been shown that the disruption of the two cryptochrome genes Cry1 and Cry2-core elements of the circadian clock-induces salt-dependent hypertension due to abnormally high synthesis of the mineralocorticoid aldosterone by the adrenal gland. This adrenal disorder occurs as a result of increased expression of Hsd3b6, a newly identified steroidogenic enzyme that regulates aldosterone production within the adrenal zona glomerular cells. Importantly, this enzyme is functionally conserved in humans, and the pathophysiologic condition of human idiopathic hyperaldosteronism resembles that of Cry1/2-deficient mice. This review highlights the potential utility of circadian clock-deficient mice as a tool for exploring hitherto unknown disease etiology linked to the circadian clock.

Aggregated Recombinant Human Interferon Beta Induces Antibodies but No Memory in Immune-Tolerant Transgenic Mice

PubMed Central

Sauerborn, Melody; Gilli, Francesca; Brinks, Vera; Schellekens, Huub; Jiskoot, Wim

2010-01-01

ABSTRACT Purpose To study the influence of protein aggregation on the immunogenicity of recombinant human interferon beta (rhIFNβ) in wild-type mice and transgenic, immune-tolerant mice, and to evaluate the induction of immunological memory. Methods RhIFNβ-1b and three rhIFNβ-1a preparations with different aggregate levels were injected intraperitoneally in mice 15× during 3 weeks, and the mice were rechallenged with rhIFNβ-1a. The formation of binding (BABs) and neutralizing antibodies (NABs) was monitored. Results Bulk rhIFNβ-1a contained large, mainly non-covalent aggregates and stressed rhIFNβ-1a mainly covalent, homogeneous (ca. 100 nm) aggregates. Reformulated rhIFNβ-1a was essentially aggregate-free. All products induced BABs and NABs in wild-type mice. Immunogenicity in the transgenic mice was product dependent. RhIFNβ-1b showed the highest and reformulated rhIFNβ-1a the lowest immunogenicity. In contrast with wild-type mice, transgenic mice did not show NABs, nor did they respond to the rechallenge. Conclusions The immunogenicity of the products in transgenic mice, unlike in wild-type mice, varied. In the transgenic mice, neither NABs nor immunological memory developed. The immunogenicity of rhIFNβ in a model reflecting the human immune system depends on the presence and the characteristics of aggregates. PMID:20499141

Genetic Factors Interact With Tobacco Smoke to Modify Risk for Inflammatory Bowel Disease in Humans and Mice.

PubMed

Yadav, Pankaj; Ellinghaus, David; Rémy, Gaëlle; Freitag-Wolf, Sandra; Cesaro, Anabelle; Degenhardt, Frauke; Boucher, Gabrielle; Delacre, Myriam; Peyrin-Biroulet, Laurent; Pichavant, Muriel; Rioux, John D; Gosset, Philippe; Franke, Andre; Schumm, L Philip; Krawczak, Michael; Chamaillard, Mathias; Dempfle, Astrid; Andersen, Vibeke

2017-08-01

for CD vs UC. Exposure of Interleukin 10 (il10)-deficient mice to cigarette smoke accelerated development of colitis and increased expression of interferon gamma in the small intestine compared to wild-type mice exposed to smoke. NOD2-deficient mice exposed to cigarette smoke developed ileitis, characterized by increased expression of interferon gamma, compared to wild-type mice exposed to smoke. In an analysis of 55 Immunochip-wide datasets, we identified 64 SNPs whose association with risk for IBD is modified by tobacco smoking. Gene-smoking interactions were confirmed in mice with disruption of Il10 and Nod2-variants of these genes have been associated with risk for IBD. Our findings from mice and humans revealed that the effects of smoking on risk for IBD depend on genetic variants. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

Neurturin-deficient mice develop dry eye and keratoconjunctivitis sicca.

PubMed

Song, Xiu Jun; Li, De-Quan; Farley, William; Luo, Li Hui; Heuckeroth, Robert O; Milbrandt, Jeffrey; Pflugfelder, Stephen C

2003-10-01

Neurturin has been identified as a neurotrophic factor for parasympathetic neurons. Neurturin-deficient (NRTN(-/-)) mice have defective parasympathetic innervation of their lacrimal glands. This study was conducted to evaluate tear function and ocular surface phenotype in NRTN(-/-) mice. Determined by tail genomic DNA PCR, 25 NRTN(-/-) mice and 17 neurturin-normal (NRTN(+/+)) mice aged 6 weeks to 4 months were evaluated. Aqueous tear production, tear fluorescein clearance and corneal sensation were serially measured. Corneal permeability to AlexaFluor dextran (AFD; Molecular Probes, Eugene, OR) was measured by a fluorometric assay at 485 nm excitation and 530 nm emission. Histology was evaluated in PAS-stained sections. Mucin and HLA class II (IA) antigen were assessed by immunofluorescent staining. Tear IL-1beta was measured by ELISA, and tear matrix metalloproteinase (MMP)-9 by zymography. Gene expression in the corneal epithelia was analyzed by semiquantitative RT-PCR. In comparison to that in age-matched NRTN(+/+) mice, aqueous tear production, tear fluorescein clearance, and corneal sensation were significantly reduced in NRTN(-/-) mice, whereas corneal permeability to AFD was significantly increased. Immunoreactive MUC-4 and -5AC mucin and goblet cell density (P < 0.001) in the conjunctiva of NRTN(-/-) mice were lower than in NRTN(+/+) mice. The expression of MUC-1 and -4 mRNA by the corneal epithelium was reduced in NRTN(-/-) mice. There were a significantly greater number of IA antigen-positive conjunctival epithelial cells in NRTN(-/-) mice than NRTN(+/+) mice. Tear fluid IL-1beta and MMP-9 concentrations and the expression of IL-1beta, TNF-alpha, macrophage inflammatory protein (MIP)-2, cytokine-induced neutrophil chemoattractant (KC), and MMP-9 mRNA by the corneal epithelia were significantly increased in NRTN(-/-) mice, compared with NRTN(+/+) mice. Neurturin-deficient mice show phenotypic changes and ocular surface inflammation that mimic human

Absence of Fc epsilonRI alpha chain results in upregulation of Fc gammaRIII-dependent mast cell degranulation and anaphylaxis. Evidence of competition between Fc epsilonRI and Fc gammaRIII for limiting amounts of FcR beta and gamma chains.

PubMed Central

Dombrowicz, D; Flamand, V; Miyajima, I; Ravetch, J V; Galli, S J; Kinet, J P

1997-01-01

In mouse mast cells, both Fc epsilonRI and Fc gammaRIII are alpha beta gamma2 tetrameric complexes in which different alpha chains confer IgE or IgG ligand recognition while the signaling FcR beta and gamma chains are identical. We used primarily noninvasive techniques (changes in body temperature, dye extravasation) to assess systemic anaphylactic responses in nonanesthetized wild-type, Fc epsilonRI alpha chain -/- and FcR gamma chain -/- mice. We confirm that systemic anaphylaxis in mice can be mediated largely through IgG1 and Fc gammaRIII and we provide direct evidence that these responses reflect activation of Fc gammaRIII rather than Fc gammaRI. Furthermore, we show that Fc gammaRIII-dependent responses are more intense in normal than in congenic mast cell-deficient KitW/KitW-v mice, indicating that Fc gammaRIII responses have mast cell-dependent and -independent components. Finally, we demonstrate that the upregulation of cell surface expression of Fc gammaRIII seen in Fc epsilonRI alpha chain -/- mice corresponds to an increased association of Fc gammaRIII alpha chains with FcR beta and gamma chains and is associated with enhanced Fc gammaRIII-dependent mast cell degranulation and systemic anaphylactic responses. Therefore, the phenotype of the Fc epsilonRI alpha chain -/- mice suggests that expression of Fc epsilonRI and Fc gammaRIII is limited by availability of the FcR beta and gamma chains and that, in normal mice, changes in the expression of one receptor (Fc epsilonRI) may influence the expression of functional responses dependent on the other (Fc gammaRIII). PMID:9062349

Circadian rhythms and food anticipatory behavior in Wfs1-deficient mice.

PubMed

Luuk, Hendrik; Fahrenkrug, Jan; Hannibal, Jens

2012-08-10

The dorsomedial hypothalamic nucleus (DMH) has been proposed as a candidate for the neural substrate of a food-entrainable oscillator. The existence of a food-entrainable oscillator in the mammalian nervous system was inferred previously from restricted feeding-induced behavioral rhythmicity in rodents with suprachiasmatic nucleus lesions. In the present study, we have characterized the circadian rhythmicity of behavior in Wfs1-deficient mice during ad libitum and restricted feeding. Based on the expression of Wfs1 protein in the DMH it was hypothesized that Wfs1-deficient mice will display reduced or otherwise altered food anticipatory activity. Wfs1 immunoreactivity in DMH was found almost exclusively in the compact part. Restricted feeding induced c-Fos immunoreactivity primarily in the ventral and lateral aspects of DMH and it was similar in both genotypes. Wfs1-deficiency resulted in significantly lower body weight and reduced wheel-running activity. Circadian rhythmicity of behavior was normal in Wfs1-deficient mice under ad libitum feeding apart from elongated free-running period in constant light. The amount of food anticipatory activity induced by restricted feeding was not significantly different between the genotypes. Present results indicate that the effects of Wfs1-deficiency on behavioral rhythmicity are subtle suggesting that Wfs1 is not a major player in the neural networks responsible for circadian rhythmicity of behavior. Copyright © 2012 Elsevier Inc. All rights reserved.

Interaction between total body gamma-irradiation and choline deficiency triggers immediate modulation of choline and choline-containing moieties.

PubMed

Batra, Vipen; Kislay, Binita; Devasagayam, Thomas Paul Asir

2011-12-01

The objective of this study was to examine the effect of 60Co-gamma (γ) radiation on acute phase modulation, if any, of choline and choline-containing moieties in choline-deficient subjects. Corresponding results could provide information that might be useful in the management of adverse effects of γ-radiation. Male Swiss mice maintained on a choline-sufficient diet (CSD) and choline-free diet (CFD) based on AIN-93M formula, were subjected to whole body γ-irradiation (2-6 Gy). Liver, serum and brain samples from each group were then tested for: (i) Alterations in choline and choline-containing moieties such as phosphatidylcholine (PC) and sphingomyeline (SM); and (ii) modulation of choline profile modulating enzymes such as phospholipase D (PLD) and total sphingomyelinase (t-SMase). Liver and brain samples were also subjected to histo-pathological examinations. No significant changes were observed in folate, choline, choline-containing moieties and choline-modulating enzymes in choline-sufficient mice. In contrast, interaction between cytotoxic effects of γ-radiation and choline deficiency modulated choline and choline-containing moieties. Feeding CFD reduced hepatic concentrations of choline, PC and SM whereas PLD and t-SMase activities were significantly raised. The decrease in liver choline and choline-containing moieties was accompanied by an increase in blood choline concentration. Despite choline deficiency, the level of choline and acetylcholine synthesizing enzyme choline acetyltransfease (ChAT) significantly increased in the brain. We propose that choline deprivation and γ-radiation interact to modulate choline reserves of hepatic tissue, which might release choline to blood. Our studies also clearly showed that interaction between choline deficiency and γ-radiation might substantially enhance liver adipogenesis.

Slitrk1-deficient mice display elevated anxiety-like behavior and noradrenergic abnormalities.

PubMed

Katayama, K; Yamada, K; Ornthanalai, V G; Inoue, T; Ota, M; Murphy, N P; Aruga, J

2010-02-01

Mutations in SLITRK1 are found in patients with Tourette's syndrome and trichotillomania. SLITRK1 encodes a transmembrane protein containing leucine-rich repeats that is produced predominantly in the nervous system. However, the role of this protein is largely unknown, except that it can modulate neurite outgrowth in vitro. To clarify the role of Slitrk1 in vivo, we developed Slitrk1-knockout mice and analyzed their behavioral and neurochemical phenotypes. Slitrk1-deficient mice exhibited elevated anxiety-like behavior in the elevated plus-maze test as well as increased immobility time in forced swimming and tail suspension tests. Neurochemical analysis revealed that Slitrk1-knockout mice had increased levels of norepinephrine and its metabolite 3-methoxy-4-hydroxyphenylglycol. Administration of clonidine, an alpha2-adrenergic agonist that is frequently used to treat patients with Tourette's syndrome, attenuated the anxiety-like behavior of Slitrk1-deficient mice in the elevated plus-maze test. These results lead us to conclude that noradrenergic mechanisms are involved in the behavioral abnormalities of Slitrk1-deficient mice. Elevated anxiety due to Slitrk1 dysfunction may contribute to the pathogenesis of neuropsychiatric diseases such as Tourette's syndrome and trichotillomania.

Widespread bronchogenic dissemination makes DBA/2 mice more susceptible than C57BL/6 mice to experimental aerosol infection with Mycobacterium tuberculosis.

PubMed

Cardona, Pere-Joan; Gordillo, Sergi; Díaz, Jorge; Tapia, Gustavo; Amat, Isabel; Pallarés, Angeles; Vilaplana, Cristina; Ariza, Aurelio; Ausina, Vicenç

2003-10-01

We have used the murine model of aerosol-induced experimental tuberculosis to assess the effects of four clinical isolates and a reference strain of Mycobacterium tuberculosis on resistant C57BL/6 mice and susceptible DBA/2 mice. Histological studies and detection of 25 cytokines potentially involved in the infection were carried out. DBA/2 mice showed higher concentrations of bacilli in bronchoalveolar lavage fluid and lung tissue. Furthermore, these mice evidenced a larger granulomatous infiltration in the parenchyma due to an increased rate of emigration of infected foamy macrophages from the granulomas to the neighboring pulmonary alveolar spaces. The better control of bacillary concentrations and pulmonary infiltration observed in C57BL/6 mice from week 3 postinfection could result from their higher RANTES, ICAM-1, and gamma interferon (IFN-gamma) mRNA levels. On the other hand, the higher MIP-2 and MCP-3 mRNA levels seen in DBA/2 mice would result in stronger lung recruitment of macrophages and neutrophils. Additionally, DBA/2 mice showed increased inducible nitric oxide synthase expression, induced by the larger number of foamy macrophages, at weeks 18 and 22. This increment was a consequence of phagocytosed bacillary debris, was independent of IFN-gamma expression, and could exert only a bacteriostatic effect. The results of the study suggest that DBA/2 mice are more susceptible than C57BL/6 mice to M. tuberculosis infection due to a higher bronchial dissemination of bacilli inside poorly activated foamy macrophages.

Plasminogen activation independent of uPA and tPA maintains wound healing in gene-deficient mice

PubMed Central

Lund, Leif R; Green, Kirsty A; Stoop, Allart A; Ploug, Michael; Almholt, Kasper; Lilla, Jennifer; Nielsen, Boye S; Christensen, Ib J; Craik, Charles S; Werb, Zena; Danø, Keld; Rømer, John

2006-01-01

Simultaneous ablation of the two known activators of plasminogen (Plg), urokinase-type (uPA) and the tissue-type (tPA), results in a substantial delay in skin wound healing. However, wound closure and epidermal re-epithelialization are significantly less impaired in uPA;tPA double-deficient mice than in Plg-deficient mice. Skin wounds in uPA;tPA-deficient mice treated with the broad-spectrum matrix metalloproteinase (MMP) inhibitor galardin (N-[(2R)-2-(hydroxamido-carbonylmethyl)-4-methylpentanoyl]-L-tryptophan methylamide) eventually heal, whereas skin wounds in galardin-treated Plg-deficient mice do not heal. Furthermore, plasmin is biochemically detectable in wound extracts from uPA;tPA double-deficient mice. In vivo administration of a plasma kallikrein (pKal)-selective form of the serine protease inhibitor ecotin exacerbates the healing impairment of uPA;tPA double-deficient wounds to a degree indistinguishable from that observed in Plg-deficient mice, and completely blocks the activity of pKal, but not uPA and tPA in wound extracts. These findings demonstrate that an additional plasminogen activator provides sufficient plasmin activity to sustain the healing process albeit at decreased speed in the absence of uPA, tPA and galardin-sensitive MMPs and suggest that pKal plays a role in plasmin generation. PMID:16763560

Enhanced antitumor reactivity of tumor-sensitized T cells by interferon alfa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vander Woude, D.L.; Wagner, P.D.; Shu, S.

Tumor-draining lymph node cells from mice bearing the methylcholanthrene-induced MCA 106 tumors can be sensitized in vitro to acquire antitumor reactivity. We examined the effect of interferon alfa on the function of cells that underwent in vitro sensitization in adoptive immunotherapy. Interferon alfa increased the antitumor reactivity of in vitro sensitized cells in the treatment of MCA 106 pulmonary metastases. This effect was evident in irradiated mice, indicating that a host response to the interferon alfa was not required. Interferon alfa treatment increased class I major histocompatibility complex antigen expression on tumor cells and increased their susceptibility to lysis bymore » in vitro sensitized cells. These results suggest that interferon alfa enhancement of adoptive immunotherapy was mediated by its effect on tumor cells. Interferon alfa may be a useful adjunct to the adoptive immunotherapy of human cancer.« less

Plasmalogen modulation attenuates atherosclerosis in ApoE- and ApoE/GPx1-deficient mice.

