Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research

Cancer.gov

Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study suggests that interferon-gamma, which has been thought to contribute to an innate defense system against cancer, under some circumstances, may instead promote melanoma and incite the development of tumors.

Effect of gamma interferon on resolution of murine chlamydial genital infection.

PubMed Central

Rank, R G; Ramsey, K H; Pack, E A; Williams, D M

1992-01-01

Mice infected in the genital tract with the Chlamydia trachomatis agent of mouse pneumonitis were treated with monoclonal rat anti-gamma interferon (anti-IFN-gamma) antibody to determine whether IFN-gamma participated in the resolution of the infection. In two experiments, anti-IFN-gamma antibody treatment resulted in significantly prolonged infections. In support of these data, passive administration of recombinant IFN-gamma to chronically infected nu/nu mice was able to bring about resolution of the infection in some animals. PMID:1398955

The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.

PubMed

Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N

1985-01-01

The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.

Review of the recombinant human interferon gamma as an immunotherapeutic: Impacts of production platforms and glycosylation.

PubMed

Razaghi, Ali; Owens, Leigh; Heimann, Kirsten

2016-12-20

Human interferon gamma is a cytokine belonging to a diverse group of interferons which have a crucial immunological function against mycobacteria and a wide variety of viral infections. To date, it has been approved for treatment of chronic granulomatous disease and malignant osteopetrosis, and its application as an immunotherapeutic agent against cancer is an increasing prospect. Recombinant human interferon gamma, as a lucrative biopharmaceutical, has been engineered in different expression systems including prokaryotic, protozoan, fungal (yeasts), plant, insect and mammalian cells. Human interferon gamma is commonly expressed in Escherichia coli, marketed as ACTIMMUNE ® , however, the resulting product of the prokaryotic expression system is unglycosylated with a short half-life in the bloodstream; the purification process is tedious and makes the product costlier. Other expression systems also did not show satisfactory results in terms of yields, the biological activity of the protein or economic viability. Thus, the review aims to synthesise available information from previous studies on the production of human interferon gamma and its glycosylation patterns in different expression systems, to provide direction to future research in this field. Copyright © 2016 Elsevier B.V. All rights reserved.

Recent considerations in the use of recombinant interferon gamma for biological therapy of atopic dermatitis.

PubMed

Brar, Kanwaljit; Leung, Donald Y M

2016-01-01

Atopic dermatitis (AD) is the most common inflammatory skin disease in the general population. There are different endophenotypes of AD that likely have a unique immune and molecular basis, such as those who are predisposed to eczema herpeticum, or Staphylococcus aureus infections. In this review, we highlight the endophenotypes of AD where reduced interferon gamma expression may be playing a role. Additionally, we review the potential role of recombinant interferon gamma therapy in the treatment of atopic dermatitis and the particular phenotypes that may benefit from this treatment. Recombinant interferon gamma treatment will likely benefit the pediatric population with AD, as well as those with susceptibilities for skin infections. Future studies are needed to elucidate whether IFN-γ may reduce the prevalence of skin infection in AD.

Secretion of Interferon gamma (IFNγ) from Human Immune Cells is Altered by Exposure to Tributyltin (TBT) and Dibutyltin (DBT)

PubMed Central

Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret

2013-01-01

Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and also alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h and 6 day exposures to TBT (200- 2.5 nM) and DBT (5- 0.05 μM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from NK cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. PMID:24357260

Potential mechanisms of cytosolic calcium modulation in interferon-gamma treated U937 cells

NASA Technical Reports Server (NTRS)

Klein, Jon B.; Mcleish, Kenneth R.; Sonnenfeld, Gerald; Dean, William L.

1987-01-01

The ability of interferon-gamma (IFN-gamma) to alter cytoplasmic Ca(2+) content in the monocytelike cell line U937 was investigated, using a slow Ca-channel blocker, diltiazem. In addition, the Ca-ATPase and the Ca-uptake activities were measured in isolated U937 membranes, together with the effect of inositol trisphosphate (IP3) upon the Ca(2+) release from Ca-loaded membranes. The addition of 50 U/ml INF-gamma to U937 cultures was found to increase internal Ca(2+) by about 100 percent within 3 min. The increase was significantly reduced by incubation in Ca-free buffer or by the addition of diltiazem. A crude membrane preparation from U937 cells was found to contain significant amounts of Ca-ATPase activity and to sequester Ca(2+) to a level of 8 nmol/mg in 30 sec; the addition of IP3 induced release of a portion of the sequestered Ca(2+) which was then resequestered. The results suggest that IFN-gamma causes an increase of cytoplasmic Ca(2+), in part, by the IP3-induced release from the internal storage sites and, in part, from the entry of extracellular Ca through slow channels.

Evaluation of gamma interferon (IFN-gamma)-induced protein 10 (IP-10) responses for detection of cattle infected with Mycobacterium bovis: comparisons to IFN-gamma responses

USDA-ARS?s Scientific Manuscript database

Gamma interferon (IFN-gamma)-induced protein 10 (IP-10) has recently shown promise as a diagnostic biomarker of Mycobacterium tuberculosis infection of humans. The aim of the current study was to compare IP-10 and IFN-gamma responses upon Mycobacterium bovis infection in cattle using archived sample...

Inhibited interferon-gamma but normal interleukin-3 production from rats flown on the Space Shuttle

NASA Technical Reports Server (NTRS)

Gould, Cheryl L.; Lyte, Mark; Williams, Joann; Mandel, Adrian D.; Sonnenfeld, Gerald

1987-01-01

Rats were flown on Space Shuttle SL-3 for one week. When spleen cells were removed from these rats and challenged with concanavalin-A, interferon-gamma production was severely inhibited, while interleukin-3 production was unaffected compared to ground-based control rats. These data indicate that there is a defect in interferon-gamma production in rats that have been exposed to spaceflight. This defect could contribute to, and be one reason for, immunosuppression observed after spaceflight.

Interferon Gamma as a Biomarker of Exposure to Enteric Viruses

EPA Science Inventory

Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...

Plasmodium falciparum erythrocyte membrane protein-1 specifically suppresses early production of host interferon-gamma.

PubMed

D'Ombrain, Marthe C; Voss, Till S; Maier, Alexander G; Pearce, J Andrew; Hansen, Diana S; Cowman, Alan F; Schofield, Louis

2007-08-16

Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP-1) is a variable antigen expressed by P. falciparum, the malarial parasite. PfEMP-1, present on the surface of infected host erythrocytes, mediates erythrocyte binding to vascular endothelium, enabling the parasite to avoid splenic clearance. In addition, PfEMP-1 is proposed to regulate host immune responses via interactions with the CD36 receptor on antigen-presenting cells. We investigated the immunoregulatory function of PfEMP-1 by comparing host cell responses to erythrocytes infected with either wild-type parasites or transgenic parasites lacking PfEMP-1. We showed that PfEMP-1 suppresses the production of the cytokine interferon-gamma by human peripheral blood mononuclear cells early after exposure to P. falciparum. Suppression of this rapid proinflammatory response was CD36 independent and specific to interferon-gamma production by gammadelta-T, NK, and alphabeta-T cells. These data demonstrate a parasite strategy for downregulating the proinflammatory interferon-gamma response and further establish transgenic parasites lacking PfEMP-1 as powerful tools for elucidating PfEMP-1 functions.

Anti-interferon-gamma antibodies in the treatment of autoimmune diseases.

PubMed

Skurkovich, Boris; Skurkovich, Simon

2003-02-01

Interferon (IFN)-gamma is an important immune regulator in normal immunity. When IFN gamma production is disturbed, various autoimmune diseases (ADs) can develop, in which we suggest that anti-IFN gamma could have a beneficial effect. Depending on the cell type in which IFN gamma synthesis is disturbed, different clinical manifestations may result. We have also proposed to remove tumor necrosis factor (TNF)-alpha, together with certain types of IFNs, to treat various ADs and AIDS, also an autoimmune condition. Anti-IFN gamma has been tested in several T-helper cell (Th1) ADs, including rheumatoid arthritis (RA), multiple sclerosis (MS), corneal transplant rejection, uveitis, Type I diabetes, schizophrenia (anti-IFN gamma and anti-TNF alpha), and various autoimmune skin diseases (alopecia areata, psoriasis vulgaris, vitiligo, pemphigus vulgaris and epidermolysis bullosa). A strong, sometimes striking, therapeutic response followed administration of anti-IFN gamma, indicating that it may be a promising therapy for Th1 ADs.

Interferon-γ Inhibits Ebola Virus Infection.

PubMed

Rhein, Bethany A; Powers, Linda S; Rogers, Kai; Anantpadma, Manu; Singh, Brajesh K; Sakurai, Yasuteru; Bair, Thomas; Miller-Hunt, Catherine; Sinn, Patrick; Davey, Robert A; Monick, Martha M; Maury, Wendy

2015-01-01

Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.

The immunomodulatory effects of interferon-gamma on mature B-lymphocyte responses.

PubMed

Jurado, A; Carballido, J; Griffel, H; Hochkeppel, H K; Wetzel, G D

1989-06-15

Interferon-gamma (IFN-gamma) exerts a broad spectrum of activities which affect the responses of mature B-cells. It strongly inhibits B-cell activation, acts as a B-cell growth factor (BCGF), and also induces final differentiation to immunoglobulin (Ig) production. IFN-gamma is deeply involved in the differential control of isotype expression, as it enhances IgG2a production and suppresses both IgG1 and IgE production. Although it is now possible to draw a general scheme of the effects of IFN-gamma on B-cells, a number of paradoxical results still exist in the field. In this manuscript, different experimental systems are analyzed in an attempt to explain these apparent paradoxes.

Production and characterization of guinea pig recombinant gamma interferon and its effect on macrophage activation.

PubMed

Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N

2006-01-01

Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.

Effects of chicken interferon Gamma on Newcastle disease virus vaccine immunogenicity

USDA-ARS?s Scientific Manuscript database

More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFN') during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFN' wit...

Interferon-alpha and interferon-gamma sensitize human tenon fibroblasts to mitomycin-C.

PubMed

Wang, Xiao Yang; Crowston, Jonathan G; Zoellner, Hans; Healey, Paul R

2007-08-01

To investigate the effect of interferon (IFN)-alpha and IFN-gamma pretreatment on mitomycin C (MMC)-induced cell death in human Tenon fibroblasts (HTFs) and the mechanisms by which IFN-alpha and IFN-gamma modulate the susceptibility of HTFs to MMC. HTFs were pretreated with IFN-alpha and IFN-gamma for 48 hours before 5-minute application of 0.4 mg/mL MMC. Cell death after 48 hours was determined by Annexin V/propidium iodide (PI) staining and lactate dehydrogenase (LDH) release assay. Fas, Fas-ligand, and Bcl-2 expression were determined by flow cytometry. Fas associated death domain (FADD), Bax, cytochrome c, and caspase expression were determined by Western blot analysis and immunofluorescence staining. MMC treatment increased cell death and upregulated Fas and FADD expression, but had no effect on Fas-Ligand, Bax, Bcl-2, or cytochrome c. Neither IFN-alpha nor IFN-gamma alone induced HTF death, but each increased cell death 2 days after MMC treatment in a dose-dependent fashion. Combination IFN-alpha and IFN-gamma had a synergistic effect. IFN-alpha and IFN-gamma pretreatment increased Fas expression. Fas upregulation was associated with increased sensitivity to MMC. IFN pretreatment increased procaspase-8, procaspase-9, and procaspase-3 expression, and caspase-3 activation. Caspase-8, caspase-3, and broad caspase inhibitors, but not caspase-9 inhibitor, inhibited MMC-induced cell death in nonpretreated and IFN-pretreated cells. IFN-alpha and IFN-gamma enhance the susceptibility of HTFs to MMC-induced cell death through a Fas-mediated and a caspase-3-dependent pathway. Pretreatment with IFN primed HTFs to MMC, providing a potential means for initially slowing the healing response with IFN and subsequently terminating fibroblast activity through MMC-induced cell death.

DNase I hypersensitivity and epsilon-globin transcriptional enhancement are separable in locus control region (LCR) HS1 mutant human beta-globin YAC transgenic mice.

PubMed

Shimotsuma, Motoshi; Okamura, Eiichi; Matsuzaki, Hitomi; Fukamizu, Akiyoshi; Tanimoto, Keiji

2010-05-07

Expression of the five beta-like globin genes (epsilon, Ggamma, Agamma, delta, beta) in the human beta-globin locus depends on enhancement by the locus control region, which consists of five DNase I hypersensitive sites (5'HS1 through 5'HS5). We report here a novel enhancer activity in 5'HS1 that appears to be potent in transfected K562 cells. Deletion analyses identified a core activating element that bound to GATA-1, and a two-nucleotide mutation that disrupted GATA-1 binding in vitro abrogated 5'HS1 enhancer activity in transfection experiments. To determine the in vivo role of this GATA site, we generated multiple lines of human beta-globin YAC transgenic mice bearing the same two-nucleotide mutation. In the mutant mice, epsilon-, but not gamma-globin, gene expression in primitive erythroid cells was severely attenuated, while adult beta-globin gene expression in definitive erythroid cells was unaffected. Interestingly, DNaseI hypersensitivity near the 5'HS1 mutant sequence was eliminated in definitive erythroid cells, whereas it was only mildly affected in primitive erythroid cells. We therefore conclude that, although the GATA site in 5'HS1 is critical for efficient epsilon-globin gene expression, hypersensitive site formation per se is independent of 5'HS1 function, if any, in definitive erythroid cells.

Interferon-gamma (INF-gamma) release test can detect cutaneous adverse effects to statins.

PubMed

Goldberg, Ilan; Isman, Gila; Shirazi, Idit; Brenner, Sarah

2009-12-01

An increasing number of cutaneous adverse effects are being reported as use of statins becomes more widespread. A study was undertaken to establish the relationship between statin and a cutaneous reaction by the in vitro interferon-gamma (INF-gamma) release test. The lymphocytes of 20 patients with suspected drug-induced skin reaction were incubated with and without the drug. The level of INF-gamma from the supernatant was measured by enzyme-linked immunosorbent assay (ELISA), and the increase calculated. Response was positive in 27 (21.43%) of the 126 drugs. Statin was the only drug with a positive response in 80% of those cases. Nine of 20 patients (45.0%) had complete resolution after discontinuation of the drug; 6 (30.0%) who replaced one drug by another statin had partial or no resolution; and 5 (20.0%) had no resolution despite cessation of statins of all kinds. A positive INF-gamma release test was found in patients who developed skin reactions while taking statins; the test's reliability was strengthened by prompt improvement following elimination of the suspected drug in the majority of patients.

The Full Globin Repertoire of Turtles Provides Insights into Vertebrate Globin Evolution and Functions.

PubMed

Schwarze, Kim; Singh, Abhilasha; Burmester, Thorsten

2015-06-15

Globins are small heme proteins that play an important role in oxygen supply, but may also have other functions. Globins offer a unique opportunity to study the functional evolution of genes and proteins. We have characterized the globin repertoire of two different turtle species: the Chinese softshell turtle (Pelodiscus sinensis) and the western painted turtle (Chrysemys picta bellii). In the genomes of both species, we have identified eight distinct globin types: hemoglobin (Hb), myoglobin, neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Therefore, along with the coelacanth, turtles are so far the only known vertebrates with a full globin repertoire. This fact allows for the first time a comparative analysis of the expression of all eight globins in a single species. Phylogenetic analysis showed an early divergence of neuroglobin and globin X before the radiation of vertebrates. Among the other globins, cytoglobin diverged first, and there is a close relationship between myoglobin and globin E; the position of globin Y is not resolved. The globin E gene was selectively lost in the green anole, and the genes coding for globin X and globin Y were deleted in chicken. Quantitative real-time reverse transcription polymerase chain reaction experiments revealed that myoglobin, neuroglobin, and globin E are highly expressed with tissue-specific patterns, which are in line with their roles in the oxidative metabolism of the striated muscles, the brain, and the retina, respectively. Histochemical analyses showed high levels of globin E in the pigment epithelium of the eye. Globin E probably has a myoglobin-like role in transporting O2 across the pigment epithelium to supply in the metabolically highly active retina. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed Central

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-01-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-04-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.

Gamma-interferon causes a selective induction of the lysosomal proteases, cathepsins B and L, in macrophages

NASA Technical Reports Server (NTRS)

Lah, T. T.; Hawley, M.; Rock, K. L.; Goldberg, A. L.

1995-01-01

Previous studies have indicated that acid-optimal cysteine proteinase(s) in the endosomal-lysosomal compartments, cathepsins, play a critical role in the proteolytic processing of endocytosed proteins to generate the antigenic peptides presented to the immune system on major histocompatibility complex (MHC) class II molecules. The presentation of these peptides and the expression of MHC class II molecules by macrophages and lymphocytes are stimulated by gamma-interferon (gamma-IFN). We found that treatment of human U-937 monocytes with gamma-IFN increased the activities and the content of the two major lysosomal cysteine proteinases, cathepsins B and L. Assays of protease activity, enzyme-linked immunosorbant assays (ELISA) and immunoblotting showed that this cytokine increased the amount of cathepsin B 5-fold and cathepsin L 3-fold in the lysosomal fraction. By contrast, the aspartic proteinase, cathepsin D, in this fraction was not significantly altered by gamma-IFN treatment. An induction of cathepsins B and L was also observed in mouse macrophages, but not in HeLa cells. These results suggest coordinate regulation in monocytes of the expression of cathepsins B and L and MHC class II molecules. Presumably, this induction of cysteine proteases contributes to the enhancement of antigen presentation by gamma-IFN.

Inhibited interferon production after space flight

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Gould, C. L.; Williams, J.; Mandel, A. D.

1988-01-01

Several studies have been performed in our laboratories indicating that interferon production may be impaired in rodents after space flight. Using an antiorthostatic suspension model that simulates some of the effects of microgravity seen during space flight, we have shown that interferon-alpha/beta production was inhibited. The inhibition was not due solely to the stress of suspension. The inhibited interferon production was transient, as suspended animals returned to normal caging recovered the ability to produce interferon. Antiorthostatic suspension of mice also resulted in a loss of resistance to infection with the diabetogenic strain of encephalomyocarditis virus, which correlated with the drop in interferon production. In rats flown in US Space Shuttle mission SL-3, interferon-gamma production was inhibited severely when spleen cells were challenged with concanavalin-A upon return to earth. In contrast, interleukin-3 production by these cells was normal. These results suggest that immune responses may be altered after antiorthostatic modeling or space flight, and the resistance to viral infections may be especially affected.

Transforming growth factor-beta controls T helper type 1 cell development through regulation of natural killer cell interferon-gamma.

PubMed

Laouar, Yasmina; Sutterwala, Fayyaz S; Gorelik, Leonid; Flavell, Richard A

2005-06-01

Interferon-gamma and interleukin 12 produced by the innate arm of the immune system are important regulators of T helper type 1 (T(H)1) cell development, but signals that negatively regulate their expression remain controversial. Here we show that transforming growth factor-beta (TGF-beta) controlled T(H)1 differentiation through the regulation of interferon-gamma produced by natural killer (NK) cells. Blockade of TGF-beta signaling in NK cells caused the accumulation of a large pool of NK cells secreting copious interferon-gamma, responsible for T(H)1 differentiation and protection from leishmania infection. In contrast, blockade of TGF-beta signaling in dendritic cells did not affect dendritic cell homeostasis or interleukin 12 production, thus indicating a previously undescribed demarcation of the function of TGF-beta in NK cells versus dendritic cells.

Differential co-promoting activities of alpha, beta and gamma interferons in the murine skin two-stage carcinogenesis model.

PubMed

Reiners, J J; Cantu, A; Thai, G; Pavone, A

1993-03-01

SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.

Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels

NASA Technical Reports Server (NTRS)

Pierangeli, Silvia S.; Sonnenfeld, Gerald

1989-01-01

Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.

Clinical and diagnostic developments of a gamma interferon release assay for use in bovine tuberculosis control programs

USDA-ARS?s Scientific Manuscript database

Currently the Bovigam assay is used as an official supplemental test within the bovine tuberculosis eradication program. This assay measures interferon-gamma (IFN-gamma) produced by lymphocytes in response to specific antigens. The objectives of the present study were to evaluate two Mycobacterium ...

Molecular Characterization and Expression of α-Globin and β-Globin Genes in the Euryhaline Flounder (Platichthys flesus)

PubMed Central

Lu, Weiqun; Mayolle, Aurelie; Cui, Guoqiang; Luo, Lei; Balment, Richard J.

2011-01-01

In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros) is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros) was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW-) than in seawater- (SW-)adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW. PMID:21969841

Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research

Cancer.gov

Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study

Pregnancy IFN-gamma responses to foetal alloantigens are altered by maternal allergy and gravidity status.

PubMed

Breckler, L A; Hale, J; Taylor, A; Dunstan, J A; Thornton, C A; Prescott, S L

2008-11-01

During pregnancy, variations in maternal-foetal cellular interactions may influence immune programming. This study was carried out to determine if maternal responses to foetal alloantigens are altered by maternal allergic disease and/or previous pregnancies. For this cohort study, peripheral blood was collected from allergic (n = 69) and nonallergic (n = 63) pregnant women at 20, 30, 36-week gestation and 6-week postpartum (pp). Cord blood was collected at delivery. Mixed lymphocyte reactions were used to measure maternal cytokine responses [interleukin-6 (IL-6), IL-10, IL-13 and (interferon-gamma) IFN-gamma] at each time point towards foetal mononuclear cells. Maternal cytokine responses during pregnancy (20, 30 and 36 weeks) were suppressed compared to the responses at 6-week pp. The ratio of maternal IFN-gamma/IL-13 and IFN-gamma/IL-10 responses were lower during pregnancy. Allergic mothers had lower IFN-gamma responses at each time-point during pregnancy with the greatest difference in responses observed at 36-week gestation. When allergic and nonallergic women were further stratified by gravidity group, IFN-gamma responses of allergic multigravid mothers were significantly lower than nonallergic multigravid mothers during pregnancy. During normal pregnancy, peripheral T-cell cytokine responses to foetal alloantigens may be altered by both allergic status of the mother and previous pregnancies. These factors could influence the cytokine milieu experienced by the foetus and will be further explored in the development of allergic disease during early life.

Interaction of an α-Globin Gene Triplication with β-Globin Gene Mutations in Iranian Patients with β-Thalassemia Intermedia.

PubMed

Farashi, Samaneh; Bayat, Nooshin; Faramarzi Garous, Negin; Ashki, Mehri; Montajabi Niat, Mona; Vakili, Shadi; Imanian, Hashem; Zeinali, Sirous; Najmabadi, Hossein; Azarkeivan, Azita

2015-01-01

The 3.7 kb triplicated α-globin gene (ααα(anti 3.7)) mutation has been found in most populations. It results from an unequal crossover between misaligned homologous segments in the α-globin gene cluster during meiosis. The pathophysiology and clinical severity of β-thalassemia (β-thal) are associated with the degree of α chain imbalance. The excess of α-globin chains plays an important role in the pathophysiology of β-thal. When heterozygous/homozygous β-thal coexists with an α gene numerical alteration, the clinical and hematological phenotype of thalassemia could change to mild anemia in case of an α deletion (-α/αα) or severe anemia in the case of an α triplication (αα/ααα). The coexistence of an ααα(anti 3.7) triplication is considered an important factor in the severity of β-thal, exacerbating the phenotypic severity of β-thal by causing more globin chain imbalance. This study shows that the ααα(anti 3.7) triplication is an important factor in the causation of β-thal intermedia (β-TI) in heterozygous β-thal. This type of phenotype modification has rarely been observed and reported in the Iranian population. Here we report the coinheritance of a triplicated α-globin gene arrangement and heterozygous/homozygous β-thal in 23 cases, presenting with a β-TI or β-thal major (β-TM) phenotype. Some of these patients were considered to have a mild β-TI phenotype as they needed no blood transfusions; some occasionally received blood transfusions in their lifetime (for example on delivery) but some are dependent on regular blood transfusions (every 20 to 40 days). Our study was focused on the importance of detecting the α-globin gene triplication in genotype/phenotype prediction in Iranian thalassemia patients.

Double-blind trial of recombinant gamma-interferon versus placebo in the treatment of rheumatoid arthritis. 1989.

PubMed

Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D

2008-02-01

One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.

Enhanced gamma interferon responses of mouse spleen cells following immunotherapy for tuberculosis relapse.

PubMed

Gil, Olga; Vilaplana, Cristina; Guirado, Evelyn; Díaz, Jorge; Cáceres, Neus; Singh, Mahavir; Cardona, Pere-Joan

2008-11-01

Gamma interferon responses of spleen cells in mice were examined during postchemotherapy relapse of intraperitoneally induced latent tuberculous infection. The mycobacterial extract RUTI, which prevented the relapse, significantly enhanced the immune responses to secreted and structural recombinant mycobacterial antigens, suggesting that RUTI-mediated protection was mediated by activated T cells.

Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.

PubMed Central

Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G

1996-01-01

The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817

Understanding α-globin gene regulation and implications for the treatment of β-thalassemia.

PubMed

Mettananda, Sachith; Gibbons, Richard J; Higgs, Douglas R

2016-03-01

Over the past three decades, a vast amount of new information has been uncovered describing how the globin genes are regulated. This knowledge has provided significant insights into the general understanding of the regulation of human genes. It is now known that molecular defects within and around the α- and β-globin genes, as well as in the distant regulatory elements, can cause thalassemia. Unbalanced production of globin chains owing to defective synthesis of one, and the continued unopposed synthesis of another, is the central causative factor in the cellular pathology and pathophysiology of thalassemia. A large body of clinical, genetic, and experimental evidence suggests that altering globin chain imbalance by reducing the production of α-globin synthesis ameliorates the disease severity in patients with β-thalassemia. With the development of new genetic-based therapeutic tools that have a potential to decrease the expression of a selected gene in a tissue-specific manner, the possibility of decreasing expression of the α-globin gene to improve the clinical severity of β-thalassemia could become a reality. © 2015 New York Academy of Sciences.

THE ANTIGENIC PROPERTIES OF GLOBIN CASEINATE

PubMed Central

Gay, Frederick P.; Robertson, T. Brailsford

1913-01-01

This study of globin and its compound with casein (globin caseinate) shows that globin fails to produce fixation antibodies in rabbits after repeated injections, thus agreeing with our own work and with that of others with similar histon bodies which are primarily toxic. When globin is combined with casein, however, it gives rise to antibodies that react not only with globin caseinate and casein but also with globin. The antibodies in antiglobin casein serum are apparently separate, one for globin and one for casein. In other words, the change in globin undergone on combination with casein has apparently rendered it antigenic. We did not succeed in demonstrating the genesis of this new antigenic property by anaphylaxis experiments. A further investigation of similar and more complex combined proteins is indicated and gives promise of more light on the nature of biological specificity. PMID:19867665

Monoclonal antibody against interferon gamma can prevent experimental cerebral malaria and its associated overproduction of tumor necrosis factor.

PubMed Central

Grau, G E; Heremans, H; Piguet, P F; Pointaire, P; Lambert, P H; Billiau, A; Vassalli, P

1989-01-01

Experimental cerebral malaria (ECM), a lethal hyperacute neurological syndrome associated with high blood levels of tumor necrosis factor, develops in genetically susceptible (CBA/Ca) mice 7 days after infection with Plasmodium berghei ANKA strain. Injections of neutralizing monoclonal antibody against recombinant murine interferon gamma, not later than 4 days after infection, markedly reduced the incidence of ECM and the elevation in serum levels of tumor necrosis factor. This treatment prevented the cerebral lesions (plugging of brain vessels by monocytes, lymphocytes, and parasitized erythrocytes). In contrast, the extent of macrophage infiltration in lymphoid organs (which is a characteristic feature of mice developing ECM), as well as the course of infection, remained unaffected by the antibody treatment. Protected mice died at a later time of severe anemia and overwhelming parasitemia, the usual outcome of P. berghei infection in mice that are not susceptible to ECM. The present data indicate that interferon gamma constitutes an important link in the cytokine network that leads to brain vessel inflammation in experimental malaria. It is proposed that interferon gamma released by activated CD4+ T cells acts by augmenting both production and action of tumor necrosis factor. PMID:2501793

[The effect of DNA hydroxymethylase Tet2 on γ globin activation in the treatment of β-thalassemia].

PubMed

Li, W X; Ma, Q W; Zeng, F Y

2018-03-01

Objective: To study the function of ten-eleven translocation 2 (Tet2) in γ globin gene expression in patients with β- thalassemia. Methods: Gamma globin expression was induced by 5-azacytidine and Tet2 gene expression was knocked down by short hairpin RNA (shRNA) in a human immortalized myelogenous leukemia K562 cell line. The global 5-hydroxymethylcytosine (5hmC) level was measured by an ELISA kit. 5hmC level of γ globin gene was quantified by sulfite sequencing. The mRNA level of Tet2, γ globin, and related transcription factors Nfe4 and Klf1 were quantified by real-time PCR. Results: Tet2 knockdown resulted in a decreased global 5hmC level from 0.14% to 0.03% as of the control group in K562 cells. The expression of γ globin was enhanced after 5-azacytidine treatment in vitro. However, γ globin mRNA level in Tet2 knockdown cells was only 55% as that in control group. The CG sites on γ globin gene were unmethylated. As Tet2 was down-regulated, the expression levels of Nfe4 and Klf1 decreased by about 80% and increased to 3.5 folds, respectively. Conclusions: Tet2 appears to maintain 5hmC level and facilitates γ globin gene activation. Moreover, Tet2 more likely regulates γ globin expression via affecting transcription factors rather than the gene itself. Thus, Tet2 could be a potential therapeutic target for β thalassemias.

Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals

PubMed Central

Patel, Vidushi S; Cooper, Steven JB; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer AM

2008-01-01

Background Vertebrate alpha (α)- and beta (β)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the α- and β-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil β-globin gene (ω) in the marsupial α-cluster, however, suggested that duplication of the α-β cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous α- and β-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. Results The platypus α-globin cluster (chromosome 21) contains embryonic and adult α- globin genes, a β-like ω-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-ζ-ζ'-αD-α3-α2-α1-ω-GBY-3'. The platypus β-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-ε-β-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate α-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal β-globin clusters are embedded in olfactory genes. Thus, the mammalian α- and β-globin clusters are orthologous to the bird α- and β-globin clusters respectively. Conclusion We propose that α- and β-globin clusters evolved from an ancient MPG-C16orf35-α-β-GBY-LUC7L arrangement 410 million years ago. A copy of the original β (represented by ω in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of β-globin genes with different expression profiles in different lineages. PMID:18657265

Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals.

PubMed

Patel, Vidushi S; Cooper, Steven J B; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer A M

2008-07-25

Vertebrate alpha (alpha)- and beta (beta)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the alpha- and beta-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil beta-globin gene (omega) in the marsupial alpha-cluster, however, suggested that duplication of the alpha-beta cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous alpha- and beta-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. The platypus alpha-globin cluster (chromosome 21) contains embryonic and adult alpha- globin genes, a beta-like omega-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-zeta-zeta'-alphaD-alpha3-alpha2-alpha1-omega-GBY-3'. The platypus beta-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-epsilon-beta-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate alpha-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal beta-globin clusters are embedded in olfactory genes. Thus, the mammalian alpha- and beta-globin clusters are orthologous to the bird alpha- and beta-globin clusters respectively. We propose that alpha- and beta-globin clusters evolved from an ancient MPG-C16orf35-alpha-beta-GBY-LUC7L arrangement 410 million years ago. A copy of the original beta (represented by omega in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of beta-globin genes with different expression

Disseminated Penicilliosis, Recurrent Bacteremic Nontyphoidal Salmonellosis, and Burkholderiosis Associated with Acquired Immunodeficiency Due to Autoantibody against Gamma Interferon ▿

PubMed Central

Tang, Bone Siu-Fai; Chan, Jasper Fuk-Woo; Chen, Min; Tsang, Owen Tak-Yin; Mok, M. Y.; Lai, Raymond Wai-Man; Lee, Rodney; Que, Tak-Lun; Tse, Herman; Li, Iris Wai-Sum; To, Kelvin Kai-Wang; Cheng, Vincent Chi-Chung; Chan, Eric Yuk-Tat; Zheng, Bojian; Yuen, Kwok-Yung

2010-01-01

Acquired immunodeficiency due to autoantibody against gamma interferon has recently been associated with opportunistic nontuberculous mycobacteriosis, especially among Southeast Asians. We report another 8 cases, all except one apparently immunocompetent hosts who suffered from concomitant or sequential infections by other intracellular pathogens causing penicilliosis, extraintestinal nontyphoidal salmonellosis, and burkholderiosis. The only case with an underlying immunodeficiency syndrome had systemic lupus erythematosus that was quiescent throughout the multiple infective episodes. Eight out of 10 (80.0%) patients with serological evidence of penicilliosis, 5 out of 7 (71.4%) with culture-positive extraintestinal nontyphoidal salmonellosis, 5 out of 28 (17.9%) with serological evidence of melioidosis, and 7 out of 13 (53.8%) with culture-positive nontuberculous mycobacteriosis possessed autoantibody against gamma interferon, whereas only 1 out of 100 patients with systemic lupus erythematosus did. Our study represents the first and largest case series linking this emerging immunodeficiency syndrome with these atypical infections in apparently immunocompetent hosts. Thus, we advocate that any patient with unexplained recurrent or polymicrobial infections due to these intracellular pathogens should be screened for acquired immunodeficiency due to autoantibody against gamma interferon. PMID:20445006

Utility of an interferon-gamma release assay for latent tuberculosis diagnosis in a case of bullous pemphigoid.

PubMed

Goodfellow, Alfred; Keeling, Douglas N; Hayes, Robert C; Webster, Duncan

2009-01-01

With increasing use of immunosuppressive therapy, including tumor necrosis factor alpha inhibitors, there is concern about infectious complications, including reactivation of latent Mycobacterium tuberculosis infection. Routine testing prior to administration of systemic immunosuppression includes the tuberculin skin test, which lacks sensitivity and specificity and may be difficult to interpret in the presence of extensive cutaneous disease. Treatment of individuals with latent tuberculosis infection is recommended when immunosuppressive medications are to be employed. We report a case in which a diagnosis of latent tuberculosis infection in a patient with extensive bullous pemphigoid was clarified by the use of an interferon-gamma release assay after equivocal tuberculin skin test results. Interferon-gamma release assays are useful adjuncts to the tuberculin skin test in the diagnosis of latent tuberculosis infection in the setting of extensive cutaneous disease.

[Aerosolized recombinant interferon-gamma prevent antigen-induced eosinophil recruitment in guinea pig trachea].

PubMed

Gao, Y; Chenping; Lin, X P

1997-10-01

In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.

Development of an aptamer beacon for detection of interferon-gamma.

PubMed

Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

2010-03-01

Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

Effect of gamma interferon on lung function of mustard gas exposed patients, after 15 years.

PubMed

Ghanei, Mostafa; Panahi, Yoones; Mojtahedzadeh, Mojtaba; Khalili, Ali Reza Hosseini; Aslani, Jafar

2006-01-01

Bronchiolitis has been known to be among the main the pathological features of lung lesions in Mustard Gas (MG) exposed patients. The purpose of this research was to evaluate the efficacy of interferon gamma-1b on the lung function in MG exposed patients with bronchiolitis. Thirty-six bronchiolitis patients, whose lung lesion had been diagnosed through High Resolution Computerized Tomography (HRCT) of the chest and also pathological study, were divided into two 18-member case and control groups. Both groups were receiving their conventional treatment (inhaled Felixotide and Servent). The case group were treated for 6 months with a combination of 200 microg of interferon gamma-1b (given three times per week subcutaneously) plus 7.5 mg of prednisolone (given once a day), while the control group received their previous conventional medications. Lung function was measured at base line and after 1, 3 and 6 months of treatment. In case and control groups, Forced Expiratory Volume in first second (FEV1) did not have statistical differences at the base line (49.3 +/- 2.9 and 48.7 +/- 4.1, respectively = 0.6), whereas a significant increase was seen in the case group (66.3 +/- 5.4) compared control group (57.3 +/- 8.6) at the subsequent months (P = 0.001 for the difference between the groups). Similar pattern of increase was observed in Forced Vital Capacity (FVC). The findings of this study indicate that a 6-month treatment with interferon gamma-1b plus a low-dose prednisolone is associated with an improvement in the lung function in mustard-gas exposed patients with bronchiolitis.

Axolotl hemoglobin: cDNA-derived amino acid sequences of two alpha globins and a beta globin from an adult Ambystoma mexicanum.

PubMed

Shishikura, Fumio; Takeuchi, Hiro-aki; Nagai, Takatoshi

2005-11-01

Erythrocytes of the adult axolotl, Ambystoma mexicanum, have multiple hemoglobins. We separated and purified two kinds of hemoglobin, termed major hemoglobin (Hb M) and minor hemoglobin (Hb m), from a five-year-old male by hydrophobic interaction column chromatography on Alkyl Superose. The hemoglobins have two distinct alpha type globin polypeptides (alphaM and alpham) and a common beta globin polypeptide, all of which were purified in FPLC on a reversed-phase column after S-pyridylethylation. The complete amino acid sequences of the three globin chains were determined separately using nucleotide sequencing with the assistance of protein sequencing. The mature globin molecules were composed of 141 amino acid residues for alphaM globin, 143 for alpham globin and 146 for beta globin. Comparing primary structures of the five kinds of axolotl globins, including two previously established alpha type globins from the same species, with other known globins of amphibians and representatives of other vertebrates, we constructed phylogenetic trees for amphibian hemoglobins and tetrapod hemoglobins. The molecular trees indicated that alphaM, alpham, beta and the previously known alpha major globin were adult types of globins and the other known alpha globin was a larval type. The existence of two to four more globins in the axolotl erythrocyte is predicted.

Interferon-gamma induces apoptosis and augments the expression of Fas and Fas ligand by microglia in vitro.

PubMed

Badie, B; Schartner, J; Vorpahl, J; Preston, K

2000-04-01

Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.

Interferon-gamma of the giant panda (Ailuropoda melanoleuca): complementary DNA cloning, expression, and phylogenetic analysis.

PubMed

Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong

2010-01-01

Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.

Globin gene structure in a reptile supports the transpositional model for amniote α- and β-globin gene evolution.

PubMed

Patel, Vidushi S; Ezaz, Tariq; Deakin, Janine E; Graves, Jennifer A Marshall

2010-12-01

The haemoglobin protein, required for oxygen transportation in the body, is encoded by α- and β-globin genes that are arranged in clusters. The transpositional model for the evolution of distinct α-globin and β-globin clusters in amniotes is much simpler than the previously proposed whole genome duplication model. According to this model, all jawed vertebrates share one ancient region containing α- and β-globin genes and several flanking genes in the order MPG-C16orf35-(α-β)-GBY-LUC7L that has been conserved for more than 410 million years, whereas amniotes evolved a distinct β-globin cluster by insertion of a transposed β-globin gene from this ancient region into a cluster of olfactory receptors flanked by CCKBR and RRM1. It could not be determined whether this organisation is conserved in all amniotes because of the paucity of information from non-avian reptiles. To fill in this gap, we examined globin gene organisation in a squamate reptile, the Australian bearded dragon lizard, Pogona vitticeps (Agamidae). We report here that the α-globin cluster (HBK, HBA) is flanked by C16orf35 and GBY and is located on a pair of microchromosomes, whereas the β-globin cluster is flanked by RRM1 on the 3' end and is located on the long arm of chromosome 3. However, the CCKBR gene that flanks the β-globin cluster on the 5' end in other amniotes is located on the short arm of chromosome 5 in P. vitticeps, indicating that a chromosomal break between the β-globin cluster and CCKBR occurred at least in the agamid lineage. Our data from a reptile species provide further evidence to support the transpositional model for the evolution of β-globin gene cluster in amniotes.

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

PubMed

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

Cloning, sequencing and expression of white rhinoceros (Ceratotherium simum) interferon-gamma (IFN-gamma) and the production of rhinoceros IFN-gamma specific antibodies.

PubMed

Morar, D; Tijhaar, E; Negrea, A; Hendriks, J; van Haarlem, D; Godfroid, J; Michel, A L; Rutten, V P M G

2007-01-15

Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-gamma) assay is used as a routine diagnostic tool to determine infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop reagents to set up a rhinoceros IFN-gamma (RhIFN-gamma) assay. The white rhinoceros IFN-gamma gene was cloned, sequenced and expressed as a mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-gamma shares a homology of 90% with equine IFN-gamma. Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant RhIFN-gamma were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that recombinant as well as native white rhinoceros IFN-gamma was recognised. This preliminary IFN-gamma enzyme-linked immunosorbent assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.

Discovery of phenylsulfonylfuroxan derivatives as gamma globin inducers by histone acetylation.

PubMed

Melo, Thais Regina Ferreira de; Kumkhaek, Chutima; Fernandes, Guilherme Felipe Dos Santos; Lopes Pires, Maria Elisa; Chelucci, Rafael Consolin; Barbieri, Karina Pereira; Coelho, Fernanda; Capote, Ticiana Sidorenko de Oliveira; Lanaro, Carolina; Carlos, Iracilda Zeppone; Marcondes, Sisi; Chegaev, Konstantin; Guglielmo, Stefano; Fruttero, Roberta; Chung, Man Chin; Costa, Fernando Ferreira; Rodgers, Griffin P; Dos Santos, Jean Leandro

2018-05-28

N-oxide derivatives 5(a-b), 8(a-b), and 11(a-c) were designed, synthesized and evaluated in vitro and in vivo as potential drugs that are able to ameliorate sickle cell disease (SCD) symptoms. All of the compounds demonstrated the capacity to releasing nitric oxide at different levels ranging from 0.8 to 30.1%, in vivo analgesic activity and ability to reduce TNF-α levels in the supernatants of monocyte cultures. The most active compound (8b) protected 50.1% against acetic acid-induced abdominal constrictions, while dipyrone, which was used as a control only protected 35%. Compounds 8a and 8b inhibited ADP-induced platelet aggregation by 84% and 76.1%, respectively. Both compounds increased γ-globin in K562 cells at 100 μM. The mechanisms involved in the γ-globin increase are related to the acetylation of histones H3 and H4 that is induced by these compounds. In vitro, the most promising compound (8b) was not cytotoxic, mutagenic and genotoxic. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Human beta-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old.

