USDA-ARS?s Scientific Manuscript database
Gamma interferon (IFN-gamma)-induced protein 10 (IP-10) has recently shown promise as a diagnostic biomarker of Mycobacterium tuberculosis infection of humans. The aim of the current study was to compare IP-10 and IFN-gamma responses upon Mycobacterium bovis infection in cattle using archived sample...
Wang, Xiao Yang; Crowston, Jonathan G; White, Andrew J R; Zoellner, Hans; Healey, Paul R
2014-08-01
The aim of the study was to investigate, using a native mitomycin-C-resistant human Tenon's fibroblast cell line, the possibility that interferon-alpha and gamma could be used with Fas agonists as an alternative anti-fibrotic strategy to mitomycin-C in trabeculectomy. A clinically resistant and in vitro verified mitomycin-C-resistant human Tenon's fibroblast cell line was pretreated with interferon-alpha and interferon-gamma for 48 h before stimulation with an agonistic Fas antibody (CH11) for 2 days to induce cell death. Cell death assays were undertaken. Changes in apoptosis-related proteins were determined by flow cytometry and Western blot. Pretreatment with interferon-alpha or interferon-gamma for 48 h increased Fas, Fas-associated protein with death domain and caspase-8 expression. Protein expression was further increased by combined exposure to interferon-alpha and gamma. Pretreatment with cytokines had no effect on Fas-L and Bcl-2. Interferon-alpha alone did not change the rate of induced cell death. A combination of interferon-alpha and gamma synergistically increased the sensitivity of mitomycin-C-resistant human Tenon's fibroblast cell line to induced cell death. An antagonistic anti-Fas antibody (ZB4) completely blocked induced cell death. Broad caspase inhibitors specific for caspases-8 and -3 reduced induced deaths in interferon pretreated mitomycin-C-resistant human Tenon's fibroblast cell line in a dose-dependent manner. Interferon-alpha and interferon-gamma render mitomycin-C-resistant human Tenon's fibroblast cell line sensitive to Fas-mediated apoptosis. The mechanism involves increased death-inducing signalling complex formation by upregulation of Fas, Fas-associated protein with death domain and caspase-8 expression. © 2013 Royal Australian and New Zealand College of Ophthalmologists.
Interferon-gamma inhibits HIV-induced invasiveness of monocytes.
Dhawan, S; Wahl, L M; Heredia, A; Zhang, Y; Epstein, J S; Meltzer, M S; Hewlett, I K
1995-12-01
HIV-infected monocytes form highly invasive network on basement membrane matrix and secrete high levels of 92-kd metalloproteinase (MMP-9), an enzyme that degrades basement membrane proteins. In the present study, using matrigel as a model basement membrane system, we demonstrate that treatment of human immunodeficiency virus (HIV)-infected monocytes with interferon-gamma at 50 U/ml inhibited the ability of infected monocytes to form an invasive network on matrigel and their invasion through the matrigel matrix. These effects were associated with a significant reduction in the levels of MMP-9 produced by HIV-infected monocytes treated with interferon-gamma 1 day prior to infection with HIV as compared with that of untreated HIV-infected monocytes. Monocytes treated with interferon-gamma 1 day after HIV infection showed the presence of integrated HIV sequences; however, the levels of MMP-9 were substantially lower than those produced by monocytes inoculated with live HIV, heat-inactivated HIV, or even the control uninfected monocytes. Exposure of monocytes to heat-inactivated HIV did not result in increased invasiveness or high MMP-9 production, suggesting that regulation of metalloproteinase by monocytes was independent of CD4-gp120 interactions and required active virus infection. Furthermore, addition of interferon-gamma to monocytes on day 10 after infection inhibited MMP-9 production by more than threefold with no significant reduction of virus replication. These results indicate that the mechanism of interferon-gamma-induced down-regulation of MMP-9 levels and reduced monocyte invasiveness may be mediated by a mechanism independent of antiviral activity of IFN-gamma in monocytes. Down-regulation of MMP-9 in HIV-infected monocytes by interferon-gamma may play an important role in the control of HIV pathogenesis.
(PCG) Protein Crystal Growth Gamma-Interferon
NASA Technical Reports Server (NTRS)
1989-01-01
(PCG) Protein Crystal Growth Gamma-Interferon. Stimulates the body's immune system and is used clinically in the treatment of cancer. Potential as an anti-tumor agent against solid tumors as well as leukemia's and lymphomas. It has additional utility as an anti-ineffective agent, including antiviral, anti-bacterial, and anti-parasitic activities. Principal Investigator on STS-26 was Charles Bugg.
Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor
Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian
2014-01-01
Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970
Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael
2014-01-01
Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.
Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research
Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study suggests that interferon-gamma, which has been thought to contribute to an innate defense system against cancer, under some circumstances, may instead promote melanoma and incite the development of tumors.
Interferon-gamma enhances radiation-induced cell death via downregulation of Chk1
Kim, Kwang Seok; Choi, Kyu Jin; Bae, Sangwoo
2012-01-01
Interferon-gamma (IFNγ) is a cytokine with roles in immune responses as well as in tumor control. Interferon is often used in cancer treatment together with other therapies. Here we report a novel approach to enhancement of cancer cell killing by combined treatment of IFNγ with ionizing radiation. We found that IFNγ treatment alone in HeLa cells induced phosphorylation of Chk1 in a time- and dose-dependent manner, and resulted in cell arrest. Moreover IFNγ treatment was correlated with attenuation of Chk1 as the treatment shortened protein half-life of Chk1. As Chk1 is an essential cell cycle regulator for viability after DNA damage, attenuation of Chk1 by IFNγ pre-treatment in HeLa cells resulted in increased cell death following ionizing radiation about 2-folds than ionizing radiation treatment alone whereas IFNγ treatment alone had little effect on cell death. X-linked inhibitor of apoptosis-associated factor 1 (XAF1), an IFN-induced gene, seems to partly regulate IFNγ-induced Chk1 destabilization and radiation sensitivity because transient depletion of XAF1 by siRNA prevented IFNγ-induced Chk1 attenuation and partly protected cells from IFNγ-enhanced radiation cell killing. Therefore the results provide a novel rationale to combine IFNγ pretreatment and DNA-damaging anti-cancer drugs such as ionizing radiation to enhance cancer cell killing. PMID:22825336
D'Ombrain, Marthe C; Voss, Till S; Maier, Alexander G; Pearce, J Andrew; Hansen, Diana S; Cowman, Alan F; Schofield, Louis
2007-08-16
Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP-1) is a variable antigen expressed by P. falciparum, the malarial parasite. PfEMP-1, present on the surface of infected host erythrocytes, mediates erythrocyte binding to vascular endothelium, enabling the parasite to avoid splenic clearance. In addition, PfEMP-1 is proposed to regulate host immune responses via interactions with the CD36 receptor on antigen-presenting cells. We investigated the immunoregulatory function of PfEMP-1 by comparing host cell responses to erythrocytes infected with either wild-type parasites or transgenic parasites lacking PfEMP-1. We showed that PfEMP-1 suppresses the production of the cytokine interferon-gamma by human peripheral blood mononuclear cells early after exposure to P. falciparum. Suppression of this rapid proinflammatory response was CD36 independent and specific to interferon-gamma production by gammadelta-T, NK, and alphabeta-T cells. These data demonstrate a parasite strategy for downregulating the proinflammatory interferon-gamma response and further establish transgenic parasites lacking PfEMP-1 as powerful tools for elucidating PfEMP-1 functions.
Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research
Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study
Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma.
Magee, Kelsey E; Kelsey, Christina E; Kurzinski, Katherine L; Ho, Jonhan; Mlakar, Logan R; Feghali-Bostwick, Carol A; Torok, Kathryn S
2013-01-01
The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS.
Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma
2013-01-01
Introduction The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. Methods The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). Results IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Conclusions Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS. PMID:24499523
Ruiz-Ruiz, Carmen; López-Rivas, Abelardo
2002-01-01
Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL/APO-2L) induces apoptosis in a variety of tumour cells upon binding to death receptors TRAIL-R1 and TRAIL-R2. Here we describe the sensitization by interferon (IFN)-gamma to TRAIL-induced apoptosis in the breast tumour cell lines MCF-7 and MDA-MB231. IFN-gamma promoted TRAIL-mediated activation of caspase-8, Bcl-2 interacting domain death agonist (Bid) degradation, Bcl-2-associated X protein (Bax) translocation to mitochondria, cytochrome c release to the cytosol and activation of caspase-9 in these cell lines. No changes in the expression of TRAIL receptors were observed upon IFN-gamma treatment. Overexpression of Bcl-2 in MCF-7 cells completely inhibited IFN-gamma-induced sensitization to TRAIL-mediated cell death. Interestingly, TRAIL-induced apoptosis was also clearly enhanced by IFN-gamma in caspase-3-overexpressing MCF-7 cells, in the absence of Bax translocation to mitochondria and cytochrome c release to the cytosol. In summary, our results suggest that IFN-gamma facilitates TRAIL-induced activation of mitochondria-regulated as well as mitochondria-independent apoptotic pathways in breast tumour cells. PMID:11936954
Kim, S; Ponka, P
2000-03-03
Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.
Gao, Y; Chenping; Lin, X P
1997-10-01
In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.
[Interferon. An overview of the state of basic research with special regard to interferon-gamma].
Günther, G; Otto, B
1993-02-01
Interferons / An overview on the state of basic research with special regard to interferon-gamma Interferons are multifunctional glycoproteins with a broad range of antiviral, antiproliferative and immunoregulatory effects on the target cell. This review deals with the basics as well as with more recent developments in interferon research. A historic overview of 35 years of interferon research since the discovery of interferons by Isaacs and Lindenmann in 1957 introduces the most important milestones in this field and appreciates the work of the participating researchers. A brief description of the classification of interferons based on different tissue sources, different antigenic properties and different induction behaviour is made. The main part of this review focuses on human interferon-gamma. We discuss recent work on the structure-function relationship of interferon-gamma. The interferon-gamma receptor and its role in signal transduction is another part of this paper. The structure and length of the C-terminal region of interferon-gamma seems to be important for receptor binding and expression of biological activities. A conservative estimate is that the family of IFN-activated genes numbers 15-20 in most cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung
2008-09-12
Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less
Plasma interferon-gamma-inducible protein-10 (IP-10) levels during acute hepatitis C virus infection
Grebely, Jason; Feld, Jordan J.; Applegate, Tanya; Matthews, Gail V.; Hellard, Margaret; Sherker, Alana; Petoumenos, Kathy; Zang, Geng; Shaw, Ineke; Yeung, Barbara; George, Jacob; Teutsch, Suzy; Kaldor, John M.; Cherepanov, Vera; Bruneau, Julie; Shoukry, Naglaa H.; Lloyd, Andrew R.; Dore, Gregory J.
2013-01-01
Systemic levels of interferon-gamma-inducible protein-10 (IP-10) are predictive of treatment-induced clearance in chronic HCV. In the present study, factors associated with plasma IP-10 levels at the time of acute HCV detection and the association between IP-10 levels and spontaneous clearance were assessed in three cohorts of acute HCV infection. Among 300 individuals, 245 (181 male, 47 HIV+) were HCV RNA+ at acute HCV detection. In adjusted analysis, factors independently associated with IP-10 levels ≥150 pg/mL (median level) included HCV RNA levels >6 log IU/mL, HIV co-infection and non-Aboriginal ethnicity. Among 245 HCV RNA+ at acute HCV detection, 214 were untreated (n=137) or had persistent infection (infection duration ≥26 weeks) at treatment initiation (n=77). Spontaneous clearance occurred in 14% (29 of 214). Individuals without spontaneous clearance had significantly higher mean plasma IP-10 levels at the time of acute HCV detection than those with clearance (248±32 vs. 142±22 pg/mL, P=0.008). The proportion of individuals with spontaneous clearance was 0% (0 of 22, P=0.048) and 16% (27 of 165) and in those in those with and without plasma IP-10 levels ≥380 pg/mL. In adjusted analyses, favourable IL28B genotype was associated with spontaneous clearance, while higher HCV RNA level was independently associated with lower odds of spontaneous clearance. Conclusion High IP-10 levels at acute HCV detection were associated with failure to spontaneously clear HCV. Patients with acute HCV and high baseline IP-10 levels, particularly >380 pg/mL, should be considered for early therapeutic intervention, and those with low levels should defer therapy for potential spontaneous clearance. PMID:23325615
Bjerre, Anna; Brusletto, Berit; Høiby, Ernst Arne; Kierulf, Peter; Brandtzaeg, Petter
2004-02-01
To analyze plasma interferon-gamma and interleukin-10 concentrations in patients with systemic meningococcal disease and patients with severe Gram-positive septic shock caused by Streptococcus pneumoniae or Staphylococcus aureus. To study the in vitro cytokine (interferon-gamma and interleukin-10) responses in a whole blood model boosted with heat-killed Neisseria meningitidis, S. pneumoniae, and S. aureus before and after treatment with recombinant interleukin-10 or recombinant interferon-gamma. Experimental study. Laboratory. Plasma samples were collected from patients with systemic meningococcal disease (n = 66) and patients with severe Gram-positive septic shock caused by S. pneumoniae (n = 4) or S. aureus (n = 3). Whole blood was boosted with heat-killed N. meningitidis, S. pneumoniae, and S. aureus (1 x 106 colony forming units/mL), and plasmas were analyzed for interleukin-10 or interferon-gamma at 0, 5, 12, and 24 hrs. Furthermore, recombinant interleukin-10 or recombinant interferon-gamma was added before bacteria, and the effect on the secretion of interferon-gamma and interleukin-10, respectively, was analyzed after 24 hrs. The median concentration of interferon-gamma was 15 pg/mL and of interleukin-10 was 10,269 pg/mL in patients with meningococcal septic shock (n = 24) compared with median interferon-gamma concentration of 3400 pg/mL and interleukin-10 concentration of 465 pg/mL in patients with severe Gram-positive shock (p =.001). Increased interferon-gamma concentrations were associated with case fatality (p =.011). In a whole blood model we demonstrated that 1 x 106 colony forming units/mL of N. meningitidis induced more interleukin-10 but less interferon-gamma than S. pneumoniae. S. aureus induced minimal secretion of both cytokines. Recombinant interleukin-10 efficiently down-regulated the secretion of interferon-gamma, and vice versa, as shown in a whole blood model. We speculate whether high concentrations of interleukin-10 contribute to the
Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N
2006-01-01
Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.
Cerebrospinal fluid interferon-gamma-inducible protein 10 (IP-10, CXCL10) in HIV-1 infection.
Cinque, Paola; Bestetti, Arabella; Marenzi, Roberta; Sala, Serena; Gisslen, Magnus; Hagberg, Lars; Price, Richard W
2005-11-01
Interferon-gamma-inducible protein (IP-10 or CXCL10) is a potent chemoattractant and has been suggested to enhance retrovirus infection and mediate neuronal injury. In order to assess this chemokine in central nervous system (CNS) HIV infection, we measured the cerebrospinal fluid (CSF) and plasma concentrations of CXCL10 by immunoassay in samples derived from 97 HIV-infected subjects across a spectrum of immunological progression and CNS complications and from 16 HIV seronegative control subjects studied at three clinical centers between 1994 and 2001. We also examined changes in the CSF and plasma CXCL10 concentrations in 30 subjects starting and three stopping antiretroviral therapy. CSF CXCL10 concentrations: (1) correlated with CSF HIV RNA and white blood cell (WBC) counts, but not with blood CXCL10, HIV RNA, or CD4 counts; (2) were increased in subjects with primary and asymptomatic HIV infections and AIDS dementia complex, but less frequently in those with more advanced infection, with or without CNS opportunistic diseases except cytomegalovirus encephalitis; (3) decreased in subjects starting antiretroviral in association with decreases in CSF and plasma HIV RNA and CSF WBCs; and (4) conversely, increased in subjects stopping treatment in parallel with CSF HIV RNA and WBCs. These results confirm that CSF CXCL10 associates closely with both CSF HIV and WBCs and suggest that this chemokine may be both a response to and contributing determinant of local infection. High CSF levels may be useful in the diagnosis of ADC in subjects with advanced immunosuppression in whom CMV encephalitis has been ruled out, though this issue requires further study.
Interferon-alpha and interferon-gamma sensitize human tenon fibroblasts to mitomycin-C.
Wang, Xiao Yang; Crowston, Jonathan G; Zoellner, Hans; Healey, Paul R
2007-08-01
To investigate the effect of interferon (IFN)-alpha and IFN-gamma pretreatment on mitomycin C (MMC)-induced cell death in human Tenon fibroblasts (HTFs) and the mechanisms by which IFN-alpha and IFN-gamma modulate the susceptibility of HTFs to MMC. HTFs were pretreated with IFN-alpha and IFN-gamma for 48 hours before 5-minute application of 0.4 mg/mL MMC. Cell death after 48 hours was determined by Annexin V/propidium iodide (PI) staining and lactate dehydrogenase (LDH) release assay. Fas, Fas-ligand, and Bcl-2 expression were determined by flow cytometry. Fas associated death domain (FADD), Bax, cytochrome c, and caspase expression were determined by Western blot analysis and immunofluorescence staining. MMC treatment increased cell death and upregulated Fas and FADD expression, but had no effect on Fas-Ligand, Bax, Bcl-2, or cytochrome c. Neither IFN-alpha nor IFN-gamma alone induced HTF death, but each increased cell death 2 days after MMC treatment in a dose-dependent fashion. Combination IFN-alpha and IFN-gamma had a synergistic effect. IFN-alpha and IFN-gamma pretreatment increased Fas expression. Fas upregulation was associated with increased sensitivity to MMC. IFN pretreatment increased procaspase-8, procaspase-9, and procaspase-3 expression, and caspase-3 activation. Caspase-8, caspase-3, and broad caspase inhibitors, but not caspase-9 inhibitor, inhibited MMC-induced cell death in nonpretreated and IFN-pretreated cells. IFN-alpha and IFN-gamma enhance the susceptibility of HTFs to MMC-induced cell death through a Fas-mediated and a caspase-3-dependent pathway. Pretreatment with IFN primed HTFs to MMC, providing a potential means for initially slowing the healing response with IFN and subsequently terminating fibroblast activity through MMC-induced cell death.
Kim, Ji-Yeon; Lee, Dong-Hyung; Joo, Jong-Kil; Jin, Jun-O; Wang, Ji-Won; Hong, Young-Seoub; Kwak, Jong-Young; Lee, Kyu-Sup
2009-09-01
Intraperitoneal immuno-inflammatory changes may be associated with the pathogenesis of endometriosis. We evaluated the effects of peritoneal fluid obtained from patients with endometriosis (ePF) on the release of interferon-gamma-induced protein-10 (IP-10/CXCL10) and interleukin-8 (IL-8/CXCL8) by neutrophils, CD4(+) T cells, and monocytes. Neutrophils, CD4(+) T cells, and monocytes were cultured with ePF and the chemokine levels in the supernatants were then measured using enzyme-linked immunosorbent assay. The addition of ePF to cultures of CD4(+) T cells led to a significant increase in the release of IP-10 when compared with control PF without endometriosis (cPF). There was a positive correlation between the levels of IL-8 and IP-10 in ePF (R = 0.89, P = 0.041), but not between the levels of IP-10 and IL-8 released by neutrophils, CD4(+) T cells, and monocytes. The levels of IP-10 in ePF were positively correlated with the release of IP-10 by ePF-treated neutrophils (R = 0.89, P < 0.001), CD4(+) T cells (R = 0.93, P < 0.001), and monocytes (R = 0.70, P = 0.01). Moreover, the addition of ePF significantly enhanced the interferon-gamma-induced release of IP-10 by nuetrophils and CD4(+) T cells. These findings suggest that neutrophils and T cells release differential levels of IP-10 and IL-8 in response to stimulation with ePF, and that these cells are a major source of IP-10 in the PF of endometriosis patients.
Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T
1999-01-01
A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.
Badie, B; Schartner, J; Vorpahl, J; Preston, K
2000-04-01
Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.
Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten
2014-01-01
ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID
Razaghi, Ali; Owens, Leigh; Heimann, Kirsten
2016-12-20
Human interferon gamma is a cytokine belonging to a diverse group of interferons which have a crucial immunological function against mycobacteria and a wide variety of viral infections. To date, it has been approved for treatment of chronic granulomatous disease and malignant osteopetrosis, and its application as an immunotherapeutic agent against cancer is an increasing prospect. Recombinant human interferon gamma, as a lucrative biopharmaceutical, has been engineered in different expression systems including prokaryotic, protozoan, fungal (yeasts), plant, insect and mammalian cells. Human interferon gamma is commonly expressed in Escherichia coli, marketed as ACTIMMUNE ® , however, the resulting product of the prokaryotic expression system is unglycosylated with a short half-life in the bloodstream; the purification process is tedious and makes the product costlier. Other expression systems also did not show satisfactory results in terms of yields, the biological activity of the protein or economic viability. Thus, the review aims to synthesise available information from previous studies on the production of human interferon gamma and its glycosylation patterns in different expression systems, to provide direction to future research in this field. Copyright © 2016 Elsevier B.V. All rights reserved.
... in people with severe, malignant osteopetrosis (an inherited bone disease). Interferon gamma-1b is in a class of ... you may have flu-like symptoms such as headache, fever, chills, muscle aches, and tiredness after your ...
Designing of interferon-gamma inducing MHC class-II binders
2013-01-01
Background The generation of interferon-gamma (IFN-γ) by MHC class II activated CD4+ T helper cells play a substantial contribution in the control of infections such as caused by Mycobacterium tuberculosis. In the past, numerous methods have been developed for predicting MHC class II binders that can activate T-helper cells. Best of author’s knowledge, no method has been developed so far that can predict the type of cytokine will be secreted by these MHC Class II binders or T-helper epitopes. In this study, an attempt has been made to predict the IFN-γ inducing peptides. The main dataset used in this study contains 3705 IFN-γ inducing and 6728 non-IFN-γ inducing MHC class II binders. Another dataset called IFNgOnly contains 4483 IFN-γ inducing epitopes and 2160 epitopes that induce other cytokine except IFN-γ. In addition we have alternate dataset that contains IFN-γ inducing and equal number of random peptides. Results It was observed that the peptide length, positional conservation of residues and amino acid composition affects IFN-γ inducing capabilities of these peptides. We identified the motifs in IFN-γ inducing binders/peptides using MERCI software. Our analysis indicates that IFN-γ inducing and non-inducing peptides can be discriminated using above features. We developed models for predicting IFN-γ inducing peptides using various approaches like machine learning technique, motifs-based search, and hybrid approach. Our best model based on the hybrid approach achieved maximum prediction accuracy of 82.10% with MCC of 0.62 on main dataset. We also developed hybrid model on IFNgOnly dataset and achieved maximum accuracy of 81.39% with 0.57 MCC. Conclusion Based on this study, we have developed a webserver for predicting i) IFN-γ inducing peptides, ii) virtual screening of peptide libraries and iii) identification of IFN-γ inducing regions in antigen (http://crdd.osdd.net/raghava/ifnepitope/). Reviewers This article was reviewed by Prof Kurt
Interferon-γ Inhibits Ebola Virus Infection.
Rhein, Bethany A; Powers, Linda S; Rogers, Kai; Anantpadma, Manu; Singh, Brajesh K; Sakurai, Yasuteru; Bair, Thomas; Miller-Hunt, Catherine; Sinn, Patrick; Davey, Robert A; Monick, Martha M; Maury, Wendy
2015-01-01
Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.
Tenforde, Mark W.; Gupte, Nikhil; Dowdy, David W.; Asmuth, David M.; Balagopal, Ashwin; Pollard, Richard B.; Sugandhavesa, Patcharaphan; Lama, Javier R.; Pillay, Sandy; Cardoso, Sandra W.; Pawar, Jyoti; Santos, Breno; Riviere, Cynthia; Mwelase, Noluthando; Kanyama, Cecilia; Kumwenda, Johnstone; Hakim, James G.; Kumarasamy, Nagalingeswaran; Bollinger, Robert; Semba, Richard D.; Campbell, Thomas B.; Gupta, Amita
2015-01-01
Objective The association between pre-antiretroviral (ART) inflammation and immune activation and risk for incident tuberculosis (TB) after ART initiation among adults is uncertain. Design Nested case-control study (n = 332) within ACTG PEARLS trial of three ART regimens among 1571 HIV-infected, treatment-naïve adults in 9 countries. We compared cases (participants with incident TB diagnosed by 96 weeks) to a random sample of controls (participants who did not develop TB, stratified by country and treatment arm). Methods We measured pre-ART C-reactive protein (CRP), EndoCab IgM, ferritin, interferon gamma (IFN-γ), interleukin 6 (IL-6), interferon gamma-inducible protein 10 (IP-10), lipopolysaccharide (LPS), soluble CD14 (sCD14), tumor necrosis factor alpha (TNF-α), and CD4/DR+/38+ and CD8/DR+/38+ T cells. Markers were defined according to established cutoff definitions when available, 75th percentile of measured values when not, and detectable versus undetectable for LPS. Using logistic regression, we measured associations between biomarkers and incident TB, adjusting for age, sex, study site, treatment arm, baseline CD4 and log10 viral load. We assessed the discriminatory value of biomarkers using receiver operating characteristic (ROC) analysis. Results Seventy-seven persons (4.9%) developed incident TB during follow-up. Elevated baseline CRP (aOR 3.25, 95% CI: 1.55–6.81) and IP-10 (aOR 1.89, 95% CI: 1.05–3.39), detectable plasma LPS (aOR 2.39, 95% CI: 1.13–5.06), and the established TB risk factors anemia and hypoalbuminemia were independently associated with incident TB. In ROC analysis, CRP, albumin, and LPS improved discrimination only modestly for TB risk when added to baseline routine patient characteristics including CD4 count, body mass index, and prior TB. Conclusion Incident TB occurs commonly after ART initiation. Although associated with higher post-ART TB risk, baseline CRP, IP-10, and LPS add limited value to routine patient characteristics
Resistance to Virus Infection Conferred by the Interferon-Induced Promyelocytic Leukemia Protein
Chelbi-Alix, Mounira K.; Quignon, Frédérique; Pelicano, Luis; Koken, Marcel H. M.; de Thé, Hugues
1998-01-01
The interferon (IFN)-induced promyelocytic leukemia (PML) protein is specifically associated with nuclear bodies (NBs) whose functions are yet unknown. Two of the NB-associated proteins, PML and Sp100, are induced by IFN. Here we show that overexpression of PML and not Sp100 induces resistance to infections by vesicular stomatitis virus (VSV) (a rhabdovirus) and influenza A virus (an orthomyxovirus) but not by encephalomyocarditis virus (a picornavirus). Inhibition of viral multiplication was dependent on both the level of PML expression and the multiplicity of infection and reached 100-fold. PML was shown to interfere with VSV mRNA and protein synthesis. Compared to the IFN mediator MxA protein, PML had less powerful antiviral activity. While nuclear body localization of PML did not seem to be required for the antiviral effect, deletion of the PML coiled-coil domain completely abolished it. Taken together, these results suggest that PML can contribute to the antiviral state induced in IFN-treated cells. PMID:9444998
The immunomodulatory effects of interferon-gamma on mature B-lymphocyte responses.
Jurado, A; Carballido, J; Griffel, H; Hochkeppel, H K; Wetzel, G D
1989-06-15
Interferon-gamma (IFN-gamma) exerts a broad spectrum of activities which affect the responses of mature B-cells. It strongly inhibits B-cell activation, acts as a B-cell growth factor (BCGF), and also induces final differentiation to immunoglobulin (Ig) production. IFN-gamma is deeply involved in the differential control of isotype expression, as it enhances IgG2a production and suppresses both IgG1 and IgE production. Although it is now possible to draw a general scheme of the effects of IFN-gamma on B-cells, a number of paradoxical results still exist in the field. In this manuscript, different experimental systems are analyzed in an attempt to explain these apparent paradoxes.
Chang, Chia-Chu; Kor, Chew-Teng; Chen, Ting-Yu; Wu, Hung-Ming
2017-01-01
Introduction Sleep disturbance is very common in menopausal women and poor sleep quality has been linked to systemic inflammation. However, the impact of poor sleep quality on health outcomes of menopausal women remains unclear. This study evaluated the relationships between sleep quality and inflammation in menopausal women. Participants and design This cross-sectional study enrolled 281 healthy women aged 45 to 60 years. The Pittsburgh Sleep Quality Index (PSQI) was used to measure quality of sleep. Multiplex assays were used to measure the levels of 9 cytokines in morning fasting plasma samples. Other variables measured in this study included clinical characteristics and high-sensitivity C-reactive protein (hs-CRP). Setting The study was performed at a medical center. Results The 281 participants comprised 79 (28%) perimenopausal women and 202 (72%) postmenopausal women. Global PSQI scores were positively correlated with plasma hs-CRP levels (P = 0.012) and were marginally associated with interferon gamma-inducible protein-10 (IP10), interleukin 6 (IL6), and macrophage inflammatory protein-1beta (MIP-1β) levels. After adjusting for age, body mass index, menopause duration, and follicle stimulating hormone, multiple linear regression analysis revealed that high PSQI scores and sleep efficiency < 65% were associated with elevated plasma levels of hs-CRP, IP10, and IL6. In addition, sleep duration < 5 hours was associated with high hs-CRP levels. Conclusion Our data show that poor sleep quality and low sleep efficiency are associated with elevated levels of circulating inflammatory factors IP10, IL6 and hs-CRP and that short sleep duration is associated with high levels of hs-CRP in menopausal women. These findings provide novel evidence that poor sleep quality is linked to low-grade systemic inflammation in menopausal women. PMID:28060925
Toscana virus induces interferon although its NSs protein reveals antagonistic activity.
Gori Savellini, Gianni; Weber, Friedemann; Terrosi, Chiara; Habjan, Matthias; Martorelli, Barbara; Cusi, Maria Grazia
2011-01-01
Toscana virus (TOSV) is a phlebotomus-transmitted virus that belongs to the family Bunyaviridae and causes widespread infections in humans; about 30 % of these cases result in aseptic meningitis. In the present study, it was shown that TOSV is an inducer of beta interferon (IFN-β), although its non-structural protein (NSs) could inhibit the induction of IFN-β if expressed in a heterologous context. A recombinant Rift Valley fever virus expressing the TOSV NSs could suppress IFN-β expression in infected cells. Moreover, in cells expressing NSs protein from a cDNA plasmid, IFN-β transcripts were not inducible by poly(I : C). Unlike other members of the family Bunyaviridae, TOSV appears to express an NSs protein that is a weak antagonist of IFN induction. Characterization of the interaction of TOSV with the IFN system will help our understanding of virus-host cell interactions and may explain why the pathogenesis of this disease is mostly mild in humans.
NASA Technical Reports Server (NTRS)
Degee, Antonie L. W.; Mansfield, John M.; Sonnenfeld, Gerald
1986-01-01
Earlier studies have demonstrated that mice resistant to Trypanosoma brucei rhodesiense (the B10.BR/SgSnJ strain) produces, upon infection by this parasite, two peaks of serum interferon (IFN), while the susceptible mice (C3HeB/FeJ) produces no IFN. In the present study, survival times were compared for B10.BR/SgSnJ, C3HeB/FeJ, and CBA/J (an intermediately resistant strain) mice that were injected, prior to infection with the parasite, with either of the following three preparations (1) IFN-gamma, (2) an antibody to IFN-gamma and (3) polyriboinosinic-polyribocytidylic acid (to induce IFN-alpha/beta). No effect on the survival times of mice by any of these preparations could be demonstrated, contrary to some previous reports.
Gil, Olga; Vilaplana, Cristina; Guirado, Evelyn; Díaz, Jorge; Cáceres, Neus; Singh, Mahavir; Cardona, Pere-Joan
2008-11-01
Gamma interferon responses of spleen cells in mice were examined during postchemotherapy relapse of intraperitoneally induced latent tuberculous infection. The mycobacterial extract RUTI, which prevented the relapse, significantly enhanced the immune responses to secreted and structural recombinant mycobacterial antigens, suggesting that RUTI-mediated protection was mediated by activated T cells.
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Cunnick, J. E.; Armfield, A. V.; Wood, P. G.; Rabin, B. S.
1992-01-01
Mild electric foot-shock has been shown to be a stressor that can alter immune responses. Male Lewis rats were exposed to one session of 16 5.0-s 1.6-mA foot-shocks. Production of interferon-gamma by splenocytes in response to concanavalin-A was decreased in spleens from the shocked rats compared to control spleens. Spleen cells from rats treated with nadolol, a peripherally acting beta-adrenergic receptor antagonist, and then shocked, showed dose-dependent attenuation of the suppression of interferon-gamma production. This suggests that catecholamines mediate shock-induced suppression of interferon-gamma production. The percentage of splenic mononuclear cells expressing class II histocompatibility (Ia) antigens on their surfaces from spleens of shocked rats was determined by flow cytometry. Significantly decreased class II positive mononuclear cells were present in the spleens of shocked rats in comparison to the spleens of control rats. This may reflect an alteration of cell trafficking or decreased production of class II antigens.
[Research Progress on Antiviral Activity of Interferon-induced Transmembrane Proteins].
Chen, Yongkun; Zhu, Wenfei; Shu, Yuelong
2016-03-01
Interferon-induced Transmembrane Proteins (IFITMs) were identified through small interference RNA (siRNA) screening method in 1980s. The antiviral properties of the IFITMs were firstly discovered in 1996. Recently, its antiviral effect and mechanism have become a research hotspot. Many studies have shown that IFITM can inhibit the replication of multiple pathogenic viruses, including influenza A virus (IAV), Human Immunodeficiency Virus (HIV-1), hepatitis C virus (HCV), Ebola virus (EBOV), West Nile virus and so on. IFITMs inhibit the replication of virus in the early stage of the viral life cycle, which occurred before the release of viral genomes into the cytosol. Recent studies indicate that IFITM proteins could block viral replication by mediate viral membrane fusion. However, the mechanism is still under investigation. Here we review the discovery and characterization of the IFITM proteins, elucidate their antiviral activities and the potential mechanisms.
Interferon-gamma (INF-gamma) release test can detect cutaneous adverse effects to statins.
Goldberg, Ilan; Isman, Gila; Shirazi, Idit; Brenner, Sarah
2009-12-01
An increasing number of cutaneous adverse effects are being reported as use of statins becomes more widespread. A study was undertaken to establish the relationship between statin and a cutaneous reaction by the in vitro interferon-gamma (INF-gamma) release test. The lymphocytes of 20 patients with suspected drug-induced skin reaction were incubated with and without the drug. The level of INF-gamma from the supernatant was measured by enzyme-linked immunosorbent assay (ELISA), and the increase calculated. Response was positive in 27 (21.43%) of the 126 drugs. Statin was the only drug with a positive response in 80% of those cases. Nine of 20 patients (45.0%) had complete resolution after discontinuation of the drug; 6 (30.0%) who replaced one drug by another statin had partial or no resolution; and 5 (20.0%) had no resolution despite cessation of statins of all kinds. A positive INF-gamma release test was found in patients who developed skin reactions while taking statins; the test's reliability was strengthened by prompt improvement following elimination of the suspected drug in the majority of patients.
[Expression of gamma interferon during HPV and Chlamydia trachomatis infection in cervical samples].
Colín-Ferreyra, María Del Carmen; Mendieta-Zerón, Hugo; Romero-Figueroa, María Del Socorro; Martínez-Madrigal, Migdania; Martínez-Pérez, Sergio; Domínguez-García, María Victoria
2015-02-01
The aim of this study was to mesure the expression of gamma interferon in HPV and Chlamydia trachomatis infection in squamous intraepithelial lesions. Samples from 100 patients diagnosed by colposcopy with or without squamous intraepithelial lesions were used in the present study. Each patient was found to be infected by HPV and C.trachomatis. Relative gamma interferon mRNA expression was assessed using a real-time reverse transcriptase PCR assay (RT-PCR). The relative units of expression of gamma interferon mRNA were 13, 1.8 and 0.3, for HPV and C.trachomatis co-infection, or HPV or C.trachomatis infection, respectively. HPV and C.trachomatis could overstimulate the expression of gamma interferon. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
Bartolomé, Javier; Castillo, Inmaculada; Quiroga, Juan Antonio; Carreño, Vicente
2016-02-01
Polymorphisms upstream interleukin (IL)-28B gene and serum levels of interferon gamma inducible protein-10 (IP-10) are associated with spontaneous and treatment-induced hepatitis C virus (HCV) clearance. Patients with seronegative occult HCV infection are anti-HCV and serum HCV-RNA negative but have viral RNA in liver and abnormal values of liver enzymes. We examined if the rs12979860 polymorphism of IL-28B and serum IP-10 levels differ between chronic and seronegative occult CV infection. IL-28B polymorphism was determined with allele specific TaqMan probes in total DNA isolated from peripheral blood mononuclear cells and IP-10 by an enzyme-linked immunosorbent assay in serum from 99 patients with seronegative occult HCV infection and 130 untreated patients with chronic hepatitis C. IL-28B genotypes were also determined in 54 healthy volunteers. Prevalence of the IL-28B CC genotype was significantly higher in seronegative occult HCV infection (52/99; 52.5%) than in chronic hepatitis C (32/130; 24.6%, P < 0.0001) or healthy controls (19/54: 32.5%, P = 0.039). Among patients with seronegative occult HCV infection, HCV-RNA load in liver was significantly lower in those with the IL-28B CC genotype than in those with CT + TT genotypes (2.8 × 10(5) ± 5.8 × 10(4) vs. 4.1 × 10(5) ± 5.9 × 10(4) copies/μg of total RNA respectively; P = 0.023). Mean serum IP-10 levels were significantly lower in patients with seronegative occult HCV infection than in patients with chronic hepatitis C (160.8 ± 17.9 vs. 288.7 ± 13.3 pg/ml respectively; P < 0.0001). These findings suggest that the host immune response plays an important role in seronegative occult HCV infection in comparison with chronic hepatitis C. © 2015 Wiley Periodicals, Inc.
CMOS image sensor for detection of interferon gamma protein interaction as a point-of-care approach.
Marimuthu, Mohana; Kandasamy, Karthikeyan; Ahn, Chang Geun; Sung, Gun Yong; Kim, Min-Gon; Kim, Sanghyo
2011-09-01
Complementary metal oxide semiconductor (CMOS)-based image sensors have received increased attention owing to the possibility of incorporating them into portable diagnostic devices. The present research examined the efficiency and sensitivity of a CMOS image sensor for the detection of antigen-antibody interactions involving interferon gamma protein without the aid of expensive instruments. The highest detection sensitivity of about 1 fg/ml primary antibody was achieved simply by a transmission mechanism. When photons are prevented from hitting the sensor surface, a reduction in digital output occurs in which the number of photons hitting the sensor surface is approximately proportional to the digital number. Nanoscale variation in substrate thickness after protein binding can be detected with high sensitivity by the CMOS image sensor. Therefore, this technique can be easily applied to smartphones or any clinical diagnostic devices for the detection of several biological entities, with high impact on the development of point-of-care applications.
Qi, Guoyan; Liu, Peng; Gu, Shanshan; Yang, Hongxia; Dong, Huimin; Xue, Yinping
2018-04-01
Our study is aimed to explore the underlying genetic basis of myasthenia gravis. We collected a Chinese pedigree with myasthenia gravis, and whole-exome sequencing was performed on the two affected siblings and their parents. The candidate pathogenic gene was identified by bioinformatics filtering, which was further verified by Sanger sequencing. The homozygous mutation c.G40A (p.V14M) in interferon gamma receptor 1was identified. Moreover, the mutation was also detected in 3 cases of 44 sporadic myasthenia gravis patients. The p.V14M substitution in interferon gamma receptor 1 may affect the signal peptide function and the translocation on cell membrane, which could disrupt the binding of the ligand of interferon gamma and antibody production, contributing to myasthenia gravis susceptibility. We discovered that a rare variant c.G40A in interferon gamma receptor 1 potentially contributes to the myasthenia gravis pathogenesis. Further functional studies are needed to confirm the effect of the interferon gamma receptor 1 on the myasthenia gravis phenotype.
Viral Replication Complexes Are Targeted by LC3-Guided Interferon-Inducible GTPases.
Biering, Scott B; Choi, Jayoung; Halstrom, Rachel A; Brown, Hailey M; Beatty, Wandy L; Lee, Sanghyun; McCune, Broc T; Dominici, Erin; Williams, Lelia E; Orchard, Robert C; Wilen, Craig B; Yamamoto, Masahiro; Coers, Jörn; Taylor, Gregory A; Hwang, Seungmin
2017-07-12
All viruses with positive-sense RNA genomes replicate on membranous structures in the cytoplasm called replication complexes (RCs). RCs provide an advantageous microenvironment for viral replication, but it is unknown how the host immune system counteracts these structures. Here we show that interferon-gamma (IFNG) disrupts the RC of murine norovirus (MNV) via evolutionarily conserved autophagy proteins and the induction of IFN-inducible GTPases, which are known to destroy the membrane of vacuoles containing bacteria, protists, or fungi. The MNV RC was marked by the microtubule-associated-protein-1-light-chain-3 (LC3) conjugation system of autophagy and then targeted by immunity-related GTPases (IRGs) and guanylate-binding proteins (GBPs) upon their induction by IFNG. Further, the LC3 conjugation system and the IFN-inducible GTPases were necessary to inhibit MNV replication in mice and human cells. These data suggest that viral RCs can be marked and antagonized by a universal immune defense mechanism targeting diverse pathogens replicating in cytosolic membrane structures. Copyright © 2017 Elsevier Inc. All rights reserved.
Kremers, Marjolein N. T.; Hodemaekers, Hennie M.; Hagenaars, Julia C. J. P.; Koning, Olivier H. J.; Renders, Nicole H. M.; Hermans, Mirjam H. A.; de Klerk, Arja; Notermans, Daan W.; Wever, Peter C.; Janssen, Riny
2015-01-01
A large community outbreak of Q fever occurred in the Netherlands in the period 2007 to 2010. Some of the infected patients developed chronic Q fever, which typically includes pathogen dissemination to predisposed cardiovascular sites, with potentially fatal consequences. To identify the immune mechanisms responsible for ineffective clearance of Coxiella burnetii in patients who developed chronic Q fever, we compared serum concentrations of 47 inflammation-associated markers among patients with acute Q fever, vascular chronic Q fever, and past resolved Q fever. Serum levels of gamma interferon were strongly increased in acute but not in vascular chronic Q fever patients, compared to past resolved Q fever patients. Interleukin-18 levels showed a comparable increase in acute as well as vascular chronic Q fever patients. Additionally, vascular chronic Q fever patients had lower serum levels of gamma interferon-inducible protein 10 (IP-10) and transforming growth factor β (TGF-β) than did acute Q fever patients. Serum responses for these and other markers indicate that type I immune responses to C. burnetii are affected in chronic Q fever patients. This may be attributed to an affected immune system in cardiovascular patients, which enables local C. burnetii replication at affected cardiovascular sites. PMID:25924761
Identification of Interferon-Stimulated Gene Proteins That Inhibit Human Parainfluenza Virus Type 3
Rabbani, M. A. G.; Ribaudo, Michael; Guo, Ju-Tao
2016-01-01
ABSTRACT A major arm of cellular innate immunity is type I interferon (IFN), represented by IFN-α and IFN-β. Type I IFN transcriptionally induces a large number of cellular genes, collectively known as IFN-stimulated gene (ISG) proteins, which act as antivirals. The IFIT (interferon-induced proteins with tetratricopeptide repeats) family proteins constitute a major subclass of ISG proteins and are characterized by multiple tetratricopeptide repeats (TPRs). In this study, we have interrogated IFIT proteins for the ability to inhibit the growth of human parainfluenza virus type 3 (PIV3), a nonsegmented negative-strand RNA virus of the Paramyxoviridae family and a major cause of respiratory disease in children. We found that IFIT1 significantly inhibited PIV3, whereas IFIT2, IFIT3, and IFIT5 were less effective or not at all. In further screening a set of ISG proteins we discovered that several other such proteins also inhibited PIV3, including IFITM1, IDO (indoleamine 2,3-dioxygenase), PKR (protein kinase, RNA activated), and viperin (virus inhibitory protein, endoplasmic reticulum associated, interferon inducible)/Cig5. The antiviral effect of IDO, the enzyme that catalyzes the first step of tryptophan degradation, could be counteracted by tryptophan. These results advance our knowledge of diverse ISG proteins functioning as antivirals and may provide novel approaches against PIV3. IMPORTANCE The innate immunity of the host, typified by interferon (IFN), is a major antiviral defense. IFN inhibits virus growth by inducing a large number of IFN-stimulated gene (ISG) proteins, several of which have been shown to have specific antiviral functions. Parainfluenza virus type 3 (PIV3) is major pathogen of children, and no reliable vaccine or specific antiviral against it currently exists. In this article, we report several ISG proteins that strongly inhibit PIV3 growth, the use of which may allow a better antiviral regimen targeting PIV3. PMID:27707917
Liu, Ruikang; Moss, Bernard
2018-05-01
Type I interferons (IFNs) induce expression of more than 300 cellular genes that provide protection against viruses and other pathogens. For survival, viruses evolved defenses to prevent the IFN response or counteract the IFN-induced antiviral state. However, because viruses and cells coevolved, the dynamic relationship between virus and host is difficult to discern. In the present study, we demonstrated that vaccinia virus with a large deletion near the left end of the genome had a diminished ability to replicate in cells that had been pretreated with beta interferon (IFN-β), suggesting that one or more of the missing 17 open reading frames (ORFs) encode an antagonist of the IFN-induced antiviral state. By systematically deleting groups of ORFs and then individual ORFs, the C9L gene was shown to be required for IFN resistance. Replication of the C9L deletion mutant (vΔC9) was impaired in human cells that had been pretreated with IFN-β. Expression of viral early genes occurred, but subsequent events, including genome uncoating, genome replication, and postreplicative gene expression, were inhibited. Expression of the C9 protein occurred prior to genome replication, consistent with an early role in counteracting the IFN-induced antiviral state. C9 contains six ankyrin repeat motifs and a near C-terminal F-box. Mass spectrometry and immunoblotting identified host proteins that copurified with a functional epitope-tagged C9. The most abundant proteins were components of the SCF (CUL1, SKP1, F-box) and signalosome/deneddylation complexes, which interact with each other, suggesting a possible role in proteolysis of one or more interferon-induced proteins. IMPORTANCE Poxviruses comprise a family of large DNA viruses that replicate in the cytoplasm of vertebrate and insect hosts and cause human and zoonotic diseases. In most cases the primary infection is moderated by innate immune defenses. Vertebrates, including fish, amphibians, reptiles, birds, and mammals, all
[Peptide Ala-Glu-Asp-Gly and interferon gamma: their role in immune response during aging].
Lin'kova, N S; Kuznik, B I; Khavinson, V Kh
2012-01-01
The decrease of lymphocyte interferon gamma expression during aging is one of the main mechanisms leading to the immunodeficiency state in the elderly. Cell penetrating geroprotective peptide Ala-Glu-Asp-Gly has the capability to activate the proliferation of lymphocytes in thymus during its aging. The nucleotide sequence which is complementary contacted with peptide Ala-Glu-Asp-Gly was found in promoter region of interferon gamma gene. Thus, the immune protection of this peptide can be explained by its activation of the interferon gamma production in T-cells.
The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis
2017-09-01
AWARD NUMBER: W81XWH-16-1-0537 TITLE: The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis PRINCIPAL INVESTIGATOR: Stanley...Sep 2016 - 31 Aug 2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis 5b...subsets that likely counteracts IL-2 regulator activity and contribute to the pathogenesis of RA. 15. SUBJECT TERMS Rheumatoid arthritis ; Autoimmunity; T
Tálas, M; Bátkai, L; Stöger, I; Nagy, K; Hiros, L; Konstantinova, I; Kozharinov, V
1983-01-01
The influence of spaceflight conditions on the biological activity of HuIFN-alpha preparations (lyophilized, in solution and in ointment) and interferon inducers was studied. In antiviral activity no difference was observed between the samples kept aboard the spaceship and the controls kept under ground conditions. The interferon inducers poly I:C, poly G:C and gossipol placed in the space laboratory for 7 days maintained their interferon-inducing capacity. The circulating interferon level in mice was the same irrespective of the induction being performed with flight or ground-control samples of inducers.
Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude
2008-09-01
The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.
Bis, Regina L.; Mallela, Krishna M.G.
2014-01-01
Antimicrobial preservatives (APs) are included in liquid multi-dose protein formulations to combat the growth of microbes and bacteria. These compounds have been shown to cause protein aggregation, which leads to serious immunogenic and toxic side-effects in patients. Our earlier work on a model protein cytochrome c (Cyt c) demonstrated that APs cause protein aggregation in a specific manner. The aim of this study is to validate the conclusions obtained from our model protein studies on a pharmaceutical protein. Interferon α-2a (IFNA2) is available as a therapeutic treatment for numerous immune-compromised disorders including leukemia and hepatitis c, and APs have been used in its multi-dose formulation. Similar to Cyt c, APs induced IFNA2 aggregation, demonstrated by the loss of soluble monomer and increase in solution turbidity. The extent of IFNA2 aggregation increased with the increase in AP concentration. IFNA2 aggregation also depended on the nature of AP, and followed the order m-cresol > phenol > benzyl alcohol > phenoxyethanol. This specific order exactly matched with that observed for the model protein Cyt c. These and previously published results on antibodies and other recombinant proteins suggest that the general mechanism by which APs induce protein aggregation may be independent of the protein. PMID:24974985
Bilello, J A; Wivel, N A; Pitha, P M
1982-01-01
Treatment of mink cell focus-inducing (MCF) virus (isolate AK-13) producing SC-1 cells with mouse fibroblast interferon (150 to 600 U/ml) led to a 100-fold decrease in the release of infectious virus, whereas there was a 2.5- to 10-fold decrease in various parameters of virus particle release. Analysis of labeled virion proteins indicated that a temporal change in virion protein composition occurred after interferon treatment. After a 24-h exposure of chronically infected cells to interferon, the virions produced contained a 85,000-dalton glycoprotein (apparently of nonviral origin) which was in excess of the virus envelope glycoprotein gp70. Particles produced from cells treated with interferon for 32 to 48 h were nearly devoid of gp70 and contained substantially lower quantities of p30. Intracellular processing of viral precursor polyproteins to the mature virion structural proteins was not altered in the presence of interferon. However, an accumulation of the viral p30 and p12E proteins was observed in interferon-treated cells, consistent with an increase in cell-associated virions. Immunoprecipitation analysis of the tissue culture fluids from [35S]methionine-labeled control and interferon-treated cells revealed marked decrease in p30 and p15E/p12E released after interferon treatment. In contrast, gp70 did not accumulate in interferon-treated cells, but was released into the culture medium in a form that was neither pelletable nor associated with p15E/p12E. Images PMID:6180173
Zhang, Qibo; Bernatoniene, Jolanta; Bagrade, Linda; Paton, James C.; Mitchell, Timothy J.; Hammerschmidt, Sven; Nunez, Desmond A.; Finn, Adam
2006-01-01
Nasopharyngeal tonsils (adenoids) are part of human nasopharynx-associated lymphoid tissue, which may play an important role in local defense against pneumococci. Recent studies with animals have suggested that several pneumococcal proteins, including CbpA and pneumolysin (Ply), may be vaccine candidates. Our recent data obtained with children suggest that antibodies to these proteins may protect against carriage. This study was performed to investigate the regulation of the T-cell-dependent antibody responses to CbpA and pneumolysin by cytokines in adenoidal immune cells from children. Adenoidal mononuclear cells (MNC) were cultured with pneumococcal concentrated culture supernatants (CCS) or recombinant proteins. Cytokine expression profiles in adenoidal MNC after antigen stimulation were analyzed by reverse transcription-PCR, protein array analysis, and an immunoassay, along with an antibody production analysis. The roles, interactions, and cellular sources of the main cytokines identified were evaluated further. Pneumococcal CCS induced production of CbpA- and Ply-specific antibodies in association with several chemokines and cytokines, including gamma interferon (IFN-γ) and interleukin-10 (IL-10) in MNC. The antibody production correlated well with the concentrations of these two cytokines. Addition of recombinant IFN-γ or IL-10 enhanced antibody production, and monoclonal antibodies to these two cytokines and T-cell depletion significantly reduced antibody production. Intracellular cytokine staining showed that T cells are a major source of IFN-γ and IL-10. Recombinant Ply and, to a lesser extent, recombinant CbpA induced significant production of IFN-γ and IL-10 in MNC. T-cell-derived IFN-γ and IL-10 may be key regulators of production of mucosal antibody to pneumococcal protein antigens in the nasopharynx and may play an important role in local protection against pneumococcal infection in children. PMID:16861661
Identification of Interferon-Stimulated Gene Proteins That Inhibit Human Parainfluenza Virus Type 3.
Rabbani, M A G; Ribaudo, Michael; Guo, Ju-Tao; Barik, Sailen
2016-12-15
A major arm of cellular innate immunity is type I interferon (IFN), represented by IFN-α and IFN-β. Type I IFN transcriptionally induces a large number of cellular genes, collectively known as IFN-stimulated gene (ISG) proteins, which act as antivirals. The IFIT (interferon-induced proteins with tetratricopeptide repeats) family proteins constitute a major subclass of ISG proteins and are characterized by multiple tetratricopeptide repeats (TPRs). In this study, we have interrogated IFIT proteins for the ability to inhibit the growth of human parainfluenza virus type 3 (PIV3), a nonsegmented negative-strand RNA virus of the Paramyxoviridae family and a major cause of respiratory disease in children. We found that IFIT1 significantly inhibited PIV3, whereas IFIT2, IFIT3, and IFIT5 were less effective or not at all. In further screening a set of ISG proteins we discovered that several other such proteins also inhibited PIV3, including IFITM1, IDO (indoleamine 2,3-dioxygenase), PKR (protein kinase, RNA activated), and viperin (virus inhibitory protein, endoplasmic reticulum associated, interferon inducible)/Cig5. The antiviral effect of IDO, the enzyme that catalyzes the first step of tryptophan degradation, could be counteracted by tryptophan. These results advance our knowledge of diverse ISG proteins functioning as antivirals and may provide novel approaches against PIV3. The innate immunity of the host, typified by interferon (IFN), is a major antiviral defense. IFN inhibits virus growth by inducing a large number of IFN-stimulated gene (ISG) proteins, several of which have been shown to have specific antiviral functions. Parainfluenza virus type 3 (PIV3) is major pathogen of children, and no reliable vaccine or specific antiviral against it currently exists. In this article, we report several ISG proteins that strongly inhibit PIV3 growth, the use of which may allow a better antiviral regimen targeting PIV3. Copyright © 2016, American Society for Microbiology
Effect of gamma interferon on resolution of murine chlamydial genital infection.
Rank, R G; Ramsey, K H; Pack, E A; Williams, D M
1992-01-01
Mice infected in the genital tract with the Chlamydia trachomatis agent of mouse pneumonitis were treated with monoclonal rat anti-gamma interferon (anti-IFN-gamma) antibody to determine whether IFN-gamma participated in the resolution of the infection. In two experiments, anti-IFN-gamma antibody treatment resulted in significantly prolonged infections. In support of these data, passive administration of recombinant IFN-gamma to chronically infected nu/nu mice was able to bring about resolution of the infection in some animals. PMID:1398955
Bis, Regina L; Mallela, Krishna M G
2014-09-10
Antimicrobial preservatives (APs) are included in liquid multi-dose protein formulations to combat the growth of microbes and bacteria. These compounds have been shown to cause protein aggregation, which leads to serious immunogenic and toxic side-effects in patients. Our earlier work on a model protein cytochrome c (Cyt c) demonstrated that APs cause protein aggregation in a specific manner. The aim of this study is to validate the conclusions obtained from our model protein studies on a pharmaceutical protein. Interferon α-2a (IFNA2) is available as a therapeutic treatment for numerous immune-compromised disorders including leukemia and hepatitis C, and APs have been used in its multi-dose formulation. Similar to Cyt c, APs induced IFNA2 aggregation, demonstrated by the loss of soluble monomer and increase in solution turbidity. The extent of IFNA2 aggregation increased with the increase in AP concentration. IFNA2 aggregation also depended on the nature of AP, and followed the order m-cresol>phenol>benzyl alcohol>phenoxyethanol. This specific order exactly matched with that observed for the model protein Cyt c. These and previously published results on antibodies and other recombinant proteins suggest that the general mechanism by which APs induce protein aggregation may be independent of the protein. Copyright © 2014 Elsevier B.V. All rights reserved.
Potential mechanisms of cytosolic calcium modulation in interferon-gamma treated U937 cells
NASA Technical Reports Server (NTRS)
Klein, Jon B.; Mcleish, Kenneth R.; Sonnenfeld, Gerald; Dean, William L.
1987-01-01
The ability of interferon-gamma (IFN-gamma) to alter cytoplasmic Ca(2+) content in the monocytelike cell line U937 was investigated, using a slow Ca-channel blocker, diltiazem. In addition, the Ca-ATPase and the Ca-uptake activities were measured in isolated U937 membranes, together with the effect of inositol trisphosphate (IP3) upon the Ca(2+) release from Ca-loaded membranes. The addition of 50 U/ml INF-gamma to U937 cultures was found to increase internal Ca(2+) by about 100 percent within 3 min. The increase was significantly reduced by incubation in Ca-free buffer or by the addition of diltiazem. A crude membrane preparation from U937 cells was found to contain significant amounts of Ca-ATPase activity and to sequester Ca(2+) to a level of 8 nmol/mg in 30 sec; the addition of IP3 induced release of a portion of the sequestered Ca(2+) which was then resequestered. The results suggest that IFN-gamma causes an increase of cytoplasmic Ca(2+), in part, by the IP3-induced release from the internal storage sites and, in part, from the entry of extracellular Ca through slow channels.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoenen, Antje; Gillespie, Leah; Department of Microbiology and Immunology, University of Melbourne, Melbourne
2014-01-05
Flaviviruses have evolved means to evade host innate immune responses. Recent evidence suggests this is due to prevention of interferon production and signaling in flavivirus-infected cells. Here we show that the interferon-induced MxA protein can sequester the West Nile virus strain Kunjin virus (WNV{sub KUN}) capsid protein in cytoplasmic tubular structures in an expression-replication system. This sequestering resulted in reduced titers of secreted WNV{sub KUN} particles. We show by electron microscopy, tomography and 3D modeling that these cytoplasmic tubular structures form organized bundles. Additionally we show that recombinant ER-targeted MxA can restrict production of infectious WNV{sub KUN} under conditions ofmore » virus infection. Our results indicate a co-ordinated and compartmentalized WNV{sub KUN} assembly process may prevent recognition of viral components by MxA, particularly the capsid protein. This recognition can be exploited if MxA is targeted to intracellular sites of WNV{sub KUN} assembly. This results in further understanding of the mechanisms of flavivirus evasion from the immune system. - Highlights: • We show that the ISG MxA can recognize the West Nile virus capsid protein. • Interaction between WNV C protein and MxA induces cytoplasmic fibrils. • MxA can be retargeted to the ER to restrict WNV particle release. • WNV assembly process is a strategy to avoid MxA recognition.« less
Interferon-gamma: biologic functions and HCV therapy (type I/II) (1 of 2 parts).
Gattoni, A; Parlato, A; Vangieri, B; Bresciani, M; Derna, R
2006-01-01
This review is aimed at exhaustively presenting and discussing the interferon-gamma (IFN-gamma), a cytokine that plays an important role in inducing and modulating an array of immune responses. A review of the most significant and recent clinical trials was performed. Although IFN-gamma has some antiviral activity, it is much less active in this regard than type I IFNs. IFN-gamma is involved in the regulation of nearly all phases of the immune and inflammatory responses, including the activation and differentiation of T cells, B cells, NK cells, macrophages, and others. It is therefore best regarded as a distint immunoregulatory cytokine. IFN-gamma secretion is a hallmark of Th1 lymphocytes. It is also secreted by nearly all CD8 T cells, by some Th0 cells, and by NK cells. Each of these cell types secretes IFN-gamma only when activated, usually as part of immune response and especially in response to IL-2 and IL-12. IFN-gamma production is inhibited by IL-4, IL-10, TGFbeta, glucocorticoids, cyclosporin A and FK506. Nearly all cell types express the heterodimeric receptor for IFN-beta and respond to this cytokine by increasing the surface expression of class I MHC proteins. As a result, virtually any cell in the vicinity of an IFN-beta-secreting cell becomes more efficient at presenting endogenous antigens and hence a better target for cytotoxic killing if it harbors an intracellular pathogen. Unlike the type I IFNs, IFN-gamma also increases the expression of class II MHC proteins on professional APCs, and so promotes antigen presentation to helper T cells as well. It also induces de novo expression of class II MHC proteins on venular endothelial cells and on some other epithelial and connective tissue cells that do not otherwise express them, thus enabling these cell types to function as temporary APCs at sites of intense immune reactions. The effector functions of NK cells are to lyse virus-infected cells and to secrete IFN-gamma, which activates macrofages to
Feng, Bo; Zhao, Lihong; Wang, Wei; Wang, Jianfang; Wang, Hongyan; Duan, Huiqin; Zhang, Jianjun; Qiao, Jian
2017-11-03
Endothelial cells are believed to play an important role in response to virus infection. Our previous microarray analysis showed that H9N2 virus infection and inactivated viral particle inoculation increased the expression of interferon-inducible transmembrane protein 1 (IFITM1) in human umbilical vein endothelial cells (HUVECs). In present study, we deeply investigated the expression patterns of IFITM1 and IFITM1-mediated antiviral response induced by H9N2 virus infection and inactivated viral particle inoculation in HUVECs. Epithelial cells that are considered target cells of the influenza virus were selected as a reference control. First, we quantified the expression levels of IFITM1 in HUVECs induced by H9N2 virus infection or viral particle inoculation using quantitative real-time PCR and western blot. Second, we observed whether hemagglutinin or neuraminidase affected IFITM1 expression in HUVECs. Finally, we investigated the effect of induced-IFITM1 on the antiviral state in HUVECs by siRNA and activation plasmid transfection. Both H9N2 virus infection and viral particle inoculation increased the expression of IFITM1 without elevating the levels of interferon-ɑ/β in HUVECs. HA or NA protein binding alone is not sufficient to increase the levels of IFITM1 and interferon-ɑ/β in HUVECs. IFITM1 induced by viral particle inoculation significantly decreased the virus titers in culture supernatants of HUVECs. Our results showed that inactivated viral particle inoculation increased the expression of IFITM1 at mRNA and protein levels. Moreover, the induction of IFITM1 expression mediated the antiviral state in HUVECs.
Brar, Kanwaljit; Leung, Donald Y M
2016-01-01
Atopic dermatitis (AD) is the most common inflammatory skin disease in the general population. There are different endophenotypes of AD that likely have a unique immune and molecular basis, such as those who are predisposed to eczema herpeticum, or Staphylococcus aureus infections. In this review, we highlight the endophenotypes of AD where reduced interferon gamma expression may be playing a role. Additionally, we review the potential role of recombinant interferon gamma therapy in the treatment of atopic dermatitis and the particular phenotypes that may benefit from this treatment. Recombinant interferon gamma treatment will likely benefit the pediatric population with AD, as well as those with susceptibilities for skin infections. Future studies are needed to elucidate whether IFN-γ may reduce the prevalence of skin infection in AD.
Interferon-γ-induced protein 10 in Lyme disease.
Fallahi, P; Elia, G; Bonatti, A
2017-01-01
Lyme disease is an infectious disease caused by bacteria of the Borrelia type, that affects about 300,000 people a year in the USA and 65,000 people a year in Europe. Borrelia infection, and Lyme disease, following occupational exposure has been frequently reported in USA, Europe and Asia. The manifestations of Lyme disease include erythema migrans (EM), arthritis, neuroborrelliosis (NB), and others. Cytokines and chemokines primarily orchestrate leukocyte recruitment to the areas of Borrelia infection, and they are critical mediators of immune and inflammatory responses, in particular of the induction of interferon (IFN)-γ and IFN-γ dependent chemokines. In EM high levels of T helper (Th) 1 cells chemoattranctants [monokine induced by IFN-γ (MIG), IFN-γ-induced protein 10 (IP- 10), and IFN-inducible T cell alpha chemoattractant (I-TAC)] have been shown. Synovial tissues and fluids of patients with Lyme Arthritis (LA) (overall with antibiotic-refractory LA) contained exceptionally high levels of Th1 chemoattractants and cytokines, particularly MIG and IFN-γ. In NB concentrations of IP-10 and I-TAC in the cerebrospinal fluid (CSF) were significantly higher, suggesting that IP-10 and I-TAC create a chemokine gradient between the CSF and serum and recruite C-X-C chemokine receptor 3-expressing memory CD4+ T-cells into the CSF of these patients. A positive association between the disseminating capacity of B. burgdorferi and early type I IFN induction has also been shown. These results suggest that IFN-γ dependent chemokines are important biomarkers to monitor the progression and diffusion of the disease in patients with Borrelia infection; further larger studies are needed.
Inhibition of interferon-inducible MxA protein expression by hepatitis B virus capsid protein.
Rosmorduc, O; Sirma, H; Soussan, P; Gordien, E; Lebon, P; Horisberger, M; Bréchot, C; Kremsdorf, D
1999-05-01
Chronic hepatitis B treatment has been significantly improved by interferon (IFN) treatment. However, some studies have suggested that hepatitis B virus (HBV) might have a direct effect on the resistance to IFN. Defective particles, generated by spliced HBV RNA and associated with chronic hepatitis B, have been previously characterized; expression of these particles leads to cytoplasmic accumulation of the capsid protein. The aim of this study was to investigate the role of these defective genomes in IFN resistance. The global antiviral activity of IFN was studied by virus yield reduction assays, the expression of three IFN-induced antiviral proteins was analysed by Western blotting and confocal microscopy, and the regulation of MxA gene expression was studied by Northern blotting and the luciferase assay, in Huh7 cells transfected with a complete or the defective HBV genome. Results showed that the expression of the defective genome reduces the antiviral activity of IFN and that this modulation involves a selective inhibition of MxA protein induction by the HBV capsid protein. Our results also show the trans-suppressive effect of the HBV capsid on the MxA promoter, which might participate in this phenomenon. In conclusion, this study shows a direct interplay between the IFN-sensitive pathway and the capsid protein and might implicate this defective HBV genome in virus persistence.
Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.
1999-01-01
Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206
Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo
2017-01-01
Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.
Manneberg, M.; Friedlein, A.; Kurth, H.; Lahm, H. W.; Fountoulakis, M.
1994-01-01
A soluble form of the human interferon gamma receptor that is required for the identification of interferon gamma antagonists was expressed in baculovirus-infected insect cells. The protein carried N-linked carbohydrate and showed a heterogeneity on denaturing polyacrylamide gels. We investigated the utilization of the potential sites for N-linked glycosylation and the structure of the carbohydrate moieties of this soluble receptor. Amino acid sequence analysis and ion spray mass spectrometry revealed that of the five potential sites for N-linked glycosylation, Asn17 and Asn69 were always utilized, whereas Asn62 and Asn162 were utilized in approximately one-third of the protein population. Asn223 was never found to be glycosylated. The soluble receptor was treated with N-glycosidase F and the oligosaccharides released were analyzed by matrix-assisted laser desorption mass spectrometry, which showed that the protein carried six types of short carbohydrate chains. The predominant species was a hexasaccharide of molecular mass 1,039, containing a fucose subunit linked to the proximal N-acetylglucosamine residue: [formula: see text] PMID:8142896
Inhibition of Interferon Regulatory Factor 3 Activation by Paramyxovirus V Protein
Irie, Takashi; Kiyotani, Katsuhiro; Igarashi, Tomoki; Yoshida, Asuka
2012-01-01
The V protein of Sendai virus (SeV) suppresses innate immunity, resulting in enhancement of viral growth in mouse lungs and viral pathogenicity. The innate immunity restricted by the V protein is induced through activation of interferon regulatory factor 3 (IRF3). The V protein has been shown to interact with melanoma differentiation-associated gene 5 (MDA5) and to inhibit beta interferon production. In the present study, we infected MDA5-knockout mice with V-deficient SeV and found that MDA5 was largely unrelated to the innate immunity that the V protein suppresses in vivo. We therefore investigated the target of the SeV V protein. We previously reported interaction of the V protein with IRF3. Here we extended the observation and showed that the V protein appeared to inhibit translocation of IRF3 into the nucleus. We also found that the V protein inhibited IRF3 activation when induced by a constitutive active form of IRF3. The V proteins of measles virus and Newcastle disease virus inhibited IRF3 transcriptional activation, as did the V protein of SeV, while the V proteins of mumps virus and Nipah virus did not, and inhibition by these proteins correlated with interaction of each V protein with IRF3. These results indicate that IRF3 is important as an alternative target of paramyxovirus V proteins. PMID:22532687
Yoo, J C; Pae, H O; Choi, B M; Kim, W I; Kim, J D; Kim, Y M; Chung, H T
2000-02-01
The effects of ionizing irradiation on the nitric oxide (NO) production in murine embryonic liver cell line, BNL CL.2 cells, were investigated. Various doses (5-40 Gy) of radiation made BNL CL.2 cells responsive to interferon-gamma alone for the production of NO in a dose-dependent manner. Small amounts of lipopolysaccharide (LPS) or tumor necrosis factor-alpha (TNF-alpha) synergized with IFN-gamma in the production of NO from irradiated BNL CL.2 cells, even though LPS or TNF-alpha alone did not induce NO production from the same cells. Immunoblots showed parallel induction of inducible nitric oxide synthase (iNOS). NO production in irradiated BNL CL.2 cells by IFN-gamma or IFN-gamma plus LPS was decreased by the addition of catalase, suggesting that H(2)O(2) produced by ionizing irradiation primed the cells to trigger NO production in response to IFN-gamma or IFN-gamma plus LPS. Furthermore, the treatment of nongamma-irradiated BNL CL.2 cells with H(2)O(2) made the cells responsive to IFN-gamma or IFN-gamma plus LPS for the production of NO. This study shows that ionizing irradiation has the ability to induce iNOS gene expression in responsive to IFN-gamma via the formation of H(2)O(2) in BNL CL.2 murine embryonic liver cells.
T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.
Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong
2017-05-12
Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.
Coppen, S R; Newsam, R; Bull, A T; Baines, A J
1995-04-20
The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.
Morar, D; Tijhaar, E; Negrea, A; Hendriks, J; van Haarlem, D; Godfroid, J; Michel, A L; Rutten, V P M G
2007-01-15
Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-gamma) assay is used as a routine diagnostic tool to determine infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop reagents to set up a rhinoceros IFN-gamma (RhIFN-gamma) assay. The white rhinoceros IFN-gamma gene was cloned, sequenced and expressed as a mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-gamma shares a homology of 90% with equine IFN-gamma. Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant RhIFN-gamma were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that recombinant as well as native white rhinoceros IFN-gamma was recognised. This preliminary IFN-gamma enzyme-linked immunosorbent assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.
Jiang, Dong; Weidner, Jessica M; Qing, Min; Pan, Xiao-Ben; Guo, Haitao; Xu, Chunxiao; Zhang, Xianchao; Birk, Alex; Chang, Jinhong; Shi, Pei-Yong; Block, Timothy M; Guo, Ju-Tao
2010-08-01
Interferons (IFNs) are key mediators of the host innate antiviral immune response. To identify IFN-stimulated genes (ISGs) that instigate an antiviral state against two medically important flaviviruses, West Nile virus (WNV) and dengue virus (DENV), we tested 36 ISGs that are commonly induced by IFN-alpha for antiviral activity against the two viruses. We discovered that five ISGs efficiently suppressed WNV and/or DENV infection when they were individually expressed in HEK293 cells. Mechanistic analyses revealed that two structurally related cell plasma membrane proteins, IFITM2 and IFITM3, disrupted early steps (entry and/or uncoating) of the viral infection. In contrast, three IFN-induced cellular enzymes, viperin, ISG20, and double-stranded-RNA-activated protein kinase, inhibited steps in viral proteins and/or RNA biosynthesis. Our results thus imply that the antiviral activity of IFN-alpha is collectively mediated by a panel of ISGs that disrupt multiple steps of the DENV and WNV life cycles.
Inhibited interferon-gamma but normal interleukin-3 production from rats flown on the Space Shuttle
NASA Technical Reports Server (NTRS)
Gould, Cheryl L.; Lyte, Mark; Williams, Joann; Mandel, Adrian D.; Sonnenfeld, Gerald
1987-01-01
Rats were flown on Space Shuttle SL-3 for one week. When spleen cells were removed from these rats and challenged with concanavalin-A, interferon-gamma production was severely inhibited, while interleukin-3 production was unaffected compared to ground-based control rats. These data indicate that there is a defect in interferon-gamma production in rats that have been exposed to spaceflight. This defect could contribute to, and be one reason for, immunosuppression observed after spaceflight.
Interferon Gamma as a Biomarker of Exposure to Enteric Viruses
Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...
NASA Technical Reports Server (NTRS)
Mazumder, B.; Fox, P. L.
1999-01-01
Ceruloplasmin (Cp) is an acute-phase protein with ferroxidase, amine oxidase, and pro- and antioxidant activities. The primary site of Cp synthesis in human adults is the liver, but it is also synthesized by cells of monocytic origin. We have shown that gamma interferon (IFN-gamma) induces the synthesis of Cp mRNA and protein in monocytic cells. We now report that the induced synthesis of Cp is terminated by a mechanism involving transcript-specific translational repression. Cp protein synthesis in U937 cells ceased after 16 h even in the presence of abundant Cp mRNA. RNA isolated from cells treated with IFN-gamma for 24 h exhibited a high in vitro translation rate, suggesting that the transcript was not defective. Ribosomal association of Cp mRNA was examined by sucrose centrifugation. When Cp synthesis was high, i.e., after 8 h of IFN-gamma treatment, Cp mRNA was primarily associated with polyribosomes. However, after 24 h, when Cp synthesis was low, Cp mRNA was primarily in the nonpolyribosomal fraction. Cytosolic extracts from cells treated with IFN-gamma for 24 h, but not for 8 h, contained a factor which blocked in vitro Cp translation. Inhibitor expression was cell type specific and present in extracts of human cells of myeloid origin, but not in several nonmyeloid cells. The inhibitory factor bound to the 3' untranslated region (3'-UTR) of Cp mRNA, as shown by restoration of in vitro translation by synthetic 3'-UTR added as a "decoy" and detection of a binding complex by RNA gel shift analysis. Deletion mapping of the Cp 3'-UTR indicated an internal 100-nucleotide region of the Cp 3'-UTR that was required for complex formation as well as for silencing of translation. Although transcript-specific translational control is common during development and differentiation and global translational control occurs during responses to cytokines and stress, to our knowledge, this is the first report of translational silencing of a specific transcript following cytokine
Fuchs, Jonas; Hölzer, Martin; Schilling, Mirjam; Patzina, Corinna; Schoen, Andreas; Zimmer, Gert; Marz, Manja; Müller, Marcel A.