PubMed

Rasmiena, Aliki A; Barlow, Christopher K; Stefanovic, Nada; Huynh, Kevin; Tan, Ricardo; Sharma, Arpeeta; Tull, Dedreia; de Haan, Judy B; Meikle, Peter J

2015-12-01

We previously reported a negative association of circulating plasmalogens (phospholipids with proposed atheroprotective properties) with coronary artery disease. Plasmalogen modulation was previously demonstrated in animals but its effect on atherosclerosis was unknown. We assessed the effect of plasmalogen enrichment on atherosclerosis of murine models with differing levels of oxidative stress. Six-week old ApoE- and ApoE/glutathione peroxidase-1 (GPx1)-deficient mice were fed a high-fat diet with/without 2% batyl alcohol (precursor to plasmalogen synthesis) for 12 weeks. Mass spectrometry analysis of lipids showed that batyl alcohol supplementation to ApoE- and ApoE/GPx1-deficient mice increased the total plasmalogen levels in both plasma and heart. Oxidation of plasmalogen in the treated mice was evident from increased level of plasmalogen oxidative by-product, sn-2 lysophospholipids. Atherosclerotic plaque in the aorta was reduced by 70% (P = 5.69E-07) and 69% (P = 2.00E-04) in treated ApoE- and ApoE/GPx1-deficient mice, respectively. A 40% reduction in plaque (P = 7.74E-03) was also seen in the aortic sinus of only the treated ApoE/GPx1-deficient mice. Only the treated ApoE/GPx1-deficient mice showed a decrease in VCAM-1 staining (-28%, P = 2.43E-02) in the aortic sinus and nitrotyrosine staining (-78%, P = 5.11E-06) in the aorta. Plasmalogen enrichment via batyl alcohol supplementation attenuated atherosclerosis in ApoE- and ApoE/GPx1-deficient mice, with a greater effect in the latter group. Plasmalogen enrichment may represent a viable therapeutic strategy to prevent atherosclerosis and reduce cardiovascular disease risk, particularly under conditions of elevated oxidative stress and inflammation. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

MCPIP1 Deficiency in Mice Results in Severe Anemia Related to Autoimmune Mechanisms

PubMed Central

Zhou, Zhou; Miao, Ruidong; Huang, Shengping; Elder, Brandon; Quinn, Tim; Papasian, Christopher J.; Zhang, Jifeng; Fan, Daping; Chen, Y. Eugene; Fu, Mingui

2013-01-01

Autoimmune gastritis is an organ-specific autoimmune disease of the stomach associated with pernicious anemia. The previous work from us and other groups identified MCPIP1 as an essential factor controlling inflammation and immune homeostasis. MCPIP1-/- developed severe anemia. However, the mechanisms underlying this phenotype remain unclear. In the present study, we found that MCPIP1 deficiency in mice resulted in severe anemia related to autoimmune mechanisms. Although MCPIP1 deficiency did not affect erythropoiesis per se, the erythropoiesis in MCPIP1-/- bone marrow erythroblasts was significantly attenuated due to iron and vitamin B12 (VB12) deficiency, which was mainly resulted from autoimmunity-associated gastritis and parietal cell loss. Consistently, exogenous supplement of iron and VB12 greatly improved the anemia phenotype of MCPIP1-/- mice. Finally, we have evidence suggesting that autoimmune hemolysis may also contribute to anemia phenotype of MCPIP1-/- mice. Taken together, our study suggests that MCPIP1 deficiency in mice leads to the development of autoimmune gastritis and pernicious anemia. Thus, MCPIP1-/- mice may be a good mouse model for investigating the pathogenesis of pernicious anemia and testing the efficacy of some potential drugs for treatment of this disease. PMID:24324805

Effects of zinc deficiency and supplementation on leptin and leptin receptor expression in pregnant mice.

PubMed

Ueda, Hidenori; Nakai, Taketo; Konishi, Tatsuya; Tanaka, Keiichi; Sakazaki, Fumitoshi; Min, Kyong-Son

2014-01-01

Leptin is an adipose-derived hormone that primarily regulates energy balance in response to nutrition. Human placental cells produce leptin, whereas murine placental cells produce soluble leptin receptors (Ob-R). However, the roles of these proteins during pregnancy have not been elucidated completely. As an essential metal, zinc (Zn) is central to insulin biosynthesis and energy metabolism. In the present study, the effects of Zn deficiency and supplementation on maternal plasma leptin and soluble Ob-R regulation in pregnant mice placentas were examined using enzyme-linked immunosorbent assay, reverse transcription-polymerase chain reaction, and Western blotting. Nutritional Zn deficiency significantly reduced plasma insulin concentrations and fetal and placental weights in pregnant mice. Plasma leptin concentrations in pregnant mice also increased 20- to 40-fold compared with those in non-pregnant mice. Although dietary Zn deficiency and supplementation did not affect plasma leptin concentrations in non-pregnant mice, Zn-deficient pregnant mice had significantly reduced plasma leptin concentrations and adipose leptin mRNA expression. In contrast, Zn-supplemented pregnant mice had increased plasma leptin concentrations without increased adipose leptin mRNA expression. Placental soluble Ob-R mRNA expression also decreased in Zn-deficient mice and tended to increase in Zn-supplemented mice. These results indicate that Zn influences plasma leptin concentrations by modulating mRNA expression of soluble Ob-R in the placenta, and leptin in visceral fat during pregnancy. These data suggest that both adipose and placenta-derived leptin system are involved in the regulation of energy metabolism during fetal growth.

Critical roles of myeloid differentiation factor 88-dependent proinflammatory cytokine release in early phase clearance of Listeria monocytogenes in mice.

PubMed

Seki, Ekihiro; Tsutsui, Hiroko; Tsuji, Noriko M; Hayashi, Nobuki; Adachi, Keishi; Nakano, Hiroki; Futatsugi-Yumikura, Shizue; Takeuchi, Osamu; Hoshino, Katsuaki; Akira, Shizuo; Fujimoto, Jiro; Nakanishi, Kenji

2002-10-01

Listeria monocytogenes (LM), a facultative intracellular Gram-positive bacterium, often causes lethal infection of the host. In this study we investigated the molecular mechanism underlying LM eradication in the early phase of infection. Upon infection with LM, both IL-12 and IL-18 were produced, and then they synergistically induced IFN-gamma production, leading to normal LM clearance in the host. IFN-gamma knockout (KO) mice were highly susceptible to LM infection. IL-12/IL-18 double knockout mice were also highly susceptible. Their susceptibility was less than that of IFN-gamma KO mice, but more than that of single IL-12 or IL-18 KO mice. Mice deficient in myeloid differentiation factor 88 (MyD88), an essential adaptor molecule used by signal transduction pathways of all members of the Toll-like receptor (TLR) family, showed an inability to produce IL-12 and IFN-gamma following LM infection and were most susceptible to LM. Furthermore, MyD88-deficient, but not IFN-gamma-deficient, Kupffer cells could not produce TNF-alpha in response to LM in vitro, indicating the importance of MyD88-dependent TNF-alpha production for host defense. As TLR2 KO, but not TLR4 KO, mice showed partial impairment in their capacity to produce IL-12, IFN-gamma, and TNF-alpha, TLR2 activation partly contributed to the induction of IL-12-mediated IFN-gamma production. These results indicated a critical role for TLRs/MyD88-dependent IL-12/TNF-alpha production and for IL-12- and IL-18-mediated IFN-gamma production in early phase clearance of LM.

Heterogeneity within populations of recombinant Chinese hamster ovary cells expressing human interferon-gamma.

PubMed

Coppen, S R; Newsam, R; Bull, A T; Baines, A J

1995-04-20

The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.

Interferon gamma peptidomimetic targeted to hepatic stellate cells ameliorates acute and chronic liver fibrosis in vivo.

PubMed

Bansal, Ruchi; Prakash, Jai; De Ruiter, Marieke; Poelstra, Klaas

2014-04-10

Hepatic stellate cells play a crucial role in the pathogenesis of hepatic fibrosis. Thus, pharmacological inhibition of pro-fibrotic activities of these cells might lead to an effective therapy for this disease. Among the potent anti-fibrotics, interferon gamma (IFNγ), a proinflammatory cytokine, is highly efficacious but it failed in clinical trials due to the poor efficacy and multiple adverse effects attributed to the ubiquitous IFNγ receptor (IFNγR) expression. To resolve these drawbacks, we chemically synthesized a chimeric molecule containing (a) IFNγ signaling peptide (IFNγ peptidomimetic, mimγ) that retains the agonistic activities of IFNγ but lacks an extracellular receptor recognition sequence for IFNγR; coupled via heterobifunctional PEG linker to (b) bicyclic platelet derived growth factor beta receptor (PDGFβR)-binding peptide (BiPPB) to induce internalization into the stellate cells that express PDGFβR. The synthesized targeted IFNγ peptidomimetic (mimγ-BiPPB) was extensively investigated for its anti-fibrotic and adverse effects in acute and chronic CCl4-induced liver fibrosis models in mice. Treatment with mimγ-BiPPB, after the onset of disease, markedly inhibited both early and established hepatic fibrosis as reflected by a reduced intrahepatic α-SMA, desmin and collagen-I mRNA expression and protein levels. While untargeted mimγ and BiPPB had no effect, and native IFNγ only induced a moderate reduction. Additionally, no off-target effects, e.g. systemic inflammation, were found with mimγ-BiPPB, which were substantially observed in mice treated with native IFNγ. The present study highlights the beneficial effects of a novel BiPPB mediated cell-specific targeting of IFNγ peptidomimetic to the disease-inducing cells and therefore represents a highly potential therapeutic approach to treat fibrotic diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

Deficiency of Gpr1 improves steroid hormone abnormality in hyperandrogenized mice.

PubMed

Yang, Ya-Li; Sun, Li-Feng; Yu, Yan; Xiao, Tian-Xia; Wang, Bao-Bei; Ren, Pei-Gen; Tang, Hui-Ru; Zhang, Jian V

2018-05-24

Polycystic ovary syndrome (PCOS) is a complex genetic disease with multifarious phenotypes. Many researches use dehydroepiandrosterone (DHEA) to induce PCOS in pubertal mouse models. The aim of this study was to investigate the role of GPR1 in dehydroepiandrosterone (DHEA)-induced hyperandrogenized mice. Prepubertal C57BL/6 mice (25 days of age) and Gpr1-deficient mice were each divided into two groups and injected daily with sesame oil with or without DHEA (6 mg/100 g) for 21 consecutive days. Hematoxylin and eosin (H&E) staining was performed to determine the characteristics of the DHEA-treated ovaries. Real-time PCR was used to examine steroid synthesis enzymes gene expression. Granulosa cell was cultured to explore the mechanism of DHEA-induced, GPR1-mediated estradiol secretion. DHEA treatment induced some aspects of PCOS in wild-type mice, such as increased body weight, elevated serum testosterone, increased number of small, cystic, atretic follicles, and absence of corpus luteum in ovaries. However, Gpr1 deficiency significantly attenuated the DHEA-induced weight gain and ovarian phenotype, improving steroidogenesis in ovaries and estradiol synthesis in cultured granulosa cells, partially through mTOR signaling. In conclusion, Gpr1 deficiency leads to the improvement of steroid synthesis in mice hyperandrogenized with DHEA, indicating that GPR1 may be a therapeutic target for DHEA-induced hyperandrogenism.

Tpl2 kinase regulates T cell interferon-γ production and host resistance to Toxoplasma gondii

PubMed Central

Watford, Wendy T.; Hissong, Bruce D.; Durant, Lydia R.; Yamane, Hidehiro; Muul, Linda M.; Kanno, Yuka; Tato, Cristina M.; Ramos, Haydeé L.; Berger, Alan E.; Mielke, Lisa; Pesu, Marko; Solomon, Benjamin; Frucht, David M.; Paul, William E.; Sher, Alan; Jankovic, Dragana; Tsichlis, Philip N.; O'Shea, John J.

2008-01-01

Tpl2 (Tumor progression locus 2), also known as Cot/MAP3K8, is a hematopoietically expressed serine-threonine kinase. Tpl2 is known to have critical functions in innate immunity in regulating tumor necrosis factor–α, Toll-like receptor, and G protein–coupled receptor signaling; however, our understanding of its physiological role in T cells is limited. We investigated the potential roles of Tpl2 in T cells and found that it was induced by interleukin-12 in human and mouse T cells in a Stat4-dependent manner. Deficiency of Tpl2 was associated with impaired interferon (IFN)-γ production. Accordingly, Tpl2−/− mice had impaired host defense against Toxoplasma gondii with reduced parasite clearance and decreased IFN-γ production. Furthermore, reconstitution of Rag2−/− mice with Tpl2-deficient T cells followed by T. gondii infection recapitulated the IFN-γ defect seen in the Tpl2-deficient mice, confirming a T cell–intrinsic defect. CD4+ T cells isolated from Tpl2−/− mice showed poor induction of T-bet and failure to up-regulate Stat4 protein, which is associated with impaired TCR-dependent extracellular signal-regulated kinase activation. These data underscore the role of Tpl2 as a regulator of T helper cell lineage decisions and demonstrate that Tpl2 has an important functional role in the regulation of Th1 responses. PMID:19001140

Comprehensive Behavioral Analysis of Activating Transcription Factor 5-Deficient Mice

PubMed Central

Umemura, Mariko; Ogura, Tae; Matsuzaki, Ayako; Nakano, Haruo; Takao, Keizo; Miyakawa, Tsuyoshi; Takahashi, Yuji

2017-01-01

Activating transcription factor 5 (ATF5) is a member of the CREB/ATF family of basic leucine zipper transcription factors. We previously reported that ATF5-deficient (ATF5-/-) mice demonstrated abnormal olfactory bulb development due to impaired interneuron supply. Furthermore, ATF5-/- mice were less aggressive than ATF5+/+ mice. Although ATF5 is widely expressed in the brain, and involved in the regulation of proliferation and development of neurons, the physiological role of ATF5 in the higher brain remains unknown. Our objective was to investigate the physiological role of ATF5 in the higher brain. We performed a comprehensive behavioral analysis using ATF5-/- mice and wild type littermates. ATF5-/- mice exhibited abnormal locomotor activity in the open field test. They also exhibited abnormal anxiety-like behavior in the light/dark transition test and open field test. Furthermore, ATF5-/- mice displayed reduced social interaction in the Crawley’s social interaction test and increased pain sensitivity in the hot plate test compared with wild type. Finally, behavioral flexibility was reduced in the T-maze test in ATF5-/- mice compared with wild type. In addition, we demonstrated that ATF5-/- mice display disturbances of monoamine neurotransmitter levels in several brain regions. These results indicate that ATF5 deficiency elicits abnormal behaviors and the disturbance of monoamine neurotransmitter levels in the brain. The behavioral abnormalities of ATF5-/- mice may be due to the disturbance of monoamine levels. Taken together, these findings suggest that ATF5-/- mice may be a unique animal model of some psychiatric disorders. PMID:28744205

CCL20, (gamma)(delta) T cells, and IL-22 in corneal epithelial healing

USDA-ARS?s Scientific Manuscript database

After corneal epithelial abrasion, leukocytes and platelets rapidly enter the corneal stroma, and CCR6 (+) IL-17(+) gamma delta T cells migrate into the epithelium. Gamma delta T-cell-deficient (TCRd(-/-)) mice have significantly reduced inflammation and epithelial wound healing. Epithelial CCL20 mR...

Structural analysis and localization of the carbohydrate moieties of a soluble human interferon gamma receptor produced in baculovirus-infected insect cells.

PubMed Central

Manneberg, M.; Friedlein, A.; Kurth, H.; Lahm, H. W.; Fountoulakis, M.

1994-01-01

A soluble form of the human interferon gamma receptor that is required for the identification of interferon gamma antagonists was expressed in baculovirus-infected insect cells. The protein carried N-linked carbohydrate and showed a heterogeneity on denaturing polyacrylamide gels. We investigated the utilization of the potential sites for N-linked glycosylation and the structure of the carbohydrate moieties of this soluble receptor. Amino acid sequence analysis and ion spray mass spectrometry revealed that of the five potential sites for N-linked glycosylation, Asn17 and Asn69 were always utilized, whereas Asn62 and Asn162 were utilized in approximately one-third of the protein population. Asn223 was never found to be glycosylated. The soluble receptor was treated with N-glycosidase F and the oligosaccharides released were analyzed by matrix-assisted laser desorption mass spectrometry, which showed that the protein carried six types of short carbohydrate chains. The predominant species was a hexasaccharide of molecular mass 1,039, containing a fucose subunit linked to the proximal N-acetylglucosamine residue: [formula: see text] PMID:8142896

Multiple host defense defects in failure of C57BL/6 ep/ep (pale ear) mice to resolve visceral Leishmania donovani infection.

PubMed Central

Murray, H W; Hariprashad, J; McDermott, D F; Stoeckle, M Y

1996-01-01

Euthymic C57BL/L ep/ep (pale ear [PE]) mice halt the visceral replication of intracellular Leishmania donovani but fail to properly resolve infection. A previous study identified an isolated defect in tissue granuloma formation in these mice; CD4+ and CD8+ cell number, gamma interferon (IFN-gamma) production, and macrophage antimicrobial activity in vitro were all intact. New in vivo results reported here suggest a considerably more complex immune defect, with evidence indicating (i) enhanced control over L. donovani after transfer of normal C57BL/6 spleen cells, (ii) a partially suppressive Th2 cell-associated response mediated by interleukin-4 (IL-4) but not reversed by CD4+ cell depletion, (iii) absent responses to endogenous Th1 cell lymphokines (IFN-gamma and IL-2) but preserved responsiveness to endogenous tumor necrosis factor alpha, (iv) absent responses to exogenous treatment with recognized antileishmanial cytokines (IFN-gamma, IL-2, IL-12, and granulocyte-macrophage colony-stimulating factor [GM-CSF]) not corrected by transfer of C57BL/6 spleen cells, and (v) a deficient response to antimony chemotherapy. Defective hepatic granuloma formation was not corrected by transfer of C57BL/6 spleen cells or by anti-IL-4 administration. While treatment with IL-2 and GM-CSF modified the tissue reaction and induced selected effector cells to encase tissue macrophages, no antileishmanial activity resulted. Together, these observations suggest that the failure of PE mice to resolve visceral L. donovani infection likely represents expression of multiple suboptimal immune responses and/or partial defects, probably involving a combination of T-cell dysfunction, a Th2 cell response, and target cell (macrophage) hyporesponsiveness. PMID:8557335

Type I Interferon Controls Propagation of Long Interspersed Element-1*

PubMed Central

Yu, Qiujing; Carbone, Christopher J.; Katlinskaya, Yuliya V.; Zheng, Hui; Zheng, Ke; Luo, Mengcheng; Wang, P. Jeremy; Greenberg, Roger A.; Fuchs, Serge Y.

2015-01-01

Type I interferons (IFN) including IFNα and IFNβ are critical for the cellular defense against viruses. Here we report that increased levels of IFNβ were found in testes from mice deficient in MOV10L1, a germ cell-specific RNA helicase that plays a key role in limiting the propagation of retrotransposons including Long Interspersed Element-1 (LINE-1). Additional experiments revealed that activation of LINE-1 retrotransposons increases the expression of IFNβ and of IFN-stimulated genes. Conversely, pretreatment of cells with IFN suppressed the replication of LINE-1. Furthermore, the efficacy of LINE-1 replication was increased in isogenic cell lines harboring inactivating mutations in diverse elements of the IFN signaling pathway. Knockdown of the IFN receptor chain IFNAR1 also stimulated LINE-1 propagation in vitro. Finally, a greater accumulation of LINE-1 was found in mice that lack IFNAR1 compared with wild type mice. We propose that LINE-1-induced IFN plays an important role in restricting LINE-1 propagation and discuss the putative role of IFN in preserving the genome stability. PMID:25716322

Resistance of chemokine receptor 6-deficient mice to Yersinia enterocolitica infection: evidence of defective M-cell formation in vivo.