PubMed

Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M

1995-12-01

Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible.

Conservation of globin genes in the "living fossil" Latimeria chalumnae and reconstruction of the evolution of the vertebrate globin family.

PubMed

Schwarze, Kim; Burmester, Thorsten

2013-09-01

The (hemo-)globins are among the best-investigated proteins in biomedical sciences. These small heme-proteins play an important role in oxygen supply, but may also have other functions. In addition to well known hemoglobin and myoglobin, six other vertebrate globin types have been identified in recent years: neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Analyses of the genome of the "living fossil" Latimeria chalumnae show that the coelacanth is the only known vertebrate that includes all eight globin types. Thus, Latimeria can also be considered as a "globin fossil". Analyses of gene synteny and phylogenetic reconstructions allow us to trace the evolution and the functional changes of the vertebrate globin family. Neuroglobin and globin X diverged from the other globin types before the separation of Protostomia and Deuterostomia. The cytoglobins, which are unlikely to be involved in O2 supply, form the earliest globin branch within the jawed vertebrates (Gnathostomata), but do not group with the agnathan hemoglobins, as it has been proposed before. There is strong evidence from phylogenetic reconstructions and gene synteny that the eye-specific globin E and muscle-specific myoglobin constitute a common clade, suggesting a similar role in intracellular O2 supply. Latimeria possesses two α- and two β-hemoglobin chains, of which one α-chain emerged prior to the divergence of Actinopterygii and Sarcopterygii, but has been retained only in the coelacanth. Notably, the embryonic hemoglobin α-chains of Gnathostomata derive from a common ancestor, while the embryonic β-chains - with the exception of a more complex pattern in the coelacanth and amphibians - display a clade-specific evolution. Globin Y is associated with the hemoglobin gene cluster, but its phylogenetic position is not resolved. Our data show an early divergence of distinct globin types in the vertebrate evolution before the emergence of tetrapods. The subsequent loss of

Chromatin structure of the LCR in the human β-globin locus transcribing the adult δ- and β-globin genes.

PubMed

Kim, Seoyeon; Kim, Yea Woon; Shim, Sung Han; Kim, Chul Geun; Kim, Aeri

2012-03-01

The β-like globin genes are transcribed in a developmental stage specific fashion in erythroid cells. The specific transcription of globin genes is conferred by the locus control region (LCR), but the chromatin structure of the LCR in the human adult β-globin locus transcribing the δ- and β-globin genes is not clear. Here, we employed hybrid MEL cells that contain a human chromosome 11. The δ- and β-globin genes were highly transcribed in hybrid MEL/ch11 cells after transcriptional induction. LCR HS3 and HS2 were strongly occupied by erythroid specific transcriptional activators and co-factors in the induced locus. These HSs, but not HS4 and HS1, were in close proximity with the active globin genes as revealed by high resolution 3C experiments. The active features at HS3 were markedly established after transcriptional induction, while HS2 was in a relatively active conformation before the induction. Unexpectedly, HS1 did not show notable active features except histone hyperacetylation. Taken together, the LCR of the human β-globin locus transcribing the adult δ- and β-globin genes has HS specific chromatin structure. The structure at each HS, which is different from the locus transcribing the fetal globin genes, might relate to its role in transcribing the adult genes. Copyright © 2011 Elsevier Ltd. All rights reserved.

A Phylogenetic Analysis of the Globins in Fungi

PubMed Central

Hoogewijs, David; Dewilde, Sylvia; Vierstraete, Andy; Moens, Luc; Vinogradov, Serge N.

2012-01-01

Background All globins belong to one of three families: the F (flavohemoglobin) and S (sensor) families that exhibit the canonical 3/3 α-helical fold, and the T (truncated 3/3 fold) globins characterized by a shortened 2/2 α-helical fold. All eukaryote 3/3 hemoglobins are related to the bacterial single domain F globins. It is known that Fungi contain flavohemoglobins and single domain S globins. Our aims are to provide a census of fungal globins and to examine their relationships to bacterial globins. Results Examination of 165 genomes revealed that globins are present in >90% of Ascomycota and ∼60% of Basidiomycota genomes. The S globins occur in Blastocladiomycota and Chytridiomycota in addition to the phyla that have FHbs. Unexpectedly, group 1 T globins were found in one Blastocladiomycota and one Chytridiomycota genome. Phylogenetic analyses were carried out on the fungal globins, alone and aligned with representative bacterial globins. The Saccharomycetes and Sordariomycetes with two FHbs form two widely divergent clusters separated by the remaining fungal sequences. One of the Saccharomycete groups represents a new subfamily of FHbs, comprising a previously unknown N-terminal and a FHb missing the C-terminal moiety of its reductase domain. The two Saccharomycete groups also form two clusters in the presence of bacterial FHbs; the surrounding bacterial sequences are dominated by Proteobacteria and Bacilli (Firmicutes). The remaining fungal FHbs cluster with Proteobacteria and Actinobacteria. The Sgbs cluster separately from their bacterial counterparts, except for the intercalation of two Planctomycetes and a Proteobacterium between the Fungi incertae sedis and the Blastocladiomycota and Chytridiomycota. Conclusion Our results are compatible with a model of globin evolution put forward earlier, which proposed that eukaryote F, S and T globins originated via horizontal gene transfer of their bacterial counterparts to the eukaryote ancestor, resulting from

Interferon system in women with genital papillomavirus infection receiving immunomodulatory therapy.

PubMed

Rogovskaya, S I; Zhdanov, A V; Loginova, N S; Faizullin, L Z; Prilepskaya, V N; Van'ko, L V; Sukhikh, G T

2002-11-01

The interferon system was studied in women with genital papillomavirus infection. In most patients the interferon system was activated, while the ability of lymphocytes to respond to inductors decreased. Laserotherapy and immunomodulatory therapy with larifan, ridostin, and viferon for 1 month normalized blood interferon concentration (39.4% patients) and interferon-gamma production by lymphocytes in response to inductors (87.9% patients). After laser monotherapy these parameters returned to normal only in 13.2 and 7.6% patients, respectively. Correlation and regression analyses showed that changes in the interferon system were synchronized after immunomodulatory therapy. These data indicate that immunomodulatory therapy produces a complex effect on the interferon system. Measurements of blood interferon level can be used to predict the effect of further treatment with interferon-gamma inductors.

Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

PubMed Central

Kimura, Elza Miyuki; Oliveira, Denise Madureira; Jorge, Susan Elisabeth; Ribeiro, Daniela Maria; Zaccariotto, Tânia Regina; Santos, Magnun Nueldo Nunes; Almeida, Vanessa; Albuquerque, Dulcinéia Martins; Costa, Fernando Ferreira; Sonati, Maria de Fátima

2015-01-01

Background Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC) and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC). Mutations were identified by molecular analyses, and the oxygen affinity, heme–heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations. PMID:25818820

Interferon-gamma promoter hypomethylation and increased expression in chronic periodontitis

PubMed Central

Zhang, Shaoping; Crivello, Antonino; Offenbacher, Steven; Moretti, Antonio; Paquette, David W.; Barros, Silvana P.

2011-01-01

Aim The goal of this investigation was to determine whether epigenetic modifications in the IFNG promoter are associated with an increase of IFNG transcription in different stages of periodontal diseases. Materials and Methods DNA was extracted from gingival biopsy samples collected from 47 total sites from 47 different subjects: 23 periodontally healthy sites, 12 experimentally induced gingivitis sites and 12 chronic periodontitis sites. Levels of DNA methylation within the IFNG promoter containing six CpG dinucleotides were determined using pyrosequencing technology. Interferon gamma mRNA expression was analysed by quantitative polymerase chain reactions using isolated RNA from part of the biological samples mentioned above. Results The methylation level of all six analysed CpG sites within the IFNG promoter region in the periodontitis biopsies {52% [interquartile range, IQR (43.8%, 63%)]} was significantly lower than periodontally healthy samples {62% [IQR (51.3%, 74%)], p =0.007} and gingivitis biopsies {63% [IQR (55%, 74%)], p =0.02}. The transcriptional level of IFNG in periodontitis biopsies was 1.96-fold and significantly higher than tissues with periodontal health (p =0.04). Although the mRNA level from experimental gingivitis samples exhibited an 8.5-fold increase as compared with periodontally healthy samples, no significant methylation difference was observed in experimental gingivitis sample. Conclusions A hypomethylation profile within IFNG promoter region is related to an increase of IFNG transcription present in the chronic periodontitis biopsies, while such an increase of IFNG in experimentally induced gingivitis seems independent of promoter methylation alteration. PMID:20958339

The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription.

PubMed

Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

2014-04-01

TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the (G)γ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the (G)γ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes.

The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription

PubMed Central

Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

2014-01-01

TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the Gγ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the Gγ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes. PMID:24470145

Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity

PubMed Central

1984-01-01

Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN

A short 2 week dose titration regimen reduces the severity of flu-like symptoms with initial interferon gamma-1b treatment.

PubMed

Devane, John G; Martin, Mary L; Matson, Mark A

2014-06-01

Flu-like symptoms (FLS) are commonly experienced by patients receiving interferon gamma-1b which may cause discontinuation or disruption of dosing during initial therapy or on re-initiation following a break in therapy. In contrast to Type I interferons, the impact of dose-titration on FLS has not been reported and is not a practice described or included in the approved prescribing information for interferon gamma-1b.The objective of this study was to assess the effect of a 2 week titration regimen on the severity of FLS during the initial 3 weeks of therapy with three times weekly subcutaneous injections of interferon gamma-1b. Healthy men and women were randomized into a double-blind, two-period, crossover study. Each study period was 3 weeks in duration and there was a minimum 15 day washout between treatment periods. Two treatment regimens were compared: No Titration dosing (full 50 mcg/m(2) subcutaneously [s.c.] three times weekly for 3 weeks) and Titration (15 mcg/m(2) s.c. three times weekly during week 1, 30 mcg/m(2) s.c. three times weekly during week 2 followed by the full dose of 50 mcg/m(2) s.c. three times weekly during week 3). Subjects remained in the clinic for at least 12 hours following each injection. FLS was based on a composite score for fever, chills, tiredness and muscle aches assessed at baseline and 4, 8 and 12 hours following each injection. Acetaminophen was allowed at the discretion of the PI. The primary endpoint was the change from baseline in FLS severity at 8 hours averaged over the 3 weeks of treatment. Additional endpoints included FLS at 4 and 12 hours, individual flu-like symptoms, rates of discontinuation, incidence of FLS and acetaminophen use. NCT 01929382. Of the 40 subjects randomized, there were 15 (37.5%) discontinuations. Titration resulted in a significant reduction in FLS severity at 8 hours (p = 0.023) averaged over the 3 week treatment period. The difference in 3 week FLS severity reflects differences

Coexposure of mice to trovafloxacin and lipopolysaccharide, a model of idiosyncratic hepatotoxicity, results in a unique gene expression profile and interferon gamma-dependent liver injury.

PubMed

Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A

2009-01-01

The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.

Executive Summary of the Guidelines for the Use of interferon-gamma Release Assays in the Diagnosis of Tuberculosis Infection.

PubMed

Santin, Miguel; García-García, José-María; Rigau, David; Altet, Neus; Anibarro, Luis; Casas, Irma; Díez, Nuria; García-Gasalla, Mercedes; Martínez-Lacasa, Xavier; Penas, Antón; Pérez-Escolano, Elvira; Sánchez, Francisca; Domínguez, José

2016-09-01

Interferon-gamma release assays are widely used for the diagnosis of tuberculosis infection in Spain. However, there is no consensus on their application in specific clinical scenarios. To develop a guide-line for their use, a panel of experts comprising specialists in infectious diseases, respiratory diseases, microbiology, pediatrics and preventive medicine, together with a methodologist, conducted a systematic literature search, summarized the findings, rated the quality of the evidence, and formulated recommendations following the Grading of Recommendations of Assessment Development and Evaluations methodology. This document provides evidence-based guidance on the use of interferon-gamma release assays for the diagnosis of tuberculosis infection in patients at risk of tuberculosis or suspected of having active disease. The guidelines will be applicable to specialist and primary care, and public health. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

Differential effects of human interferon alpha and interferon gamma on xenografted human thyroid tissue in severe combined immunodeficient mice and nude mice.

PubMed

Kawai, K; Enomoto, T; Fornasier, V; Resetkova, E; Volpé, R

1997-03-01

We have studied the in vivo effects of human interferon alpha (IFN-alpha) and interferon gamma (IFN-gamma) administration on human thyroid tissue xenografted into two mouse strains: severe combined immunodeficient (SCID) mice and nude mice. Human lymphocytes survive in SCID mice but are lysed in nude mice. Thyroid tissues from Graves' disease or Hashimoto's thyroiditis, or paranodular [normal, (N)] tissue was xenografted into SCID mice (0.8 g/mouse) pretreated with anti-asialo GM-1 antiserum and radiation and also into nude mice. One week after xenografting, SCID and nude mice were divided into three groups. Group A was treated with IFN-alpha intraperitoneally (2,000 units/mouse) three times weekly; group B was treated with IFN-gamma similarly; group C was treated with phosphate buffered saline (PBS) only (control). Autologous human peripheral blood mononuclear cells (PBMCs) were added to mice receiving N xenografts. Blood was taken every 2 weeks for levels of IgG and thyroid antibodies (TAb). After 6 weeks of treatment, mice were sacrificed, and xenograft thyrocyte histocompatibility leukocyte antigen (HLA-DR) and intercellular adhesion molecule (ICAM-1) expression were measured. In addition, thyrocyte cultures were stimulated in vitro with 200 units/ml of either IFN-alpha or IFN-gamma or PBS (control). SCID mice xenografted with autoimmune thyroid disease (AITD) in group A showed a significantly higher TAb production than group C, whereas in group B, TAb production was not statistically increased compared to control (group C). SCID mice xenografted with N did not produce TAb in any group, nor did nude mice xenografted with AITD. Thyrocyte HLA-DR expression was markedly increased in group A and B in SCID mice xenografted with Graves' disease, Hashimoto's thyroiditis, and N tissue compared to group C. In contrast, only group B (IFN-gamma) showed an increase in thyrocyte HLA-DR in nude mice. In the in vitro studies, only IFN-gamma (not IFN-alpha) stimulated

Dual specific oral tolerance induction using interferon gamma for IgE-mediated anaphylactic food allergy and the dissociation of local skin allergy and systemic oral allergy: tolerance or desensitization?

PubMed

Noh, G; Jang, E H

2014-01-01

Specific oral tolerance induction (SOTI) for IgE-mediated food allergy (IFA) can be successfully achieved using interfero gamma (classic SOTI). In this study, a tolerable dose was introduced during tolerance induction with interferon gamma (dual SOTI), and its effectiveness was evaluated. The study population comprised 25 IFA patients. Blood samples were taken for analysis, including complete blood count with differential counts of eosinophils, serum total IgE levels, and specific IgE for allergenic foods. Skin prick tests were conducted with the allergens. Oral food challenges were performed to diagnose IFA. Ten patients received dual SOTI, 5 received classic SOTI, 5 received SOTI without interferon gamma (original SOTI), and 5 were not treated (controls). Patients treated with dual SOTI and classic SOTI using interferon gamma became tolerant to the allergenic food. The tolerable dose was introduced successfully in dual SOTI. It was difficult to proceed with the same dosing protocol used for classic SOTI in cases treated with original SOTI. Following dual SOTI, the systemic reaction to oral intake subsided, but the local skin reaction to contact with the allergenic food persisted. Dual SOTI is an improved protocol for SOTI using interferon gamma for IFA.The local skin reaction and systemic reaction to oral intake were dissociated following dual SOTI. In cases of food allergy, tolerance appears to result from desensitization to allergens.

Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.

PubMed

Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F

2003-01-01

A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.

COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?

PubMed Central

Levick, Scott P.; Goldspink, Paul H.

2013-01-01

The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353

Vertebral osteomyelitis due to Aspergillus fumigatus in a patient with chronic granulomatous disease successfully treated with antifungal agents and interferon-gamma.

PubMed

Al-Tawfiq, Jaffar A; Al-Abdely, Hail M

2010-05-01

We report a case of invasive aspergillosis due to Aspergillus fumigatus involving the cervical and thoracic vertebrae and upper mediastinum of a 17 year-old Saudi male with chronic granulomatous disease (CGD). The patient did not respond to a long course of liposomal amphotericin B but did to surgical drainage and a combination of caspofungin and itraconazole with subsequent suppression with oral voriconazole. Fourteen months after the start of therapy, the patient had anterior dislocation of T2 thoracic vertebra with cord transection and quadriplegia. He was then treated intravenously with liquid itraconazole and interferon-gamma. The patient made a remarkable recovery over a 2-year period and was eventually able to walk independently. Thus, a combination of antifungals and interferon-gamma may have resulted in the positive outcome in this case.

Interleukin-12- and interferon-gamma-mediated natural killer cell activation by Agaricus blazei Murill.

PubMed

Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko

2007-06-01

Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.

Production of interferon-gamma by in vivo tumor-sensitized T cells: Association with active antitumor immunity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bursuker, I.; Pearce, M.T.

1990-02-01

The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less

α-Globin as a molecular target in the treatment of β-thalassemia

PubMed Central

Mettananda, Sachith; Gibbons, Richard J.

2015-01-01

The thalassemias, together with sickle cell anemia and its variants, are the world’s most common form of inherited anemia, and in economically undeveloped countries, they still account for tens of thousands of premature deaths every year. In developed countries, treatment of thalassemia is also still far from ideal, requiring lifelong transfusion or allogeneic bone marrow transplantation. Clinical and molecular genetic studies over the course of the last 50 years have demonstrated how coinheritance of modifier genes, which alter the balance of α-like and β-like globin gene expression, may transform severe, transfusion-dependent thalassemia into relatively mild forms of anemia. Most attention has been paid to pathways that increase γ-globin expression, and hence the production of fetal hemoglobin. Here we review the evidence that reduction of α-globin expression may provide an equally plausible approach to ameliorating clinically severe forms of β-thalassemia, and in particular, the very common subgroup of patients with hemoglobin E β-thalassemia that makes up approximately half of all patients born each year with severe β-thalassemia. PMID:25869286

Continuous in vivo infusion of interferon-gamma (IFN-gamma) enhances engraftment of syngeneic wild-type cells in Fanca-/- and Fancg-/- mice.

PubMed

Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade

2006-12-15

Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.

Interferon Gamma in African Trypanosome Infections: Friends or Foes?

PubMed

Wu, Hui; Liu, Gongguan; Shi, Meiqing

2017-01-01

African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.

Interferon-gamma promotes the survival and Fc epsilon RI-mediated histamine release in cultured human mast cells.

PubMed Central

Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T

1996-01-01

We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819

Equine interferon gamma synthesis in lymphocytes after in vivo infection and in vitro stimulation with EHV-1.

PubMed

Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H

2005-08-22

Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.

Pilot study of whole-blood gamma interferon response to the Vibrio cholerae toxin B subunit and resistance to enterotoxigenic Escherichia coli-associated diarrhea.

PubMed

Flores, Jose; DuPont, Herbert L; Paredes-Paredes, Mercedes; Aguirre-Garcia, M Magdalena; Rojas, Araceli; Gonzalez, Alexei; Okhuysen, Pablo C

2010-05-01

Enterotoxigenic Escherichia coli (ETEC), which produces heat-labile toxin (LT), is a common cause of travelers' diarrhea (TD). The B subunit of ETEC LT is immunologically related to the B subunit of Vibrio cholerae toxin (CT). In this pilot study we evaluated the whole-blood gamma interferon response to CT B in 17 U.S. adults traveling to Mexico. Only one of nine subjects who demonstrated a cellular immune response as determined by whole-blood gamma interferon production to CT B on arrival to Mexico developed diarrhea, whereas five of eight without a cellular response developed diarrhea. Markers of the cellular immune response to ETEC LT could help in identifying individuals immune to ETEC LT, and these markers deserve additional study.

Evolution and Expression of Tissue Globins in Ray-Finned Fishes.

PubMed

Gallagher, Michael D; Macqueen, Daniel J

2017-01-01

The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution.

Evolution and Expression of Tissue Globins in Ray-Finned Fishes

PubMed Central

Gallagher, Michael D.

2017-01-01

The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution. PMID:28173090

Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies

PubMed Central

Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D

2014-01-01

Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250

Development of a lion-specific interferon-gamma assay.

PubMed

Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G

2012-10-15

The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.

Graft-versus-host disease causes failure of donor hematopoiesis and lymphopoiesis in interferon-gamma receptor-deficient hosts.

PubMed

Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude

2008-09-01

The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.

The Effectiveness of Screening with Interferon-Gamma Release Assays in a University Health Care Setting with a Diverse Global Population

ERIC Educational Resources Information Center

Birch, Samantha J.; Golbeck, Amanda L.

2015-01-01

Objective: This analysis examined the effectiveness of utilizing interferon-gamma release assay (IGRA) technology in a TB (TB) screening program at a university. Participants: Participants were 2299 students at a Montana university who had presented to the university health center for TB screening during 2012 and 2013. Methods: A retrospective…

Alpha-globin gene haplotypes in South American Indians.

PubMed

Zago, M A; Melo Santos, E J; Clegg, J B; Guerreiro, J F; Martinson, J J; Norwich, J; Figueiredo, M S

1995-08-01

The haplotypes of the alpha-globin gene cluster were determined for 99 Indians from the Brazilian Amazon region who belong to 5 tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Three predominant haplotypes were identified: Ia (present in 38.9% of chromosomes), IIIa (25.8%), and IIe (22.1%). The only alpha-globin gene rearrangement detected was alpha alpha alpha 3.7 I gene triplication associated with haplotype IIIa, found in high frequencies (5.6% and 10.6%) in two tribes and absent in the others. alpha-Globin gene deletions that cause alpha-thalassemia were not seen, supporting the argument that malaria was absent in these populations until recently. The heterogeneous distribution of alpha-globin gene haplotypes and rearrangements among the different tribes differs markedly from the homogeneous distribution of beta-globin gene cluster haplotypes and reflects the action of various genetic mechanisms (genetic drift, founder effect, consanguinity) on small isolated population groups with a complicated history of divergence-fusion events. The alpha-globin gene haplotype distribution has some similarities to distributions observed in Southeast Asian and Pacific Island populations, indicating that these populations have considerable genetic affinities. However, the absence of several features of the alpha-globin gene cluster that are consistently present among the Pacific Islanders suggests that the similarity of haplotypes between Brazilian Indians and people from Polynesia, Micronesia, and Melanesia is more likely to result of ancient common ancestry rather than the consequence of recent direct genetic contribution through immigration.

Dysregulation of Serum Gamma Interferon Levels in Vascular Chronic Q Fever Patients Provides Insights into Disease Pathogenesis

PubMed Central

Kremers, Marjolein N. T.; Hodemaekers, Hennie M.; Hagenaars, Julia C. J. P.; Koning, Olivier H. J.; Renders, Nicole H. M.; Hermans, Mirjam H. A.; de Klerk, Arja; Notermans, Daan W.; Wever, Peter C.; Janssen, Riny

2015-01-01

A large community outbreak of Q fever occurred in the Netherlands in the period 2007 to 2010. Some of the infected patients developed chronic Q fever, which typically includes pathogen dissemination to predisposed cardiovascular sites, with potentially fatal consequences. To identify the immune mechanisms responsible for ineffective clearance of Coxiella burnetii in patients who developed chronic Q fever, we compared serum concentrations of 47 inflammation-associated markers among patients with acute Q fever, vascular chronic Q fever, and past resolved Q fever. Serum levels of gamma interferon were strongly increased in acute but not in vascular chronic Q fever patients, compared to past resolved Q fever patients. Interleukin-18 levels showed a comparable increase in acute as well as vascular chronic Q fever patients. Additionally, vascular chronic Q fever patients had lower serum levels of gamma interferon-inducible protein 10 (IP-10) and transforming growth factor β (TGF-β) than did acute Q fever patients. Serum responses for these and other markers indicate that type I immune responses to C. burnetii are affected in chronic Q fever patients. This may be attributed to an affected immune system in cardiovascular patients, which enables local C. burnetii replication at affected cardiovascular sites. PMID:25924761

Ionizing radiation potentiates the induction of nitric oxide synthase by interferon-gamma (Ifn-gamma) or Ifn-gamma and lipopolysaccharide in bnl cl.2 murine embryonic liver cells: role of hydrogen peroxide.

PubMed

Yoo, J C; Pae, H O; Choi, B M; Kim, W I; Kim, J D; Kim, Y M; Chung, H T

2000-02-01

The effects of ionizing irradiation on the nitric oxide (NO) production in murine embryonic liver cell line, BNL CL.2 cells, were investigated. Various doses (5-40 Gy) of radiation made BNL CL.2 cells responsive to interferon-gamma alone for the production of NO in a dose-dependent manner. Small amounts of lipopolysaccharide (LPS) or tumor necrosis factor-alpha (TNF-alpha) synergized with IFN-gamma in the production of NO from irradiated BNL CL.2 cells, even though LPS or TNF-alpha alone did not induce NO production from the same cells. Immunoblots showed parallel induction of inducible nitric oxide synthase (iNOS). NO production in irradiated BNL CL.2 cells by IFN-gamma or IFN-gamma plus LPS was decreased by the addition of catalase, suggesting that H(2)O(2) produced by ionizing irradiation primed the cells to trigger NO production in response to IFN-gamma or IFN-gamma plus LPS. Furthermore, the treatment of nongamma-irradiated BNL CL.2 cells with H(2)O(2) made the cells responsive to IFN-gamma or IFN-gamma plus LPS for the production of NO. This study shows that ionizing irradiation has the ability to induce iNOS gene expression in responsive to IFN-gamma via the formation of H(2)O(2) in BNL CL.2 murine embryonic liver cells.

Alternative activation of STAT1 and STAT3 in response to interferon-gamma.

PubMed

Qing, Yulan; Stark, George R

2004-10-01

Interferon-gamma (IFNgamma) is a pluripotent cytokine whose major biological effects are mediated through a pathway in which STAT1 is the predominant and essential transcription factor. STAT3 can also be activated weakly by IFNgamma, but the mechanism of activation and function of STAT3 as a part of the interferon response are not known. Here we show that STAT3 activation is much stronger and more prolonged in STAT1-null mouse embryo fibroblasts than in wild-type cells. In response to IFNgamma, SRC-family kinases are required to activate STAT3 (but not STAT1) through tyrosine phosphorylation, whereas the receptor-bound kinases JAK1 and JAK2 are required to activate both STATs. Tyrosine 419 of the IFNgamma receptor subunit 1 (IFNGR1) is required to activate both STATs, suggesting that STAT1 and STAT3 compete with each other for the same receptor phosphotyrosine motif. Activated STAT3 can replace STAT1 in STAT1-null cells to drive the transcription of certain genes, for example, socs-3 and c/ebpdelta, which have gamma-activated sequence motifs in their promoters. Work from Ian Kerr's laboratory reveals that the gp130-linked interleukin-6 receptor, which usually activates STAT3 predominantly, activates STAT1 efficiently when STAT3 is absent. Because STAT1 and STAT3 have opposing biological effects (STAT3 is an oncogene, and STAT1 is a tumor suppressor), the reciprocal activation of these two transcription factors in response to IFNgamma or interleukin-6 suggests that their relative abundance, which may vary substantially in different normal cell types, under different conditions or in tumors is likely to have a major impact on how cells behave in response to different cytokines.

Effects of interferon on antibody formation

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.

1984-01-01

Studies of the effects of interferon on primary and secondary antibody responses and of the relationship of interferon to other cytokines, or cell products, are presented. Dosage- and timing-dependent immunoenhancing and immunosuppressive activities of interferon are documented for mouse spleen cell cultures and for mice infected with murine hepatitis virus (MHV-3). A possibility that altered interferon production might lead to immunopathological disorders, such as lupus erythematosus, AIDS, arthritis, etc., is discussed. Latest technological developments are presented that indicate that interferon does apparently play a major role in the regulation of antibody responses.

Interferon-gamma enhances radiation-induced cell death via downregulation of Chk1

PubMed Central

Kim, Kwang Seok; Choi, Kyu Jin; Bae, Sangwoo

2012-01-01

Interferon-gamma (IFNγ) is a cytokine with roles in immune responses as well as in tumor control. Interferon is often used in cancer treatment together with other therapies. Here we report a novel approach to enhancement of cancer cell killing by combined treatment of IFNγ with ionizing radiation. We found that IFNγ treatment alone in HeLa cells induced phosphorylation of Chk1 in a time- and dose-dependent manner, and resulted in cell arrest. Moreover IFNγ treatment was correlated with attenuation of Chk1 as the treatment shortened protein half-life of Chk1. As Chk1 is an essential cell cycle regulator for viability after DNA damage, attenuation of Chk1 by IFNγ pre-treatment in HeLa cells resulted in increased cell death following ionizing radiation about 2-folds than ionizing radiation treatment alone whereas IFNγ treatment alone had little effect on cell death. X-linked inhibitor of apoptosis-associated factor 1 (XAF1), an IFN-induced gene, seems to partly regulate IFNγ-induced Chk1 destabilization and radiation sensitivity because transient depletion of XAF1 by siRNA prevented IFNγ-induced Chk1 attenuation and partly protected cells from IFNγ-enhanced radiation cell killing. Therefore the results provide a novel rationale to combine IFNγ pretreatment and DNA-damaging anti-cancer drugs such as ionizing radiation to enhance cancer cell killing. PMID:22825336

Electrochemical impedance spectroscopy based-on interferon-gamma detection

NASA Astrophysics Data System (ADS)

Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung

2014-03-01

Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.

Activation of beta-major globin gene transcription is associated with recruitment of NF-E2 to the beta-globin LCR and gene promoter.

PubMed

Sawado, T; Igarashi, K; Groudine, M

2001-08-28

The mouse beta-globin gene locus control region (LCR), located upstream of the beta-globin gene cluster, is essential for the activated transcription of genes in the cluster. The LCR contains multiple binding sites for transactivators, including Maf-recognition elements (MAREs). However, little is known about the specific proteins that bind to these sites or the time at which they bind during erythroid differentiation. We have performed chromatin immunoprecipitation experiments to determine the recruitment of the erythroid-specific transactivator p45 NF-E2/MafK (p18 NF-E2) heterodimer and small Maf proteins to various regions in the globin gene locus before and after the induction of murine erythroleukemia (MEL) cell differentiation. We report that, before induction, the LCR is occupied by small Maf proteins, and, on erythroid maturation, the NF-E2 complex is recruited to the LCR and the active globin promoters, even though the promoters do not contain MAREs. This differentiation-coupled recruitment of NF-E2 complex correlates with a greater than 100-fold increase in beta-major globin transcription, but is not associated with a significant change in locus-wide histone H3 acetylation. These findings suggest that the beta-globin gene locus exists in a constitutively open chromatin conformation before terminal differentiation, and we speculate that recruitment of NF-E2 complex to the LCR and active promoters may be a rate-limiting step in the activation of beta-globin gene expression.

Heterogeneity within populations of recombinant Chinese hamster ovary cells expressing human interferon-gamma.

PubMed

Coppen, S R; Newsam, R; Bull, A T; Baines, A J

1995-04-20

The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.

The tuberculin skin test increases the responses measured by T cell interferon-gamma release assays.

PubMed

Vilaplana, C; Ruiz-Manzano, J; Gil, O; Cuchillo, F; Montané, E; Singh, M; Spallek, R; Ausina, V; Cardona, P J

2008-06-01

RUTI is a vaccine consisting of Mycobacterium tuberculosis bacilli grown in stress conditions that is fragmented, detoxified and liposomed. RUTI was designed to shorten the treatment of latent tuberculosis infection (LTBI) with isoniazid from 9 months to just 1 month, by additional treatment with two inoculations of RUTI 4 weeks apart. During the validation process for monitoring the immunogenicity of administration of RUTI in a Phase I clinical trial, the question arose whether to introduce the tuberculin skin test (TST) in the screening of non-LTBI volunteers. This study was designed to evaluate the effect of TST on subsequent different T-cell interferon-gamma release assay (TIGRA) responses, using a spectrum of M. tuberculosis-related antigens (ESAT-6, CFP-10, 16 kDa, 19 kDa, MPT64, Ag 85B, 38 kDa, hsp65, PPD and BCG). The results showed an increase in post-TST response even in non-LTBI subjects for most antigens tested, as measured both by whole blood assay (WBA) and ELISPOT. Increased ELISPOT response decreased toward pre-TST levels within 1 month whereas the WBA response did not. Taking into account that there is no definitive correlation between TST and TIGRA tests to diagnose LTBI and the feasibility that TST might alter the immune monitoring included in clinical trials, these data suggest that TST determination should be carefully planned to avoid any interference with TIGRA.

Evidence for a large expansion and subfunctionalisation of globin genes in sea anemones.

PubMed

Smith, Hayden L; Pavasovic, Ana; Surm, Joachim M; Phillips, Matthew J; Prentis, Peter J

2018-06-27

The globin gene superfamily has been well-characterised in vertebrates, however, there has been limited research in early-diverging lineages, such as phylum Cnidaria. This study aimed to identify globin genes in multiple cnidarian lineages, and use bioinformatic approaches to characterise the evolution, structure and expression of these genes. Phylogenetic analyses and in silico protein predictions showed that all cnidarians have undergone an expansion of globin genes, which likely have a hexacoordinate protein structure. Our protein modelling has also revealed the possibility of a single pentacoordinate globin lineage in anthozoan species. Some cnidarian globin genes displayed tissue and development specific expression with very few orthologous genes similarly expressed across species. Our phylogenetic analyses also revealed that eumetazoan globin genes form a polyphyletic relationship with vertebrate globin genes. Overall, our analyses suggest that a Ngb-like and GbX-like gene were most likely present in the globin gene repertoire for the last common ancestor of eumetazoans. The identification of a large-scale expansion and subfunctionalisation of globin genes in actiniarians provides an excellent starting point to further our understanding of the evolution and function of the globin gene superfamily in early-diverging lineages.

Structural analysis and localization of the carbohydrate moieties of a soluble human interferon gamma receptor produced in baculovirus-infected insect cells.

PubMed Central

Manneberg, M.; Friedlein, A.; Kurth, H.; Lahm, H. W.; Fountoulakis, M.

1994-01-01

A soluble form of the human interferon gamma receptor that is required for the identification of interferon gamma antagonists was expressed in baculovirus-infected insect cells. The protein carried N-linked carbohydrate and showed a heterogeneity on denaturing polyacrylamide gels. We investigated the utilization of the potential sites for N-linked glycosylation and the structure of the carbohydrate moieties of this soluble receptor. Amino acid sequence analysis and ion spray mass spectrometry revealed that of the five potential sites for N-linked glycosylation, Asn17 and Asn69 were always utilized, whereas Asn62 and Asn162 were utilized in approximately one-third of the protein population. Asn223 was never found to be glycosylated. The soluble receptor was treated with N-glycosidase F and the oligosaccharides released were analyzed by matrix-assisted laser desorption mass spectrometry, which showed that the protein carried six types of short carbohydrate chains. The predominant species was a hexasaccharide of molecular mass 1,039, containing a fucose subunit linked to the proximal N-acetylglucosamine residue: [formula: see text] PMID:8142896

LCR 5' hypersensitive site specificity for globin gene activation within the active chromatin hub.

PubMed

Peterson, Kenneth R; Fedosyuk, Halyna; Harju-Baker, Susanna

2012-12-01

The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (β(m)), coupled to an intact LCR, a 5'HS3 complete deletion (5'ΔHS3) or a 5'HS3 core deletion (5'ΔHS3c). The 5'ΔHS3c mice expressed β(m)-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5'HS3 core was not required for β(m)-globin expression, previous work showed that the 5'HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5'HS complete deletion mice, except β(m)-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction.

Southern Analysis of Genomic Alterations in Gamma-Ray-Induced Aprt- Hamster Cell Mutants

PubMed Central

Grosovsky, Andrew J.; Drobetsky, Elliot A.; deJong, Pieter J.; Glickman, Barry W.

1986-01-01

The role of genomic alterations in mutagenesis induced by ionizing radiation has been the subject of considerable speculation. By Southern blotting analysis we show here that 9 of 55 (approximately 1/6) gamma-ray-induced mutants at the adenine phosphoribosyl transferase (aprt) locus of Chinese hamster ovary (CHO) cells have a detectable genomic rearrangement. These fall into two classes: intragenic deletions and chromosomal rearrangements. In contrast, no major genomic alterations were detected among 67 spontaneous mutants, although two restriction site loss events were observed. Three gamma-ray-induced mutants were found to be intragenic deletions; all may have identical break-points. The remaining six gamma-ray-induced mutants demonstrating a genomic alteration appear to be the result of chromosomal rearrangements, possibly translocation or inversion events. None of the remaining gamma-ray-induced mutants showed any observable alteration in blotting pattern indicating a substantial role for point mutation in gamma-ray-induced mutagenesis at the aprt locus. PMID:3013724

Eos Negatively Regulates Human γ-globin Gene Transcription during Erythroid Differentiation

PubMed Central

Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu

2011-01-01

Background Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Methodology/Principal Findings Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Conclusions/Significance Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation. PMID:21829552

Mice with Pulmonary Tuberculosis Treated with Mycobacterium vaccae Develop Strikingly Enhanced Recall Gamma Interferon Responses to M. vaccae Cell Wall Skeleton▿

PubMed Central

Rodríguez-Güell, Elisabeth; Agustí, Gemma; Corominas, Mercè; Cardona, Pere-Joan; Luquin, Marina; Julián, Esther

2008-01-01

Whole heat-killed Mycobacterium vaccae is used as an immunotherapeutic agent in tuberculosis (TB), but the compound(s) that triggers its immunostimulatory ability is not known. Here, we show that among different subcellular fractions, the cell wall skeleton induced a prominent expression of gamma interferon in splenocytes from both non-TB and TB M. vaccae-treated mice. PMID:18337379

Gamma Interferon-Induced T-Cell Loss in Virulent Mycobacterium avium Infection

PubMed Central

Flórido, Manuela; Pearl, John E.; Solache, Alejandra; Borges, Margarida; Haynes, Laura; Cooper, Andrea M.; Appelberg, Rui

2005-01-01

Infection by virulent Mycobacterium avium caused progressive severe lymphopenia in C57BL/6 mice due to increased apoptosis rates. T-cell depletion did not occur in gamma interferon (IFN-γ)-deficient mice which showed increased T-cell numbers and proliferation; in contrast, deficiency in nitric oxide synthase 2 did not prevent T-cell loss. Although T-cell loss was IFN-γ dependent, expression of the IFN-γ receptor on T cells was not required for depletion. Similarly, while T-cell loss was optimal if the T cells expressed IFN-γ, CD8+ T-cell depletion could occur in the absence of T-cell-derived IFN-γ. Depletion did not require that the T cells be specific for mycobacterial antigen and was not affected by deficiencies in the tumor necrosis factor receptors p55 or p75, the Fas receptor (CD95), or the respiratory burst enzymes or by forced expression of bcl-2 in hematopoietic cells. PMID:15908387

[Main regulatory element (MRE) of the Danio rerio α/β-globin gene domain exerts enhancer activity toward the promoters of the embryonic-larval and adult globin genes].

PubMed

Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V

2016-01-01

In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.

Towards β-globin gene-targeting with integrase-defective lentiviral vectors.

PubMed

Inanlou, Davoud Nouri; Yakhchali, Bagher; Khanahmad, Hossein; Gardaneh, Mossa; Movassagh, Hesam; Cohan, Reza Ahangari; Ardestani, Mehdi Shafiee; Mahdian, Reza; Zeinali, Sirous

2010-11-01

We have developed an integrase-defective lentiviral (LV) vector in combination with a gene-targeting approach for gene therapy of β-thalassemia. The β-globin gene-targeting construct has two homologous stems including sequence upstream and downstream of the β-globin gene, a β-globin gene positioned between hygromycin and neomycin resistant genes and a herpes simplex virus type 1 thymidine kinase (HSVtk) suicide gene. Utilization of integrase-defective LV as a vector for the β-globin gene increased the number of selected clones relative to non-viral methods. This method represents an important step toward the ultimate goal of a clinical gene therapy for β-thalassemia.

[Regulating human interferon-gamma gene expression in marrow stromal cells in mice by Tet-off system].

PubMed

Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong

2008-01-01

We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.

Interleukin-4 but not gamma interferon production correlates with the severity of murine cutaneous leishmaniasis.

PubMed Central

Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T

1993-01-01

For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376

Beta-globin locus activation regions: conservation of organization, structure, and function.

PubMed Central

Li, Q L; Zhou, B; Powers, P; Enver, T; Stamatoyannopoulos, G

1990-01-01

The human beta-globin locus activation region (LAR) comprises four erythroid-specific DNase I hypersensitive sites (I-IV) thought to be largely responsible for activating the beta-globin domain and facilitating high-level erythroid-specific globin gene expression. We identified the goat beta-globin LAR, determined 10.2 kilobases of its sequence, and demonstrated its function in transgenic mice. The human and goat LARs share 6.5 kilobases of homologous sequences that are as highly conserved as the epsilon-globin gene promoters. Furthermore, the overall spatial organization of the two LARs has been conserved. These results suggest that the functionally relevant regions of the LAR are large and that in addition to their primary structure, the spatial relationship of the conserved elements is important for LAR function. Images PMID:2236034

A Mouse β-Globin Mutant That Is an Exact Model of Hemoglobin Rainier in Man

PubMed Central

Peters, J.; Andrews, S. J.; Loutit, J. F.; Clegg, J. B.