2017-01-01
ABSTRACT Bats serve as a reservoir for various, often zoonotic viruses, including significant human pathogens such as Ebola and influenza viruses. However, for unknown reasons, viral infections rarely cause clinical symptoms in bats. A tight control of viral replication by the host innate immune defense might contribute to this phenomenon. Transcriptomic studies revealed the presence of the interferon-induced antiviral myxovirus resistance (Mx) proteins in bats, but detailed functional aspects have not been assessed. To provide evidence that bat Mx proteins might act as key factors to control viral replication we cloned Mx1 cDNAs from three bat families, Pteropodidae, Phyllostomidae, and Vespertilionidae. Phylogenetically these bat Mx1 genes cluster closely with their human ortholog MxA. Using transfected cell cultures, minireplicon systems, virus-like particles, and virus infections, we determined the antiviral potential of the bat Mx1 proteins. Bat Mx1 significantly reduced the polymerase activity of viruses circulating in bats, including Ebola and influenza A-like viruses. The related Thogoto virus, however, which is not known to infect bats, was not inhibited by bat Mx1. Further, we provide evidence for positive selection in bat Mx1 genes that might explain species-specific antiviral activities of these proteins. Together, our data suggest a role for Mx1 in controlling these viruses in their bat hosts. IMPORTANCE Bats are a natural reservoir for various viruses that rarely cause clinical symptoms in bats but are dangerous zoonotic pathogens, like Ebola or rabies virus. It has been hypothesized that the interferon system might play a key role in controlling viral replication in bats. We speculate that the interferon-induced Mx proteins might be key antiviral factors of bats and have coevolved with bat-borne viruses. This study evaluated for the first time a large set of bat Mx1 proteins spanning three major bat families for their antiviral potential, including
Gamma Interferon-Induced T-Cell Loss in Virulent Mycobacterium avium Infection
Flórido, Manuela; Pearl, John E.; Solache, Alejandra; Borges, Margarida; Haynes, Laura; Cooper, Andrea M.; Appelberg, Rui
2005-01-01
Infection by virulent Mycobacterium avium caused progressive severe lymphopenia in C57BL/6 mice due to increased apoptosis rates. T-cell depletion did not occur in gamma interferon (IFN-γ)-deficient mice which showed increased T-cell numbers and proliferation; in contrast, deficiency in nitric oxide synthase 2 did not prevent T-cell loss. Although T-cell loss was IFN-γ dependent, expression of the IFN-γ receptor on T cells was not required for depletion. Similarly, while T-cell loss was optimal if the T cells expressed IFN-γ, CD8+ T-cell depletion could occur in the absence of T-cell-derived IFN-γ. Depletion did not require that the T cells be specific for mycobacterial antigen and was not affected by deficiencies in the tumor necrosis factor receptors p55 or p75, the Fas receptor (CD95), or the respiratory burst enzymes or by forced expression of bcl-2 in hematopoietic cells. PMID:15908387
Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao
2003-10-31
Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yokota, Shin-ichi; Okabayashi, Tamaki; Fujii, Nobuhiro, E-mail: fujii@sapmed.ac.j
2011-05-25
Measles virus (MeV) produces two accessory proteins, V and C, from the P gene. These accessory proteins have been reported to contribute to efficient virus proliferation through the modulation of host cell events. Our previous paper described that Vero cell-adapted strains of MeV led host cells to growth arrest through the upregulation of interferon regulatory factor 1 (IRF-1), and wild strains did not. In the present study, we found that C protein expression levels varied among MeV strains in infected SiHa cells. C protein levels were inversely correlated with IRF-1 expression levels and with cell growth arrest. Forced expression ofmore » C protein released cells from growth arrest. C-deficient recombinant virus efficiently upregulated IRF-1 and caused growth arrest more efficiently than the wild-type virus. C protein preferentially bound to phosphorylated STAT1 and suppressed STAT1 dimer formation. We conclude that MeV C protein suppresses IFN-{gamma} signaling pathway via inhibition of phosphorylated STAT1 dimerization.« less
Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.
Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K
2005-01-20
Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.
Anti-interferon-gamma antibodies in the treatment of autoimmune diseases.
Skurkovich, Boris; Skurkovich, Simon
2003-02-01
Interferon (IFN)-gamma is an important immune regulator in normal immunity. When IFN gamma production is disturbed, various autoimmune diseases (ADs) can develop, in which we suggest that anti-IFN gamma could have a beneficial effect. Depending on the cell type in which IFN gamma synthesis is disturbed, different clinical manifestations may result. We have also proposed to remove tumor necrosis factor (TNF)-alpha, together with certain types of IFNs, to treat various ADs and AIDS, also an autoimmune condition. Anti-IFN gamma has been tested in several T-helper cell (Th1) ADs, including rheumatoid arthritis (RA), multiple sclerosis (MS), corneal transplant rejection, uveitis, Type I diabetes, schizophrenia (anti-IFN gamma and anti-TNF alpha), and various autoimmune skin diseases (alopecia areata, psoriasis vulgaris, vitiligo, pemphigus vulgaris and epidermolysis bullosa). A strong, sometimes striking, therapeutic response followed administration of anti-IFN gamma, indicating that it may be a promising therapy for Th1 ADs.
Tuo, Wenbin; Fetterer, Raymond; Jenkins, Mark; Dubey, J. P.
2005-01-01
Gamma interferon (IFN-γ) response is essential to the development of a host protective immunity in response to infections by intracellular parasites. Neosporosis, an infection caused by the intracellular protozoan parasite Neospora caninum, is fatal when there is a complete lack of IFN-γ in the infected host. However, the mechanism by which IFN-γ is elicited by the invading parasite is unclear. This study has identified a microbial protein in the N. caninum tachyzoite N. caninum cyclophilin (NcCyP) as a major component of the parasite responsible for the induction of IFN-γ production by bovine peripheral blood mononuclear cells (PBMC) and antigen-specific CD4+ T cells. NcCyP has high sequence homology (86%) with Toxoplasma gondii 18-kDa CyP with a calculated molecular mass of 19.4 kDa. NcCyP is a secretory protein with a predicted signal peptide of 17 amino acids. Abundant NcCyP was detected in whole-cell N. caninum tachyzoite lysate antigen (NcAg) and N. caninum tachyzoite culture supernatant. In N. caninum tachyzoite culture supernatant, three NcCyP bands of 19, 22, and 24 kDa were identified. NcAg stimulated high levels of IFN-γ production by PBMC and CD4+ T cells. The IFN-γ-inducing effect of NcAg was blocked by cyclosporine, a specific ligand for CyP, in a dose-dependent manner. Furthermore, cyclosporine abolished IFN-γ production by PBMC from naïve cows as well as PBMC and CD4+ T cells from infected/immunized cows. These results indicate that the N. caninum tachyzoite naturally produces a potent IFN-γ-inducing protein, NcCyP, which may be important for parasite survival as well as host protection. PMID:16041025
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Dang; Fang, Liurong; Luo, Rui
2010-08-13
Research highlights: {yields} FMDV L{sup pro} inhibits poly(I:C)-induced IFN-{alpha}1/{beta} mRNA expression. {yields} L{sup pro} inhibits MDA5-mediated activation of the IFN-{alpha}1/{beta} promoter. {yields} L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes. {yields} L{sup pro} inhibits IFN-{alpha}1/{beta} promoter activation by decreasing IRF-3/7 in protein levels. {yields} The ability to process eIF-4G of L{sup pro} is not necessary to inhibit IFN-{alpha}1/{beta} activation. -- Abstract: The leader proteinase (L{sup pro}) of foot-and-mouth disease virus (FMDV) has been identified as an interferon-{beta} (IFN-{beta}) antagonist that disrupts the integrity of transcription factor nuclear factor {kappa}B (NF-{kappa}B). In this study, we showed that the reductionmore » of double stranded RNA (dsRNA)-induced IFN-{alpha}1/{beta} expression caused by L{sup pro} was also associated with a decrease of interferon regulatory factor 3/7 (IRF-3/7) in protein levels, two critical transcription factors for activation of IFN-{alpha}/{beta}. Furthermore, overexpression of L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes including 2',5'-OAS, ISG54, IP-10, and RANTES. Screening L{sup pro} mutants indicated that the ability to process eIF-4G of L{sup pro} is not required for suppressing dsRNA-induced activation of the IFN-{alpha}1/{beta} promoter and decreasing IRF-3/7 expression. Taken together, our results demonstrate that, in addition to disrupting NF-{kappa}B, L{sup pro} also decreases IRF-3/7 expression to suppress dsRNA-induced type I IFN production, suggesting multiple strategies used by FMDV to counteract the immune response to viral infection.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Jeeyun; Im, Young-Hyuck; Jung, Hae Hyun
2005-08-26
The A549 cells, non-small cell lung cancer cell line from human, were resistant to interferon (IFN)-{alpha} treatment. The IFN-{alpha}-treated A549 cells showed increase in protein expression levels of NF-{kappa}B and COX-2. IFN-{alpha} induced NF-{kappa}B binding activity within 30 min and this increased binding activity was markedly suppressed with inclusion of curcumin. Curcumin also inhibited IFN-{alpha}-induced COX-2 expression in A549 cells. Within 10 min, IFN-{alpha} rapidly induced the binding activity of a {gamma}-{sup 32}P-labeled consensus GAS oligonucleotide probe, which was profoundly reversed by curcumin. Taken together, IFN-{alpha}-induced activations of NF-{kappa}B and COX-2 were inhibited by the addition of curcumin in A549more » cells.« less
Crisan, Dana; Grigorescu, Mircea Dan; Radu, Corina; Suciu, Alina; Grigorescu, Mircea
2017-04-01
One of the multiple factors contributing to virological response in chronic hepatitis C (CHC) is interferon-gamma-inducible protein-10 (IP-10). Its level reflects the status of interferon-stimulated genes, which in turn is associated with virological response to antiviral therapy. The aim of this study was to evaluate the role of serum IP-10 levels on sustained virological response (SVR) and the association of this parameter with insulin resistance (IR) and liver histology. Two hundred and three consecutive biopsy proven CHC patients were included in the study. Serum levels of IP-10 were determined using ELISA method. IR was evaluated by homeostasis model assessment-IR (HOMA-IR). Histological features were assessed invasively by liver biopsy and noninvasively using FibroTest, ActiTest and SteatoTest. Predictive factors for SVR and their interrelations were assessed. A cut-off value for IP-10 of 392 pg/ml was obtained to discriminate between responders and non-responders. SVR was obtained in 107 patients (52.70%). Area under the receiver operating characteristic curve for SVR was 0.875 with a sensitivity of 91.6 per cent, specificity 74.7 per cent, positive predictive value 80.3 per cent and negative predictive value 88.7 per cent. Higher values of IP-10 were associated with increasing stages of fibrosis (P<0.01) and higher grades of inflammation (P=0.02, P=0.07) assessed morphologically and noninvasively through FibroTest and ActiTest. Significant steatosis and IR were also associated with increased levels of IP-10 (P=0.01 and P=0.02). In multivariate analysis, IP-10 levels and fibrosis stages were independently associated with SVR. Our findings showed that the assessment of serum IP-10 level could be a predictive factor for SVR and it was associated with fibrosis, necroinflammatory activity, significant steatosis and IR in patients with chronic HCV infection.
Costa, Elísio; Fernandes, João; Ribeiro, Sandra; Sereno, José; Garrido, Patrícia; Rocha-Pereira, Petronila; Coimbra, Susana; Catarino, Cristina; Belo, Luís; Bronze-da-Rocha, Elsa; Vala, Helena; Alves, Rui; Reis, Flávio; Santos-Silva, Alice
2014-12-01
Our aim was to contribute to a better understanding of the pathophysiology of anemia in elderly, by studying how aging affects renal function, iron metabolism, erythropoiesis and the inflammatory response, using an experimental animal model. The study was performed in male Wistar, a group of young rats with 2 months age and an old one with 18 months age. Old rats presented a significant higher urea, creatinine, interferon (INF)-gamma, ferritin and soluble transferrin receptor serum levels, as well as increased counts of reticulocytes and RDW. In addition, these rats showed significant lower erythropoietin (EPO) and iron serum levels. Concerning gene expression of iron regulatory proteins, old rats presented significantly higher mRNA levels of hepcidin (Hamp), transferrin (TF), transferrin receptor 2 (TfR2) and hemojuvelin (HJV); divalent metal transporter 1 (DMT1) mRNA levels were significantly higher in duodenal tissue; EPO gene expression was significantly higher in liver and lower in kidney, and the expression of the EPOR was significantly higher in both liver and kidney. Our results showed that aging is associated with impaired renal function, which could be in turn related with the inflammatory process and with a decline in EPO renal production. Moreover, we also propose that aging may be associated with INF-gamma-induced inflammation and with alterations upon iron regulatory proteins gene expression.
Santhakumar, Diwakar; Rohaim, Mohammed Abdel Mohsen Shahaat; Hussein, Hussein A; Hawes, Pippa; Ferreira, Helena Lage; Behboudi, Shahriar; Iqbal, Munir; Nair, Venugopal; Arns, Clarice W; Munir, Muhammad
2018-05-01
The intracellular actions of interferon (IFN)-regulated proteins, including IFN-induced proteins with tetratricopeptide repeats (IFITs), attribute a major component of the protective antiviral host defense. Here we applied genomics approaches to annotate the chicken IFIT locus and currently identified a single IFIT (chIFIT5) gene. The profound transcriptional level of this effector of innate immunity was mapped within its unique cis-acting elements. This highly virus- and IFN-responsive chIFIT5 protein interacted with negative sense viral RNA structures that carried a triphosphate group on its 5' terminus (ppp-RNA). This interaction reduced the replication of RNA viruses in lentivirus-mediated IFIT5-stable chicken fibroblasts whereas CRISPR/Cas9-edited chIFIT5 gene knockout fibroblasts supported the replication of RNA viruses. Finally, we generated mosaic transgenic chicken embryos stably expressing chIFIT5 protein or knocked-down for endogenous chIFIT5 gene. Replication kinetics of RNA viruses in these transgenic chicken embryos demonstrated the antiviral potential of chIFIT5 in ovo. Taken together, these findings propose that IFIT5 specifically antagonize RNA viruses by sequestering viral nucleic acids in chickens, which are unique in innate immune sensing and responses to viruses of both poultry and human health significance.
Effects of chicken interferon Gamma on Newcastle disease virus vaccine immunogenicity
USDA-ARS?s Scientific Manuscript database
More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFN') during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFN' wit...
Fuchs, Jonas; Hölzer, Martin; Schilling, Mirjam; Patzina, Corinna; Schoen, Andreas; Hoenen, Thomas; Zimmer, Gert; Marz, Manja; Weber, Friedemann; Müller, Marcel A; Kochs, Georg
2017-08-01
Bats serve as a reservoir for various, often zoonotic viruses, including significant human pathogens such as Ebola and influenza viruses. However, for unknown reasons, viral infections rarely cause clinical symptoms in bats. A tight control of viral replication by the host innate immune defense might contribute to this phenomenon. Transcriptomic studies revealed the presence of the interferon-induced antiviral myxovirus resistance (Mx) proteins in bats, but detailed functional aspects have not been assessed. To provide evidence that bat Mx proteins might act as key factors to control viral replication we cloned Mx1 cDNAs from three bat families, Pteropodidae, Phyllostomidae, and Vespertilionidae. Phylogenetically these bat Mx1 genes cluster closely with their human ortholog MxA. Using transfected cell cultures, minireplicon systems, virus-like particles, and virus infections, we determined the antiviral potential of the bat Mx1 proteins. Bat Mx1 significantly reduced the polymerase activity of viruses circulating in bats, including Ebola and influenza A-like viruses. The related Thogoto virus, however, which is not known to infect bats, was not inhibited by bat Mx1. Further, we provide evidence for positive selection in bat Mx1 genes that might explain species-specific antiviral activities of these proteins. Together, our data suggest a role for Mx1 in controlling these viruses in their bat hosts. IMPORTANCE Bats are a natural reservoir for various viruses that rarely cause clinical symptoms in bats but are dangerous zoonotic pathogens, like Ebola or rabies virus. It has been hypothesized that the interferon system might play a key role in controlling viral replication in bats. We speculate that the interferon-induced Mx proteins might be key antiviral factors of bats and have coevolved with bat-borne viruses. This study evaluated for the first time a large set of bat Mx1 proteins spanning three major bat families for their antiviral potential, including activity
Santiago, Felix W; Covaleda, Lina M; Sanchez-Aparicio, Maria T; Silvas, Jesus A; Diaz-Vizarreta, Ana C; Patel, Jenish R; Popov, Vsevolod; Yu, Xue-jie; García-Sastre, Adolfo; Aguilar, Patricia V
2014-04-01
Recognition of viral pathogens by the retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) family results in the activation of type I interferon (IFN) responses. To avoid this response, most viruses have evolved strategies that target different essential steps in the activation of host innate immunity. In this study, we report that the nonstructural protein NSs of the newly described severe fever with thrombocytopenia syndrome virus (SFTSV) is a potent inhibitor of IFN responses. The SFTSV NSs protein was found to inhibit the activation of the beta interferon (IFN-β) promoter induced by viral infection and by a RIG-I ligand. Astonishingly, we found that SFTSV NSs interacts with and relocalizes RIG-I, the E3 ubiquitin ligase TRIM25, and TANK-binding kinase 1 (TBK1) into SFTSV NSs-induced cytoplasmic structures. Interestingly, formation of these SFTSV NSs-induced structures occurred in the absence of the Atg7 gene, a gene essential for autophagy. Furthermore, confocal microscopy studies revealed that these SFTSV NSs-induced structures colocalize with Rab5 but not with Golgi apparatus or endoplasmic reticulum markers. Altogether, the data suggest that sequestration of RIG-I signaling molecules into endosome-like structures may be the mechanism used by SFTSV to inhibit IFN responses and point toward a novel mechanism for the suppression of IFN responses. The mechanism by which the newly described SFTSV inhibits host antiviral responses has not yet been fully characterized. In this study, we describe the redistribution of RIG-I signaling components into virus-induced cytoplasmic structures in cells infected with SFTSV. This redistribution correlates with the inhibition of host antiviral responses. Further characterization of the interplay between the viral protein and components of the IFN responses could potentially provide targets for the rational development of therapeutic interventions.
Santiago, Felix W.; Covaleda, Lina M.; Sanchez-Aparicio, Maria T.; Silvas, Jesus A.; Diaz-Vizarreta, Ana C.; Patel, Jenish R.; Popov, Vsevolod; Yu, Xue-jie; García-Sastre, Adolfo
2014-01-01
ABSTRACT Recognition of viral pathogens by the retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) family results in the activation of type I interferon (IFN) responses. To avoid this response, most viruses have evolved strategies that target different essential steps in the activation of host innate immunity. In this study, we report that the nonstructural protein NSs of the newly described severe fever with thrombocytopenia syndrome virus (SFTSV) is a potent inhibitor of IFN responses. The SFTSV NSs protein was found to inhibit the activation of the beta interferon (IFN-β) promoter induced by viral infection and by a RIG-I ligand. Astonishingly, we found that SFTSV NSs interacts with and relocalizes RIG-I, the E3 ubiquitin ligase TRIM25, and TANK-binding kinase 1 (TBK1) into SFTSV NSs-induced cytoplasmic structures. Interestingly, formation of these SFTSV NSs-induced structures occurred in the absence of the Atg7 gene, a gene essential for autophagy. Furthermore, confocal microscopy studies revealed that these SFTSV NSs-induced structures colocalize with Rab5 but not with Golgi apparatus or endoplasmic reticulum markers. Altogether, the data suggest that sequestration of RIG-I signaling molecules into endosome-like structures may be the mechanism used by SFTSV to inhibit IFN responses and point toward a novel mechanism for the suppression of IFN responses. IMPORTANCE The mechanism by which the newly described SFTSV inhibits host antiviral responses has not yet been fully characterized. In this study, we describe the redistribution of RIG-I signaling components into virus-induced cytoplasmic structures in cells infected with SFTSV. This redistribution correlates with the inhibition of host antiviral responses. Further characterization of the interplay between the viral protein and components of the IFN responses could potentially provide targets for the rational development of therapeutic interventions. PMID:24478431
Interferon Gamma in African Trypanosome Infections: Friends or Foes?
Wu, Hui; Liu, Gongguan; Shi, Meiqing
2017-01-01
African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.
Rodriguez, Jason J.; Parisien, Jean-Patrick; Horvath, Curt M.
2002-01-01
Characterization of recent outbreaks of fatal encephalitis in southeast Asia identified the causative agent to be a previously unrecognized enveloped negative-strand RNA virus of the Paramyxoviridae family, Nipah virus. One feature linking Nipah virus to this family is a conserved cysteine-rich domain that is the hallmark of paramyxovirus V proteins. The V proteins of other paramyxovirus species have been linked with evasion of host cell interferon (IFN) signal transduction and subsequent antiviral responses by inducing proteasomal degradation of the IFN-responsive transcription factors, STAT1 or STAT2. Here we demonstrate that Nipah virus V protein escapes IFN by a distinct mechanism involving direct inhibition of STAT protein function. Nipah virus V protein differs from other paramyxovirus V proteins in its subcellular distribution but not in its ability to inhibit cellular IFN responses. Nipah virus V protein does not induce STAT degradation but instead inhibits IFN responses by forming high-molecular-weight complexes with both STAT1 and STAT2. We demonstrate that Nipah virus V protein accumulates in the cytoplasm by a Crm1-dependent mechanism, alters the STAT protein subcellular distribution in the steady state, and prevents IFN-stimulated STAT redistribution. Consistent with the formation of complexes, STAT protein tyrosine phosphorylation is inhibited in cells expressing the Nipah virus V protein. As a result, Nipah virus V protein efficiently prevents STAT1 and STAT2 nuclear translocation in response to IFN, inhibiting cellular responses to both IFN-α and IFN-γ. PMID:12388709
Smith, S E; Gibson, M S; Wash, R S; Ferrara, F; Wright, E; Temperton, N; Kellam, P; Fife, M
2013-12-01
Interferon-inducible transmembrane protein 3 (IFITM3) is an effector protein of the innate immune system. It confers potent, cell-intrinsic resistance to infection by diverse enveloped viruses both in vitro and in vivo, including influenza viruses, West Nile virus, and dengue virus. IFITM3 prevents cytosolic entry of these viruses by blocking complete virus envelope fusion with cell endosome membranes. Although the IFITM locus, which includes IFITM1, -2, -3, and -5, is present in mammalian species, this locus has not been unambiguously identified or functionally characterized in avian species. Here, we show that the IFITM locus exists in chickens and is syntenic with the IFITM locus in mammals. The chicken IFITM3 protein restricts cell infection by influenza A viruses and lyssaviruses to a similar level as its human orthologue. Furthermore, we show that chicken IFITM3 is functional in chicken cells and that knockdown of constitutive expression in chicken fibroblasts results in enhanced infection by influenza A virus. Chicken IFITM2 and -3 are constitutively expressed in all tissues examined, whereas IFITM1 is only expressed in the bursa of Fabricius, gastrointestinal tract, cecal tonsil, and trachea. Despite being highly divergent at the amino acid level, IFITM3 proteins of birds and mammals can restrict replication of viruses that are able to infect different host species, suggesting IFITM proteins may provide a crucial barrier for zoonotic infections.
Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.
Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F
2003-01-01
A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.
Rodríguez-Güell, Elisabeth; Agustí, Gemma; Corominas, Mercè; Cardona, Pere-Joan; Luquin, Marina; Julián, Esther
2008-01-01
Whole heat-killed Mycobacterium vaccae is used as an immunotherapeutic agent in tuberculosis (TB), but the compound(s) that triggers its immunostimulatory ability is not known. Here, we show that among different subcellular fractions, the cell wall skeleton induced a prominent expression of gamma interferon in splenocytes from both non-TB and TB M. vaccae-treated mice. PMID:18337379
Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M
1992-01-01
The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001
Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M
1992-04-01
The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.
Interferon β induces clearance of mutant ataxin 7 and improves locomotion in SCA7 knock-in mice.
Chort, Alice; Alves, Sandro; Marinello, Martina; Dufresnois, Béatrice; Dornbierer, Jean-Gabriel; Tesson, Christelle; Latouche, Morwena; Baker, Darren P; Barkats, Martine; El Hachimi, Khalid H; Ruberg, Merle; Janer, Alexandre; Stevanin, Giovanni; Brice, Alexis; Sittler, Annie
2013-06-01
We showed previously, in a cell model of spinocerebellar ataxia 7, that interferon beta induces the expression of PML protein and the formation of PML protein nuclear bodies that degrade mutant ataxin 7, suggesting that the cytokine, used to treat multiple sclerosis, might have therapeutic value in spinocerebellar ataxia 7. We now show that interferon beta also induces PML-dependent clearance of ataxin 7 in a preclinical model, SCA7(266Q/5Q) knock-in mice, and improves motor function. Interestingly, the presence of mutant ataxin 7 in the mice induces itself the expression of endogenous interferon beta and its receptor. Immunohistological studies in brains from two patients with spinocerebellar ataxia 7 confirmed that these modifications are also caused by the disease in humans. Interferon beta, administered intraperitoneally three times a week in the knock-in mice, was internalized with its receptor in Purkinje and other cells and translocated to the nucleus. The treatment induced PML protein expression and the formation of PML protein nuclear bodies and decreased mutant ataxin 7 in neuronal intranuclear inclusions, the hallmark of the disease. No reactive gliosis or other signs of toxicity were observed in the brain or internal organs. The performance of the SCA7(266Q/5Q) knock-in mice was significantly improved on two behavioural tests sensitive to cerebellar function: the Locotronic® Test of locomotor function and the Beam Walking Test of balance, motor coordination and fine movements, which are affected in patients with spinocerebellar ataxia 7. In addition to motor dysfunction, SCA7(266Q/5Q) mice present abnormalities in the retina as in patients: ataxin 7-positive neuronal intranuclear inclusions that were reduced by interferon beta treatment. Finally, since neuronal death does not occur in the cerebellum of SCA7(266Q/5Q) mice, we showed in primary cell cultures expressing mutant ataxin 7 that interferon beta treatment improves Purkinje cell survival.
Pang, W Y; Earley, B; Sweeney, T; Crowe, M A
2006-02-01
The objective of this study was to determine the effect of carprofen (C) administration before banding or burdizzo castration of bulls on cortisol, in vitro interferon-gamma (IFN-gamma) production, acute-phase proteins, feed intake, and growth. Fifty Holstein Friesian bulls (5.5 mo old; 191 +/- 3.7 kg) were blocked by weight and assigned randomly to 1 of 5 treatments (n = 10/treatment): 1) untreated control (2) banding castration at 0 min (Band); 3) Band following an i.v. injection of 1.4 mg/kg of BW of C at -20 min (Band+C); 4) Burdizzo castration at 0 min (Burd); or 5) Burd following 1.4 mg/kg of BW of C at -20 min (Burd+C). Castration acutely increased plasma cortisol concentrations compared with control; no significant differences occurred in peak and interval to peak cortisol responses between Band and Band+C or Burd and Burd+C groups. The administration of C in Band+C reduced (P < 0.05) the cortisol concentration between 6 and 12 h postcastration compared with Band animals. Overall, the integrated cortisol response was greater (P < 0.05) in the castrates than in control, whereas C treatments tended to reduce this response compared with Band (P = 0.08) and Burd (P = 0.07), respectively. Plasma fibrinogen was elevated in Band animals on d 14 and in Burd animals on d 3 and 14. Carprofen administration reduced Band- and Burd-induced fibrinogen production on d 14 and 3, respectively. Plasma haptoglobin was elevated in Band animals on d 3 and 35 compared with control, and C administration was effective in reducing the haptoglobin elevation on d 35 in Band+C compared with Band. There were no differences among treatments in in vitro IFN-gamma production induced by concanavalin A and phytohemagglutinin on d 1 and 2. Overall from d -1 to 16, there were no DMI differences among treatments. From d -1 to 35, there were no ADG differences among treatments. In conclusion, banding and burdizzo castration increased plasma cortisol with no change in in vitro IFN-gamma
Interferon-inducible effector mechanisms in cell-autonomous immunity
MacMicking, John D.
2014-01-01
Interferons (IFNs) induce the expression of hundreds of genes as part of an elaborate antimicrobial programme designed to combat infection in all nucleated cells — a process termed cell-autonomous immunity. As described in this Review, recent genomic and subgenomic analyses have begun to assign functional properties to novel IFN-inducible effector proteins that restrict bacteria, protozoa and viruses in different subcellular compartments and at different stages of the pathogen life cycle. Several newly described host defence factors also participate in canonical oxidative and autophagic pathways by spatially coordinating their activities to enhance microbial killing. Together, these IFN-induced effector networks help to confer vertebrate host resistance to a vast and complex microbial world. PMID:22531325
Interferon Induced Transfer of Viral Resistance
1982-02-01
released from the cell membrane. We have also shown that CM’s activity is removed by a gelatin /sepharose affinity column which selectively binds...interferon preparation adsorbing to the WISH cells, interferon was subjected to gelatin /sepharose affinity chromatography to remove endogenous...caused an increase in the amount of H-.amnino acids incorporated into a gelatin binding protein, presumably fibronectin. This suggests that in addition to
Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko
2007-06-01
Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.
Laouar, Yasmina; Sutterwala, Fayyaz S; Gorelik, Leonid; Flavell, Richard A
2005-06-01
Interferon-gamma and interleukin 12 produced by the innate arm of the immune system are important regulators of T helper type 1 (T(H)1) cell development, but signals that negatively regulate their expression remain controversial. Here we show that transforming growth factor-beta (TGF-beta) controlled T(H)1 differentiation through the regulation of interferon-gamma produced by natural killer (NK) cells. Blockade of TGF-beta signaling in NK cells caused the accumulation of a large pool of NK cells secreting copious interferon-gamma, responsible for T(H)1 differentiation and protection from leishmania infection. In contrast, blockade of TGF-beta signaling in dendritic cells did not affect dendritic cell homeostasis or interleukin 12 production, thus indicating a previously undescribed demarcation of the function of TGF-beta in NK cells versus dendritic cells.
López-Alvarez, María R; Martínez-Sánchez, María V; Salgado-Cecilia, María G; Campillo, José A; Heine-Suñer, Damian; Villar-Permuy, Florentina; Fuster, José L; Bas, Agueda; Gil-Herrera, Juana; Muro, Manuel; García-Alonso, Ana M; Alvarez-López, María R; Minguela, Alfredo
2009-01-01
We report the first case of hemophagocytic lymphohistiocytosis (HLH) induced by the monoclonal expansion of Epstein-Barr virus (EBV)-negative NK cells. Consanguinity of the patient's parents made it necessary to discard familial HLH in the patient and her sister with identical HLA markers and demonstrate that no cause other than the expansion of NK cells, which secrete high levels of gamma interferon, was inducing HLH in this patient.
Lin, Chiou-Feng; Tsai, Cheng-Chieh; Huang, Wei-Ching; Wang, Chi-Yun; Tseng, Hsiang-Chi; Wang, Yi; Kai, Jui-In; Wang, Szu-Wen; Cheng, Yi-Lin
2008-10-15
Interferon-gamma (IFN-gamma) plays a crucial role in innate immunity and inflammation. It causes the synergistic effect on endotoxin lipopolysaccharide (LPS)-stimulated inducible nitric oxide synthase (iNOS)/NO biosynthesis; however, the mechanism remains unclear. In the present study, we investigated the effects of glycogen synthase kinase-3 (GSK-3)-mediated inhibition of anti-inflammatory interleukin-10 (IL-10). We found, in LPS-stimulated macrophages, that IFN-gamma increased iNOS expression and NO production in a time-dependent manner. In addition, ELISA analysis showed the upregulation of tumor necrosis factor-alpha and regulated on activation, normal T expressed and secreted, and the downregulation of IL-10. RT-PCR further showed changes in the IL-10 mRNA level as well. Treating cells with recombinant IL-10 showed a decrease in IFN-gamma/LPS-induced iNOS/NO biosynthesis, whereas anti-IL-10 neutralizing antibodies enhanced this effect, suggesting that IL-10 acts in an anti-inflammatory role. GSK-3-inhibitor treatment blocked IFN-gamma/LPS-induced iNOS/NO biosynthesis but upregulated IL-10 production. Inhibiting GSK-3 using short-interference RNA showed similar results. Additionally, treating cells with anti-IL-10 neutralizing antibodies blocked these effects. We further showed that inhibiting GSK-3 increased phosphorylation of transcription factor cyclic AMP response element binding protein. Inhibiting protein tyrosine kinase Pyk2, an upstream regulator of GSK-3beta, caused inhibition on IFN-gamma/LPS-induced GSK-3beta phosphorylation at tyrosine 216 and iNOS/NO biosynthesis. Taken together, these findings reveal the involvement of GSK-3-inhibited IL-10 on the induction of iNOS/NO biosynthesis by IFN-gamma synergized with LPS. (c) 2008 Wiley-Liss, Inc.
Porcine circovirus-2 capsid protein induces cell death in PK15 cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Walia, Rupali; Dardari, Rkia, E-mail: rdardari@ucalgary.ca; Chaiyakul, Mark
Studies have shown that Porcine circovirus (PCV)-2 induces apoptosis in PK15 cells. Here we report that cell death is induced in PCV2b-infected PK15 cells that express Capsid (Cap) protein and this effect is enhanced in interferon gamma (IFN-γ)-treated cells. We further show that transient PCV2a and 2b-Cap protein expression induces cell death in PK15 cells at rate similar to PCV2 infection, regardless of Cap protein localization. These data suggest that Cap protein may have the capacity to trigger different signaling pathways involved in cell death. Although further investigation is needed to gain deeper insights into the nature of the pathwaysmore » involved in Cap-induced cell death, this study provides evidence that PCV2-induced cell death in kidney epithelial PK15 cells can be mapped to the Cap protein and establishes the need for future research regarding the role of Cap-induced cell death in PCV2 pathogenesis. - Highlights: • IFN-γ enhances PCV2 replication that leads to cell death in PK15 cells. • IFN-γ enhances nuclear localization of the PCV2 Capsid protein. • Transient PCV2a and 2b-Capsid protein expression induces cell death. • Cell death is not dictated by specific Capsid protein sub-localization.« less
Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T
1996-01-01
We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819
Interferon Induced Transfer of Viral Resistance
1981-02-01
necseeary and Identify by block number) - Interferon, Cell Communication, Resistance Transfer, Viruses , Antibody Production, Polypeptide Hormones...lymphocytes and the foreign cells, but not mycoplasmas or endogenous viruses , appears to be required for induction. The kinetics of production of leukocyte...interferon by nonsensitized lymphocytes in response to foreign cells is similar to that induced by viruses . We have shown that a component probably of Vie
Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels
NASA Technical Reports Server (NTRS)
Pierangeli, Silvia S.; Sonnenfeld, Gerald
1989-01-01
Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.
Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong
2008-01-01
We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.
Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity
1984-01-01
Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN
Muramatsu, Matthew K.; Brothwell, Julie A.; Stein, Barry D.; Putman, Timothy E.; Rockey, Daniel D.
2016-01-01
Chlamydia trachomatis can enter a viable but nonculturable state in vitro termed persistence. A common feature of C. trachomatis persistence models is that reticulate bodies fail to divide and make few infectious progeny until the persistence-inducing stressor is removed. One model of persistence that has relevance to human disease involves tryptophan limitation mediated by the host enzyme indoleamine 2,3-dioxygenase, which converts l-tryptophan to N-formylkynurenine. Genital C. trachomatis strains can counter tryptophan limitation because they encode a tryptophan-synthesizing enzyme. Tryptophan synthase is the only enzyme that has been confirmed to play a role in interferon gamma (IFN-γ)-induced persistence, although profound changes in chlamydial physiology and gene expression occur in the presence of persistence-inducing stressors. Thus, we screened a population of mutagenized C. trachomatis strains for mutants that failed to reactivate from IFN-γ-induced persistence. Six mutants were identified, and the mutations linked to the persistence phenotype in three of these were successfully mapped. One mutant had a missense mutation in tryptophan synthase; however, this mutant behaved differently from previously described synthase null mutants. Two hypothetical genes of unknown function, ctl0225 and ctl0694, were also identified and may be involved in amino acid transport and DNA damage repair, respectively. Our results indicate that C. trachomatis utilizes functionally diverse genes to mediate survival during and reactivation from persistence in HeLa cells. PMID:27430273
USDA-ARS?s Scientific Manuscript database
Currently the Bovigam assay is used as an official supplemental test within the bovine tuberculosis eradication program. This assay measures interferon-gamma (IFN-gamma) produced by lymphocytes in response to specific antigens. The objectives of the present study were to evaluate two Mycobacterium ...
Wang, C Q; Udupa, K B; Lipschitz, D A
1995-01-01
Interferon-gamma (INF-gamma) has been shown to suppress erythropoiesis and perhaps to contribute to the anemia of chronic disease. In this study we demonstrated that the concentration of INF gamma required to suppress murine burst forming unit-erythroid (BFU-E) growth was significantly less than that required to suppress colony forming unit-erythroid (CFU-E) growth. INF gamma acted at the most primitive step in erythroid progenitor cell differentiation and proliferation, as inhibition was maximal when added at the time of BFU-E culture initiation. Inhibition was progressively less if INF gamma addition was delayed after culture initiation. The effects of INF gamma on BFU-E did not require the presence of interleukin-1 alpha (IL-1 alpha), tumor necrosis factor-alpha (TNF alpha), or granulocyte macrophage colony stimulating factor (GM-CSF), as its effects were not neutralized by monoclonal antibodies against IL-1 alpha, TNF alpha, or GM-CSF. This applied whether INF gamma was added to culture with individual antibodies or with a combination of all three antibodies. INF gamma was not required for IL-1 alpha- or TNF alpha-induced suppression of BFU-E, as their effects were not neutralized by a monoclonal anti-INF gamma antibody. In contrast, GM-CSF-induced suppression of BFU-E was negated by the simultaneous addition of anti-INF gamma. We have previously shown that the addition of TNF alpha does not suppress BFU-E growth in cultures from marrow depleted of macrophages. Suppression did occur, however, if a small concentration of INF gamma that does not inhibit and increasing concentration of TNF alpha were added to culture, suggesting a synergistic effect between INF-gamma and TNF alpha. These observations suggest that INF gamma is a potent direct inhibitor of erythroid colony growth in vitro. It exerts its negative regulatory effect primarily on the earliest stages of erythroid progenitor cell differentiation and proliferation, as much higher doses are required to
Stress-induced release of HSC70 from human tumors.
Barreto, Alfonso; Gonzalez, John Mario; Kabingu, Edith; Asea, Alexzander; Fiorentino, Susana
2003-04-01
In this study, we demonstrate that the pro-inflammatory cytokine interferon-gamma (IFN-gamma) induces the active release of the constitutive form of the 70-kDa heat shock protein (HSC70) from K562 erythroleukemic cells. Treatment of K562 cells with IFN-gamma induced the upregulation of the inducible form of the 70-kDa heat shock protein (HSP70), but not the constitutive form of HSC70 within the cytosol, in a proteasome-dependent manner. In addition, IFN-gamma induced the downregulation of surface-bound HSC70, but did not significantly alter surface-bound HSP70 expression. These findings indicate that HSC70 can be actively released from tumor cells and is indicative of a previously unknown mechanism by which immune modulators stimulate the release of intracellular HSC70. This mechanism may account for the potent chaperokine activity of heat shock proteins recently observed during heat shock protein-based immunotherapy against a variety of cancers.
Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A
2008-06-01
Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).
NASA Technical Reports Server (NTRS)
Lah, T. T.; Hawley, M.; Rock, K. L.; Goldberg, A. L.
1995-01-01
Previous studies have indicated that acid-optimal cysteine proteinase(s) in the endosomal-lysosomal compartments, cathepsins, play a critical role in the proteolytic processing of endocytosed proteins to generate the antigenic peptides presented to the immune system on major histocompatibility complex (MHC) class II molecules. The presentation of these peptides and the expression of MHC class II molecules by macrophages and lymphocytes are stimulated by gamma-interferon (gamma-IFN). We found that treatment of human U-937 monocytes with gamma-IFN increased the activities and the content of the two major lysosomal cysteine proteinases, cathepsins B and L. Assays of protease activity, enzyme-linked immunosorbant assays (ELISA) and immunoblotting showed that this cytokine increased the amount of cathepsin B 5-fold and cathepsin L 3-fold in the lysosomal fraction. By contrast, the aspartic proteinase, cathepsin D, in this fraction was not significantly altered by gamma-IFN treatment. An induction of cathepsins B and L was also observed in mouse macrophages, but not in HeLa cells. These results suggest coordinate regulation in monocytes of the expression of cathepsins B and L and MHC class II molecules. Presumably, this induction of cysteine proteases contributes to the enhancement of antigen presentation by gamma-IFN.
The nucleocapsid protein of measles virus blocks host interferon response
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takayama, Ikuyo; Sato, Hiroki; Watanabe, Akira
2012-03-01
Measles virus (MV) belongs to the genus Morbillivirus of the family Paramyxoviridae. A number of paramyxoviruses inhibit host interferon (IFN) signaling pathways in host immune systems by various mechanisms. Inhibition mechanisms have been described for many paramyxoviruses. Although there are inconsistencies among previous reports concerning MV, it appears that P/V/C proteins interfere with the pathways. In this study, we confirmed the effects of MV P gene products of a wild MV strain on IFN pathways and examined that of other viral proteins on it. Interestingly, we found that N protein acts as an IFN-{alpha}/{beta} and {gamma}-antagonist as strong as Pmore » gene products. We further investigated the mechanisms of MV-N inhibition, and revealed that MV-N blocks the nuclear import of activated STAT without preventing STAT and Jak activation or STAT degradation, and that the nuclear translocation of MV-N is important for the inhibition. The inhibitory effect of the N protein was observed as a common feature of other morbilliviruses. The results presented in this report suggest that N protein of MV as well as P/V/C proteins is involved in the inhibition of host IFN signaling pathways.« less
Effects of Chicken Interferon Gamma on Newcastle Disease Virus Vaccine Immunogenicity
Cardenas-Garcia, Stivalis; Dunwoody, Robert P.; Marcano, Valerie; Diel, Diego G.; Williams, Robert J.; Gogal, Robert M.; Brown, Corrie C.; Miller, Patti J.; Afonso, Claudio L.
2016-01-01
More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFNγ) during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFNγ with Newcastle disease virus (NDV) antigens were evaluated for their ability to enhance the avian immune response and their protective capacity upon challenge with virulent NDV. These systems consisted of: 1) a DNA vaccine expressing the Newcastle disease virus fusion (F) protein co-administered with a vector expressing the chIFNγ gene for in ovo and booster vaccination, 2) a recombinant Newcastle disease virus expressing the chIFNγ gene (rZJ1*L/IFNγ) used as a live vaccine delivered in ovo and into juvenile chickens, and 3) the same rZJ1*L/IFNγ virus used as an inactivated vaccine for juvenile chickens. Co-administration of chIFNγ with a DNA vaccine expressing the F protein resulted in higher levels of morbidity and mortality, and higher amounts of virulent virus shed after challenge when compared to the group that did not receive chIFNγ. The live vaccine system co-delivering chIFNγ did not enhanced post-vaccination antibody response, nor improved survival after hatch, when administered in ovo, and did not affect survival after challenge when administered to juvenile chickens. The low dose of the inactivated vaccine co-delivering active chIFNγ induced lower antibody titers than the groups that did not receive the cytokine. The high dose of this vaccine did not increase the antibody titers or antigen-specific memory response, and did not reduce the amount of challenge virus shed or mortality after challenge. In summary, regardless of the delivery system, chIFNγ, when administered simultaneously with the vaccine antigen, did not enhance Newcastle disease virus vaccine immunogenicity. PMID:27409587
Bentz, Gretchen L.; Shackelford, Julia
2012-01-01
Epstein-Barr virus (EBV) latent membrane protein 1 (LMP1) induces multiple signal transduction pathways during latent EBV infection via its C-terminal activating region 1 (CTAR1), CTAR2, and the less-studied CTAR3. One mechanism by which LMP1 regulates cellular activation is through the induction of protein posttranslational modifications, including phosphorylation and ubiquitination. We recently documented that LMP1 induces a third major protein modification by physically interacting with the SUMO-conjugating enzyme Ubc9 through CTAR3 and inducing the sumoylation of cellular proteins in latently infected cells. We have now identified a specific target of LMP1-induced sumoylation, interferon regulatory factor 7 (IRF7). We hypothesize that during EBV latency, LMP1 induces the sumoylation of IRF7, limiting its transcriptional activity and modulating the activation of innate immune responses. Our data show that endogenously sumoylated IRF7 is detected in latently infected EBV lymphoblastoid cell lines. LMP1 expression coincided with increased sumoylation of IRF7 in a CTAR3-dependent manner. Additional experiments show that LMP1 CTAR3-induced sumoylation regulates the expression and function of IRF7 by decreasing its turnover, increasing its nuclear retention, decreasing its DNA binding, and limiting its transcriptional activation. Finally, we identified that IRF7 is sumoylated at lysine 452. These data demonstrate that LMP1 CTAR3 does in fact function in intracellular signaling, leading to biologic effects. We propose that CTAR3 is an important signaling region of LMP1 that regulates protein function by sumoylation. We have shown specifically that LMP1 CTAR3, in cooperation with CTAR2, can limit the ability of IRF7 to induce innate immune responses by inducing the sumoylation of IRF7. PMID:22951831
Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D
2008-02-01
One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.
Human B cells fail to secrete type I interferons upon cytoplasmic DNA exposure.
Gram, Anna M; Sun, Chenglong; Landman, Sanne L; Oosenbrug, Timo; Koppejan, Hester J; Kwakkenbos, Mark J; Hoeben, Rob C; Paludan, Søren R; Ressing, Maaike E
2017-11-01
Most cells are believed to be capable of producing type I interferons (IFN I) as part of an innate immune response against, for instance, viral infections. In macrophages, IFN I is potently induced upon cytoplasmic exposure to foreign nucleic acids. Infection of these cells with herpesviruses leads to triggering of the DNA sensors interferon-inducible protein 16 (IFI16) and cyclic GMP-AMP (cGAMP) synthase (cGAS). Thereby, the stimulator of interferon genes (STING) and the downstream molecules TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3) are sequentially activated culminating in IFN I secretion. Human gamma-herpesviruses, such as Epstein-Barr virus (EBV), exploit B cells as a reservoir for persistent infection. In this study, we investigated whether human B cells, similar to macrophages, engage the cytoplasmic DNA sensing pathway to induce an innate immune response. We found that the B cells fail to secrete IFN I upon cytoplasmic DNA exposure, although they express the DNA sensors cGAS and IFI16 and the signaling components TBK1 and IRF3. In primary human B lymphocytes and EBV-negative B cell lines, this deficiency is explained by a lack of detectable levels of the central adaptor protein STING. In contrast, EBV-transformed B cell lines did express STING, yet both these lines as well as STING-reconstituted EBV-negative B cells did not produce IFN I upon dsDNA or cGAMP stimulation. Our combined data show that the cytoplasmic DNA sensing pathway is dysfunctional in human B cells. This exemplifies that certain cell types cannot induce IFN I in response to cytoplasmic DNA exposure providing a potential niche for viral persistence. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.
Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G
1996-01-01
The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817
Monitoring acute phase proteins in retrovirus infected cats undergoing feline interferon-ω therapy.
Leal, R O; Gil, S; Sepúlveda, N; McGahie, D; Duarte, A; Niza, M M R E; Tavares, L
2014-01-01
Recombinant feline interferon-ω therapy is an immunomodulator currently used in the treatment of different retroviral diseases including feline immune deficiency virus and feline leukaemia virus. Although its mechanism of action remains unclear, this drug appears to potentiate the innate response. Acute phase proteins are one of the key components of innate immunity and studies describing their use as a monitoring tool for the immune system in animals undergoing interferon-ω therapy are lacking. This study aimed to determine whether interferon-ω therapy influences acute phase protein concentrations namely serum amyloid-A, α-1-glycoprotein and C-reactive protein. A single-arm study was performed using 16 cats, living in an animal shelter, naturally infected with retroviruses and subjected to the interferon-ω therapy licensed protocol. Samples were collected before (D0), during (D10 and D30) and after therapy (D65). Serum amyloid-A and C-reactive protein were measured by specific enzyme-linked immunosorbent assay kits and α-1-glycoprotein by single radial immunodiffusion. All the acute phase proteins significantly increased in cats undergoing interferon-ω therapy (D0/D65: P<0·05) CLINICAL SIGNIFICANCE: Acute phase proteins appear to be reasonable predictors of innate-immune stimulation and may be useful in the individual monitoring of naturally retroviral infected cats undergoing interferon-ω therapy. © 2013 British Small Animal Veterinary Association.
Arsenic enhances the apoptosis induced by interferon gamma: key role of IRF-1.
El Bougrini, J; Pampin, M; Chelbi-Alix, M K
2006-05-15
Interferons (IFNs) and arsenic trioxide (As2O3) are known inhibitors of cell proliferation and have been used in the treatment of certain forms of malignancy. IFNgamma treatment of cells leads to tyrosine phosphorylation of STAT1 followed by dimerization that accumulates in the nucleus. This is followed by DNA binding, activation of target gene transcription, dephosphorylation, and return to the cytoplasm. We have shown earlier that IFNgamma and As2O3 act synergistically in acute promyelocytic leukemia cells to upregulate IRF-1 expression and to induce apoptosis. Here, we show that in the human fibrosarcoma cell line 2fTGH, As2O3 prolongs IFNgamma-induced STAT1 phosphorylation resulting in persistent binding of STAT1 to GAS motif leading to an increase in IRF-1 expression which correlated with both higher anti-proliferative effect and increased apoptosis. These biological responses induced by IFNgamma alone or in combination with As2O3 were abolished when IRF-1 expression was down-regulated by RNA interference, thus demonstrating the key role of IRF-1.
Grau, G E; Heremans, H; Piguet, P F; Pointaire, P; Lambert, P H; Billiau, A; Vassalli, P
1989-01-01
Experimental cerebral malaria (ECM), a lethal hyperacute neurological syndrome associated with high blood levels of tumor necrosis factor, develops in genetically susceptible (CBA/Ca) mice 7 days after infection with Plasmodium berghei ANKA strain. Injections of neutralizing monoclonal antibody against recombinant murine interferon gamma, not later than 4 days after infection, markedly reduced the incidence of ECM and the elevation in serum levels of tumor necrosis factor. This treatment prevented the cerebral lesions (plugging of brain vessels by monocytes, lymphocytes, and parasitized erythrocytes). In contrast, the extent of macrophage infiltration in lymphoid organs (which is a characteristic feature of mice developing ECM), as well as the course of infection, remained unaffected by the antibody treatment. Protected mice died at a later time of severe anemia and overwhelming parasitemia, the usual outcome of P. berghei infection in mice that are not susceptible to ECM. The present data indicate that interferon gamma constitutes an important link in the cytokine network that leads to brain vessel inflammation in experimental malaria. It is proposed that interferon gamma released by activated CD4+ T cells acts by augmenting both production and action of tumor necrosis factor. PMID:2501793
Reiners, J J; Cantu, A; Thai, G; Pavone, A
1993-03-01
SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.
NASA Technical Reports Server (NTRS)
Gould, Cheryl L.; Sonnenfeld, Gerald
1987-01-01
The effect of pretreatment of mice with 34 units/day, for five days, of interferon-gamma (IFN-gamma) on the course of infection with LD50 of Salmonella typhimurium strain LT-2 was assessed, using two IFN preparations: (1) a hybridoma supernatant fluid containing concanavalin-A-induced IFN-gamma activity and (2) pure murine IFN-gamma produced by recombinant DNA technology. The hybridoma supernatant-treated Salmonella-infected mice were found to die faster than mice treated only with Salmonella. Pure murine IFN-gamma was found to protect infected mice significantly, with 95 percent of mice surviving LD50 infection. In contrast, the Salmonella-infected mice treated with hybridoma supernatant were found to die faster than the Salmonella-infected untreated controls. Mice treated with concanavalin A alone prior to infection with S. typhimurium died more quickly than the untreated infected controls, suggesting that contamination with concanavalin A had a detrimental effect on mice survival.
Sonoda, Junichiro; Laganière, Josée; Mehl, Isaac R; Barish, Grant D; Chong, Ling-Wa; Li, Xiangli; Scheffler, Immo E; Mock, Dennis C; Bataille, Alain R; Robert, Francois; Lee, Chih-Hao; Giguère, Vincent; Evans, Ronald M
2007-08-01
Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.
Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M
1993-01-01
Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454
Immunomodulatory intervention with Gamma interferon in mice with sepsis.
Wang, Yu; Kong, Bing-Bing; Yang, Wen-Ping; Zhao, Xin; Zhang, Rong
2017-09-15
Sepsis-triggered immune paralysis including T-cell dysfunction increase susceptibility to infection. Gamma interferon (IFNg) exert beneficial effects in patients with sepsis. Herein, we speculated that IFNg may attenuate T-cell dysfunction induced by sepsis, although the mechanisms remain elusive. To test this hypothesis, we used a model based on cecal ligation and puncture (CLP) to induce sepsis in mice. Male C57BL/6 mice were pretreated with recombinant human IFNg (0.01μg/g of body weight) before CLP. The immunophenotyping of cell surface receptor expression, and regulatory T cells (CD4+CD25+Foxp3+) were quantified by flow cytometry. Immunohistochemical staining was performed to evaluate the loss of immune effector cells. Formation of IFNg and interleukin 4 (IL-4) in the spleen and plasma levels of TNF-α, IL-6, high-mobility group box 1 (HMGB1) were determined using enzyme-linked immunosorbent assay. IFNg markedly inhibited the reduction in cytokine secretion from lipopolysaccharide (LPS)-stimulated splenocytes. IFNg-treated mices had significantly decreased percentages of programmed cell death 1 (PD-1) receptors, increased the percentages of positive costimulatory receptor CD28 on CD4 T cells expressing. IFNg markedly reduced T-cell apoptosis through upregulating the expression of Bcl-2. CLP-induced formation of regulatory T cells in the spleen was abolished in IFNg -treated mices. Moreover, IFNg treatment reduced plasma levels of TNF-α, IL-6, HMGB1. IFNg can be a powerful regulator of immune function under sepsis conditions. Therefore, targeted immune-enhancement with IFNg may be a valid therapeutic approach in sepsis. Copyright © 2017 Elsevier Inc. All rights reserved.
Jans, Jop; Unger, Wendy W J; Vissers, Marloes; Ahout, Inge M L; Schreurs, Inge; Wickenhagen, Arthur; de Groot, Ronald; de Jonge, Marien I; Ferwerda, Gerben
2018-04-01
Interferon gamma (IFN-γ) plays an important role in the antiviral immune response during respiratory syncytial virus (RSV) infections. Monocytes and T cells are recruited to the site of RSV infection, but it is unclear whether cell-cell interactions between monocytes and T cells regulate IFN-γ production. In this study, micro-array data identified the upregulation of sialic acid-binding immunoglobulin-type lectin 1 (Siglec-1) in human RSV-infected infants. In vitro, RSV increased expression of Siglec-1 on healthy newborn and adult monocytes. RSV-induced Siglec-1 on monocytes inhibited IFN-γ production by adult CD4 + T cells. In contrast, IFN-γ production by RSV in newborns was not affected by Siglec-1. The ligand for Siglec-1, CD43, is highly expressed on adult CD4 + T cells compared to newborns. Our data show that Siglec-1 reduces IFN-γ release by adult T cells possibly by binding to the highly expressed CD43. The Siglec-1-dependent inhibition of IFN-γ in adults and the low expression of CD43 on newborn T cells provides a better understanding of the immune response against RSV in early life and adulthood. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ren, Hongyu; Li, Yuhong; Jiang, Han; Du, Minquan
2016-11-01
A number of studies recently revealed a link between periodontal disease and preterm birth (PTB). PTB can be induced by dental infection with Porphyromonas gingivalis (Pg), a periodontopathic bacterium. This study aims to investigate responses of human extravillous trophoblast-derived HTR8/SVneo cells to Pg infection. Cell apoptosis, cell viability, protein expression, and cytokine production in HTR8 cells were measured via: 1) flow cytometry, 2) CCK-8 assay, 3) western blot, and 4) enzyme-linked immunosorbent assay methods, respectively. Pg decreased cell viability and increased cell apoptosis, active caspase-3 and Fas expression, and interferon-gamma (IFN-γ) secretion in HTR8 cells. Extracellular signal-regulated kinase (ERK) 1/2 inhibitor U0126 and FasL neutralizing antibody NOK1 that blocks FasL/Fas interaction both significantly suppressed Pg-induced apoptosis. U0126 also inhibited IFN-γ secretion and Fas expression close to control levels. Moreover, treatment with recombinant IFN-γ also significantly decreased number of viable HTR8 cells and increased Fas expression, suggesting IFN-γ may play an important role in Pg-induced apoptosis of HTR8 cells, at least partially through regulation of Fas expression. To the best of the authors' knowledge, this is the first study to demonstrate Pg induces IFN-γ secretion, Fas expression, and apoptosis in human extravillous trophoblast-derived HTR8/SVneo cells in an ERK1/2-dependent manner, and IFN-γ (explored by recombinant IFN-γ) and Fas are involved in Pg-induced apoptosis. The finding that Pg infection abnormally regulates inflammation and apoptosis of human trophoblasts may give new insights into the possible link of PTB with maternal periodontal disease and periodontal pathogens.
Mossman, K; Nation, P; Macen, J; Garbutt, M; Lucas, A; McFadden, G
1996-01-01
Myxoma virus is a leporipoxvirus of New World rabbits (Sylvilagus sp.) that induces a rapidly lethal infection known as myxomatosis in the European rabbit (Oryctolagus cuniculus). Like all poxviruses, myxoma virus encodes a plethora of proteins to circumvent or inhibit a variety of host antiviral immune mechanisms. M-T7, the most abundantly secreted protein of myxoma virus-infected cells, was originally identified as an interferon-gamma receptor homolog (Upton, Mossman, and McFadden, Science 258, 1369-1372, 1992). Here, we demonstrate that M-T7 is dispensable for virus replication in cultured cells but is a critical virulence factor for virus pathogenesis in European rabbits. Disruption of both copies of the M-T7 gene in myxoma virus was achieved by the deletion of 372 bp of M-T7 coding sequences, replacement with a selectable marker, p7.5Ecogpt, and selection of a recombinant virus (vMyxlac-T7gpt) resistant to mycophenolic acid. vMyxlac-T7gpt expressed no detectable M-T7 protein and infected cells supernatants were devoid of any detectable interferon-gamma binding activities. Immunohistochemical staining with anti-beta-galactosidase and anti-CD43 antibodies demonstrated that in vMyxlac-T7gpt-infected rabbits the loss of M-T7 not only caused a dramatic reduction in disease symptoms and viral dissemination to secondary sites, but also dramatically influenced host leukocyte behavior. Notably, primary lesions in wild-type virus infections were generally underlayed by large masses of inflammatory cells that did not effectively migrate into the dermal sites of viral replication, whereas in vMyxlac-T7gpt infections this apparent block to leukocyte influx was relieved. A second major phenotypic distinction noted for the M-T7 knockout virus was the extensive activation of lymphocytes in secondary immune organs, particularly the spleen and lymph nodes, by Day 4 of the infection. This is in stark contrast to infection by wild-type myxoma virus, which results in relatively
Tang, Bone Siu-Fai; Chan, Jasper Fuk-Woo; Chen, Min; Tsang, Owen Tak-Yin; Mok, M. Y.; Lai, Raymond Wai-Man; Lee, Rodney; Que, Tak-Lun; Tse, Herman; Li, Iris Wai-Sum; To, Kelvin Kai-Wang; Cheng, Vincent Chi-Chung; Chan, Eric Yuk-Tat; Zheng, Bojian; Yuen, Kwok-Yung
2010-01-01
Acquired immunodeficiency due to autoantibody against gamma interferon has recently been associated with opportunistic nontuberculous mycobacteriosis, especially among Southeast Asians. We report another 8 cases, all except one apparently immunocompetent hosts who suffered from concomitant or sequential infections by other intracellular pathogens causing penicilliosis, extraintestinal nontyphoidal salmonellosis, and burkholderiosis. The only case with an underlying immunodeficiency syndrome had systemic lupus erythematosus that was quiescent throughout the multiple infective episodes. Eight out of 10 (80.0%) patients with serological evidence of penicilliosis, 5 out of 7 (71.4%) with culture-positive extraintestinal nontyphoidal salmonellosis, 5 out of 28 (17.9%) with serological evidence of melioidosis, and 7 out of 13 (53.8%) with culture-positive nontuberculous mycobacteriosis possessed autoantibody against gamma interferon, whereas only 1 out of 100 patients with systemic lupus erythematosus did. Our study represents the first and largest case series linking this emerging immunodeficiency syndrome with these atypical infections in apparently immunocompetent hosts. Thus, we advocate that any patient with unexplained recurrent or polymicrobial infections due to these intracellular pathogens should be screened for acquired immunodeficiency due to autoantibody against gamma interferon. PMID:20445006
Goodfellow, Alfred; Keeling, Douglas N; Hayes, Robert C; Webster, Duncan
2009-01-01
With increasing use of immunosuppressive therapy, including tumor necrosis factor alpha inhibitors, there is concern about infectious complications, including reactivation of latent Mycobacterium tuberculosis infection. Routine testing prior to administration of systemic immunosuppression includes the tuberculin skin test, which lacks sensitivity and specificity and may be difficult to interpret in the presence of extensive cutaneous disease. Treatment of individuals with latent tuberculosis infection is recommended when immunosuppressive medications are to be employed. We report a case in which a diagnosis of latent tuberculosis infection in a patient with extensive bullous pemphigoid was clarified by the use of an interferon-gamma release assay after equivocal tuberculin skin test results. Interferon-gamma release assays are useful adjuncts to the tuberculin skin test in the diagnosis of latent tuberculosis infection in the setting of extensive cutaneous disease.
Development of an aptamer beacon for detection of interferon-gamma.
Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander
2010-03-01
Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Hun Sik; Kim, Sunshin; Lee, Myung-Shik
2005-10-28
Although X-linked inhibitor of apoptosis protein (XIAP) is an important intracellular suppressor of apoptosis in a variety of cell types, its role in cytokine-induced pancreatic {beta}-cell apoptosis remains unclear. Here, we found that: (i) XIAP level was inversely correlated with tumor necrosis factor (TNF)-{alpha}-induced apoptosis in MIN6N8 insulinoma cells; (ii) adenoviral XIAP overexpression abrogated the TNF-{alpha}-induced apoptosis through inhibition of caspase activity; (iii) downregulation of XIAP by antisense oligonucleotide or Smac peptide sensitized MIN6N8 cells to TNF-{alpha}-induced apoptosis; (iv) XIAP expression was induced by TNF-{alpha} through a nuclear factor-{kappa}B (NF-{kappa}B)-dependent pathway, and interferon (IFN)-{gamma} prevented such an induction in amore » manner independent of NF-{kappa}B, which presents a potential mechanism underlying cytotoxic IFN-{gamma}/TNF-{alpha} synergism. Taken together, our results suggest that XIAP is an important modulator of TNF-{alpha}-induced apoptosis of MIN6N8 cells, and XIAP regulation in pancreatic {beta}-cells might play an important role in pancreatic {beta}-cell apoptosis and in the pathogenesis of type 1 diabetes.« less
Hastie, Marcus L.; Headlam, Madeleine J.; Patel, Nirav B.; Bukreyev, Alexander A.; Buchholz, Ursula J.; Dave, Keyur A.; Norris, Emma L.; Wright, Cassandra L.; Spann, Kirsten M.; Collins, Peter L.; Gorman, Jeffrey J.
2012-01-01
Respiratory syncytial viruses encode a nonstructural protein (NS1) that interferes with type I and III interferon and other antiviral responses. Proteomic studies were conducted on human A549 type II alveolar epithelial cells and type I interferon-deficient Vero cells (African green monkey kidney cells) infected with wild-type and NS1-deficient clones of human respiratory syncytial virus to identify other potential pathway and molecular targets of NS1 interference. These analyses included two-dimensional differential gel electrophoresis and quantitative Western blotting. Surprisingly, NS1 was found to suppress the induction of manganese superoxide dismutase (SOD2) expression in A549 cells and to a much lesser degree Vero cells in response to infection. Because SOD2 is not directly inducible by type I interferons, it served as a marker to probe the impact of NS1 on signaling of other cytokines known to induce SOD2 expression and/or indirect effects of type I interferon signaling. Deductive analysis of results obtained from cell infection and cytokine stimulation studies indicated that interferon-γ signaling was a potential target of NS1, possibly as a result of modulation of STAT1 levels. However, this was not sufficient to explain the magnitude of the impact of NS1 on SOD2 induction in A549 cells. Vero cell infection experiments indicated that NS1 targeted a component of the type I interferon response that does not directly induce SOD2 expression but is required to induce another initiator of SOD2 expression. STAT2 was ruled out as a target of NS1 interference using quantitative Western blot analysis of infected A549 cells, but data were obtained to indicate that STAT1 was one of a number of potential targets of NS1. A label-free mass spectrometry-based quantitative approach is proposed as a means of more definitive identification of NS1 targets. PMID:22322095
Effect of gamma interferon on lung function of mustard gas exposed patients, after 15 years.
Ghanei, Mostafa; Panahi, Yoones; Mojtahedzadeh, Mojtaba; Khalili, Ali Reza Hosseini; Aslani, Jafar
2006-01-01
Bronchiolitis has been known to be among the main the pathological features of lung lesions in Mustard Gas (MG) exposed patients. The purpose of this research was to evaluate the efficacy of interferon gamma-1b on the lung function in MG exposed patients with bronchiolitis. Thirty-six bronchiolitis patients, whose lung lesion had been diagnosed through High Resolution Computerized Tomography (HRCT) of the chest and also pathological study, were divided into two 18-member case and control groups. Both groups were receiving their conventional treatment (inhaled Felixotide and Servent). The case group were treated for 6 months with a combination of 200 microg of interferon gamma-1b (given three times per week subcutaneously) plus 7.5 mg of prednisolone (given once a day), while the control group received their previous conventional medications. Lung function was measured at base line and after 1, 3 and 6 months of treatment. In case and control groups, Forced Expiratory Volume in first second (FEV1) did not have statistical differences at the base line (49.3 +/- 2.9 and 48.7 +/- 4.1, respectively = 0.6), whereas a significant increase was seen in the case group (66.3 +/- 5.4) compared control group (57.3 +/- 8.6) at the subsequent months (P = 0.001 for the difference between the groups). Similar pattern of increase was observed in Forced Vital Capacity (FVC). The findings of this study indicate that a 6-month treatment with interferon gamma-1b plus a low-dose prednisolone is associated with an improvement in the lung function in mustard-gas exposed patients with bronchiolitis.
Pyrogenicity of interferon and its inducer in rabbits.
Won, S J; Lin, M T
1988-03-01
The effects of intracerebral administration of interferon (IFN) or its inducer polyriboinosinic acid-polyribocytidylic acid (poly I:C) on thermoregulatory responses were assessed in conscious rabbits. Administration of IFN (10(2)-10(6) IU) or poly I:C (0.012-12 micrograms) into the preoptic anterior hypothalamus or the third cerebral ventricle caused a dose-dependent fever in rabbits at three ambient temperatures (Ta) tested. In the cold (Ta = 8 degrees C), the fever was due to increased metabolism, whereas in the heat (Ta = 32 degrees C) the fever was due to a reduction in respiratory evaporative heat loss and ear skin blood flow. At the moderate environmental temperature (Ta = 22 degrees C), the fever was due to increased metabolism and cutaneous vasoconstriction. Compared with the febrile responses induced by cerebroventricular route injection of IFN or poly I:C, the hypothalamic route of injection required a much lower dose of IFN or poly I:C to produce a similar fever. Furthermore, the fever induced by intrahypothalamic injection of IFN or poly I:C was reduced by pretreatment of animals with a systemic dose of indomethacin (an inhibitor of all prostaglandins formation) or cycloheximide (an inhibitor of protein synthesis). The data indicate that IFN or its inducer may act through the endogenous release of a prostaglandin or a protein factor of an unknown chemical nature in the preoptic anterior hypothalamic region to induce fever in rabbits. The fever induced by IFN or its inducer is brought about by a decrease in heat loss and/or an increase in heat production in rabbits.
Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong
2010-01-01
Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.
Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A
2009-01-01
The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.
Yuk, Seong-Su; Lee, Dong-Hun; Park, Jae-Keun; Tseren-Ochir, Erdene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon
2016-04-27
Interferon gamma (IFN-γ), an immunoregulatory cytokine, is known to control many microbial infections. In a previous study, chicken interferon gamma (chIFN-γ) was found to be up-regulated following avian influenza virus (AIV) infection in specific pathogen-free chickens. We aimed to investigate whether the pre-immune state induced by chIFN-γ could generate an antiviral response against influenza virus. We generated a chIFN-γ-expressing plasmid and transfected it into chicken embryo fibroblasts (CEFs) and then infected the cells with human origin H1N1 or avian origin H9N2 influenza viruses. Viral titers of culture medium were evaluated in MDCK cell and the viral RNA and IFN-stimulated genes (ISGs) were then quantified by real-time reverse transcriptase polymerase. To further evaluate the role of the antiviral effect of chIFN-γ by using a backward approach, synthetic small interfering RNAs (siRNA) targeting chIFN-γ were used to suppress chIFN-γ. The chIFN-γ-stimulated CEFs inhibited the replication of viral RNA (vRNA) and showed a mild decrease in the infectious virus load released in the culture medium. Compared to the mock-transfected control, the messenger RNA (mRNA) levels of type I IFNs and IFN-stimulated genes were up-regulated in the cells expressing chIFN-γ. After treatment with the siRNA, we detected a higher expression of viral genes than that observed in the mock-transfected control. Our results suggest that apart from the important role played by chIFN-γ in the antiviral state generated against influenza virus infection, the pre-immune state induced by chIFN-γ can be helpful in mitigating the propagation of influenza virus.
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
Bach, Eviatar; Chaffer, Marcelo; Lai, Wanika; Keefe, Greg; Begg, Douglas J.
2018-01-01
To establish infection, pathogens secrete virulence factors, such as protein kinases and phosphatases, to modulate the signal transduction pathways used by host cells to initiate immune response. The protein MAP3893c is annotated in the genome sequence of Mycobacterium avium subspecies paratuberculosis (MAP), the causative agent of Johne's disease, as the serine/threonine protein kinase G (PknG). In this work, we report that PknG is a functional kinase that is secreted within macrophages at early stages of infection. The antigen is able to induce an immune response from cattle exposed to MAP in the form of interferon gamma production after stimulation of whole blood with PknG. These findings suggest that PknG may contribute to the pathogenesis of MAP by phosphorylating macrophage signalling and/or adaptor molecules as observed with other pathogenic mycobacterial species. PMID:29581962
Bach, Horacio; Richard-Greenblatt, Melissa; Bach, Eviatar; Chaffer, Marcelo; Lai, Wanika; Keefe, Greg; Begg, Douglas J
2018-01-01
To establish infection, pathogens secrete virulence factors, such as protein kinases and phosphatases, to modulate the signal transduction pathways used by host cells to initiate immune response. The protein MAP3893c is annotated in the genome sequence of Mycobacterium avium subspecies paratuberculosis (MAP), the causative agent of Johne's disease, as the serine/threonine protein kinase G (PknG). In this work, we report that PknG is a functional kinase that is secreted within macrophages at early stages of infection. The antigen is able to induce an immune response from cattle exposed to MAP in the form of interferon gamma production after stimulation of whole blood with PknG. These findings suggest that PknG may contribute to the pathogenesis of MAP by phosphorylating macrophage signalling and/or adaptor molecules as observed with other pathogenic mycobacterial species.
How Does Vaccinia Virus Interfere With Interferon?
Smith, Geoffrey L; Talbot-Cooper, Callum; Lu, Yongxu
2018-01-01
Interferons (IFNs) are secreted glycoproteins that are produced by cells in response to virus infection and other stimuli and induce an antiviral state in cells bearing IFN receptors. In this way, IFNs restrict virus replication and spread before an adaptive immune response is developed. Viruses are very sensitive to the effects of IFNs and consequently have evolved many strategies to interfere with interferon. This is particularly well illustrated by poxviruses, which have large dsDNA genomes and encode hundreds of proteins. Vaccinia virus is the prototypic poxvirus and expresses many proteins that interfere with IFN and are considered in this review. These proteins act either inside or outside the cell and within the cytoplasm or nucleus. They function by restricting the production of IFN by blocking the signaling pathways leading to transcription of IFN genes, stopping IFNs binding to their receptors, blocking IFN-induced signal transduction leading to expression of interferon-stimulated genes (ISGs), or inhibiting the antiviral activity of ISG products. © 2018 Elsevier Inc. All rights reserved.
St Laurent, G; Yoshie, O; Floyd-Smith, G; Samanta, H; Sehgal, P B; Lengyel, P
1983-05-01
(2'-5')(A)n synthetase and RNAase L (a latent endoribonuclease) are among the mediators of interferon action. The product of (2'-5')(A)n synthetase (i.e., (2'-5')(A)n) binds, and thereby activates RNAase L. Interferons induce in Ehrlich ascites tumor (EAT) cells two mRNAs (sizes 1.5 kb and 3.8 kb), which can be translated in Xenopus oocytes into (2'-5')(A)n synthetases of 20,000 to 30,000 daltons and 85,000 to 100,000 daltons, respectively. (2'-5')(A)n synthetases of corresponding sizes are induced by interferons in EAT cells. In the cell extract the bulk of the larger enzyme is in the cytoplasmic fraction, and the bulk of the smaller one in the nuclear fraction. The only known function of (2'-5')(A)n is the activation of RNAase L, and RNAase L can be selectively crosslinked to a (2'-5')(A)n derivative in a cytoplasmic extract from EAT cells. The same (2'-5')(A)n derivative can be crosslinked to several proteins in the nuclear extract of EAT cells, and some of these proteins are induced by interferon.
Feng, Xuan; Han, Diana; Kilaru, Bharat K.; Franek, Beverly S.; Niewold, Timothy B.; Reder, Anthony T.
2014-01-01
Objective To determine whether statins affect type 1 interferon responses in relapsing-remitting multiple sclerosis (RRMS). Design Study effects of atorvastatin on type 1 interferon responses in Jurkat cells, mononuclear cells (MNCs) from therapy-naive patients with RRMS in vitro, and MNCs from interferon-treated RRMS patients in vivo in 4 conditions: no drug, statin only, interferon-beta only, and statin added on to interferon-beta therapy. Patients The study examined clinically stable patients with RRMS: 21 therapy-naive patients and 14 patients receiving interferon-beta with a statin. Interventions Statin effects on in vitro and in vivo interferon-beta–induced STAT1 transcription factor activation, expression of interferon-stimulated proteins in MNCs, and serum type 1 interferon activity. Results In vitro, atorvastatin dose dependently inhibited expression of interferon-stimulated P-Y-STAT1 by 44% (P< .001), interferon regulatory factor 1 protein by 30% (P= .006), and myxovirus resistance 1 protein by 32% (P=.004) compared with no-statin control in MNCs from therapy-naive RRMS patients. In vivo, 9 of 10 patients who received high-dose statins (80 mg) had a significant reduction in interferon-beta therapy–induced serum interferon-α/β activity, whereas only 2 of 4 patients who received medium-dose statins (40 mg) had reductions. High-dose add-on statin therapy significantly blocked interferon-beta function, with less P-Y-STAT1 transcription factor activation, and reduced myxovirus resistance 1 protein and viperin protein production. Medium doses of statins did not change STAT1 activation. Conclusions High-dose add-on statin therapy significantly reduces interferon-beta function and type 1 interferon responses in RRMS patients. These data provide a putative mechanism for how statins could counteract the beneficial effects of interferon-beta and worsen disease. PMID:22801747
Laurent-Rolle, Maudry; Morrison, Juliet; Rajsbaum, Ricardo; Macleod, Jesica M Levingston; Pisanelli, Giuseppe; Pham, Alissa; Ayllon, Juan; Miorin, Lisa; Martinez, Carles; tenOever, Benjamin R; García-Sastre, Adolfo
2014-09-10
To successfully establish infection, flaviviruses have to overcome the antiviral state induced by type I interferon (IFN-I). The nonstructural NS5 proteins of several flaviviruses antagonize IFN-I signaling. Here we show that yellow fever virus (YFV) inhibits IFN-I signaling through a unique mechanism that involves binding of YFV NS5 to the IFN-activated transcription factor STAT2 only in cells that have been stimulated with IFN-I. This NS5-STAT2 interaction requires IFN-I-induced tyrosine phosphorylation of STAT1 and the K63-linked polyubiquitination at a lysine in the N-terminal region of YFV NS5. We identified TRIM23 as the E3 ligase that interacts with and polyubiquitinates YFV NS5 to promote its binding to STAT2 and trigger IFN-I signaling inhibition. Our results demonstrate the importance of YFV NS5 in overcoming the antiviral action of IFN-I and offer a unique example of a viral protein that is activated by the same host pathway that it inhibits. Copyright © 2014 Elsevier Inc. All rights reserved.
Rajsbaum, Ricardo; Macleod, Jesica M. Levingston; Pisanelli, Giuseppe; Pham, Alissa; Ayllon, Juan; Miorin, Lisa; Martinez, Carles; tenOever, Benjamin R; García-Sastre, Adolfo
2014-01-01
Summary To successfully establish infection Flaviviruses have to overcome the antiviral state induced by type I interferon (IFN-I). The nonstructural NS5 proteins of several flaviviruses antagonize IFN-I signaling. Here we show that yellow fever virus (YFV) inhibits IFN-I signaling through a unique mechanism that involves binding of YFV NS5 to the IFN-activated transcription factor STAT2 only in cells that have been stimulated with IFN-I. This NS5-STAT2 interaction requires IFN-I-induced tyrosine phosphorylation of STAT1 and the K63-linked polyubiquitination at a lysine in the N-terminal region of YFV NS5. We identified TRIM23 as the E3 ligase that interacts with and polyubiquitinates YFV NS5 to promote its binding to STAT2 and trigger IFN-I signaling inhibition. Our results demonstrate the importance of YFV NS5 in overcoming the antiviral action of IFN-I and offer a unique example of a viral protein that is activated by the same host pathway that it inhibits. PMID:25211074
Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza
2014-03-01
The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.