PubMed

Westphal, Sabine; Lügering, Andreas; von Wedel, Julia; von Eiff, Christof; Maaser, Christian; Spahn, Thomas; Heusipp, Gerhard; Schmidt, M Alexander; Herbst, Hermann; Williams, Ifor R; Domschke, Wolfram; Kucharzik, Torsten

2008-03-01

M cells, specialized cells within Peyer's patches (PPs), are reduced in number in chemokine receptor 6 (CCR6)-deficient mice. The pathogenic microorganism Yersinia enterocolitica exploits M cells for the purpose of mucosal tissue invasion exclusively through PPs. The aim of this study was to evaluate the course of yersiniosis in CCR6-deficient mice and to investigate whether these mice might be used as an in vivo model to determine M-cell function. After oral challenge with Y. enterocolitica, control mice suffered from lethal septic infection whereas CCR6-deficient mice showed very limited symptoms of infection. Immunohistochemical analysis demonstrated PP invasion by Y. enterocolitica in control mice whereas no bacteria could be found in CCR6-deficient mice. In addition, a significant induction of proinflammatory cytokines could be found in control mice whereas proinflammatory cytokine levels in CCR6-deficient mice remained unchanged. In contrast, intraperitoneal infection resulted in severe systemic yersiniosis in both mouse groups. Abrogated oral Y. enterocolitica infection in CCR6-deficient mice demonstrates the importance of CCR6 expression in the physiological and pathological immune responses generated within PPs by influencing M-cell differentiation, underscoring the important role of M cells in the process of microbial uptake. CCR6-deficient mice may therefore represent a suitable model for the study of M-cell function in vivo.

Myeloid mineralocorticoid receptor deficiency inhibits aortic constriction-induced cardiac hypertrophy in mice.

PubMed

Li, Chao; Zhang, Yu Yao; Frieler, Ryan A; Zheng, Xiao Jun; Zhang, Wu Chang; Sun, Xue Nan; Yang, Qing Zhen; Ma, Shu Min; Huang, Baozhuan; Berger, Stefan; Wang, Wang; Wu, Yong; Yu, Ying; Duan, Sheng Zhong; Mortensen, Richard M

2014-01-01

Mineralocorticoid receptor (MR) blockade has been shown to suppress cardiac hypertrophy and remodeling in animal models of pressure overload (POL). This study aims to determine whether MR deficiency in myeloid cells modulates aortic constriction-induced cardiovascular injuries. Myeloid MR knockout (MMRKO) mice and littermate control mice were subjected to abdominal aortic constriction (AAC) or sham operation. We found that AAC-induced cardiac hypertrophy and fibrosis were significantly attenuated in MMRKO mice. Expression of genes important in generating reactive oxygen species was decreased in MMRKO mice, while that of manganese superoxide dismutase increased. Furthermore, expression of genes important in cardiac metabolism was increased in MMRKO hearts. Macrophage infiltration in the heart was inhibited and expression of inflammatory genes was decreased in MMRKO mice. In addition, aortic fibrosis and inflammation were attenuated in MMRKO mice. Taken together, our data indicated that MR deficiency in myeloid cells effectively attenuated aortic constriction-induced cardiac hypertrophy and fibrosis, as well as aortic fibrosis and inflammation.

Cell type-specific deficiency of c-kit gene expression in mutant mice of mi/mi genotype.

PubMed Central

Isozaki, K.; Tsujimura, T.; Nomura, S.; Morii, E.; Koshimizu, U.; Nishimune, Y.; Kitamura, Y.

1994-01-01

The mi locus of mice encodes a novel member of the basic-helix-loop-helix-leucine zipper protein family of transcription factors (hereafter called mi factor). In addition to microphthalmus, osteopetrosis, and lack of melanocytes, mice of mi/mi genotype are deficient in mast cells. Since the c-kit receptor tyrosine kinase plays an important role in the development of mast cells, and since the c-kit expression by cultured mast cells from mi/mi mice is deficient in both mRNA and protein levels, the mast cell deficiency of mi/mi mice has been attributed at least in part to the deficient expression of c-kit. However, it remained to be examined whether the c-kit expression was also deficient in tissues of mi/mi mice. In the present study, we examined the c-kit expression by mi/mi skin mast cells using in situ hybridization and immunohistochemistry. Moreover, we examined the c-kit expression by various cells other than mast cells in tissues of mi/mi mice. We found that the c-kit expression was deficient in mast cells but not in erythroid precursors, testicular germ cells, and neurons of mi/mi mice. This suggested that the regulation of the c-kit transcription by the mi factor was dependent on cell types. Mice of mi/mi genotype appeared to be a useful model to analyze the function of transcription factors in the whole-animal level. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:7524330

Gene Expression in Parp1 Deficient Mice Exposed to a Median Lethal Dose of Gamma Rays.

PubMed

Kumar, M A Suresh; Laiakis, Evagelia C; Ghandhi, Shanaz A; Morton, Shad R; Fornace, Albert J; Amundson, Sally A

2018-05-10

There is a current interest in the development of biodosimetric methods for rapidly assessing radiation exposure in the wake of a large-scale radiological event. This work was initially focused on determining the exposure dose to an individual using biological indicators. Gene expression signatures show promise for biodosimetric application, but little is known about how these signatures might translate for the assessment of radiological injury in radiosensitive individuals, who comprise a significant proportion of the general population, and who would likely require treatment after exposure to lower doses. Using Parp1 -/- mice as a model radiation-sensitive genotype, we have investigated the effect of this DNA repair deficiency on the gene expression response to radiation. Although Parp1 is known to play general roles in regulating transcription, the pattern of gene expression changes observed in Parp1 -/- mice 24 h postirradiation to a LD 50/30 was remarkably similar to that in wild-type mice after exposure to LD 50/30 . Similar levels of activation of both the p53 and NFκB radiation response pathways were indicated in both strains. In contrast, exposure of wild-type mice to a sublethal dose that was equal to the Parp1 -/- LD 50/30 , which resulted in a lower magnitude gene expression response. Thus, Parp1 -/- mice displayed a heightened gene expression response to radiation, which was more similar to the wild-type response to an equitoxic dose than to an equal absorbed dose. Gene expression classifiers trained on the wild-type data correctly identified all wild-type samples as unexposed, exposed to a sublethal dose or exposed to an LD 50/30 . All unexposed samples from Parp1 -/- mice were also correctly classified with the same gene set, and 80% of irradiated Parp1 -/- samples were identified as exposed to an LD 50/30 . The results of this study suggest that, at least for some pathways that may influence radiosensitivity in humans, specific gene expression

Defective bone repair in mast cell-deficient Cpa3Cre/+ mice.

PubMed

Ramirez-GarciaLuna, Jose Luis; Chan, Daniel; Samberg, Robert; Abou-Rjeili, Mira; Wong, Timothy H; Li, Ailian; Feyerabend, Thorsten B; Rodewald, Hans-Reimer; Henderson, Janet E; Martineau, Paul A

2017-01-01

In the adult skeleton, cells of the immune system interact with those of the skeleton during all phases of bone repair to influence the outcome. Mast cells are immune cells best known for their pathologic role in allergy, and may be involved in chronic inflammatory and fibrotic disorders. Potential roles for mast cells in tissue homeostasis, vascularization and repair remain enigmatic. Previous studies in combined mast cell- and Kit-deficient KitW-sh/W-sh mice (KitW-sh) implicated mast cells in bone repair but KitW-sh mice suffer from additional Kit-dependent hematopoietic and non- hematopoietic deficiencies that could have confounded the outcome. The goal of the current study was to compare bone repair in normal wild type (WT) and Cpa3Cre/+ mice, which lack mast cells in the absence of any other hematopoietic or non- hematopoietic deficiencies. Repair of a femoral window defect was characterized using micro CT imaging and histological analyses from the early inflammatory phase, through soft and hard callus formation, and finally the remodeling phase. The data indicate 1) mast cells appear in healing bone of WT mice but not Cpa3Cre/+ mice, beginning 14 days after surgery; 2) re-vascularization of repair tissue and deposition of mineralized bone was delayed and dis-organised in Cpa3Cre/+ mice compared with WT mice; 3) the defects in Cpa3Cre/+ mice were associated with little change in anabolic activity and biphasic alterations in osteoclast and macrophage activity. The outcome at 56 days postoperative was complete bridging of the defect in most WT mice and fibrous mal-union in most Cpa3Cre/+ mice. The results indicate that mast cells promote bone healing, possibly by recruiting vascular endothelial cells during the inflammatory phase and coordinating anabolic and catabolic activity during tissue remodeling. Taken together the data indicate that mast cells have a positive impact on bone repair.

Defective bone repair in mast cell-deficient Cpa3Cre/+ mice

PubMed Central

Chan, Daniel; Samberg, Robert; Abou-Rjeili, Mira; Wong, Timothy H.; Li, Ailian; Feyerabend, Thorsten B.; Rodewald, Hans-Reimer; Henderson, Janet E.; Martineau, Paul A.

2017-01-01

In the adult skeleton, cells of the immune system interact with those of the skeleton during all phases of bone repair to influence the outcome. Mast cells are immune cells best known for their pathologic role in allergy, and may be involved in chronic inflammatory and fibrotic disorders. Potential roles for mast cells in tissue homeostasis, vascularization and repair remain enigmatic. Previous studies in combined mast cell- and Kit-deficient KitW-sh/W-sh mice (KitW-sh) implicated mast cells in bone repair but KitW-sh mice suffer from additional Kit-dependent hematopoietic and non- hematopoietic deficiencies that could have confounded the outcome. The goal of the current study was to compare bone repair in normal wild type (WT) and Cpa3Cre/+ mice, which lack mast cells in the absence of any other hematopoietic or non- hematopoietic deficiencies. Repair of a femoral window defect was characterized using micro CT imaging and histological analyses from the early inflammatory phase, through soft and hard callus formation, and finally the remodeling phase. The data indicate 1) mast cells appear in healing bone of WT mice but not Cpa3Cre/+ mice, beginning 14 days after surgery; 2) re-vascularization of repair tissue and deposition of mineralized bone was delayed and dis-organised in Cpa3Cre/+ mice compared with WT mice; 3) the defects in Cpa3Cre/+ mice were associated with little change in anabolic activity and biphasic alterations in osteoclast and macrophage activity. The outcome at 56 days postoperative was complete bridging of the defect in most WT mice and fibrous mal-union in most Cpa3Cre/+ mice. The results indicate that mast cells promote bone healing, possibly by recruiting vascular endothelial cells during the inflammatory phase and coordinating anabolic and catabolic activity during tissue remodeling. Taken together the data indicate that mast cells have a positive impact on bone repair. PMID:28350850

Heat Shock Protein B1-Deficient Mice Display Impaired Wound Healing

PubMed Central

McNamee, Kay; Przybycien, Paulina M.; Lu, Xin; Williams, Richard O.; Bou-Gharios, George; Saklatvala, Jeremy; Dean, Jonathan L. E.

2013-01-01

There is large literature describing in vitro experiments on heat shock protein (hsp)B1 but understanding of its function in vivo is limited to studies in mice overexpressing human hspB1 protein. Experiments in cells have shown that hspB1 has chaperone activity, a cytoprotective role, regulates inflammatory gene expression, and drives cell proliferation. To investigate the function of the protein in vivo we generated hspB1-deficient mice. HspB1-deficient fibroblasts display increased expression of the pro-inflammatory cytokine, interleukin-6, compared to wild-type cells, but reduced proliferation. HspB1-deficient fibroblasts exhibit reduced entry into S phase and increased expression of cyclin-dependent kinase inhibitors p27kip1 and p21waf1. The expression of hspB1 protein and mRNA is also controlled by the cell cycle. To investigate the physiological function of hspB1 in regulating inflammation and cell proliferation we used an excisional cutaneous wound healing model. There was a significant impairment in the rate of healing of wounds in hspB1-deficient mice, characterised by reduced re-epithelialisation and collagen deposition but also increased inflammation. HspB1 deficiency augments neutrophil infiltration in wounds, driven by increased chemokine (C-X-C motif) ligand 1 expression. This appears to be a general mechanism as similar results were obtained in the air-pouch and peritonitis models of acute inflammation. PMID:24143227

Coordinated therapeutic effects of immune modulators and interferon.

PubMed Central

Cerutti, I; Chany, C

1983-01-01

Immune modulators injected 24 h before encephalomyocarditis virus significantly increase antiviral resistance in mice when interferon is administered 1 h after the virus. These immune modulators can be crude bacterial extracts or synthetic drugs. In some cases, the responses are additive; in others, they are clearly cooperative. To protect the mice against the development of 180 TG Crocker sarcomas, the association of bacterial extracts and interferon is highly effective under the condition that the drug concentrations and chronological order and number of injections are well defined. In contrast, the conjunction of interferon and synthetic immune modulators, in particular cimetidine, result in delayed tumor development with no significant change in the final survival rate in the experimental model described here. PMID:6315585

Cardiovascular phenotype in Smad3 deficient mice with renovascular hypertension.

PubMed

Kashyap, Sonu; Warner, Gina; Hu, Zeng; Gao, Feng; Osman, Mazen; Al Saiegh, Yousif; Lien, Karen R; Nath, Karl; Grande, Joseph P

2017-01-01

Renovascular hypertension (RVH) has deleterious effects on both the kidney and the heart. TGF-β signaling through Smad3 directs tissue fibrosis in chronic injury models. In the 2-kidney 1-clip (2K1C) model of RVH, employing mice on the 129 genetic background, Smad3 deficiency (KO) protects the stenotic kidney (STK) from development of interstitial fibrosis. However, these mice have an increased incidence of sudden cardiac death following 2K1C surgery. The purpose of this study was to characterize the cardiovascular phenotype of these mice. Renal artery stenosis (RAS) was established in Wild-type (WT) and Smad3 KO mice (129 genetic background) by placement of a polytetrafluoroethylene cuff on the right renal artery. Mortality was 25.5% for KO mice with RAS, 4.1% for KO sham mice, 1.2% for WT with RAS, and 1.8% for WT sham mice. Myocardial tissue of mice studied at 3 days following surgery showed extensive myocyte necrosis in KO but not WT mice. Myocyte necrosis was associated with a rapid induction of Ccl2 expression, macrophage influx, and increased MMP-9 activity. At later time points, both KO and WT mice developed myocardial fibrosis. No aortic aneurysms or dissections were observed at any time point. Smad3 KO mice were backcrossed to the C57BL/6J strain and subjected to RAS. Sudden death was observed at 10-14 days following surgery in 62.5% of mice; necropsy revealed aortic dissections as the cause of death. As observed in the 129 mice, the STK of Smad3 KO mice on the C57BL/6J background did not develop significant chronic renal damage. We conclude that the cardiovascular manifestations of Smad3 deficient mice are strain-specific, with myocyte necrosis in 129 mice and aortic rupture in C57BL/6J mice. Future studies will define mechanisms underlying this strain-specific effect on the cardiovascular system.

Interferon response factor 3 is essential for house dust mite-induced airway allergy.

PubMed

Marichal, Thomas; Bedoret, Denis; Mesnil, Claire; Pichavant, Muriel; Goriely, Stanislas; Trottein, François; Cataldo, Didier; Goldman, Michel; Lekeux, Pierre; Bureau, Fabrice; Desmet, Christophe J

2010-10-01

Pattern-recognition receptors (PRRs) are critically involved in the pathophysiology of airway allergy, yet most of the signaling pathways downstream of PRRs implicated in allergic airway sensitization remain unknown. We sought to study the effects of genetic depletion of interferon response factor (IRF) 3 and IRF7, important transcription factors downstream of various PRRs, in a murine model of house dust mite (HDM)-induced allergic asthma. We compared HDM-induced allergic immune responses in IRF3-deficient (IRF3(-/-)), IRF7(-/-), and wild-type mice. Parameters of airway allergy caused by HDM exposure were strongly attenuated in IRF3(-/-), but not IRF7(-/-), mice compared with those in wild-type mice. Indeed, in HDM-exposed IRF3(-/-) mice HDM-specific T(H)2 cell responses did not develop. This correlated with impaired maturation and migration of IRF3(-/-) lung dendritic cells (DCs) on HDM treatment. Furthermore, adoptive transfer of HDM-loaded DCs indicated that IRF3(-/-) DCs had an intrinsic defect rendering them unable to migrate and to prime HDM-specific T(H)2 responses. Intriguingly, we also show that DC function and allergic airway sensitization in response to HDM were independent of signaling by type I interferons, the main target genes of IRF3. Through its role in DC function, IRF3, mainly known as a central activator of antiviral immunity, is essential for the development of T(H)2-type responses to airway allergens. Copyright © 2010 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

Rotavirus Activates Lymphocytes from Non-Obese Diabetic Mice by Triggering Toll-Like Receptor 7 Signaling and Interferon Production in Plasmacytoid Dendritic Cells

PubMed Central

Pane, Jessica A.; Webster, Nicole L.; Coulson, Barbara S.

2014-01-01

It has been proposed that rotavirus infection promotes the progression of genetically-predisposed children to type 1 diabetes, a chronic autoimmune disease marked by infiltration of activated lymphocytes into pancreatic islets. Non-obese diabetic (NOD) mice provide a model for the human disease. Infection of adult NOD mice with rhesus monkey rotavirus (RRV) accelerates diabetes onset, without evidence of pancreatic infection. Rather, RRV spreads to the pancreatic and mesenteric lymph nodes where its association with antigen-presenting cells, including dendritic cells, induces cellular maturation. RRV infection increases levels of the class I major histocompatibility complex on B cells and proinflammatory cytokine expression by T cells at these sites. In autoimmunity-resistant mice and human mononuclear cells from blood, rotavirus-exposed plasmacytoid dendritic cells contribute to bystander polyclonal B cell activation through type I interferon expression. Here we tested the hypothesis that rotavirus induces bystander activation of lymphocytes from NOD mice by provoking dendritic cell activation and proinflammatory cytokine secretion. NOD mouse splenocytes were stimulated with rotavirus and assessed for activation by flow cytometry. This stimulation activated antigen-presenting cells and B cells independently of virus strain and replicative ability. Instead, activation depended on virus dose and was prevented by blockade of virus decapsidation, inhibition of endosomal acidification and interference with signaling through Toll-like receptor 7 and the type I interferon receptor. Plasmacytoid dendritic cells were more efficiently activated than conventional dendritic cells by RRV, and contributed to the activation of B and T cells, including islet-autoreactive CD8+ T cells. Thus, a double-stranded RNA virus can induce Toll-like receptor 7 signaling, resulting in lymphocyte activation. Our findings suggest that bystander activation mediated by type I interferon

Maladaptive defensive behaviours in monoamine oxidase A-deficient mice.