1985-01-01

A mutation induced by ethylnitrosourea in a spermatogonial stem cell of a 101/H mouse has resulted in a structurally altered β-diffuse major globin in one of his offspring. The mutant hemoglobin is associated with polycythemia, rubor, increased oxygen affinity and decreased hem-hem interaction. The mutant haplotype has been designated Hbb d4, polycythemia. Amino acid analysis of the mutant globin has shown that a single substitution β145 Tyr → Cys has occurred, and it is proposed that ethylnitrosourea induced an A → G transition in the tyrosine codon (TAC → TGC). This murine polycythemia is homologous with hemoglobin Rainier in man, in which the amino acid substitution is also β145 Tyr → Cys and which is associated with similar physiological consequences. PMID:3839762

LCR 5′ hypersensitive site specificity for globin gene activation within the active chromatin hub

PubMed Central

Peterson, Kenneth R.; Fedosyuk, Halyna; Harju-Baker, Susanna

2012-01-01

The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (βm), coupled to an intact LCR, a 5′HS3 complete deletion (5′ΔHS3) or a 5′HS3 core deletion (5′ΔHS3c). The 5′ΔHS3c mice expressed βm-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5′HS3 core was not required for βm-globin expression, previous work showed that the 5′HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5′HS complete deletion mice, except βm-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction. PMID:23042246

Treatment of trypanosome-infected mice with exogenous interferon, interferon inducers, or antibody to interferon

NASA Technical Reports Server (NTRS)

Degee, Antonie L. W.; Mansfield, John M.; Sonnenfeld, Gerald

1986-01-01

Earlier studies have demonstrated that mice resistant to Trypanosoma brucei rhodesiense (the B10.BR/SgSnJ strain) produces, upon infection by this parasite, two peaks of serum interferon (IFN), while the susceptible mice (C3HeB/FeJ) produces no IFN. In the present study, survival times were compared for B10.BR/SgSnJ, C3HeB/FeJ, and CBA/J (an intermediately resistant strain) mice that were injected, prior to infection with the parasite, with either of the following three preparations (1) IFN-gamma, (2) an antibody to IFN-gamma and (3) polyriboinosinic-polyribocytidylic acid (to induce IFN-alpha/beta). No effect on the survival times of mice by any of these preparations could be demonstrated, contrary to some previous reports.

Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

PubMed Central

Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

2011-01-01

Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

Annexin V Incorporated into Influenza Virus Particles Inhibits Gamma Interferon Signaling and Promotes Viral Replication

PubMed Central

Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten

2014-01-01

ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID

β-Globin locus control region HS2 and HS3 interact structurally and functionally

PubMed Central

Jackson, David A.; McDowell, Jennifer C.; Dean, Ann

2003-01-01

The overall structure of the DNase I hypersensitive sites (HSs) that comprise the β-globin locus control region (LCR) is highly conserved among mammals, implying that the HSs have conserved functions. However, it is not well understood how the LCR HSs, either individually or collectively, activate transcription. We analyzed the interactions of HS2, HS3 and HS4 with the human ε- and β-globin genes in chromatinized episomes in fetal/embryonic K562 cells. Only HS2 activates transcription of the ε-globin gene, while all three HSs activate the β-globin gene. HS3 stimulates the β-globin gene constitutively, but HS2 and HS4 transactivation requires expression of the transcription factor EKLF, which is not present in K562 cells but is required for β-globin expression in vivo. To begin addressing how the individual HSs may interact with one another in a complex, we linked the β-globin gene to both the HS2 and HS3. HS2 and HS3 together resulted in synergistic stimulation of β-globin transcription. Unexpectedly, mutated, inactive forms of HS2 impeded the activation of the β-globin gene by HS3. Thus, there appear to be distinct interactions among the HSs and between the HSs and the globin genes. These preferential, non-exclusive interactions may underlie an important structural and functional cooperativity among the regulatory sequences of the β-globin locus in vivo. PMID:12582237

Gamma Interferon Release Assays for Detection of Mycobacterium tuberculosis Infection

PubMed Central

Denkinger, Claudia M.; Kik, Sandra V.; Rangaka, Molebogeng X.; Zwerling, Alice; Oxlade, Olivia; Metcalfe, John Z.; Cattamanchi, Adithya; Dowdy, David W.; Dheda, Keertan; Banaei, Niaz

2014-01-01

SUMMARY Identification and treatment of latent tuberculosis infection (LTBI) can substantially reduce the risk of developing active disease. However, there is no diagnostic gold standard for LTBI. Two tests are available for identification of LTBI: the tuberculin skin test (TST) and the gamma interferon (IFN-γ) release assay (IGRA). Evidence suggests that both TST and IGRA are acceptable but imperfect tests. They represent indirect markers of Mycobacterium tuberculosis exposure and indicate a cellular immune response to M. tuberculosis. Neither test can accurately differentiate between LTBI and active TB, distinguish reactivation from reinfection, or resolve the various stages within the spectrum of M. tuberculosis infection. Both TST and IGRA have reduced sensitivity in immunocompromised patients and have low predictive value for progression to active TB. To maximize the positive predictive value of existing tests, LTBI screening should be reserved for those who are at sufficiently high risk of progressing to disease. Such high-risk individuals may be identifiable by using multivariable risk prediction models that incorporate test results with risk factors and using serial testing to resolve underlying phenotypes. In the longer term, basic research is necessary to identify highly predictive biomarkers. PMID:24396134

Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

PubMed

Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

2017-07-11

In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing

Effect of treatment with interferon-gamma and concanavalin A on the course of infection of mice with Salmonella typhimurium strain LT-2

NASA Technical Reports Server (NTRS)

Gould, Cheryl L.; Sonnenfeld, Gerald

1987-01-01

The effect of pretreatment of mice with 34 units/day, for five days, of interferon-gamma (IFN-gamma) on the course of infection with LD50 of Salmonella typhimurium strain LT-2 was assessed, using two IFN preparations: (1) a hybridoma supernatant fluid containing concanavalin-A-induced IFN-gamma activity and (2) pure murine IFN-gamma produced by recombinant DNA technology. The hybridoma supernatant-treated Salmonella-infected mice were found to die faster than mice treated only with Salmonella. Pure murine IFN-gamma was found to protect infected mice significantly, with 95 percent of mice surviving LD50 infection. In contrast, the Salmonella-infected mice treated with hybridoma supernatant were found to die faster than the Salmonella-infected untreated controls. Mice treated with concanavalin A alone prior to infection with S. typhimurium died more quickly than the untreated infected controls, suggesting that contamination with concanavalin A had a detrimental effect on mice survival.

Use of interferon-gamma release assays in a health care worker screening program: experience from a tertiary care centre in the United States.

PubMed

Joshi, Manish; Monson, Thomas P; Woods, Gail L

2012-01-01

Interferon-gamma release assays including the QuantiFERON-TB Gold In-Tube test (QFT-GIT [Cellestis Ltd, Australia]) may be used in place of the tuberculin skin test (TST) in surveillance programs for Mycobacterium tuberculosis infection control. However, data on performance and practicality of the QFT-GIT in such programs for health care workers (HCWs) are limited. To assess the performance, practicality and reversion rate of the QFT-GIT among HCWs at a tertiary health care institution in the United States. Retrospective chart review of HCWs at Central Arkansas Veterans Healthcare System (Arkansas, USA) who underwent QFT-GIT testing as a part of their employee screening between November 1, 2008 and October 31, 2009. QFT-GIT was used to screen 3290 HCWs. The initial QFT-GIT was interpreted as positive for 129 (3.9%) HCWs, negative for 3155 (95.9%) and indeterminate for six (0.2%). Testing with QFT-GIT was repeated in 45 HCWs who had positive results on the initial test. The QFT-GIT reverted to negative in 18 (40.0%) HCWs, all of whom had negative TST status and initial interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL. The QFT-GIT test is feasible in large health care setting as an alternative to TST for M tuberculosis infection screening in HCWs but is not free from challenges. The major concerns are the high number of positive test results and high reversion rates on repeat testing, illustrating poor short-term reproducibility of positive QFT-GIT test results. These results suggest adopting a borderline zone between interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL, and cautious clinical interpretation of values in this range.

Zebrafish globin switching occurs in two developmental stages and is controlled by the LCR.

PubMed

Ganis, Jared J; Hsia, Nelson; Trompouki, Eirini; de Jong, Jill L O; DiBiase, Anthony; Lambert, Janelle S; Jia, Zhiying; Sabo, Peter J; Weaver, Molly; Sandstrom, Richard; Stamatoyannopoulos, John A; Zhou, Yi; Zon, Leonard I

2012-06-15

Globin gene switching is a complex, highly regulated process allowing expression of distinct globin genes at specific developmental stages. Here, for the first time, we have characterized all of the zebrafish globins based on the completed genomic sequence. Two distinct chromosomal loci, termed major (chromosome 3) and minor (chromosome 12), harbor the globin genes containing α/β pairs in a 5'-3' to 3'-5' orientation. Both these loci share synteny with the mammalian α-globin locus. Zebrafish globin expression was assayed during development and demonstrated two globin switches, similar to human development. A conserved regulatory element, the locus control region (LCR), was revealed by analyzing DNase I hypersensitive sites, H3K4 trimethylation marks and GATA1 binding sites. Surprisingly, the position of these sites with relation to the globin genes is evolutionarily conserved, despite a lack of overall sequence conservation. Motifs within the zebrafish LCR include CACCC, GATA, and NFE2 sites, suggesting functional interactions with known transcription factors but not the same LCR architecture. Functional homology to the mammalian α-LCR MCS-R2 region was confirmed by robust and specific reporter expression in erythrocytes of transgenic zebrafish. Our studies provide a comprehensive characterization of the zebrafish globin loci and clarify the regulation of globin switching. Copyright © 2012 Elsevier Inc. All rights reserved.

Use of Piezoelectric Immunosensors for Detection of Interferon-Gamma Interaction with Specific Antibodies in the Presence of Released-Active Forms of Antibodies to Interferon-Gamma

PubMed Central

Don, Elena; Farafonova, Olga; Pokhil, Suzanna; Barykina, Darya; Nikiforova, Marina; Shulga, Darya; Borshcheva, Alena; Tarasov, Sergey; Ermolaeva, Tatyana; Epstein, Oleg

2016-01-01

In preliminary ELISA studies where released-active forms (RAF) of antibodies (Abs) to interferon-gamma (IFNg) were added to the antigen-antibody system, a statistically significant difference in absorbance signals obtained in their presence in comparison to placebo was observed. A piezoelectric immunosensor assay was developed to support these data and investigate the effects of RAF Abs to IFNg on the specific interaction between Abs to IFNg and IFNg. The experimental conditions were designed and optimal electrode coating, detection circumstances and suitable chaotropic agents for electrode regeneration were selected. The developed technique was found to provide high repeatability, intermediate precision and specificity. The difference between the analytical signals of RAF Ab samples and those of the placebo was up to 50.8%, whereas the difference between non-specific controls and the placebo was within 5%–6%. Thus, the piezoelectric immunosensor as well as ELISA has the potential to be used for detecting the effects of RAF Abs to IFNg on the antigen-antibody interaction, which might be the result of RAF’s ability to modify the affinity of IFNg to specific/related Abs. PMID:26791304

Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

PubMed Central

Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina

2018-01-01

The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430

Interferon-gamma alone triggers the production of nitric oxide from serum-starved BNL CL.2, murine embryonic liver cells.

PubMed

Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T

1999-01-01

A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.

Interferon-gamma exerts its negative regulatory effect primarily on the earliest stages of murine erythroid progenitor cell development.

PubMed

Wang, C Q; Udupa, K B; Lipschitz, D A

1995-01-01

Interferon-gamma (INF-gamma) has been shown to suppress erythropoiesis and perhaps to contribute to the anemia of chronic disease. In this study we demonstrated that the concentration of INF gamma required to suppress murine burst forming unit-erythroid (BFU-E) growth was significantly less than that required to suppress colony forming unit-erythroid (CFU-E) growth. INF gamma acted at the most primitive step in erythroid progenitor cell differentiation and proliferation, as inhibition was maximal when added at the time of BFU-E culture initiation. Inhibition was progressively less if INF gamma addition was delayed after culture initiation. The effects of INF gamma on BFU-E did not require the presence of interleukin-1 alpha (IL-1 alpha), tumor necrosis factor-alpha (TNF alpha), or granulocyte macrophage colony stimulating factor (GM-CSF), as its effects were not neutralized by monoclonal antibodies against IL-1 alpha, TNF alpha, or GM-CSF. This applied whether INF gamma was added to culture with individual antibodies or with a combination of all three antibodies. INF gamma was not required for IL-1 alpha- or TNF alpha-induced suppression of BFU-E, as their effects were not neutralized by a monoclonal anti-INF gamma antibody. In contrast, GM-CSF-induced suppression of BFU-E was negated by the simultaneous addition of anti-INF gamma. We have previously shown that the addition of TNF alpha does not suppress BFU-E growth in cultures from marrow depleted of macrophages. Suppression did occur, however, if a small concentration of INF gamma that does not inhibit and increasing concentration of TNF alpha were added to culture, suggesting a synergistic effect between INF-gamma and TNF alpha. These observations suggest that INF gamma is a potent direct inhibitor of erythroid colony growth in vitro. It exerts its negative regulatory effect primarily on the earliest stages of erythroid progenitor cell differentiation and proliferation, as much higher doses are required to

Design of retrovirus vectors for transfer and expression of the human. beta. -globin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, A.D.; Bender, M.A.; Harris, E.A.S.

1988-11-01

Regulated expression of the human ..beta..-globin gene has been demonstrated in cultured murine erythroleukemia cells and in mice after retrovirus-mediated gene transfer. However, the low titer of recombinant viruses described to date results in relatively inefficient gene transfer, which limits their usefulness for animal studies and for potential gene therapy in humans for diseases involving defective ..beta..-globin genes. The authors found regions that interfered with virus production within intron 2 of the ..beta..-globin gene and on both sides of the gene. The flanking regions could be removed, but intron 2 was required for ..beta..-globin expression. Inclusion of ..beta..-globin introns necessitatesmore » an antisense orientation of the gene within the retrovirus vector. However, they found no effect of the antisense ..beta..-globin transcription on virus production. A region downstream of the ..beta..-globin gene that stimulates expression of the gene in transgenic mice was included in the viruses without detrimental effects on virus titer. Virus titers of over 10/sup 6/ CFU/ml were obtained with the final vector design, which retained the ability to direct regulated expression of human ..beta..-globin in murine erythroleukemia cells. The vector also allowed transfer and expression of the human ..beta..-globin gene in hematopoietic cells (CFU-S cells) in mice.« less

MafK/NF-E2 p18 is required for beta-globin genes activation by mediating the proximity of LCR and active beta-globin genes in MEL cell line.

PubMed

Du, Mei-Jun; Lv, Xiang; Hao, De-Long; Zhao, Guo-Wei; Wu, Xue-Song; Wu, Feng; Liu, De-Pei; Liang, Chih-Chuan

2008-01-01

Evidences indicate that locus control region (LCR) of beta-globin spatially closes to the downstream active gene promoter to mediate the transcriptional activation by looping. DNA binding proteins may play an important role in the looping formation. NF-E2 is one of the key transcription factors in beta-globin gene transcriptional activation. To shed light on whether NF-E2 is involved in this process, DS19MafKsiRNA cell pools were established by specifically knocked down the expression of MafK/NF-E2 p18, one subunit of NF-E2 heterodimer. In the above cell pools, it was observed that the occupancy efficiency of NF-E2 on beta-globin gene locus and the expression level of beta-globin genes were decreased. H3 acetylation, H3-K4 methylation and the deposition of RNA polymerase II, but not the recruitment of GATA-1, were also found reduced at the beta-globin gene cluster. Chromosome Conformation Capture (3C) assay showed that the cross-linking frequency between the main NF-E2 binding site HS2 and downstream structural genes was reduced compared to the normal cell. This result demonstrated that MafK/NF-E2 p18 recruitment was involved in the physical proximity of LCR and active beta-globin genes upon beta-globin gene transcriptional activation.

Frequency of indeterminate results from an interferon-gamma release assay among HIV-infected individuals.

PubMed

Oliveira, Sandra Maria do Valle Leone de; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria

2017-01-01

To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. Avaliar a frequência de resultados indeterminados de um interferon-gamma release assay (IGRA, ensaio de liberação de interferon-gama) e os fatores relacionados com esses resultados em pessoas vivendo com HIV/AIDS (PVHA). Foram avaliadas 81 PVHA na região Centro-Oeste do Brasil, por meio do teste tuberculínico e de um IGRA. Informações a respeito de vari

[Gamma interferon: basics aspects, clinic significance and terapeutic uses].

PubMed

Mata-Espinosa, Dulce A; Hernández-Pando, Rogelio

2008-01-01

Interferons are a family of pleiotropic cytokines, their name was assigned because of their anti-replicative viral activity. IFNgamma or immune type II interferon does not share receptors with the type I interferon, its structure is different and its gene is located in different chromosome, although its biologic effects are similar. Along of several years of research, it has been found that IFNgamma enhances the transcription of genes involved in immunomodulation, antiviral responses and antitumoral activities. Regarding to the immune system, IFNgamma increases the cytotoxic and phagocytic activity of macrophages and upregulates the expression of major histocompatibility complex (MHC) class I and class II molecules in dendritics cells and other antigen presenting cells. IFNgamma also promotes the development and differentiation of naive CD4+ T lymphocytes to Th1 helper subset. Indeed, this cytokine has a key role in the control of bacterial, micotic, viral and parasitic infections. Depending of the micro-environment, IFNgamma has a dual role as pro or anti inflammatory cytokine. Novel therapeutic strategies are currently being developed with the aim to enhance the immune response or replace IFNgamma gene abnormal expression with beneficial results in humans, being recombinant IFNgamma safe and well tolerated.

Mutations on the α2-Globin Gene That May Trigger α(+)-Thalassemia.

PubMed

Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

In the present study, a total of 11 individuals with hypochromic microcytic anemia who did not reveal the most common α-thalassemia (α-thal) deletions or mutations, were subjected to more investigations by DNA sequencing of the α-globin genes. Seven novel nondeletional α-thal mutations localized on the α2-globin gene in the heterozygous state were identified. These mutations either corrupted regulatory splice sites and consequently affected RNA processing or created unstable hemoglobin (Hb) variants. The mutations described here produced globin gene variants that lead to amino acid changes in critical regions of the globin chain. The clinical presentation of most patients was a persistent mild microcytic anemia similar to an α(+)-thal. In the last decade, numerous α-globin mutations have been observed leading to an α-thal phenotype and these studies have been considered to be important as discussed here.

Electron paramagnetic resonance of globin proteins - a successful match between spectroscopic development and protein research

NASA Astrophysics Data System (ADS)

Van Doorslaer, Sabine; Cuypers, Bert

2018-02-01

At the start of the twenty-first century, the research into the haem-containing globins got a considerable impetus with the discovery of three new mammalian globins: neuroglobin, cytoglobin and androglobin. Globins are by now found in all kingdoms of life and, in many cases, their functions are still under debate. This revival in globin research increased the demand for adequate physico-chemical research tools to determine the structure-function relationships of these proteins. From early days onwards, electron paramagnetic resonance (EPR) has been used in globin research. In recent decades, the field of EPR has been revolutionised with the introduction of many new pulsed and high-field EPR techniques. In this review, we highlight how EPR has become an essential tool in globin research, and how globins equally provide ideal model systems to push technical developments in EPR.

Comparison of Tuberculin Skin Test result and interferon gamma response to human PPD in BCG scar positive and negative children.

PubMed

Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza

2014-03-01

The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.

Butyrate Infusions in the Ovine Fetus Delay the Biologic Clock for Globin Gene Switching

NASA Astrophysics Data System (ADS)

Perrine, Susan P.; Rudolph, Abraham; Faller, Douglas V.; Roman, Christine; Cohen, Ruth A.; Chen, Shao-Jing; Kan, Yuet Wai

1988-11-01

The switch from fetal to adult hemoglobin expression is regulated in many mammalian species by a developmental clock-like mechanism and determined by the gestational age of the fetus. Prolonging fetal globin gene expression is of considerable interest for therapeutic potential in diseases caused by abnormal β -globin genes. Butyric acid, which is found in increased plasma concentrations in infants of diabetic mothers who have delayed globin gene switching, was infused into catheterized fetal lambs in utero during the time of the normal globin gene switch period. The globin gene switch was significantly delayed in three of four butyrate-treated fetuses compared with controls and was entirely prevented in one fetus in whom the infusion was begun before the globin switch was under way. These data provide a model for investigating and arresting the biologic clock of hemoglobin switching.

Removing peroxide impurities from ether improves the quality of globin chains for biosynthetic studies.

PubMed

Mirzazadeh, Roghieh; Khatami, Shohreh; Bayat, Parastoo; Zamani, Zahra; Sadeghi, Sedigheh; Roohi, Soghra; Saidi, Parinaz

2005-01-01

The diagnosis of the different forms of thalassemia is one of the important applications of analysis of globin chains. These analyses are done by high performance liquid chromatography (HPLC) using a MONO-S cation exchange column and ether is used for washing the globin powder in the final step. The presence of peroxide impurities in ether could change the structure of the globin chains. In the chromatograms, these modified globins appear as separated peaks next to the unmodified globin peaks. In these cases, the alpha/beta ratio exceed by artifact the correct value. Our study demonstrates that diagnostic centers should ensure that the ether they use is pure.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Interferon-gamma inhibits intestinal restitution by preventing gap junction communication between enterocytes.

PubMed

Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J

2007-06-01

Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.

Histone- and protamine-DNA association: conservation of different patterns within the beta-globin domain in human sperm.

PubMed

Gardiner-Garden, M; Ballesteros, M; Gordon, M; Tam, P P

1998-06-01

Most DNA in human sperm is bound to highly basic proteins called protamines, but a small proportion is complexed with histones similar to those found in active chromatin. This raises the intriguing possibility that histones in sperm are marking sets of genes that will be preferentially activated during early development. We have examined the chromatin structure of members of the beta-globin gene family, which are expressed at different times in development, and the protamine 2 gene, which is expressed in spermatids prior to the widespread displacement of histones by transition proteins. The genes coding for epsilon and gamma globin, which are active in the embryonic yolk sac, contain regions which are histone associated in the sperm. No histone-associated regions are present at the sites tested within the beta- and delta-globin genes which are silent in the embryonic yolk sac. The trends of histone or protamine association are consistent for samples from the same person, and no significant between-subject variations in these trends are found for 13 of the 15 fragments analyzed in the two donors. The results suggest that sperm chromatin structures are generally similar in different men but that the length of the histone-associated regions can vary. The association of sperm DNA with histones or protamines sometimes changes within as little as 400 bp of DNA, suggesting that there is fine control over the retention of histones.

Complementation of a mutant cell line: central role of the 91 kDa polypeptide of ISGF3 in the interferon-alpha and -gamma signal transduction pathways.

PubMed Central

Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M

1993-01-01

Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454

Specific repression of β-globin promoter activity by nuclear ferritin

PubMed Central

Broyles, Robert H.; Belegu, Visar; DeWitt, Christina R.; Shah, Sandeep N.; Stewart, Charles A.; Pye, Quentin N.; Floyd, Robert A.

2001-01-01

Developmental hemoglobin switching involves sequential globin gene activations and repressions that are incompletely understood. Earlier observations, described herein, led us to hypothesize that nuclear ferritin is a repressor of the adult β-globin gene in embryonic erythroid cells. Our data show that a ferritin-family protein in K562 cell nuclear extracts binds specifically to a highly conserved CAGTGC motif in the β-globin promoter at −153 to −148 bp from the cap site, and mutation of the CAGTGC motif reduces binding 20-fold in competition gel-shift assays. Purified human ferritin that is enriched in ferritin-H chains also binds the CAGTGC promoter segment. Expression clones of ferritin-H markedly repress β-globin promoter-driven reporter gene expression in cotransfected CV-1 cells in which the β-promoter has been stimulated with the transcription activator erythroid Krüppel-like factor (EKLF). We have constructed chloramphenicol acetyltransferase reporter plasmids containing either a wild-type or mutant β-globin promoter for the −150 CAGTGC motif and have compared the constructs for susceptibility to repression by ferritin-H in cotransfection assays. We find that stimulation by cotransfected EKLF is retained with the mutant promoter, whereas repression by ferritin-H is lost. Thus, mutation of the −150 CAGTGC motif not only markedly reduces in vitro binding of nuclear ferritin but also abrogates the ability of expressed ferritin-H to repress this promoter in our cell transfection assay, providing a strong link between DNA binding and function, and strong support for our proposal that nuclear ferritin-H is a repressor of the human β-globin gene. Such a repressor could be helpful in treating sickle cell and other genetic diseases. PMID:11481480

[Allergic asthma and interleukins 2, 4, 5, 6 and 12 and gamma interferon levels].

PubMed

Bastida Segura, Diana Lyzbeth; López Velásquez, Benjamin; Castrejón Vázquez, María Isabel; Galicia Tapía, Jorge; Cano Altamirano, Silvia; Miranda Feria, Alfonso Javier

2004-01-01

Asthma is an inflammatory chronic illness, in which mastocyt cells, basophils, T lymphocytes, eosinophils and cytokines play a role. Its association with the production of TH2 cytokines is not well known, but it is considered an aberrant immune response, yielding the activation and recruitment of a number of effector cells (mastocyts/eosinophils) and the appearance of clinical symptoms. To determine the serum values of the interleukins 2, 4, 5, 6 and 12 and gamma interferon in relation to the severity degree of asthma and the time of immunotherapy in patients with stable chronic allergic bronchial asthma. Clinical records of allergic asthmatic patients from the external consultation at Servicio de Alergia e Immunología Clínica were reviewed in a period of 12 months (1st January 2002 to 1st January 2003) and those of healthy volunteers, forming three groups: Group 1, allergic asthmatics with immunotherapy less than 24 months; Group 2, allergic asthmatics with more than 24 months of immunotherapy, and Group 3, healthy volunteers (control group). Previous informed consent, a serum sample was taken of all subjects. Ninety-two subjects were included: 41 (45%) allergic asthmatics and 51 (55%) healthy volunteers. Significant differences were found in interleukins 2, 4, 5, 6 and 12 levels between healthy volunteers and asthmatics without relating the immunotherapy time. In the total group gamma interferon levels were not found. A relation of interleukins Th2 levels with the severity degree of asthma was not found. Differences of serum interleukins Th1 and Th2 in allergic patients related to immunotherapy time were not significant; even though, irrespective of immunotherapy time, IgG levels were always high. Patients with allergic asthma have a predominance of serum interleukins Th2 and, despite of the immunotherapy, in the maintaining phase, these continue high, which may be due to an immune system dysregulation maybe including other factors. Immunotherapy continues

The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.

PubMed

Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel

2012-01-01

Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.

Effect of interferon-gamma on complement gene expression in different cell types.

PubMed

Lappin, D F; Guc, D; Hill, A; McShane, T; Whaley, K

1992-01-15

We have studied the expression of the complement components C2, C3, factor B, C1 inhibitor (C1-inh), C4-binding protein (C4-bp) and factor H in human peripheral blood monocytes, skin fibroblasts, umbilical vein endothelial cells (HUVEC) and the human hepatoma cell line G2 (Hep G2) in the absence and the presence of interferon-gamma (IFN-gamma). E.l.i.s.a. performed on culture fluids, run-on transcription assays, Northern blot and double-dilution dot-blot techniques confirmed that monocytes expressed all six components, whereas fibroblasts, HUVEC and HepG2 each expressed five of the six components. Fibroblasts and HUVEC did not synthesize C4-bp, and Hep G2 did not produce factor H. In addition to these differences, the synthesis rates of C3, C1-inh and factor H were not the same in all cell types. However, the synthesis rates of C2 and factor B were similar in all four cell types. The half-lives of the mRNAs were shorter in monocytes than in other cell types. Monocyte factor H mRNA had a half-life of 12 min in monocytes, compared with over 3 h in fibroblasts and HUVEC. The instability of factor H mRNA in monocytes may contribute to their low factor H secretion rate. IFN-gamma produced dose-dependent stimulation of C2, factor B, C1-inh, C4-bp and factor H synthesis by all cell types expressing these proteins, but decreased C3 synthesis in all four cell types. Cell-specific differences in the response to IFN-gamma were observed. The increased rates of transcription of the C1-inh and factor H genes in HUVEC were greater than in other cell types, while the increased rate of transcription of the C2, factor B and C1-inh genes in Hep G2 cells was less than in other cell types. IFN-gamma did not affect the stability of C3, factor H or C4 bp mRNAs, but increased the stability of factor B and C1-inh mRNAs and decreased the stability of C2 mRNA. Although these changes occurred in all four cell types studied, the half-life of C1-inh mRNA in monocytes was increased almost 4-fold

β-globin gene cluster haplotypes in ethnic minority populations of southwest China

PubMed Central

Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing

2017-01-01

The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625

Association of monoclonal expansion of Epstein-Barr virus-negative CD158a+ NK cells secreting large amounts of gamma interferon with hemophagocytic lymphohistiocytosis.

PubMed

López-Alvarez, María R; Martínez-Sánchez, María V; Salgado-Cecilia, María G; Campillo, José A; Heine-Suñer, Damian; Villar-Permuy, Florentina; Fuster, José L; Bas, Agueda; Gil-Herrera, Juana; Muro, Manuel; García-Alonso, Ana M; Alvarez-López, María R; Minguela, Alfredo

2009-01-01

We report the first case of hemophagocytic lymphohistiocytosis (HLH) induced by the monoclonal expansion of Epstein-Barr virus (EBV)-negative NK cells. Consanguinity of the patient's parents made it necessary to discard familial HLH in the patient and her sister with identical HLA markers and demonstrate that no cause other than the expansion of NK cells, which secrete high levels of gamma interferon, was inducing HLH in this patient.

Frequency of indeterminate results from an interferon-gamma release assay among HIV-infected individuals

PubMed Central

de Oliveira, Sandra Maria do Valle Leone; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria

2017-01-01

ABSTRACT Objective: To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). Methods: We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Results: Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. Conclusions: The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. PMID:28746533

Interferon-gamma interferes with transforming growth factor-beta signaling through direct interaction of YB-1 with Smad3.

PubMed

Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao

2003-10-31

Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF

Sphingosine kinase inhibitor suppresses IL-18-induced interferon-gamma production through inhibition of p38 MAPK activation in human NK cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung

2008-09-12

Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less

The phylogenetic and evolutionary history of a novel alpha-globin-type gene in orangutans (Pongo pygmaeus).

PubMed

Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

2006-07-01

The alpha-globin genes are implicated in human resistance to malaria, a disease caused by Plasmodium parasites. This study is the first to analyze DNA sequences from a novel alpha-globin-type gene in orangutans, a species affected by Plasmodium. Phylogenetic methods show that the gene is a duplication of an alpha-globin gene and is located 5' of alpha-2 globin. The alpha-globin-type gene is notable for having four amino acid replacements relative to the orangutan's alpha-1 and alpha-2 globin genes, with no synonymous differences. Pairwise K(a)/K(s) methods and likelihood ratio tests (LRTs) revealed that the evolutionary history of the alpha-globin-type gene has been marked by either neutral or positive evolution, but not purifying selection. A comparative analysis of the amino acid replacements of the alpha-globin-type gene with human hemoglobinopathies and hemoglobin structure showed that two of the four replaced sites are members of the same molecular bond, one that is crucial to the proper functioning of the hemoglobin molecule. This suggested an adaptive evolutionary change. Functionally, this locus may result in a thalassemia-like phenotype in orangutans, possibly as an adaptation to combat Plasmodium.

Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

NASA Astrophysics Data System (ADS)

Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

1996-11-01

In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.

PubMed

Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P

2009-12-01

Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.

β-Globin chain abnormalities with coexisting α-thalassemia mutations

PubMed Central

Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan

2012-01-01

Introduction The frequency of hemoglobinopathies is still high in Adana, the biggest city of the Cukurova Region that is located in the southern part of Turkey. Our aim was to identify the concomitant mutations in α- and β-globin genes which lead to complex hemoglobinopathies and to establish an appropriate plan of action for each subject, particularly when prenatal diagnosis is necessary. Material and methods We studied the association between the β-globin gene and α-thalassemia genotypes. The reverse hybridization technique was employed to perform molecular analysis, and the results were confirmed by amplification refractory mutation system (ARMS) or restriction fragment length polymorphism (RFLP) technique. Results We evaluated 36 adult subjects (28 female and 8 male; age range: 18-52 years) with concomitant mutations in their α- and β-globin genes. The –α3.7/αα deletion was the commonest defect in the α-chain as expected, followed by α3.7/–α3.7 deletion. Twenty-five of 36 cases were sickle cell trait with coexisting α-thalassemia, while seven Hb S/S patients had concurrent mutations in their α-genes. The coexistence of αPolyA-2α/αα with Hb A/D and with Hb S/D, which is very uncommon, was also detected. There was a subject with compound heterozygosity for β-globin chain (–α3.7/αα with IVSI.110/S), and also a case who had –α3.7/αα deletion with IVSI.110/A. Conclusions Although limited, our data suggest that it would be valuable to study coexisting α-globin mutations in subjects with sickle cell disease or β-thalassemia trait during the screening programs for premarital couples, especially in populations with a high frequency of hemoglobinopathies. PMID:23056075

Interferon-gamma: biologic functions and HCV therapy (type I/II) (1 of 2 parts).

PubMed

Gattoni, A; Parlato, A; Vangieri, B; Bresciani, M; Derna, R

2006-01-01

This review is aimed at exhaustively presenting and discussing the interferon-gamma (IFN-gamma), a cytokine that plays an important role in inducing and modulating an array of immune responses. A review of the most significant and recent clinical trials was performed. Although IFN-gamma has some antiviral activity, it is much less active in this regard than type I IFNs. IFN-gamma is involved in the regulation of nearly all phases of the immune and inflammatory responses, including the activation and differentiation of T cells, B cells, NK cells, macrophages, and others. It is therefore best regarded as a distint immunoregulatory cytokine. IFN-gamma secretion is a hallmark of Th1 lymphocytes. It is also secreted by nearly all CD8 T cells, by some Th0 cells, and by NK cells. Each of these cell types secretes IFN-gamma only when activated, usually as part of immune response and especially in response to IL-2 and IL-12. IFN-gamma production is inhibited by IL-4, IL-10, TGFbeta, glucocorticoids, cyclosporin A and FK506. Nearly all cell types express the heterodimeric receptor for IFN-beta and respond to this cytokine by increasing the surface expression of class I MHC proteins. As a result, virtually any cell in the vicinity of an IFN-beta-secreting cell becomes more efficient at presenting endogenous antigens and hence a better target for cytotoxic killing if it harbors an intracellular pathogen. Unlike the type I IFNs, IFN-gamma also increases the expression of class II MHC proteins on professional APCs, and so promotes antigen presentation to helper T cells as well. It also induces de novo expression of class II MHC proteins on venular endothelial cells and on some other epithelial and connective tissue cells that do not otherwise express them, thus enabling these cell types to function as temporary APCs at sites of intense immune reactions. The effector functions of NK cells are to lyse virus-infected cells and to secrete IFN-gamma, which activates macrofages to

Correction of Murine Sickle Cell Disease Using γ-Globin Lentiviral Vectors to Mediate High-level Expression of Fetal Hemoglobin

PubMed Central

Pestina, Tamara I; Hargrove, Phillip W; Jay, Dennis; Gray, John T; Boyd, Kelli M; Persons, Derek A

2008-01-01

Increased levels of red cell fetal hemogloblin, whether due to hereditary persistence of expression or from induction with hydroxyurea therapy, effectively ameliorate sickle cell disease (SCD). Therefore, we developed erythroid-specific, γ-globin lentiviral vectors for hematopoietic stem cell (HSC)-targeted gene therapy with the goal of permanently increasing fetal hemoglobin (HbF) production in sickle red cells. We evaluated two different γ-globin lentiviral vectors for therapeutic efficacy in the BERK sickle cell mouse model. The first vector, V5, contained the γ-globin gene driven by 3.1 kb of β-globin regulatory sequences and a 130-bp β-globin promoter. The second vector, V5m3, was identical except that the γ-globin 3′-untranslated region (3′-UTR) was replaced with the β-globin 3′-UTR. Adult erythroid cells have β-globin mRNA 3′-UTR-binding proteins that enhance β-globin mRNA stability and we postulated this design might enhance γ-globin expression. Stem cell gene transfer was efficient and nearly all red cells in transplanted mice expressed human γ-globin. Both vectors demonstrated efficacy in disease correction, with the V5m3 vector producing a higher level of γ-globin mRNA which was associated with high-level correction of anemia and secondary organ pathology. These data support the rationale for a gene therapy approach to SCD by permanently enhancing HbF using a γ-globin lentiviral vector. PMID:19050697

VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

1994-09-01

The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception ofmore » closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.« less

Amoebozoa Possess Lineage-Specific Globin Gene Repertoires Gained by Individual Horizontal Gene Transfers

PubMed Central

Dröge, Jasmin; Buczek, Dorota; Suzuki, Yutaka; Makałowski, Wojciech

2014-01-01

The Amoebozoa represent a clade of unicellular amoeboid organisms that display a wide variety of lifestyles, including free-living and parasitic species. For example, the social amoeba Dictyostelium discoideum has the ability to aggregate into a multicellular fruiting body upon starvation, while the pathogenic amoeba Entamoeba histolytica is a parasite of humans. Globins are small heme proteins that are present in almost all extant organisms. Although several genomes of amoebozoan species have been sequenced, little is known about the phyletic distribution of globin genes within this phylum. Only two flavohemoglobins (FHbs) of D. discoideum have been reported and characterized previously while the genomes of Entamoeba species are apparently devoid of globin genes. We investigated eleven amoebozoan species for the presence of globin genes by genomic and phylogenetic in silico analyses. Additional FHb genes were identified in the genomes of four social amoebas and the true slime mold Physarum polycephalum. Moreover, a single-domain globin (SDFgb) of Hartmannella vermiformis, as well as two truncated hemoglobins (trHbs) of Acanthamoeba castellanii were identified. Phylogenetic evidence suggests that these globin genes were independently acquired via horizontal gene transfer from some ancestral bacteria. Furthermore, the phylogenetic tree of amoebozoan FHbs indicates that they do not share a common ancestry and that a transfer of FHbs from bacteria to amoeba occurred multiple times. PMID:25013378

Analyzing 5'HS3 and 5'HS4 LCR core regions and NF-E2 in Iranian thalassemia intermedia patients with normal or carrier status for beta-globin mutations.

PubMed

Neishabury, Maryam; Azarkeivan, Azita; Oberkanins, Christian; Abedini, Seyedeh Sedigheh; Zamani, Shahbaz; Najmabadi, Hossein

2011-03-15

Our data on 114 Iranian individuals with thalassemia intermedia phenotype revealed homozygous or compound heterozygous beta-globin mutations to be the predominant disease factor in 86.2% of cases. However, 8.2% of these individuals were found to be heterozygous or wild type for beta-globin mutations. In search for determinants outside of the beta-globin gene, which could be responsible for the unexpected thalassemia intermedia phenotype in these subjects, we screened the alpha-globin genes, the 5'HS3 and 5'HS4 regions of the beta-globin LCR, and the NF-E2 transcription factor for sequence variations in selected individuals. The -3.7 deletion was the only alpha-globin mutation detected, and no alterations were found in 5'HS3 and NF-E2. Sequence analysis of the 5'HS4 LCR core region identified three known SNPs in a single patient, who required irregular blood transfusions. The A/G polymorphism in the 5'HS4 palindromic region was also observed to be variable. Family studies were carried out on a female G/G homozygous patient, who received irregular blood transfusions. Her father, who had the same heterozygous IVSII-1 beta-globin mutation but the A/G genotype at the 5'HS4 palindromic site, presented with mild anemia and no requirement for blood transfusions. This suggests an impact of SNPs in the 5'HS4 LCR core region on the thalassemia phenotype and offers an interesting subject for further investigations in the Iranian population. Copyright © 2010 Elsevier Inc. All rights reserved.

Characterization of the transcriptome profiles related to globin gene switching during in vitro erythroid maturation

PubMed Central

2012-01-01

Background The fetal and adult globin genes in the human β-globin cluster on chromosome 11 are sequentially expressed to achieve normal hemoglobin switching during human development. The pharmacological induction of fetal γ-globin (HBG) to replace abnormal adult sickle βS-globin is a successful strategy to treat sickle cell disease; however the molecular mechanism of γ-gene silencing after birth is not fully understood. Therefore, we performed global gene expression profiling using primary erythroid progenitors grown from human peripheral blood mononuclear cells to characterize gene expression patterns during the γ-globin to β-globin (γ/β) switch observed throughout in vitro erythroid differentiation. Results We confirmed erythroid maturation in our culture system using cell morphologic features defined by Giemsa staining and the γ/β-globin switch by reverse transcription-quantitative PCR (RT-qPCR) analysis. We observed maximal γ-globin expression at day 7 with a switch to a predominance of β-globin expression by day 28 and the γ/β-globin switch occurred around day 21. Expression patterns for transcription factors including GATA1, GATA2, KLF1 and NFE2 confirmed our system produced the expected pattern of expression based on the known function of these factors in globin gene regulation. Subsequent gene expression profiling was performed with RNA isolated from progenitors harvested at day 7, 14, 21, and 28 in culture. Three major gene profiles were generated by Principal Component Analysis (PCA). For profile-1 genes, where expression decreased from day 7 to day 28, we identified 2,102 genes down-regulated > 1.5-fold. Ingenuity pathway analysis (IPA) for profile-1 genes demonstrated involvement of the Cdc42, phospholipase C, NF-Kβ, Interleukin-4, and p38 mitogen activated protein kinase (MAPK) signaling pathways. Transcription factors known to be involved in γ-and β-globin regulation were identified. The same approach was used to generate profile-2

High-Density SNP Genotyping to Define β-Globin Locus Haplotypes

PubMed Central

Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.

2014-01-01

Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352

Detection of bacterial pyrogens on the basis of their effects on gamma interferon-mediated formation of neopterin or nitrite in cultured monocyte cell lines.