Bansal, Ruchi; Prakash, Jai; De Ruiter, Marieke; Poelstra, Klaas
2014-04-10
Hepatic stellate cells play a crucial role in the pathogenesis of hepatic fibrosis. Thus, pharmacological inhibition of pro-fibrotic activities of these cells might lead to an effective therapy for this disease. Among the potent anti-fibrotics, interferon gamma (IFNγ), a proinflammatory cytokine, is highly efficacious but it failed in clinical trials due to the poor efficacy and multiple adverse effects attributed to the ubiquitous IFNγ receptor (IFNγR) expression. To resolve these drawbacks, we chemically synthesized a chimeric molecule containing (a) IFNγ signaling peptide (IFNγ peptidomimetic, mimγ) that retains the agonistic activities of IFNγ but lacks an extracellular receptor recognition sequence for IFNγR; coupled via heterobifunctional PEG linker to (b) bicyclic platelet derived growth factor beta receptor (PDGFβR)-binding peptide (BiPPB) to induce internalization into the stellate cells that express PDGFβR. The synthesized targeted IFNγ peptidomimetic (mimγ-BiPPB) was extensively investigated for its anti-fibrotic and adverse effects in acute and chronic CCl4-induced liver fibrosis models in mice. Treatment with mimγ-BiPPB, after the onset of disease, markedly inhibited both early and established hepatic fibrosis as reflected by a reduced intrahepatic α-SMA, desmin and collagen-I mRNA expression and protein levels. While untargeted mimγ and BiPPB had no effect, and native IFNγ only induced a moderate reduction. Additionally, no off-target effects, e.g. systemic inflammation, were found with mimγ-BiPPB, which were substantially observed in mice treated with native IFNγ. The present study highlights the beneficial effects of a novel BiPPB mediated cell-specific targeting of IFNγ peptidomimetic to the disease-inducing cells and therefore represents a highly potential therapeutic approach to treat fibrotic diseases. Copyright © 2014 Elsevier B.V. All rights reserved.
Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J
2018-05-01
To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.
Interferon effects on protozoan infections
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Wirth, J.; Kierszenbaum, F.; Degee, A. L. W.; Mansfield, J. M.
1985-01-01
The effects of interferon (IFN) on mice infected with two different parasitic protozoans, Trypanosoma cruzi and Trypanosoma brucei rhodesiense, are investigated experimentally. The preparation of the cell cultures, IFN and assays, antibody, and the experimental procedures are described. It is observed that in cells treated with IFN-gamma there is an increased association of T. cruzi with murine macrophages and an increase in the killing of T. cruzi by IFN-gamma-treated murine macrophages. For spleen cells infected with T.b. rhodesiense in vitro, it is detected that live trypanosomes cannot induce IFN in cells from normal mice, but can in cells from immunized mice; and that trypanosome-lysates induce IFN in vitro in cells from normal mice. The data suggest that there is a two-step mechanism for mice against T. cruzi and T.b. rhodesiense.
[Fish interferon response and its molecular regulation: a review].
Zhang, Yibing; Gui, Jianfang
2011-05-01
Interferon response is the first line of host defense against virus infection. Recent years have witnessed tremendous progress in understanding of fish innate response to virus infection, especially in fish interferon antiviral response. A line of fish genes involved in interferon antiviral response have been identified and functional studies further reveal that fish possess an IFN antiviral system similar to mammals. However, fish virus-induced interferon genes contain introns similar to mammalian type III interferon genes although they encode proteins similar to type I interferons, which makes it hard to understand the evolution of vertebrate interferon genes directly resulting in a debate on nomenclature of fish interferon genes. Actually, fish display some unique mechanisms underlying interferon antiviral response. This review documents the recent progress on fish interferon response and its molecular mechanism.
HCV core protein induces hepatic lipid accumulation by activating SREBP1 and PPAR{gamma}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Kook Hwan; Hong, Sung Pyo; Kim, KyeongJin
2007-04-20
Hepatic steatosis is a common feature in patients with chronic hepatitis C virus (HCV) infection. HCV core protein plays an important role in the development of hepatic steatosis in HCV infection. Because SREBP1 (sterol regulatory element binding protein 1) and PPAR{gamma} (peroxisome proliferators-activated receptor {gamma}) are involved in the regulation of lipid metabolism of hepatocyte, we sought to determine whether HCV core protein may impair the expression and activity of SREBP1 and PPAR{gamma}. In this study, it was demonstrated that HCV core protein increases the gene expression of SREBP1 not only in Chang liver, Huh7, and HepG2 cells transiently transfectedmore » with HCV core protein expression plasmid, but also in Chang liver-core stable cells. Furthermore, HCV core protein enhanced the transcriptional activity of SREBP1. In addition, HCV core protein elevated PPAR{gamma} transcriptional activity. However, HCV core protein had no effect on PPAR{gamma} gene expression. Finally, we showed that HCV core protein stimulates the genes expression of lipogenic enzyme and fatty acid uptake associated protein. Therefore, our finding provides a new insight into the mechanism of hepatic steatosis by HCV infection.« less
Komohara, Yoshihiro; Takemura, Kenichi; Lei, Xiao Feng; Sakashita, Naomi; Harada, Mamoru; Suzuki, Hiroshi; Kodama, Tatsuhiko; Takeya, Motohiro
2009-11-01
Class A scavenger receptors (SR-A, CD204) are highly expressed in tumor-associated macrophages (TAM). To investigate the function of SR-A in TAM, wild-type and SR-A-deficient (SR-A(-/-)) mice were injected with EL4 cells. Although these groups of mice did not differ in the numbers of infiltrating macrophages and lymphocytes and in neovascularization, SR-A(-/-) mice had delayed growth of EL4 tumors. Expression of inducible nitric oxide (NO) synthase and interferon (IFN)-gamma mRNA increased significantly in tumor tissues from SR-A(-/-) mice. Engulfment of necrotic EL4 cells induced upregulation of NO and IFN-gamma production by cultured macrophages, and production of NO and IFN-gamma increased in SR-A(-/-) macrophages in vitro. IFN-beta production by cultured macrophages was also elevated in SR-A(-/-) macrophages in vitro. These results suggested that the antitumor activity of macrophages increased in SR-A(-/-) mice because of upregulation of NO and IFN-gamma production. These data indicate an important role of SR-A in regulating TAM function by inhibiting toll-like receptor (TLR)4-IFN-beta signaling.
Effect of interferon-gamma on complement gene expression in different cell types.
Lappin, D F; Guc, D; Hill, A; McShane, T; Whaley, K
1992-01-15
We have studied the expression of the complement components C2, C3, factor B, C1 inhibitor (C1-inh), C4-binding protein (C4-bp) and factor H in human peripheral blood monocytes, skin fibroblasts, umbilical vein endothelial cells (HUVEC) and the human hepatoma cell line G2 (Hep G2) in the absence and the presence of interferon-gamma (IFN-gamma). E.l.i.s.a. performed on culture fluids, run-on transcription assays, Northern blot and double-dilution dot-blot techniques confirmed that monocytes expressed all six components, whereas fibroblasts, HUVEC and HepG2 each expressed five of the six components. Fibroblasts and HUVEC did not synthesize C4-bp, and Hep G2 did not produce factor H. In addition to these differences, the synthesis rates of C3, C1-inh and factor H were not the same in all cell types. However, the synthesis rates of C2 and factor B were similar in all four cell types. The half-lives of the mRNAs were shorter in monocytes than in other cell types. Monocyte factor H mRNA had a half-life of 12 min in monocytes, compared with over 3 h in fibroblasts and HUVEC. The instability of factor H mRNA in monocytes may contribute to their low factor H secretion rate. IFN-gamma produced dose-dependent stimulation of C2, factor B, C1-inh, C4-bp and factor H synthesis by all cell types expressing these proteins, but decreased C3 synthesis in all four cell types. Cell-specific differences in the response to IFN-gamma were observed. The increased rates of transcription of the C1-inh and factor H genes in HUVEC were greater than in other cell types, while the increased rate of transcription of the C2, factor B and C1-inh genes in Hep G2 cells was less than in other cell types. IFN-gamma did not affect the stability of C3, factor H or C4 bp mRNAs, but increased the stability of factor B and C1-inh mRNAs and decreased the stability of C2 mRNA. Although these changes occurred in all four cell types studied, the half-life of C1-inh mRNA in monocytes was increased almost 4-fold
Sperber, K; Silverstein, L; Brusco, C; Yoon, C; Mullin, G E; Mayer, L
1995-01-01
Superantigens are potent inducers of T-cell proliferation and induce a broad range of cytokines, including tumor necrosis factor (TNF), gamma interferon, and interleukin 2 (IL-2). In the present study, we compared the abilities of different staphylococcal superantigens (staphylococcal enterotoxin B [SEB], staphylococcal enterotoxin E [SEE], and toxic shock syndrome toxin 1 [TSST-1]) to stimulate distinct cytokine profiles in peripheral blood mononuclear cells (PBMC), lamina propria lymphocytes (LPL), and intraepithelial lymphocytes (IEL). One million PBMC, LPL, and IEL were stimulated with various concentrations of superantigen (10 to 0.001 ng/ml) for 24, 48, and 72 h. Maximum cytokine production by PBMC, LPL, and IEL was observed for all three superantigens at 48 h at a concentration of 1 ng/ml. In PBMC, SEE and TSST-1 stimulated more IL-2 and gamma interferon than SEB. SEE and TSST-1 also stimulated more TNF and IL-4 production than SEB. In contrast, SEB stimulated more IL-6 than either SEE or TSST-1. In LPL, there was no SEE-induced IL-2 or IL-4 production, but IL-6, TNF, and gamma interferon were induced. SEB similarly induced no IL-2 or gamma interferon from the LPL, but IL-4, IL-6, and TNF were detected. TSST-1 stimulation of LPL resulted in IL-2 and TNF production but no IL-4, IL-6, or gamma interferon. In IEL, SEE induced no IL-2, IL-4, or gamma interferon but produced IL-6 and TNF, while SEB stimulation resulted in no IL-2 or gamma interferon but did result in detectable IL-4, IL-6, and TNF. Taken together, these data indicate that there are significant differences in the cytokine profiles induced by superantigens in LPL and IEL compared with those in PBMC, and these differences may relate to differences in activation requirements. PMID:7583927
Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Se-Kyung; You, Su-Hwa; Kim, Taeseong; Tark, Dongseob; Lee, Hyang-Sim; Seo, Min-Goo; Kim, Byounghan
2015-01-01
ABSTRACT Because the currently available vaccines against foot-and-mouth disease (FMD) provide no protection until 4 to 7 days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is the application of antiviral agents. Combination treatment strategies have been used to enhance the efficacy of antiviral agents, and such strategies may be advantageous in overcoming viral mechanisms of resistance to antiviral treatments. We have developed recombinant adenoviruses (Ads) for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) targeting FMDV mRNAs encoding nonstructural proteins. The antiviral effects of Ad-porcine IFN-αγ and Ad-3siRNA expression were tested in combination in porcine cells, suckling mice, and swine. We observed enhanced antiviral effects in porcine cells and mice as well as robust protection against the highly pathogenic strain O/Andong/SKR/2010 and increased expression of cytokines in swine following combination treatment. In addition, we showed that combination treatment was effective against all serotypes of FMDV. Therefore, we suggest that the combined treatment with Ad-porcine IFN-αγ and Ad-3siRNA may offer fast-acting antiviral protection and be used with a vaccine during the period that the vaccine does not provide protection against FMD. IMPORTANCE The use of current foot-and-mouth disease (FMD) vaccines to induce rapid protection provides limited effectiveness because the protection does not become effective until a minimum of 4 days after vaccination. Therefore, during outbreaks antiviral agents remain the only available treatment to confer rapid protection and reduce the spread of foot-and-mouth disease virus (FMDV) in livestock until vaccine-induced protective immunity can become effective. Interferons (IFNs) and small interfering RNAs (siRNAs) have been reported to be effective antiviral agents against
Yun, Cheol H.; Lundgren, Anna; Azem, Josef; Sjöling, Åsa; Holmgren, Jan; Svennerholm, Ann-Mari; Lundin, B. Samuel
2005-01-01
Helicobacter pylori is known to induce a local immune response, which is characterized by activation of lymphocytes and the production of IFN-γ in the stomach mucosa. Since not only T cells, but also natural killer (NK) cells, are potent producers of gamma interferon (IFN-γ), we investigated whether NK cells play a role in the immune response to H. pylori infection. Our results showed that NK cells were present in both the gastric and duodenal mucosae but that H. pylori infection did not affect the infiltration of NK cells into the gastrointestinal area. Furthermore, we could show that NK cells could be activated directly by H. pylori antigens, as H. pylori bacteria, as well as lysate from H. pylori, induced the secretion of IFN-γ by NK cells. NK cells were also activated without direct contact when separated from the bacteria by an epithelial cell layer, indicating that the activation of NK cells by H. pylori can also occur in vivo, in the infected stomach mucosa. Moreover, the production of IFN-γ by NK cells was greatly enhanced when a small amount of interleukin-12 (IL-12) was added, and this synergistic effect was associated with increased expression of the IL-12 receptor β2. It was further evident that bacterial lysate alone was sufficient to induce the activation of cytotoxicity-related molecules. In conclusion, we demonstrated that NK cells are present in the gastroduodenal mucosa of humans and that NK cells produce high levels of IFN-γ when stimulated with a combination of H. pylori antigen and IL-12. We propose that NK cells play an active role in the local immune response to H. pylori infection. PMID:15731046
Peng, Wan; Lu, Dan-Qi; Li, Gao-Fei; Zhang, Xu; Yao, Mi; Zhang, Yong; Lin, Hao-Ran
2016-02-01
Interferon gamma (IFNγ) is a Th1 cytokine that plays a very important role in almost all phases of immune and inflammatory responses. In this study, we explored the functions of IFNγ1 and IFNγ2 of Tetraodon nigroviridis. Treating T. nigroviridis spleen and head kidney cells in vitro with recombinant T. nigroviridis IFNγ1 protein (rTn IFNγ1) or recombinant T. nigroviridis IFNγ2 protein (rTn IFNγ2) enhanced their nitric oxide responses. Both rTn IFNγ1 and rTn IFNγ2 also induced the expression of interferon-stimulated gene 15 (ISG15), a common anti-viral gene, although the expression of the interferon-inducible Mx gene was markedly inhibited by rTn IFNγ1 and was induced by rTn IFNγ2. The in vivo effects of rTn IFNγ1 and rTn IFNγ2 on Vibrio parahaemolyticus (V. parahaemolyticus) infection were assessed by intraperitoneally injecting rTn IFNγ1 or rTn IFNγ2 (100 ng) and V. parahaemolyticus (8 × 10(10)CFU/mL) into T. nigroviridis. A comparison of the group treated only with V. parahaemolyticus and those also treated with rTn IFNγ1 or rTn IFNγ2 showed that neither of these IFNγs protected T. nigroviridis from V. parahaemolyticus infection. However, rTn IFNγ1 more rapidly and robustly promoted inflammatory responses compared with rTn IFNγ2, whereas rTn IFNγ2 was involved in inducing the host to develop a more effective response earlier during the later stage of a V. parahaemolyticus infection. Moreover, microRNA-29b (miR-29b) expression is inversely correlated with IFNγ2 expression in T. nigroviridis. Copyright © 2015 Elsevier Ltd. All rights reserved.
Human interferon and its inducers: clinical program overview at Roswell Park Memorial Institute.
Carter, W A; Horoszewicz, J S
1978-11-01
An overview of the clinical interferon program at Roswell Park Memorial Institute is presented. Purified fibroblast interferon and a novel inducer of human interferon [rIn-r(C12,U)n] are being evaluated for possible antiviral, antiproliferative, and immunomodulatory activities in patients with cancer.
Mu, Chunyu; Su, Yanhui; Liu, Ran; Huang, Zhengyang; Li, Yang; Yu, Qingming; Chang, Guobin; Xu, Qi; Chen, Guohong
2015-01-01
The interferon-induced proteins with tetratricopeptide repeats (IFITs) protein family mediates antiviral effects by inhibiting translation initiation, cell proliferation, and migration in the interferon (IFN) dependent innate immune system. Several members of this family, including IFIT1, IFIT2, IFIT3 and IFIT5, have been heavily studied in mammals. Avian species contain only one family member, IFIT5, and little is known about the role of this protein in birds. In this study, duck IFIT5 (duIFIT5) full-length mRNA was cloned by reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of the cDNA ends (RACE). Based on the sequence obtained, we performed a series of bioinformatics analyses, and found that duIFIT5 was most similar to homologs in other avian species. Also, duIFIT5 contained eight conserved TPR motifs and two conserved multi-domains (TPR_11 and TPR_12). Finally, we used duck hepatitis virus type 1 (DHV-1) and polyriboinosinicpolyribocytidylic acid (poly (I:C)) as a pathogen or a pathogen-associated molecular pattern induction to infect three-day-old domestic ducklings. The liver and spleen were collected to detect the change in duIFIT5 transcript level upon infection by quantitative real-time PCR (qRT-PCR). DuIFIT5 expression rapidly increased after DHV-1 infection and maintained a high level, while the transcripts of duIFIT5 peaked at 8h after poly (I:C) infection and then returned to normal. Taken together, these results provide a greater understanding of avian IFIT5. PMID:25816333
Interferon-gamma promoter hypomethylation and increased expression in chronic periodontitis
Zhang, Shaoping; Crivello, Antonino; Offenbacher, Steven; Moretti, Antonio; Paquette, David W.; Barros, Silvana P.
2011-01-01
Aim The goal of this investigation was to determine whether epigenetic modifications in the IFNG promoter are associated with an increase of IFNG transcription in different stages of periodontal diseases. Materials and Methods DNA was extracted from gingival biopsy samples collected from 47 total sites from 47 different subjects: 23 periodontally healthy sites, 12 experimentally induced gingivitis sites and 12 chronic periodontitis sites. Levels of DNA methylation within the IFNG promoter containing six CpG dinucleotides were determined using pyrosequencing technology. Interferon gamma mRNA expression was analysed by quantitative polymerase chain reactions using isolated RNA from part of the biological samples mentioned above. Results The methylation level of all six analysed CpG sites within the IFNG promoter region in the periodontitis biopsies {52% [interquartile range, IQR (43.8%, 63%)]} was significantly lower than periodontally healthy samples {62% [IQR (51.3%, 74%)], p =0.007} and gingivitis biopsies {63% [IQR (55%, 74%)], p =0.02}. The transcriptional level of IFNG in periodontitis biopsies was 1.96-fold and significantly higher than tissues with periodontal health (p =0.04). Although the mRNA level from experimental gingivitis samples exhibited an 8.5-fold increase as compared with periodontally healthy samples, no significant methylation difference was observed in experimental gingivitis sample. Conclusions A hypomethylation profile within IFNG promoter region is related to an increase of IFNG transcription present in the chronic periodontitis biopsies, while such an increase of IFNG in experimentally induced gingivitis seems independent of promoter methylation alteration. PMID:20958339
No Love Lost Between Viruses and Interferons.
Fensterl, Volker; Chattopadhyay, Saurabh; Sen, Ganes C
2015-11-01
The interferon system protects mammals against virus infections. There are several types of interferons, which are characterized by their ability to inhibit virus replication and resultant pathogenesis by triggering both innate and cell-mediated immune responses. Virus infection is sensed by a variety of cellular pattern-recognition receptors and triggers the synthesis of interferons, which are secreted by the infected cells. In uninfected cells, cell surface receptors recognize the secreted interferons and activate intracellular signaling pathways that induce the expression of interferon-stimulated genes; the proteins encoded by these genes inhibit different stages of virus replication. To avoid extinction, almost all viruses have evolved mechanisms to defend themselves against the interferon system. Consequently, a dynamic equilibrium of survival is established between the virus and its host, an equilibrium that can be shifted to the host's favor by the use of exogenous interferon as a therapeutic antiviral agent.
Evasion of interferon responses by Ebola and Marburg viruses.
Basler, Christopher F; Amarasinghe, Gaya K
2009-09-01
The filoviruses, Ebola virus (EBOV) and Marburg virus (MARV), cause frequently lethal viral hemorrhagic fever. These infections induce potent cytokine production, yet these host responses fail to prevent systemic virus replication. Consistent with this, filoviruses have been found to encode proteins VP35 and VP24 that block host interferon (IFN)-alpha/beta production and inhibit signaling downstream of the IFN-alpha/beta and the IFN-gamma receptors, respectively. VP35, which is a component of the viral nucleocapsid complex and plays an essential role in viral RNA synthesis, acts as a pseudosubstrate for the cellular kinases IKK-epsilon and TBK-1, which phosphorylate and activate interferon regulatory factor 3 (IRF-3) and interferon regulatory factor 7 (IRF-7). VP35 also promotes SUMOylation of IRF-7, repressing IFN gene transcription. In addition, VP35 is a dsRNA-binding protein, and mutations that disrupt dsRNA binding impair VP35 IFN-antagonist activity while leaving its RNA replication functions intact. The phenotypes of recombinant EBOV bearing mutant VP35s unable to inhibit IFN-alpha/beta demonstrate that VP35 IFN-antagonist activity is critical for full virulence of these lethal pathogens. The structure of the VP35 dsRNA-binding domain, which has recently become available, is expected to provide insight into how VP35 IFN-antagonist and dsRNA-binding functions are related. The EBOV VP24 protein inhibits IFN signaling through an interaction with select host cell karyopherin-alpha proteins, preventing the nuclear import of otherwise activated STAT1. It remains to be determined to what extent VP24 may also modulate the nuclear import of other host cell factors and to what extent this may influence the outcome of infection. Notably, the Marburg virus VP24 protein does not detectably block STAT1 nuclear import, and, unlike EBOV, MARV infection inhibits STAT1 and STAT2 phosphorylation. Thus, despite their similarities, there are fundamental differences by which
Adam, Liana; Black, Peter C; Kassouf, Wassim; Eve, Beryl; McConkey, David; Munsell, Mark F; Benedict, William F; Dinney, Colin P N
2007-05-01
Intravesical adenovirus mediated interferon-alpha gene transfer has a potent therapeutic effect against superficial human bladder carcinoma xenografts growing in the bladder of athymic nude mice. We determined whether the inhibition of angiogenesis might contribute to the antitumor effect. We treated several human urothelial carcinoma cells with adenovirus mediated interferon-alpha 2b and monitored its effects on the production of angiogenic factors using real-time reverse-transcription polymerase chain reaction, Western blotting, and immunohistochemical analysis and a gel shift based transcription factor array. To assess the role of adenovirus mediated interferon 2b in angiogenic activity we used in vitro invasion assays and evaluated the anti-angiogenic effects of adenovirus mediated interferon gene therapy in an orthotopic murine model of human superficial bladder cancer. In adenovirus mediated interferon-alpha infected 253J B-V cells vascular endothelial growth factor was decreased and anti-angiogenic interferon-gamma inducible protein 10 was up-regulated. In contrast, the addition of as much as 100,000 IU recombinant interferon had no apparent effect on vascular endothelial growth factor production. Conditioned medium derived from adenovirus mediated interferon 2b infected 253J B-V cells greatly decreased the invasive potential of human endothelial cells and down-regulated their matrix metalloproteinase 2 expression compared to controls. Furthermore, adenovirus mediated interferon 2b blocked pro-angiogenic nuclear signals, such as the transcription factors activating protein-1 and 2, stimulating protein-1, nuclear factor kappaB and c-myb. In vivo experiments revealed significant vascular endothelial growth factor down-regulation and decreased tumor vessel density in the adenovirus mediated interferon 2b treated group compared to controls. Treatment with adenovirus mediated interferon 2b increases the angiostatic activity of the bladder cancer microenvironment
Bozeman, Ronald; Abel, Erika L; Macias, Everardo; Cheng, Tianyi; Beltran, Linda; DiGiovanni, John
2015-08-01
The current study was designed to explore the role of signal transducer and activator of transcription 1 (Stat1) during tumor promotion using the mouse skin multistage carcinogenesis model. Topical treatment with both 12-O-tetradecanoylphorbol-13-acetate (TPA) and 3-methyl-1,8-dihydroxy-9-anthrone (chrysarobin or CHRY) led to rapid phosphorylation of Stat1 on both tyrosine (Y701) and serine (S727) residues in epidermis. CHRY treatment also led to upregulation of unphosphorylated Stat1 (uStat1) at later time points. CHRY treatment also led to upregulation of interferon regulatory factor 1 (IRF-1) mRNA and protein, which was dependent on Stat1. Further analyses demonstrated that topical treatment with CHRY but not TPA upregulated interferon-gamma (IFNγ) mRNA in the epidermis and that the induction of both IRF-1 and uStat1 was dependent on IFNγ signaling. Stat1 deficient (Stat1(-/-) ) mice were highly resistant to skin tumor promotion by CHRY. In contrast, the tumor response (in terms of both papillomas and squamous cell carcinomas) was similar in Stat1(-/-) mice and wild-type littermates with TPA as the promoter. Maximal induction of both cyclooxygenase-2 and inducible nitric oxide synthase in epidermis following treatment with CHRY was also dependent on the presence of functional Stat1. These studies define a novel mechanism associated with skin tumor promotion by the anthrone class of tumor promoters involving upregulation of IFNγ signaling in the epidermis and downstream signaling through activated (phosphorylated) Stat1, IRF-1 and uStat1. © 2014 Wiley Periodicals, Inc.
Han, Xuesheng; Parker, Tory L
2017-06-01
Arborvitae ( Thuja plicata ) essential oil (AEO) is becoming increasingly popular in skincare, although its biological activity in human skin cells has not been investigated. Therefore, we sought to study AEO's effect on 17 important protein biomarkers that are closely related to inflammation and tissue remodeling by using a pre-inflamed human dermal fibroblast culture model. AEO significantly inhibited the expression of vascular cell adhesion molecule 1 (VCAM-1), intracellular cell adhesion molecule 1 (ICAM-1), interferon gamma-induced protein 10 (IP-10), interferon-inducible T-cell chemoattractant (I-TAC), monokine induced by interferon gamma (MIG), and macrophage colony-stimulating factor (M-CSF). It also showed significant antiproliferative activity and robustly inhibited collagen-I, collagen-III, plasminogen activator inhibitor-1 (PAI-1), and tissue inhibitor of metalloproteinase 1 and 2 (TIMP-1 and TIMP-2). The inhibitory effect of AEO on increased production of these protein biomarkers suggests it has anti-inflammatory property. We then studied the effect of AEO on the genome-wide expression of 21,224 genes in the same cell culture. AEO significantly and diversely modulated global gene expression. Ingenuity pathway analysis (IPA) showed that AEO robustly affected numerous critical genes and signaling pathways closely involved in inflammatory and tissue remodeling processes. The findings of this study provide the first evidence of the biological activity and beneficial action of AEO in human skin cells.
Ho, Nathan K.; Crandall, Ian; Sherman, Philip M.
2012-01-01
Enterohemorrhagic Escherichia coli serotype O157:H7 is a food borne enteric bacterial pathogen that causes significant morbidity and mortality in both developing and industrialized nations. E. coli O157:H7 infection of host epithelial cells inhibits the interferon gamma pro-inflammatory signaling pathway, which is important for host defense against microbial pathogens, through the inhibition of Stat-1 tyrosine phosphorylation. The aim of this study was to determine which bacterial factors are involved in the inhibition of Stat-1 tyrosine phosphorylation. Human epithelial cells were challenged with either live bacteria or bacterial-derived culture supernatants, stimulated with interferon-gamma, and epithelial cell protein extracts were then analyzed by immunoblotting. The results show that Stat-1 tyrosine phosphorylation was inhibited by E. coli O157:H7 secreted proteins. Using sequential anion exchange and size exclusion chromatography, YodA was identified, but not confirmed to mediate subversion of the Stat-1 signaling pathway using isogenic mutants. We conclude that E. coli O157:H7 subverts Stat-1 tyrosine phosphorylation in response to interferon-gamma through a still as yet unidentified secreted bacterial protein. PMID:22253910
Yamaoka, J; Kume, T; Akaike, A; Miyachi, Y
2000-05-01
Zinc, an essential metal, is a critical component of zinc binding proteins such as zinc fingers, zinc enzymes and metallothioneins. Recently, evidence for its anti-inflammatory property in skin has been accumulating, as shown in the treatment of acne, alopecia and zinc deficiency. In cutaneous inflammations, a large amount of nitric oxide (NO) is produced through induction of inducible nitric oxide synthase (iNOS) under the influence of proinflammatory cytokines, resulting in tissue damages in skin, as clarified in other organs. Therefore, we asked if the effect of zinc on NO production and/or on iNOS expression in keratinocytes may explain the anti-inflammatory property of zinc in skin. Accordingly, we sought to determine in this study whether zinc ion may have effect on IFN-gamma or TNF-alpha induced NO production and iNOS expression in cultured murine keratinocytes. Ten microM of zinc ion remarkably suppressed cytokine-induced NO production in keratinocytes. Furthermore, zinc ion also suppressed cytokine-induced iNOS expression in the protein level as well as in the messenger RNA level. These results suggest the possibility that the suppressive effect of zinc ion on cytokine-induced NO production in keratinocytes may be in part implicated in the anti-inflammatory property of zinc in some of skin disorders.
Interferon system in women with genital papillomavirus infection receiving immunomodulatory therapy.
Rogovskaya, S I; Zhdanov, A V; Loginova, N S; Faizullin, L Z; Prilepskaya, V N; Van'ko, L V; Sukhikh, G T
2002-11-01
The interferon system was studied in women with genital papillomavirus infection. In most patients the interferon system was activated, while the ability of lymphocytes to respond to inductors decreased. Laserotherapy and immunomodulatory therapy with larifan, ridostin, and viferon for 1 month normalized blood interferon concentration (39.4% patients) and interferon-gamma production by lymphocytes in response to inductors (87.9% patients). After laser monotherapy these parameters returned to normal only in 13.2 and 7.6% patients, respectively. Correlation and regression analyses showed that changes in the interferon system were synchronized after immunomodulatory therapy. These data indicate that immunomodulatory therapy produces a complex effect on the interferon system. Measurements of blood interferon level can be used to predict the effect of further treatment with interferon-gamma inductors.
Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J
2007-06-01
Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.
Flavonoids inhibit cytokine-induced endothelial cell adhesion protein gene expression.
Gerritsen, M. E.; Carley, W. W.; Ranges, G. E.; Shen, C. P.; Phan, S. A.; Ligon, G. F.; Perry, C. A.
1995-01-01
Treatment of human endothelial cells with cytokines such as interleukin-1, tumor necrosis factor-alpha (TNF-alpha) or interferon-gamma induces the expression of specific leukocyte adhesion molecules on the endothelial cell surface. Interfering with either leukocyte adhesion or adhesion protein upregulation is an important therapeutic target as evidenced by the potent anti-inflammatory actions of neutralizing antibodies to these ligands in various animal models and in patients. In the present study we report that cotreatment of human endothelial cells with certain hydroxyflavones and flavanols blocks cytokine-induced ICAM-1, VCAM-1, and E-selectin expression on human endothelial cells. One of the most potent flavones, apigenin, exhibited a dose- and time-dependent, reversible effect on adhesion protein expression as well as inhibiting adhesion protein upregulation at the transcriptional level. Apigenin also inhibited IL-1 alpha-induced prostaglandin synthesis and TNF-alpha-induced IL-6 and IL-8 production, suggesting that the hydroxyflavones may act as general inhibitors of cytokine-induced gene expression. Although apigenin did not inhibit TNF-alpha-induced nuclear translocation of NF-kappa B(p50(NFKB1)/p65(RelA)) we found this flavonoid did inhibit TNF-alpha induced beta-galactosidase activity in SW480 cells stably transfected with a beta-galactosidase reporter construct driven by four NF-kappa B elements, suggesting an action on NF-kappa B transcriptional activation. Adhesion of leukocytes to cytokine-treated endothelial cells was blocked in endothelial cells cotreated with apigenin. Finally, apigenin demonstrated potent anti-inflammatory activity in carrageenan induced rat paw edema and delayed type hypersensitivity in the mouse. We conclude that flavonoids offer important therapeutic potential for the treatment of a variety of inflammatory diseases involving an increase in leukocyte adhesion and trafficking. Images Figure 7 Figure 8 Figure 11 PMID:7543732
Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun
2012-06-29
The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.
Ballez, J S; Mols, J; Burteau, C; Agathos, S N; Schneider, Y J
2004-03-01
We have recently developed a protein-free medium (PFS) able to support the growth of Chinese hamster ovary (CHO) cells in suspension. Upon further supplementation with some plant protein hydrolysates, medium performances reached what could be observed in serum-containing media [Burteau et al. In Vitro Cell. Dev. Biol.-Anim. 39 (2003) 291]. Now, we describe the use of rice and wheat protein hydrolysates, as non-nutritional additives to the culture medium to support productivity and cell growth in suspension or in microcarriers. When CHO-320 cells secreting recombinant interferon-gamma (IFN-gamma) were cultivated in suspension in a bioreactor with our PFS supplemented with wheat hydrolysates, the maximum cell density increased by 25% and the IFN-gamma secretion by 60% compared to the control PFS. A small-scale perfusion system consisting of CHO-320 cells growing on and inside fibrous microcarriers under discontinuous operation was first developed. Under these conditions, rice protein hydrolysates stimulated recombinant IFN-gamma secretion by 30% compared to the control PFS. At the bioreactorscale, similar results were obtained but when compared to shake-flasks studies, nutrients, oxygen or toxic by-products gradients inside the microcarriers seemed to be the main limitation of the system. An increase of the perfusion rate to maintain glucose concentration over 5.5 mM and dissolved oxygen (DO) at 60% was able to stimulate the production of IFN-gamma to a level of 6.6 mug h(-1) g(-1) of microcarriers after 160 h when a cellular density of about 4 x 10(8) cell g(-1) of carriers was reached.
Solis, B; Nova, E; Gómez, S; Samartín, S; Mouane, N; Lemtouni, A; Belaoui, H; Marcos, A
2002-12-01
For several years cytokine production has been associated with infections but it was not suspected that some types of food could also induce cytokines, even in a state of non-infection. Lactic bacteria can induce interferon (IFN) production in human healthy subjects, thus, a better protection against infections would be expected. Therefore, we planned to evaluate the effect of two diets including yoghurt or milk on IFN-gamma production during nutritional recovery in two different situations of malnutrition: (1) children with diarrhoea; and (2) patients with anorexia nervosa (AN). Both the diet including yoghurt of that including milk seemed to increase IFN-gamma production at the end of nutritional recovery in the malnourished children with diarrhoea. The significance of interferon production and the lymphocyte subset increase should be explored to know if a better resistance against pathogens is related to them. Regulation of intestinal absorption and moderate stimulation of interferon production make the yoghurt-based diet a good choice in the nutritional care of children. In the same way, an increase in the IFN-gamma production was observed in AN patients consuming yoghurt. This increase of IFN-gamma production could be considered a biological marker to detect the effect of probiotics on the immune response, especially in the improvement of a deficient nutritional status.
RIOK3 Is an Adaptor Protein Required for IRF3-Mediated Antiviral Type I Interferon Production
Feng, Jun; De Jesus, Paul D.; Su, Victoria; Han, Stephanie; Gong, Danyang; Wu, Nicholas C.; Tian, Yuan; Li, Xudong; Wu, Ting-Ting; Chanda, Sumit K.
2014-01-01
ABSTRACT Detection of cytosolic nucleic acids by pattern recognition receptors leads to the induction of type I interferons (IFNs) and elicits the innate immune response. We report here the identification of RIOK3 as a novel adaptor protein that is essential for the cytosolic nucleic acid-induced type I IFN production and for the antiviral response to gammaherpesvirus through two independent kinome-wide RNA interference screens. RIOK3 knockdown blocks both cytosolic double-stranded B-form DNA and double-stranded RNA-induced IRF3 activation and IFN-β production. In contrast, the overexpression of RIOK3 activates IRF3 and induces IFN-β. RIOK3 functions downstream of TBK1 and upstream of IRF3 activation. Furthermore, RIOK3 physically interacts with both IRF3 and TBK1 and is necessary for the interaction between TBK1 and IRF3. In addition, global transcriptome analysis shows that the expression of many gene involved antiviral responses is dependent on RIOK3. Thus, knockdown of RIOK3 inhibits cellular antiviral responses against both DNA and RNA viruses (herpesvirus and influenza A virus). Our data suggest that RIOK3 plays a critical role in the antiviral type I IFN pathway by bridging TBK1 and IRF3. IMPORTANCE The innate immune response, such as the production of type I interferons, acts as the first line of defense, limiting infectious pathogens directly and shaping the adaptive immune response. In this study, we identified RIOK3 as a novel regulator of the antiviral type I interferon pathway. Specifically, we found that RIOK3 physically interacts with TBK1 and IRF3 and bridges the functions between TBK1 and IRF3 in the activation of type I interferon pathway. The identification of a cellular kinase that plays a role the type I interferon pathway adds another level of complexity in the regulation of innate immunity and will have implications for developing novel strategies to combat viral infection. PMID:24807708
Devane, John G; Martin, Mary L; Matson, Mark A
2014-06-01
Flu-like symptoms (FLS) are commonly experienced by patients receiving interferon gamma-1b which may cause discontinuation or disruption of dosing during initial therapy or on re-initiation following a break in therapy. In contrast to Type I interferons, the impact of dose-titration on FLS has not been reported and is not a practice described or included in the approved prescribing information for interferon gamma-1b.The objective of this study was to assess the effect of a 2 week titration regimen on the severity of FLS during the initial 3 weeks of therapy with three times weekly subcutaneous injections of interferon gamma-1b. Healthy men and women were randomized into a double-blind, two-period, crossover study. Each study period was 3 weeks in duration and there was a minimum 15 day washout between treatment periods. Two treatment regimens were compared: No Titration dosing (full 50 mcg/m(2) subcutaneously [s.c.] three times weekly for 3 weeks) and Titration (15 mcg/m(2) s.c. three times weekly during week 1, 30 mcg/m(2) s.c. three times weekly during week 2 followed by the full dose of 50 mcg/m(2) s.c. three times weekly during week 3). Subjects remained in the clinic for at least 12 hours following each injection. FLS was based on a composite score for fever, chills, tiredness and muscle aches assessed at baseline and 4, 8 and 12 hours following each injection. Acetaminophen was allowed at the discretion of the PI. The primary endpoint was the change from baseline in FLS severity at 8 hours averaged over the 3 weeks of treatment. Additional endpoints included FLS at 4 and 12 hours, individual flu-like symptoms, rates of discontinuation, incidence of FLS and acetaminophen use. NCT 01929382. Of the 40 subjects randomized, there were 15 (37.5%) discontinuations. Titration resulted in a significant reduction in FLS severity at 8 hours (p = 0.023) averaged over the 3 week treatment period. The difference in 3 week FLS severity reflects differences
Shin, K Y; Moon, H S; Park, H Y; Lee, T Y; Woo, Y N; Kim, H J; Lee, S J; Kong, G
2000-10-31
We have investigated the effects of tumor necrosis factor-alpha (TNF-alpha) and interferon (INF-gamma), the potent Bacillus Calmette-Guerin (BCG)-induced cytokines on the production of MMP-2, MMP-9, TIMP-1, TIMP-2 and MT1-MMP in high grade human bladder cancer cell lines, T-24, J-82 and HT-1376 cell lines. MMP-2 expression and activity were decreased in T-24 cells treated with both cytokines in a dose dependent manner. However, J-82 cells treated with TNF-alpha and INF-gamma revealed dose dependent increases of MMP-9 expression and activity with similar baseline expression and activity of MMP-2. HT-1376 cells after exposure to TNF-alpha only enhanced the expression and activity of MMP-9. These results indicate that TNF-alpha and INF-gamma could regulate the production of MMP-2 or MMP-9 on bladder cancer cells and their patterns of regulation are cell specific. Furthermore, this diverse response of bladder cancer cells to TNF-alpha and INF-gamma suggests that BCG immunotherapy may enhance the invasiveness of bladder cancer in certain conditions with induction of MMPs.
Afarid, Mehrdad; Lashkarizadeh, Hamid; Ashraf, Mohammad J; Nowroozzadeh, Mohammad Hossein; Shafiee, Sayed M
2016-05-01
To study the efficacy of intravitreal interferon alpha-2b for endotoxin-induced uveitis. A total of 36 rabbits were randomly allocated to one of the three groups: (1) received interferon plus balanced-salt solution; (2) received lipopolysaccharide (LPS) plus interferon; and (3) received LPS plus balanced-salt solution. Intraocular inflammation was evaluated by slit-lamp biomicroscopy (standardization of uveitis nomenclature grading), binocular indirect ophthalmoscopy (BIO) score, and histopathology. Group 2 showed significantly lower mean (±standard deviation) anterior chamber reaction than Group 3 (3.1 ± 0.9 vs. 3.8 ± 0.4) on day 1 postinjection, lower vitreous cells on days 1 through 7 (day 1: 3.1 ± 0.9 vs. 3.8 ± 0.4; day 3: 2.1 ± 1.6 vs. 3.8 ± 0.4; day 7: 1.9 ± 1.3 vs. 3.6 ± 0.7), and lower BIO score on days 1-7 (day 1: 3.3 ± 1.2 vs. 4.4 ± 0.7; day 3: 3.0 ± 1.4 vs. 4.3 ± 0.9; day 7: 2.4 ± 1.4 vs. 3.7 ± 1.2). The protein content of anterior and vitreous aspirates was lower in Group 2 than 3 (1618.5 ± 411.4 vs. 2567.3 ± 330.8 and 2157.0 ± 283.3 vs. 3204.6 ± 259.5, respectively). Intravitreal interferon alpha-2b was effective in controlling endotoxin-induced uveitis.
Santin, Miguel; García-García, José-María; Rigau, David; Altet, Neus; Anibarro, Luis; Casas, Irma; Díez, Nuria; García-Gasalla, Mercedes; Martínez-Lacasa, Xavier; Penas, Antón; Pérez-Escolano, Elvira; Sánchez, Francisca; Domínguez, José
2016-09-01
Interferon-gamma release assays are widely used for the diagnosis of tuberculosis infection in Spain. However, there is no consensus on their application in specific clinical scenarios. To develop a guide-line for their use, a panel of experts comprising specialists in infectious diseases, respiratory diseases, microbiology, pediatrics and preventive medicine, together with a methodologist, conducted a systematic literature search, summarized the findings, rated the quality of the evidence, and formulated recommendations following the Grading of Recommendations of Assessment Development and Evaluations methodology. This document provides evidence-based guidance on the use of interferon-gamma release assays for the diagnosis of tuberculosis infection in patients at risk of tuberculosis or suspected of having active disease. The guidelines will be applicable to specialist and primary care, and public health. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.
Kawai, K; Enomoto, T; Fornasier, V; Resetkova, E; Volpé, R
1997-03-01
We have studied the in vivo effects of human interferon alpha (IFN-alpha) and interferon gamma (IFN-gamma) administration on human thyroid tissue xenografted into two mouse strains: severe combined immunodeficient (SCID) mice and nude mice. Human lymphocytes survive in SCID mice but are lysed in nude mice. Thyroid tissues from Graves' disease or Hashimoto's thyroiditis, or paranodular [normal, (N)] tissue was xenografted into SCID mice (0.8 g/mouse) pretreated with anti-asialo GM-1 antiserum and radiation and also into nude mice. One week after xenografting, SCID and nude mice were divided into three groups. Group A was treated with IFN-alpha intraperitoneally (2,000 units/mouse) three times weekly; group B was treated with IFN-gamma similarly; group C was treated with phosphate buffered saline (PBS) only (control). Autologous human peripheral blood mononuclear cells (PBMCs) were added to mice receiving N xenografts. Blood was taken every 2 weeks for levels of IgG and thyroid antibodies (TAb). After 6 weeks of treatment, mice were sacrificed, and xenograft thyrocyte histocompatibility leukocyte antigen (HLA-DR) and intercellular adhesion molecule (ICAM-1) expression were measured. In addition, thyrocyte cultures were stimulated in vitro with 200 units/ml of either IFN-alpha or IFN-gamma or PBS (control). SCID mice xenografted with autoimmune thyroid disease (AITD) in group A showed a significantly higher TAb production than group C, whereas in group B, TAb production was not statistically increased compared to control (group C). SCID mice xenografted with N did not produce TAb in any group, nor did nude mice xenografted with AITD. Thyrocyte HLA-DR expression was markedly increased in group A and B in SCID mice xenografted with Graves' disease, Hashimoto's thyroiditis, and N tissue compared to group C. In contrast, only group B (IFN-gamma) showed an increase in thyrocyte HLA-DR in nude mice. In the in vitro studies, only IFN-gamma (not IFN-alpha) stimulated
Noh, G; Jang, E H
2014-01-01
Specific oral tolerance induction (SOTI) for IgE-mediated food allergy (IFA) can be successfully achieved using interfero gamma (classic SOTI). In this study, a tolerable dose was introduced during tolerance induction with interferon gamma (dual SOTI), and its effectiveness was evaluated. The study population comprised 25 IFA patients. Blood samples were taken for analysis, including complete blood count with differential counts of eosinophils, serum total IgE levels, and specific IgE for allergenic foods. Skin prick tests were conducted with the allergens. Oral food challenges were performed to diagnose IFA. Ten patients received dual SOTI, 5 received classic SOTI, 5 received SOTI without interferon gamma (original SOTI), and 5 were not treated (controls). Patients treated with dual SOTI and classic SOTI using interferon gamma became tolerant to the allergenic food. The tolerable dose was introduced successfully in dual SOTI. It was difficult to proceed with the same dosing protocol used for classic SOTI in cases treated with original SOTI. Following dual SOTI, the systemic reaction to oral intake subsided, but the local skin reaction to contact with the allergenic food persisted. Dual SOTI is an improved protocol for SOTI using interferon gamma for IFA.The local skin reaction and systemic reaction to oral intake were dissociated following dual SOTI. In cases of food allergy, tolerance appears to result from desensitization to allergens.
Asea, A; Hansson, M; Czerkinsky, C; Houze, T; Hermodsson, S; Strannegård, O; Hellstrand, K
1996-08-01
Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-gamma by CD3-/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-gamma production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-gamma production was operating on a pretranslational level, as indicated by the inability of enriched NK cells to accumulate IFN-gamma mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-gamma production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-gamma production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-gamma in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-gamma mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-gamma production by preventing monocyte-induced oxidative damage to NK cells.
Chesarino, Nicholas M.; McMichael, Temet M.; Hach, Jocelyn C.; Yount, Jacob S.
2014-01-01
Interferon-inducible transmembrane protein 3 (IFITM3) is essential for innate defense against influenza virus in mice and humans. IFITM3 localizes to endolysosomes where it prevents virus fusion, although mechanisms controlling its trafficking to this cellular compartment are not fully understood. We determined that both mouse and human IFITM3 are phosphorylated by the protein-tyrosine kinase FYN on tyrosine 20 (Tyr20) and that mouse IFITM3 is also phosphorylated on the non-conserved Tyr27. Phosphorylation led to a cellular redistribution of IFITM3, including plasma membrane accumulation. Mutation of Tyr20 caused a similar redistribution of IFITM3 and resulted in decreased antiviral activity against influenza virus, whereas Tyr27 mutation of mouse IFITM3 showed minimal effects on localization or activity. Using FYN knockout cells, we also found that IFITM3 phosphorylation is not a requirement for its antiviral activity. Together, these results indicate that Tyr20 is part of an endocytosis signal that can be blocked by phosphorylation or by mutation of this residue. Further mutagenesis narrowed this endocytosis-controlling region to four residues conforming to a YXXΦ (where X is any amino acid and Φ is Val, Leu, or Ile) endocytic motif that, when transferred to CD4, resulted in its internalization from the cell surface. Additionally, we found that phosphorylation of IFITM3 by FYN and mutagenesis of Tyr20 both resulted in decreased IFITM3 ubiquitination. Overall, these results suggest that modification of Tyr20 may serve in a cellular checkpoint controlling IFITM3 trafficking and degradation and demonstrate the complexity of posttranslational regulation of IFITM3. PMID:24627473
COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?
Levick, Scott P.; Goldspink, Paul H.
2013-01-01
The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353
Hong, Suntaek; Kim, Hye-Youn; Kim, Jooyoung; Ha, Huyen Trang; Kim, Young-Mi; Bae, Eunjin; Kim, Tae Hyung; Lee, Kang Choon; Kim, Seong-Jin
2013-01-01
Smad7 has been known as a negative regulator for the transforming growth factor-β (TGF-β) signaling pathway through feedback regulation. However, Smad7 has been suspected to have other biological roles through the regulation of gene transcription. By screening differentially regulated genes, we found that the caspase 8 gene was highly up-regulated in Smad7-expressing cells. Smad7 was able to activate the caspase 8 promoter through recruitment of the interferon regulatory factor 1 (IRF1) transcription factor to the interferon-stimulated response element (ISRE) site. Interaction of Smad7 on the caspase 8 promoter was confirmed with electrophoretic mobility shift assay and chromatin immunoprecipitation experiment. Interestingly, Smad7 did not directly interact with the ISRE site, but it increased the binding activity of IRF1 with ISRE. These results support that Smad7 recruits IRF1 protein on the caspase 8 promoter and functions as a transcriptional coactivator. To confirm the biological significance of caspase 8 up-regulation, we tested tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL)-mediated cell death assay in breast cancer cells. Smad7 in apoptosis-resistant MCF7 cells markedly sensitized the cells to TRAIL-induced cell death by restoring the caspase cascade. Furthermore, restoration of caspase 8-mediated apoptosis pathway repressed the tumor growth in the xenograft model. In conclusion, we suggest a novel role for Smad7 as a transcriptional coactivator for caspase 8 through the interaction with IRF1 in regulation of the cell death pathway. PMID:23255602
Cross-talk between interferon-gamma and interleukin-18 in melanogenesis.
Zhou, Jia; Ling, Jingjing; Wang, Yong; Shang, Jing; Ping, Fengfeng
2016-10-01
Skin is the largest organ in our body and strategically placed to provide a metabolically active biological barrier against a range of noxious stressors. A lot of inflammatory cytokines, which are increased after ultraviolet (UV) irradiation produced by keratinocytes or other immunocytes, are closely related to pigmentary changes, including interleukin-18 (IL-18) and interferon-γ (IFN-γ). In this study, the effect of cross-talk between IL-18 and IFN-γ on melanogenesis was investigated. Treatment with IL-18 resulted in a dose-dependent increase of melanogenesis, while IFN-γ made an opposite effect. This influence of IL-18 and IFN-γ was mediated by regulations of microphthalmia-associated transcription factor (MITF) and its downstream enzymatic cascade expressions. Furthermore, IFN-γ inhibited basal and IL-18-induced melanogenesis. IFN-γ increased signal transducer and activator of transcription-1 (STAT-1) phosphorylation to play its position in regulating melanin pigmentation, and its inhibitory effect could be prevented by Janus Kinase 1 (JAK 1) inhibitor. IFN-γ could inhibit melanogenesis by decreasing melanocyte dendrite formation. In addition, IFN-γ inhibited the expressions of Rab Pases to suppress the mature and transport of melanosomes. IL-18 could rapidly induce Akt and PTEN phosphorylation and p65 expression in B16F10 cells. When treatment with IL-18 and IFN-γ together, the phosphorylation level of Protein Kinase B (Akt) and phosphatase and tensin homolog deleted on chromosome ten (PTEN) and expression of p65 NF-κB were inhibited, compared with treated with IL-18 only. Our studies indicated that IFN-γ could directly induce B16F10 cells apoptosis in vitro. Furthermore, we demonstrated that IFN-γ markedly up-regulated IL-18 binding protein (BP) production in normal human foreskin-derived epidermal keratinocytes in dose-dependent manner. UVB irradiation induced protease-activated receptor-2 (PAR-2) expression in NHEK, IFN-γ could inhibit this
Phospholipase C-gamma 1 binding to intracellular receptors for activated protein kinase C.
Disatnik, M H; Hernandez-Sotomayor, S M; Jones, G; Carpenter, G; Mochly-Rosen, D
1994-01-18
Phospholipase C-gamma 1 (PLC-gamma 1; EC 3.1.4.11) hydrolyzes phosphatidylinositol 4,5-bisphosphate to generate diacylglycerol and inositol 1,4,5-trisphosphate and is activated in response to growth factor stimulation and tyrosine phosphorylation. Concomitantly, the enzyme translocates from the cytosol to the particulate cell fraction. A similar process of activation-induced translocation from the cytosol to the cell particulate fraction has also been described for protein kinase C (PKC). We have previously shown that activated PKC binds to specific receptor proteins, receptors for activated C kinase, or RACKs, of approximately 30 kDa. Here, we show that PLC-gamma 1 bound to these RACKs and inhibited subsequent PKC binding to RACKs. However, unlike PKC, the binding of PLC-gamma 1 to RACKs did not require phospholipids and calcium. After epidermal growth factor treatment of intact A-431 cells, the binding of PLC-gamma 1 to RACKs increased as compared with PLC-gamma 1 from control cells. This increase in PLC-gamma 1 binding to RACKs was due to the phosphorylation of PLC-gamma 1. Additional data indicated that PLC-gamma 1 binds to RACKs in solution; epidermal growth factor receptor-dependent PLC-gamma 1 phosphorylation and activation decreased in the presence of RACKs. It is possible that, in vivo, PLC-gamma 1 associates with RACKs or with other PLC-gamma 1-specific anchoring proteins in the particulate cell fraction. Since a PKC C2 homologous region is present in PLC-gamma 1, the C2 region may mediate the activation-induced translocation of the enzyme to the cell particulate fraction and the anchoring protein-PLC-gamma 1 complex may be the active translocated form of PLC-gamma 1.
Al-Tawfiq, Jaffar A; Al-Abdely, Hail M
2010-05-01
We report a case of invasive aspergillosis due to Aspergillus fumigatus involving the cervical and thoracic vertebrae and upper mediastinum of a 17 year-old Saudi male with chronic granulomatous disease (CGD). The patient did not respond to a long course of liposomal amphotericin B but did to surgical drainage and a combination of caspofungin and itraconazole with subsequent suppression with oral voriconazole. Fourteen months after the start of therapy, the patient had anterior dislocation of T2 thoracic vertebra with cord transection and quadriplegia. He was then treated intravenously with liquid itraconazole and interferon-gamma. The patient made a remarkable recovery over a 2-year period and was eventually able to walk independently. Thus, a combination of antifungals and interferon-gamma may have resulted in the positive outcome in this case.
Ellison, Michael A; Thurman, Gail; Gearheart, Christy M; Seewald, Ryan H; Porter, Christopher C; Ambruso, Daniel R
2015-01-01
The cytokine and drug interferon-γ enhances superoxide anion production by the antimicrobicidal Nox2 enzyme of neutrophils. Because mature neutrophils have a short lifespan, we hypothesized that the effects of interferon-γ on these cells might be mediated by its prolonged exposure to differentiating neutrophil precursors in the bone marrow rather than its brief exposure to mature circulating neutrophils. Effects of INF-Γ on NOX2 activity: To address this possibility we exposed the myeloid PLB-985 cell line to interferon-γ for 3 days in the presence of dimethyl sulfoxide which induces terminal differentiation of these cells. Interferon-γ was found to enhance superoxide production by Nox2 in a concentration dependent manner. In contrast, application of interferon-γ alone for 3 days failed to induce detectible Nox2 activity. Additionally, application of interferon-γ for 3 hours to pre-differentiated PLB-985 cells, which models studies using isolated neutrophils, was much less effective at enhancing superoxide anion production. Effects of INF-Γ on phox protein levels: Addition of interferon-γ during differentiation was found to upregulate the Nox2 proteins gp91phox and p47phox in concert with elevated transcription of their genes. The p22phox protein was upregulated in the absence of increased transcription presumably reflecting stabilization resulting from binding to the elevated gp91phox. Thus, increased levels of gp91phox, p47phox and p22phox likely account for the interferon-γ mediated enhancement of dimethyl sulfoxide-induced Nox2 activity. In contrast, although interferon-γ alone also increased various phox proteins and their mRNAs, the pattern was very different to that seen with interferon-γ plus dimethyl sulfoxide. In particular, p47phox was not induced thus explaining the inability of interferon -γ alone to enhance Nox2 activity. Short application of interferon-γ to already differentiated cells failed to increase any phox proteins. Our findings
Schulte, Corinna; Noels, Heidi
2018-05-10
In this issue of Acta Physiologica, a publication by Jian et al. expands our knowledge on the molecular mechanisms behind re-endothelialization and neointima formation after injury of the vascular endothelium 1 . The rationale for performing this study was that the pro-inflammatory cytokine IFN-γ is highly expressed in injury-induced neointima and acts as a master regulator of atherosclerosis. As interferon-induced protein 35 (IFI35) is induced by IFN-γ and known to be important in inflammation-related disorders, the authors hypothesized a potential involvement of IFI35 in neointima formation. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bursuker, I.; Pearce, M.T.
1990-02-01
The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less
Haldar, Arun K; Piro, Anthony S; Finethy, Ryan; Espenschied, Scott T; Brown, Hannah E; Giebel, Amanda M; Frickel, Eva-Maria; Nelson, David E; Coers, Jörn
2016-12-13
The cytokine gamma interferon (IFN-γ) induces cell-autonomous immunity to combat infections with intracellular pathogens, such as the bacterium Chlamydia trachomatis The present study demonstrates that IFN-γ-primed human cells ubiquitinate and eliminate intracellular Chlamydia-containing vacuoles, so-called inclusions. We previously described how IFN-γ-inducible immunity-related GTPases (IRGs) employ ubiquitin systems to mark inclusions for destruction in mouse cells and, furthermore, showed that the rodent pathogen Chlamydia muridarum blocks ubiquitination of its inclusions by interfering with mouse IRG function. Here, we report that ubiquitination of inclusions in human cells is independent of IRG and thus distinct from the murine pathway. We show that C. muridarum is susceptible to inclusion ubiquitination in human cells, while the closely related human pathogen C. trachomatis is resistant. C. muridarum, but not C. trachomatis, inclusions attract several markers of cell-autonomous immunity, including the ubiquitin-binding protein p62, the ubiquitin-like protein LC3, and guanylate-binding protein 1. Consequently, we find that IFN-γ priming of human epithelial cells triggers the elimination of C. muridarum, but not C. trachomatis, inclusions. This newly described defense pathway is independent of indole-2,3-dioxygenase, a known IFN-γ-inducible anti-Chlamydia resistance factor. Collectively, our observations indicate that C. trachomatis evolved mechanisms to avoid a human-specific, ubiquitin-mediated response as part of its unique adaptation to its human host. Chlamydia trachomatis is the leading cause of sexually transmitted bacterial infections and responsible for significant morbidity, including pelvic inflammatory disease, infertility, and ectopic pregnancies in women. As an obligate intracellular pathogen, C. trachomatis is in perpetual conflict with cell-intrinsic defense programs executed by its human host. Our study defines a novel anti
Interferon Independent Non-Canonical STAT Activation and Virus Induced Inflammation
Wu, Chunyan
2018-01-01
Interferons (IFNs) are a group of secreted proteins that play critical roles in antiviral immunity, antitumor activity, activation of cytotoxic T cells, and modulation of host immune responses. IFNs are cytokines, and bind receptors on cell surfaces to trigger signal transduction. The major signaling pathway activated by IFNs is the JAK/STAT (Janus kinase/signal transducer and activator of transcription) pathway, a complex pathway involved in both viral and host survival strategies. On the one hand, viruses have evolved strategies to escape from antiviral host defenses evoked by IFN-activated JAK/STAT signaling. On the other hand, viruses have also evolved to exploit the JAK/STAT pathway to evoke activation of certain STATs that somehow promote viral pathogenesis. In this review, recent progress in our understanding of the virus-induced IFN-independent STAT signaling and its potential roles in viral induced inflammation and pathogenesis are summarized in detail, and perspectives are provided. PMID:29662014
Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade
2006-12-15
Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.
Pai, Madhukar; Gokhale, Kaustubh; Joshi, Rajnish; Dogra, Sandeep; Kalantri, Shriprakash; Mendiratta, Deepak K; Narang, Pratibha; Daley, Charles L; Granich, Reuben M; Mazurek, Gerald H; Reingold, Arthur L; Riley, Lee W; Colford, John M
2005-06-08
Mycobacterium tuberculosis infection in health care workers has not been adequately studied in developing countries using newer diagnostic tests. To estimate latent tuberculosis infection prevalence in health care workers using the tuberculin skin test (TST) and a whole-blood interferon gamma (IFN-gamma) assay; to determine agreement between the tests; and to compare their correlation with risk factors. A cross-sectional comparison study of 726 health care workers aged 18 to 61 years (median age, 22 years) with no history of active tuberculosis conducted from January to May 2004, at a rural medical school in India. A total of 493 (68%) of the health care workers had direct contact with patients with tuberculosis and 514 (71%) had BCG vaccine scars. Tuberculin skin testing was performed using 1-TU dose of purified protein derivative RT23, and the IFN-gamma assay was performed by measuring IFN-gamma response to early secreted antigenic target 6, culture filtrate protein 10, and a portion of tuberculosis antigen TB7.7. Agreement between TST and the IFN-gamma assay, and comparison of the tests with respect to their association with risk factors. A large proportion of the health care workers were latently infected; 360 (50%) were positive by either TST or IFN-gamma assay, and 226 (31%) were positive by both tests. The prevalence estimates of TST and IFN-gamma assay positivity were comparable (41%; 95% confidence interval [CI], 38%-45% and 40%; 95% CI, 37%-43%, respectively). Agreement between the tests was high (81.4%; kappa = 0.61; 95% CI, 0.56-0.67). Increasing age and years in the health profession were significant risk factors for both IFN-gamma assay and TST positivity. BCG vaccination had little impact on TST and IFN-gamma assay results. Our study showed high latent tuberculosis infection prevalence in Indian health care workers, high agreement between TST and IFN-gamma assay, and similar association between positive test results and risk factors. Although TST and
Mumps Virus V Protein Antagonizes Interferon without the Complete Degradation of STAT1
Kubota, Toru; Yokosawa, Noriko; Yokota, Shin-ichi; Fujii, Nobuhiro; Tashiro, Masato; Kato, Atsushi
2005-01-01
Mumps virus (MuV) has been shown to antagonize the antiviral effects of interferon (IFN) through proteasome-mediated complete degradation of STAT1 by using the viral V protein (T. Kubota et al., Biochem. Biophys. Res. Commun. 283:255-259, 2001). However, we found that MuV could inhibit IFN signaling and the generation of a subsequent antiviral state long before the complete degradation of cellular STAT1 in infected cells. In MuV-infected cells, nuclear translocation and phosphorylation of STAT1 and STAT2 tyrosine residue (Y) at 701 and 689, respectively, by IFN-β were significantly inhibited but the phosphorylation of Jak1 and Tyk2 was not inhibited. The transiently expressed MuV V protein also inhibited IFN-β-induced Y701-STAT1 and Y689-STAT2 phosphorylation, suggesting that the V protein could block IFN-β-induced signal transduction without the aid of other viral components. Finally, a substitution of an alanine residue in place of a cysteine residue in the C-terminal V-unique region known to be required for STAT1 degradation and inhibition of anti-IFN signaling resulted in the loss of V protein function to inhibit the Y701-STAT1 and Y689-STAT2 phosphorylation. PMID:15767445
Iqbal, Jawed; Ansari, Mairaj Ahmed; Kumar, Binod; Dutta, Dipanjan; Roy, Arunava; Chikoti, Leela; Pisano, Gina; Dutta, Sujoy; Veettil, Mohanan Valiya; Chandran, Bala
2016-01-01
IFI16 (gamma-interferon-inducible protein 16), a predominantly nuclear protein involved in transcriptional regulation, also functions as an innate immune response DNA sensor and induces the IL-1β and antiviral type-1 interferon-β (IFN-β) cytokines. We have shown that IFI16, in association with BRCA1, functions as a sequence independent nuclear sensor of episomal dsDNA genomes of KSHV, EBV and HSV-1. Recognition of these herpesvirus genomes resulted in IFI16 acetylation, BRCA1-IFI16-ASC-procaspase-1 inflammasome formation, cytoplasmic translocation, and IL-1β generation. Acetylated IFI16 also interacted with cytoplasmic STING and induced IFN-β. However, the identity of IFI16 associated nuclear proteins involved in STING activation and the mechanism is not known. Mass spectrometry of proteins precipitated by anti-IFI16 antibodies from uninfected endothelial cell nuclear lysate revealed that histone H2B interacts with IFI16. Single and double proximity ligation microscopy, immunoprecipitation, EdU-genome labeled virus infection, and chromatin immunoprecipitation studies demonstrated that H2B is associated with IFI16 and BRCA1 in the nucleus in physiological conditions. De novo KSHV and HSV-1 infection as well as latent KSHV and EBV infection induces the cytoplasmic distribution of H2B-IFI16, H2B-BRCA1 and IFI16-ASC complexes. Vaccinia virus (dsDNA) cytoplasmic replication didn’t induce the redistribution of nuclear H2B-IFI16 or H2B into the cytoplasm. H2B is critical in KSHV and HSV-1 genome recognition by IFI16 during de novo infection. Viral genome sensing by IFI16-H2B-BRCA1 leads to BRCA1 dependent recruitment of p300, and acetylation of H2B and IFI16. BRCA1 knockdown or inhibition of p300 abrogated the acetylation of H2B-IFI16 or H2B. Ran-GTP protein mediated the translocation of acetylated H2B and IFI16 to the cytoplasm along with BRCA1 that is independent of IFI16-ASC inflammasome. ASC knockdown didn’t affect the acetylation of H2B, its cytoplasmic
Inoue, Kazuaki; Tsukiyama-Kohara, Kyoko; Matsuda, Chiho; Yoneyama, Mitsutoshi; Fujita, Takashi; Kuge, Shusuke; Yoshiba, Makoto; Kohara, Michinori
2012-11-30
Interferon regulatory factor-3 (IRF-3), a key transcriptional factor in the type I interferon system, is frequently impaired by hepatitis C virus (HCV), in order to establish persistent infection. However, the exact mechanism by which the virus establishes persistent infection has not been fully understood yet. The present study aimed to investigate the effects of various HCV proteins on IRF-3 activation, and elucidate the underlying mechanisms. To achieve this, full-length HCV and HCV subgenomic constructs corresponding to structural and each of the nonstructural proteins were transiently transfected into HepG2 cells. IFN-β induction, plaque formation, and IRF-3 dimerization were elicited by Newcastle disease virus (NDV) infection. The expressions of IRF-3 homodimer and its monomer, Ser386-phosphorylated IRF-3, and HCV core protein were detected by immunofluorescence and western blotting. IFN-β mRNA expression was quantified by real-time PCR (RT-PCR), and IRF-3 activity was measured by the levels of IRF-3 dimerization and phosphorylation, induced by NDV infection or polyriboinosinic:polyribocytidylic acid [poly(I:C)]. Switching of the expression of the complete HCV genome as well as the core proteins, E1, E2, and NS2, suppressed IFN-β mRNA levels and IRF-3 dimerization, induced by NDV infection. Our study revealed a crucial region of the HCV core protein, basic amino acid region 1 (BR1), to inhibit IRF-3 dimerization as well as its phosphorylation induced by NDV infection and poly (I:C), thus interfering with IRF-3 activation. Therefore, our study suggests that rescue of the IRF-3 pathway impairment may be an effective treatment for HCV infection. Copyright © 2012 Elsevier Inc. All rights reserved.
Interferon-Inducible CD169/Siglec1 Attenuates Anti-HIV-1 Effects of Alpha Interferon
Akiyama, Hisashi; Ramirez, Nora-Guadalupe Pina; Gibson, Gregory; Kline, Christopher; Watkins, Simon; Ambrose, Zandrea
2017-01-01
ABSTRACT A hallmark of human immunodeficiency virus type 1 (HIV-1) infection in vivo is chronic immune activation concomitant with type I interferon (IFN) production. Although type I IFN induces an antiviral state in many cell types, HIV-1 can replicate in vivo via mechanisms that have remained unclear. We have recently identified a type I IFN-inducible protein, CD169, as the HIV-1 attachment factor on dendritic cells (DCs) that can mediate robust infection of CD4+ T cells in trans. Since CD169 expression on macrophages is also induced by type I IFN, we hypothesized that type I IFN-inducible CD169 could facilitate productive HIV-1 infection in myeloid cells in cis and CD4+ T cells in trans and thus offset antiviral effects of type I IFN. In support of this hypothesis, infection of HIV-1 or murine leukemia virus Env (MLV-Env)-pseudotyped HIV-1 particles was enhanced in IFN-α-treated THP-1 monocytoid cells, and this enhancement was primarily dependent on CD169-mediated enhancement at the virus entry step, a phenomenon phenocopied in HIV-1 infections of IFN-α-treated primary monocyte-derived macrophages (MDMs). Furthermore, expression of CD169, a marker of type I IFN-induced immune activation in vivo, was enhanced in lymph nodes from pigtailed macaques infected with simian immunodeficiency virus (SIV) carrying HIV-1 reverse transcriptase (RT-SHIV), compared to uninfected macaques, and interestingly, there was extensive colocalization of p27gag and CD169, suggesting productive infection of CD169+ myeloid cells in vivo. While cell-free HIV-1 infection of IFN-α-treated CD4+ T cells was robustly decreased, initiation of infection in trans via coculture with CD169+ IFN-α-treated DCs restored infection, suggesting that HIV-1 exploits CD169 in cis and in trans to attenuate a type I IFN-induced antiviral state. IMPORTANCE HIV-1 infection in humans causes immune activation characterized by elevated levels of proinflammatory cytokines, including type I interferons (IFN
Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H
2005-08-22
Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.
Flores, Jose; DuPont, Herbert L; Paredes-Paredes, Mercedes; Aguirre-Garcia, M Magdalena; Rojas, Araceli; Gonzalez, Alexei; Okhuysen, Pablo C
2010-05-01
Enterotoxigenic Escherichia coli (ETEC), which produces heat-labile toxin (LT), is a common cause of travelers' diarrhea (TD). The B subunit of ETEC LT is immunologically related to the B subunit of Vibrio cholerae toxin (CT). In this pilot study we evaluated the whole-blood gamma interferon response to CT B in 17 U.S. adults traveling to Mexico. Only one of nine subjects who demonstrated a cellular immune response as determined by whole-blood gamma interferon production to CT B on arrival to Mexico developed diarrhea, whereas five of eight without a cellular response developed diarrhea. Markers of the cellular immune response to ETEC LT could help in identifying individuals immune to ETEC LT, and these markers deserve additional study.
Williams, C M; Coleman, J W
1995-10-01
We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs.
Williams, C M; Coleman, J W
1995-01-01
We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs. Images Figure 1 Figure 2 Figure 3 PMID:7490125
Wong, Hui Hui; Fung, To Sing; Fang, Shouguo; Huang, Mei; Le, My Tra; Liu, Ding Xiang
2018-02-01
Severe acute respiratory syndrome coronavirus (SARS-CoV) is an inefficient inducer of interferon (IFN) response. It expresses various proteins that effectively circumvent IFN production at different levels via distinct mechanisms. Through the construction of recombinant IBV expressing proteins 8a, 8b and 8ab encoded by SARS-CoV ORF8, we demonstrate that expression of 8b and 8ab enables the corresponding recombinant viruses to partially overcome the inhibitory actions of IFN activation to achieve higher replication efficiencies in cells. We also found that proteins 8b and 8ab could physically interact with IRF3. Overexpression of 8b and 8ab resulted in the reduction of poly (I:C)-induced IRF3 dimerization and inhibition of the IFN-β signaling pathway. This counteracting effect was partially mediated by protein 8b/8ab-induced degradation of IRF3 in a ubiquitin-proteasome-dependent manner. Taken together, we propose that SARS-CoV may exploit the unique functions of proteins 8b and 8ab as novel mechanisms to overcome the effect of IFN response during virus infection. Copyright © 2017 Elsevier Inc. All rights reserved.
Montanuy, Imma; Alejo, Ali; Alcami, Antonio
2011-01-01
Eradication of smallpox was accomplished 30 yr ago, but poxviral infections still represent a public health concern due to the potential release of variola virus or the emergence of zoonotic poxviruses, such as monkeypox virus. A critical determinant of poxvirus virulence is the inhibition of interferons (IFNs) by the virus-encoded type I IFN-binding protein (IFNα/βBP). This immunomodulatory protein is secreted and has the unique property of interacting with the cell surface in order to prevent IFN-mediated antiviral responses. However, the mechanism of its attachment to the cell surface remains unknown. Using surface plasmon resonance and cell-binding assays, we report that the IFNα/βBP from vaccinia virus, the smallpox vaccine, interacts with cell surface glycosaminoglycans (GAGs). Analysis of the contribution of different regions of the protein to cell surface binding demonstrated that clusters of basic residues in the first immunoglobulin domain mediate GAG interactions. Furthermore, mutation of the GAG-interaction motifs does not affect its IFN-binding and -blocking capacity. Functional conservation of GAG-binding sites is demonstrated for the IFNα/βBP from variola and monkeypox viruses, extending our understanding of immune modulation by the most virulent human poxviruses. These results are relevant for the design of improved vaccines and intervention strategies.—Montanuy, I., Alejo, A., Alcami, A. Glycosaminoglycans mediate retention of the poxvirus type I interferon binding protein at the cell surface to locally block interferon antiviral responses. PMID:21372110
Visser, J; Blauw, B; Hinloopen, B; Brommer, E; de Kloet, E R; Kluft, C; Nagelkerken, L
1998-02-01
A disturbed hypothalamus-pituitary-adrenal gland axis and alterations at the immune system level have been observed in patients with chronic fatigue syndrome (CFS). Glucocorticoids are known to modulate T cell responses; therefore, purified CD4 T cells from CFS patients were studied to determine whether they have an altered sensitivity to dexamethasone (DEX). CD4 T cells from CFS patients produced less interferon-gamma than did cells from controls; by contrast, interleukin-4 production and cell proliferation were comparable. With CD4 T cells from CFS patients (compared with cells from controls), a 10- to 20-fold lower DEX concentration was needed to achieve 50% inhibition of interleukin-4 production and proliferation, indicating an increased sensitivity to DEX in CFS patients. Surprisingly, interferon-gamma production in patients and controls was equally sensitive to DEX. A differential sensitivity of cytokines or CD4 T cell subsets to glucocorticoids might explain an altered immunologic function in CFS patients.
Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q
1995-01-01
Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147
Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies
Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D
2014-01-01
Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250
Gharesi-Fard, Behrouz; Zolghadri, Jaleh; Kamali-Sarvestani, Eskandar
2008-03-01
Considering the deleterious role of T helper1 (Th1) cells in pregnancy outcome, a successful treatment for recurrent spontaneous abortion (RSA) should be able to make a significant shift away from Th1 responses. Although paternal leukocyte immunization has been used for treatment of RSA for years, because of methodological differences there is no consensus on the mechanism of action and effectiveness of this method. Twenty-five Iranian non-pregnant women with RSA and 16 non-pregnant control women with at least two successful pregnancies were included in this study. All cases were followed up after leukocyte therapy for pregnancy outcome. Mononuclear cells from women were co-cultured with the husband's mononuclear cells before and after immunotherapy. The levels of tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) were checked on culture supernatant by enzyme-linked immunosorbent assay method. The mean concentration of TNF-alpha was significantly higher in patients compared with that in normal controls (P=0.0001). After immunotherapy, the TNF-alpha level was only significantly decreased in women with successful outcome (P=0.0001). Immunotherapy also induced a significant reduction in the IFN-gamma level (P=0.009). The results of this investigation confirm the role of TNF-alpha in RSA and propose the assessment of TNF-alpha production as a valuable prognostic parameter for the prediction of abortion after leukocyte therapy.