PubMed

Godar, Sean C; Bortolato, Marco; Frau, Roberto; Dousti, Mona; Chen, Kevin; Shih, Jean C

2011-10-01

Rich evidence indicates that monoamine oxidase (MAO) A, the major enzyme catalysing the degradation of monoamine neurotransmitters, plays a key role in emotional regulation. Although MAOA deficiency is associated with reactive aggression in humans and mice, the involvement of this enzyme in defensive behaviour remains controversial and poorly understood. To address this issue, we tested MAOA knockout (KO) mice in a spectrum of paradigms and settings associated with variable degrees of threat. The presentation of novel inanimate objects induced a significant reduction in exploratory approaches and increase in defensive behaviours, such as tail-rattling, biting and digging. These neophobic responses were context-dependent and particularly marked in the home cage. In the elevated plus- and T-mazes, MAOA KO mice and wild-type (WT) littermates displayed equivalent locomotor activity and time in closed and open arms; however, MAOA KO mice featured significant reductions in risk assessment, as well as unconditioned avoidance and escape. No differences between genotypes were observed in the defensive withdrawal and emergence test. Conversely, MAOA KO mice exhibited a dramatic reduction of defensive and fear-related behaviours in the presence of predator-related cues, such as predator urine or an anaesthetized rat, in comparison with those observed in their WT littermates. The behavioural abnormalities in MAOA KO mice were not paralleled by overt alterations in sensory and microvibrissal functions. Collectively, these results suggest that MAOA deficiency leads to a general inability to appropriately assess contextual risk and attune defensive and emotional responses to environmental cues.

Deficiency in Th2 cytokine responses exacerbate orthopoxvirus infection.

PubMed

Sakala, Isaac G; Chaudhri, Geeta; Eldi, Preethi; Buller, R Mark; Karupiah, Gunasegaran

2015-01-01

Ectromelia virus (ECTV) causes mousepox in mice, a disease very similar to smallpox in humans. ECTV and variola virus (VARV), the agent of smallpox, are closely related orthopoxviruses. Mousepox is an excellent small animal model to study the genetic and immunologic basis for resistance and susceptibility of humans to smallpox. Resistance to mousepox is dependent on a strong polarized type 1 immune response, associated with robust natural killer (NK) cell, cytotoxic T lymphocyte (CTL) and gamma interferon (IFN-γ) responses. In contrast, ECTV-susceptible mice generate a type 2 response, associated with weak NK cell, CTL and IFN-γ responses but robust IL-4 responses. Nonetheless, susceptible strains infected with mutant ECTV lacking virus-encoded IFN-γ binding protein (vIFN-γbp) (ECTV-IFN-γbpΔ) control virus replication through generation of type 1 response. Since the IL-4/IL-13/STAT-6 signaling pathways polarize type 2/T helper 2 (Th2) responses with a corresponding suppression of IFN-γ production, we investigated whether the combined absence of vIFN-γbp, and one or more host genes involved in Th2 response development, influence generation of protective immunity. Most mutant mouse strains infected with wild-type (WT) virus succumbed to disease more rapidly than WT animals. Conversely, the disease outcome was significantly improved in WT mice infected with ECTV-IFN-γbpΔ but absence of IL-4/IL-13/STAT-6 signaling pathways did not provide any added advantage. Deficiency in IL-13 or STAT-6 resulted in defective CTL responses, higher mortality rates and accelerated deaths. Deficiencies in IL-4/IL-13/STAT-6 signaling pathways significantly reduced the numbers of IFN-γ producing CD4 and CD8 T cells, indicating an absence of a switch to a Th1-like response. Factors contributing to susceptibility or resistance to mousepox are far more complex than a balance between Th1 and Th2 responses.

Daily Rhythmic Behaviors and Thermoregulatory Patterns Are Disrupted in Adult Female MeCP2-Deficient Mice

PubMed Central

Wu, Chiping; Bardakjian, Berj L.; Zhang, Liang; Eubanks, James H.

2012-01-01

Mutations in the X-linked gene encoding Methyl-CpG-binding protein 2 (MECP2) have been associated with neurodevelopmental and neuropsychiatric disorders including Rett Syndrome, X-linked mental retardation syndrome, severe neonatal encephalopathy, and Angelman syndrome. Although alterations in the performance of MeCP2-deficient mice in specific behavioral tasks have been documented, it remains unclear whether or not MeCP2 dysfunction affects patterns of periodic behavioral and electroencephalographic (EEG) activity. The aim of the current study was therefore to determine whether a deficiency in MeCP2 is sufficient to alter the normal daily rhythmic patterns of core body temperature, gross motor activity and cortical delta power. To address this, we monitored individual wild-type and MeCP2-deficient mice in their home cage environment via telemetric recording over 24 hour cycles. Our results show that the normal daily rhythmic behavioral patterning of cortical delta wave activity, core body temperature and mobility are disrupted in one-year old female MeCP2-deficient mice. Moreover, female MeCP2-deficient mice display diminished overall motor activity, lower average core body temperature, and significantly greater body temperature fluctuation than wild-type mice in their home-cage environment. Finally, we show that the epileptiform discharge activity in female MeCP2-deficient mice is more predominant during times of behavioral activity compared to inactivity. Collectively, these results indicate that MeCP2 deficiency is sufficient to disrupt the normal patterning of daily biological rhythmic activities. PMID:22523589

Interleukin-12 Therapy Reduces the Number of Immune Cells and Pathology in Lungs of Mice Infected with Mycobacterium tuberculosis

PubMed Central

Nolt, Dawn; Flynn, JoAnne L.

2004-01-01

Alternate modalities for the treatment of Mycobacterium tuberculosis are needed due to the rise in numbers of immunosuppressed individuals at risk for serious disease and the increasing prevalence of multidrug-resistant isolates. Interleukin-12 (IL-12) has been shown to improve immune responses against M. tuberculosis infection in both humans and mice. Previous studies using high-dose IL-12 in various disease models reported a paradoxical immunosuppression. We demonstrate here that exogenous administration of IL-12 for 8 weeks after an aerosolized low dose of M. tuberculosis results in increased survival and decreased pulmonary bacterial loads for CD4-T-cell-deficient mice, most likely due to an early increase in gamma interferon. IL-12 treatment did not impair or enhance the ability of the wild-type mice to control infection, as measured by bacterial numbers. Two novel findings are reported here regarding exogenous IL-12 therapy for M. tuberculosis infections: (i) IL-12 treatment resulted in decreased numbers of immune cells and reduced frequencies of lymphocytes (CD8+, CD4+, and NK cells) in the lungs of infected mice and (ii) IL-12 therapy reduced the pathology of M. tuberculosis-infected lungs, as granulomas were smaller and less numerous. These studies support an immunoregulatory role for IL-12 in tuberculosis. PMID:15102810

Gender differences in hypoxic acclimatization in cyclooxygenase-2-deficient mice.

PubMed

Xu, Kui; Sun, Xiaoyan; Benderro, Girriso F; Tsipis, Constantinos P; LaManna, Joseph C

2017-02-01

The aim of this study was to determine the effect of cyclooxygenase-2 (COX-2) gene deletion on the adaptive responses during prolonged moderate hypobaric hypoxia. Wild-type (WT) and COX-2 knockout (KO) mice of both genders (3 months old) were exposed to hypobaric hypoxia (~0.4 ATM) or normoxia for 21 days and brain capillary densities were determined. Hematocrit was measured at different time intervals; brain hypoxia-inducible factor -1 α (HIF-1 α ), angiopoietin 2 (Ang-2), brain erythropoietin (EPO), and kidney EPO were measured under normoxic and hypoxic conditions. There were no gender differences in hypoxic acclimatization in the WT mice and similar adaptive responses were observed in the female KO mice. However, the male KO mice exhibited progressive vulnerability to prolonged hypoxia. Compared to the WT and female KO mice, the male COX-2 KO mice had significantly lower survival rate and decreased erythropoietic and polycythemic responses, diminished cerebral angiogenesis, decreased brain accumulation of HIF-1 α , and attenuated upregulation of VEGF, EPO, and Ang-2 during hypoxia. Our data suggest that there are physiologically important gender differences in hypoxic acclimatization in COX-2-deficient mice. The COX-2 signaling pathway appears to be required for acclimatization in oxygen-limiting environments only in males, whereas female COX-2-deficient mice may be able to access COX-2-independent mechanisms to achieve hypoxic acclimatization. © 2017 Case Western Reserve University. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

Interleukin-12- and interferon-γ-mediated natural killer cell activation by Agaricus blazei Murill

PubMed Central

Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko

2007-01-01

Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-γ (IFN-γ) deficient mice. NK cell activation and IFN-γ production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-γ production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-γ-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-γ production. PMID:17346284

Abalation of Ghrelin receptor in leptin-deficient mice has paradoxical effects on glucose homeostasis compared to Ghrelin-abalated Leptin-deficient mice

USDA-ARS?s Scientific Manuscript database

Ghrelin is produced predominantly in stomach and is known to be the endogenous ligand of the growth hormone secretagogue receptor (GHSR). Ghrelin is a GH stimulator and an orexigenic hormone. In contrast, leptin is an anorexic hormone, and leptin-deficient ob/ob mice are obese and diabetic. To study...

Parasite-mediated upregulation of NK cell-derived gamma interferon protects against severe highly pathogenic H5N1 influenza virus infection.

PubMed

O'Brien, Kevin B; Schultz-Cherry, Stacey; Knoll, Laura J

2011-09-01

Outbreaks of influenza A viruses are associated with significant human morbidity worldwide. Given the increasing resistance to the available influenza drugs, new therapies for the treatment of influenza virus infection are needed. An alternative approach is to identify products that enhance a protective immune response. In these studies, we demonstrate that infecting mice with the Th1-inducing parasite Toxoplasma gondii prior to highly pathogenic avian H5N1 influenza virus infection led to decreased lung viral titers and enhanced survival. A noninfectious fraction of T. gondii soluble antigens (STAg) elicited an immune response similar to that elicited by live parasites, and administration of STAg 2 days after H5N1 influenza virus infection enhanced survival, lowered viral titers, and reduced clinical disease. STAg administration protected H5N1 virus-infected mice lacking lymphocytes, suggesting that while the adaptive immune response was not required for enhanced survival, it was necessary for STAg-mediated viral clearance. Mechanistically, we found that administration of STAg led to increased production of gamma interferon (IFN-γ) from natural killer (NK) cells, which were both necessary and sufficient for survival. Further, administration of exogenous IFN-γ alone enhanced survival from H5N1 influenza virus infection, although not to the same level as STAg treatment. These studies demonstrate that a noninfectious T. gondii extract enhances the protective immune response against severe H5N1 influenza virus infections even when a single dose is administered 2 days postinfection.

miR-155 deficiency protects mice from experimental colitis by reducing T helper type 1/type 17 responses

PubMed Central

Singh, Udai P; Murphy, Angela E; Enos, Reilly T; Shamran, Haidar A; Singh, Narendra P; Guan, Honbing; Hegde, Venkatesh L; Fan, Daping; Price, Robert L; Taub, Dennis D; Mishra, Manoj K; Nagarkatti, Mitzi; Nagarkatti, Prakash S

2014-01-01

Inflammatory bowel disease (IBD), a chronic intestinal inflammatory condition that affects millions of people worldwide, results in high morbidity and exorbitant health-care costs. The critical features of both innate and adaptive immunity are to control inflammation and dysfunction in this equilibrium is believed to be the reason for the development of IBD. miR-155, a microRNA, is up-regulated in various inflammatory disease states, including IBD, and is a positive regulator of T-cell responses. To date, no reports have defined a function for miR-155 with regard to cellular responses in IBD. Using an acute experimental colitis model, we found that miR-155−/− mice, as compared to wild-type control mice, have decreased clinical scores, a reversal of colitis-associated pathogenesis, and reduced systemic and mucosal inflammatory cytokines. The increased frequency of CD4+ lymphocytes in the spleen and lamina propria with dextran sodium sulphate induction was decreased in miR-155−/− mice. Similarly, miR-155 deficiency abrogated the increased numbers of interferon-γ expressing CD4+ T cells typically observed in wild-type mice in this model. The frequency of systemic and mucosal T helper type 17-, CCR9-expressing CD4+ T cells was also reduced in miR-155−/− mice compared with control mice. These findings strongly support a role for miR-155 in facilitating pro-inflammatory cellular responses in this model of IBD. Loss of miR-155 also results in decreases in T helper type 1/type 17, CD11b+, and CD11c+ cells, which correlated with reduced clinical scores and severity of disease. miR-155 may serve as a potential therapeutic target for the treatment of IBD. PMID:24891206

CD22 x Siglec-G double-deficient mice have massively increased B1 cell numbers and develop systemic autoimmunity.

PubMed

Jellusova, Julia; Wellmann, Ute; Amann, Kerstin; Winkler, Thomas H; Nitschke, Lars

2010-04-01

CD22 and Siglec-G are inhibitory coreceptors for BCR-mediated signaling. Although CD22-deficient mice show increased calcium signaling in their conventional B2 cells and a quite normal B cell maturation, Siglec-G-deficient mice have increased calcium mobilization just in B1 cells and show a large expansion of the B1 cell population. Neither CD22-deficient, nor Siglec-G-deficient mice on a pure C57BL/6 or BALB/c background, respectively, develop autoimmunity. Using Siglec-G x CD22 double-deficient mice, we addressed whether Siglec-G and CD22 have redundant functions. Siglec-G x CD22 double-deficient mice show elevated calcium responses in both B1 cells and B2 cells, increased serum IgM levels and an enlarged population of B1 cells. The enlargement of B1 cell numbers is even higher than in Siglecg(-/-) mice. This expansion seems to happen at the expense of B2 cells, which are reduced in absolute cell numbers, but show an activated phenotype. Furthermore, Siglec-G x CD22 double-deficient mice show a diminished immune response to both thymus-dependent and thymus-independent type II Ags. In contrast, B cells from Siglec-G x CD22 double-deficient mice exhibit a hyperproliferative response to stimulation with several TLR ligands. Aged Siglec-G x CD22 double-deficient mice spontaneously develop anti-DNA and antinuclear autoantibodies. These resulted in a moderate form of immune complex glomerulonephritis. These results show that Siglec-G and CD22 have partly compensatory functions and together are crucial in maintaining the B cell tolerance.

Bypass of lethality with mosaic mice generated by Cre-loxP-mediated recombination.

PubMed

Betz, U A; Vosshenrich, C A; Rajewsky, K; Müller, W

1996-10-01

The analysis of gene function based on the generation of mutant mice by homologous recombination in embryonic stem cells is limited if gene disruption results in embryonic lethality. Mosaic mice, which contain a certain proportion of mutant cells in all organs, allow lethality to be circumvented and the potential of mutant cells to contribute to different cell lineages to be analyzed. To generate mosaic animals, we used the bacteriophage P1-derived Cre-loxP recombination system, which allows gene alteration by Cre-mediated deletion of loxP-flanked gene segments. We generated nestin-cre transgenic mouse lines, which expressed the Cre recombinase under the control of the rat nestin promoter and its second intron enhancer. In crosses to animals carrying a loxP-flanked target gene, partial deletion of the loxP-flanked allele occurred before day 10.5 post coitum and was detectable in all adult organs examined, including germ-line cells. Using this approach, we generated mosaic mice containing cells deficient in the gamma-chain of the interleukin-2 receptor (IL-2R gamma); in these animals, the IL-2R gamma-deficient cells were underrepresented in the thymus and spleen. Because mice deficient in DNA polymerase beta die perinatally, we studied the effects of DNA polymerase beta deficiency in mosaic animals. We found that some of the mosaic polymerase beta-deficient animals were viable, but were often reduced in size and weight. The fraction of DNA polymerase beta-deficient cells in mosaic embryos decreased during embryonic development, presumably because wild-type cells had a competitive advantage. The nestin-cre transgenic mice can be used to generate mosaic animals in which target genes are mutated by Cre-mediated recombination of loxP-flanked target genes. By using mosaic animals, embryonic lethality can be bypassed and cell lineages for whose development a given target gene is critical can be identified. In the case of DNA polymerase beta, deficient cells are already

Immunity to sporozoite-induced malaria infection in mice. I. The effect of immunization of T and B cell-deficient mice. [X Radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, D.H.; Tigelaar, R.E.; Weinbaum, F.I.

1977-04-01

The cellular basis of immunity to sporozoites was investigated by examining the effect of immunization of T and B cell-deficient C57BL/6N x BALB/c AnN F/sub 1/ (BLCF/sub 1/) mice compared to immunocompetent controls. Immunization of T cell-deficient (ATX-BM-ATS) BLCF/sub 1/ mice with x-irradiated sporozoites did not result in the generation of protective immunity. The same immunization protocols protected all immunocompetent controls. In contrast, B cell-deficient (..mu..-suppressed) BLCF/sub 1/ mice were protected by immunization in the majority of cases. The absence of detectable serum circumsporozoite precipitins or sporozoite neutralizing activity in the ..mu..-suppressed mice that resisted a sporozoite challenge suggests amore » minor role for these humoral factors in protection. These data demonstrate a preeminent role for T cells in the induction of protective immunity in BLCF/sub 1/ mice against a P. berghei sporozoite infection.« less

Prefrontal single-unit firing associated with deficient extinction in mice

PubMed Central

Fitzgerald, Paul J; Whittle, Nigel; Flynn, Shaun M; Graybeal, Carolyn; Pinard, Courtney; Gunduz-Cinar, Ozge; Kravitz, Alexxai; Singewald, Nicolas; Holmes, Andrew

2014-01-01

The neural circuitry mediating fear extinction has been increasingly well studied and delineated. The rodent infralimbic subregion (IL) of the ventromedial prefrontal cortex (vmPFC) has been found to promote extinction, whereas the prelimbic cortex (PL) demonstrates an opposing, pro-fear, function. Studies employing in vivo electrophysiological recordings have observed that while increased IL single-unit firing and bursting predicts robust extinction retrieval, increased PL firing can correlate with sustained fear and poor extinction. These relationships between single-unit firing and extinction do not hold under all experimental conditions, however. In the current study, we further investigated the relationship between vmPFC and PL single-unit firing and extinction using inbred mouse models of intact (C57BL/6J, B6) and deficient (129S1/SvImJ, S1) extinction strains. Simultaneous single-unit recordings were made in the PL and vmPFC (encompassing IL) as B6 and S1 mice performed extinction training and retrieval. Impaired extinction retrieval in S1 mice was associated with elevated PL single-unit firing, as compared to firing in extinguishing B6 mice, consistent with the hypothesized pro-fear contribution of PL. Analysis of local field potentials also revealed significantly higher gamma power in the PL of Sthan B6 mice during extinction training and retrieval. In the vmPFC, impaired extinction in S1 mice was also associated with exaggerated single-unit firing, relative to B6 mice. This is in apparent contradiction to evidence that IL activity promotes extinction, but could reflect a (failed) compensatory effort by the vmPFC to mitigate fear-promoting activity in other regions, such as the PL or amygdala. In support of this hypothesis, augmenting IL activity via direct infusion of the GABAA receptor antagonist picrotoxin rescued impaired extinction retrieval in S1 mice. Chronic fluoxetine treatment produced modest reductions in fear during extinction retrieval and

Wound Healing in Mac-1 Deficient Mice

DTIC Science & Technology

2017-05-01

36. Rosenkranz AR, Coxon A, Maurer M, Gurish MF, Austen KF, Friend DS, Galli SJ, Mayadas TN. Impaired mast cell development and innate immunity in Mac...genetically deficient mice. 3 INTRODUCTION Wound healing is a complex yet well-regulated process in which multiple resident cells ...recruited inflammatory cells , and stem cells interact to create an environment that supports the healing process. An optimal inflammatory response is a

Leptin Increases Striatal Dopamine D2 Receptor Binding in Leptin-Deficient Obese (ob/ob) Mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pfaffly, J.; Michaelides, M.; Wang, G-J.