PubMed Central

Werner-Felmayer, G; Baier-Bitterlich, G; Fuchs, D; Hausen, A; Murr, C; Reibnegger, G; Werner, E R; Wachter, H

1995-01-01

In a number of mammalian cell types, pteridine biosynthesis from guanosine 5'-triphosphate and formation of nitric oxide from L-arginine are induced by gamma interferon (IFN-gamma) and bacterial lipopolysaccharide (LPS). We assessed the possibility of using such metabolic alterations for the in vitro detection of pyrogens. Products from gram-negative and gram-positive bacteria and related synthetic compounds were tested for their potential to induce either of these pathways. Stimulation of pteridine biosynthesis was monitored as the formation of neopterin in the human myelomonocytic cell line THP-1. The formation of nitric oxide was determined as nitrite in murine J774A.1 macrophage cultures. The substances tested included toxic and detoxified parts of LPS and lipid A from Escherichia coli, Salmonella typhimurium, Salmonella minnesota, and Klebsiella pneumoniae as well as lipoteichoic acid and toxic shock syndrome toxin 1 from Staphylococcus aureus. Furthermore, two cell wall compounds from Mycobacterium tuberculosis, trehalose 6,6'-dimycolate and N-acetylmuramyl-L-alanyl-D-isoglutamine, which are active components of Freund's adjuvant, were used. When applied as a single stimulus, only the whole LPS molecule potently stimulated neopterin or nitrite formation. Lipid A and products from gram-positive bacteria were weakly active. For neopterin formation, lipid A required the presence of fetal calf serum. Besides detoxified LPS and independently from the presence of serum, all bacterial compounds tested strongly increased the effects mediated by IFN-gamma. Our results show that bacterial pyrogens can be detected by monitoring the formation of neopterin or nitrite. This may provide a basis for the development of an in vitro assay for the detection of pyrogenic contamination with the aim of replacing the currently used animal test. PMID:7664177

Effects of tumor necrosis factor-alpha and interferon-gamma on expressions of matrix metalloproteinase-2 and -9 in human bladder cancer cells.

PubMed

Shin, K Y; Moon, H S; Park, H Y; Lee, T Y; Woo, Y N; Kim, H J; Lee, S J; Kong, G

2000-10-31

We have investigated the effects of tumor necrosis factor-alpha (TNF-alpha) and interferon (INF-gamma), the potent Bacillus Calmette-Guerin (BCG)-induced cytokines on the production of MMP-2, MMP-9, TIMP-1, TIMP-2 and MT1-MMP in high grade human bladder cancer cell lines, T-24, J-82 and HT-1376 cell lines. MMP-2 expression and activity were decreased in T-24 cells treated with both cytokines in a dose dependent manner. However, J-82 cells treated with TNF-alpha and INF-gamma revealed dose dependent increases of MMP-9 expression and activity with similar baseline expression and activity of MMP-2. HT-1376 cells after exposure to TNF-alpha only enhanced the expression and activity of MMP-9. These results indicate that TNF-alpha and INF-gamma could regulate the production of MMP-2 or MMP-9 on bladder cancer cells and their patterns of regulation are cell specific. Furthermore, this diverse response of bladder cancer cells to TNF-alpha and INF-gamma suggests that BCG immunotherapy may enhance the invasiveness of bladder cancer in certain conditions with induction of MMPs.

Aging is Associated with Impaired Renal Function, INF-gamma Induced Inflammation and with Alterations in Iron Regulatory Proteins Gene Expression.

PubMed

Costa, Elísio; Fernandes, João; Ribeiro, Sandra; Sereno, José; Garrido, Patrícia; Rocha-Pereira, Petronila; Coimbra, Susana; Catarino, Cristina; Belo, Luís; Bronze-da-Rocha, Elsa; Vala, Helena; Alves, Rui; Reis, Flávio; Santos-Silva, Alice

2014-12-01

Our aim was to contribute to a better understanding of the pathophysiology of anemia in elderly, by studying how aging affects renal function, iron metabolism, erythropoiesis and the inflammatory response, using an experimental animal model. The study was performed in male Wistar, a group of young rats with 2 months age and an old one with 18 months age. Old rats presented a significant higher urea, creatinine, interferon (INF)-gamma, ferritin and soluble transferrin receptor serum levels, as well as increased counts of reticulocytes and RDW. In addition, these rats showed significant lower erythropoietin (EPO) and iron serum levels. Concerning gene expression of iron regulatory proteins, old rats presented significantly higher mRNA levels of hepcidin (Hamp), transferrin (TF), transferrin receptor 2 (TfR2) and hemojuvelin (HJV); divalent metal transporter 1 (DMT1) mRNA levels were significantly higher in duodenal tissue; EPO gene expression was significantly higher in liver and lower in kidney, and the expression of the EPOR was significantly higher in both liver and kidney. Our results showed that aging is associated with impaired renal function, which could be in turn related with the inflammatory process and with a decline in EPO renal production. Moreover, we also propose that aging may be associated with INF-gamma-induced inflammation and with alterations upon iron regulatory proteins gene expression.

Immunomodulatory intervention with Gamma interferon in mice with sepsis.

PubMed

Wang, Yu; Kong, Bing-Bing; Yang, Wen-Ping; Zhao, Xin; Zhang, Rong

2017-09-15

Sepsis-triggered immune paralysis including T-cell dysfunction increase susceptibility to infection. Gamma interferon (IFNg) exert beneficial effects in patients with sepsis. Herein, we speculated that IFNg may attenuate T-cell dysfunction induced by sepsis, although the mechanisms remain elusive. To test this hypothesis, we used a model based on cecal ligation and puncture (CLP) to induce sepsis in mice. Male C57BL/6 mice were pretreated with recombinant human IFNg (0.01μg/g of body weight) before CLP. The immunophenotyping of cell surface receptor expression, and regulatory T cells (CD4+CD25+Foxp3+) were quantified by flow cytometry. Immunohistochemical staining was performed to evaluate the loss of immune effector cells. Formation of IFNg and interleukin 4 (IL-4) in the spleen and plasma levels of TNF-α, IL-6, high-mobility group box 1 (HMGB1) were determined using enzyme-linked immunosorbent assay. IFNg markedly inhibited the reduction in cytokine secretion from lipopolysaccharide (LPS)-stimulated splenocytes. IFNg-treated mices had significantly decreased percentages of programmed cell death 1 (PD-1) receptors, increased the percentages of positive costimulatory receptor CD28 on CD4 T cells expressing. IFNg markedly reduced T-cell apoptosis through upregulating the expression of Bcl-2. CLP-induced formation of regulatory T cells in the spleen was abolished in IFNg -treated mices. Moreover, IFNg treatment reduced plasma levels of TNF-α, IL-6, HMGB1. IFNg can be a powerful regulator of immune function under sepsis conditions. Therefore, targeted immune-enhancement with IFNg may be a valid therapeutic approach in sepsis. Copyright © 2017 Elsevier Inc. All rights reserved.

Editing an α-globin enhancer in primary human hematopoietic stem cells as a treatment for β-thalassemia.

PubMed

Mettananda, Sachith; Fisher, Chris A; Hay, Deborah; Badat, Mohsin; Quek, Lynn; Clark, Kevin; Hublitz, Philip; Downes, Damien; Kerry, Jon; Gosden, Matthew; Telenius, Jelena; Sloane-Stanley, Jackie A; Faustino, Paula; Coelho, Andreia; Doondeea, Jessica; Usukhbayar, Batchimeg; Sopp, Paul; Sharpe, Jacqueline A; Hughes, Jim R; Vyas, Paresh; Gibbons, Richard J; Higgs, Douglas R

2017-09-04

β-Thalassemia is one of the most common inherited anemias, with no effective cure for most patients. The pathophysiology reflects an imbalance between α- and β-globin chains with an excess of free α-globin chains causing ineffective erythropoiesis and hemolysis. When α-thalassemia is co-inherited with β-thalassemia, excess free α-globin chains are reduced significantly ameliorating the clinical severity. Here we demonstrate the use of CRISPR/Cas9 genome editing of primary human hematopoietic stem/progenitor (CD34+) cells to emulate a natural mutation, which deletes the MCS-R2 α-globin enhancer and causes α-thalassemia. When edited CD34+ cells are differentiated into erythroid cells, we observe the expected reduction in α-globin expression and a correction of the pathologic globin chain imbalance in cells from patients with β-thalassemia. Xenograft assays show that a proportion of the edited CD34+ cells are long-term repopulating hematopoietic stem cells, demonstrating the potential of this approach for translation into a therapy for β-thalassemia.β-thalassemia is characterised by the presence of an excess of α-globin chains, which contribute to erythrocyte pathology. Here the authors use CRISP/Cas9 to reduce α-globin expression in hematopoietic precursors, and show effectiveness in xenograft assays in mice.

Inhibition of G9a methyltransferase stimulates fetal hemoglobin production by facilitating LCR/γ-globin looping.

PubMed

Krivega, Ivan; Byrnes, Colleen; de Vasconcellos, Jaira F; Lee, Y Terry; Kaushal, Megha; Dean, Ann; Miller, Jeffery L

2015-07-30

Induction of fetal hemoglobin (HbF) production in adult erythrocytes can reduce the severity of sickle cell disease and β-thalassemia. Transcription of β-globin genes is regulated by the distant locus control region (LCR), which is brought into direct gene contact by the LDB1/GATA-1/TAL1/LMO2-containing complex. Inhibition of G9a H3K9 methyltransferase by the chemical compound UNC0638 activates fetal and represses adult β-globin gene expression in adult human hematopoietic precursor cells, but the underlying mechanisms are unclear. Here we studied UNC0638 effects on β-globin gene expression using ex vivo differentiation of CD34(+) erythroid progenitor cells from peripheral blood of healthy adult donors. UNC0638 inhibition of G9a caused dosed accumulation of HbF up to 30% of total hemoglobin in differentiated cells. Elevation of HbF was associated with significant activation of fetal γ-globin and repression of adult β-globin transcription. Changes in gene expression were associated with widespread loss of H3K9me2 in the locus and gain of LDB1 complex occupancy at the γ-globin promoters as well as de novo formation of LCR/γ-globin contacts. Our findings demonstrate that G9a establishes epigenetic conditions preventing activation of γ-globin genes during differentiation of adult erythroid progenitor cells. In this view, manipulation of G9a represents a promising epigenetic approach for treatment of β-hemoglobinopathies.

Structural polymorphism at LCR and its role in beta-globin gene regulation.

PubMed

Kukreti, Shrikant; Kaur, Harpreet; Kaushik, Mahima; Bansal, Aparna; Saxena, Sarika; Kaushik, Shikha; Kukreti, Ritushree

2010-09-01

Information on the secondary structures and conformational manifestations of eukaryotic DNA and their biological significance with reference to gene regulation and expression is limited. The human beta-globin gene Locus Control Region (LCR), a dominant regulator of globin gene expression, is a contiguous piece of DNA with five tissue-specific DNase I-hypersensitive sites (HSs). Since these HSs have a high density of transcription factor binding sites, structural interdependencies between HSs and different promoters may directly or indirectly regulate LCR functions. Mutations and SNPs may stabilize or destabilize the local secondary structures, affecting the gene expression by changes in the protein-DNA recognition patterns. Various palindromic or quasi-palindromic segments within LCR, could cause structural polymorphism and geometrical switching of DNA. This emphasizes the importance of understanding of the sequence-dependent variations of the DNA structure. Such structural motifs might act as regulatory elements. The local conformational variability of a DNA segment or action of a DNA specific protein is key to create and maintain active chromatin domains and affect transcription of various tissue specific beta-globin genes. We, summarize here the current status of beta-globin LCR structure and function. Further structural studies at molecular level and functional genomics might solve the regulatory puzzles that control the beta-globin gene locus. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

STING-Dependent Interferon-λ1 Induction in HT29 Cells, a Human Colorectal Cancer Cell Line, After Gamma-Radiation.

PubMed

Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J

2018-05-01

To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.

JC virus induces altered patterns of cellular gene expression: Interferon-inducible genes as major transcriptional targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Verma, Saguna; Ziegler, Katja; Ananthula, Praveen

2006-02-20

Human polyomavirus JC (JCV) infects 80% of the population worldwide. Primary infection, typically occurring during childhood, is asymptomatic in immunocompetent individuals and results in lifelong latency and persistent infection. However, among the severely immunocompromised, JCV may cause a fatal demyelinating disease, progressive multifocal leukoencephalopathy (PML). Virus-host interactions influencing persistence and pathogenicity are not well understood, although significant regulation of JCV activity is thought to occur at the level of transcription. Regulation of the JCV early and late promoters during the lytic cycle is a complex event that requires participation of both viral and cellular factors. We have used cDNA microarraymore » technology to analyze global alterations in gene expression in JCV-permissive primary human fetal glial cells (PHFG). Expression of more than 400 cellular genes was altered, including many that influence cell proliferation, cell communication and interferon (IFN)-mediated host defense responses. Genes in the latter category included signal transducer and activator of transcription 1 (STAT1), interferon stimulating gene 56 (ISG56), myxovirus resistance 1 (MxA), 2'5'-oligoadenylate synthetase (OAS), and cig5. The expression of these genes was further confirmed in JCV-infected PHFG cells and the human glioblastoma cell line U87MG to ensure the specificity of JCV in inducing this strong antiviral response. Results obtained by real-time RT-PCR and Western blot analyses supported the microarray data and provide temporal information related to virus-induced changes in the IFN response pathway. Our data indicate that the induction of an antiviral response may be one of the cellular factors regulating/controlling JCV replication in immunocompetent hosts and therefore constraining the development of PML.« less

Open and Lys–His Hexacoordinated Closed Structures of a Globin with Swapped Proximal and Distal Sites

PubMed Central

Teh, Aik-Hong; Saito, Jennifer A.; Najimudin, Nazalan; Alam, Maqsudul

2015-01-01

Globins are haem-binding proteins with a conserved fold made up of α-helices and can possess diverse properties. A putative globin-coupled sensor from Methylacidiphilum infernorum, HGbRL, contains an N-terminal globin domain whose open and closed structures reveal an untypical dimeric architecture. Helices E and F fuse into an elongated helix, resulting in a novel site-swapped globin fold made up of helices A–E, hence the distal site, from one subunit and helices F–H, the proximal site, from another. The open structure possesses a large cavity binding an imidazole molecule, while the closed structure forms a unique Lys–His hexacoordinated species, with the first turn of helix E unravelling to allow Lys52(E10) to bind to the haem. Ligand binding induces reorganization of loop CE, which is stabilized in the closed form, and helix E, triggering a large conformational movement in the open form. These provide a mechanical insight into how a signal may be relayed between the globin domain and the C-terminal domain of HGbRL, a Roadblock/LC7 domain. Comparison with HGbI, a closely related globin, further underlines the high degree of structural versatility that the globin fold is capable of, enabling it to perform a diversity of functions. PMID:26094577

Replication of the Chicken β-Globin Locus: Early-Firing Origins at the 5′ HS4 Insulator and the ρ- and βA-Globin Genes Show Opposite Epigenetic Modifications

PubMed Central

Prioleau, Marie-Noëlle; Gendron, Marie-Claude; Hyrien, Olivier

2003-01-01

Chromatin structure is believed to exert a strong effect on replication origin function. We have studied the replication of the chicken β-globin locus, whose chromatin structure has been extensively characterized. This locus is delimited by hypersensitive sites (HSs) that mark the position of insulator elements. A stretch of condensed chromatin and another HS separate the β-globin domain from an adjacent folate receptor (FR) gene. We demonstrate here that in erythroid cells that express the FR but not the globin genes, replication initiates at four sites within the β-globin domain, one at the 5′ HS4 insulator and the other three near the ρ- and βA-globin genes. Three origins consist of G+C-rich sequences enriched in CpG dinucleotides. The fourth origin is A+T rich. Together with previous work, these data reveal that the insulator origin has unmethylated CpGs, hyperacetylated histones H3 and H4, and lysine 4-methylated histone H3. In contrast, opposite modifications are observed at the other G+C-rich origins. We also show that the whole region, including the stretch of condensed chromatin, replicates early in S phase in these cells. Therefore, different early-firing origins within the same locus may have opposite patterns of epigenetic modifications. The role of insulator elements in DNA replication is discussed. PMID:12724412

Context-dependent EKLF responsiveness defines the developmental specificity of the human ɛ-globin gene in erythroid cells of YAC transgenic mice

PubMed Central

Tanimoto, Keiji; Liu, Qinghui; Grosveld, Frank; Bungert, Jörg; Engel, James Douglas

2000-01-01

We explored the mechanism of definitive-stage ɛ-globin transcriptional inactivity within a human β-globin YAC expressed in transgenic mice. We focused on the globin CAC and CAAT promoter motifs, as previous laboratory and clinical studies indicated a pivotal role for these elements in globin gene activation. A high-affinity CAC-binding site for the erythroid krüppel-like factor (EKLF) was placed in the ɛ-globin promoter at a position corresponding to that in the adult β-globin promoter, thereby simultaneously ablating a direct repeat (DR) element. This mutation led to EKLF-independent ɛ-globin transcription during definitive erythropoiesis. A second 4-bp substitution in the ɛ-globin CAAT sequence, which simultaneously disrupts a second DR element, further enhanced ectopic definitive erythroid activation of ɛ-globin transcription, which surprisingly became EKLF dependent. We finally examined factors in nuclear extracts prepared from embryonic or adult erythroid cells that bound these elements in vitro, and we identified a novel DR-binding protein (DRED) whose properties are consistent with those expected for a definitive-stage ɛ-globin repressor. We conclude that the suppression of ɛ-globin transcription during definitive erythropoiesis is mediated by the binding of a repressor that prevents EKLF from activating the ɛ-globin gene. PMID:11069894

Enhancing effects of gamma interferon on phagocytic cell association with and killing of Trypanosoma cruzi

NASA Technical Reports Server (NTRS)

Wirth, J. J.; Kierszenbaum, F.; Sonnenfeld, G.; Zlotnik, A.

1985-01-01

Results are reported from a study of the influence gamma interferon (GIFN) and interleukin 2 (IL2) have on the capability of P388D1 cells and mouse resident peritoneal macrophages (MPM) to attach to the blood-resident parasites Trypanosoma cruzi and kill them. Cultures of trypomastigote forms of the Tulahuen strain of T. cruzi grown in bovine serum were introduced into peritoneal cells of mice, along with P388D1 cells incubated with GIFN, IL2 and both. Control cells were also maintained. Statistical analysis were then performed on data on counts of the number of dead T. Cruzi cells. The GIFN enhanced the interaction of MPM and P388D1 cells with the surface of T. Cruzi, provided the interaction was given over 12 hr to take place. A depression of the cytotoxicity of P388D1 cells was attributed to mediation by H2O2, an effect partially offset by incubation with the lymphokine GIFN.

A subdose of fluconazole alters the virulence of Cryptococcus gattii during murine cryptococcosis and modulates type I interferon expression.

PubMed

Fontes, Alide Caroline Lima; Bretas Oliveira, Danilo; Santos, Juliana Ribeiro Alves; Carneiro, Hellem Cristina Silva; Ribeiro, Noelly de Queiroz; Oliveira, Lorena Vívien Neves de; Barcellos, Vanessa Abreu; Paixão, Tatiane Alves; Abrahão, Jonatas Santos; Resende-Stoianoff, Maria Aparecida; Vainstein, Marilene Henning; Santos, Daniel Assis

2017-02-01

Cryptococcosis is an invasive infection caused by yeast-like fungus of the genera Cryptococcus spp. The antifungal therapy for this disease provides some toxicity and the incidence of infections caused by resistant strains increased. Thus, we aimed to assess the consequences of fluconazole subdoses during the treatment of cryptococcosis in the murine inflammatory response and in the virulence factors of Cryptococcus gattii. Mice infected with Cryptococcus gattii were treated with subdoses of fluconazole. We determined the behavior of mice and type 1 interferon expression during the treatment; we also studied the virulence factors and susceptibility to fluconazole for the colonies recovered from the animals. A subdose of fluconazole prolonged the survival of mice, but the morbidity of cryptococcosis was higher in treated animals. These data were linked to the increase in: (i) fluconazole minimum inhibitory concentration, (ii) capsule size and (iii) melanization of C. gattii, which probably led to the increased expression of type I interferons in the brains of mice but not in the lungs. In conclusion, a subdose of fluconazole altered fungal virulence factors and susceptibility to this azole, leading to an altered inflammatory host response and increased morbidity. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Association between level of interferon gamma and acid-fast bacillipositivity in pulmonary tuberculosis

NASA Astrophysics Data System (ADS)

Priwahyuningtyas, N. B.; Sinaga, B. Y. M.; Pandia, P.; Eyanoer, P. C.

2018-03-01

Tuberculosis is an infectious disease which caused by Mycobacterium tuberculosis (M. tuberculosis) that infected numerous organ especially the lung. A person’s immunity is very affecting for a person exposed to pulmonary tuberculosis. T-helper-1 cell (Th1) is very influential in the immune system especially in interfering intracellular bacterial infection. One of the cytokines known produced by Th1 cell is interferon gamma (IFN-γ) which is in eliminating M. tuberculosis. The study aims to identify the association between level of IFN-γ and AFB positivity in pulmonary tuberculosis patients in Medan. It is a case-control study. The subjects of the study were 60 new cases of pulmonary tuberculosis with AFB sputum smear- positive that never received ATT consisting 20 cases AFB (+1), 20 cases AFB (+2) and 20 cases AFB (+3).Samples were plasma collected from the venous blood of pulmonary tuberculosis patients. The plasma then underwent laboratory assay with ELISA techniques. Independent t-test was p<0.05 considered significant. Level of IFN-γ in TB AFB (+1) is higher than TB AFB (+2) and (+3), with thesignificant statistical result (p=0.001).

Copy number variations of six and seven α-globin genes in a family with intermedia and major thalassemia phenotypes.

PubMed

Farashi, Samaneh; Vakili, Shadi; Faramarzi Garous, Negin; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-10-01

Copy number variations in α-globin genes are results of unequal crossover between homologous segments in the α-globin gene cluster that misalign during the meiosis phase of the gametogenesis process. Reduction or augmentation of α-globin genes leads to imbalance of α/β chains in hemoglobin tetramer and consequently attenuate or worsen the β-thal clinical symptoms, respectively. Multiplications in α-globin genes have been found in some populations, justifying unexpected severe phenotype of β-thal carriers. Unexpected severe phenotype in the family members may result from coexistence of extra α-globin genes, which is an important factor in the causation of thalassemia intermedia and major in heterozygous β-thalassemia. We described different multiplications in α-globin locus in an Iranian family with one, two or three extra α-globin genes (ααα/αα, αααα/αα and αααα/ααα). The excess α-globin gene/genes cause increment in β/α chain imbalance and leads to worsening pathophysiology and clinical severity of β-thalassemia carriers.

Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome

PubMed Central

Opazo, Juan C.; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F.

2015-01-01

Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about

Role of interferon in resistance and immunity to protozoa

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Degee, A. L. W.; Mansfield, J. M.; Newsome, A. L.; Arnold, R. R.

1985-01-01

Production of interferon (I) in response to protozoan infection, and the interferon-mediated inhibition of parasite replication were studied in order to determine if these effects may be related to immunologic-mediated resistance of the hosts. Two extracellular parasites-Trypanosoma brucei rhodesiense and Naegleria fowlei were used. Upon infection with the trypanosome, only resistant strains of mice produced I. An early peak of alpha/beta I is followed by appearance of gamma I, which coincided with antibody production and a drop in parasitemia. In case of the amoeba, pretreatment of its suspension with alpha/beta I inhibits its replication in vitro, and appears to protect mice from the infection and the disease. It is proposed that production of interferon, with its regulatory effect on the immune responses, may play a major role in regulating the processes of protozoan-caused diseases.

Inhibition of human mast cell growth and differentiation by interferon gamma-1b.

PubMed

Kirshenbaum, A S; Worobec, A S; Davis, T A; Goff, J P; Semere, T; Metcalfe, D D

1998-03-01

In an effort to identify cytokines that inhibit human mast cell growth, we cultured HMC-1 cells and recombinant human stem cell factor (rhSCF)-dependent human bone marrow-derived mast cells (HBMCs) in the presence of interferon gamma (IFNgamma)-1b and interferon alpha (IFNalpha)-2b. HMC-1 cell numbers decreased in the presence of 1000 U/mL IFNgamma-1b but were unaffected by 1000 U/mL of IFNalpha-2b. HBMCs were then cultured for 0 to 7 days with 100 ng/mL rhSCF and 10 ng/mL recombinant human IL-3 (rhIL-3), followed by culture in rhSCF and administration of either 1000 U/mL IFNalpha-2b or 1000 U/mL IFNgamma-1b. HBMCs appearing in cultures with rhSCF alone or in combination with IFNalpha-2b were virtually identical in number through 8 weeks of culture. In cultures supplemented with IFNgamma-1b, HBMCs significantly decreased in number and incidence of granular metachromasia by 4 to 5 weeks (p<0.001). Similar results were obtained when human marrow was cultured from day 0 with rhSCF and IFNgamma-1b. Mature rhSCF-dependent HBMCs were also cultured at 5 weeks with rhSCF alone or in combination with IFNgamma-1b. Compared with cells cultured in rhSCF, mature 5-week HBMC cultures treated with rhSCF plus IFNgamma-1b revealed a decrease in mast cells, and those mast cells that remained had fewer toluidine blue- and tryptase-positive granules after 5 to 8 weeks. FACS analysis of rhSCF plus IFNgamma-1b-treated mature HBMCs revealed increased c-kit and Fc(epsilon)RI expression. Mast cell releasibility was not increased. IFNgamma-lb was thus able to suppress mast cell growth from CD34+ cells, suggesting that this agent should be considered as a candidate cytokine for the treatment of disorders of mast cell proliferation.

Therapeutic fetal-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms.

PubMed

Dai, Yan; Sangerman, Jose; Luo, Hong Yuan; Fucharoen, Suthat; Chui, David H K; Faller, Douglas V; Perrine, Susan P

2016-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ-globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. Copyright © 2015 Elsevier Inc. All rights reserved.

Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

PubMed Central

Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

[The usefulness of in vitro interferon-gamma assay for differential diagnosis between intestinal tuberculosis and Crohns disease].

PubMed

Lee, Jung Nam; Ryu, Dong Yup; Park, Sung Han; You, Hyun Seok; Lee, Bong Eun; Kim, Dong Uk; Kim, Tae Oh; Heo, Jeong; Kim, Gwang Ha; Song, Geun Am; Kim, Suk; Park, Do Youn

2010-06-01

It is difficult to clinically and endoscopically differentiate intestinal tuberculosis (ITB) and Crohns disease (CD). The aim of this study was to evaluate the usefulness of in vitro interferon-gamma (INF-gamma) assay for differential diagnosis between ITB and CD. Sixty patients for whom differential diagnosis between ITB and CD was difficult were enrolled between January 2007 and January 2009. The INF-gamma-producing T-cell response to early secreted antigenic target 6 and culture filtrate protein 10 were measured by T-SPOT.TB blood test in vitro. We evaluated the usefulness of T-SPOT.TB blood test by comparing its results with the final diagnosis. Twenty and forty patients were revealed to be positive and negative in T-SPOT.TB blood test, respectively. Of the 20 patients found to be positive, 12 patients (60%) were finally diagnosed as ITB, 6 patients as CD, and 2 patients as Behcets enterocolitis. Of the 40 patients with negative results, 38 patients (95%) were diagnosed as CD; one as Behcets enterocolitis; one as nonspecific colitis; none as ITB. The sensitivity and specificity of T-SPOT.TB blood test for ITB were 100% and 83.3%, respectively. Positive and negative predictive values of T-SPOT.TB blood test for ITB were 60.0% and 100%, respectively. When differential diagnosis between ITB and CD is difficult, T-SPOT.TB blood test may be a helpful and rapid diagnostic tool to exclude ITB. Prospective large-scaled studies are required for further evaluation of the usefulness of T-SPOT.TB blood test for differential diagnosis between ITB and CD.

In Silico Analysis of Single Nucleotide Polymorphism (SNPs) in Human β-Globin Gene

PubMed Central

Alanazi, Mohammed; Abduljaleel, Zainularifeen; Khan, Wajahatullah; Warsy, Arjumand S.; Elrobh, Mohamed; Khan, Zahid; Amri, Abdullah Al; Bazzi, Mohammad D.

2011-01-01

Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies- the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB) gene mutations, such as that producing sickle cell hemoglobin (HbS), HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT) server we have searched for the SNPs, which showed that 200 (80%) non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40%) non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K), HbD (E→Q), HbE (E→K) and HbS (E→V). Atomic Non-Local Environment Assessment (ANOLEA), Yet Another Scientific Artificial Reality Application (YASARA), CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref) of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid residues

Effect of leukocyte therapy on tumor necrosis factor-alpha and interferon-gamma production in patients with recurrent spontaneous abortion.

PubMed

Gharesi-Fard, Behrouz; Zolghadri, Jaleh; Kamali-Sarvestani, Eskandar

2008-03-01

Considering the deleterious role of T helper1 (Th1) cells in pregnancy outcome, a successful treatment for recurrent spontaneous abortion (RSA) should be able to make a significant shift away from Th1 responses. Although paternal leukocyte immunization has been used for treatment of RSA for years, because of methodological differences there is no consensus on the mechanism of action and effectiveness of this method. Twenty-five Iranian non-pregnant women with RSA and 16 non-pregnant control women with at least two successful pregnancies were included in this study. All cases were followed up after leukocyte therapy for pregnancy outcome. Mononuclear cells from women were co-cultured with the husband's mononuclear cells before and after immunotherapy. The levels of tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) were checked on culture supernatant by enzyme-linked immunosorbent assay method. The mean concentration of TNF-alpha was significantly higher in patients compared with that in normal controls (P=0.0001). After immunotherapy, the TNF-alpha level was only significantly decreased in women with successful outcome (P=0.0001). Immunotherapy also induced a significant reduction in the IFN-gamma level (P=0.009). The results of this investigation confirm the role of TNF-alpha in RSA and propose the assessment of TNF-alpha production as a valuable prognostic parameter for the prediction of abortion after leukocyte therapy.

Stimulation of globin synthesis: relative responsiveness of reticulocytes and nucleated erythroid cells

PubMed Central

Waxman, Herbert S.

1970-01-01

The effects of iron, cobalt, hemin, and plasma on hemoglobin synthesis by suspensions of rabbit reticulocytes and nucleated bone marrow cells were studied. L-Leucine-14C and sodium pyruvate-3-14C were employed to measure globin and heme synthesis, respectively. Normal plasma (or serum) was found to stimulate the rate of globin synthesis in both systems. The stimulatory effects of iron and hemin were additive to those of plasma or serum only in the reticulocytes. Cobaltous ion, at concentrations less than 1.0 mmole/liter, was found to stimulate globin synthesis by reticulocytes as effectively as ferrous ion; cobalt was inhibitory only at concentrations greater than 3.0-5.0 mmoles/liter. Heme synthesis by reticulocytes was inhibited at all concentrations employed (0.2-5.0 mmoles/liter). In bone marrow nucleated erythroid cells, globin synthesis was markedly enhanced by exogenous hemin. In contrast to reticulocytes, however, bone marrow cells were unresponsive to either cobalt or transferrin-bound iron. Possible implications of these findings on regulation of the rate and mechanism of iron uptake and hemoglobin synthesis in vivo are discussed. PMID:5443172

Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome.

PubMed

Opazo, Juan C; Lee, Alison P; Hoffmann, Federico G; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F

2015-07-01

Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about

Interferon Gamma potentiates the injury caused by MPP(+) on SH-SY5Y cells, which is attenuated by the nitric oxide synthases inhibition.

PubMed

Titze-de-Almeida, Simoneide S; Lustosa, Cátia Faria; Horst, Camila Hillesheim; Bel, Elaine Del; Titze-de-Almeida, Ricardo

2014-12-01

This study examined whether the cytokine interferon (IFN) gamma plays a role in the injury of SH-SY5Y cells caused by MPP(+) (1-methyl-4-phenylpyridinium). First of all, IFN-gamma sensitized cells to the neurotoxin MPP(+), as determined by MTT (3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyltetrazolium bromide) assay. MPP(+)-injured cells showed higher reactive oxygen species (ROS) levels, which was reinforced by IFN-gamma. The injury triggered a marked expression of the neuronal NOS (nNOS) enzyme. L-NAME [N(ω)-nitro-L-arginine methyl ester, a non-specific NOS inhibitor] reestablished the cell viability after IFN-gamma challenging, and recovered cells from MPP(+) injury (95.0 vs. 84.7 %; P < 0.05). Seven-NI (7-nitroindazole, a nNOS inhibitor) protected cells against the injury by MPP(+) co-administered with IFN-gamma. Both inhibitors restrained the apoptosis of SH-SY5Y cells caused by MPP(+)/IFN-gamma. Regarding oxidative stress, L-NAME and 7-NI attenuated the increase in ROS levels caused by MPP(+) (45.3 or 48.4 vs. 87.9 %, P < 0.05). Indeed, L-NAME was more effective than 7-NI for reducing oxidative stress caused by MPP(+) under IFN-gamma exposition. The nNOS gene silencing by small-interfering RNAs recovered cells challenged by IFN-gamma (24 h), or MPP(+) (8 h). In conclusion, IFN-gamma sensitizes cells to MPP(+)-induced injury, also causing an increase in ROS levels. Pretreating cells with L-NAME or 7-NI reverts both the oxidative stress and apoptosis triggered by the neurotoxin MPP(+). Taking together, our data reinforce that IFN-gamma and NOS enzymes play a role in oxidative stress and dopaminergic cell death triggered by MPP(+).

The alterations in high density polyethylene properties with gamma irradiation

NASA Astrophysics Data System (ADS)

Zaki, M. F.; Elshaer, Y. H.; Taha, Doaa. H.

2017-10-01

In the present investigation, high density polyethylene (HDPE) polymer has been used to study the alterations in its properties under gamma-irradiation. Physico-chemical properties have been investigated with different spectroscopy techniques, Fourier Transform Infrared spectroscopy (FTIR), X-ray diffraction (XRD), biocompatibility properties, as well as, mechanical properties change. The FT-IR analysis shows the formation of new band at 1716 cm-1 that is attributed to the oxidation of irradiated polymer chains, which is due to the formation of carbonyl groups (C˭O). XRD patterns show that a decrease in the crystallite size and increase in the Full Width at Half Maximum (FWHM). This means that the crystallinity of irradiated samples is decreased with increase in gamma dose. The contact angle measurements show an increase in the surface free energy as the gamma irradiation increases. The measurements of mechanical properties of irradiated HDPE samples were discussed.

Mitochondria-dependent and -independent mechanisms in tumour necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis are both regulated by interferon-gamma in human breast tumour cells.

PubMed Central

Ruiz-Ruiz, Carmen; López-Rivas, Abelardo

2002-01-01

Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL/APO-2L) induces apoptosis in a variety of tumour cells upon binding to death receptors TRAIL-R1 and TRAIL-R2. Here we describe the sensitization by interferon (IFN)-gamma to TRAIL-induced apoptosis in the breast tumour cell lines MCF-7 and MDA-MB231. IFN-gamma promoted TRAIL-mediated activation of caspase-8, Bcl-2 interacting domain death agonist (Bid) degradation, Bcl-2-associated X protein (Bax) translocation to mitochondria, cytochrome c release to the cytosol and activation of caspase-9 in these cell lines. No changes in the expression of TRAIL receptors were observed upon IFN-gamma treatment. Overexpression of Bcl-2 in MCF-7 cells completely inhibited IFN-gamma-induced sensitization to TRAIL-mediated cell death. Interestingly, TRAIL-induced apoptosis was also clearly enhanced by IFN-gamma in caspase-3-overexpressing MCF-7 cells, in the absence of Bax translocation to mitochondria and cytochrome c release to the cytosol. In summary, our results suggest that IFN-gamma facilitates TRAIL-induced activation of mitochondria-regulated as well as mitochondria-independent apoptotic pathways in breast tumour cells. PMID:11936954

Relationship of the Interaction Between Two Quantitative Trait Loci with γ-Globin Expression in β-Thalassemia Intermedia Patients.

PubMed

NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran

2018-05-10

Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.

Molecular analysis of globin gene expression in different thalassaemia disorders: individual variation of β(E) pre-mRNA splicing determine disease severity.

PubMed

Tubsuwan, Alisa; Munkongdee, Thongperm; Jearawiriyapaisarn, Natee; Boonchoy, Chanikarn; Winichagoon, Pranee; Fucharoen, Suthat; Svasti, Saovaros

2011-09-01

Thalassaemia is characterized by the reduced or absent production of globins in the haemoglobin molecule leading to imbalanced α-globin/non α-globin chains. HbE, the result of a G to A mutation in codon 26 of the HBB (β-globin) gene, activates a cryptic 5' splice site in codon 25 leading to a reduction of correctly spliced β(E) -globin (HBB:c.79G>A) mRNA and consequently β(+) -thalassaemia. A wide range of clinical severities in bothα- and β-thalassaemia syndromes, from nearly asymptomatic to transfusion-dependent, has been observed. The correlation between clinical heterogeneity in various genotypes of thalassaemia and the levels of globin gene expression and β(E) -globin pre-mRNA splicing were examined using multiplex quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) and allele-specific RT-qPCR. The α-globin/non α-globin mRNA ratio was demonstrated to be a good indicator for disease severity among different thalassaemia disorders. However, the α-globin/non α-globin mRNA ratio ranged widely in β-thalassaemia/HbE patients, with no significant difference between mild and severe phenotypes. Interestingly, the correctly to aberrantly spliced β(E) -globin mRNA ratio in 30% of mild β-thalassaemia/HbE patients was higher than that of the severe patients. The splicing process of β(E) -globin pre-mRNA differs among β-thalassaemia/HbE patients and serves as one of the modifying factors for disease severity. © 2011 Blackwell Publishing Ltd.

Running, swimming and diving modifies neuroprotecting globins in the mammalian brain

PubMed Central

Williams, Terrie M; Zavanelli, Mary; Miller, Melissa A; Goldbeck, Robert A; Morledge, Michael; Casper, Dave; Pabst, D. Ann; McLellan, William; Cantin, Lucas P; Kliger, David S

2007-01-01

The vulnerability of the human brain to injury following just a few minutes of oxygen deprivation with submergence contrasts markedly with diving mammals, such as Weddell seals (Leptonychotes weddellii), which can remain underwater for more than 90 min while exhibiting no neurological or behavioural impairment. This response occurs despite exposure to blood oxygen levels concomitant with human unconsciousness. To determine whether such aquatic lifestyles result in unique adaptations for avoiding ischaemic–hypoxic neural damage, we measured the presence of circulating (haemoglobin) and resident (neuroglobin and cytoglobin) oxygen-carrying globins in the cerebral cortex of 16 mammalian species considered terrestrial, swimming or diving specialists. Here we report a striking difference in globin levels depending on activity lifestyle. A nearly 9.5-fold range in haemoglobin concentration (0.17–1.62 g Hb 100 g brain wet wt−1) occurred between terrestrial and deep-diving mammals; a threefold range in resident globins was evident between terrestrial and swimming specialists. Together, these two globin groups provide complementary mechanisms for facilitating oxygen transfer into neural tissues and the potential for protection against reactive oxygen and nitrogen groups. This enables marine mammals to maintain sensory and locomotor neural functions during prolonged submergence, and suggests new avenues for averting oxygen-mediated neural injury in the mammalian brain. PMID:18089537

Evaluation of Gamma Interferon and Antibody Tuberculosis Tests in Alpacas

PubMed Central

Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

2012-01-01

We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a “test package,” although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations. PMID:22914362

Evaluation of gamma interferon and antibody tuberculosis tests in alpacas.

PubMed

Rhodes, Shelley; Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin

2012-10-01

We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a "test package," although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations.

CMOS image sensor for detection of interferon gamma protein interaction as a point-of-care approach.

PubMed

Marimuthu, Mohana; Kandasamy, Karthikeyan; Ahn, Chang Geun; Sung, Gun Yong; Kim, Min-Gon; Kim, Sanghyo

2011-09-01

Complementary metal oxide semiconductor (CMOS)-based image sensors have received increased attention owing to the possibility of incorporating them into portable diagnostic devices. The present research examined the efficiency and sensitivity of a CMOS image sensor for the detection of antigen-antibody interactions involving interferon gamma protein without the aid of expensive instruments. The highest detection sensitivity of about 1 fg/ml primary antibody was achieved simply by a transmission mechanism. When photons are prevented from hitting the sensor surface, a reduction in digital output occurs in which the number of photons hitting the sensor surface is approximately proportional to the digital number. Nanoscale variation in substrate thickness after protein binding can be detected with high sensitivity by the CMOS image sensor. Therefore, this technique can be easily applied to smartphones or any clinical diagnostic devices for the detection of several biological entities, with high impact on the development of point-of-care applications.

Interferon-gamma and T-bet expression in a patient with toxoplasmic lymphadenopathy.

PubMed

Jöhrens, Korinna; Moos, Verena; Schneider, Thomas; Stein, Harald; Anagnostopoulos, Ioannis

2010-04-01

Infection with Toxoplasma gondii (TG) presents in some individuals as a self-limited disease with a predominant lymphadenopathy characterized by prominent B-cell activation. As this is in contrast to the in vitro based concept of a T(h)1-immune response against TG, we investigated native lymphoid tissue and peripheral blood of a patient with serologic evidence of toxoplasmosis to verify which cells show T(h)1-response features. High-level expression of T-bet in monocytoid B-cells, in germinal center B-cells, and in a lesser amount in T cells could be demonstrated by immunohistochemistry. In vitro stimulation of lymph node cells with either TG, staphylococcus enterotoxin B, or phorbol 12-myristate 13-acetate/ionomycin revealed an interferon-gamma expression in T-bet(+) B cells only in the patient and not in controls. Similar results were found for T-bet(+) T cells which were also present in controls. CD4(+) peripheral blood cells stimulated with TG antigens showed a TG-specific but attenuated T(h)1-reactivity in the patient associated with a reduced expression of IL-2 when compared with controls. We conclude that the pathogenesis and course of toxoplasmic lymphadenopathy is based on a T(h)1-cell defect, which becomes compensated by the B cells mounting a T(h)1-like immune response.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinell, J.; Whitney, J.B.; Popp, R.A.