Mols, J; Peeters-Joris, C; Wattiez, R; Agathos, S N; Schneider, Y-J
2005-01-01
Biosafety requirements increasingly restrict the cultivation of mammalian cells producing therapeutic glycoproteins to conditions that are devoid of any compound of animal origin. On cultivation in serum-free media, the proteases inhibitors, usually found in serum, cannot protect secreted recombinant proteins against unwanted endogenous proteolysis. Chinese hamster ovary (CHO) cells, secreting recombinant human interferon-gamma (CHO-320 cell line) and cultivated in suspension in an original protein-free medium, expressed at least two members of the matrix metalloproteinases (MMP), either at the cell surface (proMMP-14 and MMP-14) or secreted (proMMP-9). In addition, tissue- and urinary-type plasminogen activators were also secreted in such culture conditions. At the cell surface, dipeptidyl peptidase IV and tripeptidyl peptidase II (TPPII) activities were also detected, and their activities decreased during time course of batch cultures. The proteolytic activities of these proteins were counterbalanced by (1) their expression as zymogens (proMMP-9, proMMP-14), (2) the expression of their natural inhibitors, tissue inhibitors of metalloproteinases-1 and -2 and plasminogen activator inhibitor-1 (PAI-1), or (3) the addition of plant protein hydrolysates to the culture medium, acting as a nonspecific source of TPPII inhibitors. This study points out that, even in protein-free media, recombinant proteins secreted by CHO cells are actively protected against physiological and unwanted extracellular proteolysis either by endogenous or by exogenous inhibitors.
Development of a lion-specific interferon-gamma assay.
Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G
2012-10-15
The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.
The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon.
Fernández de Marco, María del Mar; Alejo, Alí; Hudson, Paul; Damon, Inger K; Alcami, Antonio
2010-05-01
Variola virus (VARV) caused smallpox, one of the most devastating human diseases and the first to be eradicated, but its deliberate release represents a dangerous threat. Virulent orthopoxviruses infecting humans, such as monkeypox virus (MPXV), could fill the niche left by smallpox eradication and the cessation of vaccination. However, immunomodulatory activities and virulence determinants of VARV and MPXV remain largely unexplored. We report the molecular characterization of the VARV- and MPXV-secreted type I interferon-binding proteins, which interact with the cell surface after secretion and prevent type I interferon responses. The proteins expressed in the baculovirus system have been purified, and their interferon-binding properties characterized by surface plasmon resonance. The ability of these proteins to inhibit a broad range of interferons was investigated to identify potential adaptation to the human immune system. Furthermore, we demonstrate by Western blot and activity assays the expression of the type I interferon inhibitor during VARV and MPXV infections. These findings are relevant for the design of new vaccines and therapeutics to smallpox and emergent virulent orthopoxviruses because the type I interferon-binding protein is a major virulence factor in animal models, vaccination with this protein induces protective immunity, and its neutralization prevents disease progression.
Lee, Jung Nam; Ryu, Dong Yup; Park, Sung Han; You, Hyun Seok; Lee, Bong Eun; Kim, Dong Uk; Kim, Tae Oh; Heo, Jeong; Kim, Gwang Ha; Song, Geun Am; Kim, Suk; Park, Do Youn
2010-06-01
It is difficult to clinically and endoscopically differentiate intestinal tuberculosis (ITB) and Crohns disease (CD). The aim of this study was to evaluate the usefulness of in vitro interferon-gamma (INF-gamma) assay for differential diagnosis between ITB and CD. Sixty patients for whom differential diagnosis between ITB and CD was difficult were enrolled between January 2007 and January 2009. The INF-gamma-producing T-cell response to early secreted antigenic target 6 and culture filtrate protein 10 were measured by T-SPOT.TB blood test in vitro. We evaluated the usefulness of T-SPOT.TB blood test by comparing its results with the final diagnosis. Twenty and forty patients were revealed to be positive and negative in T-SPOT.TB blood test, respectively. Of the 20 patients found to be positive, 12 patients (60%) were finally diagnosed as ITB, 6 patients as CD, and 2 patients as Behcets enterocolitis. Of the 40 patients with negative results, 38 patients (95%) were diagnosed as CD; one as Behcets enterocolitis; one as nonspecific colitis; none as ITB. The sensitivity and specificity of T-SPOT.TB blood test for ITB were 100% and 83.3%, respectively. Positive and negative predictive values of T-SPOT.TB blood test for ITB were 60.0% and 100%, respectively. When differential diagnosis between ITB and CD is difficult, T-SPOT.TB blood test may be a helpful and rapid diagnostic tool to exclude ITB. Prospective large-scaled studies are required for further evaluation of the usefulness of T-SPOT.TB blood test for differential diagnosis between ITB and CD.
Kim, N Y; Pae, H O; Ko, Y S; Yoo, J C; Choi, B M; Jun, C D; Chung, H T; Inagaki, M; Higuchi, R; Kim, Y C
1999-10-01
Bioassay-guided fractionation of an H2O extract of the barks of Fraxinus rhynchophylla has furnished two inducible nitric oxide synthase (iNOS) inhibitory compounds, ferulaldehyde (1) and scopoletin (3) together with a coumarin, fraxidin (2). Compounds 1 and 3 showed inhibition of nitric oxide (NO) synthesis in a dose-dependent manner by murine macrophage-like RAW 264.7 cells stimulated with interferon-gamma (IFN-gamma) plus lipopolysaccharide (LPS). The inhibition of NO synthesis of 1 was reflected in the decreased amount of iNOS protein, as determined by Western blotting.
Inflammation activates the interferon signaling pathways in taste bud cells.
Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan
2007-10-03
Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.
Mink parvoviruses and interferons: in vitro studies.
Wiedbrauk, D L; Bloom, M E; Lodmell, D L
1986-01-01
Although interferons can inhibit the replication of a number of viruses, little is known about their ability to inhibit parvovirus replication. Therefore, in vitro experiments were done to determine if Aleutian disease virus and mink enteritis virus, two autonomously replicating mink parvoviruses, induced interferon, were sensitive to the effects of interferon, or inhibited the production of interferon. The results indicated that these parvoviruses neither induced nor were sensitive to the effects of interferon. Furthermore, preexisting parvovirus infections did not inhibit poly(I).poly(C)-induced interferon production. This independence from the interferon system may, therefore, be a general property of the autonomously replicating parvoviruses. PMID:2431162
Penski, Nicola; Härtle, Sonja; Rubbenstroth, Dennis; Krohmann, Carsten; Ruggli, Nicolas; Schusser, Benjamin; Pfann, Michael; Reuter, Antje; Gohrbandt, Sandra; Hundt, Jana; Veits, Jutta; Breithaupt, Angele; Kochs, Georg; Stech, Jürgen; Summerfield, Artur; Vahlenkamp, Thomas; Kaspers, Bernd; Staeheli, Peter
2011-01-01
From infection studies with cultured chicken cells and experimental mammalian hosts, it is well known that influenza viruses use the nonstructural protein 1 (NS1) to suppress the synthesis of interferon (IFN). However, our current knowledge regarding the in vivo role of virus-encoded NS1 in chickens is much more limited. Here, we report that highly pathogenic avian influenza viruses of subtypes H5N1 and H7N7 lacking fully functional NS1 genes were attenuated in 5-week-old chickens. Surprisingly, in diseased birds infected with NS1 mutants, the IFN levels were not higher than in diseased birds infected with wild-type virus, suggesting that NS1 cannot suppress IFN gene expression in at least one cell population of infected chickens that produces large amounts of the cytokine in vivo. To address the question of why influenza viruses are highly pathogenic in chickens although they strongly activate the innate immune system, we determined whether recombinant chicken alpha interferon (IFN-α) can inhibit the growth of highly pathogenic avian influenza viruses in cultured chicken cells and whether it can ameliorate virus-induced disease in 5-week-old birds. We found that IFN treatment failed to confer substantial protection against challenge with highly pathogenic viruses, although it was effective against viruses with low pathogenic potential. Taken together, our data demonstrate that preventing the synthesis of IFN is not the primary role of the viral NS1 protein during infection of chickens. Our results further suggest that virus-induced IFN does not contribute substantially to resistance of chickens against highly pathogenic influenza viruses. PMID:21613402
ERIC Educational Resources Information Center
Birch, Samantha J.; Golbeck, Amanda L.
2015-01-01
Objective: This analysis examined the effectiveness of utilizing interferon-gamma release assay (IGRA) technology in a TB (TB) screening program at a university. Participants: Participants were 2299 students at a Montana university who had presented to the university health center for TB screening during 2012 and 2013. Methods: A retrospective…
Duck Interferon-Inducible Transmembrane Protein 3 Mediates Restriction of Influenza Viruses.
Blyth, Graham A D; Chan, Wing Fuk; Webster, Robert G; Magor, Katharine E
2016-01-01
Interferon-inducible transmembrane proteins (IFITMs) can restrict the entry of a wide range of viruses. IFITM3 localizes to endosomes and can potently restrict the replication of influenza A viruses (IAV) and several other viruses that also enter host cells through the endocytic pathway. Here, we investigate whether IFITMs are involved in protection in ducks, the natural host of influenza virus. We identify and sequence duck IFITM1, IFITM2, IFITM3, and IFITM5. Using quantitative PCR (qPCR), we demonstrate the upregulation of these genes in lung tissue in response to highly pathogenic IAV infection by 400-fold, 30-fold, 30-fold, and 5-fold, respectively. We express each IFITM in chicken DF-1 cells and show duck IFITM1 localizes to the cell surface, while IFITM3 localizes to LAMP1-containing compartments. DF-1 cells stably expressing duck IFITM3 (but not IFITM1 or IFITM2) show increased restriction of replication of H1N1, H6N2, and H11N9 IAV strains but not vesicular stomatitis virus. Although duck and human IFITM3 share only 38% identity, critical residues for viral restriction are conserved. We generate chimeric and mutant IFITM3 proteins and show duck IFITM3 does not require its N-terminal domain for endosomal localization or antiviral function; however, this N-terminal end confers endosomal localization and antiviral function on IFITM1. In contrast to mammalian IFITM3, the conserved YXXθ endocytosis signal sequence in the N-terminal domain of duck IFITM3 is not essential for correct endosomal localization. Despite significant structural and amino acid divergence, presumably due to host-virus coevolution, duck IFITM3 is functional against IAV. Immune IFITM genes are poorly conserved across species, suggesting that selective pressure from host-specific viruses has driven this divergence. We wondered whether coevolution between viruses and their natural host would result in the evasion of IFITM restriction. Ducks are the natural host of avian influenza A viruses
Evaluation of Gamma Interferon and Antibody Tuberculosis Tests in Alpacas
Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin
2012-01-01
We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a “test package,” although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations. PMID:22914362
Evaluation of gamma interferon and antibody tuberculosis tests in alpacas.
Rhodes, Shelley; Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin
2012-10-01
We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a "test package," although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations.
The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon
Fernández de Marco, María del Mar; Alejo, Alí; Hudson, Paul; Damon, Inger K.; Alcami, Antonio
2010-01-01
Variola virus (VARV) caused smallpox, one of the most devastating human diseases and the first to be eradicated, but its deliberate release represents a dangerous threat. Virulent orthopoxviruses infecting humans, such as monkeypox virus (MPXV), could fill the niche left by smallpox eradication and the cessation of vaccination. However, immunomodulatory activities and virulence determinants of VARV and MPXV remain largely unexplored. We report the molecular characterization of the VARV- and MPXV-secreted type I interferon-binding proteins, which interact with the cell surface after secretion and prevent type I interferon responses. The proteins expressed in the baculovirus system have been purified, and their interferon-binding properties characterized by surface plasmon resonance. The ability of these proteins to inhibit a broad range of interferons was investigated to identify potential adaptation to the human immune system. Furthermore, we demonstrate by Western blot and activity assays the expression of the type I interferon inhibitor during VARV and MPXV infections. These findings are relevant for the design of new vaccines and therapeutics to smallpox and emergent virulent orthopoxviruses because the type I interferon-binding protein is a major virulence factor in animal models, vaccination with this protein induces protective immunity, and its neutralization prevents disease progression.—Fernández de Marco, M. M., Alejo, A., Hudson, P., Damon, I. K., Alcami, A. The highly virulent variola and monkeypox viruses express secreted inhibitors of type I interferon. PMID:20019241
[Alpha interferon induced hyperthyroidism: a case report and review of the literature].
Maiga, I; Valdes-Socin, H; Thiry, A; Delwaide, J; Sidibe, A T; Beckers, A
2015-01-01
Treatment with alpha interferon in hepatitis C triggers a thyroid autoimmunity in a variable percentage of cases (2-8%). This complication raises some questions about its screening, the possibility to continue anti-viral therapy and thyroid treatment. Alpha interferon has an immunomodulatory effect on the thyroid, but also an inhibitory effect on thyroid hormone synthesis. This explains the occurrence of cases of thyroid dysfunction, which often remain undetected because of their latency. Factors predicting thyroid dysfunction with interferon use are: female sex, history of thyroid disease and previous autoimmunity. Several clinical aspects are encountered including hypothyroidism (the most frequent depending on the series) and hyperthyroidism related to Graves' disease. For their detection, a cooperation between general practionners, gastroenterologists and endocrinologists is mandatory thyroid function tests are requested before, during and after treatment,with alpha interferon. Therapeutic aspects of thyroid disorders range from simple monitoring to symptomatic treatment, such as thyroxine prescription in the presence of hypothyroidism. Antithyroid drugs radioactive iodine or thyroid surgery are used in cases of severe or persistent Graves' disease induced by alpha interferon.
Suppressing effect of low-dose gamma-ray irradiation on collagen-induced arthritis.
Nakatsukasa, Hiroko; Tsukimoto, Mitsutoshi; Ohshima, Yasuhiro; Tago, Fumitoshi; Masada, Ayako; Kojima, Shuji
2008-07-01
We previously reported attenuation of autoimmune disease by low-dose gamma-ray irradiation in MRL-lpr/lpr mice. Here, we studied the effect of low-dose gamma-ray irradiation on collagen-induced arthritis (CIA) in DBA/1J mice. Mice were immunized with type II collagen, and exposed to low-dose gamma-rays (0.5 Gy per week for 5 weeks). Paw swelling, redness, and bone degradation were suppressed by irradiation, which also delayed the onset of pathological change and reduced the severity of the arthritis. Production of tumor necrosis factor-alpha, interferon-gamma, and interleukin-6, which play important roles in the onset of CIA, was suppressed by the irradiation. The level of anti-type II collagen antibody, which is essential for the onset of CIA, was also lower in irradiated CIA mice. The population of plasma cells was increased in CIA mice, but irradiation blocked this increase. Since regulatory T cells are known to be involved in suppression of autoimmune disease, the population of CD4(+)CD25(+)Foxp3(+) regulatory T cells was measured. Intriguingly, a significant increase of these regulatory T cells was found in irradiated CIA mice. Overall, our data suggest that low-dose gamma-ray irradiation could attenuate CIA through suppression of pro-inflammatory cytokines and autoantibody production, and induction of regulatory T cells.
Alternative activation of STAT1 and STAT3 in response to interferon-gamma.
Qing, Yulan; Stark, George R
2004-10-01
Interferon-gamma (IFNgamma) is a pluripotent cytokine whose major biological effects are mediated through a pathway in which STAT1 is the predominant and essential transcription factor. STAT3 can also be activated weakly by IFNgamma, but the mechanism of activation and function of STAT3 as a part of the interferon response are not known. Here we show that STAT3 activation is much stronger and more prolonged in STAT1-null mouse embryo fibroblasts than in wild-type cells. In response to IFNgamma, SRC-family kinases are required to activate STAT3 (but not STAT1) through tyrosine phosphorylation, whereas the receptor-bound kinases JAK1 and JAK2 are required to activate both STATs. Tyrosine 419 of the IFNgamma receptor subunit 1 (IFNGR1) is required to activate both STATs, suggesting that STAT1 and STAT3 compete with each other for the same receptor phosphotyrosine motif. Activated STAT3 can replace STAT1 in STAT1-null cells to drive the transcription of certain genes, for example, socs-3 and c/ebpdelta, which have gamma-activated sequence motifs in their promoters. Work from Ian Kerr's laboratory reveals that the gp130-linked interleukin-6 receptor, which usually activates STAT3 predominantly, activates STAT1 efficiently when STAT3 is absent. Because STAT1 and STAT3 have opposing biological effects (STAT3 is an oncogene, and STAT1 is a tumor suppressor), the reciprocal activation of these two transcription factors in response to IFNgamma or interleukin-6 suggests that their relative abundance, which may vary substantially in different normal cell types, under different conditions or in tumors is likely to have a major impact on how cells behave in response to different cytokines.
Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio
2003-01-01
The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960
Titze-de-Almeida, Simoneide S; Lustosa, Cátia Faria; Horst, Camila Hillesheim; Bel, Elaine Del; Titze-de-Almeida, Ricardo
2014-12-01
This study examined whether the cytokine interferon (IFN) gamma plays a role in the injury of SH-SY5Y cells caused by MPP(+) (1-methyl-4-phenylpyridinium). First of all, IFN-gamma sensitized cells to the neurotoxin MPP(+), as determined by MTT (3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyltetrazolium bromide) assay. MPP(+)-injured cells showed higher reactive oxygen species (ROS) levels, which was reinforced by IFN-gamma. The injury triggered a marked expression of the neuronal NOS (nNOS) enzyme. L-NAME [N(ω)-nitro-L-arginine methyl ester, a non-specific NOS inhibitor] reestablished the cell viability after IFN-gamma challenging, and recovered cells from MPP(+) injury (95.0 vs. 84.7 %; P < 0.05). Seven-NI (7-nitroindazole, a nNOS inhibitor) protected cells against the injury by MPP(+) co-administered with IFN-gamma. Both inhibitors restrained the apoptosis of SH-SY5Y cells caused by MPP(+)/IFN-gamma. Regarding oxidative stress, L-NAME and 7-NI attenuated the increase in ROS levels caused by MPP(+) (45.3 or 48.4 vs. 87.9 %, P < 0.05). Indeed, L-NAME was more effective than 7-NI for reducing oxidative stress caused by MPP(+) under IFN-gamma exposition. The nNOS gene silencing by small-interfering RNAs recovered cells challenged by IFN-gamma (24 h), or MPP(+) (8 h). In conclusion, IFN-gamma sensitizes cells to MPP(+)-induced injury, also causing an increase in ROS levels. Pretreating cells with L-NAME or 7-NI reverts both the oxidative stress and apoptosis triggered by the neurotoxin MPP(+). Taking together, our data reinforce that IFN-gamma and NOS enzymes play a role in oxidative stress and dopaminergic cell death triggered by MPP(+).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cho, Eun-Ah; Juhnn, Yong-Sung, E-mail: juhnn@snu.ac.kr
2012-06-01
Highlights: Black-Right-Pointing-Pointer cAMP signaling system inhibits repair of {gamma}-ray-induced DNA damage. Black-Right-Pointing-Pointer cAMP signaling system inhibits DNA damage repair by decreasing XRCC1 expression. Black-Right-Pointing-Pointer cAMP signaling system decreases XRCC1 expression by promoting its proteasomal degradation. Black-Right-Pointing-Pointer The promotion of XRCC1 degradation by cAMP signaling system is mediated by Epac1. -- Abstract: Cyclic AMP is involved in the regulation of metabolism, gene expression, cellular growth and proliferation. Recently, the cAMP signaling system was found to modulate DNA-damaging agent-induced apoptosis by regulating the expression of Bcl-2 family proteins and inhibitors of apoptosis. Thus, we hypothesized that the cAMP signaling may modulate DNAmore » repair activity, and we investigated the effects of the cAMP signaling system on {gamma}-ray-induced DNA damage repair in lung cancer cells. Transient expression of a constitutively active mutant of stimulatory G protein (G{alpha}sQL) or treatment with forskolin, an adenylyl cyclase activator, augmented radiation-induced DNA damage and inhibited repair of the damage in H1299 lung cancer cells. Expression of G{alpha}sQL or treatment with forskolin or isoproterenol inhibited the radiation-induced expression of the XRCC1 protein, and exogenous expression of XRCC1 abolished the DNA repair-inhibiting effect of forskolin. Forskolin treatment promoted the ubiquitin and proteasome-dependent degradation of the XRCC1 protein, resulting in a significant decrease in the half-life of the protein after {gamma}-ray irradiation. The effect of forskolin on XRCC1 expression was not inhibited by PKA inhibitor, but 8-pCPT-2 Prime -O-Me-cAMP, an Epac-selective cAMP analog, increased ubiquitination of XRCC1 protein and decreased XRCC1 expression. Knockdown of Epac1 abolished the effect of 8-pCPT-2 Prime -O-Me-cAMP and restored XRCC1 protein level following {gamma
Electrochemical impedance spectroscopy based-on interferon-gamma detection
NASA Astrophysics Data System (ADS)
Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung
2014-03-01
Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.
Benaiges, D; Garcia-Retortillo, M; Mas, A; Cañete, N; Broquetas, T; Puigvehi, M; Chillarón, J J; Flores-Le Roux, J A; Sagarra, E; Cabrero, B; Zaffalon, D; Solà, R; Pedro-Botet, J; Carrión, J A
2016-01-01
The clinical value of thyrotropin receptor antibodies for the differential diagnosis of thyrotoxicosis induced by pegylated interferon-alpha remains unknown. We analyzed the diagnostic accuracy of thyrotropin receptor antibodies in the differential diagnosis of thyrotoxicosis in patients with chronic hepatitis C (CHC) receiving pegylated interferon-alpha plus ribavirin. Retrospective analysis of 274 patients with CHC receiving pegylated interferon-alpha plus ribavirin. Interferon-induced thyrotoxicosis was classified according to clinical guidelines as Graves disease, autoimmune and non- autoimmune destructive thyroiditis. 48 (17.5%) patients developed hypothyroidism, 17 (6.2%) thyrotoxicosis (6 non- autoimmune destructive thyroiditis, 8 autoimmune destructive thyroiditis and 3 Graves disease) and 22 "de novo" thyrotropin receptor antibodies (all Graves disease, 2 of the 8 autoimmune destructive thyroiditis and 17 with normal thyroid function). The sensitivity and specificity of thyrotropin receptor antibodies for Graves disease diagnosis in patients with thyrotoxicosis were 100 and 85%, respectively. Patients with destructive thyroiditis developed hypothyroidism in 87.5% of autoimmune cases and in none of those with a non- autoimmune etiology (p<0.001). Thyrotropin receptor antibodies determination cannot replace thyroid scintigraphy for the differential diagnosis of thyrotoxicosis in CHC patients treated with pegylated interferon. © Georg Thieme Verlag KG Stuttgart · New York.
Shibata, Haruki; Katsuki, Hiroshi; Nishiwaki, Mayumi; Kume, Toshiaki; Kaneko, Shuji; Akaike, Akinori
2003-09-01
Glial cell activation associated with inflammatory reaction may contribute to pathogenic processes of neurodegenerative disorders, through production of several cytotoxic molecules. We investigated the consequences of glial activation by interferon-gamma (IFN-gamma)/lipopolysaccharide (LPS) in rat midbrain slice cultures. Application of IFN-gamma followed by LPS caused dopaminergic cell death and accompanying increases in nitrite production and lactate dehydrogenase release. Aminoguanidine, an inhibitor of inducible nitric oxide synthase (iNOS), or SB203580, an inhibitor of p38 mitogen-activated protein kinase, prevented dopaminergic cell loss as well as nitrite production. SB203580 also suppressed expression of iNOS and cyclooxygenase-2 (COX-2) induced by IFN-gamma/LPS. A COX inhibitor indomethacin protected dopaminergic neurons from IFN-gamma/LPS-induced injury, whereas selective COX-2 inhibitors such as NS-398 and nimesulide did not. Notably, indomethacin was able to attenuate neurotoxicity of a nitric oxide (NO) donor. Neutralizing antibodies against tumour necrosis factor-alpha and interleukin-1beta did not inhibit dopaminergic cell death caused by IFN-gamma/LPS, although combined application of these antibodies blocked lactate dehydrogenase release and decrease in the number of non-dopaminergic neurons. These results indicate that iNOS-derived NO plays a crucial role in IFN-gamma/LPS-induced dopaminergic cell death, and that indomethacin exerts protective effect by mechanisms probably related to NO neurotoxicity rather than through COX inhibition.
Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.
2007-01-01
The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401
Sareneva, T; Mørtz, E; Tölö, H; Roepstorff, P; Julkunen, I
1996-12-01
Interferon-gamma (IFN-gamma) is a secretory glycoprotein produced by T cells in response to antigenic or mitogenic stimuli. We studied the kinetics of the synthesis, N-glycosylation, and secretion of IFN-gamma in human CD8+ T lymphocytes stimulated via T-cell receptor. Highly elevated IFN-gamma mRNA levels were found as early as 1 h after stimulation. Maximal IFN-gamma protein synthesis was observed 2-4 h after induction and appeared to correlate to steady-state IFN-gamma mRNA levels. As analyzed by pulse/chase experiments, the secretion of IFN-gamma from T cells was very rapid, the secretion half-time being approximately 20-25 min. Inhibition of N-glycosylation by tunicamycin dramatically reduced the expression of IFN-gamma, but did not block its secretion. Natural IFN-gamma is heterogeneously glycosylated and doubly, singly, and unglycosylated forms exist. Experiments performed in a cell-free translation/glycosylation system with mutated IFN-gamma constructs lacking either one of the potential glycosylation sites suggested that Asn25 is more efficiently glycosylated than Asn97. Site-specific oligosaccharide analysis of natural IFN-gamma by glycosidase treatment followed by matrix-assisted-laser-desorption-ionization mass spectrometry revealed considerable variation in the carbohydrate structures, with more than 30 different forms. The glycans at Asn25 consisted of fucosylated, mainly complex-type oligosaccharides, whereas the glycans at Asn97 were more heterogeneous, with hybrid and high-mannose structures. Our results emphasize the essential role of N-linked glycans in the biology of IFN-gamma and show that there is a considerable heterogeneity in the individual sugar chains of this important human cytokine.
Li, Yan-Feng; Lee, Koon-Guan; Ou, Xijun; Lam, Kong-Peng
2014-01-01
Stimulation of TLR7/9 by their respective ligands leads to the activation of IκB kinase α (IKKα) and Interferon Regulatory Factor 1 (IRF-1) and results in interferon (IFN)-β production in conventional dendritic cells (cDC). However, which other signaling molecules are involved in IKKα and IRF-1 activation during TLR7/9 signaling pathway are not known. We and others have shown that Bruton's Tyrosine Kinase (BTK) played a part in TLR9-mediated cytokine production in B cells and macrophages. However, it is unclear if BTK participates in TLR7/9-induced IFN-β production in cDC. In this study, we show that BTK is required for IFN-β synthesis in cDC upon TLR7/9 stimulation and that stimulated BTK-deficient cDC are defective in the induction of IKKα/β phosphorylation and IRF-1 activation. In addition, we demonstrate that Protein Kinase C µ (PKCµ) is also required for TLR7/9-induced IRF-1 activation and IFN-β upregulation in cDC and acts downstream of BTK. Taken together, we have uncovered two new molecules, BTK and PKCµ, that are involved in TLR7/9-triggered IFN-β production in cDC.
Martín, V; Pascual, E; Avia, M; Rangel, G; de Molina, A; Alejo, A; Sevilla, N
2016-01-06
Ovine interferon tau (IFN-τ) is a unique type I interferon with low toxicity and a broad host range in vivo. We report the generation of a nonreplicative recombinant adenovirus expressing biologically active IFN-τ. Using the B6.A2G-Mx1 mouse model, we showed that single-dose intranasal administration of recombinant Ad5-IFN-τ can effectively prevent lethality and disease induced by highly virulent hv-PR8 influenza virus by activating the interferon response and preventing viral replication. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Hunsicker, A; Kullich, W; Weissenhofer, W; Lorenz, D; Petermann, J; Rokos, H; Schwesinger, G
1997-05-01
To establish a standardised reproducible animal model of intraperitoneal sepsis, and to investigate early immunoserological responses to find a mediator-based system for evaluation and grading of diffuse peritonitis in patients Prospective experimental study 4 Teaching hospitals, Germany and Austria 42 LEW. 1W rats, 12 of which acted as controls Gram negative sepsis was induced by intraperitoneal injection of 6 ml of a mixture of Escherichia coli (K1:H+) 10(10) organisms/ml, autogenous haemoglobin 2.9 ml (haemoglobin concentration 3%), 0.9% sodium chloride 3 ml, and suspension 0.1 ml. Control rats were given physiological saline 6 ml alone. Concentrations of endotoxin, interferon gamma (IFN-gamma), and biopterin, and serum phospholipase A2 (PLA2) activity. There were significant differences between the septic and control rats in concentrations of endotoxin (EU/ml) (median (interquartile range) 21.85 (2.02-159.5) compared with 0, p < 0.0001; IFN-gamma (pg/ml) 1263.0 (271.0-7575.0) compared with 101.0 (89.0-141.0), p < 0.0001; biopterin (nmol/L) 111.0 (66.4-156.3) compared with 53.7 (38.3-67.6), p < 0.001; and PLA2 (U/L) 163.0 (125.8-209.0) compared with 112.5 (88.5-126.5) p < 0.01. Measurements of concentrations of endotoxin, IFN-gamma, pteridines, and PLA2 activity may well be adequate markers for early recognition of sepsis, and perhaps for grading it during the first 6 hours after induction. The allow a clear distinction to be made between septic and non-septic disorders in 87% of cases.
RNA editing is induced by type I interferon in esophageal squamous cell carcinoma.
Zhang, Jinyao; Chen, Zhaoli; Tang, Zefang; Huang, Jianbing; Hu, Xueda; He, Jie
2017-07-01
In recent years, abnormal RNA editing has been shown to play an important role in the development of esophageal squamous cell carcinoma, as such abnormal editing is catalyzed by ADAR (adenosine deaminases acting on RNA). However, the regulatory mechanism of ADAR1 in esophageal squamous cell carcinomas remains largely unknown. In this study, we investigated ADAR1 expression and its association with RNA editing in esophageal squamous cell carcinomas. RNA sequencing applied to esophageal squamous cell carcinoma clinical samples showed that ADAR1 expression was correlated with the expression of STAT1, STAT2, and IRF9. In vitro experiments showed that the abundance of ADAR1 protein was associated with the induced activation of the JAK/STAT pathway by type I interferon. RNA sequencing results showed that treatment with type I interferon caused an increase in the number and degree of RNA editing in esophageal squamous cell carcinoma cell lines. In conclusion, the activation of the JAK/STAT pathway is a regulatory mechanism of ADAR1 expression and causes abnormal RNA editing profile in esophageal squamous cell carcinoma. This mechanism may serve as a new target for esophageal squamous cell carcinoma therapy.
DeDiego, Marta L.; Nogales, Aitor; Lambert-Emo, Kris; Martinez-Sobrido, Luis
2016-01-01
ABSTRACT Influenza NS1 protein is the main viral protein counteracting host innate immune responses, allowing the virus to efficiently replicate in interferon (IFN)-competent systems. In this study, we analyzed NS1 protein variability within influenza A (IAV) H3N2 viruses infecting humans during the 2012-2013 season. We also evaluated the impact of the mutations on the ability of NS1 proteins to inhibit host innate immune responses and general gene expression. Surprisingly, a previously unidentified mutation in the double-stranded RNA (dsRNA)-binding domain (I64T) decreased NS1-mediated general inhibition of host protein synthesis by decreasing its interaction with cleavage and polyadenylation specificity factor 30 (CPSF30), leading to increased innate immune responses after viral infection. Notably, a recombinant A/Puerto Rico/8/34 H1N1 virus encoding the H3N2 NS1-T64 protein was highly attenuated in mice, most likely because of its ability to induce higher antiviral IFN responses at early times after infection and because this virus is highly sensitive to the IFN-induced antiviral state. Interestingly, using peripheral blood mononuclear cells (PBMCs) collected at the acute visit (2 to 3 days after infection), we show that the subject infected with the NS1-T64 attenuated virus has diminished responses to interferon and to interferon induction, suggesting why this subject could be infected with this highly IFN-sensitive virus. These data demonstrate the importance of influenza virus surveillance in identifying new mutations in the NS1 protein, affecting its ability to inhibit innate immune responses and, as a consequence, the pathogenicity of the virus. IMPORTANCE Influenza A and B viruses are one of the most common causes of respiratory infections in humans, causing 1 billion infections and between 300,000 and 500,000 deaths annually. Influenza virus surveillance to identify new mutations in the NS1 protein affecting innate immune responses and, as a consequence
The N-terminus of Bunyamwera orthobunyavirus NSs protein is essential for interferon antagonism.
van Knippenberg, Ingeborg; Carlton-Smith, Charlie; Elliott, Richard M
2010-08-01
Bunyamwera virus NSs protein is involved in the inhibition of cellular transcription and the interferon (IFN) response, and it interacts with the Med8 component of Mediator. A spontaneous mutant of a recombinant NSs-deleted Bunyamwera virus (rBUNdelNSs2) was identified and characterized. This mutant virus, termed mBUNNSs22, expresses a 21 aa N-terminally truncated form of NSs. Like rBUNdelNSs2, mBUNNSs22 is attenuated in IFN-deficient cells, and to a greater extent in IFN-competent cells. Both rBUNdelNSs2 and mBUNNSs22 are potent IFN inducers and their growth can be rescued by depleting cellular IRF3. Strikingly, despite encoding an NSs protein that contains the Med8 interaction domain, mBUNNSs22 fails to block RNA polymerase II activity during infection. Overall, our data suggest that both the interaction of NSs with Med8 and a novel unidentified function of the NSs N-terminus, seem necessary for Bunyamwera virus to counteract host antiviral responses.
Choi, Youn-Hee; Kim, Ha-il; Seong, Je Kyung; Yu, Dae-Yeul; Cho, Hyeseong; Lee, Mi-Ock; Lee, Jae Myun; Ahn, Yong-ho; Kim, Se Jong; Park, Jeon Han
2004-01-16
Ligand activation of peroxisome proliferator-activated receptor gamma (PPARgamma) has been reported to induce growth inhibition and apoptosis in various cancers including hepatocellular carcinoma (HCC). However, the effect of hepatitis B virus X protein (HBx) on PPARgamma activation has not been characterized in hepatitis B virus (HBV)-associated HCC. Herein, we demonstrated that HBx counteracted growth inhibition caused by PPARgamma ligand in HBx-associated HCC cells. We found that HBx bound to DNA binding domain of PPARgamma and HBx/PPARgamma interaction blocked nuclear localization and binding to recognition site of PPARgamma. HBx significantly suppressed a PPARgamma-mediated transactivation. These results suggest that HBx modulates PPARgamma function through protein-protein interaction.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Indukuri, Hemalatha; Castro, Shawn M.; Liao, S.-M.
2006-09-15
Respiratory syncytial virus (RSV)-induced chemokine gene expression occurs through the activation of a subset of transcription factors, including Interferon Regulatory Factor (IRF)-3. In this study, we have investigated the signaling pathway leading to RSV-induced IRF-3 activation and whether it is mediated by intracellular reactive oxygen species (ROS) generation. Our results show that RSV infection induces expression and catalytic activity of IKK{epsilon}, a noncanonical IKK-like kinase. Expression of a kinase-inactive IKK{epsilon} blocks RSV-induced IRF-3 serine phosphorylation, nuclear translocation and DNA-binding, leading to inhibition of RANTES gene transcription, mRNA expression and protein synthesis. Treatment of alveolar epithelial cells with antioxidants or withmore » NAD(P)H oxidase inhibitors abrogates RSV-induced chemokine secretion, IRF-3 phosphorylation and IKK{epsilon} induction, indicating that ROS generation plays a fundamental role in the signaling pathway leading to IRF-3 activation, therefore, identifying a novel molecular target for the development of strategies aimed to modify the inflammatory response associated with RSV infection of the lung.« less
Kuo, Joseph; Warner, Thomas F; Schell, Ronald F
2017-03-01
The immune mechanisms responsible for development of Lyme arthritis are partially understood with interleukin-17 (IL-17) and gamma-interferon (IFN-γ) playing a generally accepted role. Elevated levels of IL-17 and/or IFN-γ have been reported in samples from human Lyme arthritis patients and experimental mice. In addition, IL-17 and IFN-γ have been implicated in the onset of arthritis in Borrelia-primed and -infected C57BL/6 mice. Recently, we showed that IL-17-deficient mice developed swelling and histopathological changes consistent with arthritis in the presence of high levels of IFN-γ. We hypothesized that neutralization of IFN-γ in IL-17-deficient mice would inhibit Borrelia-induced arthritis. Our results, however, showed that swelling of the hind paws and histopathological changes of arthritis did not differ between Borrelia-primed and -infected IL-17-deficient and wild-type mice with or without neutralization of IFN-γ. We also found higher levels of tumor necrosis factor alpha (TNF-α) and IL-6 in the popliteal lymph node cells of Borrelia-primed and -infected IL-17-deficient mice after neutralization of IFN-γ. These results suggest that multiple cytokines interact in the development of Borrelia-induced arthritis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Interferon-induced RIP1/RIP3-mediated necrosis requires PKR and is licensed by FADD and caspases
Thapa, Roshan J.; Nogusa, Shoko; Chen, Peirong; Maki, Jenny L.; Lerro, Anthony; Andrake, Mark; Rall, Glenn F.; Degterev, Alexei; Balachandran, Siddharth
2013-01-01
Interferons (IFNs) are cytokines with powerful immunomodulatory and antiviral properties, but less is known about how they induce cell death. Here, we show that both type I (α/β) and type II (γ) IFNs induce precipitous receptor-interacting protein (RIP)1/RIP3 kinase-mediated necrosis when the adaptor protein Fas-associated death domain (FADD) is lost or disabled by phosphorylation, or when caspases (e.g., caspase 8) are inactivated. IFN-induced necrosis proceeds via progressive assembly of a RIP1–RIP3 “necrosome” complex that requires Jak1/STAT1-dependent transcription, but does not need the kinase activity of RIP1. Instead, IFNs transcriptionally activate the RNA-responsive protein kinase PKR, which then interacts with RIP1 to initiate necrosome formation and trigger necrosis. Although IFNs are powerful activators of necrosis when FADD is absent, these cytokines are likely not the dominant inducers of RIP kinase-driven embryonic lethality in FADD-deficient mice. We also identify phosphorylation on serine 191 as a mechanism that disables FADD and collaborates with caspase inactivation to allow IFN-activated necrosis. Collectively, these findings outline a mechanism of IFN-induced RIP kinase-dependent necrotic cell death and identify FADD and caspases as negative regulators of this process. PMID:23898178
Robinson, Nirmal; McComb, Scott; Mulligan, Rebecca; Dudani, Renu; Krishnan, Lakshmi; Sad, Subash
2014-01-01
Salmonella enterica serovar Typhimurium (S. Typhimurium) is a virulent pathogen that induces rapid host death. Here we observed that host survival after infection with S. Typhimurium was enhanced in the absence of type I interferon signaling, with improved survival of mice deficient in the receptor for type I interferons (Ifnar1−/− mice) that was attributed to macrophages. Although there was no impairment in cytokine expression or inflammasome activation in Ifnar1−/− macrophages, they were highly resistant to S. Typhimurium–induced cell death. Specific inhibition of the kinase RIP1or knockdown of the gene encoding the kinase RIP3 prevented the death of wild-type macrophages, which indicated that necroptosis was a mechanism of cell death. Finally, RIP3-deficient macrophages, which cannot undergo necroptosis, had similarly less death and enhanced control of S. Typhimurium in vivo. Thus, we propose that S. Typhimurium induces the production of type I interferon, which drives necroptosis of macrophages and allows them to evade the immune response. PMID:22922364
Kitagawa, Koichi; Omoto, Chika; Oda, Tsugumi; Araki, Ayame; Saito, Hiroki; Shigemura, Katsumi; Katayama, Takane; Hotta, Hak; Shirakawa, Toshiro
2017-04-01
We previously generated an oral hepatitis C virus (HCV) vaccine using Bifidobacterium displaying the HCV nonstructural protein 3 (NS3) polypeptide. NS3-specific cellular immunity is important for viral clearance and recovery from HCV infection. In this study, we enhanced the cellular immune responses induced by our oral HCV vaccine, Bifidobacterium longum 2165 (B. longum 2165), by combining interferon-α (IFN-α) as an adjuvant with the vaccine in a mouse experimental model. IFN-α is a widely used cytokine meeting the standard of care (SOC) for HCV infection and plays various immunoregulatory roles. We treated C57BL/6N mice with B. longum 2165 every other day and/or IFN-α twice a week for a month and then analyzed the immune responses using spleen cells. We determined the induction of NS3-specific cellular immunity by cytokine quantification, intracellular cytokine staining, and a cytotoxic T lymphocyte (CTL) assay targeting EL4 tumor cells expressing NS3/4A protein (EL4-NS3/4A). We also treated mice bearing EL4-NS3/4A tumor with the combination therapy in vivo. The results confirmed that the combination therapy of B. longum 2165 and IFN-α induced significantly higher IFN-γ secretion, higher population of CD4 + T and CD8 + T cells secreting IFN-γ, and higher CTL activity against EL4-NS3/4A cells compared with the control groups of phosphate-buffered saline, B. longum 2165 alone, and IFN-α alone (p < 0.05). We also confirmed that the combination therapy strongly enhanced tumor growth inhibitory effects in vivo with no serious adverse effects (p < 0.05). These results suggest that the combination of B. longum 2165 and IFN-α could induce a strong cellular immunity specific to NS3 protein as a combination therapy augmenting the current SOC immunotherapy against chronic HCV infection.
Three-dimensional crystal structure of recombinant murine interferon-beta.
Senda, T; Shimazu, T; Matsuda, S; Kawano, G; Shimizu, H; Nakamura, K T; Mitsui, Y
1992-01-01
The crystal structure of recombinant murine interferon-beta (IFN-beta) has been solved by the multiple isomorphous replacement method and refined to an R-factor of 20.5% against 2.6 A X-ray diffraction data. The structure shows a variant of the alpha-helix bundle with a new chain-folding topology, which seems to represent a basic structural framework of all the IFN-alpha and IFN-beta molecules belonging to the type I family. Functionally important segments of the polypeptide chain, as implied through numerous gene manipulation studies carried out so far, are spatially clustered indicating the binding site(s) to the receptor(s). Comparison of the present structure with those of other alpha-helical cytokine proteins, including porcine growth hormone, interleukin 2 and interferon gamma, indicated either a topological similarity in chain folding or a similar spatial arrangement of the alpha-helices. Images PMID:1505514
Inhibited interferon production after space flight
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Gould, C. L.; Williams, J.; Mandel, A. D.
1988-01-01
Several studies have been performed in our laboratories indicating that interferon production may be impaired in rodents after space flight. Using an antiorthostatic suspension model that simulates some of the effects of microgravity seen during space flight, we have shown that interferon-alpha/beta production was inhibited. The inhibition was not due solely to the stress of suspension. The inhibited interferon production was transient, as suspended animals returned to normal caging recovered the ability to produce interferon. Antiorthostatic suspension of mice also resulted in a loss of resistance to infection with the diabetogenic strain of encephalomyocarditis virus, which correlated with the drop in interferon production. In rats flown in US Space Shuttle mission SL-3, interferon-gamma production was inhibited severely when spleen cells were challenged with concanavalin-A upon return to earth. In contrast, interleukin-3 production by these cells was normal. These results suggest that immune responses may be altered after antiorthostatic modeling or space flight, and the resistance to viral infections may be especially affected.
Darwish, Samar F; El-Bakly, Wesam M; El-Naga, Reem N; Awad, Azza S; El-Demerdash, Ebtehal
2015-11-01
Iron-overload is a well-known factor of hepatotoxicity and liver fibrosis, which found to be a common finding among hepatitis C virus patients and related to interferon resistance. We aimed to elucidate the potential antifibrotic effect of deferoxamine; the main iron chelator, and its additional usefulness to interferon-based therapy in concanavalin A-induced immunological model of liver fibrosis. Rats were treated with deferoxamine and/or pegylated interferon-α for 6 weeks. Hepatotoxicity indices, oxidative stress, inflammatory and liver fibrosis markers were assessed. Concanavalin A induced a significant increase in hepatotoxicity indices and lipid peroxidation accompanied with a significant depletion of total antioxidant capacity, glutathione level and superoxide dismutase activity. Besides, it increased CD4(+) T-cells content and the downstream inflammatory cascades, including NF-κB, TNF-α, iNOS, COX-2, IL-6 and IFN-γ. Furthermore, α-SMA, TGF-β1 and hydroxyproline were increased markedly, which confirmed by histopathology. Treatment with either deferoxamine or pegylated interferon-α alone reduced liver fibrosis markers significantly and improved liver histology. However, some of the hepatotoxicity indices and oxidative stress markers did not improve upon pegylated interferon-α treatment alone, besides the remarkable increase in IL-6. Combination therapy of deferoxamine with pegylated interferon-α further improved all previous markers, ameliorated IL-6 elevation, as well as increased hepcidin expression. In conclusion, our study provides evidences for the potent antifibrotic effects of deferoxamine and the underlying mechanisms that involved attenuating oxidative stress and subsequent inflammatory cascade, as well as the production of profibrogenic factors. Addition of deferoxamine to interferon regimen for HCV patients may offer a promising adjuvant modality to enhance therapeutic response. Copyright © 2015 Elsevier Inc. All rights reserved.
La Flamme, Anne Camille; Patton, Elisabeth A.; Pearce, Edward J.
2001-01-01
In the absence of interleukin-4 (IL-4), infection with Schistosoma mansoni leads to a severe fatal disease rather than the chronic survivable condition that occurs in wild-type (WT) mice. Because the sustained production of NO most closely correlates to weight loss and fatality in infected IL-4−/− mice and because gamma interferon (IFN-γ) is an important inducer of inducible NO synthase, infected IL-4−/− mice were treated with anti-IFN-γ antibodies to determine the role of IFN-γ during schistosomiasis in WT and IL-4−/− animals. When IFN-γ was neutralized, Th2 responses were enhanced and NO production was reduced in both WT and IL-4−/− mice. The decreased NO production correlated with a rescue of proliferation in splenocytes from infected IL-4−/− mice. Furthermore, the neutralization of IFN-γ in vivo improved the gross appearance of the liver and led to a reduction in granuloma size in infected IL-4−/− but not WT mice. However, the neutralization of IFN-γ in vivo did not affect the development of severe disease in infected IL-4−/− mice. These results suggest that while the increased production of IFN-γ does lead to some of the pathology observed in infected IL-4−/− mice, it is not ultimately responsible for cachexia and death. PMID:11705919
Toscana Virus NSs Protein Inhibits the Induction of Type I Interferon by Interacting with RIG-I
Gori-Savellini, Gianni; Valentini, Melissa
2013-01-01
Toscana virus (TOSV) is a phlebovirus, of the Bunyaviridae family, that is responsible for central nervous system (CNS) injury in humans. Previous data have shown that the TOSV NSs protein is a gamma interferon (IFN-β) antagonist when transiently overexpressed in mammalian cells, inhibiting IRF-3 induction (G. Gori Savellini, F. Weber, C. Terrosi, M. Habjan, B. Martorelli, and M. G. Cusi, J. Gen. Virol. 92:71–79, 2011). In this study, we investigated whether an upstream sensor, which has a role in the signaling cascade leading to the production of type I IFN, was involved. We found a significant decrease in RIG-I protein levels in cells overexpressing TOSV NSs, suggesting that the nonstructural protein interacts with RIG-I and targets it for proteasomal degradation. In fact, the MG-132 proteasome inhibitor was able to restore IFN-β promoter activation in cells expressing NSs, demonstrating the existence of an evasion mechanism based on inhibition of the RIG-I sensor. Furthermore, a C-terminal truncated NSs protein (ΔNSs), although able to interact with RIG-I, did not affect the RIG-I-mediated IFN-β promoter activation, suggesting that the NSs domains responsible for RIG-I-mediated signaling and interaction with RIG-I are mapped on different regions. These results contribute to identify a novel mechanism for bunyaviruses by which TOSV NSs counteracts the early IFN response. PMID:23552410
Toscana virus NSs protein inhibits the induction of type I interferon by interacting with RIG-I.
Gori-Savellini, Gianni; Valentini, Melissa; Cusi, Maria Grazia
2013-06-01
Toscana virus (TOSV) is a phlebovirus, of the Bunyaviridae family, that is responsible for central nervous system (CNS) injury in humans. Previous data have shown that the TOSV NSs protein is a gamma interferon (IFN-β) antagonist when transiently overexpressed in mammalian cells, inhibiting IRF-3 induction (G. Gori Savellini, F. Weber, C. Terrosi, M. Habjan, B. Martorelli, and M. G. Cusi, J. Gen. Virol. 92:71-79, 2011). In this study, we investigated whether an upstream sensor, which has a role in the signaling cascade leading to the production of type I IFN, was involved. We found a significant decrease in RIG-I protein levels in cells overexpressing TOSV NSs, suggesting that the nonstructural protein interacts with RIG-I and targets it for proteasomal degradation. In fact, the MG-132 proteasome inhibitor was able to restore IFN-β promoter activation in cells expressing NSs, demonstrating the existence of an evasion mechanism based on inhibition of the RIG-I sensor. Furthermore, a C-terminal truncated NSs protein (ΔNSs), although able to interact with RIG-I, did not affect the RIG-I-mediated IFN-β promoter activation, suggesting that the NSs domains responsible for RIG-I-mediated signaling and interaction with RIG-I are mapped on different regions. These results contribute to identify a novel mechanism for bunyaviruses by which TOSV NSs counteracts the early IFN response.
Xu, Jinfang; Qian, Ping; Wu, Qunfeng; Liu, Shasha; Fan, Wenchun; Zhang, Keshan; Wang, Rong; Zhang, Huawei; Chen, Huanchun; Li, Xiangmin
2014-09-01
The interferon-induced transmembrane protein 3 (IFITM3) is a widely expressed potent antiviral effector of the host innate immune system. It restricts a diverse group of pathogenic, enveloped viruses, by interfering with endosomal fusion. In this report, the swine IFITM3 (sIFITM3) gene was cloned. It shares the functionally conserved CD225 domain and multiple critical amino acid residues (Y19, F74, F77, R86 and Y98) with its human ortholog, which are essential for antiviral activity. Ectopic expression of sIFITM3 significantly inhibited non-enveloped foot-and-mouth disease virus (FMDV) infection in BHK-21 cells. Furthermore, sIFITM3 blocked FMDV infection at early steps in the virus life cycle by disrupting viral attachment to the host cell surface. Importantly, inoculation of 2-day-old suckling mice with a plasmid expressing sIFITM3 conferred protection against lethal challenge with FMDV. These results suggest that sIFITM3 is a promising antiviral agent and that can safeguard the host from infection with FMDV. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Antropova, Y. N.; Konstantinova, I. V.; Fuks, B. B.; Talosh, M. Y.; Veysfeyler, Y. K.
1974-01-01
A comparative study is reported of the effect of the synthetic homopolymer poly I:C and Newcastle Disease virus on the synthesis of RNA, DNA, total protein and interferon in the spleen of nonradiated and radiated mice. In radiated animals, poly I:C and NDV had no stimulating effect on the synthesis of RNA; administration of both inducers to radiated mice did not significantly affect the content of lymphoid cellular elements in the spleen. However, while reduction of RNA synthesis, caused by radiation, also increases slightly under the effect of poly I:C and the virus, the synthesis of interferon in spleen cells and in the entire body is activated.
Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T
1993-01-01
For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376
Dron, Michel; Meritet, Jean François; Dandoy-Dron, Françoise; Meyniel, Jean-Philippe; Maury, Chantal; Tovey, Michael G
2002-03-01
The expression of the previously uncharacterized gene Adir (for ATP dependent interferon responsive gene) was increased by 5- to 15-fold in tissue of the oral cavity or in spleen and liver of mice treated orally or intraperitoneally with IFN-alpha, and in mouse cells treated in vitro with IFN-alpha or IFN-gamma. The level of Adir mRNA was also increased 20- to 40-fold in the brains of animals infected with encephalomyocarditis virus. Adir is expressed ubiquitously in mouse tissues as 1.9-, 2.4-, and 3.5-kb mRNA transcripts encoding a 385-amino-acid protein with a conserved ATP binding domain containing typical nucleotide and Mg(2+) binding sites. We also characterized the human ortholog, ADIR, which is located on chromosome 1q25-q31 and contains six exons encoding a 397-amino-acid protein with 80% homology to the mouse protein. A single 2.3-kb mRNA was detected in all human tissues examined, except for placenta, which also contained a 1.25-kb tissue-specific transcript generated by alternative splicing and encoding a putative 336-amino-acid protein. Although ADIR exhibits low homology to DYT1 and TOR1B, the deduced ADIR protein sequences are highly homologous to torsin A and torsin B and more distantly related to members of the Clp/HSP100 family of proteins, suggesting that ADIR, like torsins, is related to the AAA chaperone-like family of ATPases. An ADIR-EGFP fusion protein expressed in HeLa cells was shown to be associated with the endoplasmic reticulum.
Zibara, Kazem; Zeidan, Asad; Bjeije, Hassan; Kassem, Nouhad; Badran, Bassam; El-Zein, Nabil
2017-03-01
Interferon gamma (IFN-ɣ) is a pleiotropic cytokine which plays dual contrasting roles in cancer. Although IFN-ɣ has been clinically used to treat various malignancies, it was recently shown to have protumorigenic activities. Reactive oxygen species (ROS) are overproduced in cancer cells, mainly due to NADPH oxidase activity, which results into several changes in signaling pathways. In this study, we examined IFN-ɣ effect on the phosphorylation levels of key signaling proteins, through ROS production, in the human breast cancer cell line MCF-7. After treatment by IFN-ɣ, results showed a significant increase in the phosphorylation of STAT1, Src, raf, AKT, ERK1/2 and p38 signaling molecules, in a time specific manner. Src and Raf were found to be involved in early stages of IFN-ɣ signaling since their phosphorylation increased very rapidly. Selective inhibition of Src-family kinases resulted in an immediate significant decrease in the phosphorylation status of Raf and ERK1/2, but not p38 and AKT. On the other hand, IFN-ɣ resulted in ROS generation, through H 2 O 2 production, whereas pre-treatment with the ROS inhibitor NAC caused ROS inhibition and a significant decrease in the phosphorylation levels of AKT, ERK1/2, p38 and STAT1. Moreover, pretreatment with a selective NOX1 inhibitor resulted in a significant decrease of AKT phosphorylation. Finally, no direct relationship was found between ROS production and calcium mobilization. In summary, IFN-ɣ signaling in MCF-7 cell line is ROS-dependent and follows the Src/Raf/ERK pathway whereas its signaling through the AKT pathway is highly dependent on NOX1.
Interferon-Induced Ifit2/ISG54 Protects Mice from Lethal VSV Neuropathogenesis
Fensterl, Volker; Wetzel, Jaime L.; Ramachandran, Srividya; Ogino, Tomoaki; Stohlman, Stephen A.; Bergmann, Cornelia C.; Diamond, Michael S.; Virgin, Herbert W.; Sen, Ganes C.
2012-01-01
Interferon protects mice from vesicular stomatitis virus (VSV) infection and pathogenesis; however, it is not known which of the numerous interferon-stimulated genes (ISG) mediate the antiviral effect. A prominent family of ISGs is the interferon-induced with tetratricopeptide repeats (Ifit) genes comprising three members in mice, Ifit1/ISG56, Ifit2/ISG54 and Ifit3/ISG49. Intranasal infection with a low dose of VSV is not lethal to wild-type mice and all three Ifit genes are induced in the central nervous system of the infected mice. We tested their potential contributions to the observed protection of wild-type mice from VSV pathogenesis, by taking advantage of the newly generated knockout mice lacking either Ifit2 or Ifit1. We observed that in Ifit2 knockout (Ifit2 −/−) mice, intranasal VSV infection was uniformly lethal and death was preceded by neurological signs, such as ataxia and hind limb paralysis. In contrast, wild-type and Ifit1 −/− mice were highly protected and survived without developing such disease. However, when VSV was injected intracranially, virus replication and survival were not significantly different between wild-type and Ifit2−/− mice. When administered intranasally, VSV entered the central nervous system through the olfactory bulbs, where it replicated equivalently in wild-type and Ifit2 −/− mice and induced interferon-β. However, as the infection spread to other regions of the brain, VSV titers rose several hundred folds higher in Ifit2 −/− mice as compared to wild-type mice. This was not caused by a broadened cell tropism in the brains of Ifit2 −/− mice, where VSV still replicated selectively in neurons. Surprisingly, this advantage for VSV replication in the brains of Ifit2−/− mice was not observed in other organs, such as lung and liver. Pathogenesis by another neurotropic RNA virus, encephalomyocarditis virus, was not enhanced in the brains of Ifit2 −/− mice. Our study provides a clear demonstration of
Coursey, Terry G; Tukler Henriksson, Johanna; Barbosa, Flavia L; de Paiva, Cintia S; Pflugfelder, Stephen C
2016-06-01
Goblet cells (GCs) are specialized secretory cells that produce mucins and a variety of other proteins. Significant conjunctival GC loss occurs in both experimental dry eye models and patients with keratoconjunctivitis sicca due to the induction of interferon (IFN)-γ. With the use of a primary murine culture model, we found that GCs are highly sensitive to IFN-γ with significantly reduced proliferation and altered structure with low concentrations. GC cultures treated with IFN-γ have increased gene expression of Muc2 and Muc5AC but do not express these mucin glycoproteins. We hypothesized that IFN-γ induces endoplasmic reticulum stress and the unfolded protein response (UPR) in GCs. Cultures treated with IFN-γ increased expression of UPR-associated genes and proteins. Increased GRP78 and sXBP1 expression was found in experimental dry eye and Sjögren syndrome models and was GC specific. Increased GRP78 was also found in the conjunctiva of patients with Sjögren syndrome at the gene and protein levels. Treatment with dexamethasone inhibited expression of UPR-associated genes and increased mucin production. These results indicate that induction of UPR by IFN-γ is an important cause of GC-associated mucin deficiency observed in aqueous-deficient dry eye. Therapies to block the effects of IFN-γ on the metabolically active endoplasmic reticulum in these cells might enhance synthesis and secretion of the protective GC mucins on the ocular surface. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
DeDiego, Marta L; Nogales, Aitor; Lambert-Emo, Kris; Martinez-Sobrido, Luis; Topham, David J
2016-11-01
Influenza NS1 protein is the main viral protein counteracting host innate immune responses, allowing the virus to efficiently replicate in interferon (IFN)-competent systems. In this study, we analyzed NS1 protein variability within influenza A (IAV) H3N2 viruses infecting humans during the 2012-2013 season. We also evaluated the impact of the mutations on the ability of NS1 proteins to inhibit host innate immune responses and general gene expression. Surprisingly, a previously unidentified mutation in the double-stranded RNA (dsRNA)-binding domain (I64T) decreased NS1-mediated general inhibition of host protein synthesis by decreasing its interaction with cleavage and polyadenylation specificity factor 30 (CPSF30), leading to increased innate immune responses after viral infection. Notably, a recombinant A/Puerto Rico/8/34 H1N1 virus encoding the H3N2 NS1-T64 protein was highly attenuated in mice, most likely because of its ability to induce higher antiviral IFN responses at early times after infection and because this virus is highly sensitive to the IFN-induced antiviral state. Interestingly, using peripheral blood mononuclear cells (PBMCs) collected at the acute visit (2 to 3 days after infection), we show that the subject infected with the NS1-T64 attenuated virus has diminished responses to interferon and to interferon induction, suggesting why this subject could be infected with this highly IFN-sensitive virus. These data demonstrate the importance of influenza virus surveillance in identifying new mutations in the NS1 protein, affecting its ability to inhibit innate immune responses and, as a consequence, the pathogenicity of the virus. Influenza A and B viruses are one of the most common causes of respiratory infections in humans, causing 1 billion infections and between 300,000 and 500,000 deaths annually. Influenza virus surveillance to identify new mutations in the NS1 protein affecting innate immune responses and, as a consequence, the pathogenicity of
The POU Transcription Factor Oct-1 Represses Virus-Induced Interferon A Gene Expression
Mesplède, Thibault; Island, Marie-Laure; Christeff, Nicolas; Petek, Fahrettin; Doly, Janine; Navarro, Sébastien
2005-01-01
Alpha interferon (IFN-α) and IFN-β are able to interfere with viral infection. They exert a vast array of biologic functions, including growth arrest, cell differentiation, and immune system regulation. This regulation extends from innate immunity to cellular and humoral adaptive immune responses. A strict control of expression is needed to prevent detrimental effects of unregulated IFN. Multiple IFN-A subtypes are coordinately induced in human and mouse cells infected by virus and exhibit differences in expression of their individual mRNAs. We demonstrated that the weakly expressed IFN-A11 gene is negatively regulated after viral infection, due to a distal negative regulatory element, binding homeoprotein pituitary homeobox 1 (Pitx1). Here we show that the POU protein Oct-1 binds in vitro and in vivo to the IFN-A11 promoter and represses IFN-A expression upon interferon regulatory factor overexpression. Furthermore, we show that Oct-1-deficient MEFs exhibit increased in vivo IFN-A gene expression and increased antiviral activity. Finally, the IFN-A expression pattern is modified in Oct-1-deficient MEFs. The broad representation of effective and potent octamer-like sequences within IFN-A promoters suggests an important role for Oct-1 in IFN-A regulation. PMID:16166650
Niedelman, Wendy; Gold, Daniel A.; Rosowski, Emily E.; Sprokholt, Joris K.; Lim, Daniel; Farid Arenas, Ailan; Melo, Mariane B.; Spooner, Eric; Yaffe, Michael B.; Saeij, Jeroen P. J.
2012-01-01
The obligate intracellular parasite Toxoplasma gondii secretes effector proteins into the host cell that manipulate the immune response allowing it to establish a chronic infection. Crosses between the types I, II and III strains, which are prevalent in North America and Europe, have identified several secreted effectors that determine strain differences in mouse virulence. The polymorphic rhoptry protein kinase ROP18 was recently shown to determine the difference in virulence between type I and III strains by phosphorylating and inactivating the interferon-γ (IFNγ)-induced immunity-related GTPases (IRGs) that promote killing by disrupting the parasitophorous vacuole membrane (PVM) in murine cells. The polymorphic pseudokinase ROP5 determines strain differences in virulence through an unknown mechanism. Here we report that ROP18 can only inhibit accumulation of the IRGs on the PVM of strains that also express virulent ROP5 alleles. In contrast, specific ROP5 alleles can reduce IRG coating even in the absence of ROP18 expression and can directly interact with one or more IRGs. We further show that the allelic combination of ROP18 and ROP5 also determines IRG evasion and virulence of strains belonging to other lineages besides types I, II and III. However, neither ROP18 nor ROP5 markedly affect survival in IFNγ-activated human cells, which lack the multitude of IRGs present in murine cells. These findings suggest that ROP18 and ROP5 have specifically evolved to block the IRGs and are unlikely to have effects in species that do not have the IRG system, such as humans. PMID:22761577
Pérez de Val, Bernat; Vidal, Enric; López-Soria, Sergio; Marco, Alberto; Cervera, Zoraida; Martín, Maite; Mercader, Irene; Singh, Mahavir; Raeber, Alex; Domingo, Mariano
2016-02-10
Vaccination of domestic animals has emerged as an alternative long-term strategy for the control of tuberculosis (TB). A trial under field conditions was conducted in a TB-free goat herd to assess the safety of the Mycobacterium bovis BCG vaccine. Eleven kids and 10 milking goats were vaccinated with BCG. Bacterial shedding and interferon gamma (IFN-γ) responses were monitored throughout the study. Comprehensive pathological examination and mycobacterial culture of target tissues were performed. BCG vaccine strain was only isolated from the draining lymph node of the injection site of a kid euthanized at week 8 post-vaccination. The remaining animals were euthanized at week 24. Six out of 20 showed small granulomas at the injection site. BCG shedding was not detected in either faeces or in milk throughout the study. All vaccinated kids showed BCG-induced IFN-γ responses at week 8 post-vaccination. BCG vaccination of goats showed no lack of biological safety for the animals, environment and public health, and local adverse reactions were negligible. Copyright © 2016 Elsevier Ltd. All rights reserved.
Huang, Runqing; Zhou, Qiong; Shi, Yan; Zhang, Jing; He, Jianguo; Xie, Junfeng
2018-05-04
Family Nodaviridae consists of two genera: Alphanodavirus and Betanodavirus, and the latter is classified into four genotypes, including red-spotted grouper nervous necrosis virus, tiger puffer nervous necrosis virus, striped jack nervous necrosis virus, and barfin flounder nervous necrosis virus. Type I interferons (IFNs) play a central role in the innate immune system and antiviral responses, and the interactions between IFN and NNV have been investigated in this study. We have found that the RNA-dependent RNA polymerase (RdRp) from orange-spotted nervous necrosis virus (OGNNV), named protein A, was capable of activating IFN promoter in fathead minnow (FHM) cells. Transient expression of protein A was found to induce IFN expression and secretion, endowing FHM cells with anti-tiger frog virus ability. Protein A from SJNNV can also induce IFN expression in FHM cells but that from Flock House virus (FHV), a well-studied representative species of genus Alphanodavirus, cannot. RdRp activity and mitochondrial localization were shown to be required for protein A to induce IFN expression by means of activating IRF3 but not NFκB. Furthermore, DsRNA synthesized in vitro transcription and poly I:C activated IFN promoter activity when transfected into FHM cells, and dsRNA were also detected in NNV-infected cells. We postulated that dsRNA, a PAMP, was produced by protein A, leading to activation of innate immune response. These results suggest that protein As from NNV are the agonists of innate immune response. This is the first work to demonstrate the interaction between NNV protein A and innate immune system, and may help to understand pathogenesis of NNV. Copyright © 2018 Elsevier Ltd. All rights reserved.
Li, Lian-Feng; Yu, Jiahui; Zhang, Yuexiu; Yang, Qian; Li, Yongfeng; Zhang, Lingkai; Wang, Jinghan; Li, Su; Luo, Yuzi; Sun, Yuan; Qiu, Hua-Ji
2017-06-01
Classical swine fever virus (CSFV) is the causative agent of classical swine fever (CSF), which poses a serious threat to the global pig industry. Interferons (IFNs) and IFN-stimulated genes (ISGs) play a key role in host antiviral defense. We have previously screened the porcine 2'-5'-oligoadenylate synthetase-like protein (pOASL) as a potential anti-CSFV ISG using a reporter CSFV. This study aimed to clarify the underlying antiviral mechanism of pOASL against CSFV. We confirmed that CSFV replication was significantly suppressed in lentivirus-delivered, pOASL-overexpressing PK-15 cells, whereas silencing the expression of endogenous pOASL by small interfering RNAs markedly enhanced CSFV growth. In addition, the transcriptional level of pOASL was upregulated both in vitro and in vivo upon CSFV infection. Interestingly, the anti-CSFV effects of pOASL are independent of the canonical RNase L pathway but depend on the activation of the type I IFN response. Glutathione S -transferase pulldown and coimmunoprecipitation assays revealed that pOASL interacts with MDA5, a double-stranded RNA sensor, and further enhances MDA5-mediated type I IFN signaling. Moreover, we showed that pOASL exerts anti-CSFV effects in an MDA5-dependent manner. In conclusion, pOASL suppresses CSFV replication via the MDA5-mediated type I IFN-signaling pathway. IMPORTANCE The host innate immune response plays an important role in mounting the initial resistance to viral infection. Here, we identify the porcine 2'-5'-oligoadenylate synthetase-like protein (pOASL) as an interferon (IFN)-stimulated gene (ISG) against classical swine fever virus (CSFV). We demonstrate that the anti-CSFV effects of pOASL depend on the activation of type I IFN response. In addition, we show that pOASL, as an MDA5-interacting protein, is a coactivator of MDA5-mediated IFN induction to exert anti-CSFV actions. This work will be beneficial to the development of novel anti-CSFV strategies by targeting pOASL. Copyright
Yamaguchi, Mayu; Kitagawa, Yoshinori; Zhou, Min; Itoh, Masae; Gotoh, Bin
2014-01-03
Paramyxovirus C protein targets the host interferon (IFN) system for virus immune evasion. To identify its unknown anti-IFN activity, we examined the effect of Sendai virus C protein on activation of the IFN-α promoter via various signaling pathways. This study uncovers a novel ability of C protein to block Toll-like receptor (TLR) 7- and TLR9-dependent IFN-α induction, which is specific to plasmacytoid dendritic cells. C protein interacts with a serine/threonine kinase IKKα and inhibits phosphorylation of IRF7. This anti-IFN activity of C protein is shared across genera of the Paramyxovirinae, and thus appears to play an important role in paramyxovirus immune evasion. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Human Cells as Platform to Produce Gamma-Carboxylated Proteins.
de Sousa Bomfim, Aline; de Freitas, Marcela Cristina Corrêa; Covas, Dimas Tadeu; de Sousa Russo, Elisa Maria
2018-01-01
The gamma-carboxylated proteins belong to a family of proteins that depend on vitamin K for normal biosynthesis. The major representative gamma-carboxylated proteins are the coagulation system proteins, for example, factor VII, factor IX, factor X, prothrombin, and proteins C, S, and Z. These molecules have harbored posttranslational modifications, such as glycosylation and gamma-carboxylation, and for this reason they need to be produced in mammalian cell lines. Human cells lines have emerged as the most promising alternative to the production of gamma-carboxylated proteins. In this chapter, the methods to generate human cells as a platform to produce gamma-carboxylated proteins, for example the coagulation factors VII and IX, are presented. From the cell line modification up to the vitamin K adaptation of the produced cells is described in the protocols presented in this chapter.
Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu
2008-08-01
The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.
Role for herpes simplex virus 1 ICP27 in the inhibition of type I interferon signaling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, Karen E.; Song, Byeongwoon; Knipe, David M.
2008-05-10
Host cells respond to viral infection by many mechanisms, including the production of type I interferons which act in a paracrine and autocrine manner to induce the expression of antiviral interferon-stimulated genes (ISGs). Viruses have evolved means to inhibit interferon signaling to avoid induction of the innate immune response. Herpes simplex virus 1 (HSV-1) has several mechanisms to inhibit type I interferon production, the activities of ISGs, and the interferon signaling pathway itself. We report that the inhibition of the Jak/STAT pathway by HSV-1 requires viral gene expression and that viral immediate-early protein ICP27 plays a role in downregulating STAT-1more » phosphorylation and in preventing the accumulation of STAT-1 in the nucleus. We also show that expression of ICP27 by transfection causes an inhibition of IFN-induced STAT-1 nuclear accumulation. Therefore, ICP27 is necessary and sufficient for at least some of the effects of HSV infection on STAT-1.« less
Gamma Interferon Release Assays for Detection of Mycobacterium tuberculosis Infection
Denkinger, Claudia M.; Kik, Sandra V.; Rangaka, Molebogeng X.; Zwerling, Alice; Oxlade, Olivia; Metcalfe, John Z.; Cattamanchi, Adithya; Dowdy, David W.; Dheda, Keertan; Banaei, Niaz
2014-01-01
SUMMARY Identification and treatment of latent tuberculosis infection (LTBI) can substantially reduce the risk of developing active disease. However, there is no diagnostic gold standard for LTBI. Two tests are available for identification of LTBI: the tuberculin skin test (TST) and the gamma interferon (IFN-γ) release assay (IGRA). Evidence suggests that both TST and IGRA are acceptable but imperfect tests. They represent indirect markers of Mycobacterium tuberculosis exposure and indicate a cellular immune response to M. tuberculosis. Neither test can accurately differentiate between LTBI and active TB, distinguish reactivation from reinfection, or resolve the various stages within the spectrum of M. tuberculosis infection. Both TST and IGRA have reduced sensitivity in immunocompromised patients and have low predictive value for progression to active TB. To maximize the positive predictive value of existing tests, LTBI screening should be reserved for those who are at sufficiently high risk of progressing to disease. Such high-risk individuals may be identifiable by using multivariable risk prediction models that incorporate test results with risk factors and using serial testing to resolve underlying phenotypes. In the longer term, basic research is necessary to identify highly predictive biomarkers. PMID:24396134
Tsukimoto, Mitsutoshi; Tamaishi, Nana; Homma, Takujiro; Kojima, Shuji
2010-01-01
The transcription factor nuclear erythroid-derived 2-related factor 2 (Nrf2) regulates expression of genes encoding antioxidant proteins involved in cellular redox homeostasis, while gamma-ray irradiation is known to induce reactive oxygen species in vivo. Although activation of Nrf2 by various stresses has been studied, it has not yet been determined whether ionizing irradiation induces activation of Nrf2. Therefore, we investigated activation of Nrf2 in response to gamma-irradiation in mouse macrophage RAW264.7 cells. Irradiation of cells with gamma-rays induced an increase of Nrf2 expression. Even 0.1 Gy of gamma-irradiation induced a translocation of Nrf2 from cytoplasm to the nucleus, indicating the activation of Nrf2 by low-dose irradiation. Expression of heme oxygenase-1, which is regulated by Nrf2, was also increased at 24 h after irradiation with more than 0.1 Gy of gamma-rays. Furthermore, the activation of Nrf2 was suppressed by U0126, which is an inhibitor of the extracellular signal regulated protein kinase 1/2 (ERK1/2) pathway, suggesting involvement of ERK1/2-dependent pathway in the irradiation-induced activation of Nrf2. Our results indicate that low-dose gamma-irradiation induces activation of Nrf2 through ERK1/2-dependent pathways.
Toy, J L
1983-01-01
An overview of the interferons is presented. A description of something of what is known about them is given, including: their genes; their protein structures and characteristics; their mechanisms of actions; and their varied biological effects emphasising particularly their immunomodulatory actions. Finally, a brief summary is made of the current status of human clinical studies that have been conducted with interferons in the oncological and viral fields, mentioning also recent findings in patients who have the acquired immunodeficiency syndrome (AIDS). PMID:6193915
Leung, Donald YM; Gao, Pei-Song; Grigoryev, Dmitry N; Rafaels, Nicholas M; Streib, Joanne E; Howell, Michael D; Taylor, Patricia A; Boguniewicz, Mark; Canniff, Jennifer; Armstrong, Brian; Zaccaro, Daniel J; Schneider, Lynda C; Hata, Tissa R; Hanifin, Jon M; Beck, Lisa A; Weinberg, Adriana; Barnes, Kathleen C
2011-01-01
Background The basis for increased susceptibility of atopic dermatitis (AD) patients to develop disseminated viral skin infections such as eczema herpeticum (ADEH+) is poorly understood. Objective We sought to determine whether atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Methods GeneChip profiling was used to identify differences in gene expression of peripheral blood mononuclear cells (PBMC) from patients with a history of ADEH+ as compared to ADEH− and non-atopic controls. Key differences in protein expression were verified by ELISPOT and/or ELISA. Clinical relevance was further demonstrated by a mouse model of disseminated viral skin infection and genetic association analysis for genetic variants in IFNG and IFNGR1 and ADEH among 435 cases and controls. Results We demonstrate by global gene expression analysis selective transcriptomic changes within the interferon (IFN) superfamily of PBMCs from ADEH+ subjects reflecting low IFNγ and IFNγ receptor gene expression. IFNγ protein production was also significantly lower in ADEH+ (N=24) compared to ADEH− (N=20) and non-atopic (NA; N=20) controls. IFNγ receptor knockout (KO) mice developed disseminated viral skin infection after epicutaneous challenge with vaccinia virus (VV). Genetic variants in IFNG and IFNGR1 SNPs were significantly associated with ADEH (112 cases, 166 controls) and IFNγ production: a 2-SNP (A–G) IFNGR1 haplotype (rs10457655 and rs7749390) showed the strongest association with a reduced risk of ADEH+ ((13.2% ADEH+ vs 25.5% ADEH−, P = 0.00057). Conclusions ADEH+ patients have reduced IFNγ production, and IFNG and IFNGR1 SNPs are significantly associated with ADEH+ and may contribute to an impaired immune response to herpes simplex virus (HSV). Clinical Implications Atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Capsule summary Using genomic
Joshi, Manish; Monson, Thomas P; Woods, Gail L
2012-01-01
Interferon-gamma release assays including the QuantiFERON-TB Gold In-Tube test (QFT-GIT [Cellestis Ltd, Australia]) may be used in place of the tuberculin skin test (TST) in surveillance programs for Mycobacterium tuberculosis infection control. However, data on performance and practicality of the QFT-GIT in such programs for health care workers (HCWs) are limited. To assess the performance, practicality and reversion rate of the QFT-GIT among HCWs at a tertiary health care institution in the United States. Retrospective chart review of HCWs at Central Arkansas Veterans Healthcare System (Arkansas, USA) who underwent QFT-GIT testing as a part of their employee screening between November 1, 2008 and October 31, 2009. QFT-GIT was used to screen 3290 HCWs. The initial QFT-GIT was interpreted as positive for 129 (3.9%) HCWs, negative for 3155 (95.9%) and indeterminate for six (0.2%). Testing with QFT-GIT was repeated in 45 HCWs who had positive results on the initial test. The QFT-GIT reverted to negative in 18 (40.0%) HCWs, all of whom had negative TST status and initial interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL. The QFT-GIT test is feasible in large health care setting as an alternative to TST for M tuberculosis infection screening in HCWs but is not free from challenges. The major concerns are the high number of positive test results and high reversion rates on repeat testing, illustrating poor short-term reproducibility of positive QFT-GIT test results. These results suggest adopting a borderline zone between interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL, and cautious clinical interpretation of values in this range.