2010-06-01

Peripheral and central leptin administration have been shown to mediate central dopamine (DA) signaling. Leptin-receptor deficient rodents show decreased DA D2 receptor (D2R) binding in striatum and unique DA profiles compared to controls. Leptin-deficient mice show increased DA activity in reward-related brain regions. The objective of this study was to examine whether basal D2R-binding differences contribute to the phenotypic behaviors of leptin-deficient ob/ob mice, and whether D2R binding is altered in response to peripheral leptin treatment in these mice. Leptin decreased body weight, food intake, and plasma insulin concentration in ob/ob mice but not in wild-type mice. Basal striatal D2Rmore » binding (measured with autoradiography [{sup 3}H] spiperone) did not differ between ob/ob and wild-type mice but the response to leptin did. In wild-type mice, leptin decreased striatal D2R binding, whereas, in ob/ob mice, leptin increased D2R binding. Our findings provide further evidence that leptin modulates D2R expression in striatum and that these effects are genotype/phenotype dependent.« less

Gamma-glutamylcysteinylethyl ester attenuates progression of carbon tetrachloride-induced acute liver injury in mice.

PubMed

Nishida, K; Ohta, Y; Ishiguro, I

1998-02-20

We examined the effect of gamma-glutamylcysteinylethyl ester (gamma-GCE), which is readily transported into hepatocytes and increases hepatocellular reduced glutathione (GSH) levels, on the progression of carbon tetrachloride (CCl4)-induced liver injury in mice in comparison with that of GSH. Administration of more than 160 micromol/kg of gamma-GCE, but not GSH, to mice at 3 h after intraperitoneal injection of CCl4 (1 ml/kg) significantly attenuated increases in serum aspartate aminotransferase and alanine aminotransferase activities at 24 h after the CCl4 injection. Increases in hepatic lipid peroxide (LPO) concentrations and decreases in hepatic GSH concentrations after the CCl4 injection were significantly diminished by the gamma-GCE (160 micromol/kg) administration, but not by the same dose of GSH. Gamma-GCE, gamma-glutamylcysteine, and cysteine acted as substrates for glutathione peroxidases much less efficiently than GSH in the post-mitochondrial fraction of normal mouse liver cells. These results indicate that gamma-GCE attenuates the progression of CCl4-induced acute liver injury in mice through the maintenance of hepatic GSH levels, leading to inhibition of hepatic LPO formation, which could be due to an efficient utilization of GSH converted from gamma-GCE in the liver cells.

Increased anxiety but normal fear and safety learning in orexin-deficient mice.

PubMed

Khalil, Radwa; Fendt, Markus

2017-03-01

The loss of orexin neurons in humans leads to the disease narcolepsy, characterized by daytime sleepiness and cataplexy. Recent data suggest that orexin is also involved in emotional processing. The goal of the present study was to evaluate fear and safety learning as well as unconditioned fear (anxiety) in orexin-deficient animals. Orexin-deficient mice are an established animal model used to investigate the neuropathology and potential treatments for narcolepsy. Here, we present novel data showing that orexin-deficient mice express increased anxiety in the open field, light-dark box test and carnivore odor-induced avoidance, but are normal in fear and safety learning. These findings suggest an important role of orexin in brain areas involved in anxiety. Copyright © 2016 Elsevier B.V. All rights reserved.

Autophagy-deficient mice develop multiple liver tumors

PubMed Central

Takamura, Akito; Komatsu, Masaaki; Hara, Taichi; Sakamoto, Ayako; Kishi, Chieko; Waguri, Satoshi; Eishi, Yoshinobu; Hino, Okio; Tanaka, Keiji; Mizushima, Noboru

2011-01-01

Autophagy is a major pathway for degradation of cytoplasmic proteins and organelles, and has been implicated in tumor suppression. Here, we report that mice with systemic mosaic deletion of Atg5 and liver-specific Atg7−/− mice develop benign liver adenomas. These tumor cells originate autophagy-deficient hepatocytes and show mitochondrial swelling, p62 accumulation, and oxidative stress and genomic damage responses. The size of the Atg7−/− liver tumors is reduced by simultaneous deletion of p62. These results suggest that autophagy is important for the suppression of spontaneous tumorigenesis through a cell-intrinsic mechanism, particularly in the liver, and that p62 accumulation contributes to tumor progression. PMID:21498569

Impaired natural killer cell self-education and "missing-self" responses in Ly49-deficient mice.

PubMed

Bélanger, Simon; Tu, Megan M; Rahim, Mir Munir Ahmed; Mahmoud, Ahmad B; Patel, Rajen; Tai, Lee-Hwa; Troke, Angela D; Wilhelm, Brian T; Landry, Josette-Renée; Zhu, Qinzhang; Tung, Kenneth S; Raulet, David H; Makrigiannis, Andrew P

2012-07-19

Ly49-mediated recognition of MHC-I molecules on host cells is considered vital for natural killer (NK)-cell regulation and education; however, gene-deficient animal models are lacking because of the difficulty in deleting this large multigene family. Here, we describe NK gene complex knockdown (NKC(KD)) mice that lack expression of Ly49 and related MHC-I receptors on most NK cells. NKC(KD) NK cells exhibit defective killing of MHC-I-deficient, but otherwise normal, target cells, resulting in defective rejection by NKC(KD) mice of transplants from various types of MHC-I-deficient mice. Self-MHC-I immunosurveillance by NK cells in NKC(KD) mice can be rescued by self-MHC-I-specific Ly49 transgenes. Although NKC(KD) mice display defective recognition of MHC-I-deficient tumor cells, resulting in decreased in vivo tumor cell clearance, NKG2D- or antibody-dependent cell-mediated cytotoxicity-induced tumor cell cytotoxicity and cytokine production induced by activation receptors was efficient in Ly49-deficient NK cells, suggesting MHC-I education of NK cells is a single facet regulating their total potential. These results provide direct genetic evidence that Ly49 expression is necessary for NK-cell education to self-MHC-I molecules and that the absence of these receptors leads to loss of MHC-I-dependent "missing-self" immunosurveillance by NK cells.

Dietary zinc deficiency predisposes mice to the development of preneoplastic lesions in chemically-induced hepatocarcinogenesis.

PubMed

Romualdo, Guilherme Ribeiro; Goto, Renata Leme; Henrique Fernandes, Ana Angélica; Cogliati, Bruno; Barbisan, Luis Fernando

2016-10-01

Although there is a concomitance of zinc deficiency and high incidence/mortality for hepatocellular carcinoma in certain human populations, there are no experimental studies investigating the modifying effects of zinc on hepatocarcinogenesis. Thus, we evaluated whether dietary zinc deficiency or supplementation alter the development of hepatocellular preneoplastic lesions (PNL). Therefore, neonatal male Balb/C mice were submitted to a diethylnitrosamine/2-acetylaminefluorene-induced hepatocarcinogenesis model. Moreover, mice were fed adequate (35 mg/kg diet), deficient (3 mg/kg) or supplemented (180 mg/kg) zinc diets. Mice were euthanized at 12 (early time-point) or 24 weeks (late time-point) after introducing the diets. At the early time-point, zinc deficiency decreased Nrf2 protein expression and GSH levels while increased p65 and p53 protein expression and the number of PNL/area. At the late time-point, zinc deficiency also decreased GSH levels while increased liver genotoxicity, cell proliferation into PNL and PNL size. In contrast, zinc supplementation increased antioxidant defense at both time-points but not altered PNL development. Our findings are the first to suggest that zinc deficiency predisposes mice to the PNL development in chemically-induced hepatocarcinogenesis. The decrease of Nrf2/GSH pathway and increase of liver genotoxicity, as well as the increase of p65/cell proliferation, are potential mechanisms to this zinc deficiency-mediated effect. Copyright © 2016 Elsevier Ltd. All rights reserved.

Inhibition of Activin Receptor Type IIB Increases Strength and Lifespan in Myotubularin-Deficient Mice

PubMed Central

Lawlor, Michael W.; Read, Benjamin P.; Edelstein, Rachel; Yang, Nicole; Pierson, Christopher R.; Stein, Matthew J.; Wermer-Colan, Ariana; Buj-Bello, Anna; Lachey, Jennifer L.; Seehra, Jasbir S.; Beggs, Alan H.

2011-01-01

X-linked myotubular myopathy (XLMTM) is a congenital disorder caused by deficiency of the lipid phosphatase, myotubularin. Patients with XLMTM often have severe perinatal weakness that requires mechanical ventilation to prevent death from respiratory failure. Muscle biopsy specimens from patients with XLMTM exhibit small myofibers with central nuclei and central aggregations of organelles in many cells. It was postulated that therapeutically increasing muscle fiber size would cause symptomatic improvement in myotubularin deficiency. Recent studies have elucidated an important role for the activin-receptor type IIB (ActRIIB) in regulation of muscle growth and have demonstrated that ActRIIB inhibition results in significant muscle hypertrophy. To evaluate whether promoting muscle hypertrophy can attenuate symptoms resulting from myotubularin deficiency, the effect of ActRIIB-mFC treatment was determined in myotubularin-deficient (Mtm1δ4) mice. Compared with wild-type mice, untreated Mtm1δ4 mice have decreased body weight, skeletal muscle hypotrophy, and reduced survival. Treatment of Mtm1δ4 mice with ActRIIB-mFC produced a 17% extension of lifespan, with transient increases in weight, forelimb grip strength, and myofiber size. Pathologic analysis of Mtm1δ4 mice during treatment revealed that ActRIIB-mFC produced marked hypertrophy restricted to type 2b myofibers, which suggests that oxidative fibers in Mtm1δ4 animals are incapable of a hypertrophic response in this setting. These results support ActRIIB-mFC as an effective treatment for the weakness observed in myotubularin deficiency. PMID:21281811

Annexin V Incorporated into Influenza Virus Particles Inhibits Gamma Interferon Signaling and Promotes Viral Replication

PubMed Central

Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten

2014-01-01

ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID

Gamma Interferon Release Assays for Detection of Mycobacterium tuberculosis Infection

PubMed Central

Denkinger, Claudia M.; Kik, Sandra V.; Rangaka, Molebogeng X.; Zwerling, Alice; Oxlade, Olivia; Metcalfe, John Z.; Cattamanchi, Adithya; Dowdy, David W.; Dheda, Keertan; Banaei, Niaz

2014-01-01

SUMMARY Identification and treatment of latent tuberculosis infection (LTBI) can substantially reduce the risk of developing active disease. However, there is no diagnostic gold standard for LTBI. Two tests are available for identification of LTBI: the tuberculin skin test (TST) and the gamma interferon (IFN-γ) release assay (IGRA). Evidence suggests that both TST and IGRA are acceptable but imperfect tests. They represent indirect markers of Mycobacterium tuberculosis exposure and indicate a cellular immune response to M. tuberculosis. Neither test can accurately differentiate between LTBI and active TB, distinguish reactivation from reinfection, or resolve the various stages within the spectrum of M. tuberculosis infection. Both TST and IGRA have reduced sensitivity in immunocompromised patients and have low predictive value for progression to active TB. To maximize the positive predictive value of existing tests, LTBI screening should be reserved for those who are at sufficiently high risk of progressing to disease. Such high-risk individuals may be identifiable by using multivariable risk prediction models that incorporate test results with risk factors and using serial testing to resolve underlying phenotypes. In the longer term, basic research is necessary to identify highly predictive biomarkers. PMID:24396134

Estrogen deficiency heterogeneously affects tissue specific stem cells in mice

PubMed Central

Kitajima, Yuriko; Doi, Hanako; Ono, Yusuke; Urata, Yoshishige; Goto, Shinji; Kitajima, Michio; Miura, Kiyonori; Li, Tao-Sheng; Masuzaki, Hideaki

2015-01-01

Postmenopausal disorders are frequently observed in various organs, but their relationship with estrogen deficiency and mechanisms remain unclear. As tissue-specific stem cells have been found to express estrogen receptors, we examined the hypothesis that estrogen deficiency impairs stem cells, which consequently contributes to postmenopausal disorders. Six-week-old C57BL/6 female mice were ovariectomized, following which they received 17β-estradiol replacement or vehicle (control). Sham-operated mice were used as healthy controls. All mice were killed for evaluation 2 months after treatments. Compared with the healthy control, ovariectomy significantly decreased uterine weight, which was partially recovered by 17β-estradiol replacement. Ovariectomy significantly increased the numbers of c-kit-positive hematopoietic stem/progenitor cells in bone marrow, but impaired their capacity to grow mixed cell-type colonies in vitro. Estrogen replacement further increased the numbers of c-kit-positive hematopoietic stem/progenitor cells in bone marrow, without significantly affecting colony growth in vitro. The number of CD105-positive mesenchymal stem cells in bone marrow also significantly decreased after ovariectomy, but completely recovered following estrogen replacement. Otherwise, neither ovariectomy nor estrogen replacement changed the number of Pax7-positive satellite cells, which are a skeletal muscle-type stem cell. Estrogen deficiency heterogeneously affected tissue-specific stem cells, suggesting a likely and direct relationship with postmenopausal disorders. PMID:26245252

Phenotypic screening of hepatocyte nuclear factor (HNF) 4-{gamma} receptor knockout mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gerdin, Anna Karin; Surve, Vikas V.; Joensson, Marie

2006-10-20

Using the mouse as a model organism in pharmaceutical research presents unique advantages as its physiology in many ways resembles the human physiology, it also has a relatively short generation time, low breeding and maintenance costs, and is available in a wide variety of inbred strains. The ability to genetically modify mouse embryonic stem cells to generate mouse models that better mimic human disease is another advantage. In the present study, a comprehensive phenotypic screening protocol is applied to elucidate the phenotype of a novel mouse knockout model of hepatocyte nuclear factor (HNF) 4-{gamma}. HNF4-{gamma} is expressed in the kidneys,more » gut, pancreas, and testis. First level of the screen is aimed at general health, morphologic appearance, normal cage behaviour, and gross neurological functions. The second level of the screen looks at metabolic characteristics and lung function. The third level of the screen investigates behaviour more in-depth and the fourth level consists of a thorough pathological characterisation, blood chemistry, haematology, and bone marrow analysis. When compared with littermate wild-type mice (HNF4-{gamma}{sup +/+}), the HNF4-{gamma} knockout (HNF4-{gamma}{sup -/-}) mice had lowered energy expenditure and locomotor activity during night time that resulted in a higher body weight despite having reduced intake of food and water. HNF4-{gamma}{sup -/-} mice were less inclined to build nest and were found to spend more time in a passive state during the forced swim test.« less

Histochemical Examination on Periodontal Tissues of Klotho-Deficient Mice Fed With Phosphate-Insufficient Diet

PubMed Central

Hikone, Kumiko; Hasegawa, Tomoka; Tsuchiya, Erika; Hongo, Hiromi; Sasaki, Muneteru; Yamamoto, Tomomaya; Kudo, Ai; Oda, Kimimitsu; Haraguchi, Mai; de Freitas, Paulo Henrique Luiz; Li, Minqi; Iida, Junichiro; Amizuka, Norio

2017-01-01

To elucidate which of elevated serum concentration of inorganic phosphate (Pi) or disrupted signaling linked to αklotho/fibroblast growth factor 23 (FGF23) is a predominant regulator for senescence-related degeneration seen in αKlotho-deficient mice, we have examined histological alteration of the periodontal tissues in the mandibular interalveolar septum of αKlotho-deficient mice fed with Pi-insufficient diet. We prepared six groups of mice: wild-type, kl/kl, and αKlotho−/− mice with normal diet or low-Pi diet. As a consequence, kl/klnorPi and αKlotho−/−norPi mice showed the same abnormalities in periodontal tissues: intensely stained areas with hematoxylin in the interalveolar septum, dispersed localization of alkaline phosphatase–positive osteoblasts and tartrate-resistant acid phosphatase–reactive osteoclasts, and accumulation of dentin matrix protein 1 in the osteocytic lacunae. Although kl/kllowPi mice improved these histological abnormalities, αKlotho−/− lowPi mice failed to normalize those. Gene expression of αKlotho was shown to be increased in kl/kl lowPi specimens. It seems likely that histological abnormalities of kl/kl mice have been improved by the rescued expression of αKlotho, rather than low concentration of serum Pi. Thus, the histological malformation in periodontal tissues in αKlotho-deficient mice appears to be due to not only increased concentration of Pi but also disrupted αklotho/FGF23 signaling. PMID:28122194

Aniracetam improves contextual fear conditioning and increases hippocampal gamma-PKC activation in DBA/2J mice.

PubMed

Smith, Amy M; Wehner, Jeanne M

2002-01-01

DBA/2J (D2) mice display poor contextual learning and have less membrane-bound hippocampal protein kinase C (PKC) compared with C57BL/6 (B6) mice. Aniracetam and oxiracetam were previously shown to improve contextual learning in D2 mice and increase PKC activity. This study investigated a possible mechanism for learning enhancement by examining the effects of aniracetam on contextual fear conditioning and activation of the y isoform of PKC (gamma-PKC) in male D2 mice. In comparison to animals treated with vehicle only (10% 2-hydroxypropyl-beta-cyclodextrin), mice treated with aniracetam (100 mg/kg) 30 min prior to fear conditioning training demonstrated significantly improved contextual learning when tested 30 min and 24 h after training. This corresponded with a significant increase in activated, membrane-bound hippocampal gamma-PKC 30 min after training. No increase in learning or gamma-PKC was found 5 min after training. These results suggest an altered time course of activation of gamma-PKC in response to treatment with aniracetam, which improves learning in D2 mice.