Three types of mice with globin gene mutations, called 352HB, 27HB, and Hba/sup th-J/, appear to be true animal models of human thalassemia. Expression of the ..cap alpha..-globin genes in three stocks of mice, each one heterozygous for one of the ..cap alpha..-globin mutations, was examined at the polypeptide, RNA, and DNA levels. ..cap alpha..-globin polypeptide chains, relative to ..gamma..-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of ..cap alpha..-globin to ..gamma..-globin RNA sequences are also 75 to 80% normal, exactly reflecting the ..cap alpha..-globin to ..gamma..-globin chain ratios. In the case ofmore » mutant 352HB, at least one ..cap alpha..-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their ..cap alpha..-globin genes.« less

Prenatal Dexamethasone and Postnatal High-Fat Diet Decrease Interferon Gamma Production through an Age-Dependent Histone Modification in Male Sprague-Dawley Rats

PubMed Central

Yu, Hong-Ren; Tain, You-Lin; Sheen, Jiunn-Ming; Tiao, Mao-Meng; Chen, Chih-Cheng; Kuo, Ho-Chang; Hung, Pi-Lien; Hsieh, Kai-Sheng; Huang, Li-Tung

2016-01-01

Overexposure to prenatal glucocorticoid (GC) disturbs hypothalamic-pituitary-adrenocortical axis-associated neuroendocrine metabolism and susceptibility to metabolic syndrome. A high-fat (HF) diet is a major environmental factor that can cause metabolic syndrome. We aimed to investigate whether prenatal GC plus a postnatal HF diet could alter immune programming in rat offspring. Pregnant Sprague-Dawley rats were given intraperitoneal injections of dexamethasone or saline at 14–21 days of gestation. Male offspring were then divided into four groups: vehicle, prenatal dexamethasone exposure, postnatal HF diet (VHF), and prenatal dexamethasone exposure plus a postnatal HF diet (DHF). The rats were sacrificed and adaptive immune function was evaluated. Compared to the vehicle, the DHF group had lower interferon gamma (IFN-γ) production by splenocytes at postnatal day 120. Decreases in H3K9 acetylation and H3K36me3 levels at the IFN-γ promoter correlated with decreased IFN-γ production. The impaired IFN-γ production and aberrant site-specific histone modification at the IFN-γ promoter by prenatal dexamethasone treatment plus a postnatal HF diet resulted in resilience at postnatal day 180. Prenatal dexamethasone and a postnatal HF diet decreased IFN-γ production through a site-specific and an age-dependent histone modification. These findings suggest a mechanism by which prenatal exposure to GC and a postnatal environment exert effects on fetal immunity programming. PMID:27669212

Delayed growth of EL4 lymphoma in SR-A-deficient mice is due to upregulation of nitric oxide and interferon-gamma production by tumor-associated macrophages.

PubMed

Komohara, Yoshihiro; Takemura, Kenichi; Lei, Xiao Feng; Sakashita, Naomi; Harada, Mamoru; Suzuki, Hiroshi; Kodama, Tatsuhiko; Takeya, Motohiro

2009-11-01

Class A scavenger receptors (SR-A, CD204) are highly expressed in tumor-associated macrophages (TAM). To investigate the function of SR-A in TAM, wild-type and SR-A-deficient (SR-A(-/-)) mice were injected with EL4 cells. Although these groups of mice did not differ in the numbers of infiltrating macrophages and lymphocytes and in neovascularization, SR-A(-/-) mice had delayed growth of EL4 tumors. Expression of inducible nitric oxide (NO) synthase and interferon (IFN)-gamma mRNA increased significantly in tumor tissues from SR-A(-/-) mice. Engulfment of necrotic EL4 cells induced upregulation of NO and IFN-gamma production by cultured macrophages, and production of NO and IFN-gamma increased in SR-A(-/-) macrophages in vitro. IFN-beta production by cultured macrophages was also elevated in SR-A(-/-) macrophages in vitro. These results suggested that the antitumor activity of macrophages increased in SR-A(-/-) mice because of upregulation of NO and IFN-gamma production. These data indicate an important role of SR-A in regulating TAM function by inhibiting toll-like receptor (TLR)4-IFN-beta signaling.

CXCR6 promotes atherosclerosis by supporting T-cell homing, interferon-gamma production, and macrophage accumulation in the aortic wall.

PubMed

Galkina, Elena; Harry, Brian L; Ludwig, Andreas; Liehn, Elisa A; Sanders, John M; Bruce, Anthony; Weber, Christian; Ley, Klaus

2007-10-16

T lymphocytes are thought to be important in atherosclerosis, but very little is known about the mechanisms of lymphocyte recruitment into atherosclerosis-prone aortas. In this study we tested the hypothesis that CXCR6, a chemokine receptor that is expressed on a subset of CD4+ T helper 1 cells and natural killer T cells, is involved in lymphocyte homing into the aortic wall and modulates the development and progression of atherosclerosis. To investigate the role of CXCR6 in the development and progression of atherosclerosis, we bred CXCR6-deficient (CXCR6(GFP/GFP)) mice with apolipoprotein E-deficient (ApoE(-/-)) mice. We found that CXCR6(GFP/GFP)/ApoE(-/-) mice fed a Western diet for 17 weeks or a chow diet for 56 weeks had decreased atherosclerosis compared with ApoE(-/-) controls. Flow cytometry analysis of the aortas from CXCR6(GFP/GFP)/ApoE(-/-) mice showed that the reduction of atherosclerosis was accompanied by a decreased percentage of CXCR6+ T cells within the aortas. Short-term homing experiments demonstrated that CXCR6 is involved in the recruitment of CXCR6+ leukocytes into the atherosclerosis-prone aortic wall. The reduced percentage of CXCR6+ T cells within the aortas resulted in significantly diminished production of interferon-gamma and reduction of CD11b+/CD68+ macrophages in the aorta. These data provide evidence for a proatherosclerotic role of CXCR6. Absence of CXCR6 alters the recruitment of CXCR6+ leukocytes and modulates the local immune response within the aortic wall.

Application of genetically engineered Salmonella typhimurium for interferon-gamma-induced therapy against melanoma.

PubMed

Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo

2017-01-01

Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

Interferon-gamma regulates nucleoside transport systems in macrophages through signal transduction and activator of transduction factor 1 (STAT1)-dependent and -independent signalling pathways.

PubMed Central

Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio

2003-01-01

The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960

Modulating Vascular Hemodynamics With an Alpha Globin Mimetic Peptide (HbαX).

PubMed

Keller, T C Stevenson; Butcher, Joshua T; Broseghini-Filho, Gilson Brás; Marziano, Corina; DeLalio, Leon J; Rogers, Stephen; Ning, Bo; Martin, Jennifer N; Chechova, Sylvia; Cabot, Maya; Shu, Xiahong; Best, Angela K; Good, Miranda E; Simão Padilha, Alessandra; Purdy, Michael; Yeager, Mark; Peirce, Shayn M; Hu, Song; Doctor, Allan; Barrett, Eugene; Le, Thu H; Columbus, Linda; Isakson, Brant E

2016-12-01

The ability of hemoglobin to scavenge the potent vasodilator nitric oxide (NO) in the blood has been well established as a mechanism of vascular tone homeostasis. In endothelial cells, the alpha chain of hemoglobin (hereafter, alpha globin) and endothelial NO synthase form a macromolecular complex, providing a sink for NO directly adjacent to the production source. We have developed an alpha globin mimetic peptide (named HbαX) that displaces endogenous alpha globin and increases bioavailable NO for vasodilation. Here we show that, in vivo, HbαX administration increases capillary oxygenation and blood flow in arterioles acutely and produces a sustained decrease in systolic blood pressure in normal and angiotensin II-induced hypertensive states. HbαX acts with high specificity and affinity to endothelial NO synthase, without toxicity to liver and kidney and no effect on p50 of O 2 binding in red blood cells. In human vasculature, HbαX blunts vasoconstrictive response to cumulative doses of phenylephrine, a potent constricting agent. By binding to endothelial NO synthase and displacing endogenous alpha globin, HbαX modulates important metrics of vascular function, increasing vasodilation and flow in the resistance vasculature. © 2016 American Heart Association, Inc.

β-Globin-Expressing Definitive Erythroid Progenitor Cells Generated from Embryonic and Induced Pluripotent Stem Cell-Derived Sacs.

PubMed

Fujita, Atsushi; Uchida, Naoya; Haro-Mora, Juan J; Winkler, Thomas; Tisdale, John

2016-06-01

Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent a potential alternative source for red blood cell transfusion. However, when using traditional methods with embryoid bodies, ES cell-derived erythroid cells predominantly express embryonic type ɛ-globin, with lesser fetal type γ-globin and very little adult type β-globin. Furthermore, no β-globin expression is detected in iPS cell-derived erythroid cells. ES cell-derived sacs (ES sacs) have been recently used to generate functional platelets. Due to its unique structure, we hypothesized that ES sacs serve as hemangioblast-like progenitors capable to generate definitive erythroid cells that express β-globin. With our ES sac-derived erythroid differentiation protocol, we obtained ∼120 erythroid cells per single ES cell. Both primitive (ɛ-globin expressing) and definitive (γ- and β-globin expressing) erythroid cells were generated from not only ES cells but also iPS cells. Primitive erythropoiesis is gradually switched to definitive erythropoiesis during prolonged ES sac maturation, concurrent with the emergence of hematopoietic progenitor cells. Primitive and definitive erythroid progenitor cells were selected on the basis of glycophorin A or CD34 expression from cells within the ES sacs before erythroid differentiation. This selection and differentiation strategy represents an important step toward the development of in vitro erythroid cell production systems from pluripotent stem cells. Further optimization to improve expansion should be required for clinical application. Stem Cells 2016;34:1541-1552. © 2016 AlphaMed Press.

Correlations between endotoxin, interferon-gamma, biopterin and serum phospholipase A2-activities during lethal gram negative sepsis in rats.

PubMed

Hunsicker, A; Kullich, W; Weissenhofer, W; Lorenz, D; Petermann, J; Rokos, H; Schwesinger, G

1997-05-01

To establish a standardised reproducible animal model of intraperitoneal sepsis, and to investigate early immunoserological responses to find a mediator-based system for evaluation and grading of diffuse peritonitis in patients Prospective experimental study 4 Teaching hospitals, Germany and Austria 42 LEW. 1W rats, 12 of which acted as controls Gram negative sepsis was induced by intraperitoneal injection of 6 ml of a mixture of Escherichia coli (K1:H+) 10(10) organisms/ml, autogenous haemoglobin 2.9 ml (haemoglobin concentration 3%), 0.9% sodium chloride 3 ml, and suspension 0.1 ml. Control rats were given physiological saline 6 ml alone. Concentrations of endotoxin, interferon gamma (IFN-gamma), and biopterin, and serum phospholipase A2 (PLA2) activity. There were significant differences between the septic and control rats in concentrations of endotoxin (EU/ml) (median (interquartile range) 21.85 (2.02-159.5) compared with 0, p < 0.0001; IFN-gamma (pg/ml) 1263.0 (271.0-7575.0) compared with 101.0 (89.0-141.0), p < 0.0001; biopterin (nmol/L) 111.0 (66.4-156.3) compared with 53.7 (38.3-67.6), p < 0.001; and PLA2 (U/L) 163.0 (125.8-209.0) compared with 112.5 (88.5-126.5) p < 0.01. Measurements of concentrations of endotoxin, IFN-gamma, pteridines, and PLA2 activity may well be adequate markers for early recognition of sepsis, and perhaps for grading it during the first 6 hours after induction. The allow a clear distinction to be made between septic and non-septic disorders in 87% of cases.

Synergistic induction of apoptosis in primary rat decidual cells by INF-gamma and TNF.

PubMed

Almeida, A; Correia-da-Silva, G; Cepa, M; Bell, S C; Teixeira, N A

2007-03-01

In the rat, in response to blastocyst implantation, stromal cells of the endometrium proliferate and differentiate into decidual cells, forming the decidua. After reaching its maximum development, the decidua undergoes regression. This phenomenon appears to be due to an active process involving apoptosis. As there is sparse knowledge concerning the mechanisms of induction of decidual cell death, the potential role of cytokines present in the uterine environment during pregnancy, such as tumor necrosis factor (TNF) and interferon-gamma (INF-gamma) was explored in primary cultures of rat decidual cells. The effects of these factors upon cellular viability, nuclear morphologic alterations, expression, and enzymatic activities of the effector caspases-3/7 were evaluated. The results obtained demonstrated that in contrast to TNF, which did not induce any alteration, INF-gamma and in association with TNF caused a decrease in cell viability and an increase in the appearance of apoptotic bodies in a time-dependent manner that was augmented in the co-presence of TNF. An increase in caspase-3/7 activities after 12 hr of TNF/INF-gamma treatment was also observed. These findings suggest that INF-gamma expressed in the uterine environment may play an important role in regulating apoptosis through potential synergistic mechanisms with TNF and thereby modulate decidual stability and regression during pregnancy. (c) 2006 Wiley-Liss, Inc.

Interferon effects on protozoan infections

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Wirth, J.; Kierszenbaum, F.; Degee, A. L. W.; Mansfield, J. M.

1985-01-01

The effects of interferon (IFN) on mice infected with two different parasitic protozoans, Trypanosoma cruzi and Trypanosoma brucei rhodesiense, are investigated experimentally. The preparation of the cell cultures, IFN and assays, antibody, and the experimental procedures are described. It is observed that in cells treated with IFN-gamma there is an increased association of T. cruzi with murine macrophages and an increase in the killing of T. cruzi by IFN-gamma-treated murine macrophages. For spleen cells infected with T.b. rhodesiense in vitro, it is detected that live trypanosomes cannot induce IFN in cells from normal mice, but can in cells from immunized mice; and that trypanosome-lysates induce IFN in vitro in cells from normal mice. The data suggest that there is a two-step mechanism for mice against T. cruzi and T.b. rhodesiense.

Total alpha-globin gene cluster deletion has high frequency in Filipinos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.

1994-09-01

Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms;more » {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).« less

Biosynthesis and N-glycosylation of human interferon-gamma. Asn25 and Asn97 differ markedly in how efficiently they are glycosylated and in their oligosaccharide composition.

PubMed

Sareneva, T; Mørtz, E; Tölö, H; Roepstorff, P; Julkunen, I

1996-12-01

Interferon-gamma (IFN-gamma) is a secretory glycoprotein produced by T cells in response to antigenic or mitogenic stimuli. We studied the kinetics of the synthesis, N-glycosylation, and secretion of IFN-gamma in human CD8+ T lymphocytes stimulated via T-cell receptor. Highly elevated IFN-gamma mRNA levels were found as early as 1 h after stimulation. Maximal IFN-gamma protein synthesis was observed 2-4 h after induction and appeared to correlate to steady-state IFN-gamma mRNA levels. As analyzed by pulse/chase experiments, the secretion of IFN-gamma from T cells was very rapid, the secretion half-time being approximately 20-25 min. Inhibition of N-glycosylation by tunicamycin dramatically reduced the expression of IFN-gamma, but did not block its secretion. Natural IFN-gamma is heterogeneously glycosylated and doubly, singly, and unglycosylated forms exist. Experiments performed in a cell-free translation/glycosylation system with mutated IFN-gamma constructs lacking either one of the potential glycosylation sites suggested that Asn25 is more efficiently glycosylated than Asn97. Site-specific oligosaccharide analysis of natural IFN-gamma by glycosidase treatment followed by matrix-assisted-laser-desorption-ionization mass spectrometry revealed considerable variation in the carbohydrate structures, with more than 30 different forms. The glycans at Asn25 consisted of fucosylated, mainly complex-type oligosaccharides, whereas the glycans at Asn97 were more heterogeneous, with hybrid and high-mannose structures. Our results emphasize the essential role of N-linked glycans in the biology of IFN-gamma and show that there is a considerable heterogeneity in the individual sugar chains of this important human cytokine.

Histaminergic regulation of interferon-gamma (IFN-gamma) production by human natural killer (NK) cells.

PubMed

Asea, A; Hansson, M; Czerkinsky, C; Houze, T; Hermodsson, S; Strannegård, O; Hellstrand, K

1996-08-01

Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-gamma by CD3-/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-gamma production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-gamma production was operating on a pretranslational level, as indicated by the inability of enriched NK cells to accumulate IFN-gamma mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-gamma production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-gamma production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-gamma in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-gamma mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-gamma production by preventing monocyte-induced oxidative damage to NK cells.

Partial interferon-gamma receptor 1 deficiency in a child with tuberculoid bacillus Calmette-Guérin infection and a sibling with clinical tuberculosis.

PubMed Central

Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L

1997-01-01

Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728

Designing of interferon-gamma inducing MHC class-II binders

PubMed Central

2013-01-01

Background The generation of interferon-gamma (IFN-γ) by MHC class II activated CD4+ T helper cells play a substantial contribution in the control of infections such as caused by Mycobacterium tuberculosis. In the past, numerous methods have been developed for predicting MHC class II binders that can activate T-helper cells. Best of author’s knowledge, no method has been developed so far that can predict the type of cytokine will be secreted by these MHC Class II binders or T-helper epitopes. In this study, an attempt has been made to predict the IFN-γ inducing peptides. The main dataset used in this study contains 3705 IFN-γ inducing and 6728 non-IFN-γ inducing MHC class II binders. Another dataset called IFNgOnly contains 4483 IFN-γ inducing epitopes and 2160 epitopes that induce other cytokine except IFN-γ. In addition we have alternate dataset that contains IFN-γ inducing and equal number of random peptides. Results It was observed that the peptide length, positional conservation of residues and amino acid composition affects IFN-γ inducing capabilities of these peptides. We identified the motifs in IFN-γ inducing binders/peptides using MERCI software. Our analysis indicates that IFN-γ inducing and non-inducing peptides can be discriminated using above features. We developed models for predicting IFN-γ inducing peptides using various approaches like machine learning technique, motifs-based search, and hybrid approach. Our best model based on the hybrid approach achieved maximum prediction accuracy of 82.10% with MCC of 0.62 on main dataset. We also developed hybrid model on IFNgOnly dataset and achieved maximum accuracy of 81.39% with 0.57 MCC. Conclusion Based on this study, we have developed a webserver for predicting i) IFN-γ inducing peptides, ii) virtual screening of peptide libraries and iii) identification of IFN-γ inducing regions in antigen (http://crdd.osdd.net/raghava/ifnepitope/). Reviewers This article was reviewed by Prof Kurt

A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

PubMed

Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

2014-07-01

In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

Glucocorticoids inhibit coordinated translation of. cap alpha. - and. beta. -globin mRNAs in Friend erythroleukemia cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Papaconstantinou, J.; Stewart, J.A.; Rabek, J.P.

The dimethylsulfoxide (Me/sub 2/SO)-mediated induction of hemoglobin synthesis in Friend erythroleukemia cells is inhibited by the glucocorticoids hydrocortisone, dexamethasone, and fluocinolone acetonide; hydrocortisone, at concentrations of 10/sup -5/ to 10/sup -8/ M inhibits by 90-30% and fluocinolone acetonide at concentrations of 10/sup -8/ to 10/sup -11/ M shows a greater than 90% inhibition. At these concentrations the hormones have no effect on cell growth or viability. In this study it has been shown that there is a group of proteins, including the ..cap alpha..- and ..beta..-globins, whose regulation is associated with the induction of Friend erythroleukemia cell differentiation, and thatmore » the expression of these, in addition to ..cap alpha..- and ..beta..-globin, is affected by glucocorticoids. It is concluded that, although the translation of ..cap alpha..- and ..beta..-globin mRNA is a major site of inhibition by glucocorticoids, there is a detectable amount of ..cap alpha..- and ..beta..-globin mRNA translation which results in unequal amounts of globin synthesis and an overall more potent inhibition of hemoglobin formation.« less

Mycobacterium tuberculosis infection in health care workers in rural India: comparison of a whole-blood interferon gamma assay with tuberculin skin testing.

PubMed

Pai, Madhukar; Gokhale, Kaustubh; Joshi, Rajnish; Dogra, Sandeep; Kalantri, Shriprakash; Mendiratta, Deepak K; Narang, Pratibha; Daley, Charles L; Granich, Reuben M; Mazurek, Gerald H; Reingold, Arthur L; Riley, Lee W; Colford, John M

2005-06-08

Mycobacterium tuberculosis infection in health care workers has not been adequately studied in developing countries using newer diagnostic tests. To estimate latent tuberculosis infection prevalence in health care workers using the tuberculin skin test (TST) and a whole-blood interferon gamma (IFN-gamma) assay; to determine agreement between the tests; and to compare their correlation with risk factors. A cross-sectional comparison study of 726 health care workers aged 18 to 61 years (median age, 22 years) with no history of active tuberculosis conducted from January to May 2004, at a rural medical school in India. A total of 493 (68%) of the health care workers had direct contact with patients with tuberculosis and 514 (71%) had BCG vaccine scars. Tuberculin skin testing was performed using 1-TU dose of purified protein derivative RT23, and the IFN-gamma assay was performed by measuring IFN-gamma response to early secreted antigenic target 6, culture filtrate protein 10, and a portion of tuberculosis antigen TB7.7. Agreement between TST and the IFN-gamma assay, and comparison of the tests with respect to their association with risk factors. A large proportion of the health care workers were latently infected; 360 (50%) were positive by either TST or IFN-gamma assay, and 226 (31%) were positive by both tests. The prevalence estimates of TST and IFN-gamma assay positivity were comparable (41%; 95% confidence interval [CI], 38%-45% and 40%; 95% CI, 37%-43%, respectively). Agreement between the tests was high (81.4%; kappa = 0.61; 95% CI, 0.56-0.67). Increasing age and years in the health profession were significant risk factors for both IFN-gamma assay and TST positivity. BCG vaccination had little impact on TST and IFN-gamma assay results. Our study showed high latent tuberculosis infection prevalence in Indian health care workers, high agreement between TST and IFN-gamma assay, and similar association between positive test results and risk factors. Although TST and

The effect of fermented milk on interferon production in malnourished children and in anorexia nervosa patients undergoing nutritional care.

PubMed

Solis, B; Nova, E; Gómez, S; Samartín, S; Mouane, N; Lemtouni, A; Belaoui, H; Marcos, A

2002-12-01

For several years cytokine production has been associated with infections but it was not suspected that some types of food could also induce cytokines, even in a state of non-infection. Lactic bacteria can induce interferon (IFN) production in human healthy subjects, thus, a better protection against infections would be expected. Therefore, we planned to evaluate the effect of two diets including yoghurt or milk on IFN-gamma production during nutritional recovery in two different situations of malnutrition: (1) children with diarrhoea; and (2) patients with anorexia nervosa (AN). Both the diet including yoghurt of that including milk seemed to increase IFN-gamma production at the end of nutritional recovery in the malnourished children with diarrhoea. The significance of interferon production and the lymphocyte subset increase should be explored to know if a better resistance against pathogens is related to them. Regulation of intestinal absorption and moderate stimulation of interferon production make the yoghurt-based diet a good choice in the nutritional care of children. In the same way, an increase in the IFN-gamma production was observed in AN patients consuming yoghurt. This increase of IFN-gamma production could be considered a biological marker to detect the effect of probiotics on the immune response, especially in the improvement of a deficient nutritional status.

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

PubMed Central

Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2015-01-01

Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

Structural and Functional Analysis of an mRNP Complex That Mediates the High Stability of Human β-Globin mRNA

PubMed Central

Yu, Jia; Russell, J. Eric

2001-01-01

Human globins are encoded by mRNAs exhibiting high stabilities in transcriptionally silenced erythrocyte progenitors. Unlike α-globin mRNA, whose stability is enhanced by assembly of a specific messenger RNP (mRNP) α complex on its 3′ untranslated region (UTR), neither the structure(s) nor the mechanism(s) that effects the high-level stability of human β-globin mRNA has been identified. The present work describes an mRNP complex assembling on the 3′ UTR of the β-globin mRNA that exhibits many of the properties of the stability-enhancing α complex. The β-globin mRNP complex is shown to contain one or more factors homologous to αCP, a 39-kDa RNA-binding protein that is integral to α-complex assembly. Sequence analysis implicates a specific 14-nucleotide pyrimidine-rich track within its 3′ UTR as the site of β-globin mRNP assembly. The importance of this track to mRNA stability is subsequently verified in vivo using mice expressing human β-globin transgenes that contain informative mutations in this region. In combination, the in vitro and in vivo analyses indicate that the high stabilities of the α- and β-globin mRNAs are maintained through related mRNP complexes that may share a common regulatory pathway. PMID:11486027

Developmental regulation of DNA replication timing at the human beta globin locus.

PubMed

Simon, I; Tenzen, T; Mostoslavsky, R; Fibach, E; Lande, L; Milot, E; Gribnau, J; Grosveld, F; Fraser, P; Cedar, H

2001-11-01

The human beta globin locus replicates late in most cell types, but becomes early replicating in erythroid cells. Using FISH to map DNA replication timing around the endogenous beta globin locus and by applying a genetic approach in transgenic mice, we have demonstrated that both the late and early replication states are controlled by regulatory elements within the locus control region. These results also show that the pattern of replication timing is set up by mechanisms that work independently of gene transcription.

Successful Application of the Gamma-Interferon Assay in a Bovine Tuberculosis Eradication Program: The French Bullfighting Herd Experience.

PubMed

Keck, Nicolas; Boschiroli, Maria-Laura; Smyej, Florence; Vogler, Valérie; Moyen, Jean-Louis; Desvaux, Stéphanie

2018-01-01

In the French Camargue region, where bovine tuberculosis had been enzootic for several years in bullfighting cattle herds, the gamma-interferon (IFN) assay was used since 2003 in parallel with the intradermal test in order to increase overall disease detection sensitivity in infected herds. This study presents the results of a field-evaluation of the assay during a 10-year period (2004-2014) of disease control and surveillance program and explores the particular pattern of IFN assay results in bullfight herds in comparison to cattle from other regions of France. The low sensitivity [59.2% (50.6; 67.3)] of IFN assay using the tuberculin stimulation could be related to the poor gamma-IFN production from bullfight cattle blood cells which is significantly lower than in animals of conventional breeds. The characteristics of the assay were progressively adapted to the epidemiological situation and the desired strategic applications. Data analysis with a receiver operating characteristic curve based on a simple S/P value algorithm allowed for the determination of a new cutoff adapted for a global screening, giving a high specificity of 99.9% results and a high accuracy of the assay. Having regularly risen to above 5% since 2005, with a peak around 10% in 2010, the annual incidence dropped to under 1% in 2014. The positive predictive value relative to the bacteriological confirmation evolved during the years, from 33% in 2009 to 12% during the last screening period, a normal trend in a context of decreasing prevalence. The estimated rate of false-positive reactions during screening campaigns was 0.67%, confirming the high specificity of the test, measured in bTB negative herds, in this epidemiological context. The proportion of false-positive reactions decreased with the age and was higher in males than in females. Although these results indicate that the IFN assay is accurate in the field, it also emphasizes great differences between interferon quantities produced by

Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice.

PubMed

Boosalis, Michael S; Sangerman, Jose I; White, Gary L; Wolf, Roman F; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H; Li, Biaoru; Pace, Betty S; Nouraie, Mehdi; Faller, Douglas V; Perrine, Susan P

2015-01-01

High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies.

Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice

PubMed Central

Boosalis, Michael S.; Sangerman, Jose I.; White, Gary L.; Wolf, Roman F.; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H.; Li, Biaoru; Pace, Betty S.; Nouraie, Mehdi; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies. PMID:26713848

Combined therapy with danazol, pegilated interferon, and ribavirin improves thrombocytopenia and liver injury in rats with fibrosis.

PubMed

Alvarez, Guillermo Cabrera; Madrid-Marina, Vicente; Jimenez-Mendez, Ricardo; Buitimea, Angel Leon; Román, Margarita Bahena; Cortez-Gomez, Rudyard; Esparza, Jorge Reyes; Rodríguez-Fragoso, Lourdes

2007-01-01

The aim of this study was to investigate the effects of combinations of pegilated-interferon (PEG-IFN), ribavirin, and danazol on thrombocytopenia and liver injury in rats with fibrosis. Male adult Wistar rats were treated with either mineral oil, danazol (0.83 mg/kg per day), PEG-interferon alpha-2a (PEG-IFN, 0.3 microg/ week) + ribavirin (12 mg/kg per day), PEG-IFN + ribavirin + danazol, CCl(4) (4 g/kg for eight weeks), CCl(4) + PEG-IFN + ribavirin, or CCl(4) + PEG-IFN + ribavirin+ danazol. The following assays were conducted: hematology, clinical chemistry, liver function, liver fibrosis, lymphocyte cytokine mRNA expression, and bone-marrow DNA content. Platelet counts were low in sham-treated animals and animals treated with PEG- IFN + ribavirin (30% and 25% respectively; P < 0.05). PEG-IFN + ribavirin + danazol reduced platelet counts of fibrotic animals by only 9% (P < 0.05). PEG- IFN + ribavirin reduced hepatic collagen content by 50%, whereas danazol + PEG-IFN + ribavirin reduced hepatic collagen content by 60% (P < 0.05). PEG-IFN + ribavirin reduced the total bilirubin concentration by 27%, alanine amino transferase (ALT) activity by 75% and gamma-glutamyl transpeptidase (gamma-GTP) activity by 74% (P < 0.05). In contrast, danazol + PEG-IFN + ribavirin reduced total bilirubin levels by 61%, alkaline phosphatase activity by 45%, ALT activity by 76%, and gamma-GTP activity by 74% (P < 0.05). The only treatment that increased interleukin 10 (IL-10) mRNA in fibrotic rats was PEG-IFN + ribavirin. However, danazol + PEG-IFN + ribavirin reduced the expression of IL-6, IL-10, tumor necrosis factor alpha and transforming growth factor ss. Bone-marrow DNA content was not altered by any treatment. In conclusion, PEG-IFN + ribavirin + danazol could be a new therapeutic option for patients with liver injury, fibrosis, and thrombocytopenia.

Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.

PubMed

Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y

2017-10-01

Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.

MOLECULAR CLONING, SEQUENCING, EXPRESSION AND BIOLOGICAL ACTIVITY OF GIANT PANDA (AILUROPODA MELANOLEUCA) INTERFERON-GAMMA.

PubMed

Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun

2012-06-29

The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.

Respiratory Francisella tularensis live vaccine strain infection induces Th17 cells and prostaglandin E2, which inhibits generation of gamma interferon-positive T cells.

PubMed

Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A

2008-06-01

Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).

Gamma Interferon Loaded onto Albumin Nanoparticles: In Vitro and In Vivo Activities against Brucella abortus▿

PubMed Central

Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.

2007-01-01

The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401

Serum profile of cytokines interferon gamma and interleukin-10 in ewes subjected to artificial insemination by cervical retraction.

PubMed

Alvares, C T G; Cruz, J F; Romano, C C; Brandão, F Z

2016-04-15

This study evaluated the influence of artificial insemination (AI) by cervical retraction (CRI) on serum levels of interferon gamma (IFNγ) and interleukin-10 (IL-10) in ewes. Synchronized pluriparous Santa Inês ewes were subjected to natural mating (NM, n = 8) and AI, which was performed for a fixed time (55 ± 1 hour) by CRI (n = 8) or laparoscopy (n = 8). Ewes were classified as pregnant, with return to estrus (RE) or with embryonic loss (EL). Blood samples were collected on Day 0, Day 3, Day 5, Day 12, and Day 17 (Day 0 = AI/NM) for progesterone dosage and cytokines were quantified from Day 0 to Day 12. Progesterone levels were constant, except for a decrease in ewes with RE at Day 17 (P < 0.05). Regardless of the reproductive method used, there was no difference in the IFNγ and IL-10 levels at any time, with averages of 642.1, 713.2, and 741.2 pg/mL for IFNγ and 667.1, 616.8, and 721.1 pg/mL for IL-10 when using CRI, laproscopy, and NM, respectively. Regarding the physiological status, ewes with EL had lower serum levels of IFNγ and IL-10 than pregnant ewes and ewes with RE, regardless of the reproductive method used, with averages of 769.1, 714.9, and 555.7 pg/mL for IFNγ and 713.8, 699.3, and 578.7 pg/mL for IL-10 in pregnant ewes, ewes with RE and EL, respectively (P < 0.01). In conclusion, AI by CRI in Santa Inês ewes does not alter the profile of serum cytokines IFNγ and IL-10 and does not induce an inflammatory reaction that can compromise pregnancy. Copyright © 2016 Elsevier Inc. All rights reserved.

Globins Scavenge Sulfur Trioxide Anion Radical*

PubMed Central

Gardner, Paul R.; Gardner, Daniel P.; Gardner, Alexander P.

2015-01-01

Ferrous myoglobin was oxidized by sulfur trioxide anion radical (STAR) during the free radical chain oxidation of sulfite. Oxidation was inhibited by the STAR scavenger GSH and by the heme ligand CO. Bimolecular rate constants for the reaction of STAR with several ferrous globins and biomolecules were determined by kinetic competition. Reaction rate constants for myoglobin, hemoglobin, neuroglobin, and flavohemoglobin are large at 38, 120, 2,600, and ≥ 7,500 × 106 m−1 s−1, respectively, and correlate with redox potentials. Measured rate constants for O2, GSH, ascorbate, and NAD(P)H are also large at ∼100, 10, 130, and 30 × 106 m−1 s−1, respectively, but nevertheless allow for favorable competition by globins and a capacity for STAR scavenging in vivo. Saccharomyces cerevisiae lacking sulfite oxidase and deleted of flavohemoglobin showed an O2-dependent growth impairment with nonfermentable substrates that was exacerbated by sulfide, a precursor to mitochondrial sulfite formation. Higher O2 exposures inactivated the superoxide-sensitive mitochondrial aconitase in cells, and hypoxia elicited both aconitase and NADP+-isocitrate dehydrogenase activity losses. Roles for STAR-derived peroxysulfate radical, superoxide radical, and sulfo-NAD(P) in the mechanism of STAR toxicity and flavohemoglobin protection in yeast are suggested. PMID:26381408

Tumor necrosis factor alpha mediates resistance to Trypanosoma cruzi infection in mice by inducing nitric oxide production in infected gamma interferon-activated macrophages.

PubMed Central

Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q

1995-01-01

Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147

Association of an α-globin gene cluster duplication and heterozygous β-thalassemia in a patient with a severe thalassemia syndrome.

PubMed

Jiang, Hua; Liu, Sha; Zhang, Yong-Ling; Wan, Jun-Hui; Li, Ru; Li, Dong-Zhi

2015-01-01

We describe a new case of a β-thalassemia (β-thal) heterozygote with the mutation IVS-II-654 (C>T) presenting with a transfusion-dependent phenotype. Multiplex ligation-dependent probe amplification (MLPA) and array comparative genomic hybridization (CGH) analyses of the α-globin gene cluster revealed a full duplication of the α-globin genes including the upstream regulatory element. The duplicated allele and the normal allele in trans resulted in a total of six active α-globin genes. The severe clinical phenotype seemed to be related to the considerable excess of the α- and β-globin deficit caused by the presence of the β-thal. α-Globin cluster duplication should be considered in patients heterozygous for β-thal who show a more severe phenotype than β-thal trait.

Learning alters theta amplitude, theta-gamma coupling and neuronal synchronization in inferotemporal cortex.

PubMed

Kendrick, Keith M; Zhan, Yang; Fischer, Hanno; Nicol, Alister U; Zhang, Xuejuan; Feng, Jianfeng

2011-06-09

model which can reproduce these changes suggests that a key function of such learning-evoked alterations in theta and theta-nested gamma activity may be increased temporal desynchronization in neuronal firing leading to optimal timing of inputs to downstream neural networks potentiating their responses. In this way learning can produce potentiation in neural networks simply through altering the temporal pattern of their inputs.

Learning alters theta amplitude, theta-gamma coupling and neuronal synchronization in inferotemporal cortex

PubMed Central

2011-01-01

behavioral performance. A network model which can reproduce these changes suggests that a key function of such learning-evoked alterations in theta and theta-nested gamma activity may be increased temporal desynchronization in neuronal firing leading to optimal timing of inputs to downstream neural networks potentiating their responses. In this way learning can produce potentiation in neural networks simply through altering the temporal pattern of their inputs. PMID:21658251

Molecular evolution of globin genes in Gymnotiform electric fishes: relation to hypoxia tolerance.

PubMed

Tian, Ran; Losilla, Mauricio; Lu, Ying; Yang, Guang; Zakon, Harold

2017-02-13

Nocturnally active gymnotiform weakly electric fish generate electric signals for communication and navigation, which can be energetically taxing. These fish mainly inhabit the Amazon basin, where some species prefer well-oxygenated waters and others live in oxygen-poor, stagnant habitats. The latter species show morphological, physiological, and behavioral adaptations for hypoxia-tolerance. However, there have been no studies of hypoxia tolerance on the molecular level. Globins are classic respiratory proteins. They function principally in oxygen-binding and -delivery in various tissues and organs. Here, we investigate the molecular evolution of alpha and beta hemoglobins, myoglobin, and neuroglobin in 12 gymnotiforms compared with other teleost fish. The present study identified positively selected sites (PSS) on hemoglobin (Hb) and myoglobin (Mb) genes using different maximum likelihood (ML) methods; some PSS fall in structurally important protein regions. This evidence for the positive selection of globin genes suggests that the adaptive evolution of these genes has helped to enhance the capacity for oxygen storage and transport. Interestingly, a substitution of a Cys at a key site in the obligate air-breathing electric eel (Electrophorus electricus) is predicted to enhance oxygen storage of Mb and contribute to NO delivery during hypoxia. A parallel Cys substitution was also noted in an air-breathing African electric fish (Gymnarchus niloticus). Moreover, the expected pattern under normoxic conditions of high expression of myoglobin in heart and neuroglobin in the brain in two hypoxia-tolerant species suggests that the main effect of selection on these globin genes is on their sequence rather than their basal expression patterns. Results indicate a clear signature of positive selection in the globin genes of most hypoxia-tolerant gymnotiform fishes, which are obligate or facultative air breathers. These findings highlight the critical role of globin genes in

[Regulation of the β-globin gene family expression, useful in the search for new therapeutic targets for hemoglobinopathies].

PubMed

Scheps, Karen G; Varela, Viviana

Different hemoglobin isoforms are expressed during the embryonic, fetal and postnatal stages. They are formed by combination of polypeptide chains synthesized from the α- and β-globin gene clusters. Based on the fact that the presence of high hemoglobin F levels is beneficial in both sickle cell disease and severe thalassemic syndromes, a revision of the regulation of the β-globin cluster expression is proposed, especially regarding the genes encoding the y-globin chains (HBG1 and HBG2). In this review we describe the current knowledge about transcription factors and epigenetic regulators involved in the switches of the β-globin cluster. It is expected that the consolidation of knowledge in this field will allow finding new therapeutic targets for the treatment of hemoglobinopathies.

Cognitive dysfunction in schizophrenia: convergence of gamma-aminobutyric acid and glutamate alterations.

PubMed

Lewis, David A; Moghaddam, Bita

2006-10-01

Impairments in certain cognitive functions mediated by the dorsolateral prefrontal cortex, such as working memory, are core features of schizophrenia. Convergent findings suggest that these disturbances are associated with alterations in markers of inhibitory gamma-aminobutyric acid and excitatory glutamate neurotransmission in the dorsolateral prefrontal cortex. Specifically, reduced gamma-aminobutyric acid synthesis is present in the subpopulation of gamma-aminobutyric acid neurons that express the calcium-binding protein parvalbumin. Despite presynaptic and postsynaptic compensatory responses, the resulting impaired inhibitory regulation of pyramidal neurons contributes to a reduction in the synchronized neuronal activity that is required for working memory function. Several lines of evidence suggest that these changes may be either secondary to or exacerbated by impaired signaling via the N-methyl-d-aspartate class of glutamate receptors. These findings suggest specific targets for therapeutic interventions to improve cognitive function in individuals with schizophrenia.

Silencing of Aγ-Globin Gene Expression during Adult Definitive Erythropoiesis Mediated by GATA-1-FOG-1-Mi2 Complex Binding at the −566 GATA Site▿ †

PubMed Central

Harju-Baker, Susanna; Costa, Flávia C.; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R.

2008-01-01

Autonomous silencing of γ-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the Aγ-globin gene was identified between −730 and −378 relative to the mRNA start site. A marked copy of the Aγ-globin gene inserted between locus control region 5′ DNase I-hypersensitive site 1 and the ɛ-globin gene was transcriptionally silenced in adult β-globin locus yeast artificial chromosome (β-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the −566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low γ-globin levels, whereas only a weak signal was detected when γ-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from β-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the Aγ-globin −566 or Gγ-globin −567 GATA site when γ-globin expression was low (day 18) but not when γ-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, γ-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the −566/−567 GATA sites of the proximal γ-globin promoters. PMID:18347053

Blockade of interferon Beta, but not interferon alpha, signaling controls persistent viral infection.

PubMed

Ng, Cherie T; Sullivan, Brian M; Teijaro, John R; Lee, Andrew M; Welch, Megan; Rice, Stephanie; Sheehan, Kathleen C F; Schreiber, Robert D; Oldstone, Michael B A

2015-05-13

Although type I interferon (IFN-I) is thought to be beneficial against microbial infections, persistent viral infections are characterized by high interferon signatures suggesting that IFN-I signaling may promote disease pathogenesis. During persistent lymphocytic choriomeningitis virus (LCMV) infection, IFNα and IFNβ are highly induced early after infection, and blocking IFN-I receptor (IFNAR) signaling promotes virus clearance. We assessed the specific roles of IFNβ versus IFNα in controlling LCMV infection. While blockade of IFNβ alone does not alter early viral dissemination, it is important in determining lymphoid structure, lymphocyte migration, and anti-viral T cell responses that lead to accelerated virus clearance, approximating what occurs during attenuation of IFNAR signaling. Comparatively, blockade of IFNα was not associated with improved viral control, but with early dissemination of virus. Thus, despite their use of the same receptor, IFNβ and IFNα have unique and distinguishable biologic functions, with IFNβ being mainly responsible for promoting viral persistence. Copyright © 2015 Elsevier Inc. All rights reserved.