Durante, Marco; Formenti, Silvia C
2018-01-01
Radiation-induced chromosomal aberrations represent an early marker of late effects, including cell killing and transformation. The measurement of cytogenetic damage in tissues, generally in blood lymphocytes, from patients treated with radiotherapy has been studied for many years to predict individual sensitivity and late morbidity. Acentric fragments are lost during mitosis and create micronuclei (MN), which are well correlated to cell killing. Immunotherapy is rapidly becoming a most promising new strategy for metastatic tumors, and combination with radiotherapy is explored in several pre-clinical studies and clinical trials. Recent evidence has shown that the presence of cytosolic DNA activates immune response via the cyclic GMP-AMP synthase/stimulator of interferon genes pathway, which induces type I interferon transcription. Cytosolic DNA can be found after exposure to ionizing radiation either as MN or as small fragments leaking through nuclear envelope ruptures. The study of the dependence of cytosolic DNA and MN on dose and radiation quality can guide the optimal combination of radiotherapy and immunotherapy. The role of densely ionizing charged particles is under active investigation to define their impact on the activation of the interferon pathway.
Don, Elena; Farafonova, Olga; Pokhil, Suzanna; Barykina, Darya; Nikiforova, Marina; Shulga, Darya; Borshcheva, Alena; Tarasov, Sergey; Ermolaeva, Tatyana; Epstein, Oleg
2016-01-01
In preliminary ELISA studies where released-active forms (RAF) of antibodies (Abs) to interferon-gamma (IFNg) were added to the antigen-antibody system, a statistically significant difference in absorbance signals obtained in their presence in comparison to placebo was observed. A piezoelectric immunosensor assay was developed to support these data and investigate the effects of RAF Abs to IFNg on the specific interaction between Abs to IFNg and IFNg. The experimental conditions were designed and optimal electrode coating, detection circumstances and suitable chaotropic agents for electrode regeneration were selected. The developed technique was found to provide high repeatability, intermediate precision and specificity. The difference between the analytical signals of RAF Ab samples and those of the placebo was up to 50.8%, whereas the difference between non-specific controls and the placebo was within 5%–6%. Thus, the piezoelectric immunosensor as well as ELISA has the potential to be used for detecting the effects of RAF Abs to IFNg on the antigen-antibody interaction, which might be the result of RAF’s ability to modify the affinity of IFNg to specific/related Abs. PMID:26791304
Dinges, Martin M.; Schlievert, Patrick M.
2001-01-01
The superantigenic function of toxic shock syndrome toxin 1 (TSST-1) is generally regarded as an important determinant of its lethal effects in humans or experimental animals. This study examined the role of superantigenicity in a BALB/c mouse model of lethal TSST-1-induced hypersensitivity to lipopolysaccharide (LPS). In this model, TSST-1 greatly potentiated both LPS-induced lethality, as well as LPS-induced serum tumor necrosis factor alpha (TNF-α) activity. Although BALB/c-SCID mice were resistant to these LPS enhancement effects of TSST-1, BALB/c-SCID mice reconstituted with T cells were completely susceptible to the enhancement effect of TSST-1 on LPS-induced serum TNF-α. Mice pretreated with cyclosporine (Cs) or neutralizing antibodies against gamma interferon (IFN-γ) did not develop lethal LPS hypersensitivity when injected with TSST-1, and these agents reduced the enhancement effect of TSST-1 on LPS-induced serum TNF-α by 99 and 85%, respectively. Cs pretreatment also completely inhibited the known capacity of TSST-1 to amplify LPS-induced levels of IFN-γ in serum. In contrast, mice given Cs after a priming injection of TSST-1, but before LPS, still exhibited lethal hypersensitivity to LPS. Cs given after TSST-1 also did not inhibit enhancement of LPS-induced serum TNF-α by TSST-1 but inhibited the enhancement effect of TSST-1 on LPS-induced serum IFN-γ by 50%. These experiments support the theory that TSST-1-induced hypersensitivity to LPS is mediated primarily by IFN-γ derived from superantigen-activated T cells. PMID:11179286
[Interleukin 8 and interferon gamma in ocular toxoplasmosis].
Czepiel, Jacek; Biesiada, Grazyna; Sobczyk-Krupiarz, Iwona; Miklasszewska, Grazyna; Fedak, Danuta; Solnica, Bogdan; Mach, Tomasz; Garlicki, Aleksander
2011-01-01
Toxoplasmosis is one of the most common parasitic infections in the world, it is caused by Toxoplasma gondii. The infection is typically asymptomatic or the symptoms are very mild. Approximately 10% patients have limphadenopathy, involvement of the others organs, like eyes, nervous system, liver, heart, are observed more rarely. The aim of our study was to assess the level of selected cytokines in blood among patients with ocular toxoplasmosis. We have enrolled in the study 30 patients, 19-42 years old, treated for ocular toxoplasmosis, and 20 healthy volunteers, 20-48 years old, to the control group. Tests for blood morphology, C-reactive protein, the level of IL-8 and IFN-gamma were performed in all patients. The blood parameters in toxoplasmosis group were performed before antiparasitic treatment was given. The level of IFN-gamma in blood was lower among patients with ocular toxoplasmosis comparing with control group (1.52 vs. 4.18 pg/ml; p = 0.002). The level of IL-8 in blood was lower among patients with ocular toxoplasmosis comparing with control group (22.96 vs. 94.3 pg/ml; p = 0,007). There were no correlations between analyzed cytokines and blood morphology or CRP. The low level of IFN-gamma and IL-8 in blood is important factor leading to reactivation of the ocular toxoplasmosis.
Interferon-λ restricts West Nile virus neuroinvasion by tightening the blood-brain barrier.
Lazear, Helen M; Daniels, Brian P; Pinto, Amelia K; Huang, Albert C; Vick, Sarah C; Doyle, Sean E; Gale, Michael; Klein, Robyn S; Diamond, Michael S
2015-04-22
Although interferon-λ [also known as type III interferon or interleukin-28 (IL-28)/IL-29] restricts infection by several viruses, its inhibitory mechanism has remained uncertain. We used recombinant interferon-λ and mice lacking the interferon-λ receptor (IFNLR1) to evaluate the effect of interferon-λ on infection with West Nile virus, an encephalitic flavivirus. Cell culture studies in mouse keratinocytes and dendritic cells showed no direct antiviral effect of exogenous interferon-λ, even though expression of interferon-stimulated genes was induced. We observed no differences in West Nile virus burden between wild-type and Ifnlr1(-/-) mice in the draining lymph nodes, spleen, or blood. We detected increased West Nile virus infection in the brain and spinal cord of Ifnlr1(-/-) mice, yet this was not associated with a direct antiviral effect in mouse neurons. Instead, we observed an increase in blood-brain barrier permeability in Ifnlr1(-/-) mice. Treatment of mice with pegylated interferon-λ2 resulted in decreased blood-brain barrier permeability, reduced West Nile virus infection in the brain without affecting viremia, and improved survival against lethal virus challenge. An in vitro model of the blood-brain barrier showed that interferon-λ signaling in mouse brain microvascular endothelial cells increased transendothelial electrical resistance, decreased virus movement across the barrier, and modulated tight junction protein localization in a protein synthesis- and signal transducer and activator of transcription 1 (STAT1)-independent manner. Our data establish an indirect antiviral function of interferon-λ in which noncanonical signaling through IFNLR1 tightens the blood-brain barrier and restricts viral neuroinvasion and pathogenesis. Copyright © 2015, American Association for the Advancement of Science.
Odor-induced phosphorylation of olfactory cilia proteins.
Boekhoff, I; Schleicher, S; Strotmann, J; Breer, H
1992-01-01
Stimulation of isolated rat olfactory cilia in the presence of [gamma-32P]ATP leads to a significantly enhanced incorporation of [32P]phosphate. Depending on the type of odorants applied, the induced phosphorylation is completely blocked by specific inhibitors of either protein kinase A or protein kinase C. Time-course experiments indicate that the odor-induced modification of ciliary proteins is transient; the intensity of labeling decayed over time (1-10 sec). Separation of ciliary proteins by SDS/polyacrylamide gel electrophoresis followed by autoradiography demonstrated that upon stimulation with lilial, a single polypeptide (50,000 Da) was phosphorylated; the size of the modified protein is in line with the hypothesis that odorant receptors are phosphorylated subsequent to activation by specific odors. Images PMID:1334554
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Sang-pil; Ha, Jung Min; Yun, Sung Ji
2010-08-13
Research highlights: {yields} Elevated cAMP activates both PKA and Epac. {yields} PKA activates CREB transcriptional factor and Epac activates PI3K/Akt pathway via Rap1. {yields} Akt modulates PPAR-{gamma} transcriptional activity in concert with CREB. -- Abstract: Peroxisome proliferator-activated receptor-{gamma} (PPAR-{gamma}) is required for the conversion of pre-adipocytes. However, the mechanism underlying activation of PPAR-{gamma} is unclear. Here we showed that cAMP-induced activation of protein kinase A (PKA) and Akt is essential for the transcriptional activation of PPAR-{gamma}. Hormonal induction of adipogenesis was blocked by a phosphatidylinositol 3-kinase (PI3K) inhibitor (LY294002), by a protein kinase A (PKA) inhibitor (H89), and by amore » Rap1 inhibitor (GGTI-298). Transcriptional activity of PPAR-{gamma} was markedly enhanced by 3-isobutyl-1-methylxanthine (IBMX), but not insulin and dexamethasone. In addition, IBMX-induced PPAR-{gamma} transcriptional activity was blocked by PI3K/Akt, PKA, or Rap1 inhibitors. 8-(4-Chlorophenylthio)-2'-O-methyl-cAMP (8-pCPT-2'-O-Me-cAMP) which is a specific agonist for exchanger protein directly activated by cAMP (Epac) significantly induced the activation of Akt. Furthermore, knock-down of Akt1 markedly attenuated PPAR-{gamma} transcriptional activity. These results indicate that both PKA and Akt signaling pathways are required for transcriptional activation of PPAR-{gamma}, suggesting post-translational activation of PPAR-{gamma} might be critical step for adipogenic gene expression.« less
Paeonol attenuates TNBS-induced colitis by inhibiting NF-{kappa}B and STAT1 transactivation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ishiguro, Kazuhiro; Ando, Takafumi; Maeda, Osamu
2006-11-15
Paeonol, a major phenolic component of Moutan Cortex, is known to have anti-inflammatory activity. However, the effect of Paeonol on colitis has not been evaluated and the molecular mechanism of its anti-inflammatory action remains unknown. The aim of this study was to determine if Paeonol enema attenuates trinitrobenzene sulfonic acid (TNBS)-induced colitis in mice. We also investigated the effects of Paeonol in colon cancer-derived CW-2 cells and T cell leukemia-derived Jurkat cells treated with tumor necrosis factor {alpha} (TNF{alpha}) and/or interferon {gamma} (IFN{gamma}), which play critical roles in TNBS-induced colitis. Paeonol enema attenuated TNBS-induced colitis judging by body weigh reduction,more » colon length and histological score. Myeloperoxidase activity and inducible nitric oxide synthase (iNOS) production in the colon were also reduced with Paeonol enema. In CW-2 cells, Paeonol inhibited iNOS protein and mRNA expression induced by costimulation of TNF{alpha} and IFN{gamma}. Furthermore, Paeonol reduced TNF{alpha}-induced NF-{kappa}B transactivation and IFN{gamma}-induced STAT1 transactivation in CW-2 cells and also in Jurkat cells. These findings suggest that Paeonol enema may be useful for the treatment of colitis.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Preble, O.T.; Rothko, K.; Klippel, J.H.
1983-06-01
The interferon (IFN)-induced enzyme 2-5A synthetase was elevated in mononuclear cells from both serum IFN-positive and -negative systemic lupus erythematosus (SLE) patients. This suggests that a much higher percentage of patients than previously thought produce endogenous IFN. These results may partly explain findings that mononuclear cells from SLE patients are deficient in IFN production in vitro in response to certain IFN inducers. Although normal lymphocytes can produce an acid-labile alpha IFN after stimulation with C. parvum in vitro, the reason for endogenous production of this unusual alpha IFN by SLE patients remains unknown.
Blank, V C; Bertucci, L; Furmento, V A; Peña, C; Marino, V J; Roguin, L P
2013-06-10
We have previously demonstrated that tyrosine phosphorylation of STAT1/3 and p38 mitogen-activated protein kinase (p38 MAPK) activation are involved in the apoptotic response triggered by a chimeric cyclic peptide of the interferon-α2b (IFN-α2b) in WISH cells. Since the peptide also induced serine phosphorylation of STAT proteins, in the present study we examined the kinase involved in serine STAT1 phosphorylation and the signaling effectors acting upstream such activation. We first found that p38 MAPK is involved in serine STAT1 phosphorylation, since a reduction of phophoserine-STAT1 levels was evident after incubating WISH cells with cyclic peptide in the presence of a p38 pharmacological inhibitor or a dominant-negative p38 mutant. Next, we demonstrated that the peptide induced activation of protein kinase Cδ (PKCδ). Based on this finding, the role of this kinase was then evaluated. After incubating WISH cells with a PKCδ inhibitor or after decreasing PKCδ expression levels by RNA interference, both peptide-induced serine STAT1 and p38 phosphorylation levels were significantly decreased, indicating that PKCδ functions as an upstream regulator of p38. We also showed that PKCδ and p38 activation stimulated by the peptide was inhibited by a specific pharmacological inhibitor of phosphatidylinositol 3-kinase (PI3K) or by a dominant-negative p85 PI3K-regulatory subunit, suggesting that PI3K is upstream in the signaling cascade. In addition, the role of PI3K and PKCδ in cyclic peptide-induced apoptosis was examined. Both signaling effectors were found to regulate the antiproliferative activity and the apoptotic response triggered by the cyclic peptide in WISH cells. In conclusion, we herein demonstrated that STAT1 serine phosphorylation is mediated by the sequential activation of PI3K, PKCδ and p38 MAPK. This signaling cascade contributes to the antitumor effect induced by the chimeric IFN-α2b cyclic peptide in WISH cells. Copyright © 2013 Elsevier Inc
Fink, Annette; Lemmermann, Niels A W; Gillert-Marien, Dorothea; Thomas, Doris; Freitag, Kirsten; Böhm, Verena; Wilhelmi, Vanessa; Reifenberg, Kurt; Reddehase, Matthias J; Holtappels, Rafaela
2012-11-01
Cytomegalovirus (CMV) disease with multiple organ manifestations is the most feared viral complication limiting the success of hematopoietic cell transplantation as a therapy of hematopoietic malignancies. A timely endogenous reconstitution of CD8 T cells controls CMV infection, and adoptive transfer of antiviral CD8 T cells is a therapeutic option to prevent CMV disease by bridging the gap between an early CMV reactivation and delayed endogenous reconstitution of protective immunity. Preclinical research in murine models has provided 'proof of concept' for CD8 T-cell therapy of CMV disease. Protection by CD8 T cells appears to be in conflict with the finding that CMVs encode proteins that inhibit antigen presentation to CD8 T cells by interfering with the constitutive trafficking of peptide-loaded MHC class I molecules (pMHC-I complexes) to the cell surface. Here, we have systematically explored antigen presentation in the presence of the three currently noted immune evasion proteins of murine CMV in all possible combinations and its modulation by pre-treatment of cells with interferon-gamma (IFN-γ). The data reveal improvement in antigen processing by pre-treatment with IFN-γ can almost overrule the inhibitory function of immune evasion molecules in terms of pMHC-I expression levels capable of triggering most of the specific CD8 T cells, though the intensity of stimulation did not retrieve their full functional capacity. Notably, an in vivo conditioning of host tissue cells with IFN-γ in adoptive cell transfer recipients constitutively overexpressing IFN-γ (B6-SAP-IFN-γ mice) enhanced the antiviral efficiency of CD8 T cells in this transgenic cytoimmunotherapy model.
Dunn, John R; Kaneene, John B; Grooms, Daniel L; Bolin, Steven R; Bolin, Carole A; Bruning-Fann, Colleen S
2005-02-01
To determine whether cattle testing positive for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA were more likely to have false-positive responses on the caudal fold tuberculin (CFT) test or interferon-gamma (IFN-gamma) assay for Mycobacterium bovis than cattle testing negative for M paratuberculosis. 1043 cattle from 10 herds in Michigan. Feces and blood samples for plasma were collected from cattle > or =24 months old on the day the CFT test was read. Fecal samples were submitted for microbial culture for M paratuberculosis. Plasma samples were tested for antibody against M paratuberculosis, and IFN-gamma after stimulation with purified protein derivative tuberculin from M bovis or M avium. Of 1043 cattle, 180 (17.3%) had positive CFT test results (suspects) and 8 (0.8%) had positive IFN-gamma assay results after stimulation with purified protein derivative tuberculin from M bovis. Forty-five (4.3%) and 115 (11.0%) cattle tested positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA, respectively. Cattle with positive responses for M paratuberculosis appeared to have an increased likelihood of false-positive results on the CFT test, although this association was not significant. No significant association was detected among cattle testing positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA and positive CFT test and IFN-gamma assay results for M bovis.
Regulation of CD93 cell surface expression by protein kinase C isoenzymes.
Ikewaki, Nobunao; Kulski, Jerzy K; Inoko, Hidetoshi
2006-01-01
Human CD93, also known as complement protein 1, q subcomponent, receptor (C1qRp), is selectively expressed by cells with a myeloid lineage, endothelial cells, platelets, and microglia and was originally reported to be involved in the complement protein 1, q subcomponent (C1q)-mediated enhancement of phagocytosis. The intracellular molecular events responsible for the regulation of its expression on the cell surface, however, have not been determined. In this study, the effect of protein kinases in the regulation of CD93 expression on the cell surface of a human monocyte-like cell line (U937), a human NK-like cell line (KHYG-1), and a human umbilical vein endothelial cell line (HUV-EC-C) was investigated using four types of protein kinase inhibitors, the classical protein kinase C (cPKC) inhibitor Go6976, the novel PKC (nPKC) inhibitor Rottlerin, the protein kinase A (PKA) inhibitor H-89 and the protein tyrosine kinase (PTK) inhibitor herbimycin A at their optimum concentrations for 24 hr. CD93 expression was analyzed using flow cytometry and glutaraldehyde-fixed cellular enzyme-linked immunoassay (EIA) techniques utilizing a CD93 monoclonal antibody (mAb), mNI-11, that was originally established in our laboratory as a CD93 detection probe. The nPKC inhibitor Rottlerin strongly down-regulated CD93 expression on the U937 cells in a dose-dependent manner, whereas the other inhibitors had little or no effect. CD93 expression was down-regulated by Go6976, but not by Rottlerin, in the KHYG-1 cells and by both Rottlerin and Go6976 in the HUV-EC-C cells. The PKC stimulator, phorbol myristate acetate (PMA), strongly up-regulated CD93 expression on the cell surface of all three cell-lines and induced interleukin-8 (IL-8) production by the U937 cells and interferon-gamma (IFN-gamma) production by the KHYG-1 cells. In addition, both Go6976 and Rottlerin inhibited the up-regulation of CD93 expression induced by PMA and IL-8 or IFN-gamma production in the respective cell
[Gamma interferon: basics aspects, clinic significance and terapeutic uses].
Mata-Espinosa, Dulce A; Hernández-Pando, Rogelio
2008-01-01
Interferons are a family of pleiotropic cytokines, their name was assigned because of their anti-replicative viral activity. IFNgamma or immune type II interferon does not share receptors with the type I interferon, its structure is different and its gene is located in different chromosome, although its biologic effects are similar. Along of several years of research, it has been found that IFNgamma enhances the transcription of genes involved in immunomodulation, antiviral responses and antitumoral activities. Regarding to the immune system, IFNgamma increases the cytotoxic and phagocytic activity of macrophages and upregulates the expression of major histocompatibility complex (MHC) class I and class II molecules in dendritics cells and other antigen presenting cells. IFNgamma also promotes the development and differentiation of naive CD4+ T lymphocytes to Th1 helper subset. Indeed, this cytokine has a key role in the control of bacterial, micotic, viral and parasitic infections. Depending of the micro-environment, IFNgamma has a dual role as pro or anti inflammatory cytokine. Novel therapeutic strategies are currently being developed with the aim to enhance the immune response or replace IFNgamma gene abnormal expression with beneficial results in humans, being recombinant IFNgamma safe and well tolerated.
Kanno, Jun; Aisaki, Ken-ichi; Igarashi, Katsuhide; Kitajima, Satoshi; Matsuda, Nae; Morita, Koichi; Tsuji, Masaki; Moriyama, Noriko; Furukawa, Yusuke; Otsuka, Maki; Tachihara, Erika; Nakatsu, Noriyuki; Kodama, Yukio
2013-01-01
Pentachlorophenol (PCP) was monitored for transcriptome responses in adult mouse liver at 2, 4, 8 and 24 hr after a single oral administration at four dose levels, 0, 10, 30 and 100 mg/kg. The expression data obtained using Affymetrix GeneChip MOE430 2.0 were absolutized by the Percellome method and expressed as three dimensional (3D) surface graphs with axes of time, dose and copy numbers of mRNA per cell. We developed the programs RSort, for comprehensive screening of the 3D surface data and PercellomeExploror for cross-referencing and confirmed the significant responses by visual inspection. In the first 8 hr, approximately 100 probe sets (PSs) related to PXR/SXR and Cyp2a4 and other metabolic enzymes were induced whereas Fos and JunB were suppressed. At 24 hr, about 1,200 PSs were strongly induced. We cross-referenced the Percellome database consisting of 111 chemicals on the liver transcriptome and found that about half of the PSs belonged to the metabolic pathways including Nrf2-mediated oxidative stress response networks shared with some of the 111 chemicals. The other half of the induced genes were interferon signaling network genes (ISG) and their induction was unique to PCP. Toll like receptors and other pattern recognition receptors, interferon regulatory factors and interferon alpha itself were included but inflammatory cytokines were not induced. In summary, these data indicated that functional symptoms of PCP treatment, such as hyperthermia and profuse sweating might be mediated by the ISG rather than the previously documented mitochondrial uncoupling mechanism. PCP might become a hint for developing low molecular weight orally available interferon mimetic drugs following imiquimod and RO4948191 as agonists of toll-like receptor and interferon receptor.
Shen, Miaoqing; Bunaciu, Rodica P; Congleton, Johanna; Jensen, Holly A; Sayam, Lavanya G; Varner, Jeffrey D; Yen, Andrew
2011-12-01
All-trans retinoic acid (RA) and interferons (IFNs) have efficacy in treating certain leukemias and lymphomas, respectively, motivating interest in their mechanism of action to improve therapy. Both RA and IFNs induce interferon regulatory factor-1 (IRF-1). We find that in HL-60 myeloblastic leukemia cells which undergo mitogen activated protien kinase (MAPK)-dependent myeloid differentiation in response to RA, IRF-1 propels differentiation. RA induces MAPK-dependent expression of IRF-1. IRF-1 binds c-Cbl, a MAPK related adaptor. Ectopic IRF-1 expression causes CD38 expression and activation of the Raf/MEK/ERK axis, and enhances RA-induced differentiation by augmenting CD38, CD11b, respiratory burst and G0 arrest. Ectopic IRF-1 expression also decreases the activity of aldehyde dehydrogenase 1, a stem cell marker, and enhances RA-induced ALDH1 down-regulation. Interestingly, expression of aryl hydrocarbon receptor (AhR), which is RA-induced and known to down-regulate Oct4 and drive RA-induced differentiation, also enhances IRF-1 expression. The data are consistent with a model whereby IRF-1 acts downstream of RA and AhR to enhance Raf/MEK/ERK activation and propel differentiation.
Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.
2001-01-01
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leung, Daisy W.; Borek, Dominika; Farahbakhsh, Mina
2010-06-21
VP35 is one of seven structural proteins encoded by the Ebola viral genome and mediates viral replication, nucleocapsid formation and host immune suppression. The C-terminal interferon inhibitory domain (IID) of VP35 is critical for dsRNA binding and interferon inhibition. The wild-type VP35 IID structure revealed several conserved residues that are important for dsRNA binding and interferon antagonism. Here, the expression, purification and crystallization of recombinant Zaire Ebola VP35 IID mutants R312A, K319A/R322A and K339A in space groups P6{sub 1}22, P2{sub 1}2{sub 1}2{sub 1} and P2{sub 1}, respectively, are described. Diffraction data were collected using synchrotron sources at the Advanced Lightmore » Source and the Advanced Photon Source.« less
Stevenson, Heather L; Estes, Mark D; Thirumalapura, Nagaraja R; Walker, David H; Ismail, Nahed
2010-08-01
Human monocytotropic ehrlichiosis is caused by Ehrlichia chaffeensis, a Gram-negative bacterium lacking lipopolysaccharide. We have shown that fatal murine ehrlichiosis is associated with CD8(+)T cell-mediated tissue damage, tumor necrosis factor-alpha, and interleukin (IL)-10 overproduction, and CD4(+)Th1 hyporesponsiveness. In this study, we examined the relative contributions of natural killer (NK) and NKT cells in Ehrlichia-induced toxic shock. Lethal ehrlichial infection in wild-type mice induced a decline in NKT cell numbers, and late expansion and migration of activated NK cells to the liver, a main infection site that coincided with development of hepatic injury. The spatial and temporal changes in NK and NKT cells in lethally infected mice correlated with higher NK cell cytotoxic activity, higher expression of cytotoxic molecules such as granzyme B, higher production of interferon-gamma and tumor necrosis factor-alpha, increased hepatic infiltration with CD8alphaCD11c(+) dendritic cells and CD8(+)T cells, decreased splenic CD4(+)T cells, increased serum concentrations of IL-12p40, IL-18, RANTES, and monocyte chemotactic protein-1, and elevated production of IL-18 by liver mononuclear cells compared with nonlethally infected mice. Depletion of NK cells prevented development of severe liver injury, decreased serum levels of interferon-gamma, tumor necrosis factor-alpha, and IL-10, and enhanced bacterial elimination. These data indicate that NK cells promote immunopathology and defective anti-ehrlichial immunity, possibly via decreasing the protective immune response mediated by interferon-gamma producing CD4(+)Th1 and NKT cells.
The effect of gamma irradiation on rice protein aqueous solution
NASA Astrophysics Data System (ADS)
Baccaro, Stefania; Bal, Oya; Cemmi, Alessia; Di Sarcina, Ilaria
2018-05-01
The use of proteins as natural biopolymers are sensibly increasing in several application fields such as food industry, packaging and environment protection. In particular, rice proteins (RP) present good nutritional, hypoallergenic and healthful properties very interesting for human consumption. Since ionizing radiation can be successfully applied on protein containing systems involved in different industrial processes, this work aims to determine the effect of gamma radiation on 5 wt%-7.5 wt% RP aqueous solutions in a wide range of absorbed doses up to around 40 kGy. The changes of RP secondary and tertiary structures and their chemical composition were followed by UV-VIS absorbance spectroscopy, luminescence analysis and pH measurements. The experimental data showed the occurrence of the unfolding of RP chains with the increase of the absorbed dose and the formation of new molecules, due to the reaction among tryptophane and tyrosine amino acids and the radical species induced by gamma radiation. The results are also confirmed by the modification of the pH values measured for the irradiated solutions.
Gurung, Ratna B; Begg, Douglas J; Purdie, Auriol C; de Silva, Kumudika; Bannantine, John P; Whittington, Richard J
2014-06-01
Johne's disease in ruminants is a chronic infection of the intestines caused by Mycobacterium avium subsp. paratuberculosis. An important strategy to control disease is early detection, and a potentially efficient method for early detection is measurement of cell-mediated immune responses developed by the host in response to exposure or infection. One method is to measure lymphoproliferation and cytokine release from the host cells when exposed to the organism or parts of the organism. In this study, 10 recombinant M. avium subsp. paratuberculosis proteins known to be upregulated under in vitro stress conditions were evaluated by examining their ability to evoke memory as a result of exposure by vaccination or oral challenge with live Mycobacterium avium subsp. paratuberculosis. Out of 10 proteins, MAP2698c was found to induce higher cell-mediated immune responses in vaccinated and challenged sheep in comparison to healthy controls. The findings suggest that not all stress-regulated proteins have the diagnostic potential to detect cell-mediated immune responses in ovine paratuberculosis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Gurung, Ratna B.; Begg, Douglas J.; Purdie, Auriol C.; de Silva, Kumudika; Bannantine, John P.
2014-01-01
Johne's disease in ruminants is a chronic infection of the intestines caused by Mycobacterium avium subsp. paratuberculosis. An important strategy to control disease is early detection, and a potentially efficient method for early detection is measurement of cell-mediated immune responses developed by the host in response to exposure or infection. One method is to measure lymphoproliferation and cytokine release from the host cells when exposed to the organism or parts of the organism. In this study, 10 recombinant M. avium subsp. paratuberculosis proteins known to be upregulated under in vitro stress conditions were evaluated by examining their ability to evoke memory as a result of exposure by vaccination or oral challenge with live Mycobacterium avium subsp. paratuberculosis. Out of 10 proteins, MAP2698c was found to induce higher cell-mediated immune responses in vaccinated and challenged sheep in comparison to healthy controls. The findings suggest that not all stress-regulated proteins have the diagnostic potential to detect cell-mediated immune responses in ovine paratuberculosis. PMID:24695774
Pae, H O; Seo, W G; Oh, G S; Kim, N Y; Kim, Y M; Kwon, T O; Shin, M K; Chai, K Y; Chung, H T
2001-02-01
We have examined the effect of the aqueous extract of Rhodiola sachalinensis root (RSE), a traditional herbal medicine, on nitric oxide (NO) synthesis in murine fetal hepatocytes (BNL CL.2) by measuring the stable end-product nitrite and the mRNA of inducible NO synthase (iNOS). Interferon-gamma (IFN-gamma) by itself failed to induce NO synthesis in BNL CL.2 cells. RSE also did not elicit NO synthesis at concentrations up to 1,000 microg/ml, but dose- and time-dependently induced NO synthesis in the presence of IFN-gamma in BNL CL.2 cells. Whereas RSE or IFN-gamma failed to induce detectable levels of iNOS mRNA, a combination of RSE and IFN-gamma markedly induced iNOS mRNA in BNL CL.2 cells. Thus, we found that RSE triggered IFN-gamma-primed BNL CL.2 cells to synthesize NO by inducing iNOS gene expression. The capability of RSE to induce NO synthesis might be related to the therapeutic efficacy of RSE on the liver diseases.
Sun, Jinhua; Chen, Yinglin; Qin, Feiyue; Guan, Xueting; Xu, Wei; Xu, Liangmei
2017-06-01
Interferons have attracted considerable attention due to their vital roles in the host immune response and low induction of antibiotic resistance. In this study, total RNA was extracted from spleen cells of chicken embryos inoculated with Newcastle disease vaccine, and the full-length chicken interferon-γ (ChIFN-γ) gene was amplified by RT-PCR. The full complementary DNA sequence of the ChIFN-γ gene was 495 bp long and was cloned into the prokaryotic expression vector pProEX™HT b . The plasmid was transformed into Escherichia coli DH5α and the expression of ChIFN-γ was induced by isopropyl β-D-1-thiogalactopyranoside. Sodium dodecyl sulfate - polyacrylamide gel electrophoresis and Western blot results showed the expressed fusion protein had a molecular weight of approximately 18 kDa and was recognized by an anti-His mAb. Moreover, ChIFN-γ was found to demonstrate anti-viral activity in vitro. To test the in vivo function of ChIFN-γ in broilers under heat stress, a total of 100 broilers were randomly assigned to either a control group or a treated group, in which they were hypodermically injected with recombinant ChIFN-γ. Results demonstrated ChIFN-γ affects the messenger RNA expression levels of heat shock protein 70 (HSP70) in the heart and lung tissues, and decreases the concentration of HSP70 in serum. Therefore, we conclude recombinant ChIFN-γ can reduce heat stress to some extent in vivo. © 2016 Japanese Society of Animal Science.
Cappelli, G; Volpe, P; Sanduzzi, A; Sacchi, A; Colizzi, V; Mariani, F
2001-12-01
Mycobacterium tuberculosis is an intracellular pathogen that readily survives and replicates in human macrophages (MPhi). Host cells have developed different mycobactericidal mechanisms, including the production of inflammatory cytokines. The aim of this study was to compare the MPhi response, in terms of cytokine gene expression, to infection with the M. tuberculosis laboratory strain H37Rv and the clinical M. tuberculosis isolate CMT97. Both strains induce the production of interleukin-12 (IL-12) and IL-16 at comparable levels. However, the clinical isolate induces a significantly higher and more prolonged MPhi activation, as shown by reverse transcription-PCR analysis of IL-1beta, IL-6, IL-10, transforming growth factor beta, tumor necrosis factor alpha, and gamma interferon (IFN-gamma) transcripts. Interestingly, when IFN-gamma transcription is high, the number of M. tuberculosis genes expressed decreases and vice versa, whereas no mycobactericidal effect was observed in terms of bacterial growth. Expression of 11 genes was also studied in the two M. tuberculosis strains by infecting resting or activated MPhi and compared to bacterial intracellular survival. In both cases, a peculiar inverse correlation between expression of these genes and multiplication was observed. The number and type of genes expressed by the two strains differed significantly.
Swedan, Samer; Musiyenko, Alla; Barik, Sailen
2009-10-01
Viruses of the Paramyxoviridae family, such as the respiratory syncytial virus (RSV), suppress cellular innate immunity represented by type I interferon (IFN) for optimal growth in their hosts. The two unique nonstructural (NS) proteins, NS1 and NS2, of RSV suppress IFN synthesis, as well as IFN function, but their exact targets are still uncharacterized. Here, we investigate if either or both of the NS proteins affect the steady-state levels of key members of the IFN pathway. We found that both NS1 and NS2 decreased the levels of TRAF3, a strategic integrator of multiple IFN-inducing signals, although NS1 was more efficient. Only NS1 reduced IKKepsilon, a key protein kinase that specifically phosphorylates and activates IFN regulatory factor 3. Loss of the TRAF3 and IKKepsilon proteins appeared to involve a nonproteasomal mechanism. Interestingly, NS2 modestly increased IKKepsilon levels. In the IFN response pathway, NS2 decreased the levels of STAT2, the essential transcription factor for IFN-inducible antiviral genes. Preliminary mapping revealed that the C-terminal 10 residues of NS1 were essential for reducing IKKepsilon levels and the C-terminal 10 residues of NS2 were essential for increasing and reducing IKKepsilon and STAT2, respectively. In contrast, deletion of up to 20 residues of the C termini of NS1 and NS2 did not diminish their TRAF3-reducing activity. Coimmunoprecipitation studies revealed that NS1 and NS2 form a heterodimer. Clearly, the NS proteins of RSV, working individually and together, regulate key signaling molecules of both the IFN activation and response pathways.
Gounder, Anshu P; Yokoyama, Christine C; Jarjour, Nicholas N; Bricker, Traci L; Edelson, Brian T; Boon, Adrianus C M
2018-04-01
Pro-inflammatory cytokinemia is a hallmark of highly pathogenic H5N1 influenza virus (IAV) disease yet little is known about the role of host proteins in modulating a pathogenic innate immune response. The host Interferon Induced Protein 35 (Ifi35) has been implicated in increased susceptibility to H5N1-IAV infection. Here, we show that Ifi35 deficiency leads to reduced morbidity in mouse models of highly pathogenic H5N1- and pandemic H1N1-IAV infection. Reduced weight loss in Ifi35-/- mice following H5N1-IAV challenge was associated with reduced cellular infiltration and decreased production of specific cytokines and chemokines including IL-12p40. Expression of Ifi35 by the hematopoietic cell compartment in bone-marrow chimeric mice contributed to increased immune cell recruitment and IL-12p40 production. In addition, Ifi35 deficient primary macrophages produce less IL-12p40 following TLR-3, TLR-4, and TLR-7 stimulation in vitro. Decreased levels of IL-12p40 and its homodimer, IL-12p80, were found in bronchoalveolar lavage fluid of H5N1-IAV infected Ifi35 deficient mice. Specific antibody blockade of IL-12p80 ameliorated weight loss and reduced cellular infiltration following H5N1-IAV infection in wild-type mice; suggesting that increased levels of IL-12p80 alters the immune response to promote inflammation and IAV disease. These data establish a role for Ifi35 in modulating cytokine production and exacerbating inflammation during IAV infection.
Select nutrients, progesterone, and interferon tau affect conceptus metabolism and development
Bazer, Fuller W; Kim, Jingyoung; Song, Gwonhwa; Ka, Hakhyun; Tekwe, Carmen D; Wu, Guoyao
2012-01-01
Interferon tau (IFNT), a novel multifunctional type I interferon secreted by trophectoderm, is the pregnancy recognition signal in ruminants that also has antiviral, antiproliferative, and immunomodulatory bioactivities. IFNT, with progesterone, affects availability of the metabolic substrate in the uterine lumen by inducing expression of genes for transport of select nutrients into the uterine lumen that activate mammalian target of rapamycin (mTOR) cell signaling responsible for proliferation, migration, and protein synthesis by conceptus trophectoderm. As an immunomodulatory protein, IFNT induces an anti-inflammatory state affecting metabolic events that decrease adiposity and glutamine:fructose-6-phosphate amidotransferase 1 activity, while increasing insulin sensitivity, nitric oxide production by endothelial cells, and brown adipose tissue in rats. This short review focuses on effects of IFNT and progesterone affecting transport of select nutrients into the uterine lumen to stimulate mTOR cell signaling required for conceptus development, as well as effects of IFNT on the immune system and adiposity in rats with respect to its potential therapeutic value in reducing obesity. PMID:23050969
Sun, Haiyan; Pattnaik, Asit K; Osorio, Fernando A; Vu, Hiep L X
2016-12-01
We recently generated a fully synthetic porcine reproductive and respiratory syndrome virus strain (designated as PRRSV-CON), which confers unprecedented levels of heterologous protection. We report herein that the synthetic PRRSV-CON possesses a unique phenotype in that it induces type-I interferons (IFNs) instead of suppressing these cytokines as most of the naturally occurring PRRSV isolates do. Through gain- and loss- of-function studies, the IFN-inducing phenotype of PRRSV-CON was mapped to the 3.3kb genomic fragment encoding three viral nonstructural proteins: nsp1α, nsp1β and the N-terminal part of nsp2. Further studies indicated that a cooperation among these 3 proteins was required for effective induction of IFNs. Collectively, this study constitutes the first step toward understanding the mechanisms by which the synthetic PRRSV-CON confers heterologous protection. Copyright © 2016 Elsevier Inc. All rights reserved.
ATL response to arsenic/interferon therapy is triggered by SUMO/PML/RNF4-dependent Tax degradation.
Dassouki, Zeina; Sahin, Umut; El Hajj, Hiba; Jollivet, Florence; Kfoury, Youmna; Lallemand-Breitenbach, Valérie; Hermine, Olivier; de Thé, Hugues; Bazarbachi, Ali
2015-01-15
The human T-cell lymphotropic virus type I (HTLV-1) Tax transactivator initiates transformation in adult T-cell leukemia/lymphoma (ATL), a highly aggressive chemotherapy-resistant malignancy. The arsenic/interferon combination, which triggers degradation of the Tax oncoprotein, selectively induces apoptosis of ATL cell lines and has significant clinical activity in Tax-driven murine ATL or human patients. However, the role of Tax loss in ATL response is disputed, and the molecular mechanisms driving degradation remain elusive. Here we demonstrate that ATL-derived or HTLV-1-transformed cells are dependent on continuous Tax expression, suggesting that Tax degradation underlies clinical responses to the arsenic/interferon combination. The latter enforces promyelocytic leukemia protein (PML) nuclear body (NB) formation and partner protein recruitment. In arsenic/interferon-treated HTLV-1 transformed or ATL cells, Tax is recruited onto NBs and undergoes PML-dependent hyper-sumoylation by small ubiquitin-like modifier (SUMO)2/3 but not SUMO1, ubiquitination by RNF4, and proteasome-dependent degradation. Thus, the arsenic/interferon combination clears ATL through degradation of its Tax driver, and this regimen could have broader therapeutic value by promoting degradation of other pathogenic sumoylated proteins. © 2015 by The American Society of Hematology.
Reduction of antigenic protein levels in latex gloves after gamma irradiation.
Zehr, B D; Gromelski, S; Beezhold, D
1994-01-01
Gamma irradiation is currently the method most commonly used to sterilize surgical gloves. In this study, the effect of gamma irradiation on antigenic proteins in latex gloves was examined. Protein extraction and quantitation were carried out using latex gloves before and after sterilization. Antigenic protein levels were determined by an ELISA assay specific for latex proteins (LEAP). LEAP analysis revealed a significant decrease after gamma-irradiation sterilization. This observation may partially explain the lower levels of extractable antigenic proteins found in sterile surgical gloves compared with nonsterile examination gloves. However, gamma irradiation was less effective than autoclave sterilization in reducing protein levels.
[The expression of interferon-lambda1 in CHO cell].
Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu
2013-06-01
To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.
Toki, S; Hiromatsu, K; Aoki, Y; Makino, M; Yoshikai, Y
1997-10-01
Mice with retrovirus-induced murine acquired immunodeficiency syndrome (MAIDS) were hypersensitive to lipopolysaccharide (LPS)-induced lethal shock accompanied by marked elevations of systematic interleukin 1beta (IL-beta) and interferon gamma (IFN-gamma) after LPS challenge. Pretreatment with 10 microg of recombinant human granulocyte colony-stimulating factor (rhG-CSF) protected MAIDS mice from hypersensitivity to LPS-induced lethal shock and this protection was concomitant with suppression of IFN-gamma production. Copyright 1997 Academic Press Limited.
[Allergic asthma and interleukins 2, 4, 5, 6 and 12 and gamma interferon levels].
Bastida Segura, Diana Lyzbeth; López Velásquez, Benjamin; Castrejón Vázquez, María Isabel; Galicia Tapía, Jorge; Cano Altamirano, Silvia; Miranda Feria, Alfonso Javier
2004-01-01
Asthma is an inflammatory chronic illness, in which mastocyt cells, basophils, T lymphocytes, eosinophils and cytokines play a role. Its association with the production of TH2 cytokines is not well known, but it is considered an aberrant immune response, yielding the activation and recruitment of a number of effector cells (mastocyts/eosinophils) and the appearance of clinical symptoms. To determine the serum values of the interleukins 2, 4, 5, 6 and 12 and gamma interferon in relation to the severity degree of asthma and the time of immunotherapy in patients with stable chronic allergic bronchial asthma. Clinical records of allergic asthmatic patients from the external consultation at Servicio de Alergia e Immunología Clínica were reviewed in a period of 12 months (1st January 2002 to 1st January 2003) and those of healthy volunteers, forming three groups: Group 1, allergic asthmatics with immunotherapy less than 24 months; Group 2, allergic asthmatics with more than 24 months of immunotherapy, and Group 3, healthy volunteers (control group). Previous informed consent, a serum sample was taken of all subjects. Ninety-two subjects were included: 41 (45%) allergic asthmatics and 51 (55%) healthy volunteers. Significant differences were found in interleukins 2, 4, 5, 6 and 12 levels between healthy volunteers and asthmatics without relating the immunotherapy time. In the total group gamma interferon levels were not found. A relation of interleukins Th2 levels with the severity degree of asthma was not found. Differences of serum interleukins Th1 and Th2 in allergic patients related to immunotherapy time were not significant; even though, irrespective of immunotherapy time, IgG levels were always high. Patients with allergic asthma have a predominance of serum interleukins Th2 and, despite of the immunotherapy, in the maintaining phase, these continue high, which may be due to an immune system dysregulation maybe including other factors. Immunotherapy continues
Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K
2011-11-01
Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.
Werner-Felmayer, G; Baier-Bitterlich, G; Fuchs, D; Hausen, A; Murr, C; Reibnegger, G; Werner, E R; Wachter, H
1995-01-01
In a number of mammalian cell types, pteridine biosynthesis from guanosine 5'-triphosphate and formation of nitric oxide from L-arginine are induced by gamma interferon (IFN-gamma) and bacterial lipopolysaccharide (LPS). We assessed the possibility of using such metabolic alterations for the in vitro detection of pyrogens. Products from gram-negative and gram-positive bacteria and related synthetic compounds were tested for their potential to induce either of these pathways. Stimulation of pteridine biosynthesis was monitored as the formation of neopterin in the human myelomonocytic cell line THP-1. The formation of nitric oxide was determined as nitrite in murine J774A.1 macrophage cultures. The substances tested included toxic and detoxified parts of LPS and lipid A from Escherichia coli, Salmonella typhimurium, Salmonella minnesota, and Klebsiella pneumoniae as well as lipoteichoic acid and toxic shock syndrome toxin 1 from Staphylococcus aureus. Furthermore, two cell wall compounds from Mycobacterium tuberculosis, trehalose 6,6'-dimycolate and N-acetylmuramyl-L-alanyl-D-isoglutamine, which are active components of Freund's adjuvant, were used. When applied as a single stimulus, only the whole LPS molecule potently stimulated neopterin or nitrite formation. Lipid A and products from gram-positive bacteria were weakly active. For neopterin formation, lipid A required the presence of fetal calf serum. Besides detoxified LPS and independently from the presence of serum, all bacterial compounds tested strongly increased the effects mediated by IFN-gamma. Our results show that bacterial pyrogens can be detected by monitoring the formation of neopterin or nitrite. This may provide a basis for the development of an in vitro assay for the detection of pyrogenic contamination with the aim of replacing the currently used animal test. PMID:7664177
Perot, Brieuc P; Boussier, Jeremy; Yatim, Nader; Rossman, Jeremy S; Ingersoll, Molly A; Albert, Matthew L
2018-05-10
Influenza A virus (IAV) infection perturbs metabolic pathways such as autophagy, a stress-induced catabolic pathway that crosstalks with cellular inflammatory responses. However, the impact of autophagy perturbation on IAV gene expression or host cell responses remains disputed. Discrepant results may be a reflection of in vivo studies using cell-specific autophagy-related (Atg) gene-deficient mouse strains, which do not delineate modification of developmental programmes from more proximal effects on inflammatory response. In vitro experiments can be confounded by gene expression divergence in wild-type cultivated cell lines, as compared to those experiencing long-term absence of autophagy. With the goal to investigate cellular processes within cells that are competent or incompetent for autophagy, we generated a novel experimental cell line in which autophagy can be restored by ATG5 protein stabilization in an otherwise Atg5-deficient background. We confirmed that IAV induced autophagosome formation and p62 accumulation in infected cells and demonstrated that perturbation of autophagy did not impact viral infection or replication in ATG5-stablized cells. Notably, the induction of interferon-stimulated genes (ISGs) by IAV was diminished when cells were autophagy competent. We further demonstrated that, in the absence of ATG5, IAV-induced interferon-β (IFN-β) expression was increased as compared to levels in autophagy-competent lines, a mechanism that was independent of IAV non-structural protein 1. In sum, we report that induction of autophagy by IAV infection reduces ISG expression in infected cells by limiting IFN-β expression, which may benefit viral replication and spread.
Limitations of Using IL-17A and IFN-γ-Induced Protein 10 to Detect Bovine Tuberculosis
Xin, Ting; Gao, Xintao; Yang, Hongjun; Li, Pingjun; Liang, Qianqian; Hou, Shaohua; Sui, Xiukun; Guo, Xiaoyu; Yuan, Weifeng; Zhu, Hongfei; Ding, Jiabo; Jia, Hong
2018-01-01
Bovine tuberculosis (bTB) is primarily caused by infection with Mycobacterium bovis, which belongs to the Mycobacterium tuberculosis complex. The airborne route is considered the most common for transmission of M. bovis, and more than 15% of cattle with bTB shed the Mycobacterium, which can be detect by nested PCR to amplify mycobacterial mpb70 from a nasal swab from a cow. To screen for cytokines fostering early and accurate detection of bTB, peripheral blood mononuclear cells were isolated from naturally M. bovis-infected, experimentally M. bovis 68002-infected, and uninfected cattle, then these cells were stimulated by PPD-B, CFP-10-ESAT-6 (CE), or phosphate-buffered saline (PBS) for 6 h. The levels of interferon gamma (IFN-γ), IFN-γ-induced protein 10 (IP-10), IL-6, IL-12, IL-17A, and tumor necrosis factor alpha mRNA were measured using real-time PCR. To explore the cytokines associated with different periods of M. bovis infection, cattle were divided into three groups: PCR-positive, PCR-negative, and uninfected using the tuberculin skin test, CFP-10/ESAT-6/TB10.4 protein cocktail-based skin test, IFN-γ release assay (IGRA), CFP-10/ESAT-6 (CE)-based IGRA, and nested PCR. The expression of IP-10, IL-17A, and IFN-γ proteins induced by PPD-B, CE, or PBS was detected by ELISA. The results showed that levels of PPD-B-stimulated IL-17A and IP-10 (mRNA and protein), and CE-induced IP-10 (mRNA and protein) were significantly higher in cattle naturally or experimentally infected with M. bovis than in those that were uninfected. The levels of PPD-B- or CE-induced IL-17A and IP-10 (protein) could be used to differentiate M. bovis-infected calves from uninfected ones for 6 to 30 weeks post-infection, whereas PPD-B- and CE-induced IP-10 and IL-17A mRNA expression could be used to differentiate M. bovis-infected calves from uninfected ones between 6 and 58 weeks post-infection. However, CE-induced IL-17A (protein) was not a reliable indicator of M. bovis infection
Role of CD28/B7 costimulation in the dexamethasone-induced suppression of IFN-gamma.
Agarwal, S K; Marshall, G D
2000-11-01
In vitro exposure of peripheral blood mononuclear cells (PBMC) to glucocorticoids (GC), at concentrations observed during psychologic stress, induces a shift in the human type 1/type 2 cytokine balance toward a type 2 cytokine response. The mechanisms involved in these cytokine alterations are unknown but likely include modulation of regulatory cytokines or the interaction between the antigen-presenting cell (APC) and T lymphocyte or both. The CD28/B7 costimulation pathway has been reported to modulate the type 1/type 2 cytokine balance and may contribute to the GC-associated cytokine alterations. Therefore, we sought to determine the effect of dexamethasone (Dex) on the expression and function of the human CD28/B7 costimulatory pathway and whether these alterations contribute to the Dex-induced type 1/type 2 cytokine alterations. Dex inhibited the expression of both CD80 and CD86 on THP-1 cells, a human acute monocytic leukemia cell line, as determined by flow cytometry. Dex also inhibited the expression of CD28 and CTLA-4 on phytohemagglutinin (PHA)-stimulated CD3+ T lymphocytes, which was attenuated by the addition of interleukin-12 (IL-12). Lastly, activation of CD28 with anti-CD28 antibody attenuated the Dex-induced decrease in interferon-gamma (IFN-gamma) production by anti-CD3 antibody-stimulated PBMC. These data suggest that Dex induces a modulation of the CD28/B7 costimulatory pathway that contributes to the shift in the type 1/type 2 cytokine balance toward a predominant type 2 cytokine response.
Garaigorta, Urtzi; Heim, Markus H; Boyd, Bryan; Wieland, Stefan; Chisari, Francis V
2012-10-01
Stress granules (SGs) are cytoplasmic structures that are induced in response to environmental stress, including viral infections. Here we report that hepatitis C virus (HCV) triggers the appearance of SGs in a PKR- and interferon (IFN)-dependent manner. Moreover, we show an inverse correlation between the presence of stress granules and the induction of IFN-stimulated proteins, i.e., MxA and USP18, in HCV-infected cells despite high-level expression of the corresponding MxA and USP18 mRNAs, suggesting that interferon-stimulated gene translation is inhibited in stress granule-containing HCV-infected cells. Finally, in short hairpin RNA (shRNA) knockdown experiments, we found that the stress granule proteins T-cell-restricted intracellular antigen 1 (TIA-1), TIA1-related protein (TIAR), and RasGAP-SH3 domain binding protein 1 (G3BP1) are required for efficient HCV RNA and protein accumulation at early time points in the infection and that G3BP1 and TIA-1 are required for intracellular and extracellular infectious virus production late in the infection, suggesting that they are required for virus assembly. In contrast, TIAR downregulation decreases extracellular infectious virus titers with little effect on intracellular RNA content or infectivity late in the infection, suggesting that it is required for infectious particle release. Collectively, these results illustrate that HCV exploits the stress granule machinery at least two ways: by inducing the formation of SGs by triggering PKR phosphorylation, thereby downregulating the translation of antiviral interferon-stimulated genes, and by co-opting SG proteins for its replication, assembly, and egress.
Viral evasion of DNA-stimulated innate immune responses
Christensen, Maria H; Paludan, Søren R
2017-01-01
Cellular sensing of virus-derived nucleic acids is essential for early defenses against virus infections. In recent years, the discovery of DNA sensing proteins, including cyclic GMP–AMP synthase (cGAS) and gamma-interferon-inducible protein (IFI16), has led to understanding of how cells evoke strong innate immune responses against incoming pathogens carrying DNA genomes. The signaling stimulated by DNA sensors depends on the adaptor protein STING (stimulator of interferon genes), to enable expression of antiviral proteins, including type I interferon. To facilitate efficient infections, viruses have evolved a wide range of evasion strategies, targeting host DNA sensors, adaptor proteins and transcription factors. In this review, the current literature on virus-induced activation of the STING pathway is presented and we discuss recently identified viral evasion mechanisms targeting different steps in this antiviral pathway. PMID:26972769
Hiet, Marie-Sophie; Bauhofer, Oliver; Zayas, Margarita; Roth, Hanna; Tanaka, Yasuhito; Schirmacher, Peter; Willemsen, Joschka; Grünvogel, Oliver; Bender, Silke; Binder, Marco; Lohmann, Volker; Lotteau, Vincent; Ruggieri, Alessia; Bartenschlager, Ralf
2015-10-01
Hepatitis C virus (HCV) nonstructural protein 5A (NS5A) is a multifunctional protein playing a crucial role in diverse steps of the viral replication cycle and perturbing multiple host cell pathways. We showed previously that removal of a region in domain 2 (D2) of NS5A (mutant NS5A(D2Δ)) is dispensable for viral replication in hepatoma cell lines. By using a mouse model and immune-competent cell systems, we studied the role of D2 in controlling the innate immune response. In vivo replication competence of NS5A(D2Δ) was studied in transgenic mice with human liver xenografts. Results were validated using primary human hepatocytes (PHHs) and mechanistic analyses were conducted in engineered Huh7 hepatoma cells with reconstituted innate signaling pathways. Although the deletion in NS5A removed most of the interferon (IFN) sensitivity determining-region, mutant NS5A(D2Δ) was as sensitive as the wild type to IFN-α and IFN-λ in vitro, but severely attenuated in vivo. This attenuation could be recapitulated in PHHs and was linked to higher activation of the IFN response, concomitant with reduced viral replication and virus production. Importantly, immune-reconstituted Huh7-derived cell lines revealed a sequential activation of the IFN-response via RIG-I (retinoic acid-inducible gene I) and MDA5 (Myeloma differentiation associated factor 5), respectively, that was significantly higher in the case of the mutant lacking most of NS5A D2. Our study reveals an important role of NS5A D2 for suppression of the IFN response that is activated by HCV via RIG-I and MDA5 in a sequential manner. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Setoh, Yin Xiang; Periasamy, Parthiban; Peng, Nias Yong Gao; Amarilla, Alberto A; Slonchak, Andrii; Khromykh, Alexander A
2017-11-02
West Nile virus (WNV) is a neurotropic flavivirus that can cause encephalitis in mammalian and avian hosts. In America, the virulent WNV strain (NY99) is causing yearly outbreaks of encephalitis in humans and horses, while in Australia the less virulent Kunjin strain of WNV strain has not been associated with significant disease outbreaks until a recent 2011 large outbreak in horses (but not in humans) caused by NSW2011 strain. Using chimeric viruses between NY99 and NSW2011 strains we previously identified a role for the non-structural proteins of NY99 strain and especially the NS3 protein, in enhanced virus replication in type I interferon response-competent cells and increased virulence in mice. To further define the role of NY99 NS3 protein in inhibition of type I interferon response, we have generated and characterised additional chimeric viruses containing the protease or the helicase domains of NY99 NS3 on the background of the NSW2011 strain. The results identified the role for the helicase but not the protease domain of NS3 protein in the inhibition of type I interferon signalling and showed that helicase domain of the more virulent NY99 strain performs this function more efficiently than helicase domain of the less virulent NSW2011 strain. Further analysis with individual amino acid mutants identified two amino acid residues in the helicase domain primarily responsible for this difference. Using chimeric replicons, we also showed that the inhibition of type I interferon (IFN) signalling was independent of other known functions of NS3 in RNA replication and assembly of virus particles.
Periasamy, Parthiban; Peng, Nias Yong Gao; Amarilla, Alberto A.; Slonchak, Andrii; Khromykh, Alexander A.
2017-01-01
West Nile virus (WNV) is a neurotropic flavivirus that can cause encephalitis in mammalian and avian hosts. In America, the virulent WNV strain (NY99) is causing yearly outbreaks of encephalitis in humans and horses, while in Australia the less virulent Kunjin strain of WNV strain has not been associated with significant disease outbreaks until a recent 2011 large outbreak in horses (but not in humans) caused by NSW2011 strain. Using chimeric viruses between NY99 and NSW2011 strains we previously identified a role for the non-structural proteins of NY99 strain and especially the NS3 protein, in enhanced virus replication in type I interferon response-competent cells and increased virulence in mice. To further define the role of NY99 NS3 protein in inhibition of type I interferon response, we have generated and characterised additional chimeric viruses containing the protease or the helicase domains of NY99 NS3 on the background of the NSW2011 strain. The results identified the role for the helicase but not the protease domain of NS3 protein in the inhibition of type I interferon signalling and showed that helicase domain of the more virulent NY99 strain performs this function more efficiently than helicase domain of the less virulent NSW2011 strain. Further analysis with individual amino acid mutants identified two amino acid residues in the helicase domain primarily responsible for this difference. Using chimeric replicons, we also showed that the inhibition of type I interferon (IFN) signalling was independent of other known functions of NS3 in RNA replication and assembly of virus particles. PMID:29099073
Kimura, Mitsuaki; Ito, Yasunori; Shimomura, Masaki; Morishita, Hideaki; Meguro, Takaaki; Adachi, Yuichi; Seto, Shiro
2017-07-01
Although food protein-induced enterocolitis syndrome (FPIES) is supposed to be caused by inflammation, the role of cytokines has not yet been clarified. To elucidate the role of cytokines in the development of symptoms and abnormal laboratory findings at an oral food challenge (OFC), changes in serum cytokine levels were analyzed for 6 OFCs in 4 patients with FPIES. The result of OFC was judged positive if any gastrointestinal (GI) symptoms (vomiting, diarrhea, or bloody stool) were induced. Among 11 cytokines profiled, serum levels of interleukin (IL)-2, IL-5, and IL-8 were clearly increased in all 4 positive OFCs in which elevations of the serum level of C-reactive protein (CRP) and peripheral blood neutrophilia were also seen. The level of serum IL-10 also rose in 2 positive OFCs. Remarkable increases in the serum level of interferon-gamma (IFN-γ), tumor necrosis factor-alpha (TNF-α), IL-6, and IL-12 were observed in a positive OFC where the serum level of CRP rose markedly (6.75 mg/dL). The serum levels of IL-5 were also elevated in 2 negative OFCs. No apparent specific correlations were found between cytokines and GI symptoms. These results suggest that IL-2 and IL-8 are involved in the antigen-specific immune responses in most patients with FPIES. Further studies are needed to elucidate the significance of these cytokine in the pathogenesis of FPIES. Copyright © 2016 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.
Brooks, Alexandra K.; Lawson, Marcus A.; Rytych, Jennifer L.; Yu, Kevin C.; Janda, Tiffany M.; Steelman, Andrew J.; McCusker, Robert H.
2016-01-01
Elevated levels of circulating pro-inflammatory cytokines are associated with symptomology of several psychiatric disorders, notably major depressive disorder. Symptomology has been linked to inflammation/cytokine-dependent induction of the Kynurenine Pathway. Galectins, like pro-inflammatory cytokines, play a role in neuroinflammation and the pathogenesis of several neurological disorders but without a clearly defined mechanism of action. Their involvement in the Kynurenine Pathway has not been investigated. Thus, we searched for a link between galectins and the Kynurenine Pathway using in vivo and ex vivo models. Mice were administered LPS and pI:C to determine if galectins (Gal’s) were upregulated in the brain following in vivo inflammatory challenges. We then used organotypic hippocampal slice cultures (OHSCs) to determine if Gal’s, alone or with inflammatory mediators [interferon-gamma (IFNγ), tumor necrosis factor-alpha (TNFα), interleukin-1beta (IL-1β), polyinosine-polycytidylic acid (pI:C), and dexamethasone (Dex; synthetic glucocorticoid)], would increase expression of indoleamine/tryptophan-2,3-dioxygenases (DO’s: Ido1, Ido2, and Tdo2; Kynurenine Pathway rate-limiting enzymes). In vivo, hippocampal expression of cytokines (IL-1β, TNFα, and IFNγ), Gal-3, and Gal-9 along with Ido1 and Ido2 were increased by LPS and pI:C (bacterial and viral mimetics). Of the cytokines induced in vivo, only IFNγ increased expression of two Ido1 transcripts (Ido1-FL and Ido1-v1) by OHSCs. Although ineffective alone, Gal-9 accentuated IFNγ-induced expression of only Ido1-FL. Similarly, IFNγ induced expression of several Ido2 transcripts (Ido2-v1, Ido2-v3, Ido2-v4, Ido2-v5, and Ido2-v6). Gal-9 accentuated IFNγ-induced expression of only Ido2-v1. Surprisingly, Gal-9 alone, slightly but significantly, induced expression of Tdo2 (Tdo2-v1 and Tdo2-v2, but not Tdo2-FL). These effects were specific to Gal-9 as Gal-1 and Gal-3 did not alter DO expression. These results
Cheng, Jinbo; Liao, Yajin; Zhou, Lujun; Peng, Shengyi; Chen, Hong; Yuan, Zengqiang
2016-01-01
Type I interferon (IFN-I) is critical for a host against viral and bacterial infections via induction of hundreds of interferon-stimulated genes (ISGs), but the mechanism underlying the regulation of IFN-I remains largely unknown. In this study, we first demonstrate that ISG expression is required for optimal IFN-β levels, an effect that is further enhanced by endoplasmic reticulum (ER) stress. Furthermore, we identify mitochondrial calcium uniporter protein (MCU) as a mitochondrial antiviral signaling protein (MAVS)-interacting protein that is important for ER stress induction and amplified MAVS signaling activation. In addition, by performing an ectopic expression assay to screen a library of 117 human ISGs for effects on IFN-β levels, we found that tumor necrosis factor receptor 1 (TNFR1) significantly increases IFN-β levels independent of ER stress. Altogether, our findings suggest that MCU and TNFR1 are involved in the regulation of RIG-I-like receptors (RLR) signaling. PMID:26892273
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Yanni; Lai, Fangfang; Xu, Yang
2011-11-04
Highlights: Black-Right-Pointing-Pointer Using an ABCA1p-LUC HepG2 cell line, we found that MPA upregulated ABCA1 expression. Black-Right-Pointing-Pointer MPA induced ABCA1 and LXR{alpha} protein expression in HepG2 cells. Black-Right-Pointing-Pointer PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. Black-Right-Pointing-Pointer The effect of MPA upregulating ABCA1 was due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 pathway. -- Abstract: ATP-binding cassette transporter A1 (ABCA1) promotes cholesterol and phospholipid efflux from cells to lipid-poor apolipoprotein A-I and plays an important role in atherosclerosis. In a previous study, we developed a high-throughput screening method using an ABCA1p-LUC HepG2 cell line to find upregulators of ABCA1.more » Using this method in the present study, we found that mycophenolic acid (MPA) upregulated ABCA1 expression (EC50 = 0.09 {mu}M). MPA upregulation of ABCA1 expression was confirmed by real-time quantitative reverse transcription-PCR and Western blot analysis in HepG2 cells. Previous work has indicated that MPA is a potent agonist of peroxisome proliferator-activated receptor gamma (PPAR{gamma}; EC50 = 5.2-9.3 {mu}M). Liver X receptor {alpha} (LXR{alpha}) is a target gene of PPAR{gamma} and may directly regulate ABCA1 expression. Western blot analysis showed that MPA induced LXR{alpha} protein expression in HepG2 cells. Addition of PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. These data suggest that MPA increased ABCA1 expression mainly through activation of PPAR{gamma}. Thus, the effects of MPA on upregulation of ABCA1 expression were due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 signaling pathway. This is the first report that the antiatherosclerosis activity of MPA is due to this mechanism.« less
Interferon-induced Sus scrofa Mx1 blocks endocytic traffic of incoming influenza A virus particles.
Palm, Mélanie; Garigliany, Mutien-Marie; Cornet, François; Desmecht, Daniel
2010-01-01
The interferon-induced Mx proteins of vertebrates are dynamin-like GTPases, some isoforms of which can additionally inhibit the life cycle of certain RNA viruses. Here we show that the porcine Mx1 protein (poMx1) inhibits replication of influenza A virus and we attempt to identify the step at which the viral life cycle is blocked. In infected cells expressing poMx1, the level of transcripts encoding the viral nucleoprotein is significantly lower than normal, even when secondary transcription is prevented by exposure to cycloheximide. This reveals that a pretranscriptional block participates to the anti-influenza activity. Binding and internalization of incoming virus particles are normal in the presence of poMx1 but centripetal traffic to the late endosomes is interrupted. Surprisingly but decisively, poMx1 significantly alters binding of early endosome autoantigen 1 to early endosomes and/or early endosome size and spatial distribution. This is compatible with impairment of traffic of the endocytic vesicles to the late endosomes. INRA, EDP Sciences, 2010.
Karachaliou, Niki; Gonzalez-Cao, Maria; Crespo, Guillermo; Drozdowskyj, Ana; Aldeguer, Erika; Gimenez-Capitan, Ana; Teixido, Cristina; Molina-Vila, Miguel Angel; Viteri, Santiago; De Los Llanos Gil, Maria; Algarra, Salvador Martin; Perez-Ruiz, Elisabeth; Marquez-Rodas, Ivan; Rodriguez-Abreu, Delvys; Blanco, Remedios; Puertolas, Teresa; Royo, Maria Angeles; Rosell, Rafael
2018-01-01
Background: Programmed death-ligand 1 (PD-L1) may be induced by oncogenic signals or can be upregulated via interferon gamma (IFN-γ). We have explored whether the expression of IFNG, the gene encoding IFN-γ, is associated with clinical response to the immune checkpoint blockade in non-small cell lung cancer (NSCLC) and melanoma patients. The role of inflammation-associated transcription factors STAT3, IKBKE, STAT1 and other associated genes has also been examined. Methods: Total RNA from 17 NSCLC and 21 melanoma patients was analyzed by quantitative reverse transcription PCR. STAT3 and Rantes, YAP1 and CXCL5, DNMT1, RIG1 and TET1, EOMES, IFNG, PD-L1 and CTLA4, IKBKE and NFATC1 mRNA were examined. PD-L1 protein expression in tumor and immune cells and stromal infiltration of CD8+ T-cells were also evaluated. Progression-free survival and overall survival were estimated. Results: A total of 17 NSCLC patients received nivolumab and 21 melanoma patients received pembrolizumab. Progression-free survival with nivolumab was significantly longer in NSCLC patients with high versus low IFNG expression (5.1 months versus 2 months, p = 0.0124). Progression-free survival with pembrolizumab was significantly longer in melanoma patients with high versus low IFNG expression (5.0 months versus 1.9 months, p = 0.0099). Significantly longer overall survival was observed for melanoma patients with high versus low IFNG expression (not reached versus 10.2 months p = 0.0183). There was a trend for longer overall survival for NSCLC patients with high versus low IFNG expression. Conclusions: IFN-γ is an important marker for prediction of response to immune checkpoint blockade. Further research is warranted in order to validate whether IFNG is more accurate than PD-L1. PMID:29383037
Uchida, Shotaro; Horie, Ryo; Sato, Hiroki; Kai, Chieko; Yoneda, Misako
2018-05-16
Nipah virus (NiV) is a highly pathogenic paramyxovirus that causes lethal encephalitis in humans. We previously reported that the V protein, one of the three accessory proteins encoded by the P gene, is one of the key determinants of the pathogenesis of NiV in a hamster infection model. Satterfield B.A. et al. have also revealed that V protein is required for the pathogenicity of henipavirus in a ferret infection model. However, the complete functions of NiV V have not been clarified. In this study, we identified UBX domain-containing protein 1 (UBXN1), a negative regulator of RIG-I-like receptor signaling, as a host protein that interacts with NiV V. NiV V interacted with the UBX domain of UBXN1 via its proximal zinc-finger motif in the C-terminal domain. NiV V increased the level of UBXN1 protein by suppressing its proteolysis. Furthermore, NiV V suppressed RIG-I and MDA5-dependent interferon signaling by stabilizing UBXN1 and increasing the interaction between MAVS and UBXN1 in addition to directly interrupting the activation of MDA5. Our results suggest a novel molecular mechanism by which the induction of interferon is potentially suppressed by NiV V protein via UBXN1.
Amit, Ajay; Vijayamahantesh; Dikhit, Manas R; Singh, Ashish Kumar; Kumar, Vikash; Suman, Shashi S; Singh, Ashu; Kumar, Akhilesh; Thakur, Ajit Kumar; Das, Vidyanand Ravi; Das, Pradeep; Bimal, Sanjiva
2017-02-01
In the present study, the efficacy of Leishmania donovani protein disulfide isomerase (LdPDI) as a DNA vaccine was evaluated in BALB/C mice. Mice immunized with the LdPDI-DNA construct were found to be the most immuno-reactive, as the construct induced higher T-cell proliferation. The increased T-cell proliferation was associated with a substantial rise in Th1 and Th17+ CD4 cell response and triggered a higher proportion of CD8+ T cells for the release of interferon-gamma along with a reduced splenic parasite load on Days20 and 60 post challenge (PC). Furthermore, the vaccine construct triggered increased interferon (IFN)-γ, interleukin(IL)-17A, and IL-22 release accompanied by decreased extracellular signal-regulated kinases (ERK) 1/2 signaling and increased mitogen-activated protein kinase (MAPK) signaling coinciding with an increase in the amount of nitrite and reactive oxygen species (ROS)in vaccinating the splenocyts. We summarize from our data that the PDI-DNA construct of Leishmania donovani has the potential to elicit protective immunity through the pro-inflammatory cytokines of CD8+ and CD4+(Th1 and Th17) following an intervention in the downstream signaling event of ERK1/2 (probably through p38MAPK signaling). Therefore, the study suggests a new control against visceral leishmaniasis in the future. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Myoung Woo; Kim, Dae Seong; Kim, Hye Ryung
Highlights: Black-Right-Pointing-Pointer Greater than 30 {mu}M ciglitazone induces cell death in glioma cells. Black-Right-Pointing-Pointer Cell death by ciglitazone is independent of PPAR{gamma} in glioma cells. Black-Right-Pointing-Pointer CGZ induces cell death by the loss of MMP via decreased Akt. -- Abstract: Peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) regulates multiple signaling pathways, and its agonists induce apoptosis in various cancer cells. However, their role in cell death is unclear. In this study, the relationship between ciglitazone (CGZ) and PPAR{gamma} in CGZ-induced cell death was examined. At concentrations of greater than 30 {mu}M, CGZ, a synthetic PPAR{gamma} agonist, activated caspase-3 and induced apoptosis inmore » T98G cells. Treatment of T98G cells with less than 30 {mu}M CGZ effectively induced cell death after pretreatment with 30 {mu}M of the PPAR{gamma} antagonist GW9662, although GW9662 alone did not induce cell death. This cell death was also observed when cells were co-treated with CGZ and GW9662, but was not observed when cells were treated with CGZ prior to GW9662. In cells in which PPAR{gamma} was down-regulated cells by siRNA, lower concentrations of CGZ (<30 {mu}M) were sufficient to induce cell death, although higher concentrations of CGZ ( Greater-Than-Or-Slanted-Equal-To 30 {mu}M) were required to induce cell death in control T98G cells, indicating that CGZ effectively induces cell death in T98G cells independently of PPAR{gamma}. Treatment with GW9662 followed by CGZ resulted in a down-regulation of Akt activity and the loss of mitochondrial membrane potential (MMP), which was accompanied by a decrease in Bcl-2 expression and an increase in Bid cleavage. These data suggest that CGZ is capable of inducing apoptotic cell death independently of PPAR{gamma} in glioma cells, by down-regulating Akt activity and inducing MMP collapse.« less
Modiano, Nir; Lu, Yanping E; Cresswell, Peter
2005-06-14
Human guanylate-binding protein-1 (hGBP-1) is a large GTPase, similar in structure to the dynamins. Like many smaller GTPases of the Ras/Rab family, it is farnesylated, suggesting it may dock into membranes and perhaps play a role in intracellular trafficking. To date, however, hGBP-1 has never been associated with a specific intracellular compartment. Here we present evidence that hGBP-1 can associate with the Golgi apparatus. Redistribution from the cytosol to the Golgi was observed by immunofluorescence and subcellular fractionation after aluminum fluoride treatment, suggesting that it occurs when hGBP-1 is in its GTP-bound state. Relocalization was blocked by a farnesyl transferase inhibitor. The C589S mutant of hGBP-1, which cannot be farnesylated, and the previously uncharacterized R48P mutant, which cannot bind GTP, both failed to localize to the Golgi. These two mutants had a dominant-negative effect, preventing endogenous wild-type hGBP-1 from efficiently redistributing after aluminum fluoride treatment. Furthermore, hGBP-1 requires another IFN-gamma-induced factor to be targeted to the Golgi, because constitutively expressed hGBP-1 remained cytosolic in cells treated with aluminum fluoride unless the cells were preincubated with IFN-gamma. Finally, two nonhydrolyzing mutants of hGBP-1, corresponding to active mutants of Ras family proteins, failed to constitutively associate with the Golgi; we propose three possible explanations for this surprising result.