Mice deficient in LMAN1 exhibit FV and FVIII deficiencies and liver accumulation of α1-antitrypsin

PubMed Central

Zheng, Chunlei; Zhu, Min; Tao, Jiayi; Vasievich, Matthew P.; Baines, Andrea; Kim, Jinoh; Schekman, Randy; Kaufman, Randal J.; Ginsburg, David

2011-01-01

The type 1-transmembrane protein LMAN1 (ERGIC-53) forms a complex with the soluble protein MCFD2 and cycles between the endoplasmic reticulum (ER) and the ER-Golgi intermediate compartment (ERGIC). Mutations in either LMAN1 or MCFD2 cause the combined deficiency of factor V (FV) and factor VIII (FVIII; F5F8D), suggesting an ER-to-Golgi cargo receptor function for the LMAN1-MCFD2 complex. Here we report the analysis of LMAN1-deficient mice. Levels of plasma FV and FVIII, and platelet FV, are all reduced to ∼ 50% of wild-type in Lman1−/− mice, compared with the 5%-30% levels typically observed in human F5F8D patients. Despite previous reports identifying cathepsin C, cathepsin Z, and α1-antitrypsin as additional potential cargoes for LMAN1, no differences were observed between wild-type and Lman1−/− mice in the levels of cathepsin C and cathepsin Z in liver lysates or α1-antitrypsin levels in plasma. LMAN1 deficiency had no apparent effect on COPII-coated vesicle formation in an in vitro assay. However, the ER in Lman1−/− hepatocytes is slightly distended, with significant accumulation of α1-antitrypsin and GRP78. An unexpected, partially penetrant, perinatal lethality was observed for Lman1−/− mice, dependent on the specific inbred strain genetic background, suggesting a potential role for other, as yet unidentified LMAN1-dependent cargo proteins. PMID:21795745

Card9- and MyD88-Mediated Gamma Interferon and Nitric Oxide Production Is Essential for Resistance to Subcutaneous Coccidioides posadasii Infection.

PubMed

Hung, Chiung-Yu; Castro-Lopez, Natalia; Cole, Garry T

2016-04-01

Coccidioidomycosis is a potentially life-threatening respiratory disease which is endemic to the southwestern United States and arid regions of Central and South America. It is responsible for approximately 150,000 infections annually in the United States alone. Almost every human organ has been reported to harbor parasitic cells of Coccidioides spp. in collective cases of the disseminated form of this mycosis. Current understanding of the mechanisms of protective immunity against lung infection has been largely derived from murine models of pulmonary coccidioidomycosis. However, little is known about the nature of the host response to Coccidioides in extrapulmonary tissue. Primary subcutaneous coccidioidal infection is rare but has been reported to result in disseminated disease. Here, we show that activation of MyD88 and Card9 signal pathways are required for resistance to Coccidioides infection following subcutaneous challenge of C57BL/6 mice, which correlates with earlier findings of the protective response to pulmonary infection. MyD88(-/-) andCard9(-/-) mice recruited reduced numbers of T cells, B cells, and neutrophils to the Coccidioides-infected hypodermis com pared to wild-type mice; however, neutrophils were dispensable for resistance to skin infection. Further studies have shown that gamma interferon (IFN-γ) production and activation of Th1 cells characterize resistance to subcutaneous infection. Furthermore, activation of a phagosomal enzyme, inducible nitric oxide synthase, which is necessary for NO production, is a requisite for fungal clearance in the hypodermis. Collectively, our data demonstrate that MyD88- and Card9-mediated IFN-γ and nitric oxide production is essential for protection against subcutaneous Coccidioides infection. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Estrogen Receptor α Deficiency Modulates TLR Ligand-Mediated PDC-TREM Expression in Plasmacytoid Dendritic Cells in Lupus-Prone Mice.

PubMed

Scott, Jennifer L; Cunningham, Melissa A; Naga, Osama S; Wirth, Jena R; Eudaly, Jackie G; Gilkeson, Gary S

2015-12-15

Female lupus-prone NZM2410 estrogen receptor α (ERα)-deficient mice are protected from renal disease and have prolonged survival compared with wild-type littermates; however, the mechanism of protection is unknown. Plasmacytoid dendritic cells (pDCs) and type I IFN drive lupus pathogenesis. Estrogen acting via ERα enhances both pDC development and IFN production. The objectives for this study were to determine if ERα modulates pDC function and IFN activity in predisease NZM2410 mice as a possible protective mechanism of ERα deficiency in lupus-prone mice. We measured the effect of ERα deficiency on spleen pDC frequency, number, maturation, and activation state. ERα deficiency reduced type I IFN activity and the frequency of MHC class II(+) pDCs in the spleen without altering overall pDC frequency, number, or maturation state. Additionally, ERα-deficient NZM2410 mice had a significantly decreased frequency of pDCs expressing PDC-TREM, a modulator of TLR-mediated IFN production. After in vitro TLR9 stimulation, ERα deficiency significantly reduced the expression of PDC-TREM on pDCs from both NZM2410 and C57BL/6 mice. Thus, we have identified a significant effect of ERα deficiency on pDCs in predisease NZM2410 mice, which may represent a mechanism by which ERα deficiency protects NZM2410 mice from lupuslike disease. Copyright © 2015 by The American Association of Immunologists, Inc.

Use of interferon-gamma release assays in a health care worker screening program: experience from a tertiary care centre in the United States.

PubMed

Joshi, Manish; Monson, Thomas P; Woods, Gail L

2012-01-01

Interferon-gamma release assays including the QuantiFERON-TB Gold In-Tube test (QFT-GIT [Cellestis Ltd, Australia]) may be used in place of the tuberculin skin test (TST) in surveillance programs for Mycobacterium tuberculosis infection control. However, data on performance and practicality of the QFT-GIT in such programs for health care workers (HCWs) are limited. To assess the performance, practicality and reversion rate of the QFT-GIT among HCWs at a tertiary health care institution in the United States. Retrospective chart review of HCWs at Central Arkansas Veterans Healthcare System (Arkansas, USA) who underwent QFT-GIT testing as a part of their employee screening between November 1, 2008 and October 31, 2009. QFT-GIT was used to screen 3290 HCWs. The initial QFT-GIT was interpreted as positive for 129 (3.9%) HCWs, negative for 3155 (95.9%) and indeterminate for six (0.2%). Testing with QFT-GIT was repeated in 45 HCWs who had positive results on the initial test. The QFT-GIT reverted to negative in 18 (40.0%) HCWs, all of whom had negative TST status and initial interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL. The QFT-GIT test is feasible in large health care setting as an alternative to TST for M tuberculosis infection screening in HCWs but is not free from challenges. The major concerns are the high number of positive test results and high reversion rates on repeat testing, illustrating poor short-term reproducibility of positive QFT-GIT test results. These results suggest adopting a borderline zone between interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL, and cautious clinical interpretation of values in this range.

Bile acids override steatosis in farnesoid X receptor deficient mice in a model of non-alcoholic steatohepatitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Weibin; Liu, Xijun; Peng, Xiaomin

Highlights: • FXR deficiency enhanced MCD diet-induced hepatic fibrosis. • FXR deficiency attenuated MCD diet-induced hepatic steatosis. • FXR deficiency repressed genes involved in fatty acid uptake and triglyceride accumulation. - Abstract: Non-alcoholic fatty liver disease (NAFLD) is one of the most common liver diseases, and the pathogenesis is still not well known. The farnesoid X receptor (FXR) is a member of the nuclear hormone receptor superfamily and plays an essential role in maintaining bile acid and lipid homeostasis. In this study, we study the role of FXR in the pathogenesis of NFALD. We found that FXR deficient (FXR{sup −/−})more » mice fed methionine- and choline-deficient (MCD) diet had higher serum ALT and AST activities and lower hepatic triglyceride levels than wild-type (WT) mice fed MCD diet. Expression of genes involved in inflammation (VCAM-1) and fibrosis (α-SMA) was increased in FXR{sup −/−} mice fed MCD diet (FXR{sup −/−}/MCD) compared to WT mice fed MCD diet (WT/MCD). Although MCD diet significantly induced hepatic fibrosis in terms of liver histology, FXR{sup −/−}/MCD mice showed less degree of hepatic steatosis than WT/MCD mice. Moreover, FXR deficiency synergistically potentiated the elevation effects of MCD diet on serum and hepatic bile acids levels. The super-physiological concentrations of hepatic bile acids in FXR{sup −/−}/MCD mice inhibited the expression of genes involved in fatty acid uptake and triglyceride accumulation, which may be an explanation for less steatosis in FXR{sup −/−}/MCD mice in contrast to WT/MCD mice. These results suggest that hepatic bile acids accumulation could override simple steatosis in hepatic injury during the progression of NAFLD and further emphasize the role of FXR in maintaining hepatic bile acid homeostasis in liver disorders and in hepatic protection.« less

An IRF-3-, IRF-5-, and IRF-7-Independent Pathway of Dengue Viral Resistance Utilizes IRF-1 to Stimulate Type I and II Interferon Responses.

PubMed

Carlin, Aaron F; Plummer, Emily M; Vizcarra, Edward A; Sheets, Nicholas; Joo, Yunichel; Tang, William; Day, Jeremy; Greenbaum, Jay; Glass, Christopher K; Diamond, Michael S; Shresta, Sujan

2017-11-07

Interferon-regulatory factors (IRFs) are a family of transcription factors (TFs) that translate viral recognition into antiviral responses, including type I interferon (IFN) production. Dengue virus (DENV) and other clinically important flaviviruses are suppressed by type I IFN. While mice lacking the type I IFN receptor (Ifnar1 -/- ) succumb to DENV infection, we found that mice deficient in three transcription factors controlling type I IFN production (Irf3 -/- Irf5 -/- Irf7 -/- triple knockout [TKO]) survive DENV challenge. DENV infection of TKO mice resulted in minimal type I IFN production but a robust type II IFN (IFN-γ) response. Using loss-of-function approaches for various molecules, we demonstrate that the IRF-3-, IRF-5-, IRF-7-independent pathway predominantly utilizes IFN-γ and, to a lesser degree, type I IFNs. This pathway signals via IRF-1 to stimulate interleukin-12 (IL-12) production and IFN-γ response. These results reveal a key antiviral role for IRF-1 by activating both type I and II IFN responses during DENV infection. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Use of Piezoelectric Immunosensors for Detection of Interferon-Gamma Interaction with Specific Antibodies in the Presence of Released-Active Forms of Antibodies to Interferon-Gamma

PubMed Central

Don, Elena; Farafonova, Olga; Pokhil, Suzanna; Barykina, Darya; Nikiforova, Marina; Shulga, Darya; Borshcheva, Alena; Tarasov, Sergey; Ermolaeva, Tatyana; Epstein, Oleg

2016-01-01

In preliminary ELISA studies where released-active forms (RAF) of antibodies (Abs) to interferon-gamma (IFNg) were added to the antigen-antibody system, a statistically significant difference in absorbance signals obtained in their presence in comparison to placebo was observed. A piezoelectric immunosensor assay was developed to support these data and investigate the effects of RAF Abs to IFNg on the specific interaction between Abs to IFNg and IFNg. The experimental conditions were designed and optimal electrode coating, detection circumstances and suitable chaotropic agents for electrode regeneration were selected. The developed technique was found to provide high repeatability, intermediate precision and specificity. The difference between the analytical signals of RAF Ab samples and those of the placebo was up to 50.8%, whereas the difference between non-specific controls and the placebo was within 5%–6%. Thus, the piezoelectric immunosensor as well as ELISA has the potential to be used for detecting the effects of RAF Abs to IFNg on the antigen-antibody interaction, which might be the result of RAF’s ability to modify the affinity of IFNg to specific/related Abs. PMID:26791304

Plasminogen activator inhibitor-1 deficiency ameliorates insulin resistance and hyperlipidemia but not bone loss in obese female mice.

PubMed

Tamura, Yukinori; Kawao, Naoyuki; Yano, Masato; Okada, Kiyotaka; Matsuo, Osamu; Kaji, Hiroshi

2014-05-01

We previously demonstrated that plasminogen activator inhibitor-1 (PAI-1), an inhibitor of fibrinolysis, is involved in type 1 diabetic bone loss in female mice. PAI-1 is well known as an adipogenic factor induced by obesity. We therefore examined the effects of PAI-1 deficiency on bone and glucose and lipid metabolism in high-fat and high-sucrose diet (HF/HSD)-induced obese female mice. Female wild-type (WT) and PAI-1-deficient mice were fed with HF/HSD or normal diet for 20 weeks from 10 weeks of age. HF/HSD increased the levels of plasma PAI-1 in WT mice. PAI-1 deficiency suppressed the levels of blood glucose, plasma insulin, and total cholesterol elevated by obesity. Moreover, PAI-1 deficiency improved glucose intolerance and insulin resistance induced by obesity. Bone mineral density (BMD) at trabecular bone as well as the levels of osterix, alkaline phosphatase, and receptor activator of nuclear factor κB ligand mRNA in tibia were decreased by HF/HSD in WT mice, and those changes by HF/HSD were not affected by PAI-1 deficiency. HF/HSD increased the levels of plasma TNF-α in both WT and PAI-1-deficient mice, and the levels of plasma TNF-α were negatively correlated with trabecular BMD in tibia of female mice. In conclusion, we revealed that PAI-1 deficiency does not affect the trabecular bone loss induced by obesity despite the amelioration of insulin resistance and hyperlipidemia in female mice. Our data suggest that the changes of BMD and bone metabolism by obesity might be independent of PAI-1 as well as glucose and lipid metabolism.

Deficiency of Endogenous Acute Phase Serum Amyloid A Does Not Impact Atherosclerotic Lesions in ApoE-/- Mice

PubMed Central

De Beer, Maria C; Wroblewski, Joanne M; Noffsinger, Victoria P; Rateri, Debra L; Howatt, Deborah A; Balakrishnan, Anju; Ji, Ailing; Shridas, Preetha; Thompson, Joel C; van der Westhuyzen, Deneys R; Tannock, Lisa R; Daugherty, Alan; Webb, Nancy R; De Beer, Frederick C

2014-01-01

Objective Although elevated plasma concentrations of serum amyloid A (SAA) are strongly associated with increased risk for atherosclerotic cardiovascular disease in humans, the role of SAA in the pathogenesis of lesion formation remains obscure. Our goal was to determine the impact of SAA deficiency on atherosclerosis in hypercholesterolemic mice. Approach and Results ApoE-/- mice, either wild type or deficient in both major acute phase SAA isoforms, SAA1.1 and SAA2.1 (SAAWT and SAAKO, respectively), were fed a normal rodent diet for 50 weeks. Female, but not male SAAKO mice had a modest increase (22%; p ≤ 0.05) in plasma cholesterol concentrations and a 53% increase in adipose mass compared to SAAWT mice that did not impact the plasma cytokine levels or the expression of adipose tissue inflammatory markers. SAA deficiency did not impact lipoprotein cholesterol distributions or plasma triglyceride concentrations in either male or female mice. Atherosclerotic lesion areas measured on the intimal surfaces of the arch, thoracic, and abdominal regions were not significantly different between SAAKO and SAAWT mice in either gender. To accelerate lesion formation, mice were fed a Western diet for 12 weeks. SAA deficiency had no effect on diet-induced alterations in plasma cholesterol, triglyceride or cytokine concentrationsn or on aortic atherosclerotic lesion areas in either male or female mice. In addition, SAA deficiency in male mice had no effect on lesion areas or macrophage accumulation in the aortic roots. Conclusions The absence of endogenous SAA1.1 and 2.1 does not impact atherosclerotic lipid deposition in apoE-/- mice fed either normal or Western diets. PMID:24265416

IL-15-deficient mice develop enhanced allergic responses to airway allergen exposure

PubMed Central

Mathias, Clinton B.; Schramm, Craig M.; Guernsey, Linda A.; Wu, Carol A.; Polukort, Stephanie H.; Rovatti, Jeffrey; Ser-Dolansky, Jennifer; Secor, Eric; Schneider, Sallie S.; Thrall, Roger S.; Aguila, Hector L.

2017-01-01

Background Interleukin-15 is a pleiotropic cytokine that is critical for the development and survival of multiple hematopoietic lineages. Mice lacking IL-15 have selective defects in populations of several pro-allergic immune cells including natural killer (NK) cells, NKT cells, and memory CD8+T cells. We therefore hypothesized that IL-15−/− mice will have reduced inflammatory responses during the development of allergic airway disease (AAD). Objective To determine whether IL-15−/− mice have attenuated allergic responses in a mouse model of AAD. Methods C57BL/6 wild-type (WT) and IL-15−/− mice were sensitized and challenged with ovalbumin (OVA) and the development of AAD was ascertained by examining changes in airway inflammatory responses, Th2 responses, and lung histopathology. Results Here we report that IL-15−/− mice developed enhanced allergic responses in an OVA-induced model of AAD. In the absence of IL-15, OVA-challenged mice exhibited enhanced bronchial eosinophilic inflammation, elevated IL-13 production, and severe lung histopathology in comparison with WT mice. In addition, increased numbers of CD4+T and B cells in the spleens and broncholaveolar lavage (BAL) were also observed. Examination of OVA-challenged IL-15Rα−/− animals revealed a similar phenotype resulting in enhanced airway eosinophilia compared to WT mice. Adoptive transfer of splenic CD8+T cells from OVA-sensitized WT mice suppressed the enhancement of eosinophilia in IL-15−/− animals to levels observed in WT mice, but had no further effects. Conclusion and Clinical Relevance These data demonstrate that mice with an endogenous IL-15 deficiency are susceptible to the development of severe, enhanced Th2-mediated AAD, which can be regulated by CD8+T cells. Furthermore, the development of disease as well as allergen-specific Th2 responses occurs despite deficiencies in several IL-15-dependent cell types including NK, NKT, and γδ T cells, suggesting that these cells or

Adult vitamin D deficiency exacerbates impairments caused by social stress in BALB/c and C57BL/6 mice.