Establishment of a novel endothelial target mouse model of a typhus group rickettsiosis: evidence for critical roles for gamma interferon and CD8 T lymphocytes.

PubMed

Walker, D H; Popov, V L; Feng, H M

2000-09-01

A mouse model of typhus rickettsiosis that reproduces the hematogenous dissemination to the critical target organs, including brain, lungs, heart, and kidneys, primary endothelial and, to a lesser degree, macrophage intracellular rickettsial infection, and typical vascular-based lesions of louse-borne typhus and murine typhus was established. Intravenous inoculation of C3H/HeN mice with Rickettsia typhi caused disease with a duration of the incubation period and mortality rate that were dependent on the infective dose of rickettsiae. Lethal infection was associated with high concentrations of R. typhi in the lungs and brain, despite a brisker humoral immune response to the rickettsiae than in the sublethal infection. Gamma interferon and CD8 T lymphocytes were demonstrated to be crucial to clearance of the rickettsiae and recovery from infection in experiments in which specific monoclonal antibodies were administered to deplete these components. Death of animals depleted of gamma interferon or CD8 T lymphocytes was associated with overwhelming rickettsial infection demonstrated by titers of infectious rickettsiae and by immunohistochemistry. An effective antirickettsial immune response was associated with elevated serum concentrations of IL-12 on Day 5 and increased secretion of IL-12 by concanavalin-A-stimulated spleen cells on Day 5. Evidence for transient suppression of the immune response consisted of marked reduction in the secretion of IL-2 and IL-12 by concanavalin-A-stimulated spleen cells on Days 10 and 15. This model offers excellent opportunities for study of attenuation and pathogenetic mechanisms of typhus rickettsiae, which are established biologic weapons of potential use in bioterrorism.

Excessive interferon-α signaling in autoimmunity alters glycosphingolipid processing in B cells.

PubMed

Tan, Andy Hee-Meng; Sanny, Arleen; Ng, Sze-Wai; Ho, Ying-Swan; Basri, Nurhidayah; Lee, Alison Ping; Lam, Kong-Peng

2018-05-01

Excessive interferon-α (IFN-α) production by innate immune cells is a hallmark of autoimmune diseases. What other cell type secretes IFN-α and how IFN-α affects immune cell metabolism and homeostasis in autoimmunity are largely unclear. Here, we report that autoimmune B cells, arising from two different B cell-specific genetic lesions in mice, secrete IFN-α. In addition, IFN-α, found in abundance in autoimmunity, elicited profound changes in the B cell lipidome, increasing their expression of glycosphingolipids (GSLs) and leading to their CD1d-mediated depletion of iNKT cells in vitro and in vivo. IFN-α receptor blockade could reverse the loss of iNKT cells. Excessive stimulation of B cells with IFN-α altered the expression of enzymes that catalyze critical steps in GSL processing, increasing the expressions of glucosylceramide synthase (GCS) and globotrihexosylceramide synthase (Gb3S) but decreasing that of α-galactosidase A (α-galA). Inhibiting GCS or restoring α-galA expression prevented iNKT depletion by IFN-α-activated B cells. Taken together, our work indicated that excessive IFN-α perturbs GSL metabolism in B cells which in turn adversely affects iNKT homeostasis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effect of recombinant human gamma interferon on intracellular activities of antibiotics against Listeria monocytogenes in the human macrophage cell line THP-1.

PubMed Central

Scorneaux, B; Ouadrhiri, Y; Anzalone, G; Tulkens, P M

1996-01-01

Listeria monocytogenes is a facultative intracellular pathogen which enters cells by endocytosis and reaches phagolysosomes from where it escapes and multiplies in the cytosol of untreated cells. Exposure of macrophages to gamma interferon (IFN-gamma) restricts L. monocytogenes to phagosomes and prevents its intracellular multiplication. We have tested whether IFN-gamma also modulates the susceptibility of L. monocytogenes to antibiotics. We selected drugs from three different classes displaying marked properties concerning their cellular accumulation and subcellular distribution, namely, ampicillin (not accumulated by cells but present in cytosol), azithromycin (largely accumulated by cells but mostly restricted to lysosomes), and sparfloxacin (accumulated to a fair extent but detected only in cytosol). We used a continuous line of myelomonocytic cells (THP-1 macrophages), which display specific surface receptors for IFN-gamma, and examined the activity of these antibiotics against L. monocytogenes Hly+ (virulent variant) and L. monocytogenes Hly- (a nonvirulent variant defective in hemolysin production). Untreated THP-1 and phorbol myristate acetate-differentiated THP-1 were permissive for infection and multiplication of intracellular L. monocytogenes Hly+ (virulent variant). All three antibiotics tested were bactericidal against this Listeria strain when added to an extracellular concentration of 10x their MIC. After preexposure of THP-1 to IFN-gamma, L. monocytogenes Hly+ was still phagocytosed but no longer grew intracellularly. The activity of ampicillin became almost undetectable (antagonistic effect), and that of azithromycin was unchanged (additive effect with that of IFN-gamma), whereas that of sparfloxacin was markedly enhanced (synergy). A similar behavior (lack of bacterial growth, associated with a loss of activity of ampicillin, an enhanced activity of sparfloxacin, and unchanged activity of azithromycin) was observed in cells infected with L

Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma.

PubMed

Magee, Kelsey E; Kelsey, Christina E; Kurzinski, Katherine L; Ho, Jonhan; Mlakar, Logan R; Feghali-Bostwick, Carol A; Torok, Kathryn S

2013-01-01

The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS.

Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma

PubMed Central

2013-01-01

Introduction The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. Methods The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). Results IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Conclusions Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS. PMID:24499523

The population genetics of the alpha-2 globin locus of orangutans (Pongo pygmaeus).

PubMed

Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

2005-03-01

In this study, the molecular population genetics of the orangutan's alpha-2 globin (HBA2) gene were investigated in order to test for the action of natural selection. Haplotypes from 28 orangutan chromosomes were collected from a 1.46-kilobase region of the alpha-2 globin locus. While many aspects of the data were consistent with neutrality, the observed heterogeneous distribution of polymorphisms was inconsistent with neutral expectations. Furthermore, a single amino acid variant, found in both the Bornean and the Sumatran orangutan subspecies, was associated with different alternative synonymous variants in each subspecies, suggesting that the allele may have spread separately through the two subspecies after two distinct origination events. This variant is not in Hardy-Weinberg equilibrium (HWE). These observations are consistent with neutral models that incorporate population structure and models that invoke selection. The orangutan Plasmodium parasite is a plausible selective agent that may underlie the variation at alpha-2 globin in orangutans.

Delayed translational silencing of ceruloplasmin transcript in gamma interferon-activated U937 monocytic cells: role of the 3' untranslated region

NASA Technical Reports Server (NTRS)

Mazumder, B.; Fox, P. L.

1999-01-01

Ceruloplasmin (Cp) is an acute-phase protein with ferroxidase, amine oxidase, and pro- and antioxidant activities. The primary site of Cp synthesis in human adults is the liver, but it is also synthesized by cells of monocytic origin. We have shown that gamma interferon (IFN-gamma) induces the synthesis of Cp mRNA and protein in monocytic cells. We now report that the induced synthesis of Cp is terminated by a mechanism involving transcript-specific translational repression. Cp protein synthesis in U937 cells ceased after 16 h even in the presence of abundant Cp mRNA. RNA isolated from cells treated with IFN-gamma for 24 h exhibited a high in vitro translation rate, suggesting that the transcript was not defective. Ribosomal association of Cp mRNA was examined by sucrose centrifugation. When Cp synthesis was high, i.e., after 8 h of IFN-gamma treatment, Cp mRNA was primarily associated with polyribosomes. However, after 24 h, when Cp synthesis was low, Cp mRNA was primarily in the nonpolyribosomal fraction. Cytosolic extracts from cells treated with IFN-gamma for 24 h, but not for 8 h, contained a factor which blocked in vitro Cp translation. Inhibitor expression was cell type specific and present in extracts of human cells of myeloid origin, but not in several nonmyeloid cells. The inhibitory factor bound to the 3' untranslated region (3'-UTR) of Cp mRNA, as shown by restoration of in vitro translation by synthetic 3'-UTR added as a "decoy" and detection of a binding complex by RNA gel shift analysis. Deletion mapping of the Cp 3'-UTR indicated an internal 100-nucleotide region of the Cp 3'-UTR that was required for complex formation as well as for silencing of translation. Although transcript-specific translational control is common during development and differentiation and global translational control occurs during responses to cytokines and stress, to our knowledge, this is the first report of translational silencing of a specific transcript following cytokine

Results of space experiment program "Interferon". II. Influence of spaceflight conditions on the activity of interferon preparations and interferon inducers ("Interferon II").

PubMed

Tálas, M; Bátkai, L; Stöger, I; Nagy, K; Hiros, L; Konstantinova, I; Kozharinov, V

1983-01-01

The influence of spaceflight conditions on the biological activity of HuIFN-alpha preparations (lyophilized, in solution and in ointment) and interferon inducers was studied. In antiviral activity no difference was observed between the samples kept aboard the spaceship and the controls kept under ground conditions. The interferon inducers poly I:C, poly G:C and gossipol placed in the space laboratory for 7 days maintained their interferon-inducing capacity. The circulating interferon level in mice was the same irrespective of the induction being performed with flight or ground-control samples of inducers.

Effects of Chicken Interferon Gamma on Newcastle Disease Virus Vaccine Immunogenicity

PubMed Central

Cardenas-Garcia, Stivalis; Dunwoody, Robert P.; Marcano, Valerie; Diel, Diego G.; Williams, Robert J.; Gogal, Robert M.; Brown, Corrie C.; Miller, Patti J.; Afonso, Claudio L.

2016-01-01

More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFNγ) during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFNγ with Newcastle disease virus (NDV) antigens were evaluated for their ability to enhance the avian immune response and their protective capacity upon challenge with virulent NDV. These systems consisted of: 1) a DNA vaccine expressing the Newcastle disease virus fusion (F) protein co-administered with a vector expressing the chIFNγ gene for in ovo and booster vaccination, 2) a recombinant Newcastle disease virus expressing the chIFNγ gene (rZJ1*L/IFNγ) used as a live vaccine delivered in ovo and into juvenile chickens, and 3) the same rZJ1*L/IFNγ virus used as an inactivated vaccine for juvenile chickens. Co-administration of chIFNγ with a DNA vaccine expressing the F protein resulted in higher levels of morbidity and mortality, and higher amounts of virulent virus shed after challenge when compared to the group that did not receive chIFNγ. The live vaccine system co-delivering chIFNγ did not enhanced post-vaccination antibody response, nor improved survival after hatch, when administered in ovo, and did not affect survival after challenge when administered to juvenile chickens. The low dose of the inactivated vaccine co-delivering active chIFNγ induced lower antibody titers than the groups that did not receive the cytokine. The high dose of this vaccine did not increase the antibody titers or antigen-specific memory response, and did not reduce the amount of challenge virus shed or mortality after challenge. In summary, regardless of the delivery system, chIFNγ, when administered simultaneously with the vaccine antigen, did not enhance Newcastle disease virus vaccine immunogenicity. PMID:27409587

T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.

PubMed

Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong

2017-05-12

Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.

Electron transfer function versus oxygen delivery: a comparative study for several hexacoordinated globins across the animal kingdom.

PubMed

Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C

2011-01-01

Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.

Inflammation activates the interferon signaling pathways in taste bud cells.

PubMed

Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan

2007-10-03

Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.

The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

PubMed Central

Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

2017-01-01

Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor

PubMed Central

Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian

2014-01-01

Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970

Gamma interferon-induced guanylate binding protein 1 is a novel actin cytoskeleton remodeling factor.

PubMed

Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael

2014-01-01

Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.

Biomonitoring of carcinogenic substances: enzymatic digestion of globin for detecting alkylated amino acids

NASA Astrophysics Data System (ADS)

Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen

1993-03-01

We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.

Tuberculin Skin Tests versus Interferon-Gamma Release Assays in Tuberculosis Screening among Immigrant Visa Applicants.

PubMed

Chuke, Stella O; Yen, Nguyen Thi Ngoc; Laserson, Kayla F; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G; Whitworth, William C; Shah, J Jina; Painter, John A; Mazurek, Gerald H; Maloney, Susan A

2014-01-01

Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB.

Haemolytic anaemia to the alpha-interferon treatment: a proposed mechanism.

PubMed

Barbolla, L; Paniagua, C; Outeiriño, J; Prieto, E; Sánchez Fayos, J

1993-01-01

Auto-immune haemolytic anaemia (AIHA) has been found in a case of alpha-interferon treatment. Serum antibody and eluate were positive in the absence of the drug. Although the patient recovered after the treatment was stopped, DAGT remained positive for at least 8 months. The mechanism proposed to explain why this drug induced AIHA is similar to that proposed for alpha-methyl-dopa. Drugs could alter the red cell membrane and impair the immune system. Such changes have been observed with alpha-interferon and were related with increased autoimmunity.

Evaluation of microbial globin promoters for oxygen-limited processes using Escherichia coli.

PubMed

Lara, Alvaro R; Jaén, Karim E; Sigala, Juan-Carlos; Regestein, Lars; Büchs, Jochen

2017-01-01

Oxygen-responsive promoters can be useful for synthetic biology applications, however, information on their characteristics is still limited. Here, we characterized a group of heterologous microaerobic globin promoters in Escherichia coli . Globin promoters from Bacillus subtilis , Campylobacter jejuni , Deinococcus radiodurans , Streptomyces coelicolor , Salmonella typhi and Vitreoscilla stercoraria were used to express the FMN-binding fluorescent protein (FbFP), which is a non-oxygen dependent marker. FbFP fluorescence was monitored online in cultures at maximum oxygen transfer capacities (OTR max ) of 7 and 11 mmol L -1  h -1 . Different FbFP fluorescence intensities were observed and the OTR max affected the induction level and specific fluorescence emission rate (the product of the specific fluorescence intensity multiplied by the specific growth rate) of all promoters. The promoter from S. typhi displayed the highest fluorescence emission yields (the quotient of the fluorescence intensity divided by the scattered light intensity at every time-point) and rate, and together with the promoters from D. radiodurans and S. coelicolor , the highest induction ratios. These results show the potential of diverse heterologous globin promoters for oxygen-limited processes using E. coli .

Neuroglobin and cytoglobin: two new members of globin family

PubMed Central

Tosqui, Priscilla; Colombo, Marcio Francisco

2011-01-01

The globin family has long been defined by myoglobin and hemoglobin, proteins with the functions of oxygen storage and transportation, respectively. Recently, two new members of this family were discovered: neuroglobin present in neurons and retinal cells and cytoglobin found in various types of tissue. The increased expression of these proteins in hypoxic conditions first suggested a role in oxygen supply. However structural and functional differences, such as the hexacoordinated heme, a high autoxidation rate and different concentrations between different cellular types, have dismissed this hypothesis. The protective role of these globins has already been established. In vitro and in vivo studies have demonstrated increased survival of neurons under stress in the presence of neuroglobin and increased resistance to neurodegenerative diseases. However the mechanism remains unknown. Functions, including detoxification of nitric oxide, free radical scavenging and as an antioxidant and signaling of apoptosis, have also been suggested for neuroglobin and an antifibrotic function for cytoglobin. PMID:23049323

Coexistence of multiple globin genes conferring protection against nitrosative stress to the Antarctic bacterium Pseudoalteromonas haloplanktis TAC125.

PubMed

Coppola, Daniela; Giordano, Daniela; Milazzo, Lisa; Howes, Barry D; Ascenzi, Paolo; di Prisco, Guido; Smulevich, Giulietta; Poole, Robert K; Verde, Cinzia

2018-02-28

Despite the large number of globins recently discovered in bacteria, our knowledge of their physiological functions is restricted to only a few examples. In the microbial world, globins appear to perform multiple roles in addition to the reversible binding of oxygen; all these functions are attributable to the heme pocket that dominates functional properties. Resistance to nitrosative stress and involvement in oxygen chemistry seem to be the most prevalent functions for bacterial globins, although the number of globins for which functional roles have been studied via mutation and genetic complementation is very limited. The acquisition of structural information has considerably outpaced the physiological and molecular characterisation of these proteins. The genome of the Antarctic cold-adapted bacterium Pseudoalteromonas haloplanktis TAC125 (PhTAC125) contains genes encoding three distinct single-chain 2/2 globins, supporting the hypothesis of their crucial involvement in a number of functions, including protection against oxidative and nitrosative stress in the cold and O 2 -rich environment. In the genome of PhTAC125, the genes encoding 2/2 globins are constitutively transcribed, thus suggesting that these globins are not functionally redundant in their physiological function in PhTAC125. In the present study, the physiological role of one of the 2/2 globins, Ph-2/2HbO-2217, was investigated by integrating in vivo and in vitro results. This role includes the involvement in the detoxification of reactive nitrogen and O 2 species including NO by developing two in vivo and in vitro models to highlight the protective role of Ph-2/2HbO-2217 against reactive nitrogen species. The PSHAa2217 gene was cloned and over-expressed in the flavohemoglobin-deficient mutant of Escherichia coli and the growth properties and O 2 uptake in the presence of NO of the mutant carrying the PSHAa2217 gene were analysed. The ferric form of Ph-2/2HbO-2217 is able to catalyse peroxynitrite

Protective Role of Gamma Interferon during the Recall Response to Influenza Virus

PubMed Central

Bot, Adrian; Bot, Simona; Bona, Constantin A.

1998-01-01

During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110

[Effects of recombinant human alpha-2b and gamma interferons on bone marrow megakaryocyte progenitors (CFU-Meg) from patients with chronic myelocytic leukemia].

PubMed

Tanabe, Y; Dan, K; Kuriya, S; Nomura, T

1989-10-01

The effects of recombinant human interferon (IFN) alpha-2b and gamma on the bone marrow megakaryocyte progenitors (CFU-Meg) were compared between eight patients in the chronic phase of Ph1-positive chronic myelocytic leukemia (CML) and five hematologically normal patients. CFU-Meg was assayed in plasma clot culture added with phytohemagglutinin-stimulated leukocyte-conditioned medium as a source of colony stimulating activity. The average count of CFU-Meg colonies formed from the bone marrow of CML patients was 5.5 times that of normal controls. Spontaneous CFU-Meg colonies were grown in seven of eight CML patients, but in none of five controls. Colony formation by CFU-Meg in CML as well as normal bone marrow was suppressed by the two preparations of IFN in a dose dependent fashion. Their suppressive influence on colonies from CFU-Meg was comparable between CML and normal bone marrow at lower concentrations, but was less marked for CML than normal bone marrow at higher concentrations. The formation of CFU-Meg colonies from CML bone marrow was more severely suppressed by IFN-gamma than IFN-alpha-2b. Depletion of either T lymphocytes or adherent cells from the CML bone marrow cells diminished the suppressive effects of IFN-gamma, but had no influence on the effects of IFN-alpha-2b.

Effects of interferon-gamma and lipopolysaccharide on macrophage iron metabolism are mediated by nitric oxide-induced degradation of iron regulatory protein 2.

PubMed

Kim, S; Ponka, P

2000-03-03

Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.

Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.

PubMed

Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein

2016-10-01

β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.

Fabrication of fiber-optic localized surface plasmon resonance sensor and its application to detect antibody-antigen reaction of interferon-gamma

NASA Astrophysics Data System (ADS)

Jeong, Hyeon-Ho; Erdene, Norov; Lee, Seung-Ki; Jeong, Dae-Hong; Park, Jae-Hyoung

2011-12-01

A fiber-optic localized surface plasmon (FO LSPR) sensor was fabricated by gold nanoparticles (Au NPs) immobilized on the end-face of an optical fiber. When Au NPs were formed on the end-face of an optical fiber by chemical reaction, Au NPs aggregation occurred and the Au NPs were immobilized in various forms such as monomers, dimers, trimers, etc. The component ratio of the Au NPs on the end-face of the fabricated FO LSPR sensor was slightly changed whenever the sensors were fabricated in the same condition. Including this phenomenon, the FO LSPR sensor was fabricated with high sensitivity by controlling the density of Au NPs. Also, the fabricated sensors were measured for the resonance intensity for the different optical systems and analyzed for the effect on sensitivity. Finally, for application as a biosensor, the sensor was used for detecting the antibody-antigen reaction of interferon-gamma.

Identifying Mechanisms by Which Escherichia coli O157:H7 Subverts Interferon-γ Mediated Signal Transducer and Activator of Transcription-1 Activation

PubMed Central

Ho, Nathan K.; Crandall, Ian; Sherman, Philip M.

2012-01-01

Enterohemorrhagic Escherichia coli serotype O157:H7 is a food borne enteric bacterial pathogen that causes significant morbidity and mortality in both developing and industrialized nations. E. coli O157:H7 infection of host epithelial cells inhibits the interferon gamma pro-inflammatory signaling pathway, which is important for host defense against microbial pathogens, through the inhibition of Stat-1 tyrosine phosphorylation. The aim of this study was to determine which bacterial factors are involved in the inhibition of Stat-1 tyrosine phosphorylation. Human epithelial cells were challenged with either live bacteria or bacterial-derived culture supernatants, stimulated with interferon-gamma, and epithelial cell protein extracts were then analyzed by immunoblotting. The results show that Stat-1 tyrosine phosphorylation was inhibited by E. coli O157:H7 secreted proteins. Using sequential anion exchange and size exclusion chromatography, YodA was identified, but not confirmed to mediate subversion of the Stat-1 signaling pathway using isogenic mutants. We conclude that E. coli O157:H7 subverts Stat-1 tyrosine phosphorylation in response to interferon-gamma through a still as yet unidentified secreted bacterial protein. PMID:22253910

Altered interferon-γ response in patients with Q-fever fatigue syndrome.

PubMed

Keijmel, Stephan P; Raijmakers, Ruud P H; Bleeker-Rovers, Chantal P; van der Meer, Jos W M; Netea, Mihai G; Schoffelen, Teske; van Deuren, Marcel

2016-04-01

Whether immunological mechanisms underlie Q-fever fatigue syndrome (QFS) remains unclear. For acute Q-fever, the antigen-specific interferon-γ (IFNγ) response may be a useful tool for diagnosis, and the IFNγ/interleukin(IL)-2 production ratio may be a marker for chronic Q-fever and treatment monitoring. Here we explored the specific IFNγ production and IFNγ/IL-2 ratio in QFS patients. IFNγ and IL-2 production were tested in ex-vivo stimulated whole blood of QFS patients (n = 20), and compared to those previously determined in seropositive controls (n = 135), and chronic Q-fever patients (n = 28). Also, the correlation between patient characteristics and IFNγ, IL-2, and IFNγ/IL-2 ratio was determined. QFS patients were younger (p < 0.001), but gender distribution was similar to seropositive controls and chronic Q-fever patients. Coxiella burnetii Nine Mile stimulation revealed a higher IFNγ production in QFS (median 319.5 pg/ml) than in seropositive controls (120 pg/ml, p < 0.01), but comparable to chronic Q-fever (2846 pg/ml). The IFNγ/IL-2 ratio was similar to that in seropositive controls, but lower than in chronic Q-fever patients (p < 0.01). Symptom duration was positively correlated with IL-2 production, and negatively correlated with the IFNγ/IL-2 ratio. These results point to an altered cell-mediated immunity in QFS, and suggest a different immune response than in chronic Q-fever. Copyright © 2016 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

Persistently retained interferon-gamma responsiveness in individuals with a history of pulmonary tuberculosis.

PubMed

Seo, Kwang Won; Ahn, Jong-Joon; Ra, Seung Won; Kwon, Woon-Jung; Jegal, Yangjin

2014-06-01

The interferon gamma (IFN-γ) release assays (IGRAs) are the best method of detecting Mycobacterium tuberculosis infection. However, reports on IGRAs results obtained during and right after the treatment of tuberculosis (TB) have presented differing results. Some studies have shown declining responses, whereas other reports described persistent, fluctuating, or increasing responses. We postulated that the IGRA-positivity will decrease or revert long time after treatment of TB, and thus, evaluated the response of IGRA in subjects with a history of pulmonary TB. Seventy subjects (M:F = 51:19; age = 53.2 ± 11.8 years) underwent tuberculin skin tests (TSTs) and IGRA. The interval of time elapsed after the completion of anti-TB treatment was < 10 years for 16 subjects, 10-20 years for 13 subjects, 20-30 years for 16 subjects, and ≥ 30 years for 25 subjects. The TST was positive in 49 subjects (74%) and negative in 17 subjects (26%). The IGRA was positive in 52 subjects (74%) and negative in 18 subjects (26%). The IFN-γ level and the size of induration showed good correlation (r = 0.525, P < 0.001). However, the correlation between time elapsed after the completion of anti-TB treatment and the size of induration or that between time and the IFN-γ level was not significant. The TST and IGRA were positive in 72.7% and 68.0% of subjects ≥ 30 years after the treatment of pulmonary TB. In conclusion, majority of subjects with a history of pulmonary TB are IGRA-positive, even a few decades after the completion of anti-TB treatment.

Assessment of safety and interferon gamma responses of Mycobacterium bovis BCG vaccine in goat kids and milking goats.

PubMed

Pérez de Val, Bernat; Vidal, Enric; López-Soria, Sergio; Marco, Alberto; Cervera, Zoraida; Martín, Maite; Mercader, Irene; Singh, Mahavir; Raeber, Alex; Domingo, Mariano

2016-02-10

Vaccination of domestic animals has emerged as an alternative long-term strategy for the control of tuberculosis (TB). A trial under field conditions was conducted in a TB-free goat herd to assess the safety of the Mycobacterium bovis BCG vaccine. Eleven kids and 10 milking goats were vaccinated with BCG. Bacterial shedding and interferon gamma (IFN-γ) responses were monitored throughout the study. Comprehensive pathological examination and mycobacterial culture of target tissues were performed. BCG vaccine strain was only isolated from the draining lymph node of the injection site of a kid euthanized at week 8 post-vaccination. The remaining animals were euthanized at week 24. Six out of 20 showed small granulomas at the injection site. BCG shedding was not detected in either faeces or in milk throughout the study. All vaccinated kids showed BCG-induced IFN-γ responses at week 8 post-vaccination. BCG vaccination of goats showed no lack of biological safety for the animals, environment and public health, and local adverse reactions were negligible. Copyright © 2016 Elsevier Ltd. All rights reserved.

The role of interferon gamma release assays in the monitoring of response to anti-tuberculosis treatment in children.

PubMed

Shaik, Junaid; Pillay, Manormoney; Jeena, Prakash

2014-09-01

Successful control of childhood TB requires early diagnosis, effective chemotherapy and a method of evaluating the response to therapy. Identification of suitable biomarkers that predict the response to anti-TB therapy may allow the duration of treatment to be shortened. The majority of biomarker studies in paediatric TB have focused on the role of T cell-based interferon-gamma (IFN-γ) release assays (IGRAs) in the diagnosis of either latent or active disease. Little has been published on the role of IGRAs in the monitoring response to therapy in children. We reviewed the available literature to ascertain the value of IGRAs in the monitoring of response to anti-TB therapy in children. We explored the results of the few studies that have investigated the role of IGRAs as markers of response to anti-TB treatment in children. We conclude that the role of IGRAs as surrogate markers appears promising. Robust clinical trials are, however, needed to entrench the value of IGRAs as surrogate biomarkers of response to anti-TB therapy in children. Copyright © 2013 Elsevier Ltd. All rights reserved.

Interferon-driven alterations of the host's amino acid metabolism in the pathogenesis of typhoid fever.

PubMed

Blohmke, Christoph J; Darton, Thomas C; Jones, Claire; Suarez, Nicolas M; Waddington, Claire S; Angus, Brian; Zhou, Liqing; Hill, Jennifer; Clare, Simon; Kane, Leanne; Mukhopadhyay, Subhankar; Schreiber, Fernanda; Duque-Correa, Maria A; Wright, James C; Roumeliotis, Theodoros I; Yu, Lu; Choudhary, Jyoti S; Mejias, Asuncion; Ramilo, Octavio; Shanyinde, Milensu; Sztein, Marcelo B; Kingsley, Robert A; Lockhart, Stephen; Levine, Myron M; Lynn, David J; Dougan, Gordon; Pollard, Andrew J

2016-05-30

Enteric fever, caused by Salmonella enterica serovar Typhi, is an important public health problem in resource-limited settings and, despite decades of research, human responses to the infection are poorly understood. In 41 healthy adults experimentally infected with wild-type S. Typhi, we detected significant cytokine responses within 12 h of bacterial ingestion. These early responses did not correlate with subsequent clinical disease outcomes and likely indicate initial host-pathogen interactions in the gut mucosa. In participants developing enteric fever after oral infection, marked transcriptional and cytokine responses during acute disease reflected dominant type I/II interferon signatures, which were significantly associated with bacteremia. Using a murine and macrophage infection model, we validated the pivotal role of this response in the expression of proteins of the host tryptophan metabolism during Salmonella infection. Corresponding alterations in tryptophan catabolites with immunomodulatory properties in serum of participants with typhoid fever confirmed the activity of this pathway, and implicate a central role of host tryptophan metabolism in the pathogenesis of typhoid fever. © 2016 Blohmke et al.

The locus control region is required for association of the murine β-globin locus with engaged transcription factories during erythroid maturation

PubMed Central

Ragoczy, Tobias; Bender, M.A.; Telling, Agnes; Byron, Rachel; Groudine, Mark

2006-01-01

We have examined the relationship between nuclear localization and transcriptional activity of the endogenous murine β-globin locus during erythroid differentiation. Murine fetal liver cells were separated into distinct erythroid maturation stages by fluorescence-activated cell sorting, and the nuclear position of the locus was determined at each stage. We find that the β-globin locus progressively moves away from the nuclear periphery with increasing maturation. Contrary to the prevailing notion that the nuclear periphery is a repressive compartment in mammalian cells, βmajor-globin expression begins at the nuclear periphery prior to relocalization. However, relocation of the locus to the nuclear interior with maturation is accompanied by an increase in βmajor-globin transcription. The distribution of nuclear polymerase II (Pol II) foci also changes with erythroid differentiation: Transcription factories decrease in number and contract toward the nuclear interior. Moreover, both efficient relocalization of the β-globin locus from the periphery and its association with hyperphosphorylated Pol II transcription factories require the locus control region (LCR). These results suggest that the LCR-dependent association of the β-globin locus with transcriptionally engaged Pol II foci provides the driving force for relocalization of the locus toward the nuclear interior during erythroid maturation. PMID:16705039

Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

PubMed Central

Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2013-01-01

In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

The effect of co-administration of DNA carrying chicken interferon-gamma gene on protection of chickens against infectious bursal disease by DNA-mediated vaccination.

PubMed

Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long

2006-11-17

The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.

Three-dimensional crystal structure of recombinant murine interferon-beta.

PubMed Central

Senda, T; Shimazu, T; Matsuda, S; Kawano, G; Shimizu, H; Nakamura, K T; Mitsui, Y

1992-01-01

The crystal structure of recombinant murine interferon-beta (IFN-beta) has been solved by the multiple isomorphous replacement method and refined to an R-factor of 20.5% against 2.6 A X-ray diffraction data. The structure shows a variant of the alpha-helix bundle with a new chain-folding topology, which seems to represent a basic structural framework of all the IFN-alpha and IFN-beta molecules belonging to the type I family. Functionally important segments of the polypeptide chain, as implied through numerous gene manipulation studies carried out so far, are spatially clustered indicating the binding site(s) to the receptor(s). Comparison of the present structure with those of other alpha-helical cytokine proteins, including porcine growth hormone, interleukin 2 and interferon gamma, indicated either a topological similarity in chain folding or a similar spatial arrangement of the alpha-helices. Images PMID:1505514

Evolutionary context for the association of γ-globin, serum uric acid, and hypertension in African Americans.

PubMed

Shriner, Daniel; Kumkhaek, Chutima; Doumatey, Ayo P; Chen, Guanjie; Bentley, Amy R; Charles, Bashira A; Zhou, Jie; Adeyemo, Adebowale; Rodgers, Griffin P; Rotimi, Charles N

2015-11-05

Hyperuricemia and associated cardio-metabolic disorders are more prevalent in African Americans than in European Americans. We used genome-wide admixture mapping and association testing to identify loci with ancestry effects on serum uric acid levels. We analyzed 1,976 African Americans from Washington, D.C, including 1,322 individuals from 328 pedigrees and 654 unrelated individuals, enrolled in the Howard University Family Study. We performed admixture mapping and genome-wide association testing using ~800 k autosomal single-nucleotide polymorphisms (SNPs). We performed fine mapping by dense genotyping. We assessed functionality by a combination of bioinformatic annotation, reporter gene assays, and gel shift experiments. We also analyzed 12,641 individuals enrolled in the National Health and Nutrition Examination Survey. We detected a genome-wide significant locus on chromosome 11p15.4 at which serum uric acid levels increased with increasing African ancestry, independent of kidney function. Fine-mapping identified two independent signals in the β-globin locus. The ancestral allele at SNP rs2855126, located upstream of the hemoglobin, gamma A gene HBG1, was associated with increased serum uric acid levels and higher expression of a reporter gene relative to the derived allele. Hyperuricemia was associated with increased risk of hypertension in 3,767 African Americans (Odds Ratio = 2.48, p = 2.71 × 10(-19)). Given that increased expression of γ-globin leads to increased levels of fetal hemoglobin which confers protection against malaria, we hypothesize that evolution in Africa of protection against malaria may have occurred at the cost of increased serum uric acid levels, contributing to the high rates of hyperuricemia and associated cardio-metabolic disorders observed in African Americans.

[Interleukin 8 and interferon gamma in ocular toxoplasmosis].

PubMed

Czepiel, Jacek; Biesiada, Grazyna; Sobczyk-Krupiarz, Iwona; Miklasszewska, Grazyna; Fedak, Danuta; Solnica, Bogdan; Mach, Tomasz; Garlicki, Aleksander

2011-01-01

Toxoplasmosis is one of the most common parasitic infections in the world, it is caused by Toxoplasma gondii. The infection is typically asymptomatic or the symptoms are very mild. Approximately 10% patients have limphadenopathy, involvement of the others organs, like eyes, nervous system, liver, heart, are observed more rarely. The aim of our study was to assess the level of selected cytokines in blood among patients with ocular toxoplasmosis. We have enrolled in the study 30 patients, 19-42 years old, treated for ocular toxoplasmosis, and 20 healthy volunteers, 20-48 years old, to the control group. Tests for blood morphology, C-reactive protein, the level of IL-8 and IFN-gamma were performed in all patients. The blood parameters in toxoplasmosis group were performed before antiparasitic treatment was given. The level of IFN-gamma in blood was lower among patients with ocular toxoplasmosis comparing with control group (1.52 vs. 4.18 pg/ml; p = 0.002). The level of IL-8 in blood was lower among patients with ocular toxoplasmosis comparing with control group (22.96 vs. 94.3 pg/ml; p = 0,007). There were no correlations between analyzed cytokines and blood morphology or CRP. The low level of IFN-gamma and IL-8 in blood is important factor leading to reactivation of the ocular toxoplasmosis.

Interferon-gamma and interleukin-10 profile of children with tuberculosis in North Sumatera, Indonesia

NASA Astrophysics Data System (ADS)

Daulay, R. S.; Daulay, R. M.

2018-03-01

Cellular immunity was mediated the host immune response against Mycobacterium tuberculosis, in which cytokine and T-helper (Th) 1 cells play an important role. Interferon-gamma (IFN-γ) is a leading cytokine involved in the immune response of tuberculosis (TB).The primary function of IFN-γ is to activate macrophages in opposition Mycobacterium tuberculosis. Contrast from IFN-γ, interleukin-10 (IL-10) is considered inhibitory cytokine, important to an adequate balance between inflammatory responses. To analyze cytokine profile, particularly IFN-γ and IL-10 of the children with TB in Indonesia, a cross-sectional study was conducted at two general hospitals and seven primary health care located in Medan and Batubara, North Sumatera, Indonesia. Among 51 children with TB disease and 51 healthy children, found that IFN-γ and IL-10 levels were lower in TB patients compared to healthy children. Statistically significant decreased production of the IFN-γ levels (p=0.042) were found in TB patients 9.41 (1.10-28.06) pg/ml contrast to healthy children 6.30 (1.30-89.76) pg/ml. Homologue finding of the IL-10 levels were also found in TB patients 4.93 (0.22-48.01) pg/ml and 4.93 (0.07-81.60) pg/ml in healthy children, but not statistically significant (p=0.784). High levels of IL-10 were not proven to suppress the levels production of IFN-γ in TB patients.

Household food insecurity is associated with low interferon-gamma levels in pregnant Indian women.

PubMed

Vaidya, A; Bhosale, R; Sambarey, P; Suryavanshi, N; Young, S; Mave, V; Kanade, S; Kulkarni, V; Deshpande, P; Balasubramanian, U; Elf, J; Gupte, N; Gupta, A; Mathad, J S

2017-07-01

Over 20% of tuberculosis (TB) cases during pregnancy occur in India. To determine the association between household food insecurity and interferon-gamma (IFN-γ) levels in pregnancy. Pregnant women in India were administered the Household Food Insecurity Access Scale (HFIAS) questionnaire and underwent an IFN-γ release assay. Logistic regression was used to identify factors associated with food insecurity. Of 538 women, 60 (11%) had household food insecurity, 47 (78%) of which were moderate or severe food insecure. After mitogen stimulation, moderate or severe food insecure women had a median IFN-γ concentration of 4.2 IU/ml (IQR 2.2-9.8) vs. 8.4 IU/ml (IQR 3.0-10) in women with no or mild food insecurity (P = 0.03). In multivariate analysis, higher IFN-γ concentrations were associated with human immunodeficiency virus infection (OR 1.3, 95%CI 0.51-2.1, P = 0.001), and inversely associated with moderate or severe food insecurity (OR -1.6, 95%CI -2.9 to -0.27, P = 0.02) and the number of adults in the household (OR -0.08, 95%CI -0.16 to -0.01, P = 0.03). There was no association between food insecurity and IFN-γ response to Mycobacterium tuberculosis antigen. Food insecurity in pregnancy is associated with low IFN-γ levels. There was no association between food insecurity and IFN-γ response to M. tuberculosis antigen, but our study was underpowered to detect this outcome.

Robust Protection against Highly Virulent Foot-and-Mouth Disease Virus in Swine by Combination Treatment with Recombinant Adenoviruses Expressing Porcine Alpha and Gamma Interferons and Multiple Small Interfering RNAs

PubMed Central

Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Se-Kyung; You, Su-Hwa; Kim, Taeseong; Tark, Dongseob; Lee, Hyang-Sim; Seo, Min-Goo; Kim, Byounghan

2015-01-01

ABSTRACT Because the currently available vaccines against foot-and-mouth disease (FMD) provide no protection until 4 to 7 days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is the application of antiviral agents. Combination treatment strategies have been used to enhance the efficacy of antiviral agents, and such strategies may be advantageous in overcoming viral mechanisms of resistance to antiviral treatments. We have developed recombinant adenoviruses (Ads) for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) targeting FMDV mRNAs encoding nonstructural proteins. The antiviral effects of Ad-porcine IFN-αγ and Ad-3siRNA expression were tested in combination in porcine cells, suckling mice, and swine. We observed enhanced antiviral effects in porcine cells and mice as well as robust protection against the highly pathogenic strain O/Andong/SKR/2010 and increased expression of cytokines in swine following combination treatment. In addition, we showed that combination treatment was effective against all serotypes of FMDV. Therefore, we suggest that the combined treatment with Ad-porcine IFN-αγ and Ad-3siRNA may offer fast-acting antiviral protection and be used with a vaccine during the period that the vaccine does not provide protection against FMD. IMPORTANCE The use of current foot-and-mouth disease (FMD) vaccines to induce rapid protection provides limited effectiveness because the protection does not become effective until a minimum of 4 days after vaccination. Therefore, during outbreaks antiviral agents remain the only available treatment to confer rapid protection and reduce the spread of foot-and-mouth disease virus (FMDV) in livestock until vaccine-induced protective immunity can become effective. Interferons (IFNs) and small interfering RNAs (siRNAs) have been reported to be effective antiviral agents against

The beta -globin locus control region (LCR) functions primarily by enhancing the transition from transcription initiation to elongation.

PubMed

Sawado, Tomoyuki; Halow, Jessica; Bender, M A; Groudine, Mark

2003-04-15

To investigate the molecular basis of beta-globin gene activation, we analyzed factor recruitment and histone modification at the adult beta-globin gene in wild-type (WT)/locus control region knockout (DeltaLCR) heterozygous mice and in murine erythroleukemia (MEL) cells. Although histone acetylation and methylation (Lys 4) are high before and after MEL differentiation, recruitment of the erythroid-specific activator NF-E2 to the promoter and preinitiation complex (PIC) assembly occur only after differentiation. We reported previously that targeted deletion of the LCR reduces beta-globin gene expression to 1%-4% of WT without affecting promoter histone acetylation. Here, we report that NF-E2 is recruited equally efficiently to the adult beta-globin promoters of the DeltaLCR and WT alleles. Moreover, the LCR deletion reduces PIC assembly only twofold, but has a dramatic effect on Ser 5 phosphorylation of RNA polymerase II and transcriptional elongation. Our results suggest at least three distinct stages in beta-globin gene activation: (1) an LCR-independent chromatin opening stage prior to NF-E2 recruitment to the promoter and PIC assembly; (2) an intermediate stage in which NF-E2 binding (LCR-independent) and PIC assembly (partially LCR-dependent) occur; and (3) an LCR-dependent fully active stage characterized by efficient pol II elongation. Thus, in its native location the LCR functions primarily downstream of activator recruitment and PIC assembly.

Interferon-gamma and interlukin-4 patterns in BALB/c mice suffering from cutaneous leishmaniasis treated with cantharidin.