Tilahun, Ashenafi Y; Holz, Marah; Wu, Tsung-Teh; David, Chella S; Rajagopalan, Govindarajan
2011-02-03
Toxic shock syndrome (TSS) caused by the superantigen exotoxins of Staphylococcus aureus and Streptococcus pyogenes is characterized by robust T cell activation, profound elevation in systemic levels of multiple cytokines, including interferon-γ (IFN-γ), followed by multiple organ dysfunction and often death. As IFN-γ possesses pro- as well as anti-inflammatory properties, we delineated its role in the pathogenesis of TSS. Antibody-mediated in vivo neutralization of IFN-γ or targeted disruption of IFN-γ gene conferred significant protection from lethal TSS in HLA-DR3 transgenic mice. Following systemic high dose SEB challenge, whereas the HLA-DR3.IFN-γ(+/+) mice became sick and succumbed to TSS, HLA-DR3.IFN-γ(-/-) mice appeared healthy and were significantly protected from SEB-induced lethality. SEB-induced systemic cytokine storm was significantly blunted in HLA-DR3.IFN-γ(-/-) transgenic mice. Serum concentrations of several cytokines (IL-4, IL-10, IL-12p40 and IL-17) and chemokines (KC, rantes, eotaxin and MCP-1) were significantly lower in HLA-DR3.IFN-γ(-/-) transgenic mice. However, SEB-induced T cell expansion in the spleens was unaffected and expansion of SEB-reactive TCR Vβ8(+) CD4(+) and CD8(+) T cells was even more pronounced in HLA-DR3.IFN-γ(-/-) transgenic mice when compared to HLA-DR3.IFN-γ(+/+) mice. A systematic histopathological examination of several vital organs revealed that both HLA-DR3.IFN-γ(+/+) and HLA-DR3.IFN-γ(-/-) transgenic mice displayed comparable severe inflammatory changes in lungs, and liver during TSS. Remarkably, whereas the small intestines from HLA-DR3.IFN-γ(+/+) transgenic mice displayed significant pathological changes during TSS, the architecture of small intestines in HLA-DR3.IFN-γ(-/-) transgenic mice was preserved. In concordance with these histopathological changes, the gut permeability to macromolecules was dramatically increased in HLA-DR3.IFN-γ(+/+) but not HLA-DR3.IFN-γ(-/-) mice during TSS. Overall
Tilahun, Ashenafi Y.; Holz, Marah; Wu, Tsung-Teh; David, Chella S.; Rajagopalan, Govindarajan
2011-01-01
Toxic shock syndrome (TSS) caused by the superantigen exotoxins of Staphylococcus aureus and Streptococcus pyogenes is characterized by robust T cell activation, profound elevation in systemic levels of multiple cytokines, including interferon-γ (IFN-γ), followed by multiple organ dysfunction and often death. As IFN-γ possesses pro- as well as anti-inflammatory properties, we delineated its role in the pathogenesis of TSS. Antibody-mediated in vivo neutralization of IFN-γ or targeted disruption of IFN-γ gene conferred significant protection from lethal TSS in HLA-DR3 transgenic mice. Following systemic high dose SEB challenge, whereas the HLA-DR3.IFN-γ+/+ mice became sick and succumbed to TSS, HLA-DR3.IFN-γ−/− mice appeared healthy and were significantly protected from SEB-induced lethality. SEB-induced systemic cytokine storm was significantly blunted in HLA-DR3.IFN-γ−/− transgenic mice. Serum concentrations of several cytokines (IL-4, IL-10, IL-12p40 and IL-17) and chemokines (KC, rantes, eotaxin and MCP-1) were significantly lower in HLA-DR3.IFN-γ−/− transgenic mice. However, SEB-induced T cell expansion in the spleens was unaffected and expansion of SEB-reactive TCR Vβ8+ CD4+ and CD8+ T cells was even more pronounced in HLA-DR3.IFN-γ−/− transgenic mice when compared to HLA-DR3.IFN-γ+/+ mice. A systematic histopathological examination of several vital organs revealed that both HLA-DR3.IFN-γ+/+ and HLA-DR3.IFN-γ−/− transgenic mice displayed comparable severe inflammatory changes in lungs, and liver during TSS. Remarkably, whereas the small intestines from HLA-DR3.IFN-γ+/+ transgenic mice displayed significant pathological changes during TSS, the architecture of small intestines in HLA-DR3.IFN-γ−/− transgenic mice was preserved. In concordance with these histopathological changes, the gut permeability to macromolecules was dramatically increased in HLA-DR3.IFN-γ+/+ but not HLA-DR3.IFN-γ−/− mice during TSS. Overall, IFN
Lee, Jun Sik; Lee, Je Chul; Lee, Chang-Min; Jung, In Duk; Jeong, Young-Il; Seong, Eun-Young; Chung, Hae-Young; Park, Yeong-Min
2007-06-30
Acinetobacter baumannii is an increasing hospital-acquired pathogen that causes a various type of infections, but little is known about the protective immune response to this microorganism. Outer membrane protein A of A. baumannii (AbOmpA) is a major porin protein and plays an important role in pathogenesis. We analyzed interaction between AbOmpA and dendritic cells (DCs) to characterize the role of this protein in promoting innate and adaptive immune responses. AbOmpA functionally activates bone marrow-derived DCs by augmenting expression of the surface markers, CD40, CD54, B7 family (CD80 and CD86) and major histocompatibility complex class I and II. AbOmpA induces production of Th1-promoting interleukin-12 from DCs and augments the syngeneic and allogeneic immunostimulatory capacity of DCs. AbOmpA stimulates production of interferon-gamma from T cells in mixed lymphocyte reactions, which suggesting Th1-polarizing capacity. CD4(+) T cells stimulated by AbOmpA-stimulated DCs show a Th1-polarizing cytokine profile. The expression of surface markers on DCs is mediated by both mitogen-activated protein kinases and NF-kappaB pathways. Our findings suggest that AbOmpA induces maturation of DCs and drives Th1 polarization, which are important properties for determining the nature of immune response against A. baumannii.
IFN-gamma induction by SCG, 1,3-beta-D-glucan from Sparassis crispa, in DBA/2 mice in vitro.
Harada, Toshie; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito
2002-12-01
Sparassis crispa Fr. in an edible mushroom recently cultivable in Japan. A branched beta-glucan from S. crispa (SCG) is a major 6-branched 1,3-beta-D-glucan showing antitumor activity. In this study, we examined interferon-gamma (IFN-gamma) induction by SCG from splenocytes in DBA/2 mice in vitro. In the splenocytes derived from almost all inbred strains of mice except for DBA/1 and DBA/2 mice, IFN-gamma production was not induced by SCG. The breeder and genders of DBA/2 mice showed no influence on IFN-gamma induction by SCG. On the other hand, the magnitude of IFN-gamma induction was lower in young mice than in their older counterparts. IFN-gamma was induced by SCG in adherent splenocytes, but IFN-gamma production was most significantly increased by SCG in instances involving coexistence of adherent and nonadherent splenocytes. In fact, inhibition of cell-cell contact reduced IFN-gamma induction by SCG. In addition, interleukin-12 p70 (IL-12p70) was induced by SCG in DBA/2 mice. It was suggested that soluble factors and cell-cell contact mediate synergistic effects on SCG-induced IFN-gamma production.
Bowick, Gavin C; Airo, Adriana M; Bente, Dennis A
2012-06-19
Crimean Congo hemorrhagic fever (CCHF) is a tick-borne hemorrhagic zoonosis associated with high mortality. Pathogenesis studies and the development of vaccines and antivirals against CCHF have been severely hampered by the lack of suitable animal model. We recently developed and characterized a mature mouse model for CCHF using mice carrying STAT1 knockout (KO). Given the importance of interferons in controlling viral infections, we investigated the expression of interferon pathway-associated genes in KO and wild-type (WT) mice challenged with CCHF virus. We expected that the absence of the STAT1 protein would result in minimal expression of IFN-related genes. Surprisingly, the KO mice showed high levels of IFN-stimulated gene expression, beginning on day 2 post-infection, while in WT mice challenged with virus the same genes were expressed at similar levels on day 1. We conclude that CCHF virus induces similar type I IFN responses in STAT1 KO and WT mice, but the delayed response in the KO mice permits rapid viral dissemination and fatal illness.
Estes, D M; Tuo, W; Brown, W C; Goin, J
1998-12-01
In this report, we sought to determine the role of selected type I interferons [interferon-alpha (IFN-alpha) and interferon-tau (IFN-tau)], IFN-gamma and transforming growth factor-beta (TGF-beta) in the regulation of bovine antibody responses. B cells were stimulated via CD40 in the presence or absence of B-cell receptor (BCR) cross-linking. IFN-alpha enhanced IgM, IgG2 and IgA responses but did not enhance IgG1 responses. BCR signalling alone was more effective at inducing IgG2 responses with IFN-alpha than dual cross-linking with CD40. Recombinant ovine IFN-tau was less effective at inducing IgG2 responses when compared with IFN-alpha, though IgA responses were similar in magnitude following BCR cross-linking. At higher concentrations, IFN-tau enhanced IgA responses greater than twofold over the levels observed with IFN-alpha. Previous studies have shown that addition of IFN-gamma to BCR or pokeweed mitogen-activated bovine B cells stimulates IgG2 production. However, following CD40 stimulation alone, IFN-gamma was relatively ineffective at stimulating high-rate synthesis of any non-IgM isotype. Dual cross-linking via CD40 and the BCR resulted in decreased synthesis of IgM with a concomitant increase in IgA and similar levels of IgG2 production to those obtained via the BCR alone. We also assessed the effects of endogenous and exogenous TGF-beta on immunoglobulin synthesis by bovine B cells. Exogenous TGF-beta stimulates both IgG2 and IgA production following CD40 and BCR cross-linking in the presence of IL-2. Blocking endogenous TGF-beta did not inhibit the up-regulation of IgG2 or IgA by interferons.
Jegaskanda, S.; Ahn, S. H.; Skinner, N.; Thompson, A. J.; Ngyuen, T.; Holmes, J.; De Rose, R.; Navis, M.; Winnall, W. R.; Kramski, M.; Bernardi, G.; Bayliss, J.; Colledge, D.; Sozzi, V.; Visvanathan, K.; Locarnini, S. A.; Kent, S. J.
2014-01-01
ABSTRACT The mechanisms by which hepatitis B virus (HBV) establishes and maintains chronic hepatitis B infection (CHB) are poorly defined. Innate immune responses play an important role in reducing HBV replication and pathogenesis. HBV has developed numerous mechanisms to escape these responses, including the production of the secreted hepatitis B e antigen (HBeAg), which has been shown to regulate antiviral toll-like receptor (TLR) and interleukin-1 (IL-1) signaling. IL-18 is a related cytokine that inhibits HBV replication in hepatoma cell lines and in the liver through the induction of gamma interferon (IFN-γ) by NK cells and T cells. We hypothesized that HBV or HBV proteins inhibit IFN-γ expression by NK cells as an accessory immunomodulatory function. We show that HBeAg protein inhibits the NF-κB pathway and thereby downregulates NK cell IFN-γ expression. Additionally, IFN-γ expression was significantly inhibited by exposure to serum from individuals with HBeAg-positive but not HBeAg-negative chronic HBV infection. Further, we show that the HBeAg protein suppresses IL-18-mediated NF-κB signaling in NK and hepatoma cells via modulation of the NF-κB pathway. Together, these findings show that the HBeAg inhibits IL-18 signaling and IFN-γ expression, which may play an important role in the establishment and/or maintenance of persistent HBV infection. IMPORTANCE It is becoming increasingly apparent that NK cells play a role in the establishment and/or maintenance of chronic hepatitis B infection. The secreted HBeAg is an important regulator of innate and adaptive immune responses. We now show that the HBeAg downregulates NK cell-mediated IFN-γ production and IL-18 signaling, which may contribute to the establishment of infection and/or viral persistence. Our findings build on previous studies showing that the HBeAg also suppresses the TLR and IL-1 signaling pathways, suggesting that this viral protein is a key regulator of antiviral innate immune responses
Strain differences in the somnogenic effects of interferon inducers in mice.
Toth, L A
1996-12-01
Increased slow-wave sleep accompanies influenza infection in C57BL/6 mice but not BALB/c mice. These strains of mice possess different alleles of the genetic lucus If-1, which codes for high (If-1h; C57BL/6) and low (If-1(1); BALB/c) production of interferon (IFN), a putative sleep-inducing cytokine. To evaluate the contribution of the If-1 gene to differences in murine sleep propensity, sleep patterns were evaluated in mice treated with the IFN inducers polyinosinic:polycytidilic acid (pIC) or Newcastle disease virus (NDV), with influenza virus, or with murine interferon (IFN-alpha) or IFN-alpha/beta. As compared with baseline values, C57BL/6 mice exhibited increased slow-wave sleep after all three challenges, but BALB/c mice did not. Congenic B6.C-H28c mice, which bear the BALB/c allele for low IFN production on the C57BL/6 genetic background, showed enhanced slow-wave sleep after influenza infection but not after NDV. Exogenous IFN did not enhance slow-wave sleep in either C57BL/6 or BALB/c mice. These data suggest that the If-1 allele may influence the somnogenic responsiveness of mice under some conditions but that additional mechanisms may contribute to sleep enhancement during infectious disease.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Sung Hun; Yoo, Chong Il; Medical Research Institute, College of Medicine, Pusan National University, Pusan, 602-739
2006-09-01
The present study was undertaken to determine the role of the mitogen-activated protein kinase (MAPK) subfamilies in cell death induced by PPAR{gamma} agonists in osteoblastic cells. Ciglitazone and troglitazone, PPAR{gamma} agonists, resulted in a concentration- and time-dependent cell death, which was largely attributed to apoptosis. But a PPAR{alpha} agonist ciprofibrate did not affect the cell death. Ciglitazone caused reactive oxygen species (ROS) generation and ciglitazone-induced cell death was prevented by antioxidants, suggesting an important role of ROS generation in the ciglitazone-induced cell death. ROS generation and cell death induced by ciglitazone were inhibited by the PPAR{gamma} antagonist GW9662. Ciglitazone treatmentmore » caused activation of extracellular signal-regulated kinase (ERK) and p38. Activation of ERK was dependent on epidermal growth factor receptor (EGFR) and that of p38 was independent. Ciglitazone-induced cell death was significantly prevented by PD98059, an inhibitor of ERK upstream kinase MEK1/2, and SB203580, a p38 inhibitor. Ciglitazone treatment increased Bax expression and caused a loss of mitochondrial membrane potential, and its effect was prevented by N-acetylcysteine, PD98059, and SB203580. Ciglitazone induced caspase activation, which was prevented by PD98059 and SB203580. The general caspase inhibitor z-DEVD-FMK and the specific inhibitor of caspases-3 DEVD-CHO exerted the protective effect against the ciglitazone-induced cell death. The EGFR inhibitors AG1478 and suramin protected against the ciglitazone-induced cell death. Taken together, these findings suggest that the MAPK signaling pathways play an active role in mediating the ciglitazone-induced cell death of osteoblasts and function upstream of a mitochondria-dependent mechanism. These data may provide a novel insight into potential therapeutic strategies for treatment of osteoporosis.« less
Kathum, Omer Abid; Schräder, Tobias; Anhlan, Darisuren; Nordhoff, Carolin; Liedmann, Swantje; Pande, Amit; Mellmann, Alexander; Ehrhardt, Christina; Wixler, Viktor; Ludwig, Stephan
2016-06-01
Phosphorylation and dephosphorylation acts as a fundamental molecular switch that alters protein function and thereby regulates many cellular processes. The non-structural protein 1 (NS1) of influenza A virus is an important factor regulating virulence by counteracting cellular immune responses against viral infection. NS1 was shown to be phosphorylated at several sites; however, so far, no function has been conclusively assigned to these post-translational events yet. Here, we show that the newly identified phospho-site threonine 49 of NS1 is differentially phosphorylated in the viral replication cycle. Phosphorylation impairs binding of NS1 to double-stranded RNA and TRIM25 as well as complex formation with RIG-I, thereby switching off its interferon antagonistic activity. Because phosphorylation was shown to occur at later stages of infection, we hypothesize that at this stage other functions of the multifunctional NS1 beyond its interferon-antagonistic activity are needed. © 2016 The Authors Cellular Microbiology published by John Wiley & Sons Ltd.
Jeevan, Amminikutty; Bonilla, Diana Lucia; McMurray, David Neil
2009-09-01
Cytokine messenger RNA (mRNA) expression was investigated in the spleen and lung digest cells of bacillus Calmette-Guérin (BCG)-vaccinated and non-vaccinated guinea pigs following low-dose, pulmonary exposure to virulent Mycobacterium tuberculosis. After purified protein derivative (PPD) stimulation, the levels of lung cell interferon-gamma (IFN-gamma), tumour necrosis factor-alpha (TNF-alpha) and spleen cell interleukin-12 (IL-12) p40 mRNAs were significantly increased in the non-vaccinated M. tuberculosis-infected guinea pigs compared to the BCG-vaccinated guinea pigs. In contrast, the expression of anti-inflammatory transforming growth factor-beta and IL-10 mRNAs was significantly enhanced in the spleens of BCG-vaccinated animals. Despite the presence of protective cytokine mRNA expression, the non-vaccinated guinea pigs had significantly higher lung and spleen bacterial burdens. In contrast, BCG-vaccinated guinea pigs controlled the bacterial multiplication in their lungs and spleens, indicating that both protective as well as anti-inflammatory cytokine responses are associated with a reduction in bacteria. In addition, lung digest cells from non-vaccinated guinea pigs contained a significantly higher percentage of neutrophils, CD3(+) and CD8(+) T cells, while the percentage of macrophages was increased in the BCG-vaccinated animals. Total and purified lung digest T cells co-cultured with lung macrophages (LMøs) proliferated poorly after PPD stimulation in both non-vaccinated and BCG-vaccinated animals while robust proliferation to PPD was observed when T cells were co-cultured with peritoneal macrophages (PMøs). Macrophages within the lung compartment appear to regulate the response of T cells irrespective of the vaccination status in guinea pigs. Taken together, our results suggest that type I cytokine mRNA expression is not associated with vaccine-induced protection in the low-dose guinea pig model of tuberculosis.
Kim, Dae Yeon; Hong, Min Jeong; Park, Cheong-Sool; Seo, Yong Weon
2015-05-01
To compare the effects of gamma-irradiation on biochemical responses and growth, six-week-old Brachypodium plants were chronically exposed to gamma-irradiation for 30 days at various dosages. Growth surveys of Brachypodium plants in response to different dosages of gamma-irradiation were conducted to compare physiological changes between irradiated and non-irradiated plants. Photosynthetic pigments, soluble sugar content, activities of antioxidant enzymes, and malonaldehyde (MDA) induced by reactive oxygen species (ROS) production were also measured. Gamma-irradiation had a negative influence on the average plant height, leaf length, leaf width, and fresh weight. Photosynthetic pigment levels decreased with increasing dosages of gamma-irradiation, while soluble sugar content slightly increased. Gamma-irradiation responsive proteins were detected and identified by two-dimensional gel electrophoresis (2D-PAGE) and matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF). The proteins had a role in photosynthetic carbon fixation, anabolic pathway glycolysis, mitochondrial ATP production, and oxidative stress response regulation. MDA levels and activities of antioxidant enzymes such as superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT), and peroxidase (POD) increased with the increase in gamma-irradiation dosage level. This study provides some basic information regarding responses to gamma-irradiation, and provides valuable physiological and biological data on the effects of different gamma-irradiation dosages on Triticeae species.
Pisanelli, Giuseppe; Laurent-Rolle, Maudry; Manicassamy, Balaji; Belicha-Villanueva, Alan; Morrison, Juliet; Lozano-Dubernard, Bernardo; Castro-Peralta, Felipa; Iovane, Giuseppe; García-Sastre, Adolfo
2017-01-01
La Piedad Michoacán Mexico Virus (LPMV) is a member of the Rubulavirus genus within the Paramyxoviridae family. LPMV is the etiologic agent of “blue eye disease”, causing a significant disease burden in swine in Mexico with long-term implications for the agricultural industry. This virus mainly affects piglets and is characterized by meningoencephalitis and respiratory distress. It also affects adult pigs, causing reduced fertility and abortions in females, and orchitis and epididymitis in males. Viruses of the Paramyxoviridae family evade the innate immune response by targeting components of the interferon (IFN) signaling pathway. The V protein, expressed by most paramyxoviruses, is a well-characterized IFN signaling antagonist. Until now, there were no reports on the role of the LPMV-V protein in inhibiting the IFN response. In this study we demonstrate that LPMV-V protein antagonizes type I but not type II IFN signaling by binding STAT2, a component of the type I IFN cascade. Our results indicate that the last 18 amino acids of LPMV-V protein are required for binding to STAT2 in human and swine cells. While LPMV-V protein does not affect the protein levels of STAT1 or STAT2, it does prevent the IFN-induced phosphorylation and nuclear translocation of STAT1 and STAT2 thereby inhibiting cellular responses to IFN α/β PMID:26546155
Nagamine, Takeaki; Suzuki, Keiji; Kondo, Toshihiko; Nakazato, Kyomi; Kakizaki, Satoru; Takagi, Hitoshi; Nakajima, Katuyuki
2005-08-01
An association between reactive oxygen species and liver damage has been postulated in the course of hepatitis C virus (HCV) infection. Metallothionein (MT), induced by HCV core protein and interferon (IFN), plays a role in scavenging free radicals. MT expression in liver biopsies obtained from 21 patients with chronic HCV infection before and after IFN-alpha therapy was investigated. Changes in Knodell histological activity index (HAI) scores, MT protein levels (immunohistochemistry), MT-I and MT-II messenger (m)RNA expression levels (in situ hybridization) and proliferating cell nuclear antigen (PCNA) labelling index were determined and compared in serial liver specimens. MT staining was clustered around the portal tracts with inflammatory cells and fibrosis. The pattern of MT protein before IFN-alpha therapy was similar in all patients, but was higher in IFN-sustained responders than in nonresponders after IFN-alpha therapy. HAI scores and PCNA labelling indexes were significantly reduced after IFN-alpha therapy. MT-II mRNA expression correlated positively with PCNA index before therapy and with HAI scores after therapy (P<0.05). No correlation was found between MT-I mRNA and HAI scores or PCNA index. The findings indicate that IFN-alpha-induced hepatic MT may participate in the therapeutic effects of IFN-alpha for HCV. In addition, MT-II mRNA expression may be involved in cell proliferation in the livers of patients with chronic HCV infection.
Dual role of SLP-76 in mediating T cell receptor-induced activation of phospholipase C-gamma1.
Beach, Dvora; Gonen, Ronnie; Bogin, Yaron; Reischl, Ilona G; Yablonski, Deborah
2007-02-02
Phospholipase C-gamma1 (PLC-gamma1) activation depends on a heterotrimeric complex of adaptor proteins composed of LAT, Gads, and SLP-76. Upon T cell receptor stimulation, a portion of PLC-gamma1 is recruited to a detergent-resistant membrane fraction known as the glycosphingolipid-enriched membrane microdomains (GEMs), or lipid rafts, to which LAT is constitutively localized. In addition to LAT, PLC-gamma1 GEM recruitment depended on SLP-76, and, in particular, required the Gads-binding domain of SLP-76. The N-terminal tyrosine phosphorylation sites and P-I region of SLP-76 were not required for PLC-gamma1 GEM recruitment, but were required for PLC-gamma1 phosphorylation at Tyr(783). Thus, GEM recruitment can be insufficient for full activation of PLC-gamma1 in the absence of a second SLP-76-mediated event. Indeed, a GEM-targeted derivative of PLC-gamma1 depended on SLP-76 for T cell receptor-induced phosphorylation at Tyr783 and subsequent NFAT activation. On a biochemical level, SLP-76 inducibly associated with both Vav and catalytically active ITK, which efficiently phosphorylated a PLC-gamma1 fragment at Tyr783 in vitro. Both associations were disrupted upon mutation of the N-terminal tyrosine phosphorylation sites of SLP-76. The P-I region deletion disrupted Vav association and reduced SLP-76-associated kinase activity. A smaller deletion within the P-I region, which does not impair PLC-gamma1 activation, did not impair the association with Vav, but reduced SLP-76-associated kinase activity. These results provide new insight into the multiple roles of SLP-76 and the functional importance of its interactions with other signaling proteins.
Moroda, Masataka; Takamoto, Masaya; Iwakura, Yoichiro; Nakayama, Jun; Aosai, Fumie
2017-12-01
Interleukin17A (IL-17A) is known to be involved in the host defense against pathogens and the pathogenesis of autoimmune diseases. Previously, we showed that excessive amounts of interferon gamma (IFN-γ) play an important role in the pathogenesis of the lethal effects of Toxoplasma gondii by inducing anaphylactic responses. In the study described in this report, we examined the effects of IL-17A deficiency on murine host defense against oral T. gondii infection. IL-17A-deficient C57BL/6 (B6) mice exhibited higher rates of mortality than wild-type (WT) mice during the acute phase of T. gondii infection. CD4 + T cells in the mesenteric lymph nodes (mLNs) and ileum of T. gondii -infected IL-17A-deficient mice produced higher levels of IFN-γ than did those of WT mice. In addition, the level of T. gondii HSP70 ( T.g HSP70) expression was also significantly increased in the ileum, mLNs, liver, and spleen of infected IL-17A-deficient mice compared with that in WT mice. These elevated levels of expression of T.g HSP70 and IFN-γ in infected IL-17A-deficient mice were presumably linked to the IL-17A defect since they decreased to WT levels after treatment with recombinant IL-17A. Furthermore, IL-17A-deficient mice were highly susceptible to the anaphylactic effect of T.g HSP70, and the survival of IL-17A-deficient mice during the acute phase was improved by treatment with an anti- T.g HSP70 monoclonal antibody. These results suggest that IL-17A plays an important role in host survival against T. gondii infection by protecting the host from an anaphylactic reaction via the downregulation of T.g HSP70 and IFN-γ production. Copyright © 2017 American Society for Microbiology.
Coers, Jörn; Bernstein-Hanley, Isaac; Grotsky, David; Parvanova, Iana; Howard, Jonathan C; Taylor, Gregory A; Dietrich, William F; Starnbach, Michael N
2008-05-01
Chlamydiae are obligate intracellular bacterial pathogens that exhibit a broad range of host tropism. Differences in host tropism between Chlamydia species have been linked to host variations in IFN-gamma-mediated immune responses. In mouse cells, IFN-gamma can effectively restrict growth of the human pathogen Chlamydia trachomatis but fails to control growth of the closely related mouse pathogen Chlamydia muridarum. The ability of mouse cells to resist C. trachomatis replication is largely dependent on the induction of a family of IFN-gamma-inducible GTPases called immunity-related GTPases or IRGs. In this study we demonstrate that C. muridarum can specifically evade IRG-mediated host resistance. It has previously been suggested that C. muridarum inactivates the IRG protein Irga6 (Iigp1) to dampen the murine immune response. However, we show that Irga6 is dispensable for the control of C. trachomatis replication. Instead, an effective IFN-gamma response to C. trachomatis requires the IRG proteins Irgm1 (Lrg47), Irgm3 (Igtp), and Irgb10. Ectopic expression of Irgb10 in the absence of IFN-gamma is sufficient to reduce intracellular growth of C. trachomatis but fails to restrict growth of C. muridarum, indicating that C. muridarum can specifically evade Irgb10-driven host responses. Importantly, we find that Irgb10 protein intimately associates with inclusions harboring C. trachomatis but is absent from inclusions formed by C. muridarum. These data suggest that C. muridarum has evolved a mechanism to escape the murine IFN-gamma response by restricting access of Irgb10 and possibly other IRG proteins to the inclusion.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Soyeon; Innovative Research Institute for Cell Therapy, Seoul National University College of Medicine and Hospital, Seoul; Lee, Jae-Jung
2011-03-18
Research highlights: {yields} PPAR{gamma} ligands increased the rate of apoptosis and inhibition of proliferation in ovarian cancer cells. {yields} PPAR{gamma} ligands induced p63 and p73 expression, but not p53. {yields} p63 and p73 leads to an increase in p21 expression and apoptosis in ovarian cancer cells with treatment PPAR{gamma} ligands. {yields} These findings suggest that PPAR{gamma} ligands suppressed growth of ovarian cancer cells through upregulation of p63 and p73. -- Abstract: Peroxisome proliferator-activated receptor gamma (PPAR{gamma}) agonists, including thiazolidinediones (TZDs), can induce anti-proliferation, differentiation, and apoptosis in various cancer cell types. This study investigated the mechanism of the anticancer effectmore » of TZDs on human ovarian cancer. Six human ovarian cancer cell lines (NIH:OVCAR3, SKOV3, SNU-251, SNU-8, SNU-840, and 2774) were treated with the TZD, which induced dose-dependent inhibition of cell growth. Additionally, these cell lines exhibited various expression levels of PPAR{gamma} protein as revealed by Western blotting. Flow cytometry showed that the cell cycle was arrested at the G1 phase, as demonstrated by the appearance of a sub-G1 peak. This observation was corroborated by the finding of increased levels of Bax, p21, PARP, and cleaved caspase 3 in TGZ-treated cells. Interestingly, when we determined the effect of p53-induced growth inhibition in these three human ovarian cancer cells, we found that they either lacked p53 or contained a mutant form of p53. Furthermore, TGZ induced the expression of endogenous or exogenous p63 and p73 proteins and p63- or p73-directed short hairpin (si) RNAs inhibited the ability of TGZ to regulate expression of p21 in these cells. Thus, our results suggest that PPAR{gamma} ligands can induce growth suppression of ovarian cancer cells and mediate p63 and p73 expression, leading to enhanced growth inhibition and apoptosis. The tumor suppressive effects of PPAR{gamma
Hecker, M.; Preiss, C.; Klemm, P.; Busse, R.
1996-01-01
1. In view of the potential deleterious effects of high amounts of nitric oxide (NO) produced by the inducible isoform of NO synthase (iNOS) in inflammation, the prevention of the expression of this enzyme represents an important therapeutic goal. In cytokine-stimulated cells, activation of nuclear factor kappa B (NF-kappa B) is crucial for the increase in iNOS gene expression. Since NF-kappa B activation appears to involve a redox-sensitive step, we have investigated whether three structurally unrelated antioxidants, 5,7-dihydroxyflavone (chrysin), 3,4-dichloroisocoumarin (DCI) and N-acetyl 5-hydroxytryptamine (N-acetylserotonin, NAS), affect iNOS expression in cultured RAW 264.7 monocyte/macrophages stimulated with bacterial lipopolysaccharide (LPS, 140 ng ml-1) and interferon-gamma (IFN gamma, 5 u ml-1). 2. During a 6 h incubation period neither LPS nor IFN gamma alone exerted a significant effect but when combined, caused a prominent increase in nitrite formation, iNOS mRNA and protein abundance. Co-incubation with chrysin (50 microM), DCI (50 microM) or NAS (1 mM) markedly attenuated this increase in iNOS gene expression. 3. DCI, but not chrysin or NAS, prevented the activation of NF-kappa B in cells exposed to LPS plus IFN gamma for 30 min. In contrast, all three antioxidants significantly blunted the DNA-binding activity of interferon regulatory factor 1 (IRF-1), which mediates the synergistic effect of IFN gamma on iNOS gene expression in cells treated for 2 h with LPS plus IFN gamma. 4. DCI thus appears to inhibit iNOS gene expression at the transcriptional level by preventing the activation of both NF-kappa B and IRF-1. The inhibitory effect of DCI on NF-kappa B activation, however, does not seem to be related to its antioxidative properties, since DCI, unlike chrysin or NAS, is a potent serine protease inhibitor which stabilizes the inactive NF-kappa B complex by protecting the inhibitory I kappa B-alpha subunit from proteolytic degradation. 5. The
Schulte, Barbara M; Gielen, Paul R; Kers-Rebel, Esther D; Prosser, Amy C; Lind, Katharina; Flodström-Tullberg, Malin; Tack, Cees J; Elving, Lammy D; Adema, Gosse J
2016-09-01
In children at risk for type 1 diabetes, innate immune activity is detected before seroconversion. Enterovirus infections have been linked to diabetes development, and a polymorphism (A946T) in the innate immune sensor recognizing enterovirus RNA, interferon-induced with helicase C domain 1/melanoma differentiation-associated protein 5, predisposes to disease. We hypothesized that the strength of innate antienteroviral responses is affected in autoimmune type 1 diabetes patients and linked to the A946T polymorphism. We compared induction of interferon-stimulated genes (ISGs) in peripheral blood mononuclear cells (PBMCs) and dendritic cells (DCs) in healthy individuals and diabetes patients upon stimulation with enterovirus, enterovirus-antibody complexes, or ligands mimicking infection in relation to the A946T polymorphism. Overall, PBMCs of diabetes patients and healthy donors showed comparable ISG induction upon stimulation. No differences were observed in DCs. Interestingly, the data imply that the magnitude of responses to enterovirus and enterovirus-antibody complexes in PBMCs is critically influenced by the A946T polymorphism and elevated in heterozygotes compared to TT homozygous individuals in autoimmune diabetes patients, but not healthy controls. These data imply an intrinsic difference in the responses to enterovirus and enterovirus-antibody complexes in diabetes patients carrying a TT risk genotype compared to heterozygotes that may influence control of enterovirus clearance.
NASA Technical Reports Server (NTRS)
Wirth, J. J.; Kierszenbaum, F.; Sonnenfeld, G.; Zlotnik, A.
1985-01-01
Results are reported from a study of the influence gamma interferon (GIFN) and interleukin 2 (IL2) have on the capability of P388D1 cells and mouse resident peritoneal macrophages (MPM) to attach to the blood-resident parasites Trypanosoma cruzi and kill them. Cultures of trypomastigote forms of the Tulahuen strain of T. cruzi grown in bovine serum were introduced into peritoneal cells of mice, along with P388D1 cells incubated with GIFN, IL2 and both. Control cells were also maintained. Statistical analysis were then performed on data on counts of the number of dead T. Cruzi cells. The GIFN enhanced the interaction of MPM and P388D1 cells with the surface of T. Cruzi, provided the interaction was given over 12 hr to take place. A depression of the cytotoxicity of P388D1 cells was attributed to mediation by H2O2, an effect partially offset by incubation with the lymphokine GIFN.
Hu, Guobin; Yin, Xiangyan; Lou, Huimin; Xia, Jun; Dong, Xianzhi; Zhang, Jianyie; Liu, Qiuming
2011-02-01
Two cDNAs with different 3'-untranslated region (UTR) encoding an interferon regulatory factor 3 (IRF-3) were cloned from head kidney of Japanese flounder, Paralichthys olivaceus, by reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) methods. Sequence analysis reveals that they were generated by alternative polyadenylation. The predicted protein consists of 467 amino acid residues which shares the highest identity of 50.7-57.6% to fish IRF-3 and possesses a DNA-binding domain (DBD), an IRF association domain (IAD) and a serine-rich domain (SRD) of vertebrate IRF-3. The presence of these domains along with phylogenetic analysis places it into the IRF-3 group of the IRF-3 subfamily. RT-PCR analysis revealed that flounder IRF-3 was expressed constitutively in limited tissue types including head kidney, spleen, kidney, heart, gill, intestine and liver. A quantitative real time PCR assay was employed to monitor expression of IRF-3, type I interferon (IFN) and Mx in flounder head kidney and gill. All three genes were up-regulated by polyinosinic:polycytidylic acid (polyI:C) and lymphocystis disease virus (LCDV) with an earlier but slight and less persistent increase in transcription levels seen for the IRF-3. Finally, flounder IRF-3 was proved to induce fish type I IFN promoter in FG9307 cells, a flounder gill cell line, by a luciferase assay. These results provide insights into the roles of fish IRF-3 in the antiviral immunity. Copyright © 2010 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Priwahyuningtyas, N. B.; Sinaga, B. Y. M.; Pandia, P.; Eyanoer, P. C.
2018-03-01
Tuberculosis is an infectious disease which caused by Mycobacterium tuberculosis (M. tuberculosis) that infected numerous organ especially the lung. A person’s immunity is very affecting for a person exposed to pulmonary tuberculosis. T-helper-1 cell (Th1) is very influential in the immune system especially in interfering intracellular bacterial infection. One of the cytokines known produced by Th1 cell is interferon gamma (IFN-γ) which is in eliminating M. tuberculosis. The study aims to identify the association between level of IFN-γ and AFB positivity in pulmonary tuberculosis patients in Medan. It is a case-control study. The subjects of the study were 60 new cases of pulmonary tuberculosis with AFB sputum smear- positive that never received ATT consisting 20 cases AFB (+1), 20 cases AFB (+2) and 20 cases AFB (+3).Samples were plasma collected from the venous blood of pulmonary tuberculosis patients. The plasma then underwent laboratory assay with ELISA techniques. Independent t-test was p<0.05 considered significant. Level of IFN-γ in TB AFB (+1) is higher than TB AFB (+2) and (+3), with thesignificant statistical result (p=0.001).
Wieland, Stefan F.; Vega, Raquel G.; Müller, Rolf; Evans, Claire F.; Hilbush, Brian; Guidotti, Luca G.; Sutcliffe, J. Gregor; Schultz, Peter G.; Chisari, Francis V.
2003-01-01
We have previously shown that alpha/beta interferon (IFN-α/β) and IFN-γ inhibit hepatitis B virus (HBV) replication noncytopathically in the livers of HBV transgenic mice and in hepatocyte cell lines derived from these mice. The present study was designed to identify transcriptionally controlled hepatocellular genes that are tightly associated with the inhibition of HBV replication and that might, therefore, mediate the antiviral effect of these cytokines. Twenty-nine genes were identified, many of which have known or potential antiviral activity. Notably, multiple components of the immunoproteasome and ubiquitin-like proteins were strongly induced by both IFN-α/β and IFN-γ, as were a number of GTP-binding proteins, including GTPases with known antiviral activity, chemokines, signaling molecules, and miscellaneous genes associated with antigen processing, DNA-binding, or cochaperone activity and several expressed sequence tags. The results suggest that one or more members of this relatively small subset of genes may mediate the antiviral effect of IFN-α/β and IFN-γ against HBV. We have already exploited this information by demonstrating that the antiviral activity of IFN-α/β and IFN-γ is proteasome dependent. PMID:12502840
Shigella Outer Membrane Protein PSSP-1 Is Broadly Protective against Shigella Infection
Rho, Semi; Kim, Su Hee; Kim, Heejoo; Song, Hyo Jin; Kim, Eun Jin; Kim, Ryang Yeo; Kim, Eun Hye; Sinha, Anuradha; Dey, Ayan; Yang, Jae Seung; Song, Man Ki; Nandy, Ranjan Kumar; Czerkinsky, Cecil
2015-01-01
In developing countries, Shigella is a primary cause of diarrhea in infants and young children. Although antibiotic therapy is an effective treatment for shigellosis, therapeutic options are narrowing due to the emergence of antibiotic resistance. Thus, preventive vaccination could become the most efficacious approach for controlling shigellosis. We have identified several conserved protein antigens that are shared by multiple Shigella serotypes and species. Among these, one antigen induced cross-protection against experimental shigellosis, and we have named it pan-Shigella surface protein 1 (PSSP-1). PSSP-1-induced protection requires a mucosal administration route and coadministration of an adjuvant. When PSSP-1 was administered intranasally, it induced cross-protection against Shigella flexneri serotypes 2a, 5a, and 6, Shigella boydii, Shigella sonnei, and Shigella dysenteriae serotype 1. Intradermally administered PSSP-1 induced strong serum antibody responses but failed to induce protection in the mouse lung pneumonia model. In contrast, intranasal administration elicited efficient local and systemic antibody responses and production of interleukin 17A and gamma interferon. Interestingly, blood samples from patients with recent-onset shigellosis showed variable but significant mucosal antibody responses to other conserved Shigella protein antigens but not to PSSP-1. We suggest that PSSP-1 is a promising antigen for a broadly protective vaccine against Shigella. PMID:25651919
Interferons and Interferon Regulatory Factors in Malaria
Claser, Carla; Tan, Kevin Shyong Wei; Rénia, Laurent
2014-01-01
Malaria is one of the most serious infectious diseases in humans and responsible for approximately 500 million clinical cases and 500 thousand deaths annually. Acquired adaptive immune responses control parasite replication and infection-induced pathologies. Most infections are clinically silent which reflects on the ability of adaptive immune mechanisms to prevent the disease. However, a minority of these can become severe and life-threatening, manifesting a range of overlapping syndromes of complex origins which could be induced by uncontrolled immune responses. Major players of the innate and adaptive responses are interferons. Here, we review their roles and the signaling pathways involved in their production and protection against infection and induced immunopathologies. PMID:25157202
Role of interferon in resistance and immunity to protozoa
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Degee, A. L. W.; Mansfield, J. M.; Newsome, A. L.; Arnold, R. R.
1985-01-01
Production of interferon (I) in response to protozoan infection, and the interferon-mediated inhibition of parasite replication were studied in order to determine if these effects may be related to immunologic-mediated resistance of the hosts. Two extracellular parasites-Trypanosoma brucei rhodesiense and Naegleria fowlei were used. Upon infection with the trypanosome, only resistant strains of mice produced I. An early peak of alpha/beta I is followed by appearance of gamma I, which coincided with antibody production and a drop in parasitemia. In case of the amoeba, pretreatment of its suspension with alpha/beta I inhibits its replication in vitro, and appears to protect mice from the infection and the disease. It is proposed that production of interferon, with its regulatory effect on the immune responses, may play a major role in regulating the processes of protozoan-caused diseases.
Inhibition of human mast cell growth and differentiation by interferon gamma-1b.
Kirshenbaum, A S; Worobec, A S; Davis, T A; Goff, J P; Semere, T; Metcalfe, D D
1998-03-01
In an effort to identify cytokines that inhibit human mast cell growth, we cultured HMC-1 cells and recombinant human stem cell factor (rhSCF)-dependent human bone marrow-derived mast cells (HBMCs) in the presence of interferon gamma (IFNgamma)-1b and interferon alpha (IFNalpha)-2b. HMC-1 cell numbers decreased in the presence of 1000 U/mL IFNgamma-1b but were unaffected by 1000 U/mL of IFNalpha-2b. HBMCs were then cultured for 0 to 7 days with 100 ng/mL rhSCF and 10 ng/mL recombinant human IL-3 (rhIL-3), followed by culture in rhSCF and administration of either 1000 U/mL IFNalpha-2b or 1000 U/mL IFNgamma-1b. HBMCs appearing in cultures with rhSCF alone or in combination with IFNalpha-2b were virtually identical in number through 8 weeks of culture. In cultures supplemented with IFNgamma-1b, HBMCs significantly decreased in number and incidence of granular metachromasia by 4 to 5 weeks (p<0.001). Similar results were obtained when human marrow was cultured from day 0 with rhSCF and IFNgamma-1b. Mature rhSCF-dependent HBMCs were also cultured at 5 weeks with rhSCF alone or in combination with IFNgamma-1b. Compared with cells cultured in rhSCF, mature 5-week HBMC cultures treated with rhSCF plus IFNgamma-1b revealed a decrease in mast cells, and those mast cells that remained had fewer toluidine blue- and tryptase-positive granules after 5 to 8 weeks. FACS analysis of rhSCF plus IFNgamma-1b-treated mature HBMCs revealed increased c-kit and Fc(epsilon)RI expression. Mast cell releasibility was not increased. IFNgamma-lb was thus able to suppress mast cell growth from CD34+ cells, suggesting that this agent should be considered as a candidate cytokine for the treatment of disorders of mast cell proliferation.
Tumor-induced thymic atrophy: alteration in interferons and Jak/Stats signaling pathways.
Carrio, Roberto; Torroella-Kouri, Marta; Iragavarapu-Charyulu, Vijaya; Lopez, Diana M
2011-02-01
The thymus is the major site of T cell differentiation and a key organ of the immune system. Thym atrophy has been observed in several model systems including aging, and tumor development. Previous results from our laboratory have reported that the thymic atrophy seen in mammary tumor bearers is associated with a severe depletion of CD4+CD8+ double positive immature cells and changes in the levels of cytokines expressed in the thymus microenvironment. Cytokines regulate numerous aspects of hematopoiesis via activation of the Jak/Stat pathways. In the present study we have used our mammary tumor model to investigate whether changes in the levels of cytokines in the thymus could affect the normal expression of the aforementioned pathways. RNA and protein analysis revealed an overexpression of the different members of interferons, a downregulation of most of the Jak/Stat pathways, and an increased expression of several suppressors of cytokine signaling (SOSC) in the thymuses of tumor bearers. Together, our data suggest that the impaired Jak/Stat signaling pathways observed in the whole thymus of tumor-bearing mice could be contributing to the abnormal T cell development and apoptosis observed during the tumor-induced thymic atrophy.
A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.
Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M
2006-03-01
Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.
Xia, Chuan; Vijayan, Madhuvanthi; Pritzl, Curtis J; Fuchs, Serge Y; McDermott, Adrian B; Hahm, Bumsuk
2015-12-16
Influenza A virus (IAV) employs diverse strategies to circumvent type I interferon (IFN) responses, particularly by inhibiting the synthesis of type I IFNs. However, it is poorly understood if and how IAV regulates the type I IFN receptor (IFNAR)-mediated signaling mode. In this study, we demonstrate that IAV induces the degradation of IFNAR subunit 1 (IFNAR1) to attenuate the type I IFN-induced antiviral signaling pathway. Following infection, the level of IFNAR1 protein, but not mRNA, decreased. Indeed, IFNAR1 was phosphorylated and ubiquitinated by IAV infection, which resulted in IFNAR1 elimination. The transiently overexpressed IFNAR1 displayed antiviral activity by inhibiting virus replication. Importantly, the hemagglutinin (HA) protein of IAV was proved to trigger the ubiquitination of IFNAR1, diminishing the levels of IFNAR1. Further, influenza A viral HA1 subunit, but not HA2 subunit, downregulated IFNAR1. However, viral HA-mediated degradation of IFNAR1 was not caused by the endoplasmic reticulum (ER) stress response. IAV HA robustly reduced cellular sensitivity to type I IFNs, suppressing the activation of STAT1/STAT2 and induction of IFN-stimulated antiviral proteins. Taken together, our findings suggest that IAV HA causes IFNAR1 degradation, which in turn helps the virus escape the powerful innate immune system. Thus, the research elucidated an influenza viral mechanism for eluding the IFNAR signaling pathway, which could provide new insights into the interplay between influenza virus and host innate immunity. Influenza A virus (IAV) infection causes significant morbidity and mortality worldwide and remains a major health concern. When triggered by influenza viral infection, host cells produce type I interferon (IFN) to block viral replication. Although IAV was shown to have diverse strategies to evade this powerful, IFN-mediated antiviral response, it is not well-defined if IAV manipulates the IFN receptor-mediated signaling pathway. Here, we
Franssila, R; Auramo, J; Modrow, S; Möbs, M; Oker-Blom, C; Käpylä, P; Söderlund-Venermo, M; Hedman, K
2005-01-01
Human parvovirus B19 is a small non-enveloped DNA virus with an icosahedral capsid consisting of proteins of only two species, the major protein VP2 and the minor protein VP1. VP2 is contained within VP1, which has an additional unique portion (VP1u) of 227 amino acids. We determined the ability of eukaryotically expressed parvovirus B19 virus-like particles consisting of VP1 and VP2 in the ratio recommended for vaccine use, or of VP2 alone, to stimulate, in an HLA class II restricted manner, peripheral blood mononuclear cells (PBMC) to proliferate and to secrete interferon gamma (IFN-γ) and interleukin (IL)-10 cytokines among recently and remotely B19 infected subjects. PBMC reactivity with VP1u was determined specifically with a prokaryotically expressed VP1u antigen. In general, B19-specific IFN-γ responses were stronger than IL-10 responses in both recent and remote infection; however, IL-10 responses were readily detectable among both groups, with the exception of patients with relapsed or persisting symptoms who showed strikingly low IL-10 responses. Whereas VP1u-specific IFN-γ responses were very strong among the recently infected subjects, the VP1u-specific IFN-γ and IL-10 responses were virtually absent among the remotely infected subjects. The disappearance of VP1u-specific IFN-γ expression is surprising, as B-cell immunity against VP1u is well maintained. PMID:16178856
Saini, Neeraj Kumar; Sinha, Rajesh; Singh, Pooja; Sharma, Monika; Pathak, Rakesh; Rathor, Nisha; Varma-Basil, Mandira; Bose, Mridula
2016-11-01
Mycobacterium tuberculosis subverts the host immune response through numerous immune-evasion strategies. Apoptosis has been identified as one such mechanism and has been well studied in M. tuberculosis infection. Here, we demonstrate that the Mce4A protein of mce4 operon is involved in the induction of host cell apoptosis. Earlier we have shown that the Mce4A was required for the invasion and survival of M. tuberculosis. In this report we present evidence to establish a role for Mce4A in the modulation of THP-1 cell survival. Recombinant Mce4A was expressed and purified from Escherichia coli as inclusion bodies and then refolded. Viability of THP-1 cells decreased in a dose-dependent manner when treated with Mce4A. The secretion of pro-inflammatory cytokines like tumor necrosis factor (TNF-α) or interferon gamma (IFN-γ), and enhanced nitric oxide release was observed when the THP-1 cells, were treated with Mce4A protein. The Mce4A induced apoptosis of the THP-1 cells was TNF-α dependent since blocking with anti TNF-α antibody abrogated this phenomenon. Collectively, these data suggest that Mce4A can induce the THP-1 cells to undergo apoptosis which primarily follows a TNF- α dependent pathway. Copyright © 2016 Elsevier Ltd. All rights reserved.
Chromatin organization as an indicator of glucocorticoid induced natural killer cell dysfunction.
Misale, Michael S; Witek Janusek, Linda; Tell, Dina; Mathews, Herbert L
2018-01-01
It is well-established that psychological distress reduces natural killer cell immune function and that this reduction can be due to the stress-induced release of glucocorticoids. Glucocorticoids are known to alter epigenetic marks associated with immune effector loci, and are also known to influence chromatin organization. The purpose of this investigation was to assess the effect of glucocorticoids on natural killer cell chromatin organization and to determine the relationship of chromatin organization to natural killer cell effector function, e.g. interferon gamma production. Interferon gamma production is the prototypic cytokine produced by natural killer cells and is known to modulate both innate and adaptive immunity. Glucocorticoid treatment of human peripheral blood mononuclear cells resulted in a significant reduction in interferon gamma production. Glucocorticoid treatment also resulted in a demonstrable natural killer cell nuclear phenotype. This phenotype was localization of the histone, post-translational epigenetic mark, H3K27me3, to the nuclear periphery. Peripheral nuclear localization of H3K27me3 was directly related to cellular levels of interferon gamma. This nuclear phenotype was determined by direct visual inspection and by use of an automated, high through-put technology, the Amnis ImageStream. This technology combines the per-cell information content provided by standard microscopy with the statistical significance afforded by large sample sizes common to standard flow cytometry. Most importantly, this technology provides for a direct assessment of the localization of signal intensity within individual cells. The results demonstrate glucocorticoids to dysregulate natural killer cell function at least in part through altered H3K27me3 nuclear organization and demonstrate H3K27me3 chromatin organization to be a predictive indicator of glucocorticoid induced immune dysregulation of natural killer cells. Copyright © 2017 Elsevier Inc. All rights
Role of STAT1 in Chlamydia-Induced Type-1 Interferon Production in Oviduct Epithelial Cells
Hosey, Kristen Lynette; Hu, Sishun
2015-01-01
We previously reported that Chlamydia muridarum-infected murine oviduct epithelial cells (OE cells) secrete interferon β (IFN-β) in a mostly TLR3-dependent manner. However, C. muridarum-infected TLR3-deficient OE cells were still able to secrete detectable levels of IFN-β into the supernatants, suggesting that other signaling pathways contribute to Chlamydia-induced IFN-β synthesis in these cells. We investigated the role of STAT1 as a possible contributor in the Chlamydia-induced type-1 IFN production in wild-type (WT) and TLR3-deficient OE cells to ascertain its putative role at early- and late-times during Chlamydia infection. Our data show that C. muridarum infection significantly increased STAT1 gene expression and protein activation in WT OE cells; however, TLR3-deficient OE cells showed diminished STAT1 protein activation and gene expression. There was significantly less IFN-β detected in the supernatants of C. muridarum-infected OE cells derived from mice deficient in STAT1 when compared with WT OE cells, which suggest that STAT1 is required for the optimal synthesis of IFN-β during infection. Real-time quantitative polymerase chain reaction analyses of signaling components of the type-1 IFN signaling pathway demonstrated equal upregulation in the expression of STAT2 and IRF7 genes in the WT and TLR3-deficient OE cells, but no upregulation in these genes in the STAT1-deficient OE cells. Finally, experiments in which INFAR1 was blocked with neutralizing antibody revealed that IFNAR1-mediated signaling was critical to the Chlamydia-induced upregulation in IFN-α gene transcription, but had no role in the Chlamydia-induced upregulation in IFN-β gene transcription. PMID:26262558
2005-01-01
Abstract The aim of this study was to evaluate the effect of 3 Brucella ovis subcellular protein fractions: Outer membrane (OMP), inner membrane (IMP), and cytoplasm (CP), on cellular immune response by in vitro production of interleukin (IL)-2, IL-4, and interferon (IFN)-γ. Each fraction was inoculated 3 times into Balb/c mice, primary cultures of mice spleen cells were done, and these were then stimulated with the fractions. Culture supernatants were collected at 24, 48, 72, 96, and 120 h postinoculation. Cytokine concentration was measured by Duoset-enzyme-linked immunosorbent assay (ELISA). The OMP fraction induced highest cellular immune response of 1000 pg/mL of IL-2 at 24 h, which decreased to < 100 pg/mL by 96 h. The IL-2 response for the IMP fraction was low at 24 h, but exceeded that of the OMP fraction at 72, 96, and 120 h. The CP showed a poor IL response. Regarding the IFN-γ production, OMP and IMP induced a high response at 120 h. These results open the possibility for the use of B. ovis outer and inner membrane proteins as a subcellular vaccine. PMID:15745223
Liu, Ting-Kai; Zhang, Yi-Bing; Liu, Ying; Sun, Fan; Gui, Jian-Fang
2011-12-01
The double-stranded RNA (dsRNA)-dependent protein kinase (PKR) inhibits protein synthesis by phosphorylating eukaryotic translation initiation factor 2α (eIF2α). In fish species, in addition to PKR, there exists a PKR-like protein kinase containing Z-DNA binding domains (PKZ). However, the antiviral role of fish PKZ and the functional relationship between fish PKZ and PKR remain unknown. Here we confirmed the coexpression of fish PKZ and PKR proteins in Carassius auratus blastula embryonic (CAB) cells and identified them as two typical interferon (IFN)-inducible eIF2α kinases, both of which displayed an ability to inhibit virus replication. Strikingly, fish IFN or all kinds of IFN stimuli activated PKZ and PKR to phosphorylated eIF2α. Overexpression of both fish kinases together conferred much more significant inhibition of virus replication than overexpression of either protein, whereas morpholino knockdown of both made fish cells more vulnerable to virus infection than knockdown of either. The antiviral ability of fish PKZ was weaker than fish PKR, which correlated with its lower ability to phosphorylate eIF2α than PKR. Moreover, the independent association of fish PKZ or PKR reveals that each of them formed homodimers and that fish PKZ phosphorylated eIF2α independently on fish PKR and vice versa. These results suggest that fish PKZ and PKR play a nonredundant but cooperative role in IFN antiviral response.
Dery, Kenneth J; Silver, Craig; Yang, Lu; Shively, John E
2018-06-15
The adhesion protein carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) is widely expressed in epithelial cells as a short cytoplasmic isoform (S-iso) and in leukocytes as a long cytoplasmic isoform (L-iso) and is frequently silenced in cancer by unknown mechanisms. Previously, we reported that interferon response factor 1 (IRF1) biases alternative splicing (AS) to include the variable exon 7 (E7) in CEACAM1, generating long cytoplasmic isoforms. We now show that IRF1 and a variant of heterogeneous nuclear ribonucleoprotein L (Lv1) coordinately silence the CEACAM1 gene. RNAi-mediated Lv1 depletion in IRF1-treated HeLa and melanoma cells induced significant CEACAM1 protein expression, reversed by ectopic Lv1 expression. The Lv1-mediated CEACAM1 repression resided in residues Gly 71 -Gly 89 and Ala 38 -Gly 89 in Lv1's N-terminal extension. ChIP analysis of IRF1- and FLAG-tagged Lv1-treated HeLa cells and global treatment with the global epigenetic modifiers 5-aza-2'-deoxycytidine and trichostatin A indicated that IRF1 and Lv1 together induce chromatin remodeling, restricting IRF1 access to the CEACAM1 promoter. In interferon γ-treated HeLa cells, the transcription factor SP1 did not associate with the CEACAM1 promoter, but binding by upstream transcription factor 1 (USF1), a known CEACAM1 regulator, was greatly enhanced. ChIP-sequencing revealed that Lv1 overexpression in IRF1-treated cells induces transcriptional silencing across many genes, including DCC ( d eleted in c olorectal c arcinoma), associated with CEACAM5 in colon cancer. Notably, IRF1, but not IRF3 and IRF7, affected CEACAM1 expression via translational repression. We conclude that IRF1 and Lv1 coordinately regulate CEACAM1 transcription, alternative splicing, and translation and may significantly contribute to CEACAM1 silencing in cancer. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Pisanelli, Giuseppe; Laurent-Rolle, Maudry; Manicassamy, Balaji; Belicha-Villanueva, Alan; Morrison, Juliet; Lozano-Dubernard, Bernardo; Castro-Peralta, Felipa; Iovane, Giuseppe; García-Sastre, Adolfo
2016-02-02
La Piedad Michoacán Mexico Virus (LPMV) is a member of the Rubulavirus genus within the Paramyxoviridae family. LPMV is the etiologic agent of "blue eye disease", causing a significant disease burden in swine in Mexico with long-term implications for the agricultural industry. This virus mainly affects piglets and is characterized by meningoencephalitis and respiratory distress. It also affects adult pigs, causing reduced fertility and abortions in females, and orchitis and epididymitis in males. Viruses of the Paramyxoviridae family evade the innate immune response by targeting components of the interferon (IFN) signaling pathway. The V protein, expressed by most paramyxoviruses, is a well-characterized IFN signaling antagonist. Until now, there were no reports on the role of the LPMV-V protein in inhibiting the IFN response. In this study we demonstrate that LPMV-V protein antagonizes type I but not type II IFN signaling by binding STAT2, a component of the type I IFN cascade. Our results indicate that the last 18 amino acids of LPMV-V protein are required for binding to STAT2 in human and swine cells. While LPMV-V protein does not affect the protein levels of STAT1 or STAT2, it does prevent the IFN-induced phosphorylation and nuclear translocation of STAT1 and STAT2 thereby inhibiting cellular responses to IFN α/β. Copyright © 2015 Elsevier B.V. All rights reserved.
Pancreatitis induced by pegylated interferon alfa-2b in a patient affected by chronic hepatitis C.
Cecchi, Enrica; Forte, Paolo; Cini, Elisabetta; Banchelli, Grazia; Ferlito, Chiara; Mugelli, Alessandro
2004-01-01
A middle-aged man was admitted to the ED because of nausea and vomiting, abdominal distention and fainting. A blood analysis revealed high levels of serum amylase and lipase, confirming a diagnosis of acute pancreatitis. The history showed that the patient had self-administered a single dose of pegylated interferon alfa-2b and ribavirin daily for 7 days for chronic hepatitis C. The medications were stopped and his condition gradually improved. In agreement with the literature and the Naranjo algorythm result, pegylated interferon alfa-2b is associated with acute pancreatitis. Identification of a few signs and symptoms is the first 'signal' in preventing a serious drug-induced adverse event.
Bouloy, Michèle; Janzen, Christian; Vialat, Pierre; Khun, Huot; Pavlovic, Jovan; Huerre, Michel; Haller, Otto
2001-01-01
Rift Valley fever virus (RVFV), a phlebovirus of the family Bunyaviridae, is a major public health threat in Egypt and sub-Saharan Africa. The viral and host cellular factors that contribute to RVFV virulence and pathogenicity are still poorly understood. All pathogenic RVFV strains direct the synthesis of a nonstructural phosphoprotein (NSs) that is encoded by the smallest (S) segment of the tripartite genome and has an undefined accessory function. In this report, we show that MP12 and clone 13, two attenuated RVFV strains with mutations in the NSs gene, were highly virulent in IFNAR−/− mice lacking the alpha/beta interferon (IFN-α/β) receptor but remained attenuated in IFN-γ receptor-deficient mice. Both attenuated strains proved to be excellent inducers of early IFN-α/β production. In contrast, the virulent strain ZH548 failed to induce detectable amounts of IFN-α/β and replicated extensively in both IFN-competent and IFN-deficient mice. Clone 13 has a defective NSs gene with a large in-frame deletion. This defect in the NSs gene results in expression of a truncated protein which is rapidly degraded. To investigate whether the presence of the wild-type NSs gene correlated with inhibition of IFN-α/β production, we infected susceptible IFNAR−/− mice with S gene reassortant viruses. When the S segment of ZH548 was replaced by that of clone 13, the resulting reassortants became strong IFN inducers. When the defective S segment of clone 13 was exchanged with the wild-type S segment of ZH548, the reassortant virus lost the capacity to stimulate IFN-α/β production. These results demonstrate that the ability of RVFV to inhibit IFN-α/β production correlates with viral virulence and suggest that the accessory protein NSs is an IFN antagonist. PMID:11152510
How Ebola virus counters the interferon system.
Kühl, A; Pöhlmann, S
2012-09-01
Zoonotic transmission of Ebola virus (EBOV) to humans causes a severe haemorrhagic fever in afflicted individuals with high case-fatality rates. Neither vaccines nor therapeutics are at present available to combat EBOV infection, making the virus a potential threat to public health. To devise antiviral strategies, it is important to understand which components of the immune system could be effective against EBOV infection. The interferon (IFN) system constitutes a key innate defence against viral infections and prevents development of lethal disease in mice infected with EBOV strains not adapted to this host. Recent research revealed that expression of the host cell IFN-inducible transmembrane proteins 1-3 (IFITM1-3) and tetherin is induced by IFN and restricts EBOV infection, at least in cell culture model systems. IFITMs, tetherin and other effector molecules of the IFN system could thus pose a potent barrier against EBOV spread in humans. However, EBOV interferes with signalling events required for human cells to express these proteins. Here, we will review the strategies employed by EBOV to fight the IFN system, and we will discuss how IFITM proteins and tetherin inhibit EBOV infection. © 2012 Blackwell Verlag GmbH.
Various heterologous cells exhibit interferon induced transfer of viral resistance.
Hughes, T K; Blalock, J E; Baron, S
1978-01-01
Previously it was shown that cocultivation of mouse L and human WISH or baby hamster kidney cells in the presence of mouse interferon resulted in decreased viral yield from both cell species. We now show that this phenomenon also occurs when rabbit kidney and human WISH cells, with their corresponding interferons, are cocultivated with human WISH and baby hamster kidney cells, respectively. This finding increases the number of donor cell types to three. The related finding that monkey VERO and chick embryo cells can be recipients of transferred resistance expands the number of heterologous recipient cell species capable of receiving transferred resistence to five. Not all cell types tested have been shown to function in this transfer system. The fact that VERO cells, which do not produce interferon, are capable of receiving transferred resistence is significant because it indicates that the mechanism of transfer does not involve production or interferon by the recipient cells.
Deng, Liufu; Liang, Hua; Xu, Meng; Yang, Xuanming; Burnette, Byron; Arina, Ainhoa; Li, Xiao-Dong; Mauceri, Helena; Beckett, Michael; Darga, Thomas; Huang, Xiaona; Gajewski, Thomas F; Chen, Zhijian J; Fu, Yang-Xin; Weichselbaum, Ralph R
2014-11-20
Ionizing radiation-mediated tumor regression depends on type I interferon (IFN) and the adaptive immune response, but several pathways control I IFN induction. Here, we demonstrate that adaptor protein STING, but not MyD88, is required for type I IFN-dependent antitumor effects of radiation. In dendritic cells (DCs), STING was required for IFN-? induction in response to irradiated-tumor cells. The cytosolic DNA sensor cyclic GMP-AMP (cGAMP) synthase (cGAS) mediated sensing of irradiated-tumor cells in DCs. Moreover, STING was essential for radiation-induced adaptive immune responses, which relied on type I IFN signaling on DCs. Exogenous IFN-? treatment rescued the cross-priming by cGAS or STING-deficient DCs. Accordingly, activation of STING by a second messenger cGAMP administration enhanced antitumor immunity induced by radiation. Thus radiation-mediated antitumor immunity in immunogenic tumors requires a functional cytosolic DNA-sensing pathway and suggests that cGAMP treatment might provide a new strategy to improve radiotherapy. Copyright © 2014 Elsevier Inc. All rights reserved.
THE EFFECTS OF $gamma$-RADIATION ON THE PROTEIN CONTENT OF APPLES AND PEARS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Clarke, I.D.; Fernandes, S.J.G.
1961-11-01
Apples and pears, which had received 1 x l0/sup 5/s rad and 2 x 10/sup 5/ s rad gamma radiation in air at 20-C, were stored with untreated fruit in air at 37 and 32 deg F, respectively. The pulp and peel were frozen and stored in polyethylene bottles until chemical analysis. In general, the results obtained with apple tissue indicated that protein synthesis was unaffected by the treatment. The results obtained with pear tissue clearly indicate that the treatment induced protein synthesis during the storage period, while the levels of protein nitrogen in the untreated fruit remained at amore » fairly steady level. (C.H.)« less
Deckert-Schlüter, M; Rang, A; Weiner, D; Huang, S; Wiestler, O D; Hof, H; Schlüter, D
1996-12-01
Toxoplasma gondii may cause severe infections in immunocompromised patients including fetuses and those with AIDS. Among the factors mediating protection against T. gondii, IFN-gamma has gained special attention. To analyze the role of IFN-gamma in the early phase of toxoplasmosis, IFN-gamma receptor-deficient (IFN-gamma R0/0) mice were orally infected with low-virulent toxoplasms. IFN-gamma R0/0 mice died of the disease up to day 10 postinfection, whereas immunocompetent wild-type (WT) mice developed a chronic toxoplasmosis. Histopathology revealed that in IFN-gamma R0/0 mice, the parasite multiplied unrestrictedly in the small intestine, the intestinal lymphatic tissue, the liver, and the spleen. Ultimately, animals died of a necrotizing hepatitis. In WT mice, the same organs were effected, but multiplication of the parasite was effectively limited. Compared with WT mice, immunohistochemistry and flow cytometry demonstrated that in IFN-gamma R0/0 mice, macrophages were only marginally activated in response to the infection, as evidenced by a reduced expression of major histocompatability complex class II antigens. In addition, immunohistochemistry and RT-PCR showed a reduced production of the macrophage-derived cytokines tumor necrosis factor-alpha, inducible nitric oxide synthase, and IL-1 beta in the liver of IFN-gamma R0/0 mice. In contrast, activation of T cells, recruitment of immune cells to inflammatory foci, and anti-T. gondii IgM antibody production were unaffected by the mutation of the IFN-gamma R. Moreover, induction of IL-2, IL-4, and IL-10 mRNA transcripts in the liver was normal in IFN-gamma R0/0 mice. Adoptive transfer experiments revealed that the immune T cells of WT animals did not protect IFN-gamma R0/0 mice from lethal infection with highly virulent toxoplasms, whereas WT mice were significantly protected by the adoptive transfer. Based on these studies, we conclude that IFN-gamma is absolutely required for an efficient activation of
Interferon-gamma and T-bet expression in a patient with toxoplasmic lymphadenopathy.
Jöhrens, Korinna; Moos, Verena; Schneider, Thomas; Stein, Harald; Anagnostopoulos, Ioannis
2010-04-01
Infection with Toxoplasma gondii (TG) presents in some individuals as a self-limited disease with a predominant lymphadenopathy characterized by prominent B-cell activation. As this is in contrast to the in vitro based concept of a T(h)1-immune response against TG, we investigated native lymphoid tissue and peripheral blood of a patient with serologic evidence of toxoplasmosis to verify which cells show T(h)1-response features. High-level expression of T-bet in monocytoid B-cells, in germinal center B-cells, and in a lesser amount in T cells could be demonstrated by immunohistochemistry. In vitro stimulation of lymph node cells with either TG, staphylococcus enterotoxin B, or phorbol 12-myristate 13-acetate/ionomycin revealed an interferon-gamma expression in T-bet(+) B cells only in the patient and not in controls. Similar results were found for T-bet(+) T cells which were also present in controls. CD4(+) peripheral blood cells stimulated with TG antigens showed a TG-specific but attenuated T(h)1-reactivity in the patient associated with a reduced expression of IL-2 when compared with controls. We conclude that the pathogenesis and course of toxoplasmic lymphadenopathy is based on a T(h)1-cell defect, which becomes compensated by the B cells mounting a T(h)1-like immune response.
Recurrence of depressive disorders after interferon-induced depression
Chiu, W-C; Su, Y-P; Su, K-P; Chen, P-C
2017-01-01
Interferon alpha (IFN-α)-treated patients commonly develop depression during the therapy period. Although most IFN-α-induced depressive disorders achieve remission after IFN-α therapy, no studies have examined the long-term mood effects of IFN-α treatment. We conducted a 12-year population-based cohort study of hepatitis C virus (HCV)-infected patients who were older than 20 years and had received IFN-α therapy. The sample was obtained from the Taiwan National Health Insurance Research Database. The cohort included patients with and without IFN-α-induced depression, matched randomly by age, sex and depression history, at a ratio of 1:10. The follow-up started after the last administration of IFN-α and was designed to determine the incidence of recurrent depressive disorder after IFN-α therapy. A total of 156 subjects were identified as having IFN-α-induced depression and achieving full remission after IFN-α therapy. The overall incidence of recurrent depressive disorders among patients with and without IFN-α-induced depression was 56.8 (95% confidence interval (CI), 42.4–76.1) and 4.1 (95% CI, 2.9–5.8) cases, respectively, per 100 000 person-years, P<0.001. The adjusted hazard ratios for recurrent depressive disorder were 13.5 (95% CI, 9.9–18.3) in the IFN-α-treated cohort and 22.2 (95% CI, 11.2–44.2) in the matched cohort for IFN-α-induced depression patients after adjusting for age, sex, income, urbanization and comorbid diseases. IFN-α-induced depression was associated with a high risk of recurrent depression. It was not a transient disease and might be considered an episode of depressive disorder. Continuation therapy might be considered, and further research is needed. PMID:28170005
Viperin targets flavivirus virulence by inducing assembly of non-infectious capsid particles.
Vonderstein, Kirstin; Nilsson, Emma; Hubel, Philipp; Nygård Skalman, Lars; Upadhyay, Arunkumar; Pasto, Jenny; Pichlmair, Andreas; Lundmark, Richard; Överby, Anna K
2017-10-18
Efficient antiviral immunity requires interference with virus replication at multiple layers targeting diverse steps in the viral life cycle. Here we describe a novel flavivirus inhibition mechanism that results in interferon-mediated obstruction of tick-borne encephalitis virus particle assembly, and involves release of malfunctional membrane associated capsid (C) particles. This mechanism is controlled by the activity of the interferon-induced protein viperin, a broad spectrum antiviral interferon stimulated gene. Through analysis of the viperin-interactome, we identified the Golgi Brefeldin A resistant guanine nucleotide exchange factor 1 (GBF1), as the cellular protein targeted by viperin. Viperin-induced antiviral activity as well as C-particle release was stimulated by GBF1 inhibition and knock down, and reduced by elevated levels of GBF1. Our results suggest that viperin targets flavivirus virulence by inducing the secretion of unproductive non-infectious virus particles, by a GBF1-dependent mechanism. This yet undescribed antiviral mechanism allows potential therapeutic intervention. Importance The interferon response can target viral infection on almost every level, however, very little is known about interference of flavivirus assembly. Here we show that interferon, through the action of viperin, can disturb assembly of tick-borne encephalitis virus. The viperin protein is highly induced after viral infection and exhibit broad-spectrum antiviral activity. However, the mechanism of action is still elusive and appear to vary between the different viruses, indicating that cellular targets utilized by several viruses might be involved. In this study we show that viperin induce capsid particle release by interacting and inhibiting the function of the cellular protein Golgi Brefeldin A resistant guanine nucleotide exchange factor 1 (GBF1). GBF1 is a key protein in the cellular secretory pathway and essential in the life cycle of many viruses, also targeted by
Oshiumi, Hiroyuki; Matsumoto, Misako; Hatakeyama, Shigetsugu; Seya, Tsukasa
2009-01-09
RIG-I (retinoic acid-inducible gene-I), a cytoplasmic RNA helicase, interacts with IPS-1/MAVS/Cardif/VISA, a protein on the outer membrane of mitochondria, to signal the presence of virus-derived RNA and induce type I interferon production. Activation of RIG-I requires the ubiquitin ligase, TRIM25, which mediates lysine 63-linked polyubiquitination of the RIG-I N-terminal CARD-like region. However, how this modification proceeds for activation of IPS-1 by RIG-I remains unclear. Here we identify an alternative factor, Riplet/RNF135, that promotes RIG-I activation independent of TRIM25. The Riplet/RNF135 protein consists of an N-terminal RING finger domain, C-terminal SPRY and PRY motifs, and shows sequence similarity to TRIM25. Immunoprecipitation analyses demonstrated that the C-terminal helicase and repressor domains of RIG-I interact with the Riplet/RNF135 C-terminal region, whereas the CARD-like region of RIG-I is dispensable for this interaction. Riplet/RNF135 promotes lysine 63-linked polyubiquitination of the C-terminal region of RIG-I, modification of which differs from the N-terminal ubiquitination by TRIM25. Overexpression and knockdown analyses revealed that Riplet/RNF135 promotes RIG-I-mediated interferon-beta promoter activation and inhibits propagation of the negative-strand RNA virus, vesicular stomatitis virus. Our data suggest that Riplet/RNF135 is a novel factor of the RIG-I pathway that is involved in the evoking of human innate immunity against RNA virus infection, and activates RIG-I through ubiquitination of its C-terminal region. We infer that a variety of RIG-I-ubiquitinating molecular complexes sustain RIG-I activation to modulate RNA virus replication in the cytoplasm.
Using support vector machine to predict beta- and gamma-turns in proteins.
Hu, Xiuzhen; Li, Qianzhong
2008-09-01
By using the composite vector with increment of diversity, position conservation scoring function, and predictive secondary structures to express the information of sequence, a support vector machine (SVM) algorithm for predicting beta- and gamma-turns in the proteins is proposed. The 426 and 320 nonhomologous protein chains described by Guruprasad and Rajkumar (Guruprasad and Rajkumar J. Biosci 2000, 25,143) are used for training and testing the predictive model of the beta- and gamma-turns, respectively. The overall prediction accuracy and the Matthews correlation coefficient in 7-fold cross-validation are 79.8% and 0.47, respectively, for the beta-turns. The overall prediction accuracy in 5-fold cross-validation is 61.0% for the gamma-turns. These results are significantly higher than the other algorithms in the prediction of beta- and gamma-turns using the same datasets. In addition, the 547 and 823 nonhomologous protein chains described by Fuchs and Alix (Fuchs and Alix Proteins: Struct Funct Bioinform 2005, 59, 828) are used for training and testing the predictive model of the beta- and gamma-turns, and better results are obtained. This algorithm may be helpful to improve the performance of protein turns' prediction. To ensure the ability of the SVM method to correctly classify beta-turn and non-beta-turn (gamma-turn and non-gamma-turn), the receiver operating characteristic threshold independent measure curves are provided. (c) 2008 Wiley Periodicals, Inc.
Rapid activation of the interferon system in vivo.
Dianzani, F; Gullino, P; Baron, S
1978-01-01
Experiments were carried out to study the kinetics of local interferon production in the subcutaneous tissues of rats stimulated with Newcastle disease virus. Specifically, the interferon produced and released in the extracellular fluids was collected at various intervals of time in micropore chambers implanted into the subcutaneous tissue of rats. Interferon was detected at moderate titers 1 h after induction, and it was present at high titer at 2 h. The interferon levels remained remarkably high in the samples collected after 3, 5, and 24 h, and in some rats it was still detectable after 48 and 72 h. Since control experiments showed that it requires 2 to 3 h for interferon to penetrate the chambers, it may be concluded that high concentrations of interferon are present in the extracellular fluid within 1 h of induction. The evaluation of the kinetics of production and of the concentrations attained in the extracellular fluid suggests that in a solid tissue a cell infected by a potent interferon inducer may produce interferon early enough and in sufficient quantity to protect neighboring cells before the production of progeny virions. PMID:669799
Durward-Diioia, Marina; Harms, Jerome; Khan, Mike; Hall, Cherisse; Smith, Judith A.