PubMed

Groves, Natalie J; Zhou, Mei; Jhaveri, Dhanisha J; McGrath, John J; Burne, Thomas H J

2017-12-01

Vitamin D deficiency is prevalent in adults throughout the world. Epidemiological studies have shown significant associations between vitamin D deficiency and an increased risk of various neuropsychiatric and neurodegenerative disorders, such as schizophrenia, depression, Alzheimer's disease and cognitive impairment. However, studies based on observational epidemiology cannot address questions of causality; they cannot determine if vitamin D deficiency is a causal factor leading to the adverse health outcome. The main aim of this study was to determine if AVD deficiency would exacerbate the effects of a secondary exposure, in this case social stress, in BALB/c mice and in the more resilient C57BL/6 mice. Ten-week old male BALB/c and C57BL/6 mice were fed a control or vitamin D deficient diet for 10 weeks, and the mice were further separated into one of two groups for social treatment, either Separated (SEP) or Social Defeat (DEF). SEP mice were placed two per cage with a perforated Plexiglas divider, whereas the DEF mice underwent 10days of social defeat prior to behavioural testing. We found that AVD-deficient mice were more vulnerable to the effects of social stress using a social avoidance test, and this was dependent on strain. These results support the hypothesis that vitamin D deficiency may exacerbate behavioural outcomes in mice vulnerable to stress, a finding that can help guide future studies. Importantly, these discoveries support the epidemiological link between vitamin D deficiency and neuropsychiatric and neurodegenerative disorders; and has provided clues that can guide future studies related to unravelling the mechanisms of action linking adult vitamin D deficiency and adverse brain related outcomes. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

Stress-induced alterations in interferon production and class II histocompatibility antigen expression

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Cunnick, J. E.; Armfield, A. V.; Wood, P. G.; Rabin, B. S.

1992-01-01

Mild electric foot-shock has been shown to be a stressor that can alter immune responses. Male Lewis rats were exposed to one session of 16 5.0-s 1.6-mA foot-shocks. Production of interferon-gamma by splenocytes in response to concanavalin-A was decreased in spleens from the shocked rats compared to control spleens. Spleen cells from rats treated with nadolol, a peripherally acting beta-adrenergic receptor antagonist, and then shocked, showed dose-dependent attenuation of the suppression of interferon-gamma production. This suggests that catecholamines mediate shock-induced suppression of interferon-gamma production. The percentage of splenic mononuclear cells expressing class II histocompatibility (Ia) antigens on their surfaces from spleens of shocked rats was determined by flow cytometry. Significantly decreased class II positive mononuclear cells were present in the spleens of shocked rats in comparison to the spleens of control rats. This may reflect an alteration of cell trafficking or decreased production of class II antigens.

RIPK3 Mediates Necroptosis during Embryonic Development and Postnatal Inflammation in Fadd-Deficient Mice.

PubMed

Zhao, Qun; Yu, XianJun; Zhang, HaiWei; Liu, YongBo; Zhang, XiXi; Wu, XiaoXia; Xie, Qun; Li, Ming; Ying, Hao; Zhang, Haibing

2017-04-25

RIPK3 mediates cell death and regulates inflammatory responses. Although genetic studies have suggested that RIPK3-MLKL-mediated necroptosis leads to embryonic lethality in Fadd or Caspase-8-deficient mice, the exact mechanisms are not fully understood. Here, we generated Ripk3 mutant mice by altering the RIPK3 kinase domain (Ripk3 Δ/Δ mice), thus abolishing its kinase activity. Ripk3 Δ/Δ cells were resistant to necroptosis stimulation in vitro, and Ripk3 Δ/Δ mice were protected from necroptotic diseases. Although the Ripk3 Δ/Δ mutation rescued embryonic lethality in Fadd -/- embryos, Fadd -/- Ripk3 Δ/Δ mice died within 1 day after birth due to massive inflammation. These results indicate that Ripk3 ablation rescues embryonic lethality in Fadd-deficient mice by suppressing two RIPK3-mediating processes: necroptosis during embryogenesis and inflammation during postnatal development in Fadd -/- mice. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Loss of stearoyl-CoA desaturase 1 rescues cardiac function in obese leptin-deficient mice.

PubMed

Dobrzyn, Pawel; Dobrzyn, Agnieszka; Miyazaki, Makoto; Ntambi, James M

2010-08-01

The heart of leptin-deficient ob/ob mice is characterized by pathologic left ventricular hypertrophy along with elevated triglyceride (TG) content, increased stearoyl-CoA desaturase (SCD) activity, and increased myocyte apoptosis. In the present study, using an ob/ob;SCD1(-/-) mouse model, we tested the hypothesis that lack of SCD1 could improve steatosis and left ventricle (LV) function in leptin deficiency. We show that disruption of the SCD1 gene improves cardiac function in ob/ob mice by correcting systolic and diastolic dysfunction without affecting levels of plasma TG and FFA. The improvement is associated with reduced expression of genes involved in FA transport and lipid synthesis in the heart, as well as reduction in cardiac FFA, diacylglycerol, TG, and ceramide levels. The rate of FA beta-oxidation is also significantly lower in the heart of ob/ob;SCD1(-/-) mice compared with ob/ob controls. Moreover, SCD1 deficiency reduces cardiac apoptosis in ob/ob mice due to increased expression of antiapoptotic factor Bcl-2 and inhibition of inducible nitric oxide synthase and caspase-3 activities. Reduction in myocardial lipid accumulation and inhibition of apoptosis appear to be one of the main mechanisms responsible for improved LV function in ob/ob mice caused by SCD1 deficiency.

Isoflurane anesthesia exacerbates learning and memory impairment in zinc-deficient APP/PS1 transgenic mice.

PubMed

Feng, Chunsheng; Liu, Ya; Yuan, Ye; Cui, Weiwei; Zheng, Feng; Ma, Yuan; Piao, Meihua

2016-12-01

Zinc (Zn) is known to play crucial roles in numerous brain functions including learning and memory. Zn deficiency is believed to be widespread throughout the world, particularly in patients with Alzheimer's disease (AD). A number of studies have shown that volatile anesthetics, such as isoflurane, might be potential risk factors for the development of AD. However, whether isoflurane exposure accelerates the process of AD and cognitive impairment in AD patients with Zn deficiency is yet to be documented. The aim of the present study was to explore the effects of 1.4% isoflurane exposure for 2 h on learning and memory function, and neuropathogenesis in 10-month-old Zn-adequate, Zn-deficient, and Zn-treated APP/PS1 mice with the following parameters: behavioral tests, neuronal apoptosis, Aβ, and tau pathology. The results demonstrated that isoflurane exposure showed no impact on learning and memory function, but induced transient elevation of neuroapoptosis in Zn-adequate APP/PS1 mice. Exposure of isoflurane exhibited significant neuroapoptosis, Aβ generation, tau phosphorylation, and learning and memory impairment in APP/PS1 mice in the presence of Zn deficiency. Appropriate Zn treatment improved learning and memory function, and prevented isoflurane-induced neuroapoptosis in APP/PS1 mice. Isoflurane exposure may cause potential neurotoxicity, which is tolerated to some extent in Zn-adequate APP/PS1 mice. When this tolerance is limited, like in AD with Zn deficiency, isoflurane exposure markedly exacerbated learning and memory impairment, and neuropathology, indicating that AD patients with certain conditions such as Zn deficiency may be vulnerable to volatile anesthetic isoflurane. Copyright © 2016 Elsevier Ltd. All rights reserved.

Toll-like receptor 4 (TLR4) deficient mice are protected from adipose tissue inflammation in aging.

PubMed

Ghosh, Amiya K; O'Brien, Martin; Mau, Theresa; Yung, Raymond

2017-09-07

Adipose tissue (AT) inflammation is a central mechanism for metabolic dysfunction in both diet-induced obesity and age-associated obesity. Studies in diet-induced obesity have characterized the role of Fetuin A (Fet A) in Free Fatty Acids (FFA)-mediated TLR4 activation and adipose tissue inflammation. However, the role of Fet A & TLR4 in aging-related adipose tissue inflammation is unknown. In the current study, analysis of epidymymal fat pads of C57/Bl6 male mice, we found that, in contrast to data from diet-induced obesity models, adipose tissue from aged mice have normal Fet A and TLR4 expression. Interestingly, aged TLR4-deficient mice have diminished adipose tissue inflammation compared to normal controls. We further demonstrated that reduced AT inflammation in old TLR4-deficient mice is linked to impaired ER stress, augmented autophagy activity, and diminished senescence phenomenon. Importantly, old TLR4-deficient mice have improved glucose tolerance compared to age-matched wild type mice, suggesting that the observed reduced AT inflammation in aged TLR4-deficient mice has important physiological consequences. Taken together, our present study establishes novel aspect of aging-associated AT inflammation that is distinct from diet-induced AT inflammation. Our results also provide strong evidence that TLR4 plays a significant role in promoting aging adipose tissue inflammation.

Toll-like receptor 4 (TLR4) deficient mice are protected from adipose tissue inflammation in aging

PubMed Central

Ghosh, Amiya K.; O'Brien, Martin; Mau, Theresa; Yung, Raymond

2017-01-01

Adipose tissue (AT) inflammation is a central mechanism for metabolic dysfunction in both diet-induced obesity and age-associated obesity. Studies in diet-induced obesity have characterized the role of Fetuin A (Fet A) in Free Fatty Acids (FFA)-mediated TLR4 activation and adipose tissue inflammation. However, the role of Fet A & TLR4 in aging-related adipose tissue inflammation is unknown. In the current study, analysis of epidymymal fat pads of C57/Bl6 male mice, we found that, in contrast to data from diet-induced obesity models, adipose tissue from aged mice have normal Fet A and TLR4 expression. Interestingly, aged TLR4-deficient mice have diminished adipose tissue inflammation compared to normal controls. We further demonstrated that reduced AT inflammation in old TLR4-deficient mice is linked to impaired ER stress, augmented autophagy activity, and diminished senescence phenomenon. Importantly, old TLR4-deficient mice have improved glucose tolerance compared to age-matched wild type mice, suggesting that the observed reduced AT inflammation in aged TLR4-deficient mice has important physiological consequences. Taken together, our present study establishes novel aspect of aging-associated AT inflammation that is distinct from diet-induced AT inflammation. Our results also provide strong evidence that TLR4 plays a significant role in promoting aging adipose tissue inflammation. PMID:28898202

Type I interferon signals in macrophages and dendritic cells control dengue virus infection: implications for a new mouse model to test dengue vaccines.

PubMed

Züst, Roland; Toh, Ying-Xiu; Valdés, Iris; Cerny, Daniela; Heinrich, Julia; Hermida, Lisset; Marcos, Ernesto; Guillén, Gerardo; Kalinke, Ulrich; Shi, Pei-Yong; Fink, Katja

2014-07-01

Dengue virus (DENV) infects an estimated 400 million people every year, causing prolonged morbidity and sometimes mortality. Development of an effective vaccine has been hampered by the lack of appropriate small animal models; mice are naturally not susceptible to DENV and only become infected if highly immunocompromised. Mouse models lacking both type I and type II interferon (IFN) receptors (AG129 mice) or the type I IFN receptor (IFNAR(-/-) mice) are susceptible to infection with mouse-adapted DENV strains but are severely impaired in mounting functional immune responses to the virus and thus are of limited use for study. Here we used conditional deletion of the type I IFN receptor (IFNAR) on individual immune cell subtypes to generate a minimally manipulated mouse model that is susceptible to DENV while retaining global immune competence. Mice lacking IFNAR expression on CD11c(+) dendritic cells and LysM(+) macrophages succumbed completely to DENV infection, while mice deficient in the receptor on either CD11c(+) or LysM(+) cells were susceptible to infection but often resolved viremia and recovered fully from infection. Conditional IFNAR mice responded with a swift and strong CD8(+) T-cell response to viral infection, compared to a weak response in IFNAR(-/-) mice. Furthermore, mice lacking IFNAR on either CD11c(+) or LysM(+) cells were also sufficiently immunocompetent to raise a protective immune response to a candidate subunit vaccine against DENV-2. These data demonstrate that mice with conditional deficiencies in expression of the IFNAR represent improved models for the study of DENV immunology and screening of vaccine candidates. Dengue virus infects 400 million people every year worldwide, causing 100 million clinically apparent infections, which can be fatal if untreated. Despite many years of research, there are no effective vaccine and no antiviral treatment available for dengue. Development of vaccines has been hampered in particular by the lack of

Macrophage deficiency of Akt2 reduces atherosclerosis in Ldlr null mice[S

PubMed Central

Babaev, Vladimir R.; Hebron, Katie E.; Wiese, Carrie B.; Toth, Cynthia L.; Ding, Lei; Zhang, Youmin; May, James M.; Fazio, Sergio; Vickers, Kasey C.; Linton, MacRae F.

2014-01-01

Macrophages play crucial roles in the formation of atherosclerotic lesions. Akt, a serine/threonine protein kinase B, is vital for cell proliferation, migration, and survival. Macrophages express three Akt isoforms, Akt1, Akt2, and Akt3, but the roles of Akt1 and Akt2 in atherosclerosis in vivo remain unclear. To dissect the impact of macrophage Akt1 and Akt2 on early atherosclerosis, we generated mice with hematopoietic deficiency of Akt1 or Akt2. After 8 weeks on Western diet, Ldlr−/− mice reconstituted with Akt1−/− fetal liver cells (Akt1−/−→Ldlr−/−) had similar atherosclerotic lesion areas compared with control mice transplanted with WT cells (WT→Ldlr−/−). In contrast, Akt2−/−→Ldlr−/− mice had dramatically reduced atherosclerotic lesions compared with WT→Ldlr−/− mice of both genders. Similarly, in the setting of advanced atherosclerotic lesions, Akt2−/−→Ldlr−/− mice had smaller aortic lesions compared with WT→Ldlr−/− and Akt1−/−→Ldlr−/− mice. Importantly, Akt2−/−→Ldlr−/− mice had reduced numbers of proinflammatory blood monocytes expressing Ly-6Chi and chemokine C-C motif receptor 2. Peritoneal macrophages isolated from Akt2−/− mice were skewed toward an M2 phenotype and showed decreased expression of proinflammatory genes and reduced cell migration. Our data demonstrate that loss of Akt2 suppresses the ability of macrophages to undergo M1 polarization reducing both early and advanced atherosclerosis. PMID:25240046

Inhibition of autoimmune diabetes in NOD mice with serum from streptococcal preparation (OK-432)-injected mice.

PubMed Central

Seino, H; Satoh, J; Shintani, S; Takahashi, K; Zhu, X P; Masuda, T; Nobunaga, T; Saito, M; Terano, Y; Toyota, T

1991-01-01

We have recently reported that systemic and chronic administration of recombinant tumour necrosis factor alpha (TNF-alpha), as well as streptococcal preparation (OK-432), inhibits development of insulin-dependent diabetes mellitus (IDDM) in NOD mice and BB rats, models of IDDM. In this study we examined whether serum containing endogenous TNF induced by OK-432 injection could inhibit IDDM in NOD mice. Treatment twice a week from 4 weeks of age with OK-432-injected mouse serum, which contained endogenous TNF (75U), but not IL-1, IL-2 and interferon-gamma (IFN-gamma) activity, reduced the intensity of insulitis and significantly inhibited the cumulative incidence of diabetes by 28 weeks of age in NOD mice, as compared with the incidence in non-treated mice (P less than 0.01) and in mice treated with control serum (P less than 0.02). This inhibitory effect of the serum was diminished, although not significantly, by neutralization of serum TNF activity with anti-mouse TNF antibody. In the mice treated with the serum from OK-432-injected mice, Thy-1.2+ or CD8+ spleen cells decreased (P less than 0.01) and surface-Ig+ (S-Ig+) cells increased (P less than 0.05), whereas the proliferative response of spleen cells to concanavalin A (P less than 0.01) and lipopolysaccharide (P less than 0.05) increased. The results indicate that the inhibition by OK-432 treatment of IDDM in NOD mice was partially mediated by serum factors including endogenous TNF. PMID:1747949

Activation of c-Raf-1 kinase signal transduction pathway in alpha(7) integrin-deficient mice.

PubMed

Saher, G; Hildt, E

1999-09-24

Integrin alpha(7)-deficient mice develop a novel form of muscular dystrophy. Here we report that deficiency of alpha(7) integrin causes an activation of the c-Raf-1/mitogen-activated protein (MAP) 2 kinase signal transduction pathway in muscle cells. The observed activation of c-Raf-1/MAP2 kinases is a specific effect, because the alpha(7) integrin deficiency does not cause unspecific stress as determined by measurement of the Hsp72/73 level and activity of the JNK2 kinase. Because an increased level of activated FAK was found in muscle of alpha(7) integrin-deficient mice, the activation of c-Raf-1 kinase is triggered most likely by an integrin-dependent pathway. In accordance with this, in the integrin alpha(7)-deficient mice, part of the integrin beta(1D) variant in muscle is replaced by the beta(1A) variant, which permits the FAK activation. A recent report describes that integrin activity can be down-modulated by the c-Raf-1/MAP2 kinase pathway. Specific activation of the c-Raf-1/MAP2 kinases by cell-permeable peptides in skeletal muscle of rabbits causes degeneration of muscle fibers. Therefore, we conclude that in alpha(7) integrin-deficient mice, the continuous activation of c-Raf-1 kinase causes a permanent reduction of integrin activity diminishing integrin-dependent cell-matrix interactions and thereby contributing to the development of the dystrophic phenotype.

Interferon-gamma alone triggers the production of nitric oxide from serum-starved BNL CL.2, murine embryonic liver cells.

PubMed

Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T

1999-01-01

A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.

Interferon-gamma exerts its negative regulatory effect primarily on the earliest stages of murine erythroid progenitor cell development.

PubMed

Wang, C Q; Udupa, K B; Lipschitz, D A

1995-01-01

Interferon-gamma (INF-gamma) has been shown to suppress erythropoiesis and perhaps to contribute to the anemia of chronic disease. In this study we demonstrated that the concentration of INF gamma required to suppress murine burst forming unit-erythroid (BFU-E) growth was significantly less than that required to suppress colony forming unit-erythroid (CFU-E) growth. INF gamma acted at the most primitive step in erythroid progenitor cell differentiation and proliferation, as inhibition was maximal when added at the time of BFU-E culture initiation. Inhibition was progressively less if INF gamma addition was delayed after culture initiation. The effects of INF gamma on BFU-E did not require the presence of interleukin-1 alpha (IL-1 alpha), tumor necrosis factor-alpha (TNF alpha), or granulocyte macrophage colony stimulating factor (GM-CSF), as its effects were not neutralized by monoclonal antibodies against IL-1 alpha, TNF alpha, or GM-CSF. This applied whether INF gamma was added to culture with individual antibodies or with a combination of all three antibodies. INF gamma was not required for IL-1 alpha- or TNF alpha-induced suppression of BFU-E, as their effects were not neutralized by a monoclonal anti-INF gamma antibody. In contrast, GM-CSF-induced suppression of BFU-E was negated by the simultaneous addition of anti-INF gamma. We have previously shown that the addition of TNF alpha does not suppress BFU-E growth in cultures from marrow depleted of macrophages. Suppression did occur, however, if a small concentration of INF gamma that does not inhibit and increasing concentration of TNF alpha were added to culture, suggesting a synergistic effect between INF-gamma and TNF alpha. These observations suggest that INF gamma is a potent direct inhibitor of erythroid colony growth in vitro. It exerts its negative regulatory effect primarily on the earliest stages of erythroid progenitor cell differentiation and proliferation, as much higher doses are required to

Cerebral protein kinase C and its mRNA level in apolipoprotein E-deficient mice.