PubMed

Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

2014-06-01

Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. INFECTED BALB/C MICE WERE DIVIDED INTO FIVE GROUPS AS: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth.

Interferon-Gamma and Interlukin-4 Patterns in BALB/c Mice Suffering From Cutaneous Leishmaniasis Treated With Cantharidin

PubMed Central

Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh

2014-01-01

Background: Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. Objectives: The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. Materials and Methods: Infected BALB/c mice were divided into five groups as: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. Results: The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. Conclusions: The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth. PMID:25371808

Identification and Characterization of Neospora caninum Cyclophilin That Elicits Gamma Interferon Production

PubMed Central

Tuo, Wenbin; Fetterer, Raymond; Jenkins, Mark; Dubey, J. P.

2005-01-01

Gamma interferon (IFN-γ) response is essential to the development of a host protective immunity in response to infections by intracellular parasites. Neosporosis, an infection caused by the intracellular protozoan parasite Neospora caninum, is fatal when there is a complete lack of IFN-γ in the infected host. However, the mechanism by which IFN-γ is elicited by the invading parasite is unclear. This study has identified a microbial protein in the N. caninum tachyzoite N. caninum cyclophilin (NcCyP) as a major component of the parasite responsible for the induction of IFN-γ production by bovine peripheral blood mononuclear cells (PBMC) and antigen-specific CD4+ T cells. NcCyP has high sequence homology (86%) with Toxoplasma gondii 18-kDa CyP with a calculated molecular mass of 19.4 kDa. NcCyP is a secretory protein with a predicted signal peptide of 17 amino acids. Abundant NcCyP was detected in whole-cell N. caninum tachyzoite lysate antigen (NcAg) and N. caninum tachyzoite culture supernatant. In N. caninum tachyzoite culture supernatant, three NcCyP bands of 19, 22, and 24 kDa were identified. NcAg stimulated high levels of IFN-γ production by PBMC and CD4+ T cells. The IFN-γ-inducing effect of NcAg was blocked by cyclosporine, a specific ligand for CyP, in a dose-dependent manner. Furthermore, cyclosporine abolished IFN-γ production by PBMC from naïve cows as well as PBMC and CD4+ T cells from infected/immunized cows. These results indicate that the N. caninum tachyzoite naturally produces a potent IFN-γ-inducing protein, NcCyP, which may be important for parasite survival as well as host protection. PMID:16041025

Interferon after surgery for women with advanced (Stage II-IV) epithelial ovarian cancer.

PubMed

Lawal, Aramide O; Musekiwa, Alfred; Grobler, Liesl

2013-06-06

the interferon and observation alone groups in post-surgical women who had undergone first-line chemotherapy for advanced EOC. One trial with 293 participants found that while no significant difference was observed in incidence of nausea or vomiting between the two treatment groups, significantly more flu-like symptoms (RR 2.25, 95% CI 1.73 to 2.91) and fatigue (RR 1.54, 95% CI 1.27 to 1.88) were reported in the interferon group. For the second comparison, a meta-analysis of two trials comprising 244 participants found that although there was no significant difference in overall survival between the interferon plus chemotherapy and the chemotherapy alone group (HR 1.14, 95% CI 0.74 to 1.76), women in the interferon plus chemotherapy group had worse progression free survival than those in the chemotherapy alone group (HR 1.43, 95% CI 1.02 to 2.00). Compared to chemotherapy alone, adding interferon to chemotherapy did not alter the incidence of adverse events in post-surgical women with advanced EOC. Implications for practice Based on low quality evidence, the addition of interferon to first-line chemotherapy did not alter the overall survival in post-surgical women with advanced EOC compared with chemotherapy alone. There is low quality evidence to suggest that interferon in combination with chemotherapy worsened the progression free survival in post-surgical women with advanced EOC compared with chemotherapy alone. There is not enough evidence that interferon therapy alone alters overall survival or progression free survival compared to observation alone in post-surgical women who have undergone first-line chemotherapy. Three of the five trials included in this review were stopped early and were, therefore, underpowered to detect any true effect of the intervention. The trials did not report the results of important outcomes in a uniform manner, preventing statistical aggregation of the results. Trial methodology was poorly reported resulting in unclear risk of bias

Added value of interferon-gamma release assays in screening for tuberculous infection in the Netherlands.

PubMed

Erkens, C G M; Dinmohamed, A G; Kamphorst, M; Toumanian, S; van Nispen-Dobrescu, R; Alink, M; Oudshoorn, N; Mensen, M; van den Hof, S; Borgdorff, M; Verver, S

2014-04-01

Interferon-gamma release assays (IGRAs) are reported to be more specific for the diagnosis of latent tuberculous infection (LTBI) than the tuberculin skin test (TST). The two-step procedure, TST followed by an IGRA, is reported to be cost-effective in high-income countries, but it requires more financial resources. To assess the added value of IGRA compared to TST alone in the Netherlands. Test results and background data on persons tested with an IGRA were recorded by the Public Municipal Health Services in a web-based database. The number of persons diagnosed with LTBI using different screening algorithms was calculated. In those tested with an IGRA, at least 60% of persons who would have been diagnosed with LTBI based on TST alone had a negative IGRA. Among those with a TST reaction below the cut-off for the diagnosis of LTBI, 13% had a positive IGRA. For 41% of persons tested with an IGRA after TST, the IGRA influenced whether or not an LTBI diagnosis would be made. With the IGRA as reference standard, a high proportion of persons in low-prevalence settings are treated unnecessarily for LTBI if tested with TST alone, while a small proportion eligible for preventive treatment are missed. Incremental costs of the two-step strategy seem to be balanced by the improved targeting of preventive treatment.

Stimulated peripheral production of interferon-gamma is related to fatigue and depression in multiple sclerosis.

PubMed

Pokryszko-Dragan, A; Frydecka, I; Kosmaczewska, A; Ciszak, L; Bilińska, M; Gruszka, E; Podemski, R; Frydecka, D

2012-10-01

The aim of the study was to evaluate the stimulated production of interferon-gamma (IFNγ) by peripheral CD3+CD4+ T lymphocytes in patients with multiple sclerosis (MS) with regard to the degree of fatigue, and to investigate relationships between immunological parameters, level of depression and clinical variables. Forty MS patients (30 women, 10 men, aged 22-60 years): 20 fatigued and 20 non-fatigued were involved in the study. Fatigue was evaluated using the Fatigue Severity Scale (FSS) and Modified Fatigue Impact Scale (MFIS), depression level - using Beck Depression Inventory (BDI). Production of IFNγ by stimulated peripheral blood CD3+CD4+ T lymphocytes, assessed using flow cytometry, was compared between MS patients with different levels of fatigue and controls. Correlations were searched out between immunological findings and BDI, age, duration and course of MS, relapse rate, disability (assessed in Expanded Disability Status Scale - EDSS) and its progression. Stimulated production of IFNγ by CD3+CD4+ T lymphocytes was higher in severely fatigued patients in comparison with non-fatigued ones and controls, tended to correlate with FSS and MFIS, and correlated with BDI. No relationships were found between immunological findings and disease-related variables. Stimulated production of IFNγ by peripheral CD3+CD4+ T lymphocytes is related to fatigue and depression in MS patients. Copyright © 2012 Elsevier B.V. All rights reserved.

Tuberculin Skin Tests versus Interferon-Gamma Release Assays in Tuberculosis Screening among Immigrant Visa Applicants

PubMed Central

Chuke, Stella O.; Yen, Nguyen Thi Ngoc; Laserson, Kayla F.; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G.; Whitworth, William C.; Shah, J. Jina; Painter, John A.; Mazurek, Gerald H.; Maloney, Susan A.

2014-01-01

Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB. PMID:24738031

Erythroid activator NF-E2, TAL1 and KLF1 play roles in forming the LCR HSs in the human adult β-globin locus.

PubMed

Kim, Yea Woon; Yun, Won Ju; Kim, AeRi

2016-06-01

The β-like globin genes are developmental stage specifically transcribed in erythroid cells. The transcription of the β-like globin genes requires erythroid specific activators such as GATA-1, NF-E2, TAL1 and KLF1. However, the roles of these activators have not fully elucidated in transcription of the human adult β-globin gene. Here we employed hybrid MEL cells (MEL/ch11) where a human chromosome containing the β-globin locus is present and the adult β-globin gene is highly transcribed by induction. The roles of erythroid specific activators were analyzed by inhibiting the expression of NF-E2, TAL1 or KLF1 in MEL/ch11 cells. The loss of each activator decreased the transcription of human β-globin gene, locus wide histone hyperacetylation and the binding of other erythroid specific activators including GATA-1, even though not affecting the expression of other activators. Notably, sensitivity to DNase I was reduced in the locus control region (LCR) hypersensitive sites (HSs) with the depletion of activators. These results indicate that NF-E2, TAL1 and KLF1, all activators play a primary role in HSs formation in the LCR. It might contribute to the transcription of human adult β-globin gene by allowing the access of activators and cofactors. The roles of activators in the adult β-globin locus appear to be different from the roles in the early fetal locus. Copyright © 2016 Elsevier Ltd. All rights reserved.

High Fractional Occupancy of a Tandem Maf Recognition Element and Its Role in Long-Range β-Globin Gene Regulation

PubMed Central

Stees, Jared R.; Hossain, Mir A.; Sunose, Tomoki; Kudo, Yasushi; Pardo, Carolina E.; Nabilsi, Nancy H.; Darst, Russell P.; Poudyal, Rosha; Igarashi, Kazuhiko; Kladde, Michael P.

2015-01-01

Enhancers and promoters assemble protein complexes that ultimately regulate the recruitment and activity of RNA polymerases. Previous work has shown that at least some enhancers form stable protein complexes, leading to the formation of enhanceosomes. We analyzed protein-DNA interactions in the murine β-globin gene locus using the methyltransferase accessibility protocol for individual templates (MAPit). The data show that a tandem Maf recognition element (MARE) in locus control region (LCR) hypersensitive site 2 (HS2) reveals a remarkably high degree of occupancy during differentiation of mouse erythroleukemia cells. Most of the other transcription factor binding sites in LCR HS2 or in the adult β-globin gene promoter regions exhibit low fractional occupancy, suggesting highly dynamic protein-DNA interactions. Targeting of an artificial zinc finger DNA-binding domain (ZF-DBD) to the HS2 tandem MARE caused a reduction in the association of MARE-binding proteins and transcription complexes at LCR HS2 and the adult βmajor-globin gene promoter but did not affect expression of the βminor-globin gene. The data demonstrate that a stable MARE-associated footprint in LCR HS2 is important for the recruitment of transcription complexes to the adult βmajor-globin gene promoter during erythroid cell differentiation. PMID:26503787

Comparison of ligand migration and binding in heme proteins of the globin family

NASA Astrophysics Data System (ADS)

Karin, Nienhaus; Ulrich Nienhaus, G.

2015-12-01

The binding of small diatomic ligands such as carbon monoxide or dioxygen to heme proteins is among the simplest biological processes known. Still, it has taken many decades to understand the mechanistic aspects of this process in full detail. Here, we compare ligand binding in three heme proteins of the globin family, myoglobin, a dimeric hemoglobin, and neuroglobin. The combination of structural, spectroscopic, and kinetic experiments over many years by many laboratories has revealed common properties of globins and a clear mechanistic picture of ligand binding at the molecular level. In addition to the ligand binding site at the heme iron, a primary ligand docking site exists that ensures efficient ligand binding to and release from the heme iron. Additional, secondary docking sites can greatly facilitate ligand escape after its dissociation from the heme. Although there is only indirect evidence at present, a preformed histidine gate appears to exist that allows ligand entry to and exit from the active site. The importance of these features can be assessed by studies involving modified proteins (via site-directed mutagenesis) and comparison with heme proteins not belonging to the globin family.

Reversal in fatigued athletes of a defect in interferon gamma secretion after administration of Lactobacillus acidophilus.

PubMed

Clancy, R L; Gleeson, M; Cox, A; Callister, R; Dorrington, M; D'Este, C; Pang, G; Pyne, D; Fricker, P; Henriksson, A

2006-04-01

Fatigue and impaired performance in athletes is well recognised and has been loosely linked to "overtraining". Reduced concentration of IgA in the saliva and increased shedding of Epstein Barr virus (EBV) have been associated with intense training in elite athletes. To determine whether athletes presenting with fatigue and impaired performance had an immune defect relevant to defective containment of EBV infection, and whether a probiotic preparation (Lactobacillus acidophilus) shown to enhance mucosal immunity in animal models could reverse any detected abnormality. The fatigued athletes had clinical characteristics consistent with re-activation of EBV infection and significantly (p = 0.02) less secretion of interferon (IFN) gamma from blood CD4 positive T cells. After one month of daily capsules containing 2 x 10(10) colony forming units of L acidophilus, secretion of IFNgamma from T cells had increased significantly (p = 0.01) to levels found in healthy control athletes. A significant (p = 0.03) increase in salivary IFNgamma concentrations in healthy control athletes after the one month course of L acidophilus demonstrated in man the capacity for this probiotic to enhance the mucosal IFNgamma concentration. This is the first evidence of a T cell defect in fatigued athletes, and of its reversal following probiotic therapy.

Bergamot (Citrus bergamia Risso) fruit extracts as γ-globin gene expression inducers: phytochemical and functional perspectives.

PubMed

Guerrini, Alessandra; Lampronti, Ilaria; Bianchi, Nicoletta; Zuccato, Cristina; Breveglieri, Giulia; Salvatori, Francesca; Mancini, Irene; Rossi, Damiano; Potenza, Rocco; Chiavilli, Francesco; Sacchetti, Gianni; Gambari, Roberto; Borgatti, Monica

2009-05-27

Epicarps of Citrus bergamia fruits from organic farming were extracted with the objective of obtaining derived products differently rich in coumarins and psoralens. The extracts were chemically characterized by (1)H nuclear magnetic resonance (NMR), gas chromatography-flame ionization detection (GC-FID), gas chromatography-mass spectrometry (GC-MS), and high-pressure liquid chromatography (HPLC) for detecting and quantifying the main constituents. Both bergamot extracts and chemical standards corresponding to the main constituents detected were then assayed for their capacity to increase erythroid differentiation of K562 cells and expression of γ-globin genes in human erythroid precursor cells. Three experimental cell systems were employed: (a) the human leukemic K562 cell line, (b) K562 cell clones stably transfected with a pCCL construct carrying green-enhanced green fluorescence protein (EGFP) under the γ-globin gene promoter, and (c) the two-phase liquid culture of human erythroid progenitors isolated from healthy donors. The results suggest that citropten and bergapten are powerful inducers of differentiation and γ-globin gene expression in human erythroid cells. These data could have practical relevance, because pharmacologically mediated regulation of human γ-globin gene expression, with the consequent induction of fetal hemoglobin, is considered to be a potential therapeutic approach in hematological disorders, including β-thalassemia and sickle cell anemia.

A majority of mice show long-term expression of a human. beta. -globin gene after retrovirus transfer into hematopoietic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bender, M.A.; Gelinas, R.E.; Miller

1989-04-01

Murine bone marrow was infected with a high-titer retrovirus vector containing the human {beta}-globin and neomycin phosphotransferase genes. Anemic W/W/sup v/ mice were transplanted with infected marrow which in some cases had been exposed to the selective agent G418. Human {beta}-globin expression was monitored in transplanted animals by using a monoclonal antibody specific for human {beta}-globin polypeptide, and hematopoietic reconstitution was monitored by using donor and recipient mice which differed in hemoglobin type. In some experiments all transplanted mice expressed the human {beta}-globin polypeptide for over 4 months, and up to 50% of peripheral erythrocytes contained detectable levels of polypeptide.more » DNA analysis of transplanted animals revealed that virtually every myeloid cell contained a provirus. Integration site analysis and reconstitution of secondary marrow recipients suggested that every mouse was reconstituted with at least one infected stem cell which had extensive repopulation capability. The ability to consistently transfer an active {beta}-globin gene into mouse hematopoietic cells improves the feasibility of using these techniques for somatic cell gene therapy in humans.« less

Target-based drug discovery for [Formula: see text]-globin disorders: drug target prediction using quantitative modeling with hybrid functional Petri nets.

PubMed

Mehraei, Mani; Bashirov, Rza; Tüzmen, Şükrü

2016-10-01

Recent molecular studies provide important clues into treatment of [Formula: see text]-thalassemia, sickle-cell anaemia and other [Formula: see text]-globin disorders revealing that increased production of fetal hemoglobin, that is normally suppressed in adulthood, can ameliorate the severity of these diseases. In this paper, we present a novel approach for drug prediction for [Formula: see text]-globin disorders. Our approach is centered upon quantitative modeling of interactions in human fetal-to-adult hemoglobin switch network using hybrid functional Petri nets. In accordance with the reverse pharmacology approach, we pose a hypothesis regarding modulation of specific protein targets that induce [Formula: see text]-globin and consequently fetal hemoglobin. Comparison of simulation results for the proposed strategy with the ones obtained for already existing drugs shows that our strategy is the optimal as it leads to highest level of [Formula: see text]-globin induction and thereby has potential beneficial therapeutic effects on [Formula: see text]-globin disorders. Simulation results enable verification of model coherence demonstrating that it is consistent with qPCR data available for known strategies and/or drugs.

Reproducibility of Interferon Gamma (IFN-γ) Release Assays. A Systematic Review

PubMed Central

Tagmouti, Saloua; Slater, Madeline; Benedetti, Andrea; Kik, Sandra V.; Banaei, Niaz; Cattamanchi, Adithya; Metcalfe, John; Dowdy, David; van Zyl Smit, Richard; Dendukuri, Nandini

2014-01-01

Rationale: Interferon gamma (IFN-γ) release assays for latent tuberculosis infection result in a larger-than-expected number of conversions and reversions in occupational screening programs, and reproducibility of test results is a concern. Objectives: Knowledge of the relative contribution and extent of the individual sources of variability (immunological, preanalytical, or analytical) could help optimize testing protocols. Methods: We performed a systematic review of studies published by October 2013 on all potential sources of variability of commercial IFN-γ release assays (QuantiFERON-TB Gold In-Tube and T-SPOT.TB). The included studies assessed test variability under identical conditions and under different conditions (the latter both overall and stratified by individual sources of variability). Linear mixed effects models were used to estimate within-subject SD. Measurements and Main Results: We identified a total of 26 articles, including 7 studies analyzing variability under the same conditions, 10 studies analyzing variability with repeat testing over time under different conditions, and 19 studies reporting individual sources of variability. Most data were on QuantiFERON (only three studies on T-SPOT.TB). A considerable number of conversions and reversions were seen around the manufacturer-recommended cut-point. The estimated range of variability of IFN-γ response in QuantiFERON under identical conditions was ±0.47 IU/ml (coefficient of variation, 13%) and ±0.26 IU/ml (30%) for individuals with an initial IFN-γ response in the borderline range (0.25–0.80 IU/ml). The estimated range of variability in noncontrolled settings was substantially larger (±1.4 IU/ml; 60%). Blood volume inoculated into QuantiFERON tubes and preanalytic delay were identified as key sources of variability. Conclusions: This systematic review shows substantial variability with repeat IFN-γ release assays testing even under identical conditions, suggesting that reversions

HbVar: A relational database of human hemoglobin variants and thalassemia mutations at the globin gene server.

PubMed

Hardison, Ross C; Chui, David H K; Giardine, Belinda; Riemer, Cathy; Patrinos, George P; Anagnou, Nicholas; Miller, Webb; Wajcman, Henri

2002-03-01

We have constructed a relational database of hemoglobin variants and thalassemia mutations, called HbVar, which can be accessed on the web at http://globin.cse.psu.edu. Extensive information is recorded for each variant and mutation, including a description of the variant and associated pathology, hematology, electrophoretic mobility, methods of isolation, stability information, ethnic occurrence, structure studies, functional studies, and references. The initial information was derived from books by Dr. Titus Huisman and colleagues [Huisman et al., 1996, 1997, 1998]. The current database is updated regularly with the addition of new data and corrections to previous data. Queries can be formulated based on fields in the database. Tables of common categories of variants, such as all those involving the alpha1-globin gene (HBA1) or all those that result in high oxygen affinity, are maintained by automated queries on the database. Users can formulate more precise queries, such as identifying "all beta-globin variants associated with instability and found in Scottish populations." This new database should be useful for clinical diagnosis as well as in fundamental studies of hemoglobin biochemistry, globin gene regulation, and human sequence variation at these loci. Copyright 2002 Wiley-Liss, Inc.

Altered cytokine production by specific human peripheral blood cell subsets immediately following space flight

NASA Technical Reports Server (NTRS)

Crucian, B. E.; Cubbage, M. L.; Sams, C. F.

2000-01-01

In this study, flow cytometry was used to positively identify the specific lymphocyte subsets exhibiting space flight-induced alterations in cytokine production. Whole blood samples were collected from 27 astronauts at three points (one preflight, two postflight) surrounding four space shuttle missions. Assays performed included serum/urine stress hormones, white blood cell (WBC) phenotyping, and intracellular cytokine production following mitogenic stimulation. Absolute levels of peripheral granulocytes were significantly elevated following space flight, but the levels of circulating lymphocytes and monocytes were unchanged. Lymphocyte subset analysis demonstrated a decreased percentage of T cells, whereas percentages of B cells and natural killer (NK) cells remained unchanged after flight. Nearly all the astronauts exhibited an increased CD4/CD8 T cell ratio. Assessment of naive (CD45RA+) vs. memory (CD45RO+) CD4+ T cell subsets was ambiguous, and subjects tended to group within specific missions. Although no significant trend was seen in absolute monocyte levels, a significant decrease in the percentage of the CD14+ CD16+ monocytes was seen following space flight in all subjects tested. T cell (CD3+) production of interleukin-2 (IL-2) was significantly decreased after space flight, as was IL-2 production by both CD4+ and CD8+ T cell subsets. Production of interferon-gamma (IFN-gamma) was not altered by space flight for the CD8+ cell subset, but there was a significant decrease in IFN-gamma production for the CD4+ T cell subset. Serum and urine stress hormone analysis indicated significant physiologic stresses in astronauts following space flight. Altered peripheral leukocyte subsets, altered serum and urine stress hormone levels, and altered T cell cytokine secretion profiles were all observed postflight. In addition, there appeared to be differential susceptibility to space flight regarding cytokine secretion by T cell subsets. These alterations may be the

Myxoma virus M-T7, a secreted homolog of the interferon-gamma receptor, is a critical virulence factor for the development of myxomatosis in European rabbits.

PubMed

Mossman, K; Nation, P; Macen, J; Garbutt, M; Lucas, A; McFadden, G

1996-01-01

Myxoma virus is a leporipoxvirus of New World rabbits (Sylvilagus sp.) that induces a rapidly lethal infection known as myxomatosis in the European rabbit (Oryctolagus cuniculus). Like all poxviruses, myxoma virus encodes a plethora of proteins to circumvent or inhibit a variety of host antiviral immune mechanisms. M-T7, the most abundantly secreted protein of myxoma virus-infected cells, was originally identified as an interferon-gamma receptor homolog (Upton, Mossman, and McFadden, Science 258, 1369-1372, 1992). Here, we demonstrate that M-T7 is dispensable for virus replication in cultured cells but is a critical virulence factor for virus pathogenesis in European rabbits. Disruption of both copies of the M-T7 gene in myxoma virus was achieved by the deletion of 372 bp of M-T7 coding sequences, replacement with a selectable marker, p7.5Ecogpt, and selection of a recombinant virus (vMyxlac-T7gpt) resistant to mycophenolic acid. vMyxlac-T7gpt expressed no detectable M-T7 protein and infected cells supernatants were devoid of any detectable interferon-gamma binding activities. Immunohistochemical staining with anti-beta-galactosidase and anti-CD43 antibodies demonstrated that in vMyxlac-T7gpt-infected rabbits the loss of M-T7 not only caused a dramatic reduction in disease symptoms and viral dissemination to secondary sites, but also dramatically influenced host leukocyte behavior. Notably, primary lesions in wild-type virus infections were generally underlayed by large masses of inflammatory cells that did not effectively migrate into the dermal sites of viral replication, whereas in vMyxlac-T7gpt infections this apparent block to leukocyte influx was relieved. A second major phenotypic distinction noted for the M-T7 knockout virus was the extensive activation of lymphocytes in secondary immune organs, particularly the spleen and lymph nodes, by Day 4 of the infection. This is in stark contrast to infection by wild-type myxoma virus, which results in relatively

A randomized, double-blind, phase I/II trial of tumor necrosis factor and interferon-gamma for treatment of AIDS-related complex (Protocol 025 from the AIDS Clinical Trials Group).

PubMed

Agosti, J M; Coombs, R W; Collier, A C; Paradise, M A; Benedetti, J K; Jaffe, H S; Corey, L

1992-05-01

To determine safety and efficacy of tumor necrosis factor (TNF) and interferon-gamma (IFN gamma) in the treatment of patients with acquired immunodeficiency syndrome (AIDS)-related complex, a randomized, double-blind study was conducted. Twenty-five patients with AIDS-related complex and CD4 lymphocytes less than or equal to 500 x 10(6)/L attended an AIDS Clinical Trials Unit of a tertiary referral center. Patients were administered tumor necrosis factor (TNF) (10 micrograms/m2) or IFN gamma (10 micrograms/m2), or both intramuscularly three times weekly for 16 weeks. Side effects from all three preparations included fever, constitutional symptoms, and local reactions. No significant hematologic, hepatic, renal, or coagulation abnormalities were observed. CD4 lymphocyte counts, beta 2-microglobulin, p24 antigen levels, and anti-p24 antibody did not change significantly during therapy. Similarly, no significant change was noted in rates of HIV isolation from peripheral blood mononuclear cells or plasma. TNF and IFN gamma were tolerable after premedication with acetaminophen; however, no significant change in markers of human immunodeficiency virus infection was demonstrated. These cytokines alone do not appear to be of benefit, nor do they appear to hasten the progression of HIV infection.

A novel mechanism of skin tumor promotion involving interferon-gamma (IFNγ)/signal transducer and activator of transcription-1 (Stat1) signaling.

PubMed

Bozeman, Ronald; Abel, Erika L; Macias, Everardo; Cheng, Tianyi; Beltran, Linda; DiGiovanni, John

2015-08-01

The current study was designed to explore the role of signal transducer and activator of transcription 1 (Stat1) during tumor promotion using the mouse skin multistage carcinogenesis model. Topical treatment with both 12-O-tetradecanoylphorbol-13-acetate (TPA) and 3-methyl-1,8-dihydroxy-9-anthrone (chrysarobin or CHRY) led to rapid phosphorylation of Stat1 on both tyrosine (Y701) and serine (S727) residues in epidermis. CHRY treatment also led to upregulation of unphosphorylated Stat1 (uStat1) at later time points. CHRY treatment also led to upregulation of interferon regulatory factor 1 (IRF-1) mRNA and protein, which was dependent on Stat1. Further analyses demonstrated that topical treatment with CHRY but not TPA upregulated interferon-gamma (IFNγ) mRNA in the epidermis and that the induction of both IRF-1 and uStat1 was dependent on IFNγ signaling. Stat1 deficient (Stat1(-/-) ) mice were highly resistant to skin tumor promotion by CHRY. In contrast, the tumor response (in terms of both papillomas and squamous cell carcinomas) was similar in Stat1(-/-) mice and wild-type littermates with TPA as the promoter. Maximal induction of both cyclooxygenase-2 and inducible nitric oxide synthase in epidermis following treatment with CHRY was also dependent on the presence of functional Stat1. These studies define a novel mechanism associated with skin tumor promotion by the anthrone class of tumor promoters involving upregulation of IFNγ signaling in the epidermis and downstream signaling through activated (phosphorylated) Stat1, IRF-1 and uStat1. © 2014 Wiley Periodicals, Inc.

Interferon-driven alterations of the host’s amino acid metabolism in the pathogenesis of typhoid fever

PubMed Central

Jones, Claire; Waddington, Claire S.; Zhou, Liqing; Hill, Jennifer; Clare, Simon; Mukhopadhyay, Subhankar; Schreiber, Fernanda; Roumeliotis, Theodoros I.; Yu, Lu; Ramilo, Octavio; Sztein, Marcelo B.; Kingsley, Robert A.; Levine, Myron M.

2016-01-01

Enteric fever, caused by Salmonella enterica serovar Typhi, is an important public health problem in resource-limited settings and, despite decades of research, human responses to the infection are poorly understood. In 41 healthy adults experimentally infected with wild-type S. Typhi, we detected significant cytokine responses within 12 h of bacterial ingestion. These early responses did not correlate with subsequent clinical disease outcomes and likely indicate initial host–pathogen interactions in the gut mucosa. In participants developing enteric fever after oral infection, marked transcriptional and cytokine responses during acute disease reflected dominant type I/II interferon signatures, which were significantly associated with bacteremia. Using a murine and macrophage infection model, we validated the pivotal role of this response in the expression of proteins of the host tryptophan metabolism during Salmonella infection. Corresponding alterations in tryptophan catabolites with immunomodulatory properties in serum of participants with typhoid fever confirmed the activity of this pathway, and implicate a central role of host tryptophan metabolism in the pathogenesis of typhoid fever. PMID:27217537

Molecular basis of length polymorphism in the human zeta-globin gene complex.

PubMed Central

Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J

1983-01-01

The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667

Altitudinal Variation at Duplicated β-Globin Genes in Deer Mice: Effects of Selection, Recombination, and Gene Conversion

PubMed Central

Storz, Jay F.; Natarajan, Chandrasekhar; Cheviron, Zachary A.; Hoffmann, Federico G.; Kelly, John K.

2012-01-01

Spatially varying selection on a given polymorphism is expected to produce a localized peak in the between-population component of nucleotide diversity, and theory suggests that the chromosomal extent of elevated differentiation may be enhanced in cases where tandemly linked genes contribute to fitness variation. An intriguing example is provided by the tandemly duplicated β-globin genes of deer mice (Peromyscus maniculatus), which contribute to adaptive differentiation in blood–oxygen affinity between high- and low-altitude populations. Remarkably, the two β-globin genes segregate the same pair of functionally distinct alleles due to a history of interparalog gene conversion and alleles of the same functional type are in perfect coupling-phase linkage disequilibrium (LD). Here we report a multilocus analysis of nucleotide polymorphism and LD in highland and lowland mice with different genetic backgrounds at the β-globin genes. The analysis of haplotype structure revealed a paradoxical pattern whereby perfect LD between the two β-globin paralogs (which are separated by 16.2 kb) is maintained in spite of the fact that LD within both paralogs decays to background levels over physical distances of less than 1 kb. The survey of nucleotide polymorphism revealed that elevated levels of altitudinal differentiation at each of the β-globin genes drop away quite rapidly in the external flanking regions (upstream of the 5′ paralog and downstream of the 3′ paralog), but the level of differentiation remains unexpectedly high across the intergenic region. Observed patterns of diversity and haplotype structure are difficult to reconcile with expectations of a two-locus selection model with multiplicative fitness. PMID:22042573

Role of Gamma Interferon in the Pathogenesis of Severe Schistosomiasis in Interleukin-4-Deficient Mice

PubMed Central

La Flamme, Anne Camille; Patton, Elisabeth A.; Pearce, Edward J.

2001-01-01

In the absence of interleukin-4 (IL-4), infection with Schistosoma mansoni leads to a severe fatal disease rather than the chronic survivable condition that occurs in wild-type (WT) mice. Because the sustained production of NO most closely correlates to weight loss and fatality in infected IL-4−/− mice and because gamma interferon (IFN-γ) is an important inducer of inducible NO synthase, infected IL-4−/− mice were treated with anti-IFN-γ antibodies to determine the role of IFN-γ during schistosomiasis in WT and IL-4−/− animals. When IFN-γ was neutralized, Th2 responses were enhanced and NO production was reduced in both WT and IL-4−/− mice. The decreased NO production correlated with a rescue of proliferation in splenocytes from infected IL-4−/− mice. Furthermore, the neutralization of IFN-γ in vivo improved the gross appearance of the liver and led to a reduction in granuloma size in infected IL-4−/− but not WT mice. However, the neutralization of IFN-γ in vivo did not affect the development of severe disease in infected IL-4−/− mice. These results suggest that while the increased production of IFN-γ does lead to some of the pathology observed in infected IL-4−/− mice, it is not ultimately responsible for cachexia and death. PMID:11705919

Effects of peritoneal fluid from endometriosis patients on interferon-gamma-induced protein-10 (CXCL10) and interleukin-8 (CXCL8) released by neutrophils and CD4+ T cells.

PubMed

Kim, Ji-Yeon; Lee, Dong-Hyung; Joo, Jong-Kil; Jin, Jun-O; Wang, Ji-Won; Hong, Young-Seoub; Kwak, Jong-Young; Lee, Kyu-Sup

2009-09-01

Intraperitoneal immuno-inflammatory changes may be associated with the pathogenesis of endometriosis. We evaluated the effects of peritoneal fluid obtained from patients with endometriosis (ePF) on the release of interferon-gamma-induced protein-10 (IP-10/CXCL10) and interleukin-8 (IL-8/CXCL8) by neutrophils, CD4(+) T cells, and monocytes. Neutrophils, CD4(+) T cells, and monocytes were cultured with ePF and the chemokine levels in the supernatants were then measured using enzyme-linked immunosorbent assay. The addition of ePF to cultures of CD4(+) T cells led to a significant increase in the release of IP-10 when compared with control PF without endometriosis (cPF). There was a positive correlation between the levels of IL-8 and IP-10 in ePF (R = 0.89, P = 0.041), but not between the levels of IP-10 and IL-8 released by neutrophils, CD4(+) T cells, and monocytes. The levels of IP-10 in ePF were positively correlated with the release of IP-10 by ePF-treated neutrophils (R = 0.89, P < 0.001), CD4(+) T cells (R = 0.93, P < 0.001), and monocytes (R = 0.70, P = 0.01). Moreover, the addition of ePF significantly enhanced the interferon-gamma-induced release of IP-10 by nuetrophils and CD4(+) T cells. These findings suggest that neutrophils and T cells release differential levels of IP-10 and IL-8 in response to stimulation with ePF, and that these cells are a major source of IP-10 in the PF of endometriosis patients.

Sex differences in learned fear expression and extinction involve altered gamma oscillations in medial prefrontal cortex.

PubMed

Fenton, Georgina E; Halliday, David M; Mason, Rob; Bredy, Timothy W; Stevenson, Carl W

2016-11-01

Sex differences in learned fear expression and extinction involve the medial prefrontal cortex (mPFC). We recently demonstrated that enhanced learned fear expression during auditory fear extinction and its recall is linked to persistent theta activation in the prelimbic (PL) but not infralimbic (IL) cortex of female rats. Emerging evidence indicates that gamma oscillations in mPFC are also implicated in the expression and extinction of learned fear. Therefore we re-examined our in vivo electrophysiology data and found that females showed persistent PL gamma activation during extinction and a failure of IL gamma activation during extinction recall. Altered prefrontal gamma oscillations thus accompany sex differences in learned fear expression and its extinction. These findings are relevant for understanding the neural basis of post-traumatic stress disorder, which is more prevalent in women and involves impaired extinction and mPFC dysfunction. Copyright © 2016 Elsevier Inc. All rights reserved.

Tuberculosis screening of new hospital employees: compliance, clearance to work time, and cost using tuberculin skin test and interferon-gamma release assays.

PubMed

Foster-Chang, Sarah A; Manning, Mary L; Chandler, Laura

2014-11-01

Selection of the most suitable test(s) for detection of Mycobacterium tuberculosis (TB) infection should be based on purpose, setting, effectiveness, and cost. Two tests are available to screen for latent TB: the tuberculin skin test (TST) and the more recent interferon-gamma release assays (IGRAs). Based on the administrative, logistic, and technical ease of use, an IGRA trial was initiated by the occupational health department at an urban Veteran's Administration health care facility for TB screening of new employees. As a result, new employees completing the pre-placement process within the organization's designated 14 days increased from 77% to 97%, new employee clearance to work time decreased from 13.18 to 5.91 days, and new employee TB screening costs were reduced by 40%. The IGRA is an acceptable alternative to the TST and has significant potential to improve the process of pre-placement TB screening. Copyright 2014, SLACK Incorporated.

Fish oil feeding delays influenza virus clearance and impairs production of interferon-gamma and virus-specific immunoglobulin A in the lungs of mice.

PubMed

Byleveld, P M; Pang, G T; Clancy, R L; Roberts, D C

1999-02-01

Ingestion of fish oil can suppress the inflammatory response to injury and may impair host resistance to infection. To investigate the effect of a diet containing fish oil on immunity to viral infection, 148 BALB/c mice were fed diets containing 3 g/100 g of sunflower oil with either 17 g/100 g of fish oil or beef tallow for 14 d before intranasal challenge with live influenza virus. At d 1 and d 5 after infection, the mice fed fish oil had higher lung viral load and lower body weight (P < 0.05). In addition to the greater viral load and weight loss at d 5 after infection, the fish oil group consumed less food (P < 0.05) while the beef tallow group was clearing the virus, had regained their preinfection weights and was returning to their preinfection food consumption. The fish oil group had impaired production of lung interferon-gamma (IFN-gamma), serum immunoglobulin (Ig) G and lung IgA-specific antibodies (all P < 0. 05) although lung IFN-alpha/beta and the relative proportions of bronchial lymph node CD4+ and CD8+ T lymphocytes did not differ between groups after infection. The present study demonstrates a delay in virus clearance in mice fed fish oil associated with reduced IFN-gamma and antibody production and a greater weight loss and suppression of appetite following influenza virus infection. However, differences observed during the course of infection did not affect the ultimate outcome as both groups cleared the virus and returned to preinfection food consumption and body weight by d 7.

Borrelia-primed and -infected mice deficient of interleukin-17 develop arthritis after neutralization of gamma-interferon.

PubMed

Kuo, Joseph; Warner, Thomas F; Schell, Ronald F

2017-03-01

The immune mechanisms responsible for development of Lyme arthritis are partially understood with interleukin-17 (IL-17) and gamma-interferon (IFN-γ) playing a generally accepted role. Elevated levels of IL-17 and/or IFN-γ have been reported in samples from human Lyme arthritis patients and experimental mice. In addition, IL-17 and IFN-γ have been implicated in the onset of arthritis in Borrelia-primed and -infected C57BL/6 mice. Recently, we showed that IL-17-deficient mice developed swelling and histopathological changes consistent with arthritis in the presence of high levels of IFN-γ. We hypothesized that neutralization of IFN-γ in IL-17-deficient mice would inhibit Borrelia-induced arthritis. Our results, however, showed that swelling of the hind paws and histopathological changes of arthritis did not differ between Borrelia-primed and -infected IL-17-deficient and wild-type mice with or without neutralization of IFN-γ. We also found higher levels of tumor necrosis factor alpha (TNF-α) and IL-6 in the popliteal lymph node cells of Borrelia-primed and -infected IL-17-deficient mice after neutralization of IFN-γ. These results suggest that multiple cytokines interact in the development of Borrelia-induced arthritis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Comparative inhibition of rabbit globin mRNA translation by modified antisense oligodeoxynucleotides.

PubMed Central

Cazenave, C; Stein, C A; Loreau, N; Thuong, N T; Neckers, L M; Subasinghe, C; Hélène, C; Cohen, J S; Toulmé, J J

1989-01-01

We have studied the translation of rabbit globin mRNA in cell free systems (reticulocyte lysate and wheat germ extract) and in microinjected Xenopus oocytes in the presence of anti-sense oligodeoxynucleotides. Results obtained with the unmodified all-oxygen compounds were compared with those obtained when phosphorothioate or alpha-DNA was used. In the wheat germ system a 17-mer sequence targeted to the coding region of beta-globin mRNA was specifically inhibitory when either the unmodified phosphodiester oligonucleotide or its phosphorothioate analogue were used. In contrast no effect was observed with the alpha-oligomer. These results were ascribed to the fact that phosphorothioate oligomers elicit an RNase-H activity comparable to the all-oxygen congeners, while alpha-DNA/mRNA hybrids were a poor substrate. Microinjected Xenopus oocytes followed a similar pattern. The phosphorothioate oligomer was more efficient to prevent translation than the unmodified 17-mer. Inhibition of beta-globin synthesis was observed in the nanomolar concentration range. This result can be ascribed to the nuclease resistance of phosphorothioates as compared to natural phosphodiester linkages, alpha-oligomers were devoid of any inhibitory effect up to 30 microM. Phosphorothioate oligodeoxyribonucleotides were shown to be non-specific inhibitors of protein translation, at concentrations in the micromolar range, in both cell-free systems and oocytes. Non-specific inhibition of translation was dependent on the length of the phosphorothioate oligomer. These non-specific effects were not observed with the unmodified or the alpha-oligonucleotides. Images PMID:2472605

Efficient Generation of β-Globin-Expressing Erythroid Cells Using Stromal Cell-Derived Induced Pluripotent Stem Cells from Patients with Sickle Cell Disease.

PubMed

Uchida, Naoya; Haro-Mora, Juan J; Fujita, Atsushi; Lee, Duck-Yeon; Winkler, Thomas; Hsieh, Matthew M; Tisdale, John F

2017-03-01

Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent an ideal source for in vitro modeling of erythropoiesis and a potential alternative source for red blood cell transfusions. However, iPS cell-derived erythroid cells predominantly produce ε- and γ-globin without β-globin production. We recently demonstrated that ES cell-derived sacs (ES sacs), known to express hemangioblast markers, allow for efficient erythroid cell generation with β-globin production. In this study, we generated several iPS cell lines derived from bone marrow stromal cells (MSCs) and peripheral blood erythroid progenitors (EPs) from sickle cell disease patients, and evaluated hematopoietic stem/progenitor cell (HSPC) generation after iPS sac induction as well as subsequent erythroid differentiation. MSC-derived iPS sacs yielded greater amounts of immature hematopoietic progenitors (VEGFR2 + GPA-), definitive HSPCs (CD34 + CD45+), and megakaryoerythroid progenitors (GPA + CD41a+), as compared to EP-derived iPS sacs. Erythroid differentiation from MSC-derived iPS sacs resulted in greater amounts of erythroid cells (GPA+) and higher β-globin (and βS-globin) expression, comparable to ES sac-derived cells. These data demonstrate that human MSC-derived iPS sacs allow for more efficient erythroid cell generation with higher β-globin production, likely due to heightened emergence of immature progenitors. Our findings should be important for iPS cell-derived erythroid cell generation. Stem Cells 2017;35:586-596. © 2016 AlphaMed Press.