2015-01-01
Brucella melitensis is a well-adapted zoonotic pathogen considered a scourge of mankind since recorded history. In some cases, initial infection leads to chronic and reactivating brucellosis, incurring significant morbidity and economic loss. The mechanism by which B. melitensis subverts adaptive immunological memory is poorly understood. Previous work has shown that Brucella-specific CD8+ T cells express gamma interferon (IFN-γ) and can transition to long-lived memory cells but are not polyfunctional. In this study, chronic infection of mice with B. melitensis led to CD8+ T cell exhaustion, manifested by programmed cell death 1 (PD-1) and lymphocyte activation gene 3 (LAG-3) expression and a lack of IFN-γ production. The B. melitensis-specific CD8+ T cells that produced IFN-γ expressed less IFN-γ per cell than did CD8+ cells from uninfected mice. Both memory precursor (CD8+ LFA1HI CD127HI KLRG1LO) and long-lived memory (CD8+ CD27HI CD127HI KLRG1LO) cells were identified during chronic infection. Interestingly, after adoptive transfer, mice receiving cells from chronically infected animals were able to contain infection more rapidly than recipients of cells from acutely infected or uninfected donors, although the proportions of exhausted CD8+ T cells increased after adoptive transfer in both challenged and unchallenged recipients. CD8+ T cells of challenged recipients initially retained the stunted IFN-γ production found prior to transfer, and cells from acutely infected mice were never seen to transition to either memory subset at all time points tested, up to 30 days post-primary infection, suggesting a delay in the generation of memory. Here we have identified defects in Brucella-responsive CD8+ T cells that allow chronic persistence of infection. PMID:26416901
Nogueira, Marcelle Almeida de Sousa; Gavioli, Camila Fátima Biancardi; Pereira, Nátalli Zanete; de Carvalho, Gabriel Costa; Domingues, Rosana; Aoki, Valéria; Sato, Maria Notomi
2015-04-01
Lichen planus (LP) is a common inflammatory skin disease of unknown etiology. Reports of a common transactivation of quiescent human endogenous retroviruses (HERVs) support the connection of viruses to the disease. HERVs are ancient retroviral sequences in the human genome and their transcription is often deregulated in cancer and autoimmune diseases. We explored the transcriptional activity of HERV sequences as well as the antiviral restriction factor and interferon-inducible genes in the skin from LP patients and healthy control (HC) donors. The study included 13 skin biopsies from patients with LP and 12 controls. Real-time PCR assay identified significant decrease in the HERV-K gag and env mRNA expression levels in LP subjects, when compared to control group. The expressions of HERV-K18 and HERV-W env were also inhibited in the skin of LP patients. We observed a strong correlation between HERV-K gag with other HERV sequences, regardless the down-modulation of transcripts levels in LP group. In contrast, a significant up-regulation of the cytidine deaminase APOBEC 3G (apolipoprotein B mRNA-editing), and the GTPase MxA (Myxovirus resistance A) mRNA expression level was identified in the LP skin specimens. Other transcript expressions, such as the master regulator of type I interferon-dependent immune responses, STING (stimulator of interferon genes) and IRF-7 (interferon regulatory factor 7), IFN-β and the inflammassome NALP3, had increased levels in LP, when compared to HC group. Our study suggests that interferon-inducible factors, in addition to their role in innate immunity against exogenous pathogens, contribute to the immune control of HERVs. Evaluation of the balance between HERV and interferon-inducible factor expression could possibly contribute to surveillance of inflammatory/malignant status of skin diseases.
Kast, Richard E
2008-10-01
This note mechanistically accounts for recent unexplained findings that all-trans retinoic acid (ATRA, also termed tretinoin) exerts an anti-viral effect against hepatitis C virus (HCV) in chronically infected patients, in whom ATRA also showed synergy with interferon-alpha. How HCV replication was suppressed was unclear. Both effects of ATRA can be accounted for by ATRA's upregulation of RIG protein, an 18 kDa product of retinoic induced gene-1. Increased RIG then couples ATRA to increased Type 1 interferons' production. Details of this mechanism predict that ATRA will similarly augment interferon-a activity in treating chronic myelogenous leukemia, melanoma, myeloma and renal cell carcinoma and that the addition of ribavirin and/or bexarotene will each incrementally enhance interferon-a responses in these cancers.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Choi, Hyeon-Jae; Lee, Jin-Hwee; Jung, Yi-Sook, E-mail: yisjung@ajou.ac.kr
Highlights: • (+)-Nootkatone inhibits TNF-α/IFN-γ-induced TARC and MDC expression in HaCaT cells. • PKCζ, p38 MAPK, or NF-κB mediate TNF-α/IFN-γ-induced TARC and MDC expression. • (+)-Nootkatone inhibits TNF-α/IFN-γ-induced activation of PKCζ, p38 MAPK, or NF-κB. • (+)-Nootkatone suppresses chemokine expression by inhibiting of PKCζ and p38 pathways. - Abstract: Chemokines are important mediators of cell migration, and thymus and activation-regulated chemokine (TARC/CCL17) and macrophage-derived chemokine (MDC/CCL22) are well-known typical inflammatory chemokines involved in atopic dermatitis (AD). (+)-Nootkatone is the major component of Cyperus rotundus. (+)-Nootkatone has antiallergic, anti-inflammatory, and antiplatelet activities. The purpose of this study was to investigate themore » effect of (+)-nootkatone on tumor necrosis factor α (TNF-α)/interferon γ (IFN-γ)-induced expression of Th2 chemokines in HaCaT cells. We found that (+)-nootkatone inhibited the TNF-α/IFN-γ-induced expression of TARC/CCL17 and MDC/CCL22 mRNA in HaCaT cells. It also significantly inhibited TNF-α/IFN-γ-induced activation of nuclear factor kappa B (NF-κB), p38 mitogen-activated protein kinase (MAPK), and protein kinase Cζ (PKCζ). Furthermore, we showed that PKCζ and p38 MAPK contributed to the inhibition of TNF-α/IFN-γ-induced TARC/CCL17 and MDC/CCL22 expression by blocking IκBα degradation in HaCaT cells. Taken together, these results suggest that (+)-nootkatone may suppress TNF-α/IFN-γ-induced TARC/CCL17 and MDC/CCL22 expression in HaCaT cells by inhibiting of PKCζ and p38 MAPK signaling pathways that lead to activation of NF-κB. We propose that (+)-nootkatone may be a useful therapeutic candidate for inflammatory skin diseases such as AD.« less
Inhibition of Breast Cancer by Repression of Angiogenic Hypoxia-Inducible Transcription Factors
2003-09-01
cancer cells to death receptor-induced apoptosis by inhibition ofNF-KB: Synergistic action of Apo2L/TRAIL, Interferon-y, Aspirin and Apigenin . (Abstract...of !KK0 (with ::leety! ,~81iCy!iC ::H~irl" ASA), and CK2 (with the plant flavonoid, apigenin ), results in loss of NF-KB-dependent expression of BcI...reduction of NF-KS-induced survival proteins by ASA and apigenin synergizes with interferon-y-mediated elevation of death signaling proteins to
Li, Dengzhe; Gale, Robert Peter; Liu, Yanfeng; Lei, Baoxia; Wang, Yuan; Diao, Dongmei; Zhang, Mei
2017-07-01
Multi-drug resistance (MDR), immune suppression and decreased apoptosis are important causes of therapy-failure in leukaemia. Short interfering RNAs (siRNAs) down-regulate gene transcription, have sequence-independent immune-stimulatory effects and synergize with other anti-cancer therapies in some experimental models. We designed a siRNA targeting MDR1 with 5'-triphosphate ends (3p-siRNA-MDR1). Treatment of leukaemia cells with 3p-siRNA-MDR1 down-regulated MDR1 expression, reduced-drug resistance and induced immune and pro-apoptotic effects in drug-resistant HL-60/Adr and K562/Adr human leukaemia cell lines. We show mechanisms-of-action of these effects involve alterations in the anti-viral cytosolic retinoic acid-inducible protein-I (RIG-I; encoded by RIG-I or DDX58) mediated type-I interferon signal induction, interferon-gamma-inducible protein 10 (IP-10; encoded by IP10 or CXCL10) secretion, major histocompatibility complex-I expression (MHC-I) and caspase-mediated cell apoptosis. 3p-siRNA-MDR1 transfection also enhanced the anti-leukaemia efficacy of doxorubicin. These data suggest a possible synergistic role for 3p-siRNA-MDR1 in anti-leukaemia therapy. Copyright © 2017 Elsevier Ltd. All rights reserved.
Tan, Juan; Qiao, Wentao; Wang, Jian; Xu, Fengwen; Li, Yue; Zhou, Jun; Chen, Qimin; Geng, Yunqi
2008-01-01
Interferon-induced proteins (IFPs) exert multiple functions corresponding to diverse interferon signals. However, the intracellular functions of many IFPs are not fully characterized. Here, we report that IFP35, a member of the IFP family with a molecular mass of 35 kDa, can interact with the bovine Tas (BTas) regulatory protein of bovine foamy virus (BFV). The interaction involves NID2 (IFP35/Nmi homology domain) of IFP35 and the central domain of BTas. The overexpression of IFP35 disturbs the ability of BTas to activate viral-gene transcription and inhibits viral replication. The depletion of endogenous IFP35 by interfering RNA can promote the activation of BFV, suggesting an inhibitory function of IFP35 in viral-gene expression. In addition, IFP35 can interact with the homologous regulatory protein of prototype FV and arrest viral replication and repress viral transcription. Our study suggests that IFP35 may represent a novel pathway of interferon-mediated antiviral activity in host organisms that plays a role in the maintenance of FV latency. PMID:18305040
DOE Office of Scientific and Technical Information (OSTI.GOV)
Khaiboullina, Svetlana F., E-mail: sv.khaiboullina@gmail.com; Morzunov, Sergey P.; Boichuk, Sergei V.
2013-09-01
Hantaviruses are negative strand RNA species that replicate predominantly in the cytoplasm. They also activate numerous cellular responses, but their involvement in nuclear processes is yet to be established. Using human umbilical vein endothelial cells (HUVECs), this study investigates the molecular finger-print of nuclear transcription factors during hantavirus infection. The viral-replication-dependent activation of pro-myelocytic leukemia protein (PML) was followed by subsequent localization in nuclear bodies (NBs). PML was also found in close proximity to activated Sp100 nuclear antigen and interferon-stimulated gene 20 kDa protein (ISG-20), but co-localization with death-domain associated protein-6 (DAXX) was not observed. These data demonstrate that hantavirusmore » triggers PML activation and localization in NBs in the absence of DAXX-PLM-NB co-localization. The results suggest that viral infection interferes with DAXX-mediated apoptosis, and expression of interferon-activated Sp100 and ISG-20 proteins may indicate intracellular intrinsic antiviral attempts.« less
Pestivirus Npro Directly Interacts with Interferon Regulatory Factor 3 Monomer and Dimer
Holthauzen, Luis Marcelo F.; Ruggli, Nicolas
2016-01-01
ABSTRACT Interferon regulatory factor 3 (IRF3) is a transcription factor involved in the activation of type I alpha/beta interferon (IFN-α/β) in response to viral infection. Upon viral infection, the IRF3 monomer is activated into a phosphorylated dimer, which induces the transcription of interferon genes in the nucleus. Viruses have evolved several ways to target IRF3 in order to subvert the innate immune response. Pestiviruses, such as classical swine fever virus (CSFV), target IRF3 for ubiquitination and subsequent proteasomal degradation. This is mediated by the viral protein Npro that interacts with IRF3, but the molecular details for this interaction are largely unknown. We used recombinant Npro and IRF3 proteins and show that Npro interacts with IRF3 directly without additional proteins and forms a soluble 1:1 complex. The full-length IRF3 but not merely either of the individual domains is required for this interaction. The interaction between Npro and IRF3 is not dependent on the activation state of IRF3, since Npro binds to a constitutively active form of IRF3 in the presence of its transcriptional coactivator, CREB-binding protein (CBP). The results indicate that the Npro-binding site on IRF3 encompasses a region that is unperturbed by the phosphorylation and subsequent activation of IRF3 and thus excludes the dimer interface and CBP-binding site. IMPORTANCE The pestivirus N-terminal protease, Npro, is essential for evading the host's immune system by facilitating the degradation of interferon regulatory factor 3 (IRF3). However, the nature of the Npro interaction with IRF3, including the IRF3 species (inactive monomer versus activated dimer) that Npro targets for degradation, is largely unknown. We show that classical swine fever virus Npro and porcine IRF3 directly interact in solution and that full-length IRF3 is required for interaction with Npro. Additionally, Npro interacts with a constitutively active form of IRF3 bound to its transcriptional
Shigella outer membrane protein PSSP-1 is broadly protective against Shigella infection.
Kim, Jae-Ouk; Rho, Semi; Kim, Su Hee; Kim, Heejoo; Song, Hyo Jin; Kim, Eun Jin; Kim, Ryang Yeo; Kim, Eun Hye; Sinha, Anuradha; Dey, Ayan; Yang, Jae Seung; Song, Man Ki; Nandy, Ranjan Kumar; Czerkinsky, Cecil; Kim, Dong Wook
2015-04-01
In developing countries, Shigella is a primary cause of diarrhea in infants and young children. Although antibiotic therapy is an effective treatment for shigellosis, therapeutic options are narrowing due to the emergence of antibiotic resistance. Thus, preventive vaccination could become the most efficacious approach for controlling shigellosis. We have identified several conserved protein antigens that are shared by multiple Shigella serotypes and species. Among these, one antigen induced cross-protection against experimental shigellosis, and we have named it pan-Shigella surface protein 1 (PSSP-1). PSSP-1-induced protection requires a mucosal administration route and coadministration of an adjuvant. When PSSP-1 was administered intranasally, it induced cross-protection against Shigella flexneri serotypes 2a, 5a, and 6, Shigella boydii, Shigella sonnei, and Shigella dysenteriae serotype 1. Intradermally administered PSSP-1 induced strong serum antibody responses but failed to induce protection in the mouse lung pneumonia model. In contrast, intranasal administration elicited efficient local and systemic antibody responses and production of interleukin 17A and gamma interferon. Interestingly, blood samples from patients with recent-onset shigellosis showed variable but significant mucosal antibody responses to other conserved Shigella protein antigens but not to PSSP-1. We suggest that PSSP-1 is a promising antigen for a broadly protective vaccine against Shigella. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L
1997-01-01
Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728
Han, Xuesheng; Parker, Tory L
2017-06-01
Lemongrass ( Cymbopogon flexuosus ) essential oil (LEO), which has citral as its main component, has exhibited anti-inflammatory effect in both animal and human cells. In this study, we evaluated the anti-inflammatory activity of a commercially available LEO in pre-inflamed human dermal fibroblasts. We first studied the impact of LEO on 17 protein biomarkers that are critically associated with inflammation and tissue remodeling. LEO significantly inhibited production of the inflammatory biomarkers vascular cell adhesion molecule 1 (VCAM-1), interferon gamma-induced protein 10 (IP-10), interferon-inducible T-cell alpha chemoattractant (I-TAC), and monokine induced by gamma interferon (MIG); decreased levels of the tissue remodeling biomarkers collagen-I and III, epidermal growth factor receptor (EGFR), and plasminogen activator inhibitor (PAI-1); and inhibited the immunomodulatory biomarker macrophage colony-stimulating factor (M-CSF). Furthermore, we studied the impact of LEO on genome-wide gene expression profiles. LEO significantly modulated global gene expression and robustly impacted signaling pathways, many of which are critical for inflammation and tissue remodeling processes. This study provides the first evidence of the anti-inflammatory activity of LEO in human skin cells and indicates that it is a good therapeutic candidate for treating inflammatory conditions of the skin.
Bausero, Maria A; Gastpar, Robert; Multhoff, Gabriele; Asea, Alexzander
2005-09-01
IFN-gamma exhibits differential effects depending on the target and can induce cellular activation and enhance survival or mediate cell death via activation of apoptotic pathways. In this study, we demonstrate an alternative mechanism by which IFN-gamma enhances tumor recognition, mediated by the active release of Hsp72. We demonstrate that stimulation of 4T1 breast adenocarcinoma cells and K562 erythroleukemic cells with IFN-gamma triggers the cellular stress response, which results in the enhanced expression of total Hsp72 expression without a significant increase in cell death. Intracellular expression of Hsp72 was abrogated in cells stably transfected with a mutant hsf-1 gene. IFN-gamma-induced Hsp72 expression correlated with enhanced surface expression and consequent release of Hsp72 into the culture medium. Pretreatment of tumors with compounds known to the block the classical protein transport pathway, including monensin, brefeldin A, tunicamycin, and thapsigargin, did not significantly block Hsp72 release. However, pretreatment with intracellular calcium chelator BAPTA-AM or disruption of lipid rafts using methyl beta-cyclodextrin completely abrogated IFN-gamma-induced Hsp72 release. Biochemical characterization revealed that Hsp72 is released within exosomes and has the ability to up-regulate CD83 expression and stimulate IL-12 release by naive dendritic cells. Pretreatment with neutralizing mAb or depletion of Hsp72 completely abrogated its chaperokine function. Taken together, these findings are indicative of an additional previously unknown mechanism by which IFN-gamma promotes tumor surveillance and furthers our understanding of the central role of extracellular Hsp72 as an endogenous adjuvant and danger signal.
Jiang, Yanbo; Shi, Kai; Wang, Shuo; Li, Xuefeng; Cui, Fude
2010-12-01
This study presents a preliminary exploration on extending the half-life of therapeutic proteins by crystallization strategy without new molecular entities generation. Recombinant human interferon (rhIFN) α-2b, a model protein drug in this case, was crystallized using a hanging-drop vapor diffusion method. A novel chelating technique with metal ions was employed to promote crystals formation. The effects of key factors such as seeding protein concentration, pH of the hanging drop, ionic strength of the equilibration solution, and precipitants were investigated. Size-exclusion liquid chromatography, antiviral activity determination, and enzyme-linked immunosorbent assay indicated that both the molecular integrity and biological potency of rhIFN were not significantly affected by crystallization process. In addition, the in vitro release behavior of rhIFN from crystal lattice was characterized by an initial fast release, followed by a sustained release up to 48 hour. The work described here suggested an exciting possibility of therapeutic protein crystals as a long-acting formulation.
Wang, Song; Chi, Xiaojuan; Wei, Haitao; Chen, Yuhai; Chen, Zhilong; Huang, Shile; Chen, Ji-Long
2014-08-01
Although alteration in host cellular translation machinery occurs in virus-infected cells, the role of such alteration and the precise pathogenic processes are not well understood. Influenza A virus (IAV) infection shuts off host cell gene expression at transcriptional and translational levels. Here, we found that the protein level of eukaryotic translation initiation factor 4B (eIF4B), an integral component of the translation initiation apparatus, was dramatically reduced in A549 cells as well as in the lung, spleen, and thymus of mice infected with IAV. The decrease in eIF4B level was attributed to lysosomal degradation of eIF4B, which was induced by viral NS1 protein. Silencing eIF4B expression in A549 cells significantly promoted IAV replication, and conversely, overexpression of eIF4B markedly inhibited the viral replication. Importantly, we observed that eIF4B knockdown transgenic mice were more susceptible to IAV infection, exhibiting faster weight loss, shorter survival time, and more-severe organ damage. Furthermore, we demonstrated that eIF4B regulated the expression of interferon-induced transmembrane protein 3 (IFITM3), a critical protein involved in immune defense against a variety of RNA viruses, including influenza virus. Taken together, our findings reveal that eIF4B plays an important role in host defense against IAV infection at least by regulating the expression of IFITM3, which restricts viral entry and thereby blocks early stages of viral production. These data also indicate that influenza virus has evolved a strategy to overcome host innate immunity by downregulating eIF4B protein. Influenza A virus (IAV) infection stimulates the host innate immune system, in part, by inducing interferons (IFNs). Secreted IFNs activate the Janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway, leading to elevated transcription of a large group of IFN-stimulated genes that have antiviral function. To circumvent the host innate
McMahan, Zsuzsanna H; Wigley, Frederick M; Casciola-Rosen, Livia
2017-06-01
To evaluate whether scleroderma patients who are double-positive for anti-interferon-inducible protein 16 (anti-IFI-16) antibodies and anticentromere (anti-CENP) antibodies are at increased risk for significant digital vascular events relative to patients positive for anti-CENP antibodies alone. Sera from 165 scleroderma patients who tested positive for anti-CENP antibodies upon clinical evaluation were reassayed for both anti-CENP and anti-IFI-16 antibodies using enzyme-linked immunosorbent assay testing. Patients who were positive for anti-CENP antibodies alone were then compared to patients who were double-positive for both anti-IFI-16 and anti-CENP antibodies. The association between a history of significant digital vascular events (digital pits, ischemic digital ulcers, and/or gangrene) and double-positive antibody status was examined using chi-square tests. After completion of univariate analysis, multivariable analyses were done to adjust for clinically relevant covariates. Of the 165 anti-CENP antibody positive patients, 21 (12.7%) also had anti-IFI-16 antibodies. Patients who were double-positive for anti-CENP and anti-IFI-16 antibodies were more likely to have had digital pits, ischemic digital ulcers, and/or gangrene (P = 0.03). After adjustment for clinically relevant covariates (age, cutaneous subtype, disease duration, and smoking), double-positive patients remained at significantly higher odds of having severe Raynaud's phenomenon (odds ratio 3.5 [95% confidence interval 1.1-11.1]; P = 0.03). Scleroderma patients who are double-positive for antibodies recognizing CENP and IFI-16 are significantly more likely to have significant digital vascular events during the course of their disease. This study provides further evidence that anti-CENP and anti-IFI-16 antibodies are disease biomarkers that may be used for risk stratification of vascular events in scleroderma. © 2016, American College of Rheumatology.
Cekay, Michael John; Roesler, Stefanie; Frank, Tanja; Knuth, Anne-Kathrin; Eckhardt, Ines; Fulda, Simone
2017-12-01
Since cancer cells often evade apoptosis, induction of necroptosis as another mode of programmed cell death is considered a promising therapeutic alternative. Here, we identify a novel synergistic interaction of Smac mimetics that antagonize x-linked Inhibitor of Apoptosis (XIAP), cellular Inhibitor of Apoptosis (cIAP) 1 and 2 with interferon (IFN)γ to induce necroptosis in apoptosis-resistant cancer cells in which caspase activation is blocked. This synergism is confirmed by calculation of combination indices (CIs) and found in both solid and hematological cancer cell lines as well as for different Smac mimetics (i.e. BV6, Birinapant), pointing to a broader relevance. Importantly, individual genetic knockdown of key components of necroptosis signaling, i.e. receptor-interacting protein (RIP) 1, RIP3 or mixed lineage kinase domain-like pseudokinase (MLKL), significantly protects from BV6/IFNγ-induced cell death. Similarly, pharmacological inhibitors of RIP1 (necrostatin-1(Nec-1)), RIP3 (GSK'872) or MLKL (necrosulfonamide (NSA)) significantly reduce BV6/IFNγ-stimulated cell death. Of note, IFN-regulatory factor (IRF)1 is required for BV6/IFNγ-mediated necroptosis, as IRF1 silencing provides protection from cell death. By comparison, antibodies blocking tumor necrosis factor (TNF)α, TNF-related apoptosis-inducing ligand (TRAIL) or CD95 ligand fail to inhibit BV6/IFNγ-induced cell death, pointing to a mechanism independently of death receptor ligands. This is the first report showing that Smac mimetics synergize with IFNγ to trigger necroptosis in apoptosis-resistant cancer cells with important implications for Smac mimetic-based strategies for the treatment of cancer. Copyright © 2017 Elsevier B.V. All rights reserved.
Gamma-ray background induced by atmospheric neutrons
NASA Astrophysics Data System (ADS)
Ma, Y.-Q.
1984-03-01
A small piggyback detector system is used to study the reduction of gamma-ray background induced by atmospheric neutrons in the type of actively shielded gamma-ray spectroscopes. The system consists of two 1.5 x 1.5 arcsec NaI crystal units, one of which is surrounded by some neutron shield material. The results of a balloon flight in 1981 are presented. The data show that a shield of 3 cm-thick pure paraffin cannot reduce the gamma-ray background. On the contrary, it may even cause some enhancement.
Ohsugi, Tomoyuki; Yamaguchi, Kiyoshi; Zhu, Chi; Ikenoue, Tsuneo; Furukawa, Yoichi
2017-01-01
Impaired Wnt signaling pathway plays a crucial role in the development of colorectal cancer through activation of the β-catenin/TCF7L2 complex. Although genes up-regulated by Wnt/β-catenin signaling have been intensively studied, the roles of down-regulated genes are poorly understood. In this study, we explored a global gene expression of colorectal cancer cells transfected with β-catenin siRNAs or a dominant negative form of TCF7L2 (dnTCF7L2), and identified a set of genes down-regulated by Wnt/β-catenin signaling. Among the genes, we focused here on IFIT2, a gene encoding interferon-induced protein with tetratricopeptide repeats. A reporter assay using plasmids containing a 5’-flanking region of the gene showed that the reporter activity was enhanced by either transduction of β-catenin siRNA or dnTCF7L2, suggesting that the region is involved in the transcriptional regulation as a downstream of the β-catenin/TCF7L2 complex. Consistent with this result, expression of IFIT2 was significantly lower in colorectal cancer tissues than that in normal tissues. Exogenous IFIT2 expression decreased cell proliferation and increased apoptosis of colorectal cancer cells. These data suggested that the down-regulation of IFIT2 by Wnt/β-catenin signaling may play a vital role in human colorectal carcinogenesis through the suppression of apoptosis. PMID:29245969
Pegylated interferon de novo-induce autoimmune haemolytic anaemia in chronic hepatitis C patient.
Said, Ashraf; Elbahrawy, Ashraf; Alfiomy, Mohamed; Abdellah, Mohamed; Shahat, Khaled; Salah, Mohamed; Mostafa, Sadek; Elwassief, Ahmed; Aboelfotoh, Attef; Abdelhafeez, Hafez; El-Sherif, Assem
2011-08-11
A 55-year-old Egyptian woman with chronic hepatitis C undergoing treatment with pegylated interferon (Peg-IFN) alfa-2a plus ribavirin was referred to our hospital on November 2010 with prolonged easy fatigability and an attack of syncope; she had no prior history of autoimmune disorders or allergy. Laboratory investigations documented the presence of Peg-IFN induced autoimmune haemolytic anaemia and autoimmune thyroiditis. Intravenous γ globulin (IVGG) failed to correct the autoimmune process; on the other hand steroid therapy dramatically corrected both haematological and thyroid values, and step down the immune process. Our report indicated that Peg-IFN de novo-induce autoimmune haemolysis, documenting a previous report. IVGG failed to step down the immune process in our case.
de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M
2009-10-01
A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.
The structure of the human interferon alpha/beta receptor gene.
Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G
1992-02-05
Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.
The interferon response circuit in antiviral host defense.
Haller, O; Weber, F
2009-01-01
Viruses have learned to multiply in the face of a powerful innate and adaptive immune response of the host. They have evolved multiple strategies to evade the interferon (IFN) system which would otherwise limit virus growth at an early stage of infection. IFNs induce the synthesis of a range of antiviral proteins which serve as cell-autonomous intrinsic restriction factors. For example, the dynamin-like MxA GTPase inhibits the multiplication of influenza and bunyaviruses (such as La Crosse virus, Hantaan virus, Rift Valley Fever virus, and Crimean-Congo hemorrhagic fever virus) by binding and sequestering the nucleocapsid protein into large perinuclear complexes. To overcome such intracellular restrictions, virulent viruses either inhibit IFN synthesis, bind and inactivate secreted IFN molecules, block IFN-activated signaling, or disturb the action of IFN-induced antiviral proteins. Many viruses produce specialized proteins to disarm the danger signal or express virulence genes that target members of the IFN regulatory factor family (IRFs) or components of the JAK-STAT signaling pathway. An alternative evasion strategy is based on extreme viral replication speed which out-competes the IFN response. The identification of viral proteins with IFN antagonistic functions has great implications for disease prevention and therapy. Virus mutants lacking IFN antagonistic properties represent safe yet highly immunogenic candidate vaccines. Furthermore, novel drugs intercepting viral IFN-antagonists could be used to disarm the viral intruders.
Keck, Nicolas; Boschiroli, Maria-Laura; Smyej, Florence; Vogler, Valérie; Moyen, Jean-Louis; Desvaux, Stéphanie
2018-01-01
In the French Camargue region, where bovine tuberculosis had been enzootic for several years in bullfighting cattle herds, the gamma-interferon (IFN) assay was used since 2003 in parallel with the intradermal test in order to increase overall disease detection sensitivity in infected herds. This study presents the results of a field-evaluation of the assay during a 10-year period (2004-2014) of disease control and surveillance program and explores the particular pattern of IFN assay results in bullfight herds in comparison to cattle from other regions of France. The low sensitivity [59.2% (50.6; 67.3)] of IFN assay using the tuberculin stimulation could be related to the poor gamma-IFN production from bullfight cattle blood cells which is significantly lower than in animals of conventional breeds. The characteristics of the assay were progressively adapted to the epidemiological situation and the desired strategic applications. Data analysis with a receiver operating characteristic curve based on a simple S/P value algorithm allowed for the determination of a new cutoff adapted for a global screening, giving a high specificity of 99.9% results and a high accuracy of the assay. Having regularly risen to above 5% since 2005, with a peak around 10% in 2010, the annual incidence dropped to under 1% in 2014. The positive predictive value relative to the bacteriological confirmation evolved during the years, from 33% in 2009 to 12% during the last screening period, a normal trend in a context of decreasing prevalence. The estimated rate of false-positive reactions during screening campaigns was 0.67%, confirming the high specificity of the test, measured in bTB negative herds, in this epidemiological context. The proportion of false-positive reactions decreased with the age and was higher in males than in females. Although these results indicate that the IFN assay is accurate in the field, it also emphasizes great differences between interferon quantities produced by
Type I interferon and pattern recognition receptor signaling following particulate matter inhalation
2012-01-01
Background Welding, a process that generates an aerosol containing gases and metal-rich particulates, induces adverse physiological effects including inflammation, immunosuppression and cardiovascular dysfunction. This study utilized microarray technology and subsequent pathway analysis as an exploratory search for markers/mechanisms of in vivo systemic effects following inhalation. Mice were exposed by inhalation to gas metal arc – stainless steel (GMA-SS) welding fume at 40 mg/m3 for 3 hr/d for 10 d and sacrificed 4 hr, 14 d and 28 d post-exposure. Whole blood cells, aorta and lung were harvested for global gene expression analysis with subsequent Ingenuity Pathway Analysis and confirmatory qRT-PCR. Serum was collected for protein profiling. Results The novel finding was a dominant type I interferon signaling network with the transcription factor Irf7 as a central component maintained through 28 d. Remarkably, these effects showed consistency across all tissues indicating a systemic type I interferon response that was complemented by changes in serum proteins (decreased MMP-9, CRP and increased VCAM1, oncostatin M, IP-10). In addition, pulmonary expression of interferon α and β and Irf7 specific pattern recognition receptors (PRR) and signaling molecules (Ddx58, Ifih1, Dhx58, ISGF3) were induced, an effect that showed specificity when compared to other inflammatory exposures. Also, a canonical pathway indicated a coordinated response of multiple PRR and associated signaling molecules (Tlr7, Tlr2, Clec7a, Nlrp3, Myd88) to inhalation of GMA-SS. Conclusion This methodological approach has the potential to identify consistent, prominent and/or novel pathways and provides insight into mechanisms that contribute to pulmonary and systemic effects following toxicant exposure. PMID:22776377
Erdely, Aaron; Antonini, James M; Salmen-Muniz, Rebecca; Liston, Angie; Hulderman, Tracy; Simeonova, Petia P; Kashon, Michael L; Li, Shengqiao; Gu, Ja K; Stone, Samuel; Chen, Bean T; Frazer, David G; Zeidler-Erdely, Patti C
2012-07-09
Welding, a process that generates an aerosol containing gases and metal-rich particulates, induces adverse physiological effects including inflammation, immunosuppression and cardiovascular dysfunction. This study utilized microarray technology and subsequent pathway analysis as an exploratory search for markers/mechanisms of in vivo systemic effects following inhalation. Mice were exposed by inhalation to gas metal arc - stainless steel (GMA-SS) welding fume at 40 mg/m3 for 3 hr/d for 10 d and sacrificed 4 hr, 14 d and 28 d post-exposure. Whole blood cells, aorta and lung were harvested for global gene expression analysis with subsequent Ingenuity Pathway Analysis and confirmatory qRT-PCR. Serum was collected for protein profiling. The novel finding was a dominant type I interferon signaling network with the transcription factor Irf7 as a central component maintained through 28 d. Remarkably, these effects showed consistency across all tissues indicating a systemic type I interferon response that was complemented by changes in serum proteins (decreased MMP-9, CRP and increased VCAM1, oncostatin M, IP-10). In addition, pulmonary expression of interferon α and β and Irf7 specific pattern recognition receptors (PRR) and signaling molecules (Ddx58, Ifih1, Dhx58, ISGF3) were induced, an effect that showed specificity when compared to other inflammatory exposures. Also, a canonical pathway indicated a coordinated response of multiple PRR and associated signaling molecules (Tlr7, Tlr2, Clec7a, Nlrp3, Myd88) to inhalation of GMA-SS. This methodological approach has the potential to identify consistent, prominent and/or novel pathways and provides insight into mechanisms that contribute to pulmonary and systemic effects following toxicant exposure.
Utsumi, J; Yamazaki, S; Kawaguchi, K; Kimura, S; Shimizu, H
1989-10-05
Human interferon-beta 1 is extremely stable is a low ionic strength solution of pH 2 such as 10 mM HCl at 37 degrees C. However, the presence of 0.15 M NaCl led to a remarkable loss of antiviral activity. The molecular-sieve high-performance liquid chromatography revealed that, whereas completely active human interferon-beta 1 eluted as a 25 kDa species (monomeric form), the inactivated preparation eluted primarily as a 90 kDa species (oligomeric form). The specific activity (units per mg protein) of the oligomeric form was approx. 10% of that of the monomeric form. This observation shows that oligomeric human interferon-beta 1 is apparently in an inactive form. When the oligomeric eluate was resolved by polyacrylamide gel containing sodium dodecyl sulphate (SDS), it appeared to be monomeric under non-reducing conditions. Monomerization of the oligomeric human interferon-beta 1 by treatment with 1% SDS, fully regenerated its antiviral activity. These results suggest that the inactivation of the human interferon-beta 1 preparation was caused by its oligomerization via hydrophobic interactions without the formation of intermolecular disulphide bonds. These oligomers can be dissociated by SDS to restore biological activity.
Jobst, Belinda; Weigl, Julia; Michl, Carina; Vivarelli, Fabio; Pinz, Sophia; Amslinger, Sabine; Rascle, Anne
2016-11-01
The JAK/STAT pathway is an essential mediator of cytokine signaling, often upregulated in human diseases and therefore recognized as a relevant therapeutic target. We previously identified the synthetic chalcone α-bromo-2',3,4,4'-tetramethoxychalcone (α-Br-TMC) as a novel JAK2/STAT5 inhibitor. We also found that treatment with α-Br-TMC resulted in a downward shift of STAT5 proteins in SDS-PAGE, suggesting a post-translational modification that might affect STAT5 function. In the present study, we show that a single cysteine within STAT5 is responsible for the α-Br-TMC-induced protein shift, and that this modification does not alter STAT5 transcriptional activity. We also compared the inhibitory activity of α-Br-TMC to that of another synthetic chalcone, α-trifluoromethyl-2',3,4,4'-tetramethoxychalcone (α-CF3-TMC). We found that, like α-Br-TMC, α-CF3-TMC inhibits JAK2 and STAT5 phosphorylation in response to interleukin-3, however without altering STAT5 mobility in SDS-PAGE. Moreover, we demonstrate that both α-Br-TMC and α-CF3-TMC inhibit interferon-α-induced activation of STAT1 and STAT2, by inhibiting their phosphorylation and the expression of downstream interferon-stimulated genes. Together with the previous finding that α-Br-TMC and α-CF3-TMC inhibit the response to inflammation by inducing Nrf2 and blocking NF-κB activities, our data suggest that synthetic chalcones might be useful as anti-inflammatory, anti-cancer and immunomodulatory agents in the treatment of human diseases.
Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.
Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y
2017-10-01
Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.
Quakkelaar, Esther D.; Redeker, Anke; Haddad, Elias K.; Harari, Alexandre; McCaughey, Stella Mayo; Duhen, Thomas; Filali-Mouhim, Abdelali; Goulet, Jean-Philippe; Loof, Nikki M.; Ossendorp, Ferry; Perdiguero, Beatriz; Heinen, Paul; Gomez, Carmen E.; Kibler, Karen V.; Koelle, David M.; Sékaly, Rafick P.; Sallusto, Federica; Lanzavecchia, Antonio; Pantaleo, Giuseppe; Esteban, Mariano; Tartaglia, Jim; Jacobs, Bertram L.; Melief, Cornelis J. M.
2011-01-01
Attenuated poxviruses are safe and capable of expressing foreign antigens. Poxviruses are applied in veterinary vaccination and explored as candidate vaccines for humans. However, poxviruses express multiple genes encoding proteins that interfere with components of the innate and adaptive immune response. This manuscript describes two strategies aimed to improve the immunogenicity of the highly attenuated, host-range restricted poxvirus NYVAC: deletion of the viral gene encoding type-I interferon-binding protein and development of attenuated replication-competent NYVAC. We evaluated these newly generated NYVAC mutants, encoding HIV-1 env, gag, pol and nef, for their ability to stimulate HIV-specific CD8 T-cell responses in vitro from blood mononuclear cells of HIV-infected subjects. The new vectors were evaluated and compared to the parental NYVAC vector in dendritic cells (DCs), RNA expression arrays, HIV gag expression and cross-presentation assays in vitro. Deletion of type-I interferon-binding protein enhanced expression of interferon and interferon-induced genes in DCs, and increased maturation of infected DCs. Restoration of replication competence induced activation of pathways involving antigen processing and presentation. Also, replication-competent NYVAC showed increased Gag expression in infected cells, permitting enhanced cross-presentation to HIV-specific CD8 T cells and proliferation of HIV-specific memory CD8 T-cells in vitro. The recombinant NYVAC combining both modifications induced interferon-induced genes and genes involved in antigen processing and presentation, as well as increased Gag expression. This combined replication-competent NYVAC is a promising candidate for the next generation of HIV vaccines. PMID:21347234
Bakrania, Anita K; Variya, Bhavesh C; Patel, Snehal S
2017-01-01
As a novel target for breast cancer, interferon inducers have found its role as anti-angiogenic agents with diethylaminoethyl dextran (DEAE-Dextran) being a molecule used for centuries as a transfection agent. Our results herein offer an explanation for the emergence of DEAE-Dextran as an anti-tumor agent for TNBC with in-depth mechanistic approach as an anti-angiogenic molecule. DEAE-Dextran has found to possess cytotoxic activity demonstrated during the various in vitro cytotoxicity assays; moreover, as an anti-oxidant, DEAE-Dextran has shown to possess excellent reactive oxygen species scavenging activity. The interferon inducing capacity of DEAE-Dextran was determined qualitatively as well as quantitatively specifically demonstrating overexpression of β-interferon. As a measure of anti-proliferative activity, DEAE-Dextran exhibited reduced ki67, p53, and PCNA levels. Also, overexpression of CK5/6 and p63 in DEAE-Dextran treated animals indicated improvement in breast cell morphology along with an improvement in cell-cell adhesion by virtue of upregulation of β-catenin and E-cadherin. Anti-angiogenic property of DEAE-Dextran was concluded by the downregulation of CD31, VEGF, and NOTCH1 both in vivo and in vitro . Further, apoptosis due to DEAE-Dextran, initially determined by downregulation of Bcl2, was confirmed with flow cytometry. Overall, results are defensive of DEAE-Dextran as an emerging anti-tumor agent with mechanisms pertaining to β-interferon induction with probable VEGF and NOTCH1 inhibition as well as apoptosis which still needs to be studied in further depth.
Bakrania, Anita K.; Variya, Bhavesh C.; Patel, Snehal S.
2017-01-01
As a novel target for breast cancer, interferon inducers have found its role as anti-angiogenic agents with diethylaminoethyl dextran (DEAE-Dextran) being a molecule used for centuries as a transfection agent. Our results herein offer an explanation for the emergence of DEAE-Dextran as an anti-tumor agent for TNBC with in-depth mechanistic approach as an anti-angiogenic molecule. DEAE-Dextran has found to possess cytotoxic activity demonstrated during the various in vitro cytotoxicity assays; moreover, as an anti-oxidant, DEAE-Dextran has shown to possess excellent reactive oxygen species scavenging activity. The interferon inducing capacity of DEAE-Dextran was determined qualitatively as well as quantitatively specifically demonstrating overexpression of β-interferon. As a measure of anti-proliferative activity, DEAE-Dextran exhibited reduced ki67, p53, and PCNA levels. Also, overexpression of CK5/6 and p63 in DEAE-Dextran treated animals indicated improvement in breast cell morphology along with an improvement in cell–cell adhesion by virtue of upregulation of β-catenin and E-cadherin. Anti-angiogenic property of DEAE-Dextran was concluded by the downregulation of CD31, VEGF, and NOTCH1 both in vivo and in vitro. Further, apoptosis due to DEAE-Dextran, initially determined by downregulation of Bcl2, was confirmed with flow cytometry. Overall, results are defensive of DEAE-Dextran as an emerging anti-tumor agent with mechanisms pertaining to β-interferon induction with probable VEGF and NOTCH1 inhibition as well as apoptosis which still needs to be studied in further depth. PMID:29311933
Wang, Rong; Nan, Yuchen; Yu, Ying
2013-01-01
Porcine reproductive and respiratory syndrome virus (PRRSV) inhibits the interferon-mediated antiviral response. Type I interferons (IFNs) induce the expression of IFN-stimulated genes by activating phosphorylation of both signal transducer and activator of transcription 1 (STAT1) and STAT2, which form heterotrimers (interferon-stimulated gene factor 3 [ISGF3]) with interferon regulatory factor 9 (IRF9) and translocate to the nucleus. PRRSV Nsp1β blocks the nuclear translocation of the ISGF3 complex by an unknown mechanism. In this study, we discovered that Nsp1β induced the degradation of karyopherin-α1 (KPNA1, also called importin-α5), which is known to mediate the nuclear import of ISGF3. Overexpression of Nsp1β resulted in a reduction of KPNA1 levels in a dose-dependent manner, and treatment of the cells with the proteasome inhibitor MG132 restored KPNA1 levels. Furthermore, the presence of Nsp1β induced an elevation of KPNA1 ubiquitination and a shortening of its half-life. Our analysis of Nsp1β deletion constructs showed that the N-terminal domain of Nsp1β was involved in the ubiquitin-proteasomal degradation of KPNA1. A nucleotide substitution resulting in an amino acid change from valine to isoleucine at residue 19 of Nsp1β diminished its ability to induce KPNA1 degradation and to inhibit IFN-mediated signaling. Interestingly, infection of MARC-145 cells by PRRSV strains VR-2332 and VR-2385 also resulted in KPNA1 reduction, whereas infection by an avirulent strain, Ingelvac PRRS modified live virus (MLV), did not. MLV Nsp1β had no effect on KPNA1; however, a mutant with an amino acid change at residue 19 from isoleucine to valine induced KPNA1 degradation. These results indicate that Nsp1β blocks ISGF3 nuclear translocation by inducing KPNA1 degradation and that valine-19 in Nsp1β correlates with the inhibition. PMID:23449802
Interferon-alpha in the treatment of multiple myeloma.
Khoo, Teh Liane; Vangsted, Annette Juul; Joshua, Douglas; Gibson, John
2011-03-01
Interferons are soluble proteins produced naturally by cells in response to viruses. It has both anti-proliferative and immunomodulating properties and is one of the first examples of a biological response modifier use to treat the haematological malignancy multiple myeloma. Interferon has been used in this clinical practice for over thirty years. However, despite considerable efforts, numerous clinical trials and two large meta-analysis, its exact role in the management of multiple myeloma still remains unclear. Its role in the treatment of multiple myeloma has been as a single induction agent, a co-induction agent with other chemotherapy regimens, and as maintenance therapy after conventional chemotherapy or complete remission after autologous or allogeneic transplantation. Interferon as a single induction agent or co-induction agent with other chemotherapy agents appears only to have minimal benefit in myeloma. Its role as maintenance therapy in the plateau phase of myeloma also remains uncertain. More recently, the use of interferon must now compete with the "new drugs"--thalidomide, lenalidomide and bortezomib in myeloma treatment. Will there be a future role of interferon in the treatment of multiple myeloma or will interferon be resigned to the history books remains to be seen.
Geng, Wei; Lo, Chung-Mau; Ng, Kevin T.P.; Ling, Chang-Chun; Qi, Xiang; Li, Chang-Xian; Zhai, Yuan; Liu, Xiao-Bing; Ma, Yuen-Yuen; Man, Kwan
2015-01-01
Tumor recurrence remains an obstacle after liver surgery, especially in living donor liver transplantation (LDLT) for patients with hepatocellular carcinoma (HCC). The acute-phase liver graft injury might potentially induce poor response to chemotherapy in recurrent HCC after liver transplantation. We here intended to explore the mechanism and to identify a therapeutic target to overcome such chemoresistance. The associations among graft injury, overexpression of IP10 and multidrug resistant genes were investigated in a rat liver transplantation model, and further validated in clinical cohort. The role of IP10 on HCC cell proliferation and tumor growth under chemotherapy was studied both in vitro and in vivo. The underlying mechanism was revealed by detecting the activation of endoplasmic reticulum (ER) stress signaling pathways. Moreover, the effect of IP10 neutralizing antibody sensitizing cisplatin treatment was further explored. In rat liver transplantation model, significant up-regulation of IP10 associated with multidrug resistant genes was found in small-for-size liver graft. Clinically, high expression of circulating IP10 was significant correlated with tumor recurrence in HCC patients underwent LDLT. Overexpression of IP10 promoted HCC cell proliferation and tumor growth under cisplatin treatment by activation of ATF6/Grp78 signaling. IP10 neutralizing antibody sensitized cisplatin treatment in nude mice. The overexpression of IP10, which induced by liver graft injury, may lead to cisplatin resistance via ATF6/Grp78 ER stress signaling pathway. IP10 neutralizing antibody could be a potential adjuvant therapy to sensitize cisplatin treatment. PMID:26336986
Oliveira, Sandra Maria do Valle Leone de; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria
2017-01-01
To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. Avaliar a frequência de resultados indeterminados de um interferon-gamma release assay (IGRA, ensaio de liberação de interferon-gama) e os fatores relacionados com esses resultados em pessoas vivendo com HIV/AIDS (PVHA). Foram avaliadas 81 PVHA na região Centro-Oeste do Brasil, por meio do teste tuberculínico e de um IGRA. Informações a respeito de vari
DOE Office of Scientific and Technical Information (OSTI.GOV)
Verma, Saguna; Ziegler, Katja; Ananthula, Praveen
2006-02-20
Human polyomavirus JC (JCV) infects 80% of the population worldwide. Primary infection, typically occurring during childhood, is asymptomatic in immunocompetent individuals and results in lifelong latency and persistent infection. However, among the severely immunocompromised, JCV may cause a fatal demyelinating disease, progressive multifocal leukoencephalopathy (PML). Virus-host interactions influencing persistence and pathogenicity are not well understood, although significant regulation of JCV activity is thought to occur at the level of transcription. Regulation of the JCV early and late promoters during the lytic cycle is a complex event that requires participation of both viral and cellular factors. We have used cDNA microarraymore » technology to analyze global alterations in gene expression in JCV-permissive primary human fetal glial cells (PHFG). Expression of more than 400 cellular genes was altered, including many that influence cell proliferation, cell communication and interferon (IFN)-mediated host defense responses. Genes in the latter category included signal transducer and activator of transcription 1 (STAT1), interferon stimulating gene 56 (ISG56), myxovirus resistance 1 (MxA), 2'5'-oligoadenylate synthetase (OAS), and cig5. The expression of these genes was further confirmed in JCV-infected PHFG cells and the human glioblastoma cell line U87MG to ensure the specificity of JCV in inducing this strong antiviral response. Results obtained by real-time RT-PCR and Western blot analyses supported the microarray data and provide temporal information related to virus-induced changes in the IFN response pathway. Our data indicate that the induction of an antiviral response may be one of the cellular factors regulating/controlling JCV replication in immunocompetent hosts and therefore constraining the development of PML.« less
Aziz, Maha M; Eid, Nihad I; Nada, Ahmed S; Amin, Nour El-Din; Ain-Shoka, Afaf A
2018-03-01
The present study was conducted to evaluate the possible protective role of the algae spirulina (Sp) against nephrotoxicity and oxidative stress which are the main secondary effects induced by the immunosuppressant drug CSA and/or ionizing radiation. In this study, male rats were given Sp (1 g/kg) either for 15 days before irradiation (6.5 Gy) or 5 days before and 10 days concomitant with CSA (25 mg/kg). Markers used to assess renal injury included serum creatinine, urea, glucose, albumin, protein, and lipid profile as well as kidney content of reduced glutathione (GSH); lipid peroxidation (thiobarbituric acid reactive substances (TBARS)); nitrite and superoxide dismutase (SOD) activity. In addition, some trace elements (Zn and Mg) were estimated in kidney. Apoptosis was assessed by immunohistochemical estimation of caspase-3 expression in addition to histopathological examination. Results revealed that gamma radiation and/or CSA induced elevation in urea, creatinine, lipids, and glucose while decreasing albumin and protein levels. There was a noticeable increase in kidney content of GSH, TBARS, and nitrite. Meanwhile, profound decrease in kidney SOD activity was observed. Treatment with Sp significantly reversed the changes induced by CSA and/or gamma radiation in renal function tests. Spirulina also ameliorated kidney oxidative stress through decreasing GSH, TBARS, and nitrite kidney content while increasing SOD activity. Histopathological examination further confirmed Sp protective efficacy. Moreover, kidney caspase-3 expression that was triggered by CSA and/or gamma radiation was decreased. In conclusion, spirulina can be regarded as a promising renoprotective natural agent against renal injury induced by CSA and/or gamma radiation.
Vercelli, D; Jabara, H H; Lauener, R P; Geha, R S
1990-01-15
The T cell-derived lymphokine IL-4 is essential for the induction of IgE synthesis by human lymphocytes. The IgE-inducing effect of IL-4 is antagonized by IFN-gamma. The secretion of IFN-gamma is vigorously triggered in MLC. Thus, IL-4-stimulated MLC represent a suitable model to characterize the functional antagonism between IL-4 and IFN-gamma. In this report, we show that rIL-4 consistently induced IgE synthesis when added to human primary MLC. IL-4-dependent IgE production required cognate T/B cell recognition, because it was inhibited by antibodies to CD3 and MHC class II (HlA-DR) Ag. A neutralizing anti-IFN-gamma mAb dramatically enhanced IL-4-dependent IgE synthesis by MLC, indicating that endogenous IFN-gamma is a major inhibitor of IgE production. More importantly, addition of rIL-4 markedly inhibited the release of IFN-gamma in supernatants of MLC and Con A-activated PBMC. The decrease in IFN-gamma protein was accompanied by a decreased expression of IFN-gamma mRNA transcripts. The downregulation of IFN-gamma by IL-4 is likely to play an important role in the IL-4-dependent induction of IgE synthesis.
Díaz-Guerra, M; Rivas, C; Esteban, M
1999-02-01
To define protein domains important for activation of the interferon (IFN)-induced enzyme 2-5A-dependent RNaseL, we have generated vaccinia virus (VV) recombinants able to express in cultured cells truncated forms of this protein and compared their biologic activities with those producing the wild-type enzyme, with and without coexpression of 2-5A synthetase. Our results show that full activation of RNaseL requires binding of 2-5A oligonucleotides within amino acid positions 212-339, corresponding to ankyrin repeats 6 to 9. The protein kinase and ribonuclease domains of RNaseL, amino acids 340-741, are sufficient for a constitutively active enzyme that is unresponsive to excess 2-5A. These results demonstrate in vivo the importance of the ankyrin domains in the biologic function of RNaseL. We suggest that ankyrin repeats act as key modulators of RNaseL activity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, Karen E.; Knipe, David M., E-mail: david_knipe@hms.harvard.ed
2010-01-05
Host cells respond to viral infection by the production of type I interferons (IFNs), which induce the expression of antiviral genes. Herpes simplex virus I (HSV-1) encodes many mechanisms that inhibit the type I IFN response, including the ICP27-dependent inhibition of type I IFN signaling. Here we show inhibition of Stat-1 nuclear accumulation in cells that express ICP27. ICP27 expression also induces the secretion of a small, heat-stable type I IFN antagonizing protein that inhibits Stat-1 nuclear accumulation. We show that the inhibition of IFN-induced Stat-1 phosphorylation occurs at or upstream of Jak-1 phosphorylation. Finally, we show that ISG15 expressionmore » is induced after IFNalpha treatment in mock-infected cells, but not cells infected with WT HSV-1 or ICP27{sup -} HSV-1. These data suggest that HSV-1 has evolved multiple mechanisms to inhibit IFN signaling not only in infected cells, but also in neighboring cells, thereby allowing for increased viral replication and spread.« less
Zhang, Lu; Mo, Jinyao; Swanson, Karen V; Wen, Haitao; Petrucelli, Alex; Gregory, Sean M; Zhang, Zhigang; Schneider, Monika; Jiang, Yan; Fitzgerald, Katherine A; Ouyang, Songying; Liu, Zhi-Jie; Damania, Blossom; Shu, Hong-Bing; Duncan, Joseph A; Ting, Jenny P-Y
2014-03-20
Stimulator of interferon genes (STING, also named MITA, MYPS, or ERIS) is an intracellular DNA sensor that induces type I interferon through its interaction with TANK-binding kinase 1 (TBK1). Here we found that the nucleotide-binding, leucine-rich-repeat-containing protein, NLRC3, reduced STING-dependent innate immune activation in response to cytosolic DNA, cyclic di-GMP (c-di-GMP), and DNA viruses. NLRC3 associated with both STING and TBK1 and impeded STING-TBK1 interaction and downstream type I interferon production. By using purified recombinant proteins, we found NLRC3 to interact directly with STING. Furthermore, NLRC3 prevented proper trafficking of STING to perinuclear and punctated region, known to be important for its activation. In animals, herpes simplex virus 1 (HSV-1)-infected Nlrc3(-/-) mice exhibited enhanced innate immunity and reduced morbidity and viral load. This demonstrates the intersection of two key pathways of innate immune regulation, NLR and STING, to fine tune host response to intracellular DNA, DNA virus, and c-di-GMP. Copyright © 2014 Elsevier Inc. All rights reserved.
Zhang, Lu; Mo, Jinyao; Swanson, Karen V.; Wen, Haitao; Petrucelli, Alex; Gregory, Sean M.; Zhang, Zhigang; Schneider, Monika; Jiang, Yan; Fitzgerald, Katherine A.; Ouyang, Songying; Liu, Zhi-Jie; Damania, Blossom A; Shu, Hong-Bing; Duncan, Joseph A.; Ting, Jenny P-Y.
2014-01-01
SUMMARY Stimulator of interferon genes (STING, also named MITA, MYPS or ERIS) is an intracellular DNA sensor that induces type I interferon through its interaction with TANK-binding kinase 1 (TBK1). Here we found that the nucleotide-binding, leucine-rich repeat containing protein, NLRC3, reduced STING-dependent innate immune activation in response to cytosolic DNA, cyclic di-GMP (c-di-GMP) and DNA viruses. NLRC3 associated with both STING and TBK1, and impeded STING-TBK1 interaction and downstream type I interferon production. Using purified recombinant proteins NLRC3 was found to interact directly with STING. Furthermore, NLRC3 prevented proper trafficking of STING to perinuclear and punctated region, known to be important for its activation. In animals, herpes simplex virus 1 (HSV-1)-infected Nlrc3−/− mice exhibited enhanced innate immunity, reduced morbidity and viral load. This demonstrates the intersection of two key pathways of innate immune regulation, NLR and STING, to fine tune host response to intracellular DNA, DNA virus and c-di-GMP PMID:24560620
ER stress and genomic instability induced by gamma radiation in mice primary cultured glial cells.
Chatterjee, Jit; Nairy, Rajesha K; Langhnoja, Jaldeep; Tripathi, Ashutosh; Patil, Rajashekhar K; Pillai, Prakash P; Mustak, Mohammed S
2018-06-01
Ionizing radiation induces various pathophysiological conditions by altering central nervous system (CNS) homeostasis, leading to neurodegenerative diseases. However, the potential effect of ionizing radiation response on cellular physiology in glial cells is unclear. In the present study, micronucleus test, comet assay, and RT-PCR were performed to investigate the potential effect of gamma radiation in cultured oligodendrocytes and astrocytes with respect to genomic instability, Endoplasmic Reticulum (ER) stress, and inflammation. Further, we studied the effect of alteration in ER stress specific gene expression in cortex post whole body radiation in mice. Results showed that exposure of gamma radiation of 2Gy in-vitro cultured astrocytes and oligodendrocytes and 7Gy in-vivo induced ER stress and Inflammation along with profuse DNA damage and Chromosomal abnormality. Additionally, we observed downregulation of myelin basic protein levels in cultured oligodendrocytes exposed to radiation. The present data suggests that ER stress and pro inflammatory cytokines serve as the major players in inducing glial cell dysfunction post gamma irradiation along with induction of genomic instability. Taken together, these results indicate that ER stress, DNA damage, and inflammatory pathways may be critical events leading to glial cell dysfunction and subsequent cell death following exposure to ionizing radiation.
Pegylated interferon de novo-induce autoimmune haemolytic anaemia in chronic hepatitis C patient
Said, Ashraf; Elbahrawy, Ashraf; Alfiomy, Mohamed; Abdellah, Mohamed; Shahat, Khaled; Salah, Mohamed; Mostafa, Sadek; Elwassief, Ahmed; Aboelfotoh, Attef; Abdelhafeez, Hafez; El-Sherif, Assem
2011-01-01
A 55-year-old Egyptian woman with chronic hepatitis C undergoing treatment with pegylated interferon (Peg-IFN) alfa-2a plus ribavirin was referred to our hospital on November 2010 with prolonged easy fatigability and an attack of syncope; she had no prior history of autoimmune disorders or allergy. Laboratory investigations documented the presence of Peg-IFN induced autoimmune haemolytic anaemia and autoimmune thyroiditis. Intravenous γ globulin (IVGG) failed to correct the autoimmune process; on the other hand steroid therapy dramatically corrected both haematological and thyroid values, and step down the immune process. Our report indicated that Peg-IFN de novo-induce autoimmune haemolysis, documenting a previous report. IVGG failed to step down the immune process in our case. PMID:22688484
The Interferon-Stimulated Gene Ifitm3 Restricts West Nile Virus Infection and Pathogenesis.
Gorman, Matthew J; Poddar, Subhajit; Farzan, Michael; Diamond, Michael S
2016-09-15
The interferon-induced transmembrane protein (IFITM) family of proteins inhibit infection of several different enveloped viruses in cell culture by virtue of their ability to restrict entry and fusion from late endosomes. As few studies have evaluated the importance of Ifitm3 in vivo in restricting viral pathogenesis, we investigated its significance as an antiviral gene against West Nile virus (WNV), an encephalitic flavivirus, in cells and mice. Ifitm3(-/-) mice were more vulnerable to lethal WNV infection, and this was associated with greater virus accumulation in peripheral organs and central nervous system tissues. As no difference in viral burden in the brain or spinal cord was observed after direct intracranial inoculation, Ifitm3 likely functions as an antiviral protein in nonneuronal cells. Consistent with this, Ifitm3(-/-) fibroblasts but not dendritic cells resulted in higher yields of WNV in multistep growth analyses. Moreover, transcomplementation experiments showed that Ifitm3 inhibited WNV infection independently of Ifitm1, Ifitm2, Ifitm5, and Ifitm6. Beyond a direct effect on viral infection in cells, analysis of the immune response in WNV-infected Ifitm3(-/-) mice showed decreases in the total number of B cells, CD4(+) T cells, and antigen-specific CD8(+) T cells. Finally, bone marrow chimera experiments demonstrated that Ifitm3 functioned in both radioresistant and radiosensitive cells, as higher levels of WNV were observed in the brain only when Ifitm3 was absent from both compartments. Our analyses suggest that Ifitm3 restricts WNV pathogenesis likely through multiple mechanisms, including the direct control of infection in subsets of cells. As part of the mammalian host response to viral infections, hundreds of interferon-stimulated genes (ISGs) are induced. The inhibitory activity of individual ISGs varies depending on the specific cell type and viral pathogen. Among ISGs, the genes encoding interferon-induced transmembrane protein (IFITM
INF-gamma rearranges membrane topography of MHC-I and ICAM-1 in colon carcinoma cells.
Bacsó, Zsolt; Bene, László; Damjanovich, László; Damjanovich, Sándor
2002-01-18
Flow-cytometric fluorescence energy transfer (FCET) measurements between fluorescently labeled cell surface MHC-I and ICAM-1 molecules indicated similar receptor patterns in the plasma membrane of interferon-gamma (INF-gamma)-treated colon carcinoma cells as those observed earlier at the surface of lymphoid cells. INF-gamma activation significantly increased the density of MHC-I and ICAM-1 proteins in the membrane. This increase in receptor density was accompanied by decreased proximity level of the homo-associated MHC-I receptors. Hetero-association of MHC-I and ICAM-1 molecules was increased by INF-gamma treatment. INF-gamma changed neither hetero- nor homo-association of transferrin receptors. By staining the sphingomyelin/cholesterol-enriched lipid microdomains with fluorescently labeled cholera toxin B subunit, we found an increase in the amount of lipid-raft associated G(M1)-gangliosides due to INF-gamma treatment. Confocal microscopic results and FCET measurements show that MHC-I and ICAM-1 are components of G(M1)-ganglioside containing lipid-rafts and also support an increase in the size of these lipid-rafts upon INF-gamma treatment.
Southern Analysis of Genomic Alterations in Gamma-Ray-Induced Aprt- Hamster Cell Mutants
Grosovsky, Andrew J.; Drobetsky, Elliot A.; deJong, Pieter J.; Glickman, Barry W.
1986-01-01
The role of genomic alterations in mutagenesis induced by ionizing radiation has been the subject of considerable speculation. By Southern blotting analysis we show here that 9 of 55 (approximately 1/6) gamma-ray-induced mutants at the adenine phosphoribosyl transferase (aprt) locus of Chinese hamster ovary (CHO) cells have a detectable genomic rearrangement. These fall into two classes: intragenic deletions and chromosomal rearrangements. In contrast, no major genomic alterations were detected among 67 spontaneous mutants, although two restriction site loss events were observed. Three gamma-ray-induced mutants were found to be intragenic deletions; all may have identical break-points. The remaining six gamma-ray-induced mutants demonstrating a genomic alteration appear to be the result of chromosomal rearrangements, possibly translocation or inversion events. None of the remaining gamma-ray-induced mutants showed any observable alteration in blotting pattern indicating a substantial role for point mutation in gamma-ray-induced mutagenesis at the aprt locus. PMID:3013724
Controlling nuclear JAKs and STATs for specific gene activation by IFN{gamma}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea
2011-07-08
Highlights: {yields} Gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interact with the promoter region of IFN{gamma}-associated genes along with transcription factor STAT1{alpha}. {yields} We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. {yields} The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interacted with the promoter region of IFN{gamma}-activated genes along with transcription factor STAT1{alpha}. Recent studies have suggested that activated Janus kinases pJAK2 andmore » pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFN{gamma}. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFN{gamma} treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The {beta}-actin gene, which is not activated by IFN{gamma}, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFN{gamma} treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFN{gamma} treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFN{gamma
Giri, S. N.; Hyde, D. M.
1988-01-01
The effects of polyinosinic-polycytidylic acid (Poly I:C), an inducer of interferons, on bleomycin (Bleo)-induced lung fibrosis was studied in hamsters. Poly I:C (10 mg/kg intraperitoneally) was administered for two days and immediately before intratracheal instillation of bleomycin (7.5 U/kg) or an equivalent volume of saline and thereafter daily for 13 days. The lung hydroxyproline in control, Poly I:C, Bleo, and Bleo + Poly I:C groups averaged 791, 752, 1177, and 766 micrograms/lung. As compared to control, the prolyl hydroxylase activity in the Bleo group was increased by 83% whereas in Bleo + Poly I:C group, the activity was increased by 42%. Protein in the bronchoalveolar lavage supernatant in Poly I:C, Bleo and Bleo + Poly I:C groups were 72, 286, and 206% of the control, respectively. There was no difference in total leukocyte counts between Bleo + Poly I:C and Bleo groups, but the differential cell counts were changed. The numbers of neutrophils, monocytes, lymphocytes, and eosinophils were 50, 84, 91, and 10% of Bleo group, respectively. Morphometric estimates of the volume of parenchymal lesion within the lung showed that hamsters in Bleo + Poly I:C group had significantly less volume of lesion (1.0 cucm) than the Bleo group (1.6 cucm). In addition, the fibrotic lesions in Bleo + Poly I:C group were multifocal and primarily proximal acinar in location, had fewer extracellular fibers, neutrophils and monocytes. Poly I:C treatment ameliorated bleomycin-induced lung collagen accumulation. Images Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:2462354
Habjan, Matthias; Pichlmair, Andreas; Elliott, Richard M; Overby, Anna K; Glatter, Timo; Gstaiger, Matthias; Superti-Furga, Giulio; Unger, Hermann; Weber, Friedemann
2009-05-01
Rift Valley fever virus (RVFV) continues to cause large outbreaks of acute febrile and often fatal illness among humans and domesticated animals in Africa, Saudi Arabia, and Yemen. The high pathogenicity of this bunyavirus is mainly due to the viral protein NSs, which was shown to prevent transcriptional induction of the antivirally active type I interferons (alpha/beta interferon [IFN-alpha/beta]). Viruses lacking the NSs gene induce synthesis of IFNs and are therefore attenuated, whereas the noninducing wild-type RVFV strains can only be inhibited by pretreatment with IFN. We demonstrate here in vitro and in vivo that a substantial part of the antiviral activity of IFN against RVFV is due to a double-stranded RNA-dependent protein kinase (PKR). PKR-mediated virus inhibition, however, was much more pronounced for the strain Clone 13 with NSs deleted than for the NSs-expressing strain ZH548. In vivo, Clone 13 was nonpathogenic for wild-type (wt) mice but could regain pathogenicity if mice lacked the PKR gene. ZH548, in contrast, killed both wt and PKR knockout mice indiscriminately. ZH548 was largely resistant to the antiviral properties of PKR because RVFV NSs triggered the specific degradation of PKR via the proteasome. The NSs proteins of the related but less virulent sandfly fever Sicilian virus and La Crosse virus, in contrast, had no such anti-PKR activity despite being efficient suppressors of IFN induction. Our data suggest that RVFV NSs has gained an additional anti-IFN function that may explain the extraordinary pathogenicity of this virus.
Axonal interferon responses and alphaherpesvirus neuroinvasion
NASA Astrophysics Data System (ADS)
Song, Ren
Infection by alphaherpesviruses, including herpes simplex virus (HSV) and pseudorabies virus (PRV), typically begins at a peripheral epithelial surface and continues into the peripheral nervous system (PNS) that innervates this tissue. Inflammatory responses are induced at the infected peripheral site prior to viral invasion of the PNS. PNS neurons are highly polarized cells with long axonal processes that connect to distant targets. When the peripheral tissue is first infected, only the innervating axons are exposed to this inflammatory milieu, which include type I interferon (e.g. IFNbeta) and type II interferon (i.e. IFNgamma). IFNbeta can be produced by all types of cells, while IFNgamma is secreted by some specific types of immune cells. And both types of IFN induce antiviral responses in surrounding cells that express the IFN receptors. The fundamental question is how do PNS neurons respond to the inflammatory milieu experienced only by their axons. Axons must act as potential front-line barriers to prevent PNS infection and damage. Using compartmented cultures that physically separate neuron axons from cell bodies, I found that pretreating isolated axons with IFNbeta or IFNgamma significantly diminished the number of HSV-1 and PRV particles moving from axons to the cell bodies in an IFN receptor-dependent manner. Furthermore, I found the responses in axons are activated differentially by the two types of IFNs. The response to IFNbeta is a rapid, axon-only response, while the response to IFNgamma involves long distance signaling to the PNS cell body. For example, exposing axons to IFNbeta induced STAT1 phosphorylation (p-STAT1) only in axons, while exposure of axons to IFNgamma induced p-STAT1 accumulation in distant cell body nuclei. Blocking transcription in cell bodies eliminated IFNgamma-, but not IFNbeta-mediated antiviral effects. Proteomic analysis of IFNbeta- or IFNgamma-treated axons identified several differentially regulated proteins. Therefore
Lu, Yao; Truccolo, Wilson; Wagner, Fabien B; Vargas-Irwin, Carlos E; Ozden, Ilker; Zimmermann, Jonas B; May, Travis; Agha, Naubahar S; Wang, Jing; Nurmikko, Arto V
2015-06-01
Transient gamma-band (40-80 Hz) spatiotemporal patterns are hypothesized to play important roles in cortical function. Here we report the direct observation of gamma oscillations as spatiotemporal waves induced by targeted optogenetic stimulation, recorded by intracortical multichannel extracellular techniques in macaque monkeys during their awake resting states. Microelectrode arrays integrating an optical fiber at their center were chronically implanted in primary motor (M1) and ventral premotor (PMv) cortices of two subjects. Targeted brain tissue was transduced with the red-shifted opsin C1V1(T/T). Constant (1-s square pulses) and ramp stimulation induced narrowband gamma oscillations during awake resting states. Recordings across 95 microelectrodes (4 × 4-mm array) enabled us to track the transient gamma spatiotemporal patterns manifested, e.g., as concentric expanding and spiral waves. Gamma oscillations were induced well beyond the light stimulation volume, via network interactions at distal electrode sites, depending on optical power. Despite stimulation-related modulation in spiking rates, neuronal spiking remained highly asynchronous during induced gamma oscillations. In one subject we examined stimulation effects during preparation and execution of a motor task and observed that movement execution largely attenuated optically induced gamma oscillations. Our findings demonstrate that, beyond previously reported induced gamma activity under periodic drive, a prolonged constant stimulus above a certain threshold may carry primate motor cortex network dynamics into gamma oscillations, likely via a Hopf bifurcation. More broadly, the experimental capability in combining microelectrode array recordings and optogenetic stimulation provides an important approach for probing spatiotemporal dynamics in primate cortical networks during various physiological and behavioral conditions.
Nordén, Rickard; Martner, Anna; Samuelsson, Ebba; Hynsjö, Lars; Wold, Agnes E.
2017-01-01
ABSTRACT A peculiar trait of pneumococci (Streptococcus pneumoniae) is their propensity to undergo spontaneous lysis during stationary growth due to activation of the enzyme autolysin (LytA), which fragments the peptidoglycan cell wall. The fragments that are generated upon autolysis impair phagocytosis and reduce production of interleukin-12 (IL-12) and gamma interferon (IFN-γ) by human leukocytes in response to intact pneumococci, thereby impeding crucial host defenses. The objective was to identify additional monocyte genes whose transcription is induced by intact pneumococci and subverted by autolyzed bacteria. Monocytes were isolated from healthy blood donors and stimulated for 3 h with UV-inactivated S. pneumoniae (Rx1PLY− LytA+ strain), which is capable of autolyzing, its LytA− isogenic autolysin-deficient mutant, or a mixture of the two (containing twice the initial bacterial concentration). Gene expression was assessed by Illumina microarray, and selected findings were confirmed by reverse transcription-quantitative real-time PCR (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and flow cytometry. In all, we identified 121 genes that were upregulated to a significantly higher degree by intact than autolyzed pneumococci. These included IFNB1 and a large set of interferon-induced genes, such as IFIT3, RSAD2, CFCL1, and CXCL10 genes, as well as IL12B and CD40 genes. RT-qPCR revealed that transcription of these genes in response to intact pneumococci diminished when autolyzed pneumococci were admixed and that this pattern was independent of pneumolysin. Thus, transcription of interferon-related genes is triggered by intact pneumococci and subverted by fragments generated by spontaneous bacterial autolysis. We suggest that interferon-related pathways are important for elimination of pneumococci and that autolysis contributes to virulence by extinguishing these pathways. PMID:28223347
Ahn, H J; Tomura, M; Yu, W G; Iwasaki, M; Park, W R; Hamaoka, T; Fujiwara, H
1998-12-01
While IL-12 is known to activate JAK2 and TYK2 and induce the phosphorylation of STAT4 and STAT3, little is known regarding how the activation of these signaling molecules is related to the biologic effects of IL-12. Using an IL-12-responsive T cell clone (2D6), we investigated their requirements for proliferation and IFN-gamma production of 2D6 cells. 2D6 cells could be maintained with either IL-12 or IL-2. 2D6 lines maintained with IL-12 (2D6(IL-12)) or IL-2 (2D6(IL-2)) exhibited comparable levels of proliferation, but produced large or only small amounts of IFN-gamma, respectively, when restimulated with IL-12 after starvation of either cytokine. 2D6(IL-12) induced TYK2 and STAT4 phosphorylation. In contrast, their phosphorylation was marginally induced in 2D6(IL-2). The reduced STAT4 phosphorylation was due to a progressive decrease in the amount of STAT4 protein along with the passages in IL-2-containing medium. 2D6(IL-12) and 2D6(IL-2) similarly proliferating in response to IL-12 induced comparable levels of JAK2 activation and STAT5 phosphorylation. JAK2 was associated with STAT5, and IL-12-induced STAT5 phosphorylation was elicited in the absence of JAK3 activation. These results indicate that IL-12 has the capacity to induce/maintain STAT4 and STAT5 proteins, and that TYK2 and JAK2 activation correlate with STAT4 phosphorylation/IFN-gamma induction and STAT5 phosphorylation/cellular proliferation, respectively.
Walker, D H; Popov, V L; Feng, H M
2000-09-01
A mouse model of typhus rickettsiosis that reproduces the hematogenous dissemination to the critical target organs, including brain, lungs, heart, and kidneys, primary endothelial and, to a lesser degree, macrophage intracellular rickettsial infection, and typical vascular-based lesions of louse-borne typhus and murine typhus was established. Intravenous inoculation of C3H/HeN mice with Rickettsia typhi caused disease with a duration of the incubation period and mortality rate that were dependent on the infective dose of rickettsiae. Lethal infection was associated with high concentrations of R. typhi in the lungs and brain, despite a brisker humoral immune response to the rickettsiae than in the sublethal infection. Gamma interferon and CD8 T lymphocytes were demonstrated to be crucial to clearance of the rickettsiae and recovery from infection in experiments in which specific monoclonal antibodies were administered to deplete these components. Death of animals depleted of gamma interferon or CD8 T lymphocytes was associated with overwhelming rickettsial infection demonstrated by titers of infectious rickettsiae and by immunohistochemistry. An effective antirickettsial immune response was associated with elevated serum concentrations of IL-12 on Day 5 and increased secretion of IL-12 by concanavalin-A-stimulated spleen cells on Day 5. Evidence for transient suppression of the immune response consisted of marked reduction in the secretion of IL-2 and IL-12 by concanavalin-A-stimulated spleen cells on Days 10 and 15. This model offers excellent opportunities for study of attenuation and pathogenetic mechanisms of typhus rickettsiae, which are established biologic weapons of potential use in bioterrorism.
Detection of interferon alpha protein reveals differential levels and cellular sources in disease.
Rodero, Mathieu P; Decalf, Jérémie; Bondet, Vincent; Hunt, David; Rice, Gillian I; Werneke, Scott; McGlasson, Sarah L; Alyanakian, Marie-Alexandra; Bader-Meunier, Brigitte; Barnerias, Christine; Bellon, Nathalia; Belot, Alexandre; Bodemer, Christine; Briggs, Tracy A; Desguerre, Isabelle; Frémond, Marie-Louise; Hully, Marie; van den Maagdenberg, Arn M J M; Melki, Isabelle; Meyts, Isabelle; Musset, Lucile; Pelzer, Nadine; Quartier, Pierre; Terwindt, Gisela M; Wardlaw, Joanna; Wiseman, Stewart; Rieux-Laucat, Frédéric; Rose, Yoann; Neven, Bénédicte; Hertel, Christina; Hayday, Adrian; Albert, Matthew L; Rozenberg, Flore; Crow, Yanick J; Duffy, Darragh
2017-05-01
Type I interferons (IFNs) are essential mediators of antiviral responses. These cytokines have been implicated in the pathogenesis of autoimmunity, most notably systemic lupus erythematosus (SLE), diabetes mellitus, and dermatomyositis, as well as monogenic type I interferonopathies. Despite a fundamental role in health and disease, the direct quantification of type I IFNs has been challenging. Using single-molecule array (Simoa) digital ELISA technology, we recorded attomolar concentrations of IFNα in healthy donors, viral infection, and complex and monogenic interferonopathies. IFNα protein correlated well with functional activity and IFN-stimulated gene expression. High circulating IFNα levels were associated with increased clinical severity in SLE patients, and a study of the cellular source of IFNα protein indicated disease-specific mechanisms. Measurement of IFNα attomolar concentrations by digital ELISA will enhance our understanding of IFN biology and potentially improve the diagnosis and stratification of pathologies associated with IFN dysregulation. © 2017 Rodero et al.