PubMed

Hung, M C; Hayase, K; Yoshida, R; Sato, M; Imaizumi, K

2001-08-10

It is known that protein kinase C (PKC) activity may be one of the fundamental cellular changes associated with memory function. Apolipoprotein E (apoE) deficiency causes cholinergic deficits and memory impairment. ApoE-deficient mouse has been employed as a serviceable model for studying the relation between apoE and the memory deficit induced by cholinergic impairment. Brain-fatty acid binding protein (b-FABP) might be functional during development of the nervous system. Peroxisome proliferator-activated receptor (PPAR) is involved in the early change in lipid metabolism. We investigated the alterations not only in cerebral PKC activity, but also in the gene expressions of PKC-beta, brain-FABP and PPAR-alpha in apoE-deficient mice. The results showed that there was a lower cerebral membrane-bound PKC activity in the apoE-deficient mice than in its wild type strain (C57BL/6). But there were no significant differences in cytosolic PKC activity. PKC-beta, b-FABP and PPAR-alpha mRNA expressions in cerebrum were lowered in apoE-deficient mice. These findings may be involved in the dysfunction of the brain neurotransmission system in apoE-deficient mouse. Alternatively, these results also suggest that cerebral apoE plays an important role in brain PKC activation by maintaining an appropriate expression of b-FABP and PPAR-alpha mRNAs.

Interferon-γ : The Major Mediator of Resistance against Toxoplasma gondii

NASA Astrophysics Data System (ADS)

Suzuki, Yasuhiro; Orellana, Manuel A.; Schreiber, Robert D.; Remington, Jack S.

1988-04-01

Mice were injected with a monoclonal antibody to interferon-γ to examine the importance of endogenous production of this lymphokine in resistance against infection with the sporozoan parasite Toxoplasma gondii. Mice with intraperitoneal infections of T. gondii that received no antibody survived and developed chronic T. gondii infection, whereas the infected mice that received the monoclonal antibody died of toxoplasmosis. The activation of macrophages, which kill T. gondii in vivo, was inhibited by administration of the monoclonal antibody, but the production of antibodies to T. gondii was not suppressed. The fact that an antibody to interferon-γ can eliminate resistance to acute Toxoplasma infection in mice suggests that this lymphokine is an important mediator of host resistance to this parasite.

CD4+ T-Cell- and Gamma Interferon-Dependent Protection against Murine Malaria by Immunization with Linear Synthetic Peptides from a Plasmodium yoelii 17-Kilodalton Hepatocyte Erythrocyte Protein

PubMed Central

Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.

1999-01-01

Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206

Human Atopic Dermatitis Complicated by Eczema Herpeticum is Associated with Abnormalities in Gamma Interferon Response

PubMed Central

Leung, Donald YM; Gao, Pei-Song; Grigoryev, Dmitry N; Rafaels, Nicholas M; Streib, Joanne E; Howell, Michael D; Taylor, Patricia A; Boguniewicz, Mark; Canniff, Jennifer; Armstrong, Brian; Zaccaro, Daniel J; Schneider, Lynda C; Hata, Tissa R; Hanifin, Jon M; Beck, Lisa A; Weinberg, Adriana; Barnes, Kathleen C

2011-01-01

Background The basis for increased susceptibility of atopic dermatitis (AD) patients to develop disseminated viral skin infections such as eczema herpeticum (ADEH+) is poorly understood. Objective We sought to determine whether atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Methods GeneChip profiling was used to identify differences in gene expression of peripheral blood mononuclear cells (PBMC) from patients with a history of ADEH+ as compared to ADEH− and non-atopic controls. Key differences in protein expression were verified by ELISPOT and/or ELISA. Clinical relevance was further demonstrated by a mouse model of disseminated viral skin infection and genetic association analysis for genetic variants in IFNG and IFNGR1 and ADEH among 435 cases and controls. Results We demonstrate by global gene expression analysis selective transcriptomic changes within the interferon (IFN) superfamily of PBMCs from ADEH+ subjects reflecting low IFNγ and IFNγ receptor gene expression. IFNγ protein production was also significantly lower in ADEH+ (N=24) compared to ADEH− (N=20) and non-atopic (NA; N=20) controls. IFNγ receptor knockout (KO) mice developed disseminated viral skin infection after epicutaneous challenge with vaccinia virus (VV). Genetic variants in IFNG and IFNGR1 SNPs were significantly associated with ADEH (112 cases, 166 controls) and IFNγ production: a 2-SNP (A–G) IFNGR1 haplotype (rs10457655 and rs7749390) showed the strongest association with a reduced risk of ADEH+ ((13.2% ADEH+ vs 25.5% ADEH−, P = 0.00057). Conclusions ADEH+ patients have reduced IFNγ production, and IFNG and IFNGR1 SNPs are significantly associated with ADEH+ and may contribute to an impaired immune response to herpes simplex virus (HSV). Clinical Implications Atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Capsule summary Using genomic

Autism-like Deficits in Shank3-Deficient Mice Are Rescued by Targeting Actin Regulators.

PubMed

Duffney, Lara J; Zhong, Ping; Wei, Jing; Matas, Emmanuel; Cheng, Jia; Qin, Luye; Ma, Kaijie; Dietz, David M; Kajiwara, Yuji; Buxbaum, Joseph D; Yan, Zhen

2015-06-09

Haploinsufficiency of the Shank3 gene, which encodes a scaffolding protein at glutamatergic synapses, is a highly prevalent and penetrant risk factor for autism. Using combined behavioral, electrophysiological, biochemical, imaging, and molecular approaches, we find that Shank3-deficient mice exhibit autism-like social deficits and repetitive behaviors, as well as the significantly diminished NMDA receptor (NMDAR) synaptic function and synaptic distribution in prefrontal cortex. Concomitantly, Shank3-deficient mice have a marked loss of cortical actin filaments, which is associated with the reduced Rac1/PAK activity and increased activity of cofilin, the major actin depolymerizing factor. The social deficits and NMDAR hypofunction are rescued by inhibiting cofilin or activating Rac1 in Shank3-deficient mice and are induced by inhibiting PAK or Rac1 in wild-type mice. These results indicate that the aberrant regulation of synaptic actin filaments and loss of synaptic NMDARs contribute to the manifestation of autism-like phenotypes. Thus, targeting actin regulators provides a strategy for autism treatment. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Dietary apigenin attenuates the development of atopic dermatitis-like skin lesions in NC/Nga mice.

PubMed

Yano, Satomi; Umeda, Daisuke; Yamashita, Shuya; Yamada, Koji; Tachibana, Hirofumi

2009-11-01

One of the flavones, apigenin has various physiological functions including anti-inflammatory activities. Atopic dermatitis (AD) is a chronically relapsing inflammatory disorder that is characterized by pruritic and eczematous skin lesions. To evaluate the anti-allergic effect of apigenin in vivo, we examined the effect of dietary apigenin on picrylchloride (PiCl)-induced AD-like pathology in NC/Nga mice. NC/Nga mice were fed experimental diets containing apigenin from Day 18 after sensitized with PiCl for 4 weeks. Dietary apigenin significantly alleviated the development of skin lesions, accompanied by lower serum immunoglobulin (Ig) G1 and IgE levels in NC/Nga mice. Interferon (IFN)-gamma mRNA expression level in spleen cells from NC/Nga mice was reduced by apigenin feeding. Moreover, interleukin 4-induced signal transducers and activators of transcription 6 phosphorylation in primary spleen cells from BALB/c mice was inhibited by treatment with apigenin. These results suggest that apigenin attenuates exacerbation of AD-like symptoms in part through the reduction of serum IgE level and IFN-gamma expression in NC/Nga mice.

Type I interleukin-1 receptor is required for pulmonary responses to subacute ozone exposure in mice.

PubMed

Johnston, Richard A; Mizgerd, Joseph P; Flynt, Lesley; Quinton, Lee J; Williams, Erin S; Shore, Stephanie A

2007-10-01

Interleukin (IL)-1, a proinflammatory cytokine, is expressed in the lung after ozone (O(3)) exposure. IL-1 mediates its effects through the type I IL-1 receptor (IL-1RI), the only signaling receptor for both IL-1alpha and IL-1beta. The purpose of this study was to determine the role of IL-1RI in pulmonary responses to O(3.) To that end, wild-type, C57BL/6 (IL-1RI(+/+)) mice and IL-1RI-deficient (IL-1RI(-/-)) mice were exposed to O(3) either subacutely (0.3 ppm for 72 h) or acutely (2 ppm for 3 h). Subacute O(3) exposure increased bronchoalveolar lavage fluid (BALF) protein, interferon-gamma-inducible protein (IP)-10, soluble tumor necrosis factor receptor 1 (sTNFR1), and neutrophils in IL-1RI(+/+) and IL-1RI(-/-) mice. With the exception of IP-10, all outcome indicators were reduced in IL-1RI(-/-) mice. Furthermore, subacute O(3) exposure increased IL-6 mRNA expression in IL-1RI(+/+), but not IL-1RI(-/-) mice. Acute (2 ppm) O(3) exposure increased BALF protein, IL-6, eotaxin, KC, macrophage inflammatory protein (MIP)-2, IP-10, monocyte chemotactic protein-1, sTNFR1, neutrophils, and epithelial cells in IL-1RI(+/+) and IL-1RI(-/-) mice. For IL-6, eotaxin, MIP-2, and sTNFR1, there were small but significant reductions of these outcome indicators in IL-1RI(-/-) versus IL-1RI(+/+) mice at 6 hours after exposure, but not at other time points, whereas other outcome indicators were unaffected by IL-1RI deficiency. These results suggest that IL-1RI is required for O(3)-induced pulmonary inflammation during subacute O(3) exposure, but plays a more minor role during acute O(3) exposure. In addition, these results suggest that the induction of IL-6 via IL-1RI may be important in mediating the effects of O(3) during subacute exposure.

Host defense against systemic infection with Streptococcus pneumoniae is impaired in E-, P-, and E-/P-selectin-deficient mice.

PubMed Central

Munoz, F M; Hawkins, E P; Bullard, D C; Beaudet, A L; Kaplan, S L

1997-01-01

Endothelial selectins mediate rolling of leukocytes on endothelium, a crucial step for leukocyte firm adhesion and emigration into sites of tissue injury and infection. To characterize the role of the endothelial selectins during bacterial sepsis in vivo, Streptococcus pneumoniae (1-10 x 10(6) colony-forming units) was inoculated intraperitoneally into wild-type mice and mice with E-, P-, or E-/P-selectin deficiencies. Mice were followed 10 d for morbidity, survival, clearance of bacteremia, and leukocyte migration to the peritoneal cavity and organs 48 h after infection. All selectin-deficient mice showed a more pronounced morbidity, a significantly higher mortality associated with persistent bacteremia, and a higher bacterial load when compared with wild-type mice. These differences were most remarkable in the E-selectin-deficient mice, which showed the highest rate of mortality and bacteremia (P deficient mice. Although the absence of endothelial selectins did not substantially impair leukocyte emigration to sites of infection 48 h after pneumococcal sepsis, it resulted in increased mortality and a higher bacterial load in the bloodstream of selectin-deficient mice. These results demonstrate a definitive phenotypic abnormality in E-selectin-deficient mice, and suggest that E- and P-selectin are important in the host defense against S. pneumoniae infection. PMID:9329976

Effects of propolis and gamma-cyclodextrin on intestinal neoplasia in normal weight and obese mice.

PubMed

Cho, Youngjin; Gutierrez, Linda; Bordonaro, Michael; Russo, Daniel; Anzelmi, Frank; Hooven, Jayde T; Cerra, Carmine; Lazarova, Darina L

2016-09-01

Obesity is associated with colorectal cancer (CRC). This effect might be attributed to adipokine-supported signaling. We have established that propolis suppresses survival signaling in CRC cells in vitro; therefore, we ascertained the ability of a propolis supplement to modulate intestinal neoplastic development in C57BL/6J-ApcMin/+/J mice in the lean and obese state. To induce obesity, mice were fed with a Western diet containing 40% fat. Since the propolis supplement includes gamma-cyclodextrin, the interventions included diets supplemented with or without gamma-cyclodextrin. The animals were administered the following diets: (1) control diet, (2) control diet/gamma-cyclodextrin, (3) control diet/propolis, (4) Western diet, (5) Western diet/gamma-cyclodextrin, and (6) Western diet/propolis. Western diet, resulting in obesity, accelerated neoplastic progression, as evidenced by the larger size and higher grade dysplasia of the neoplasms. In the context of normal weight, gamma-cyclodextrin and propolis affected neoplastic progression, as determined by the size of the lesions and their grade of dysplasia. A statistically significant decrease in the number of adenomas was detected in mice fed a control diet with the propolis supplement (61.8 ± 10.6 vs. 35.3 ± 7.6, P = 0.008). Although there was no significant difference in the polyp numbers between the six groups, the mice with the lowest number and size of adenomas were those fed a Western diet with gamma-cyclodextrin. This unexpected outcome might be explained by the increased levels of apoptosis detected in the intestinal tissues of these obese mice. We posit that butyrate derived from the metabolism of gamma-cyclodextrin may contribute to the decreased neoplastic burden in the context of obesity; however, future studies are required to address this possibility. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

In vivo treatment with interleukin 12 protects mice from immune abnormalities observed during murine acquired immunodeficiency syndrome (MAIDS)

PubMed Central

1994-01-01

Lymphoproliferation, chronic B cell activation resulting in hypergammaglobulinemia, and profound immunodeficiency are prominent features of a retrovirus-induced syndrome designated murine acquired immunodeficiency syndrome (MAIDS). In vivo treatment of infected mice with recombinant interleukin 12 (IL-12) beginning at the time of infection or up to 9 wk after virus inoculation markedly inhibited the development of splenomegaly and lymphadenopathy, as well as B cell activation and Ig secretion. Treatment with IL-12 also had major effects in preventing induction of several immune defects including impaired production of interferon gamma (IFN-gamma) and IL-2 and depressed proliferative responses to various stimuli. The therapeutic effects of IL-12 on the immune system of mice with MAIDS were also associated with reduced expression of the retrovirus that causes this disease (BM5def), with lesser effects on expression of ecotropic MuLV. IL-12 treatment was not effective in IFN-gamma knockout mice or in infected mice treated simultaneously with IL-12 and anti-IFN-gamma. These results demonstrate that induction and progression of MAIDS are antagonized by IL-12 through high-level expression of IFN-gamma and may provide an experimental basis for developing treatments of retrovirus- induced immune disorders with similar immunopathogenic mechanisms. PMID:7964495

Physiological and glycomic characterization of N-acetylglucosaminyltransferase-IVa and -IVb double deficient mice

PubMed Central

Takamatsu, Shinji; Antonopoulos, Aristotelis; Ohtsubo, Kazuaki; Ditto, David; Chiba, Yasunori; Le, Dzung T.; Morris, Howard R.; Haslam, Stuart M.; Dell, Anne; Marth, Jamey D.; Taniguchi, Naoyuki

2010-01-01

N-Acetylglucosaminyltransferase-IV (GnT-IV) has two isoenzymes, GnT-IVa and GnT-IVb, which initiate the GlcNAcβ1-4 branch synthesis on the Manα1-3 arm of the N-glycan core thereby increasing N-glycan branch complexity and conferring endogenous lectin binding epitopes. To elucidate the physiological significance of GnT-IV, we engineered and characterized GnT-IVb-deficient mice and further generated GnT-IVa/-IVb double deficient mice. In wild-type mice, GnT-IVa expression is restricted to gastrointestinal tissues, whereas GnT-IVb is broadly expressed among organs. GnT-IVb deficiency induced aberrant GnT-IVa expression corresponding to the GnT-IVb distribution pattern that might be attributed to increased Ets-1, which conceivably activates the Mgat4a promoter, and thereafter preserved apparent GnT-IV activity. The compensative GnT-IVa expression might contribute to amelioration of the GnT-IVb-deficient phenotype. GnT-IVb deficiency showed mild phenotypic alterations in hematopoietic cell populations and hemostasis. GnT-IVa/-IVb double deficiency completely abolished GnT-IV activity that resulted in the disappearance of the GlcNAcβ1-4 branch on the Manα1-3 arm that was confirmed by MALDI-TOF MS and GC-MS linkage analyses. Comprehensive glycomic analyses revealed that the abundance of terminal moieties was preserved in GnT-IVa/-IVb double deficiency that was due to the elevated expression of glycosyltransferases regarding synthesis of terminal moieties. Thereby, this may maintain the expression of glycan ligands for endogenous lectins and prevent cellular dysfunctions. The fact that the phenotype of GnT-IVa/-IVb double deficiency largely overlapped that of GnT-IVa single deficiency can be attributed to the induced glycomic compensation. This is the first report that mammalian organs have highly organized glycomic compensation systems to preserve N-glycan branch complexity. PMID:20015870

Iron Overload and Heart Fibrosis in Mice Deficient for Both β2-Microglobulin and Rag1

PubMed Central

Santos, Manuela M.; de Sousa, Maria; Rademakers, Luke H. P. M.; Clevers, Hans; Marx, J. J. M.; Schilham, Marco W.

2000-01-01

Genetic causes of hereditary hemochromatosis (HH) include mutations in the HFE gene, a β2-microglobulin (β2m)-associated major histocompatibility complex class I-like protein. Accordingly, mutant β2m−/− mice have increased intestinal iron absorption and develop parenchymal iron overload in the liver. In humans, other genetic and environmental factors have been suggested to influence the pathology and severity of HH. Previously, an association has been reported between low numbers of lymphocytes and the severity of clinical expression of the iron overload in HH. In the present study, the effect of a total absence of lymphocytes on iron overload was investigated by crossing β2m−/− mice (which develop iron overload resembling human disease) with mice deficient in recombinase activator gene 1 (Rag1), which is required for normal B and T lymphocyte development. Iron overload was more severe in β2mRag1 double-deficient mice than in each of the single deficient mice, with iron accumulation in parenchymal cells of the liver, in acinar cells of the pancreas, and in heart myocytes. With increasing age β2mRag1−/− mice develop extensive heart fibrosis, which could be prevented by reconstitution with normal hematopoietic cells. Thus, the development of iron-mediated cellular damage is substantially enhanced when a Rag1 mutation, which causes a lack of mature lymphocytes, is introduced into β2m−/− mice. Mice deficient in β2m and Rag1 thus offer a new experimental model of iron-related cardiomyopathy. PMID:11106561