Detection of interferon alpha protein reveals differential levels and cellular sources in disease
Rodero, Mathieu P.; Rice, Gillian I.; Werneke, Scott; Alyanakian, Marie-Alexandra; Barnerias, Christine; Bellon, Nathalia; Belot, Alexandre; Bodemer, Christine; Desguerre, Isabelle; Meyts, Isabelle; Musset, Lucile; Wardlaw, Joanna; Wiseman, Stewart; Rose, Yoann; Neven, Bénédicte; Hertel, Christina; Hayday, Adrian; Albert, Matthew L.; Rozenberg, Flore
2017-01-01
Type I interferons (IFNs) are essential mediators of antiviral responses. These cytokines have been implicated in the pathogenesis of autoimmunity, most notably systemic lupus erythematosus (SLE), diabetes mellitus, and dermatomyositis, as well as monogenic type I interferonopathies. Despite a fundamental role in health and disease, the direct quantification of type I IFNs has been challenging. Using single-molecule array (Simoa) digital ELISA technology, we recorded attomolar concentrations of IFNα in healthy donors, viral infection, and complex and monogenic interferonopathies. IFNα protein correlated well with functional activity and IFN-stimulated gene expression. High circulating IFNα levels were associated with increased clinical severity in SLE patients, and a study of the cellular source of IFNα protein indicated disease-specific mechanisms. Measurement of IFNα attomolar concentrations by digital ELISA will enhance our understanding of IFN biology and potentially improve the diagnosis and stratification of pathologies associated with IFN dysregulation. PMID:28420733
Regulation by interferon alpha of immunoglobulin isotype selection and lymphokine production in mice
1991-01-01
Antigens and infectious agents that stimulate interferon alpha(IFN- alpha) production in mice induce antibody responses that are predominantly of the immunoglobulin (Ig)G2a isotype and contain little or no IgE. This suggested the possibility that IFN-alpha might have a role in directing Ig isotype selection. Consistent with this possibility, we have found that injection of mice with recombinant mouse IFN-alpha suppresses IgE secretion, enhances IgG2a secretion, and has no independent effect on IgG1 secretion in mice stimulated with a foreign anti-IgD antibody. Injection of mice with polyinosinic acid.polycytidylic acid (poly I.C), an inducer of macrophage IFN-alpha production, also suppresses the anti-IgD antibody-induced IgE response and stimulates the IgG2a response; these effects are blocked by a sheep antibody that neutralizes mouse IFN-alpha/beta. Both recombinant IFN- alpha and poly I.C have maximum IgE suppressive and IgG2a stimulatory effects when injected early in the anti-IgD antibody-induced immune response. Addition of IFN-alpha to mouse B cells cultured with lipopolysaccharide (LPS) + interleukin 4 (IL-4) suppresses both IgG1 and IgE production, but much less potently than IFN-gamma. IFN-alpha suppresses anti-IgD antibody-induced increases in the level of splenic IL-4 mRNA, but enhances the anti-IgD antibody-induced increase in the splenic level of IFN-gamma mRNA. These results are consistent with the effect of IFN-alpha on Ig isotype expression in mice, as IL-4 stimulates IgE and suppresses IgG2a secretion while IFN-gamma exerts opposite effects. These observations suggest that antigen presenting cells, by secreting IFN-alpha early in the course of an immune response, can influence the nature of that response both through direct effects on B cells and by influencing the differentiation of T cells. PMID:1940796
Scorneaux, B; Ouadrhiri, Y; Anzalone, G; Tulkens, P M
1996-01-01
Listeria monocytogenes is a facultative intracellular pathogen which enters cells by endocytosis and reaches phagolysosomes from where it escapes and multiplies in the cytosol of untreated cells. Exposure of macrophages to gamma interferon (IFN-gamma) restricts L. monocytogenes to phagosomes and prevents its intracellular multiplication. We have tested whether IFN-gamma also modulates the susceptibility of L. monocytogenes to antibiotics. We selected drugs from three different classes displaying marked properties concerning their cellular accumulation and subcellular distribution, namely, ampicillin (not accumulated by cells but present in cytosol), azithromycin (largely accumulated by cells but mostly restricted to lysosomes), and sparfloxacin (accumulated to a fair extent but detected only in cytosol). We used a continuous line of myelomonocytic cells (THP-1 macrophages), which display specific surface receptors for IFN-gamma, and examined the activity of these antibiotics against L. monocytogenes Hly+ (virulent variant) and L. monocytogenes Hly- (a nonvirulent variant defective in hemolysin production). Untreated THP-1 and phorbol myristate acetate-differentiated THP-1 were permissive for infection and multiplication of intracellular L. monocytogenes Hly+ (virulent variant). All three antibiotics tested were bactericidal against this Listeria strain when added to an extracellular concentration of 10x their MIC. After preexposure of THP-1 to IFN-gamma, L. monocytogenes Hly+ was still phagocytosed but no longer grew intracellularly. The activity of ampicillin became almost undetectable (antagonistic effect), and that of azithromycin was unchanged (additive effect with that of IFN-gamma), whereas that of sparfloxacin was markedly enhanced (synergy). A similar behavior (lack of bacterial growth, associated with a loss of activity of ampicillin, an enhanced activity of sparfloxacin, and unchanged activity of azithromycin) was observed in cells infected with L
Interferon in lyssavirus infection.
Rieder, Martina; Finke, Stefan; Conzelmann, Karl-Klaus
2012-01-01
Rabies is a zoonosis still claiming more than 50 000 human deaths per year. Typically, human cases are due to infection with rabies virus, the prototype of the Lyssavirus genus, but sporadic cases of rabies-like encephalitis caused by other lyssaviruses have been reported. In contrast to rabies virus, which has an extremely broad host range including many terrestrial warm-blooded animals, rabies-related viruses are associated predominantly with bats and rarely infect terrestrial species. In spite of a very close genetic relationship of rabies and rabies-related viruses, the factors determining the limited host range of rabies-related viruses are not clear. In the past years the importance of viral countermeasures against the host type I interferon system for establishment of an infection became evident. The rabies virus phosphoprotein (P) has emerged as a critical factor required for paralysing the signalling cascades leading to transcriptional activation of interferon genes as well as interferon signalling pathways, thereby limiting expression of antiviral and immune stimulatory genes. Comparative studies would be of interest in order to determine whether differential abilities of the lyssavirus P proteins contribute to the restricted host range of lyssaviruses.
Prakash, Prem; Singh, Vishal; Jain, Manish; Rana, Minakshi; Khanna, Vivek; Barthwal, Manoj Kumar; Dikshit, Madhu
2014-03-15
High dietary fructose causes insulin resistance syndrome (IRS), primarily due to simultaneous induction of genes involved in glucose, lipid and mitochondrial oxidative metabolism. The present study evaluates effect of a hepatoprotective agent, silymarin (SYM) on fructose-induced metabolic abnormalities in the rat and also assessed the associated thrombotic complications. Wistar rats were kept on high fructose (HFr) diet throughout the 12-week study duration (9 weeks of HFr feeding and subsequently 3 weeks of HFr plus SYM oral administration [once daily]). SYM treatment significantly reduced the HFr diet-induced increase expression of peroxisome proliferator-activated receptor gamma coactivator (PGC)-1α/β, peroxisome proliferator-activated receptor (PPAR)-α, forkhead box protein O1 (FOXO1), sterol regulatory element binding protein (SREBP)-1c, liver X receptor (LXR)-β, fatty acid synthase (FAS) and PPARγ genes in rat liver. SYM also reduced HFr diet mediated increase in plasma triglycerides (TG), non-esterified fatty acids (NEFA), uric acid, malondialdehyde (MDA), total nitrite and pro-inflammatory cytokines (C-reactive protein [CRP], interleukin-6 [IL-6], interferon-gamma [IFN-γ] and tumor necrosis factor [TNF]) levels. Moreover, SYM ameliorated HFr diet induced reduction in glucose utilization and endothelial dysfunction. Additionally, SYM significantly reduced platelet activation (adhesion and aggregation), prolonged ferric chloride-induced blood vessel occlusion time and protected against exacerbated myocardial ischemia reperfusion (MI-RP) injury. SYM treatment prevented HFr induced mRNA expression of hepatic PGC-1α/β and also its target transcription factors which was accompanied with recovery in insulin sensitivity and reduced propensity towards thrombotic complications and aggravated MI-RP injury. Copyright © 2014 Elsevier B.V. All rights reserved.
Wilden, Holger; Schirrmacher, Volker; Fournier, Philippe
2011-08-01
Newcastle disease virus (NDV) is an interesting agent for activating innate immune activity in macrophages including secretion of TNF-α and IFN-α, upregulation of TRAIL and activation of NF-κB and iNOS. However, the molecular mechanism of such cellular activities remains largely unknown. Tumor selectivity of replication of NDV has been described to be linked to deviations in tumor cells of the type I interferon response. We therefore focused on the interferon response to NDV of macrophages as part of innate anti-viral and anti-tumor activity. In particular, we investigated the functional significance of the interferon regulatory factor genes (IRF)-3 and IRF-7. Deletion of the IRF-3 or IRF-7 gene was found to increase susceptibility of mouse macrophages to virus infection. Surprisingly, NDV replicated better in IRF-3 KO than in IRF-7 KO macrophages. Further analysis showed that IRF-3 KO macrophages have a lower basal and NDV-induced RIG-I expression in comparison to IRF-7 KO macrophages. This might explain why, in IRF-3 KO macrophages, the secretion of type I interferons after NDV infection is delayed, when compared to IRF-7 KO and wild-type macrophages. In addition, IRF-3 KO cells showed reduced NDV-induced levels of IRF-7. This effect could be prevented by priming the cells first by interferon-α. Further results indicated that an early production of type I interferon rather than high maximal levels at later time points are important for resistance to infection by NDV. In conclusion, these results demonstrate an important role of IRF-3 for the innate anti-viral response to NDV of mouse macrophages.
Werner-Felmayer, G; Werner, E R; Fuchs, D; Hausen, A; Reibnegger, G; Wachter, H
1990-05-15
Determination of neopterin [D-erythro-6-(1',2',3'-trihydroxypropyl)pterin] in body fluids is a powerful diagnostic tool in a variety of diseases in which activation of cellular immune mechanisms is involved, such as certain malignancies, allograft rejection, and autoimmune and infectious diseases. In vitro, neopterin is released into the supernatant by peripheral blood-derived monocytes/macrophages upon stimulation with gamma-interferon. In parallel, cleavage of tryptophan by indoleamine 2,3-dioxygenase is induced. We report here that the human myelomonocytic cell line THP-1 forms neopterin and degrades tryptophan upon treatment with gamma-interferon. Like in macrophages alpha-interferon and beta-interferon induce these pathways only to a much smaller degree. The action of interferons is enhanced by cotreatment with tumor necrosis factor alpha, lipopolysaccharide, or dexamethasone. gamma-Interferon-induced neopterin formation and indoleamine 2,3-dioxygenase activity are increased by raising extracellular tryptophan concentrations. The pattern of intracellularly formed pteridines upon stimulation with gamma-interferon shows the unique characteristics of human monocytes/macrophages. Neopterin, monapterin, and biopterin are produced in a 50:2:1 ratio. Thus, the THP-1 cell line provides a permanent, easily accessible in vitro system for studying the induction and mechanism of neopterin formation.
Disruption of Type I Interferon Induction by HIV Infection of T Cells
Sanchez, David Jesse; Miranda, Daniel; Marsden, Matthew D.; Dizon, Thomas Michael A.; Bontemps, Johnny R.; Davila, Sergio J.; Del Mundo, Lara E.; Ha, Thai; Senaati, Ashkon; Zack, Jerome A.; Cheng, Genhong
2015-01-01
Our main objective of this study was to determine how Human Immunodeficiency Virus (HIV) avoids induction of the antiviral Type I Interferon (IFN) system. To limit viral infection, the innate immune system produces important antiviral cytokines such as the IFN. IFN set up a critical roadblock to virus infection by limiting further replication of a virus. Usually, IFN production is induced by the recognition of viral nucleic acids by innate immune receptors and subsequent downstream signaling. However, the importance of IFN in the defense against viruses has lead most pathogenic viruses to evolve strategies to inhibit host IFN induction or responses allowing for increased pathogenicity and persistence of the virus. While the adaptive immune responses to HIV infection have been extensively studied, less is known about the balance between induction and inhibition of innate immune defenses, including the antiviral IFN response, by HIV infection. Here we show that HIV infection of T cells does not induce significant IFN production even IFN I Interferon production. To explain this paradox, we screened HIV proteins and found that two HIV encoded proteins, Vpu and Nef, strongly antagonize IFN induction, with expression of these proteins leading to loss of expression of the innate immune viral RNA sensing adaptor protein, IPS-1 (IFN-β promoter stimulator-1). We hypothesize that with lower levels of IPS-1 present, infected cells are defective in mounting antiviral responses allowing HIV to replicate without the normal antiviral actions of the host IFN response. Using cell lines as well as primary human derived cells, we show that HIV targeting of IPS-1 is key to limiting IFN induction. These findings describe how HIV infection modulates IFN induction providing insight into the mechanisms by which HIV establishes infection and persistence in a host. PMID:26375588
Disruption of Type I Interferon Induction by HIV Infection of T Cells.
Sanchez, David Jesse; Miranda, Daniel; Marsden, Matthew D; Dizon, Thomas Michael A; Bontemps, Johnny R; Davila, Sergio J; Del Mundo, Lara E; Ha, Thai; Senaati, Ashkon; Zack, Jerome A; Cheng, Genhong
2015-01-01
Our main objective of this study was to determine how Human Immunodeficiency Virus (HIV) avoids induction of the antiviral Type I Interferon (IFN) system. To limit viral infection, the innate immune system produces important antiviral cytokines such as the IFN. IFN set up a critical roadblock to virus infection by limiting further replication of a virus. Usually, IFN production is induced by the recognition of viral nucleic acids by innate immune receptors and subsequent downstream signaling. However, the importance of IFN in the defense against viruses has lead most pathogenic viruses to evolve strategies to inhibit host IFN induction or responses allowing for increased pathogenicity and persistence of the virus. While the adaptive immune responses to HIV infection have been extensively studied, less is known about the balance between induction and inhibition of innate immune defenses, including the antiviral IFN response, by HIV infection. Here we show that HIV infection of T cells does not induce significant IFN production even IFN I Interferon production. To explain this paradox, we screened HIV proteins and found that two HIV encoded proteins, Vpu and Nef, strongly antagonize IFN induction, with expression of these proteins leading to loss of expression of the innate immune viral RNA sensing adaptor protein, IPS-1 (IFN-β promoter stimulator-1). We hypothesize that with lower levels of IPS-1 present, infected cells are defective in mounting antiviral responses allowing HIV to replicate without the normal antiviral actions of the host IFN response. Using cell lines as well as primary human derived cells, we show that HIV targeting of IPS-1 is key to limiting IFN induction. These findings describe how HIV infection modulates IFN induction providing insight into the mechanisms by which HIV establishes infection and persistence in a host.
MACHIDA, KEIGO; TSUKIYAMA-KOHARA, KYOKO; SEKIGUCH, SATOSHI; SEIKE, EIJI; TÓNE, SHIGENOBU; HAYASHI, YUKIKO; TOBITA, YOSHIMI; KASAMA, YURI; SHIMIZU, MASUMI; TAKAHASHI, HIDEMI; TAYA, CHYOJI; YONEKAWA, HIROMICHI; TANAKA, NOBUYUKI; KOHARA, MICHINORI
2014-01-01
BACKGROUND & AIMS The molecular mechanisms of lymphoproliferation associated with the disruption of interferon (IFN) signaling and chronic hepatitis C virus (HCV) infection are poorly understood. Lymphomas are extrahepatic manifestations of HCV infection; we sought to clarify the molecular mechanisms of these processes. METHODS We established interferon regulatory factor-1– null (irf-1−/−) mice with inducible and persistent expression of HCV structural proteins (irf-1/CN2 mice). All the mice (n = 900) were observed for at least 600 days after Cre/loxP switching. Histologic analyses, as well as analyses of lymphoproliferation, sensitivity to Fas-induced apoptosis, colony formation, and cytokine production, were performed. Proteins associated with these processes were also assessed. RESULTS Irf-1/CN2 mice had extremely high incidences of lymphomas and lymphoproliferative disorders and displayed increased mortality. Disruption of irf-1 reduced the sensitivity to Fas-induced apoptosis and decreased the levels of caspases-3/7 and caspase-9 messenger RNA species and enzymatic activities. Furthermore, the irf-1/CN2 mice showed decreased activation of caspases-3/7 and caspase-9 and increased levels of interleukin (IL)-2, IL-10, and Bcl-2, as well as increased Bcl-2 expression, which promoted oncogenic transformation of lymphocytes. IL-2 and IL-10 were induced by the HCV core protein in splenocytes. CONCLUSIONS Disruption of IFN signaling resulted in development of lymphoma, indicating that differential signaling occurs in lymphocytes compared with liver. This mouse model, in which HCV expression and disruption of IFN signaling synergize to promote lymphoproliferation, will be an important tool for the development of therapeutic agents that target the lymphoproliferative pathway. PMID:19362089
Navea, Amparo; Almansa, Inmaculada; Muriach, María; Bosch-Morell, Francisco
2014-01-01
The aim of the present study was to evaluate the anti-inflammatory efficacy of Daclizumab, an anti-interleukin-2 receptor drug, in an experimental uveitis model upon a subcutaneous injection of lipopolysaccharide into Lewis rats, a valuable model for ocular acute inflammatory processes. The integrity of the blood-aqueous barrier was assessed 24 h after endotoxin-induced uveitis by evaluating two parameters: cell count and protein concentration in aqueous humors. The histopathology of all the ocular structures (cornea, lens, sclera, choroid, retina, uvea, and anterior and posterior chambers) was also considered. Enzyme-linked immunosorbent assays of the aqueous humor samples were performed to quantify the levels of the different chemokine and cytokine proteins. Similarly, a biochemical analysis of oxidative stress-related markers was also assessed. The inflammation observed in the anterior chamber of the eyes when Daclizumab was administered with endotoxin was largely prevented since the aqueous humor protein concentration substantially lowered concomitantly with a significant reduction in the uveal and vitreous histopathological grading. Th1 lymphocytes-related cytokines, such as Interleukin-2 and Interferon-γ, also significantly reduced with related anti-oxidant systems recovery. Daclizumab treatment in endotoxin-induced uveitis reduced Th1 lymphocytes-related cytokines, such as Interleukin-2 and Interferon gamma, by about 60–70% and presented a preventive role in endotoxin-induced oxidative stress. This antioxidant protective effect of Daclizumab may be related to several of the observed Daclizumab effects in our study, including IL-6 cytokine regulatory properties and a substantial concomitant drop in INFγ. Concurrently, Daclizumab treatment triggered a significant reduction in both the uveal histopathological grading and protein concentration in aqueous humors, but not in cellular infiltration. PMID:24595020
Kalia, Neena; Auger, Jocelyn M; Atkinson, Ben; Watson, Steve P
2008-05-01
The role of collagen receptor complex GPVI-FcR gamma-chain, PLCgamma2 and LAT in laser-induced thrombosis is unclear. Controversy surrounds whether collagen is exposed in this model or whether thrombosis is dependent on thrombin. This study hypothesized that collagen exposure plays a critical role in thrombus formation in this model, which was tested by investigating contributions of FcR gamma-chain, LAT, PLCgamma2 and thrombin. Thrombi were monitored using intravital microscopy in anesthetized wild-type and FcR gamma-chain, LAT and PLCgamma2 knockout mice. Hirudin (thrombin inhibitor) was administered to wild-type and FcR gamma-chain knockout mice. Significantly reduced thrombus formation was observed in FcR gamma-chain and PLCgamma2 knockouts with a greater decrease observed in LAT knockouts. Dramatic reduction was observed in wild-types treated with hirudin, with abolished thrombus formation only observed in FcR gamma-chain knockouts treated with hirudin. GPVI-FcR gamma-chain, LAT and PLCgamma2 are essential for thrombus generation and stability in this laser-induced model of injury. More importantly, a greater role for LAT was identified, which may reflect a role for it downstream of a second matrix protein receptor. However, inhibition of platelet activation by matrix proteins and thrombin generation are both required to maximally prevent thrombus formation.
Lu, Yao; Truccolo, Wilson; Wagner, Fabien B.; Vargas-Irwin, Carlos E.; Ozden, Ilker; Zimmermann, Jonas B.; May, Travis; Agha, Naubahar S.; Wang, Jing
2015-01-01
Transient gamma-band (40–80 Hz) spatiotemporal patterns are hypothesized to play important roles in cortical function. Here we report the direct observation of gamma oscillations as spatiotemporal waves induced by targeted optogenetic stimulation, recorded by intracortical multichannel extracellular techniques in macaque monkeys during their awake resting states. Microelectrode arrays integrating an optical fiber at their center were chronically implanted in primary motor (M1) and ventral premotor (PMv) cortices of two subjects. Targeted brain tissue was transduced with the red-shifted opsin C1V1(T/T). Constant (1-s square pulses) and ramp stimulation induced narrowband gamma oscillations during awake resting states. Recordings across 95 microelectrodes (4 × 4-mm array) enabled us to track the transient gamma spatiotemporal patterns manifested, e.g., as concentric expanding and spiral waves. Gamma oscillations were induced well beyond the light stimulation volume, via network interactions at distal electrode sites, depending on optical power. Despite stimulation-related modulation in spiking rates, neuronal spiking remained highly asynchronous during induced gamma oscillations. In one subject we examined stimulation effects during preparation and execution of a motor task and observed that movement execution largely attenuated optically induced gamma oscillations. Our findings demonstrate that, beyond previously reported induced gamma activity under periodic drive, a prolonged constant stimulus above a certain threshold may carry primate motor cortex network dynamics into gamma oscillations, likely via a Hopf bifurcation. More broadly, the experimental capability in combining microelectrode array recordings and optogenetic stimulation provides an important approach for probing spatiotemporal dynamics in primate cortical networks during various physiological and behavioral conditions. PMID:25761956
Non-B-DNA structures on the interferon-beta promoter?
Robbe, K; Bonnefoy, E
1998-01-01
The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.
Panzer, Ulf; Zahner, Gunther; Wienberg, Ulrike; Steinmetz, Oliver M; Peters, Anett; Turner, Jan-Eric; Paust, Hans-Joachim; Wolf, Gunter; Stahl, Rolf A K; Schneider, André
2008-12-01
Activators of the peroxisome proliferator-activated receptor gamma (PPARgamma), originally found to be implicated in lipid metabolism and glucose homeostasis, have been shown to modulate inflammatory responses through interference with cytokine and chemokine production. Given the central role of mesangial cell-derived chemokines in glomerular leukocyte recruitment in human and experimental glomerulonephritis, we studied the influence of natural and synthetic PPARgamma activators on INF-gamma-induced expression of the T cell-attracting chemokines IP-10/CXCL10, Mig/CXCL9 and I-TAC/CXCL11 in mouse mesangial cells. INF-gamma-treated mesangial cells were cultured in the presence or absence of either the naturally occurring PPARgamma ligand 15-deoxy-Delta(12,14)-prostaglandin J(2) (15d-PGJ(2)) or synthetic PPARgamma activators of the glitazone group. Chemokine mRNA and protein expression and activation of the JAK/STAT signalling pathway were analysed. The 15d-PGJ(2), but not synthetic PPARgamma ligands, dose-dependently inhibited INF-gamma-induced chemokine gene (mRNA and protein) expression. Combined results from EMSA and western blot analysis revealed the inhibitory ability of 15d-PGJ(2), but not of synthetic PPARgamma ligands, on IFN-gamma-induced tyrosine phosphorylation of JAK1, JAK2, STAT1 and nuclear STAT1 translocation and DNA binding. Our results demonstrate that 15d-PGJ(2) inhibits INF-gamma-induced chemokine expression in mesangial cells by targeting the JAK/STAT signalling pathway. This effect is independent of an interference with PPARgamma.
Zhang, Xiaobo; De Paiva, Cintia S; Su, Zhitao; Volpe, Eugene A; Li, De-Quan; Pflugfelder, Stephen C
2014-01-01
Evidence suggests that the cytokine interferon (IFN)-γ released by natural killer and CD4(+) T cells contributes to the conjunctival goblet cell (GC) loss in dry eye. The purpose of this study was to investigate if topical neutralization of IFN-γ prevents or alleviates GC loss in an experimental desiccating stress (DS) model of dry eye. In this study, we found that topical IFN-γ neutralization significantly decreased DS-induced conjunctival GC loss. This was accompanied by decreased epithelial apoptosis, and increased IL-13 and decreased FoxA2 expression in the forniceal conjunctiva. To establish that IFN-γ produced by pathogenic CD4(+) T cells contributes to DS-induced GC loss, adoptive transfer of CD4(+) T cells isolated from DS exposed donors to naïve RAG-1(-/-) recipient mice was performed. Similar to the donor mice, topical IFN-γ neutralization decreased conjunctival GC loss, suppressed apoptosis and increased IL-13 expression in adoptive transfer recipients. In summary, this study demonstrated that topical neutralization of IFN-γ prevents GC loss via modulating apoptosis and maintaining IL-13 signaling. Copyright © 2013 Elsevier Ltd. All rights reserved.
Defaux, Antoinette; Zurich, Marie-Gabrielle; Braissant, Olivier; Honegger, Paul; Monnet-Tschudi, Florianne
2009-05-07
Brain inflammation plays a central role in numerous brain pathologies, including multiple sclerosis (MS). Microglial cells and astrocytes are the effector cells of neuroinflammation. They can be activated also by agents such as interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS). Peroxisome proliferator-associated receptor (PPAR) pathways are involved in the control of the inflammatory processes, and PPAR-beta seems to play an important role in the regulation of central inflammation. In addition, PPAR-beta agonists were shown to have trophic effects on oligodendrocytes in vitro, and to confer partial protection in experimental autoimmune encephalomyelitis (EAE), an animal model of MS. In the present work, a three-dimensional brain cell culture system was used as in vitro model to study antibody-induced demyelination and inflammatory responses. GW 501516, a specific PPAR-beta agonist, was examined for its capacity to protect from antibody-mediated demyelination and to prevent inflammatory responses induced by IFN-gamma and LPS. Aggregating brain cells cultures were prepared from embryonal rat brain, and used to study the inflammatory responses triggered by IFN-gamma and LPS and by antibody-mediated demyelination induced by antibodies directed against myelin-oligodendrocyte glycoprotein (MOG). The effects of GW 501516 on cellular responses were characterized by the quantification of the mRNA expression of tumor necrosis factor-alpha (TNF-alpha), interleukin-6 (IL-6), inducible NO synthase (i-NOS), PPAR-beta, PPAR-gamma, glial fibrillary acidic protein (GFAP), myelin basic protein (MBP), and high molecular weight neurofilament protein (NF-H). GFAP expression was also examined by immunocytochemistry, and microglial cells were visualized by isolectin B4 (IB4) and ED1 labeling. GW 501516 decreased the IFN-gamma-induced up-regulation of TNF-alpha and iNOS in accord with the proposed anti-inflammatory effects of this PPAR-beta agonist. However, it increased IL-6 m
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahdjoudj, S.; Kaabeche, K.; Holy, X.
2005-02-01
The molecular mechanisms regulating the adipogenic differentiation of bone marrow stromal cells in vivo remain largely unknown. In this study, we investigated the regulatory effects of transforming growth factor beta-2 (TGF-{beta}2) on transcription factors involved in adipogenic differentiation induced by hind limb suspension in rat bone marrow stromal cells in vivo. Time course real-time quantitative reverse-transcription polymerase chain reaction (RT-PCR) analysis of gene expression showed that skeletal unloading progressively increases the expression of CCAAT/enhancer-binding protein (C/EBP){alpha} and C/EBP{beta} {alpha} at 5 days in bone marrow stromal cells resulting in increased peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}2) transcripts at 7 days. TGF-{beta}2more » administration in unloaded rats corrected the rise in C/EBP{alpha} and C/EBP{beta} transcripts induced by unloading in bone marrow stromal cells. This resulted in inhibition of PPAR{gamma}2 expression that was associated with increased Runx2 expression. Additionally, the inhibition of C/EBP{alpha} and C/EBP{beta} expression by TGF-{beta}2 was associated with increased PPAR{gamma} serine phosphorylation in bone marrow stromal cells, a mechanism that inhibits PPAR{gamma} transactivating activity. The sequential inhibitory effect of TGF-{beta}2 on C/EBP{alpha}, C/EBP{beta}, and PPAR{gamma}2 resulted in reduced LPL expression and abolition of bone marrow stromal cell adipogenic differentiation, which contributed to prevent bone loss induced by skeletal unloading. We conclude that TGF-{beta}2 inhibits the excessive adipogenic differentiation of bone marrow stromal cells induced by skeletal unloading by inhibiting C/EBP{alpha}, C/EBP{beta}, and PPAR{gamma} expression and activity, which provides a sequential mechanism by which TGF-{beta}2 regulates adipogenic differentiation of bone marrow stromal cells in vivo.« less
Enhanced antitumor reactivity of tumor-sensitized T cells by interferon alfa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vander Woude, D.L.; Wagner, P.D.; Shu, S.
Tumor-draining lymph node cells from mice bearing the methylcholanthrene-induced MCA 106 tumors can be sensitized in vitro to acquire antitumor reactivity. We examined the effect of interferon alfa on the function of cells that underwent in vitro sensitization in adoptive immunotherapy. Interferon alfa increased the antitumor reactivity of in vitro sensitized cells in the treatment of MCA 106 pulmonary metastases. This effect was evident in irradiated mice, indicating that a host response to the interferon alfa was not required. Interferon alfa treatment increased class I major histocompatibility complex antigen expression on tumor cells and increased their susceptibility to lysis bymore » in vitro sensitized cells. These results suggest that interferon alfa enhancement of adoptive immunotherapy was mediated by its effect on tumor cells. Interferon alfa may be a useful adjunct to the adoptive immunotherapy of human cancer.« less
Support vector machines for prediction and analysis of beta and gamma-turns in proteins.
Pham, Tho Hoan; Satou, Kenji; Ho, Tu Bao
2005-04-01
Tight turns have long been recognized as one of the three important features of proteins, together with alpha-helix and beta-sheet. Tight turns play an important role in globular proteins from both the structural and functional points of view. More than 90% tight turns are beta-turns and most of the rest are gamma-turns. Analysis and prediction of beta-turns and gamma-turns is very useful for design of new molecules such as drugs, pesticides, and antigens. In this paper we investigated two aspects of applying support vector machine (SVM), a promising machine learning method for bioinformatics, to prediction and analysis of beta-turns and gamma-turns. First, we developed two SVM-based methods, called BTSVM and GTSVM, which predict beta-turns and gamma-turns in a protein from its sequence. When compared with other methods, BTSVM has a superior performance and GTSVM is competitive. Second, we used SVMs with a linear kernel to estimate the support of amino acids for the formation of beta-turns and gamma-turns depending on their position in a protein. Our analysis results are more comprehensive and easier to use than the previous results in designing turns in proteins.
Interferon response factor 3 is essential for house dust mite-induced airway allergy.
Marichal, Thomas; Bedoret, Denis; Mesnil, Claire; Pichavant, Muriel; Goriely, Stanislas; Trottein, François; Cataldo, Didier; Goldman, Michel; Lekeux, Pierre; Bureau, Fabrice; Desmet, Christophe J
2010-10-01
Pattern-recognition receptors (PRRs) are critically involved in the pathophysiology of airway allergy, yet most of the signaling pathways downstream of PRRs implicated in allergic airway sensitization remain unknown. We sought to study the effects of genetic depletion of interferon response factor (IRF) 3 and IRF7, important transcription factors downstream of various PRRs, in a murine model of house dust mite (HDM)-induced allergic asthma. We compared HDM-induced allergic immune responses in IRF3-deficient (IRF3(-/-)), IRF7(-/-), and wild-type mice. Parameters of airway allergy caused by HDM exposure were strongly attenuated in IRF3(-/-), but not IRF7(-/-), mice compared with those in wild-type mice. Indeed, in HDM-exposed IRF3(-/-) mice HDM-specific T(H)2 cell responses did not develop. This correlated with impaired maturation and migration of IRF3(-/-) lung dendritic cells (DCs) on HDM treatment. Furthermore, adoptive transfer of HDM-loaded DCs indicated that IRF3(-/-) DCs had an intrinsic defect rendering them unable to migrate and to prime HDM-specific T(H)2 responses. Intriguingly, we also show that DC function and allergic airway sensitization in response to HDM were independent of signaling by type I interferons, the main target genes of IRF3. Through its role in DC function, IRF3, mainly known as a central activator of antiviral immunity, is essential for the development of T(H)2-type responses to airway allergens. Copyright © 2010 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.
Schwaab, T; Heaney, J A; Schned, A R; Harris, R D; Cole, B F; Noelle, R J; Phillips, D M; Stempkowski, L; Ernstoff, M S
2000-04-01
The clinical observation of spontaneous regression in patients with renal cell carcinoma (RCC) and the response to various immunotherapeutic therapies strongly suggest a role for the host immune system in this disease. Prior studies showed that sequential administration of interferon (IFN) gamma and IFN alpha to RCC patients was safe. Clinical responses as well as immune changes in the peripheral blood mononuclear cell compartment were observed. Autologous tumor cell vaccines (AV) have also demonstrated activity in renal cell carcinoma. We hypothesize that the addition of AV to sequential IFN gamma and a therapy might improve the tumor-specific immune response by providing an appropriate source of antigen in the appropriate cytokine environment. To our knowledge, this is the first trial using AV combined with IFN alpha and IFN gamma. The purpose of this study was to evaluate the feasibility of manufacturing and administering (AV) from resected tumor samples, and administration of AV with combination IFN gamma and IFN alpha therapy. Finally, the impact on immunological parameters of these treatment options was assessed. Patients with metastatic RCC were randomly assigned to receive AV plus bCG along with a sequential administration of IFN gamma and a either together or after initiation of vaccine. Toxicity and clinical responses were evaluated. Modulations of the immune system were investigated by analyzing phenotype, cytokine mRNA expression, T cell proliferation and cytotoxicity in the peripheral blood mononuclear cell compartment. Fourteen patients with metastatic renal cell carcinoma were enrolled in this study; 9 were available for response evaluation. In a 70 day period, 3 (33%) showed mixed responses, 5 (56%) stable disease and 1 (11%) progression of disease. Toxicities were consistent with previous clinical reports. In the flow-cytometry phenotype analysis, stimulation of distinct subsets of circulating T-lymphocytes and a decrease of CD8+ T cell subsets was
Permyakova, Natalia V; Zagorskaya, Alla A; Belavin, Pavel A; Uvarova, Elena A; Nosareva, Olesya V; Nesterov, Andrey E; Novikovskaya, Anna A; Zav'yalov, Evgeniy L; Moshkin, Mikhail P; Deineko, Elena V
2015-01-01
Tuberculosis remains one of the major infectious diseases, which continues to pose a major global health problem. Transgenic plants may serve as bioreactors to produce heterologous proteins including antibodies, antigens, and hormones. In the present study, a genetic construct has been designed that comprises the Mycobacterium tuberculosis genes cfp10, esat6 and dIFN gene, which encode deltaferon, a recombinant analog of the human γ-interferon designed for expression in plant tissues. This construct was transferred to the carrot (Daucus carota L.) genome by Agrobacterium-mediated transformation. This study demonstrates that the fusion protein CFP10-ESAT6-dIFN is synthesized in the transgenic carrot storage roots. The protein is able to induce both humoral and cell-mediated immune responses in laboratory animals (mice) when administered either orally or by injection. It should be emphasized that M. tuberculosis antigens contained in the fusion protein have no cytotoxic effect on peripheral blood mononuclear cells.
Shao, Junjie; Liang, Yuying; Ly, Hinh
2018-01-01
The smallest arenaviral protein is the zinc-finger protein (Z) that belongs to the RING finger protein family. Z serves as a main component required for virus budding from the membrane of the infected cells through self-oligomerization, a process that can be aided by the viral nucleoprotein (NP) to form the viral matrix of progeny virus particles. Z has also been shown to be essential for mediating viral transcriptional repression activity by locking the L polymerase onto the viral promoter in a catalytically inactive state, thus limiting viral replication. The Z protein has also recently been shown to inhibit the type I interferon-induction pathway by directly binding to the intracellular pathogen-sensor proteins RIG-I and MDA5, and thus inhibiting their normal functions. This chapter describes several assays used to examine the important roles of the arenaviral Z protein in mediating virus budding (i.e., either Z self-budding or NP-Z budding activities), viral transcriptional inhibition in a viral minigenome (MG) assay, and type I IFN suppression in an IFN-β promoter-mediated luciferase reporter assay.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Qingzhan; Shi, Kaichuang; Yoo, Dongwan, E-mail: dyoo@illinois.edu
Type I interferons (IFN-α/β) are the major components of the innate immune response of hosts, and in turn many viruses have evolved to modulate the host response during infection. We found that the IFN-β production was significantly suppressed during PEDV infection in cells. To identify viral IFN antagonists and to study their suppressive function, viral coding sequences for the entire structural and nonstructural proteins were cloned and expressed. Of 16 PEDV nonstructural proteins (nsps), nsp1, nsp3, nsp7, nsp14, nsp15 and nsp16 were found to inhibit the IFN-β and IRF3 promoter activities. The sole accessory protein ORF3, structure protein envelope (E),more » membrane (M), and nucleocapsid (N) protein were also shown to inhibit such activities. PEDV nsp1 did not interfere the IRF3 phosphorylation and nuclear translocation but interrupted the enhanceosome assembly of IRF3 and CREB-binding protein (CBP) by degrading CBP. A further study showed that the CBP degradation by nsp1 was proteasome-dependent. Our data demonstrate that PEDV modulates the host innate immune responses by degrading CBP and suppressing ISGs expression. - Highlights: • PEDV modulates the host innate immune system by suppressing the type I interferon production and ISGs expression. • Ten viral proteins were identified as IFN antagonists, and nsp1 was the most potent viral IFN antagonist. • PEDV nsp1 did not interfere the IRF3 phosphorylation and nuclear translocation but interrupted the enhanceosome assembly of IRF3 and CREB-binding protein (CBP). • PEDV nsp1 caused the CBP degradation in the nucleus, which may be the key mechanism for PEDV-mediated IFN downregulation.« less
Chuke, Stella O; Yen, Nguyen Thi Ngoc; Laserson, Kayla F; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G; Whitworth, William C; Shah, J Jina; Painter, John A; Mazurek, Gerald H; Maloney, Susan A
2014-01-01
Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB.
Onabajo, Olusegun O.; Porter-Gill, Patricia; Paquin, Ashley; Rao, Nina; Liu, Luyang; Tang, Wei; Brand, Nathan
2015-01-01
Interferon lambda 4 (IFN-λ4) is a novel type-III interferon that can be generated only in individuals carrying a ΔG frame-shift allele of an exonic genetic variant (rs368234815-ΔG/TT). The rs368234815-ΔG allele is strongly associated with decreased clearance of hepatitis C virus (HCV) infection. Here, we further explored the biological function of IFN-λ4 expressed in human hepatic cells—a hepatoma cell line HepG2 and fresh primary human hepatocytes (PHHs). We performed live confocal imaging, cell death and proliferation assays, mRNA expression profiling, protein detection, and antibody blocking assays using transient and inducible stable in vitro systems. Not only did we observe significant intracellular retention of IFN-λ4 but also detected secreted IFN-λ4 in the culture media of expressing cells. Secreted IFN-λ4 induced strong activation of the interferon-stimulated genes (ISGs) in IFN-λ4-expressing and surrounding cells in transwell assays. Specifically, in PHHs, secreted IFN-λ4 induced expression of the CXCL10 transcript and a corresponding pro-inflammatory chemokine, IP-10. In IFN-λ4-expressing HepG2 cells, we also observed decreased proliferation and increased cell death. All IFN-λ4-induced phenotypes—activation of ISGs, decreased proliferation, and increased cell death—could be inhibited by an anti-IFN-λ4-specific antibody. Our study offers new insights into biology of IFN-λ4 and its possible role in HCV clearance. PMID:26134097
NASA Astrophysics Data System (ADS)
Arunachalam, Balasubramanian; Phan, Uyen T.; Geuze, Hans J.; Cresswell, Peter
2000-01-01
Proteins internalized into the endocytic pathway are usually degraded. Efficient proteolysis requires denaturation, induced by acidic conditions within lysosomes, and reduction of inter- and intrachain disulfide bonds. Cytosolic reduction is mediated enzymatically by thioredoxin, but the mechanism of lysosomal reduction is unknown. We describe here a lysosomal thiol reductase optimally active at low pH and capable of catalyzing disulfide bond reduction both in vivo and in vitro. The active site, determined by mutagenesis, consists of a pair of cysteine residues separated by two amino acids, similar to other enzymes of the thioredoxin family. The enzyme is a soluble glycoprotein that is synthesized as a precursor. After delivery into the endosomal/lysosomal system by the mannose 6-phosphate receptor, N- and C-terminal prosequences are removed. The enzyme is expressed constitutively in antigen-presenting cells and induced by IFN-γ in other cell types, suggesting a potentially important role in antigen processing.
Kim, Su-Mi; Kim, Se-Kyung; Park, Jong-Hyeon; Lee, Kwang-Nyeong; Ko, Young-Joon; Lee, Hyang-Sim; Seo, Min-Goo; Shin, Yeun-Kyung; Kim, Byounghan
2014-04-01
Foot-and-mouth disease (FMD) is a virulent and economically costly disease in domestic livestock. Since the current vaccine available against FMD provides no protection until 7days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is by the application of anti-viral agents. The combination of recombinant adenovirus expressing type I interferon (IFN-α) and adenovirus expressing type II IFN (IFN-γ) has been reported to be an effective anti-viral treatment strategy against FMDV. Nevertheless, the recombinant adenovirus mixture may be inefficient because of the low anti-viral efficiency of IFN-γ compared to that of IFN-α. In this study, we generated a recombinant adenovirus co-expressing porcine IFN-α and IFN-γ in tandem using an FMDV 2A sequence to mediate effective cleavage of the two proteins (referred to as Ad-porcine IFN-αγ). We demonstrated that both recombinant porcine IFN-α and IFN-γ were expressed and interferon stimulated gene (ISG)s related with IFN-α and IFN-γ were induced in porcine kidney (IBRS-2) cells infected with Ad-porcine IFN-αγ. Additionally, the anti-viral effects of Ad-porcine IFN-αγ against FMDV were enhanced both in IBRS-2 cells and in CD-1 (ICR) suckling mice compared to that of adenovirus expressing only a single protein. We propose that Ad-porcine IFN-αγ could be a rapid, highly efficient, convenient anti-viral agent against FMDV. Copyright © 2014 Elsevier B.V. All rights reserved.
O'Brien, Kevin B; Schultz-Cherry, Stacey; Knoll, Laura J
2011-09-01
Outbreaks of influenza A viruses are associated with significant human morbidity worldwide. Given the increasing resistance to the available influenza drugs, new therapies for the treatment of influenza virus infection are needed. An alternative approach is to identify products that enhance a protective immune response. In these studies, we demonstrate that infecting mice with the Th1-inducing parasite Toxoplasma gondii prior to highly pathogenic avian H5N1 influenza virus infection led to decreased lung viral titers and enhanced survival. A noninfectious fraction of T. gondii soluble antigens (STAg) elicited an immune response similar to that elicited by live parasites, and administration of STAg 2 days after H5N1 influenza virus infection enhanced survival, lowered viral titers, and reduced clinical disease. STAg administration protected H5N1 virus-infected mice lacking lymphocytes, suggesting that while the adaptive immune response was not required for enhanced survival, it was necessary for STAg-mediated viral clearance. Mechanistically, we found that administration of STAg led to increased production of gamma interferon (IFN-γ) from natural killer (NK) cells, which were both necessary and sufficient for survival. Further, administration of exogenous IFN-γ alone enhanced survival from H5N1 influenza virus infection, although not to the same level as STAg treatment. These studies demonstrate that a noninfectious T. gondii extract enhances the protective immune response against severe H5N1 influenza virus infections even when a single dose is administered 2 days postinfection.
Kim, Sangwon; Ponka, Prem
2002-01-01
Iron regulatory proteins (IRP1 and IRP2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements (IREs) that are located in the 3' untranslated region (UTR) and the 5' UTR of their respective mRNAs. Cellular iron levels affect binding of IRPs to IREs and consequently expression of TfR and ferritin. Moreover, NO(.), a redox species of nitric oxide that interacts primarily with iron, can activate IRP1 RNA-binding activity resulting in an increase in TfR mRNA levels and a decrease in ferritin synthesis. We have shown that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA-binding of IRP2, followed by IRP2 degradation, and these changes were associated with a decrease in TfR mRNA levels and a dramatic increase in ferritin synthesis. Moreover, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP1 binding activity, whereas RNA-binding of IRP2 decreased and was followed by a degradation of this protein. Furthermore, the decrease of IRP2 binding/protein levels was associated with a decrease in TfR mRNA levels and an increase in ferritin synthesis in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. These results suggest that NO(+)-mediated degradation of IRP2 plays a major role in iron metabolism during inflammation.
Gaspard, I; Kerdine, S; Pallardy, M; Lebrec, H
1999-09-01
Xenobiotic-induced hypersensitivity reactions are immune-mediated effects that involve specific antibodies and/or effector and regulatory T lymphocytes. Cytokines are key mediators of such responses and must be considered as possible endpoints for predicting sensitizing potency of drugs and chemicals, as well as for helping diagnosis of allergy. Detecting cytokine production at the protein level has been shown to not be always sensitive enough. This paper describes three examples of the utilization of semiquantitative or competitive reverse transcription polymerase chain reaction analysis of interleukin-4, interferon gamma, and interleukin-1beta mRNAs as endpoints for assessing T-cell or dendritic cell responses to sensitizing drugs (beta-lactam antibiotics) or chemicals (dinitrochlorobenzene). Copyright 1999 Academic Press.
Yamauchi, Shota; Takeuchi, Kenji; Chihara, Kazuyasu; Honjoh, Chisato; Kato, Yuji; Yoshiki, Hatsumi; Hotta, Hak; Sada, Kiyonao
2016-12-08
Interferon-α (IFN-α) and IFN-λ are structurally distinct cytokines that bind to different receptors, but induce expression of similar sets of genes through Janus kinase (JAK)-signal transducers and activators of transcription (STAT) pathways. The difference between IFN-α and IFN-λ signaling remains poorly understood. Here, using the CRISPR/Cas9 system, we examine the role of STAT1 and STAT2 in the inhibition of hepatitis C virus (HCV) replication by IFN-α and IFN-λ. Treatment with IFN-α increases expression of IFN-stimulated genes (ISGs) such as double-stranded RNA-activated protein kinase (PKR) and decreases viral RNA and protein levels in HCV-infected Huh-7.5 human hepatoma cells. These responses are only partially attenuated by knockout of STAT1 but are abolished by knockout of STAT2. In contrast, the inhibition of HCV replication by IFN-λ is abolished by knockout of STAT1 or STAT2. Microarray analysis reveals that IFN-α but not IFN-λ can induce expression of the majority of ISGs in STAT1 knockout cells. These findings suggest that IFN-α can inhibit HCV replication through a STAT2-dependent but STAT1-independent pathway, whereas IFN-λ induces ISG expression and inhibits HCV replication exclusively through a STAT1- and STAT2-dependent pathway.
Yamauchi, Shota; Takeuchi, Kenji; Chihara, Kazuyasu; Honjoh, Chisato; Kato, Yuji; Yoshiki, Hatsumi; Hotta, Hak; Sada, Kiyonao
2016-01-01
Interferon-α (IFN-α) and IFN-λ are structurally distinct cytokines that bind to different receptors, but induce expression of similar sets of genes through Janus kinase (JAK)-signal transducers and activators of transcription (STAT) pathways. The difference between IFN-α and IFN-λ signaling remains poorly understood. Here, using the CRISPR/Cas9 system, we examine the role of STAT1 and STAT2 in the inhibition of hepatitis C virus (HCV) replication by IFN-α and IFN-λ. Treatment with IFN-α increases expression of IFN-stimulated genes (ISGs) such as double-stranded RNA-activated protein kinase (PKR) and decreases viral RNA and protein levels in HCV-infected Huh-7.5 human hepatoma cells. These responses are only partially attenuated by knockout of STAT1 but are abolished by knockout of STAT2. In contrast, the inhibition of HCV replication by IFN-λ is abolished by knockout of STAT1 or STAT2. Microarray analysis reveals that IFN-α but not IFN-λ can induce expression of the majority of ISGs in STAT1 knockout cells. These findings suggest that IFN-α can inhibit HCV replication through a STAT2-dependent but STAT1-independent pathway, whereas IFN-λ induces ISG expression and inhibits HCV replication exclusively through a STAT1- and STAT2-dependent pathway. PMID:27929099
Protective Role of Gamma Interferon during the Recall Response to Influenza Virus
Bot, Adrian; Bot, Simona; Bona, Constantin A.
1998-01-01
During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110
Zhao, Fen; Yu, Yonghui; Liu, Wei; Zhang, Jian; Liu, Xinqi; Liu, Lingying; Yin, Huinan
2018-03-21
This article describes results of the effect of dietary supplementation with small molecular weight soybean protein-derived peptides on major rat burn injury-induced muscle atrophy. As protein nutrients have been previously implicated to play an important role in improving burn injury outcomes, optimized more readily absorbed small molecular weight soybean protein-derived peptides were evaluated. Thus, the quantity, sodium dodecyl sulfate polyacrylamide-gel electrophoresis patterns, molecular weight distribution, and composition of amino acids of the prepared peptides were analyzed, and a major full-thickness 30% total body surface area burn-injury rat model was utilized to assess the impact of supplementation with soybean protein-derived peptides on initial systemic inflammatory responses as measured by interferon-gamma (IFN-γ), chemokine (C-C motif) ligand 2 (CCL2, also known as MCP-1), chemokine (C-C motif) ligand 7 (CCL7, also known as MCP-3), and generation of muscle atrophy as measured by tibialis anterior muscle (TAM) weight relative to total body weight. Induction of burn injury-induced muscle atrophy ubiquitin-proteasome system (UPS) signaling pathways in effected muscle tissues was determined by Western blot protein expression measurements of E3 ubiquitin-protein ligase TRIM-63 (TRIM63, also known as MuRF1) and F-box only protein 32 (FBXO32, also known as atrogin-1 or MAFbx). In addition, induction of burn injury-induced autophagy signaling pathways associated with muscle atrophy in effected muscle tissues was assessed by immunohistochemical analysis as measured by microtubule-associated proteins 1 light chain 3 (MAP1LC3, or commonly abbreviated as LC3) and beclin-1 (BECN1) expression, as well as relative induction of cytoplasmic-liberated form of MAP1LC3 (LC3-I) and phagophore and autophagosome membrane-bound form of MAP1LC3 (LC3-II), and BECN1 protein expression by Western blot analysis. Nutrient supplementation with small molecular weight soybean
Interactions of the interferon system with cellular metabolism
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald
1986-01-01
The results of studies concerning the interaction of the interferon (Inf) system with the activities of carcinogens, tumor promoters, and cytochrome P-450 are presented. The results show that the addition of a tumor promoter (TPA or 4-O-methyl-TPA) to a tissue culture enhances virus-induced Inf-gamma production, suggesting a potential value of tumor promoters in the biosynthesis of commercial Inf. On the other hand, the carcinogens were reported to inhibit the induction of Inf-alpha/beta in cultured cells and in intact animals (with no effect on the administered or preformed Inf). The demonstration of a correlation between the carcinogenic potential of a compound and its inhibitive effect on Inf production suggests a possible use of the Inf production assay in the evaluation of the carcinogenicity of chemicals. In addition, it was shown that the induction of Inf-alpha/beta as well as the administration of this Inf depresses the levels of rat liver cytochrome P-450 which is responsible for binding lipophilic drugs, steroids, and carcinogens, thus increasing the toxicity of the respective chemical.
Bekpen, Cemalettin; Hunn, Julia P; Rohde, Christoph; Parvanova, Iana; Guethlein, Libby; Dunn, Diane M; Glowalla, Eva; Leptin, Maria; Howard, Jonathan C
2005-01-01
Background Members of the p47 (immunity-related GTPases (IRG) family) GTPases are essential, interferon-inducible resistance factors in mice that are active against a broad spectrum of important intracellular pathogens. Surprisingly, there are no reports of p47 function in humans. Results Here we show that the p47 GTPases are represented by 23 genes in the mouse, whereas humans have only a single full-length p47 GTPase and an expressed, truncated presumed pseudo-gene. The human full-length gene is orthologous to an isolated mouse p47 GTPase that carries no interferon-inducible elements in the promoter of either species and is expressed constitutively in the mature testis of both species. Thus, there is no evidence for a p47 GTPase-based resistance system in humans. Dogs have several interferon-inducible p47s, and so the primate lineage that led to humans appears to have lost an ancient function. Multiple p47 GTPases are also present in the zebrafish, but there is only a tandem p47 gene pair in pufferfish. Conclusion Mice and humans must deploy their immune resources against vacuolar pathogens in radically different ways. This carries significant implications for the use of the mouse as a model of human infectious disease. The absence of the p47 resistance system in humans suggests that possession of this resistance system carries significant costs that, in the primate lineage that led to humans, are not outweighed by the benefits. The origin of the vertebrate p47 system is obscure. PMID:16277747
Tanabe, Y; Dan, K; Kuriya, S; Nomura, T
1989-10-01
The effects of recombinant human interferon (IFN) alpha-2b and gamma on the bone marrow megakaryocyte progenitors (CFU-Meg) were compared between eight patients in the chronic phase of Ph1-positive chronic myelocytic leukemia (CML) and five hematologically normal patients. CFU-Meg was assayed in plasma clot culture added with phytohemagglutinin-stimulated leukocyte-conditioned medium as a source of colony stimulating activity. The average count of CFU-Meg colonies formed from the bone marrow of CML patients was 5.5 times that of normal controls. Spontaneous CFU-Meg colonies were grown in seven of eight CML patients, but in none of five controls. Colony formation by CFU-Meg in CML as well as normal bone marrow was suppressed by the two preparations of IFN in a dose dependent fashion. Their suppressive influence on colonies from CFU-Meg was comparable between CML and normal bone marrow at lower concentrations, but was less marked for CML than normal bone marrow at higher concentrations. The formation of CFU-Meg colonies from CML bone marrow was more severely suppressed by IFN-gamma than IFN-alpha-2b. Depletion of either T lymphocytes or adherent cells from the CML bone marrow cells diminished the suppressive effects of IFN-gamma, but had no influence on the effects of IFN-alpha-2b.
Yu, Man; Tong, Jian-Hua; Mao, Mao; Kan, Li-Xin; Liu, Meng-Min; Sun, Yi-Wu; Fu, Gang; Jing, Yong-Kui; Yu, Long; Lepaslier, Denis; Lanotte, Michel; Wang, Zhen-Yi; Chen, Zhu; Waxman, Samuel; Wang, Ya-Xin; Tan, Jia-Zhen; Chen, Sai-Juan
1997-01-01
In a cell line (NB4) derived from a patient with acute promyelocytic leukemia, all-trans-retinoic acid (ATRA) and interferon (IFN) induce the expression of a novel gene we call RIG-G (for retinoic acid-induced gene G). This gene codes for a 58-kDa protein containing 490 amino acids with several potential sites for post-translational modification. In untreated NB4 cells, the expression of RIG-G is undetectable. ATRA treatment induces the transcriptional expression of RIG-G relatively late (12–24 hr) in a protein synthesis-dependent manner, whereas IFN-α induces its expression early (30 min to 3 hr). Database search has revealed a high-level homology between RIG-G and several IFN-stimulated genes in human (ISG54K, ISG56K, and IFN-inducible and retinoic acid-inducible 58K gene) and some other species, defining a well conserved gene family. The gene is composed of two exons and has been mapped by fluorescence in situ hybridization to chromosome 10q24, where two other human IFN-stimulated gene members are localized. A synergistic induction of RIG-G expression in NB4 cells by combined treatment with ATRA and IFNs suggests that a collaboration exists between their respective signaling pathways. PMID:9207104
Xing, Junji; Ly, Hinh
2014-01-01
ABSTRACT Arenavirus pathogens cause a wide spectrum of diseases in humans ranging from central nervous system disease to lethal hemorrhagic fevers with few treatment options. The reason why some arenaviruses can cause severe human diseases while others cannot is unknown. We find that the Z proteins of all known pathogenic arenaviruses, lymphocytic choriomeningitis virus (LCMV) and Lassa, Junin, Machupo, Sabia, Guanarito, Chapare, Dandenong, and Lujo viruses, can inhibit retinoic acid-inducible gene 1 (RIG-i) and Melanoma Differentiation-Associated protein 5 (MDA5), in sharp contrast to those of 14 other nonpathogenic arenaviruses. Inhibition of the RIG-i-like receptors (RLRs) by pathogenic Z proteins is mediated by the protein-protein interactions of Z and RLRs, which lead to the disruption of the interactions between RLRs and mitochondrial antiviral signaling (MAVS). The Z-RLR interactive interfaces are located within the N-terminal domain (NTD) of the Z protein and the N-terminal CARD domains of RLRs. Swapping of the LCMV Z NTD into the nonpathogenic Pichinde virus (PICV) genome does not affect virus growth in Vero cells but significantly inhibits the type I interferon (IFN) responses and increases viral replication in human primary macrophages. In summary, our results show for the first time an innate immune-system-suppressive mechanism shared by the diverse pathogenic arenaviruses and thus shed important light on the pathogenic mechanism of human arenavirus pathogens. IMPORTANCE We show that all known human-pathogenic arenaviruses share an innate immune suppression mechanism that is based on viral Z protein-mediated RLR inhibition. Our report offers important insights into the potential mechanism of arenavirus pathogenesis, provides a convenient way to evaluate the pathogenic potential of known and/or emerging arenaviruses, and reveals a novel target for the development of broad-spectrum therapies to treat this group of diverse pathogens. More broadly, our
Involvement of {gamma}-secretase in postnatal angiogenesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hayashi, Hiroki; Nakagami, Hironori; Takami, Yoichi
2007-11-23
{gamma}-Secretase cleaves the transmembrane domains of several integral membrane proteins involved in vasculogenesis. Here, we investigated the role of {gamma}-secretase in the regulation of postnatal angiogenesis using {gamma}-secretase inhibitors (GSI). In endothelial cell (EC), {gamma}-secretase activity was up-regulated under hypoxia or the treatment of vascular endothelial growth factor (VEGF). The treatment of GSI significantly attenuated growth factor-induced EC proliferation and migration as well as c-fos promoter activity in a dose-dependent manner. In vascular smooth muscle cell (VSMC), treatment of GSI significantly attenuated growth factor-induced VEGF and fibroblast growth factor-2 (FGF-2) expression. Indeed, GSI attenuated VEGF-induced tube formation and inhibited FGF-2-inducedmore » angiogenesis on matrigel in mice as quantified by FITC-lectin staining of EC. Overall, we demonstrated that {gamma}-secretase may be key molecule in postnatal angiogenesis which may be downstream molecule of growth factor-induced growth and migration in EC, and regulate the expression of angiogenic growth factors in VSMC.« less
NASA Astrophysics Data System (ADS)
Jeong, Hyeon-Ho; Erdene, Norov; Lee, Seung-Ki; Jeong, Dae-Hong; Park, Jae-Hyoung
2011-12-01
A fiber-optic localized surface plasmon (FO LSPR) sensor was fabricated by gold nanoparticles (Au NPs) immobilized on the end-face of an optical fiber. When Au NPs were formed on the end-face of an optical fiber by chemical reaction, Au NPs aggregation occurred and the Au NPs were immobilized in various forms such as monomers, dimers, trimers, etc. The component ratio of the Au NPs on the end-face of the fabricated FO LSPR sensor was slightly changed whenever the sensors were fabricated in the same condition. Including this phenomenon, the FO LSPR sensor was fabricated with high sensitivity by controlling the density of Au NPs. Also, the fabricated sensors were measured for the resonance intensity for the different optical systems and analyzed for the effect on sensitivity. Finally, for application as a biosensor, the sensor was used for detecting the antibody-antigen reaction of interferon-gamma.
Holzer, Barbara; Bakshi, Siddharth; Bridgen, Anne; Baron, Michael D
2011-01-01
The Nairoviruses are an important group of tick-borne viruses that includes pathogens of man (Crimean Congo hemorrhagic fever virus) and livestock animals (Dugbe virus, Nairobi sheep disease virus (NSDV)). NSDV is found in large parts of East Africa and the Indian subcontinent (where it is known as Ganjam virus). We have investigated the ability of NSDV to antagonise the induction and actions of interferon. Both pathogenic and apathogenic isolates could actively inhibit the induction of type 1 interferon, and also blocked the signalling pathways of both type 1 and type 2 interferons. Using transient expression of viral proteins or sections of viral proteins, these activities all mapped to the ovarian tumour-like protease domain (OTU) found in the viral RNA polymerase. Virus infection, or expression of this OTU domain in transfected cells, led to a great reduction in the incorporation of ubiquitin or ISG15 protein into host cell proteins. Point mutations in the OTU that inhibited the protease activity also prevented it from antagonising interferon induction and action. Interestingly, a mutation at a peripheral site, which had little apparent effect on the ability of the OTU to inhibit ubiquitination and ISG15ylation, removed the ability of the OTU to block the induction of type 1 and the action of type 2 interferons, but had a lesser effect on the ability to block type 1 interferon action, suggesting that targets other than ubiquitin and ISG15 may be involved in the actions of the viral OTU.
Holzer, Barbara; Bakshi, Siddharth; Bridgen, Anne; Baron, Michael D.
2011-01-01
The Nairoviruses are an important group of tick-borne viruses that includes pathogens of man (Crimean Congo hemorrhagic fever virus) and livestock animals (Dugbe virus, Nairobi sheep disease virus (NSDV)). NSDV is found in large parts of East Africa and the Indian subcontinent (where it is known as Ganjam virus). We have investigated the ability of NSDV to antagonise the induction and actions of interferon. Both pathogenic and apathogenic isolates could actively inhibit the induction of type 1 interferon, and also blocked the signalling pathways of both type 1 and type 2 interferons. Using transient expression of viral proteins or sections of viral proteins, these activities all mapped to the ovarian tumour-like protease domain (OTU) found in the viral RNA polymerase. Virus infection, or expression of this OTU domain in transfected cells, led to a great reduction in the incorporation of ubiquitin or ISG15 protein into host cell proteins. Point mutations in the OTU that inhibited the protease activity also prevented it from antagonising interferon induction and action. Interestingly, a mutation at a peripheral site, which had little apparent effect on the ability of the OTU to inhibit ubiquitination and ISG15ylation, removed the ability of the OTU to block the induction of type 1 and the action of type 2 interferons, but had a lesser effect on the ability to block type 1 interferon action, suggesting that targets other than ubiquitin and ISG15 may be involved in the actions of the viral OTU. PMID:22163042
Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12.
Chace, J H; Hooker, N A; Mildenstein, K L; Krieg, A M; Cowdery, J S
1997-08-01
Bacterial DNA (bDNA) activates B cells and macrophages and can augment inflammatory responses by inducing release of proinflammatory cytokines. We found that bDNA stimulation of mouse spleen cells induced NK cell IFN-gamma production that was dependent upon the presence of unmethylated CpG motifs, and oligonucleotides with internal CpG motifs could also induce splenocytes to secrete IFN-gamma. The bDNA-induced IFN-gamma response was strictly macrophages dependent. While splenocytes from SCID mice secreted IFN-gamma in response to bDNA, depletion of macrophages eliminated this response. Additionally, purified NK cells did not respond to bDNA; however, addition of macrophages restored the NK cell IFN-gamma response. Coculture of NK cells with preactivated macrophages further increased bDNA-induced NK cell IFN-gamma production. Anti-IL-12 or IL-10 inhibited bDNA-induced IFN-gamma response. Treatment of purified macrophages with bDNA resulted in IL-12 secretion accompanied by an increase in IL-12 p40 mRNA level. Although isolated NK cells did not make IFN-gamma in response to bDNA, NK cells costimulated with IL-12 gained the ability to respond to bDNA. These experiments show that bDNA induces macrophage IL-12 production which, in turn, stimulates NK cell IFN-gamma production. Macrophage-derived IL-12 renders NK cells responsive to bDNA permitting an even greater IFN-gamma response to bDNA.
Seo, Kwang Won; Ahn, Jong-Joon; Ra, Seung Won; Kwon, Woon-Jung; Jegal, Yangjin
2014-06-01
The interferon gamma (IFN-γ) release assays (IGRAs) are the best method of detecting Mycobacterium tuberculosis infection. However, reports on IGRAs results obtained during and right after the treatment of tuberculosis (TB) have presented differing results. Some studies have shown declining responses, whereas other reports described persistent, fluctuating, or increasing responses. We postulated that the IGRA-positivity will decrease or revert long time after treatment of TB, and thus, evaluated the response of IGRA in subjects with a history of pulmonary TB. Seventy subjects (M:F = 51:19; age = 53.2 ± 11.8 years) underwent tuberculin skin tests (TSTs) and IGRA. The interval of time elapsed after the completion of anti-TB treatment was < 10 years for 16 subjects, 10-20 years for 13 subjects, 20-30 years for 16 subjects, and ≥ 30 years for 25 subjects. The TST was positive in 49 subjects (74%) and negative in 17 subjects (26%). The IGRA was positive in 52 subjects (74%) and negative in 18 subjects (26%). The IFN-γ level and the size of induration showed good correlation (r = 0.525, P < 0.001). However, the correlation between time elapsed after the completion of anti-TB treatment and the size of induration or that between time and the IFN-γ level was not significant. The TST and IGRA were positive in 72.7% and 68.0% of subjects ≥ 30 years after the treatment of pulmonary TB. In conclusion, majority of subjects with a history of pulmonary TB are IGRA-positive, even a few decades after the completion of anti-TB treatment.
Masroori, Nasser; Merindol, Natacha; Berthoux, Lionel
2016-03-22
The promyelocytic leukemia (PML) protein, a type I interferon (IFN-I)-induced gene product and a member of the tripartite motif (TRIM) family, modulates the transcriptional activity of viruses belonging to various families. Whether PML has an impact on the replication of HIV-1 has not been fully addressed, but recent studies point to its possible involvement in the restriction of HIV-1 in human cells and in the maintenance of transcriptional latency in human cell lines in which HIV-1 is constitutively repressed. We investigated further the restriction of HIV-1 and a related lentivirus, SIVmac, by PML in murine cells and in a lymphocytic human cell line. In particular, we studied the relevance of PML to IFN-I-mediated inhibition and the role of individual human isoforms. We demonstrate that both human PML (hPML) and murine PML (mPML) inhibit the early post-entry stages of the replication of HIV-1 and a related lentivirus, SIVmac. In addition, HIV-1 was transcriptionally silenced by mPML and by hPML isoforms I, II, IV and VI in MEFs. This PML-mediated transcriptional repression was attenuated in presence of the histone deacetylase inhibitor SAHA. In contrast, depletion of PML had no effect on HIV-1 gene expression in a human T cell line. PML was found to contribute to the inhibition of HIV-1 by IFN-I. Specifically, IFN-α and IFN-β treatments of MEFs enhanced the PML-dependent inhibition of HIV-1 early replication stages. We show that PML can inhibit HIV-1 and other lentiviruses as part of the IFN-I-mediated response. The restriction takes place at two distinct steps, i.e. reverse transcription and transcription, and in an isoform-specific, cellular context-specific fashion. Our results support a model in which PML activates innate immune antilentiviral effectors. These data are relevant to the development of latency reversal-inducing pharmacological agents, since PML was previously proposed as a pharmacological target for such inhibitors. This study also has
Longbottom, E Rebecca; Torrance, Hew D T; Owen, Helen C; Fragkou, Paraskevi C; Hinds, Charles J; Pearse, Rupert M; O'Dwyer, Michael J
2016-08-01
The aim of this study was to evaluate the role of interleukin (IL)-6 pathways in postoperative immune suppression and to assess the reversibility of this phenomenon. The postoperative period is characterized by increased IL-6 production and features of immune suppression. In vitro, IL-6 mediates anti-inflammatory effects through inhibition of interferon gamma (IFN-γ) pathways. The significance of the immunomodulatory effects of IL-6 in the clinical setting of postoperative immune suppression remains unclear. Patients over 45 years old undergoing elective surgery, involving the gastrointestinal tract, were recruited. IL-6 levels were assayed using an enzyme linked immunosorbent assay preoperatively, and at 24 and 48 hours. Peripheral blood mononuclear cells from healthy volunteers were cultured in perioperative serum and CD14Human Leukocyte Antigen-DR (HLA-DR) [monocyte HLA-DR (mHLA-DR)] geometric mean florescent intensity was measured in the presence and absence of IL-6 neutralizing antibody and recombinant IFN-γ. Of the 108 patients, 41 developed a postoperative infection. The IL-6 levels increased 19-fold from the preoperative sample to 24 hours postoperatively (P < 0.0001). Higher IL-6 levels at 24 (P = 0.0002) and 48 hours (P = 0.003) were associated with subsequent postoperative infectious complications. mHLA-DR mean florescent intensity fell when healthy peripheral blood mononuclear cells were cultured with postoperative serum compared with preoperative serum (P = 0.008). This decrease was prevented by the presence of IFN-γ in the culture media, but not by the presence of IL-6-neutralizing antibody. IL-6 levels increase after a major surgery and are associated with an increased susceptibility to postoperative infections. Serum obtained from postoperative patients induces an immunosuppressive response, reflected in reduced mHLA-DR levels, mediated through IL-6 independent pathways and is reversible with IFN-γ. These data may have
Shaik, Junaid; Pillay, Manormoney; Jeena, Prakash
2014-09-01
Successful control of childhood TB requires early diagnosis, effective chemotherapy and a method of evaluating the response to therapy. Identification of suitable biomarkers that predict the response to anti-TB therapy may allow the duration of treatment to be shortened. The majority of biomarker studies in paediatric TB have focused on the role of T cell-based interferon-gamma (IFN-γ) release assays (IGRAs) in the diagnosis of either latent or active disease. Little has been published on the role of IGRAs in the monitoring response to therapy in children. We reviewed the available literature to ascertain the value of IGRAs in the monitoring of response to anti-TB therapy in children. We explored the results of the few studies that have investigated the role of IGRAs as markers of response to anti-TB treatment in children. We conclude that the role of IGRAs as surrogate markers appears promising. Robust clinical trials are, however, needed to entrench the value of IGRAs as surrogate biomarkers of response to anti-TB therapy in children. Copyright © 2013 Elsevier Ltd. All rights reserved.
2011-01-01
Background The mechanisms by which chronic hepatitis B is completely resolved through antiviral therapy are unknown, and the contribution of acquired T cell immunity to hepatitis B surface antigen (HBsAg) seroclearance has not been investigated. Therefore, we measured the T-cell responses to core and envelope antigens in patients with HBsAg seroclearance. Methods Fourteen subjects with HBsAg seroclearance following antiviral treatment for chronic hepatitis B, 7 HBeAg-positive immunotolerant HBV carriers and 9 HBeAg-negative inactive HBsAg carriers were recruited. HBV-specific T-cell responses to recombinant HBV core (rHBcAg) and envelope (rHBsAg) proteins and pools of core and envelope peptides were measured using an ELISPOT assay detecting interferon-gamma and intracellular cytokine staining (ICS) assays detecting interferon-gamma or interleukin 2. Results Interferon-gamma ELISPOT assays showed a low frequency of weak responses to the rHBsAg and S peptide pool in the HBsAg seroclearance group, and the response frequency to the rHBcAg and the C peptide pool was higher than to the rHBsAg (P < 0.001) and S peptide pool (P = 0.001) respectively. A higher response frequency to C than S peptide pools was confirmed in the interferon-gamma ICS assays for both CD4+ (P = 0.033) and CD8+ (P = 0.040) T cells in the HBsAg seroclearance group. The responses to C and S antigens in the inactive carriers were similar. Conclusions There was a low frequency of CD4+ and CD8+ T cell immune responses to envelope antigens in Chinese subjects with HBsAg seroclearance following antiviral therapy. It is unlikely that these immune responses are responsible for HBsAg seroclearance in these subjects. PMID:21320337
Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long
2006-11-17
The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.
Alvares, C T G; Cruz, J F; Romano, C C; Brandão, F Z
2016-04-15
This study evaluated the influence of artificial insemination (AI) by cervical retraction (CRI) on serum levels of interferon gamma (IFNγ) and interleukin-10 (IL-10) in ewes. Synchronized pluriparous Santa Inês ewes were subjected to natural mating (NM, n = 8) and AI, which was performed for a fixed time (55 ± 1 hour) by CRI (n = 8) or laparoscopy (n = 8). Ewes were classified as pregnant, with return to estrus (RE) or with embryonic loss (EL). Blood samples were collected on Day 0, Day 3, Day 5, Day 12, and Day 17 (Day 0 = AI/NM) for progesterone dosage and cytokines were quantified from Day 0 to Day 12. Progesterone levels were constant, except for a decrease in ewes with RE at Day 17 (P < 0.05). Regardless of the reproductive method used, there was no difference in the IFNγ and IL-10 levels at any time, with averages of 642.1, 713.2, and 741.2 pg/mL for IFNγ and 667.1, 616.8, and 721.1 pg/mL for IL-10 when using CRI, laproscopy, and NM, respectively. Regarding the physiological status, ewes with EL had lower serum levels of IFNγ and IL-10 than pregnant ewes and ewes with RE, regardless of the reproductive method used, with averages of 769.1, 714.9, and 555.7 pg/mL for IFNγ and 713.8, 699.3, and 578.7 pg/mL for IL-10 in pregnant ewes, ewes with RE and EL, respectively (P < 0.01). In conclusion, AI by CRI in Santa Inês ewes does not alter the profile of serum cytokines IFNγ and IL-10 and does not induce an inflammatory reaction that can compromise pregnancy. Copyright © 2016 Elsevier Inc. All rights reserved.
Yoneto, Toshihiko; Yoshimoto, Takayuki; Wang, Chrong-Reen; Takahama, Yasuhiro; Tsuji, Moriya; Waki, Seiji; Nariuchi, Hideo
1999-01-01
We have examined the roles of gamma interferon (IFN-γ), nitric oxide (NO), and natural killer (NK) cells in the host resistance to infection with the blood-stage malarial parasite Plasmodium berghei XAT, an irradiation-induced attenuated variant of the lethal strain P. berghei NK65. Although the infection with P. berghei XAT enhanced NK cell lytic activity of splenocytes, depletion of NK1.1+ cells caused by the treatment of mice with anti-NK1.1 antibody affected neither parasitemia nor IFN-γ production by their splenocytes. The P. berghei XAT infection induced a large amount of NO production by splenocytes during the first peak of parasitemia, while P. berghei NK65 infection induced a small amount. Unexpectedly, however, mice deficient in inducible nitric oxide synthase (iNOS−/−) cleared P. berghei XAT after two peaks of parasitemia were observed, as occurred for wild-type control mice. Although the infected iNOS−/− mouse splenocytes did not produce a detectable level of NO, they produced an amount of IFN-γ comparable to that produced by wild-type control mouse splenocytes, and treatment of these mice with neutralizing anti-IFN-γ antibody led to the progression of parasitemia and fatal outcome. CD4−/− mice infected with P. berghei XAT could not clear the parasite, and all these mice died with apparently reduced IFN-γ production. Furthermore, treatment with carrageenan increased the susceptibility of mice to P. berghei XAT infection. These results suggest that neither NO production nor NK cell activation is critical for the resistance to P. berghei XAT infection and that IFN-γ plays an important role in the elimination of malarial parasites, possibly by the enhancement of phagocytic activity of macrophages. PMID:10225894
Li, Zhiqun; Wolff, Karen C.; Samuel, Charles E.
2009-01-01
Two size forms of ADAR1 adenosine deaminase are known, one constitutively expressed (p110) and the other interferon (IFN)-induced (p150). To test the role of ADAR1 in viral infection, HeLa cells with ADAR1 stably knocked down and 293 cells over expressing ADAR1 were utilized. Over expression of p150 ADAR1 had no significant effect on the yield of vesicular stomatitis virus. Likewise, reduction of p110 and p150 ADAR1 proteins to less than ~10 to 15% of parental levels (ADAR1-deficient) had no significant effect on VSV growth in the absence of IFN treatment. However, inhibition of virus growth following IFN treatment was ~1 log10 further reduced compared to ADAR1-sufficient cells. The level of phosphorylated protein kinase PKR was increased in ADAR1-deficient cells compared to ADAR1-sufficient cells following IFN treatment, regardless of viral infection. These results suggest that ADAR1 suppresses activation of PKR and inhibition of VSV growth in response to IFN treatment. PMID:19913273