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Effect of interferons and other biological response modifiers (BRMS) on macrophage-mediated inhibition of Listeria monocytogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badger, A.M.; Swift, B.; Sung, C.P.

1986-03-05

Recombinant murine gamma interferon (IFN-..gamma..) activates oil elicited C57BL/6 peritoneal macrophages to inhibit the growth of Listeria. Maximum activity is obtained with 10-20 units/ml, can be demonstrated in the absence of antibiotics and is not due to LPS contamination. Studies of the kinetics of this phenomenon demonstrate that a 30 minute incubation with IFN-..gamma.. is sufficient to initiate the antiproliferative state and full activity can be obtained with a 4 hour incubation. Alpha/beta interferon (IFN-..cap alpha../..beta..) is also active but requires 100X more units to obtain equivalent activity. The evaluation of a number of other BRMS demonstrated that MDP andmore » LPS could stimulate phagocytosis of Listeria but could not inhibit their growth. Bestatin, tuftsin, Con A, A23187 and Poly I:C did not stimulate either phagocytosis or growth inhibitory activity. These compounds were also tested for their ability to enhance the release of superoxide anion from PMA stimulated macrophages. With the exception of tuftsin and bestatin all of the BRMS tested were able to enhance the production of oxidative burst products confirming the findings of others of the dissociation between the two functions.« less

Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus

PubMed Central

Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi

2015-01-01

Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer–promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them. PMID:25588787

Sequence Divergence in the 3′ Untranslated Regions of Human ζ- and α-Globin mRNAs Mediates a Difference in Their Stabilities and Contributes to Efficient α-to-ζ Gene Developmental Switching

PubMed Central

Russell, J. Eric; Morales, Julia; Makeyev, Aleksandr V.; Liebhaber, Stephen A.

1998-01-01

The developmental stage-specific expression of human globin proteins is characterized by a switch from the coexpression of ζ- and α-globin in the embryonic yolk sac to exclusive expression of α-globin during fetal and adult life. Recent studies with transgenic mice demonstrate that in addition to transcriptional control elements, full developmental silencing of the human ζ-globin gene requires elements encoded within the transcribed region. In the current work, we establish that these latter elements operate posttranscriptionally by reducing the relative stability of ζ-globin mRNA. Using a transgenic mouse model system, we demonstrate that human ζ-globin mRNA is unstable in adult erythroid cells relative to the highly stable human α-globin mRNA. A critical determinant of the difference between α- and ζ-globin mRNA stability is mapped by in vivo expression studies to their respective 3′ untranslated regions (3′UTRs). In vitro messenger ribonucleoprotein (mRNP) assembly assays demonstrate that the α- and ζ-globin 3′UTRs assemble a previously described mRNP stability-determining complex, the α-complex, with distinctly different affinities. The diminished efficiency of α-complex assembly on the ζ 3′UTR results from a single C→G nucleotide substitution in a crucial polypyrimidine tract contained by both the human α- and ζ-globin mRNA 3′UTRs. A potential pathway for accelerated ζ-globin mRNA decay is suggested by the observation that its 3′UTR encodes a shortened poly(A) tail. Based upon these data, we propose a model for ζ-globin gene silencing in fetal and adult erythroid cells in which posttranscriptional controls play a central role by providing for accelerated clearance of ζ-globin transcripts. PMID:9528789

Beta-globin LCR and intron elements cooperate and direct spatial reorganization for gene therapy.

PubMed

Buzina, Alla; Lo, Mandy Y M; Moffett, Angela; Hotta, Akitsu; Fussner, Eden; Bharadwaj, Rikki R; Pasceri, Peter; Garcia-Martinez, J Victor; Bazett-Jones, David P; Ellis, James

2008-04-11

The Locus Control Region (LCR) requires intronic elements within beta-globin transgenes to direct high level expression at all ectopic integration sites. However, these essential intronic elements cannot be transmitted through retrovirus vectors and their deletion may compromise the therapeutic potential for gene therapy. Here, we systematically regenerate functional beta-globin intron 2 elements that rescue LCR activity directed by 5'HS3. Evaluation in transgenic mice demonstrates that an Oct-1 binding site and an enhancer in the intron cooperate to increase expression levels from LCR globin transgenes. Replacement of the intronic AT-rich region with the Igmu 3'MAR rescues LCR activity in single copy transgenic mice. Importantly, a combination of the Oct-1 site, Igmu 3'MAR and intronic enhancer in the BGT158 cassette directs more consistent levels of expression in transgenic mice. By introducing intron-modified transgenes into the same genomic integration site in erythroid cells, we show that BGT158 has the greatest transcriptional induction. 3D DNA FISH establishes that induction stimulates this small 5'HS3 containing transgene and the endogenous locus to spatially reorganize towards more central locations in erythroid nuclei. Electron Spectroscopic Imaging (ESI) of chromatin fibers demonstrates that ultrastructural heterochromatin is primarily perinuclear and does not reorganize. Finally, we transmit intron-modified globin transgenes through insulated self-inactivating (SIN) lentivirus vectors into erythroid cells. We show efficient transfer and robust mRNA and protein expression by the BGT158 vector, and virus titer improvements mediated by the modified intron 2 in the presence of an LCR cassette composed of 5'HS2-4. Our results have important implications for the mechanism of LCR activity at ectopic integration sites. The modified transgenes are the first to transfer intronic elements that potentiate LCR activity and are designed to facilitate correction of

Dampened STING-Dependent Interferon Activation in Bats.

PubMed

Xie, Jiazheng; Li, Yang; Shen, Xurui; Goh, Geraldine; Zhu, Yan; Cui, Jie; Wang, Lin-Fa; Shi, Zheng-Li; Zhou, Peng

2018-03-14

Compared with terrestrial mammals, bats have a longer lifespan and greater capacity to co-exist with a variety of viruses. In addition to cytosolic DNA generated by these viral infections, the metabolic demands of flight cause DNA damage and the release of self-DNA into the cytoplasm. However, whether bats have an altered DNA sensing/defense system to balance high cytosolic DNA levels remains an open question. We demonstrate that bats have a dampened interferon response due to the replacement of the highly conserved serine residue (S358) in STING, an essential adaptor protein in multiple DNA sensing pathways. Reversing this mutation by introducing S358 restored STING functionality, resulting in interferon activation and virus inhibition. Combined with previous reports on bat-specific changes of other DNA sensors such as TLR9, IFI16, and AIM2, our findings shed light on bat adaptation to flight, their long lifespan, and their unique capacity to serve as a virus reservoir. Copyright © 2018 Elsevier Inc. All rights reserved.

The effect of centaurein on interferon-{gamma} expression and Listeria infection in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, S.-L.; Department of Biological Science and Technology, National Chiao Tung University, 1001, Ta Hsueh Road, Hsinchu 300, Taiwan; Yeh, H.-H.

2007-02-15

We previously found that centaurein enhanced IFN-{gamma} transcription in T cells. Here, we demonstrate that centaurein increased the IFN-{gamma} expression in T and NK cells and the serum IFN-{gamma} level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-{gamma} but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-{gamma} expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection viamore » a modulation of IFN-{gamma} expression.« less

Comparison of Cytomegalovirus (CMV) Enzyme-Linked Immunosorbent Spot and CMV Quantiferon Gamma Interferon-Releasing Assays in Assessing Risk of CMV Infection in Kidney Transplant Recipients

PubMed Central

Saldan, Alda; Mengoli, Carlo; Fiscon, Marta; Silvestre, Cristina; Fallico, Loredana; Peracchi, Marta; Furian, Lucrezia; Cusinato, Riccardo; Bonfante, Luciana; Rossi, Barbara; Marchini, Francesco; Sgarabotto, Dino; Rigotti, Paolo; Palù, Giorgio

2013-01-01

Assessing cytomegalovirus (CMV)-specific cell-mediated immunity (CMI) represents an appealing strategy for identifying transplant recipients at risk of infection. In this study, we compared two gamma interferon-releasing assays (IGRAs), Quantiferon-CMV and CMV enzyme-linked immunosorbent spot (ELISPOT), to determine the ability of each test to predict protective CMV-specific T-cell responses. Two hundred twenty-one Quantiferon-CMV and ELISPOT tests were conducted on 120 adult kidney transplant recipients (KTRs), including 100 CMV-seropositive transplant recipients (R+) and 20 CMV-seronegative transplant recipients of a CMV-positive donor (D+/R−). As a control cohort, 39 healthy adult subjects (including 33 CMV-seropositive and 6 CMV-seronegative subjects) were enrolled. CMV IgG serology was used as a reference for both tests. In the CMV-seropositive individuals, the ELISPOT and Quantiferon-CMV assays provided 46% concordance with the serology, 12% discordance, 18% disagreement between ELISPOT or Quantiferon-CMV and the serology, and 24% gray areas when one or both tests resulted in weak positives. None of the CMV-seronegative subjects showed detectable responses in the ELISPOT or the Quantiferon-CMV test. In transplant recipients, both the ELISPOT and Quantiferon-CMV assays positively correlated with each other and negatively correlated with CMV DNAemia in a significant way (P < 0.05). During the antiviral prophylaxis, all 20 D+/R− KTRs we examined displayed undetectable Quantiferon-CMV and ELISPOT results, and there was no evidence of CMV seroconversion. The receiving operator curve (ROC) statistical analysis revealed similar specificities and sensitivities in predicting detectable viremia (areas under the curve [AUC], 0.66 and 0.62 for Quantiferon-CMV and ELISPOT, respectively). ELISPOT and Quantiferon-CMV values of >150 spots/200,000 peripheral blood mononuclear cells (PBMCs) and >1 to 6 IU gamma interferon (IFN-γ) were associated with protection from CMV

Human Atopic Dermatitis Complicated by Eczema Herpeticum is Associated with Abnormalities in Gamma Interferon Response

PubMed Central

Leung, Donald YM; Gao, Pei-Song; Grigoryev, Dmitry N; Rafaels, Nicholas M; Streib, Joanne E; Howell, Michael D; Taylor, Patricia A; Boguniewicz, Mark; Canniff, Jennifer; Armstrong, Brian; Zaccaro, Daniel J; Schneider, Lynda C; Hata, Tissa R; Hanifin, Jon M; Beck, Lisa A; Weinberg, Adriana; Barnes, Kathleen C

2011-01-01

Background The basis for increased susceptibility of atopic dermatitis (AD) patients to develop disseminated viral skin infections such as eczema herpeticum (ADEH+) is poorly understood. Objective We sought to determine whether atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Methods GeneChip profiling was used to identify differences in gene expression of peripheral blood mononuclear cells (PBMC) from patients with a history of ADEH+ as compared to ADEH− and non-atopic controls. Key differences in protein expression were verified by ELISPOT and/or ELISA. Clinical relevance was further demonstrated by a mouse model of disseminated viral skin infection and genetic association analysis for genetic variants in IFNG and IFNGR1 and ADEH among 435 cases and controls. Results We demonstrate by global gene expression analysis selective transcriptomic changes within the interferon (IFN) superfamily of PBMCs from ADEH+ subjects reflecting low IFNγ and IFNγ receptor gene expression. IFNγ protein production was also significantly lower in ADEH+ (N=24) compared to ADEH− (N=20) and non-atopic (NA; N=20) controls. IFNγ receptor knockout (KO) mice developed disseminated viral skin infection after epicutaneous challenge with vaccinia virus (VV). Genetic variants in IFNG and IFNGR1 SNPs were significantly associated with ADEH (112 cases, 166 controls) and IFNγ production: a 2-SNP (A–G) IFNGR1 haplotype (rs10457655 and rs7749390) showed the strongest association with a reduced risk of ADEH+ ((13.2% ADEH+ vs 25.5% ADEH−, P = 0.00057). Conclusions ADEH+ patients have reduced IFNγ production, and IFNG and IFNGR1 SNPs are significantly associated with ADEH+ and may contribute to an impaired immune response to herpes simplex virus (HSV). Clinical Implications Atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Capsule summary Using genomic

[Effectiveness of interferon-gamma release assays in the tuberculosis contact investigation of elderly people].

PubMed

Seto, Junji; Ahiko, Tadayuki

2014-04-01

To confirm the effectiveness of interferon-gamma release assays (IGRAs) in the tuberculosis (TB) contact investigation of elderly people, we analyzed the results of the QuantiFERON TB Gold in tube (QFT-3G) test, which is a commercially available IGRA. We analyzed the results of the QFT-3G test in 2,420 subjects who were in close contact with TB patients. We investigated subjects with latent TB infection and those showing the onset of TB among the QFT-3G-positive subjects. The QFT-3G-positive rate was 7.3% (95% confidence interval, 6.2%-8.3%). In addition, we demonstrated that the QFT-3G-positive rate increased with age (P < 0.001). The QFT-3G-positive rate was high, particularly in elderly people (> or = 60 years), but the rate was significantly lower than the predicted prevalence of TB infection. Therefore, it was assumed that the QFT-3G test does not always provide a positive result, even in cases of subjects with a previous TB infection. Furthermore, data from the QFT-3G-positive subjects indicated that approximately one half of subjects aged 60-69 years, approximately one-third of those aged 70-79 years, and approximately one-quarter of those aged over 80 years have had recent TB infections. In conclusion, the results of the QFT-3G test in elderly people need to be carefully evaluated according to the contact situation with TB patients; nevertheless, the QFT-3G test is useful for the screening of latent TB infection in elderly people who were in close contact with TB patients.

Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.

PubMed

Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G

2010-04-15

Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.

A 21 Nucleotide Duplication on the α1- and α2-Globin Genes Involves a Variety of Hypochromic Microcytic Anemias, From Mild to Hb H Disease.

PubMed

Farashi, Samaneh; Faramarzi Garous, Negin; Zeinali, Fatemeh; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Najmabadi, Hossein; Azarkeivan, Azita; Tamaddoni, Ahmad

2015-01-01

α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects in the α-globin gene cluster can result in α-thal that may develop into a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. Loss of one functional α gene, indicated as heterozygous α(+)-thal, shows minor hematological abnormalities. Homozygosity for α(+)- or heterozygosity for α(0)-thal have more severe hematological abnormalities due to a markedly reduced α chain output. At the molecular level, the absence of three α-globin genes resulting from the compound heterozygous state for α(0)- and α(+)-thal, lead to Hb H disease. Here we present a 21 nucleotide (nt) duplication consisting of six amino acids and 3 bp of intronic sequence at the exon-intron boundary, in both the α-globin genes, detected by direct DNA sequencing. This duplication was identified in three patients originating from two different Iranian ethnic groups and one Arab during more than 12 years. The clinical presentation of these individuals varies widely from a mild asymptomatic anemia (heterozygote in α1-globin gene) to a severely anemic state, diagnosed as an Hb H individual requiring blood transfusion (duplication on the α2-globin gene in combination with the - -(MED) double α-globin gene deletion). The third individual, who was homozygous for this nt duplication on the α1-globin gene, showed severe hypochromic microcytic anemia and splenomegaly. In the last decade, numerous α-globin mutations have demonstrated the necessity of prenatal diagnosis (PND) for α-thal, and this study has contributed another mutation as important enough that needs to be considered.

Analysis of α1 and α2 globin genes among patients with hemoglobin Adana in Malaysia.

PubMed

Lee, T Y; Lai, M I; Ismail, P; Ramachandran, V; Tan, J A M A; Teh, L K; Othman, R; Hussein, N H; George, E

2016-04-07

Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.

Interferon modulation of c-myc expression in cloned Daudi cells: relationship to the phenotype of interferon resistance.

PubMed

Dron, M; Modjtahedi, N; Brison, O; Tovey, M G

1986-05-01

Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells.

Role of CD28/B7 costimulation in the dexamethasone-induced suppression of IFN-gamma.

PubMed

Agarwal, S K; Marshall, G D

2000-11-01

In vitro exposure of peripheral blood mononuclear cells (PBMC) to glucocorticoids (GC), at concentrations observed during psychologic stress, induces a shift in the human type 1/type 2 cytokine balance toward a type 2 cytokine response. The mechanisms involved in these cytokine alterations are unknown but likely include modulation of regulatory cytokines or the interaction between the antigen-presenting cell (APC) and T lymphocyte or both. The CD28/B7 costimulation pathway has been reported to modulate the type 1/type 2 cytokine balance and may contribute to the GC-associated cytokine alterations. Therefore, we sought to determine the effect of dexamethasone (Dex) on the expression and function of the human CD28/B7 costimulatory pathway and whether these alterations contribute to the Dex-induced type 1/type 2 cytokine alterations. Dex inhibited the expression of both CD80 and CD86 on THP-1 cells, a human acute monocytic leukemia cell line, as determined by flow cytometry. Dex also inhibited the expression of CD28 and CTLA-4 on phytohemagglutinin (PHA)-stimulated CD3+ T lymphocytes, which was attenuated by the addition of interleukin-12 (IL-12). Lastly, activation of CD28 with anti-CD28 antibody attenuated the Dex-induced decrease in interferon-gamma (IFN-gamma) production by anti-CD3 antibody-stimulated PBMC. These data suggest that Dex induces a modulation of the CD28/B7 costimulatory pathway that contributes to the shift in the type 1/type 2 cytokine balance toward a predominant type 2 cytokine response.

Siglec-1 inhibits RSV-induced interferon gamma production by adult T cells in contrast to newborn T cells.

PubMed

Jans, Jop; Unger, Wendy W J; Vissers, Marloes; Ahout, Inge M L; Schreurs, Inge; Wickenhagen, Arthur; de Groot, Ronald; de Jonge, Marien I; Ferwerda, Gerben

2018-04-01

Interferon gamma (IFN-γ) plays an important role in the antiviral immune response during respiratory syncytial virus (RSV) infections. Monocytes and T cells are recruited to the site of RSV infection, but it is unclear whether cell-cell interactions between monocytes and T cells regulate IFN-γ production. In this study, micro-array data identified the upregulation of sialic acid-binding immunoglobulin-type lectin 1 (Siglec-1) in human RSV-infected infants. In vitro, RSV increased expression of Siglec-1 on healthy newborn and adult monocytes. RSV-induced Siglec-1 on monocytes inhibited IFN-γ production by adult CD4 + T cells. In contrast, IFN-γ production by RSV in newborns was not affected by Siglec-1. The ligand for Siglec-1, CD43, is highly expressed on adult CD4 + T cells compared to newborns. Our data show that Siglec-1 reduces IFN-γ release by adult T cells possibly by binding to the highly expressed CD43. The Siglec-1-dependent inhibition of IFN-γ in adults and the low expression of CD43 on newborn T cells provides a better understanding of the immune response against RSV in early life and adulthood. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Interferon-gamma improves impaired dentinogenic and immunosuppressive functions of irreversible pulpitis-derived human dental pulp stem cells

PubMed Central

Sonoda, Soichiro; Yamaza, Haruyoshi; Ma, Lan; Tanaka, Yosuke; Tomoda, Erika; Aijima, Reona; Nonaka, Kazuaki; Kukita, Toshio; Shi, Songtao; Nishimura, Fusanori; Yamaza, Takayoshi

2016-01-01

Clinically, irreversible pulpitis is treated by the complete removal of pulp tissue followed by replacement with artificial materials. There is considered to be a high potential for autologous transplantation of human dental pulp stem cells (DPSCs) in endodontic treatment. The usefulness of DPSCs isolated from healthy teeth is limited. However, DPSCs isolated from diseased teeth with irreversible pulpitis (IP-DPSCs) are considered to be suitable for dentin/pulp regeneration. In this study, we examined the stem cell potency of IP-DPSCs. In comparison with healthy DPSCs, IP-DPSCs expressed lower colony-forming capacity, population-doubling rate, cell proliferation, multipotency, in vivo dentin regeneration, and immunosuppressive activity, suggesting that intact IP-DPSCs may be inadequate for dentin/pulp regeneration. Therefore, we attempted to improve the impaired in vivo dentin regeneration and in vitro immunosuppressive functions of IP-DPSCs to enable dentin/pulp regeneration. Interferon gamma (IFN-γ) treatment enhanced in vivo dentin regeneration and in vitro T cell suppression of IP-DPSCs, whereas treatment with tumor necrosis factor alpha did not. Therefore, these findings suggest that IFN-γ may be a feasible modulator to improve the functions of impaired IP-DPSCs, suggesting that autologous transplantation of IFN-γ-accelerated IP-DPSCs might be a promising new therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:26775677

Evaluation of pre- and posttransplantation serum interferon-gamma and soluble CD30 for predicting liver allograft rejection.

PubMed

Kim, K H; Oh, E-J; Jung, E-S; Park, Y-J; Choi, J Y; Kim, D-G; Lee, K Y; Kang, C S

2006-06-01

The aim of the present study was to identify whether the serum interferon-gamma (IFNgamma), a Th1 cytokine, or soluble CD30 (sCD30), a marker for activation of Th2 cytokine-producing T cells, predict acute cellular rejection episodes among liver graft patients. Pretransplant and posttransplant sera from 32 living donor liver transplant recipients obtained on days 1, 3, and 7 after surgery were tested for serum IFNgamma and sCD30 concentrations using commercial enzyme-linked immunosorbent assay kits. Recipients with an acute rejection episode (ARE) (n=14) displayed significantly higher IFNgamma concentrations pretransplant than did the patients with no ARE (n=18) (P<.05). The pretransplant serum levels of sCD30 were not different between the non-ARE and ARE groups. However, in comparison with the non-ARE group, who showed steadily decreasing serum sCD30 levels after transplantation, 12 among the 14 patients in the ARE group showed increasing sCD30 levels from day 1 to day 3 after transplantation (P<.05). These results suggest that the sCD30 increment during the early period after liver transplantation affects the immune response of rejection. This observation emphasizes the clinical relevance of serum sCD30, in addition to serum IFNgamma, as predictive markers for acute liver graft rejection.

Interferon modulation of c-myc expression in cloned Daudi cells: relationship to the phenotype of interferon resistance.

PubMed Central

Dron, M; Modjtahedi, N; Brison, O; Tovey, M G

1986-01-01

Treatment of interferon-sensitive Daudi cell with electrophoretically pure human interferon alpha markedly reduced the level of c-myc mRNA, increased the level of class I histocompatibility antigen (HLA) mRNA, and did not affect the level of actin mRNA within the same cells. In contrast, the level of c-myc mRNA or HLA mRNA did not change significantly following interferon treatment in different clones of Daudi cells selected for resistance to the antiproliferative action of interferon. These cells possessed interferon receptors, however, and responded to interferon modulation of other genes, including 2',5' oligoisoadenylate synthetase (M. G. Tovey, M. Dron, K. E. Mogensen, B. Lebleu, N. Metchi, and J. Begon-Lours, Guymarho, J. Gen. Virol., 64:2649-2653, 1983; M. Dron, M. G. Tovey, and P. Eid, J. Gen. Virol., 66:787-795, 1985). A clone of interferon-resistant Daudi cells which had reverted to almost complete sensitivity to both the antiproliferative action of interferon and the interferon-enhanced expression of HLA mRNA remained refractory, however, to interferon modulation of c-myc expression, suggesting that a reduced level of c-myc mRNA may not be a prerequisite for inhibition of cell proliferation in interferon-treated cells. Our results do not exclude the possibility, however, that posttranscriptional modification(s) of c-myc expression may precede an inhibition of cell proliferation in interferon-treated cells. Images PMID:3785169

Contradictory results in interferon research

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.

1984-01-01

Several reports on immunologically related interferon research, both in the areas of basic science and clinical research, are briefly reviewed, and it is noted that in many cases the results obtained are contradictory. It is argued, however, that the contradictory results are not surprising since interferon is a biological response modifier and has been known to produce opposite results even when the same interferon prepartion is used. It is emphasized that dosage, timing, route, and other experimental conditions are essential factors in planning immunological studies with interferon. Careful planning of future experiments with interferon should be required to prevent the possible generation of effects that are opposite to those expected.

Interferon Alfa-2b Injection

MedlinePlus

Interferon alfa-2b injection is used to treat a number of conditions.Interferon alfa-2b injection is used alone or in combination ... lymphoma (NHL; a slow-growing blood cancer). Interferon alfa-2b is in a class of medications called ...

Plasmodium falciparum malaria skews globin gene expression balance in in-vitro haematopoietic stem cell culture system: Its implications in malaria associated anemia.

PubMed

Pathak, Vrushali; Colah, Roshan; Ghosh, Kanjaksha

2018-02-01

Understanding the pathophysiology and associated host parasite interactions of the malaria infection is the prerequisite for developing effective prevention and treatment strategies. The exact mechanism underlying malaria associated ineffective and dyserythropoiesis is not yet fully understood. Being an important protein, haemoglobin serves as the main amino acid reservoir available to the intra-erythrocytic plasmodium. It is important to check the expression profiling of globin genes which may help us to understand host parasite interactions and its potential contribution to both infection and disease. Here, an in-vitro culture system was used to study the effect of different doses of Plasmodium falciparum on haematopoietic stem cell expansion, differentiation and expression of globin genes. Upon exposure to the different doses of P. falciparum parasites of strains 3D7, Dd2 and RKL9 (intact and lysed form) at different stages of erythroid development, cells demonstrated suppression in growth and differentiation. At almost all stages of erythroid development upon parasite exposure, the γ globin gene was found to be downregulated and the α/β as well as α/non- α globin mRNA ratios in late stage erythroid cells were found to be reduced (p < .01) compared to the untreated controls. The imbalance in globin chain expression might be considered as one of the factors involved in malaria associated inappropriate erythropoietic responses. Copyright © 2018 Elsevier Inc. All rights reserved.

Myeloid interferon-γ receptor deficiency does not affect atherosclerosis in LDLR(-/-) mice.

PubMed

Boshuizen, Marieke C S; Neele, Annette E; Gijbels, Marion J J; van der Velden, Saskia; Hoeksema, Marten A; Forman, Ruth A; Muller, Werner; Van den Bossche, Jan; de Winther, Menno P J

2016-03-01

Atherosclerosis is a chronic lipid-driven inflammatory disease of the arterial wall. Interferon gamma (IFNγ) is an important immunomodulatory cytokine and a known pro-atherosclerotic mediator. However, cell-specific targeting of IFNγ or its signaling in atherosclerosis development has not been studied yet. As macrophages are important IFNγ targets, we here addressed the involvement of myeloid IFNγ signaling in murine atherosclerosis. Bone marrow was isolated from interferon gamma receptor 2 chain (IFNγR2) wildtype and myeloid IFNγR2 deficient mice and injected into lethally irradiated LDLR(-/-) mice. After recovery mice were put on a high fat diet for 10 weeks after which atherosclerotic lesion analysis was performed. In addition, the accompanying liver inflammation was assessed. Even though absence of myeloid IFNγ signaling attenuated the myeloid IFNγ response, no significant differences in atherosclerotic lesion size or phenotype were found. Also, when examining the liver inflammatory state no effects of IFNγR2 deficiency could be observed. Overall, our data argue against a role for myeloid IFNγR2 in atherosclerosis development. Since myeloid IFNγ signaling seems to be nonessential throughout atherogenesis, it is important to understand the mechanisms by which IFNγ acts in atherogenesis. In the future new studies should be performed considering other cell-specific targets. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Pre-immune state induced by chicken interferon gamma inhibits the replication of H1N1 human and H9N2 avian influenza viruses in chicken embryo fibroblasts.

PubMed

Yuk, Seong-Su; Lee, Dong-Hun; Park, Jae-Keun; Tseren-Ochir, Erdene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon

2016-04-27

Interferon gamma (IFN-γ), an immunoregulatory cytokine, is known to control many microbial infections. In a previous study, chicken interferon gamma (chIFN-γ) was found to be up-regulated following avian influenza virus (AIV) infection in specific pathogen-free chickens. We aimed to investigate whether the pre-immune state induced by chIFN-γ could generate an antiviral response against influenza virus. We generated a chIFN-γ-expressing plasmid and transfected it into chicken embryo fibroblasts (CEFs) and then infected the cells with human origin H1N1 or avian origin H9N2 influenza viruses. Viral titers of culture medium were evaluated in MDCK cell and the viral RNA and IFN-stimulated genes (ISGs) were then quantified by real-time reverse transcriptase polymerase. To further evaluate the role of the antiviral effect of chIFN-γ by using a backward approach, synthetic small interfering RNAs (siRNA) targeting chIFN-γ were used to suppress chIFN-γ. The chIFN-γ-stimulated CEFs inhibited the replication of viral RNA (vRNA) and showed a mild decrease in the infectious virus load released in the culture medium. Compared to the mock-transfected control, the messenger RNA (mRNA) levels of type I IFNs and IFN-stimulated genes were up-regulated in the cells expressing chIFN-γ. After treatment with the siRNA, we detected a higher expression of viral genes than that observed in the mock-transfected control. Our results suggest that apart from the important role played by chIFN-γ in the antiviral state generated against influenza virus infection, the pre-immune state induced by chIFN-γ can be helpful in mitigating the propagation of influenza virus.

Molecular characterization and development of Sarcocystis speeri sarcocysts in gamma interferon gene knockout mice.

PubMed

Dubey, J P; Verma, S K; Dunams, D; Calero-Bernal, R; Rosenthal, B M

2015-11-01

The North American opossum (Didelphis virginiana) is the definitive host for at least three named species of Sarcocystis: Sarcocystis falcatula, Sarcocystis neurona and Sarcocystis speeri. The South American opossums (Didelphis albiventris, Didelphis marsupialis and Didelphis aurita) are definitive hosts for S. falcatula and S. lindsayi. The sporocysts of these Sarcocystis species are similar morphologically. They are also not easily distinguished genetically because of the difficulties of DNA extraction from sporocysts and availability of distinguishing genetic markers. Some of these species can be distinguished by bioassay; S. neurona and S. speeri are infective to gamma interferon gene knockout (KO) mice, but not to budgerigars (Melopsittacus undulatus); whereas S. falcatula and S. lindsayi are infective to budgerigars but not to KO mice. The natural intermediate host of S. speeri is unknown. In the present study, development of sarcocysts of S. speeri in the KO mice is described. Sarcocysts were first seen at 12 days post-inoculation (p.i.), and they became macroscopic (up to 4 mm long) by 25 days p.i. The structure of the sarcocyst wall did not change from the time bradyzoites had formed at 50-220 days p.i. Sarcocysts contained unique villar protrusions, 'type 38'. The polymerase chain reaction amplifications and sequences analysis of three nuclear loci (18S rRNA, 28S rRNA and ITS1) and two mitochondrial loci (cox1 and cytb) of S. speeri isolate from an Argentinean opossum (D. albiventris) confirmed its membership among species of Sarcocystis and indicated an especially close relationship to another parasite in this genus that employs opossums as its definitive host, S. neurona. These results should be useful in finding natural intermediate host of S. speeri.

Mi2β Is Required for γ-Globin Gene Silencing: Temporal Assembly of a GATA-1-FOG-1-Mi2 Repressor Complex in β-YAC Transgenic Mice

PubMed Central

Costa, Flávia C.; Fedosyuk, Halyna; Chazelle, Allen M.; Neades, Renee Y.; Peterson, Kenneth R.

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the −566 GATA motif of the Aγ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of Aγ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the −566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1–mediated repressor complex was disrupted by the −566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting −566 Aγ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis. PMID:23284307

Mi2β is required for γ-globin gene silencing: temporal assembly of a GATA-1-FOG-1-Mi2 repressor complex in β-YAC transgenic mice.

PubMed

Costa, Flávia C; Fedosyuk, Halyna; Chazelle, Allen M; Neades, Renee Y; Peterson, Kenneth R

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the -566 GATA motif of the (A)γ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of (A)γ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the -566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1-mediated repressor complex was disrupted by the -566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting -566 (A)γ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis.

Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

PubMed

Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

2017-12-30

Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

The Jak-STAT pathway stimulated by interferon alpha or interferon beta.

PubMed

Horvath, Curt M

2004-11-23

Type I interferons, such as interferon alpha and interferon beta (IFN-alpha and beta), signal through a Janus kinase (Jak) to signal transduction and activator of transcription (STAT) pathway to stimulate gene expression. In response to ligand binding, the receptors dimerize, Jaks phosphorylate STAT1 and STAT2, which then dimerize and interact with a third transcriptional regulator IFN regulatory factor 9 (IRF9) to stimulate gene expression. IFN-alpha is the main innate antiviral cytokine and is essential for effective immune response to viral infection. The animation shows activation of STAT-responsive gene expression in response to type I IFNs.

The higher structure of chromatin in the LCR of the beta-globin locus changes during development.

PubMed

Fang, Xiangdong; Yin, Wenxuan; Xiang, Ping; Han, Hemei; Stamatoyannopoulos, George; Li, Qiliang

2009-11-27

The beta-globin locus control region (LCR) is able to enhance the expression of all globin genes throughout the course of development. However, the chromatin structure of the LCR at the different developmental stages is not well defined. We report DNase I and micrococcal nuclease hypersensitivity, chromatin immunoprecipitation analyses for histones H2A, H2B, H3, and H4, and 3C (chromatin conformation capture) assays of the normal and mutant beta-globin loci, which demonstrate that nucleosomes at the DNase I hypersensitive sites of the LCR could be either depleted or retained depending on the stages of development. Furthermore, MNase sensitivity and 3C assays suggest that the LCR chromatin is more open in embryonic erythroblasts than in definitive erythroblasts at the primary- and secondary-structure levels; however, the LCR chromatin is packaged more tightly in embryonic erythroblasts than in definitive erythroblasts at the tertiary chromatin level. Our study provides the first evidence that the occupancy of nucleosomes at a DNase I hypersensitive site is a developmental stage-related event and that embryonic and adult cells possess distinct chromatin structures of the LCR.

A molecular study of a family with Greek hereditary persistence of fetal hemoglobin and beta-thalassemia.

PubMed Central

Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U

1984-01-01

A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198

Rapid determination of human globin chains using reversed-phase high-performance liquid chromatography.

PubMed

Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min

2012-07-15

Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.

Alterations in interhemispheric gamma-band connectivity are related to the emergence of auditory verbal hallucinations in healthy subjects during NMDA-receptor blockade.

PubMed

Thiebes, Stephanie; Steinmann, Saskia; Curic, Stjepan; Polomac, Nenad; Andreou, Christina; Eichler, Iris-Carola; Eichler, Lars; Zöllner, Christian; Gallinat, Jürgen; Leicht, Gregor; Mulert, Christoph

2018-06-01

Auditory verbal hallucinations (AVH) are a common positive symptom of schizophrenia. Excitatory-to-inhibitory (E/I) imbalance related to disturbed N-methyl-D-aspartate receptor (NMDAR) functioning has been suggested as a possible mechanism underlying altered connectivity and AVH in schizophrenia. The current study examined the effects of ketamine, a NMDAR antagonist, on glutamate-related mechanisms underlying interhemispheric gamma-band connectivity, conscious auditory perception during dichotic listening (DL), and the emergence of auditory verbal distortions and hallucinations (AVD/AVH) in healthy volunteers. In a single-blind, pseudo-randomized, placebo-controlled crossover design, nineteen male, right-handed volunteers were measured using 64 channel electroencephalography (EEG). Psychopathology was assessed with the PANSS interview and the 5D-ASC questionnaire, including a subscale to detect auditory alterations with regard to AVD/AVH (AUA-AVD/AVH). Interhemispheric connectivity analysis was performed using eLORETA source estimation and lagged phase synchronization (LPS) in the gamma-band range (30-100 Hz). Ketamine induced positive symptoms such as hallucinations in a subgroup of healthy subjects. In addition, interhemispheric gamma-band connectivity was found to be altered under ketamine compared to placebo, and subjects with AUA-AVD/AVH under ketamine showed significantly higher interhemispheric gamma-band connectivity than subjects without AUA-AVD/AVH. These findings demonstrate a relationship between NMDAR functioning, interhemispheric connectivity in the gamma-band frequency range between bilateral auditory cortices and the emergence of AVD/AVH in healthy subjects. The result is in accordance with the interhemispheric miscommunication hypothesis of AVH and argues for a possible role of glutamate in AVH in schizophrenia.

NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

PubMed Central

Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

1995-01-01

The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

Translational recognition of the 5'-terminal 7-methylguanosine of globin messenger RNA as a function of ionic strength.

PubMed

Chu, L Y; Rhoads, R E

1978-06-13

The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.

Cerebrospinal fluid interferon-gamma-inducible protein 10 (IP-10, CXCL10) in HIV-1 infection.

PubMed

Cinque, Paola; Bestetti, Arabella; Marenzi, Roberta; Sala, Serena; Gisslen, Magnus; Hagberg, Lars; Price, Richard W

2005-11-01

Interferon-gamma-inducible protein (IP-10 or CXCL10) is a potent chemoattractant and has been suggested to enhance retrovirus infection and mediate neuronal injury. In order to assess this chemokine in central nervous system (CNS) HIV infection, we measured the cerebrospinal fluid (CSF) and plasma concentrations of CXCL10 by immunoassay in samples derived from 97 HIV-infected subjects across a spectrum of immunological progression and CNS complications and from 16 HIV seronegative control subjects studied at three clinical centers between 1994 and 2001. We also examined changes in the CSF and plasma CXCL10 concentrations in 30 subjects starting and three stopping antiretroviral therapy. CSF CXCL10 concentrations: (1) correlated with CSF HIV RNA and white blood cell (WBC) counts, but not with blood CXCL10, HIV RNA, or CD4 counts; (2) were increased in subjects with primary and asymptomatic HIV infections and AIDS dementia complex, but less frequently in those with more advanced infection, with or without CNS opportunistic diseases except cytomegalovirus encephalitis; (3) decreased in subjects starting antiretroviral in association with decreases in CSF and plasma HIV RNA and CSF WBCs; and (4) conversely, increased in subjects stopping treatment in parallel with CSF HIV RNA and WBCs. These results confirm that CSF CXCL10 associates closely with both CSF HIV and WBCs and suggest that this chemokine may be both a response to and contributing determinant of local infection. High CSF levels may be useful in the diagnosis of ADC in subjects with advanced immunosuppression in whom CMV encephalitis has been ruled out, though this issue requires further study.

Interferon-gamma receptor-deficiency renders mice highly susceptible to toxoplasmosis by decreased macrophage activation.

PubMed

Deckert-Schlüter, M; Rang, A; Weiner, D; Huang, S; Wiestler, O D; Hof, H; Schlüter, D

1996-12-01

Toxoplasma gondii may cause severe infections in immunocompromised patients including fetuses and those with AIDS. Among the factors mediating protection against T. gondii, IFN-gamma has gained special attention. To analyze the role of IFN-gamma in the early phase of toxoplasmosis, IFN-gamma receptor-deficient (IFN-gamma R0/0) mice were orally infected with low-virulent toxoplasms. IFN-gamma R0/0 mice died of the disease up to day 10 postinfection, whereas immunocompetent wild-type (WT) mice developed a chronic toxoplasmosis. Histopathology revealed that in IFN-gamma R0/0 mice, the parasite multiplied unrestrictedly in the small intestine, the intestinal lymphatic tissue, the liver, and the spleen. Ultimately, animals died of a necrotizing hepatitis. In WT mice, the same organs were effected, but multiplication of the parasite was effectively limited. Compared with WT mice, immunohistochemistry and flow cytometry demonstrated that in IFN-gamma R0/0 mice, macrophages were only marginally activated in response to the infection, as evidenced by a reduced expression of major histocompatability complex class II antigens. In addition, immunohistochemistry and RT-PCR showed a reduced production of the macrophage-derived cytokines tumor necrosis factor-alpha, inducible nitric oxide synthase, and IL-1 beta in the liver of IFN-gamma R0/0 mice. In contrast, activation of T cells, recruitment of immune cells to inflammatory foci, and anti-T. gondii IgM antibody production were unaffected by the mutation of the IFN-gamma R. Moreover, induction of IL-2, IL-4, and IL-10 mRNA transcripts in the liver was normal in IFN-gamma R0/0 mice. Adoptive transfer experiments revealed that the immune T cells of WT animals did not protect IFN-gamma R0/0 mice from lethal infection with highly virulent toxoplasms, whereas WT mice were significantly protected by the adoptive transfer. Based on these studies, we conclude that IFN-gamma is absolutely required for an efficient activation of

Understanding the kinetics of ligand binding to globins with molecular dynamics simulations: the necessity of multiple state models.

PubMed

Estarellas Martin, Carolina; Seira Castan, Constantí; Luque Garriga, F Javier; Bidon-Chanal Badia, Axel

2015-10-01

Residue conformational changes and internal cavity migration processes play a key role in regulating the kinetics of ligand migration and binding events in globins. Molecular dynamics simulations have demonstrated their value in the study of these processes in different haemoglobins, but derivation of kinetic data demands the use of more complex techniques like enhanced sampling molecular dynamics methods. This review discusses the different methodologies that are currently applied to study the ligand migration process in globins and highlight those specially developed to derive kinetic data. Copyright © 2015 Elsevier Ltd. All rights reserved.

HLA-DRB1 and HLA-DQB1 Are Associated with Adult-Onset Immunodeficiency with Acquired Anti-Interferon-Gamma Autoantibodies

PubMed Central

Pithukpakorn, Manop; Roothumnong, Ekkapong; Angkasekwinai, Nasikarn; Suktitipat, Bhoom; Assawamakin, Anunchai; Luangwedchakarn, Voravich; Umrod, Pinklow; Thongnoppakhun, Wanna; Foongladda, Suporn; Suputtamongkol, Yupin

2015-01-01

Recently a newly identified clinical syndrome of disseminated non-tuberculous mycobacterial diseases (with or without other opportunistic infections in adult patients who were previously healthy, has been recognized in association with an acquired autoantibody to interferon-gamma. This syndrome is emerging as an important cause of morbidity and mortality, especially among people of Asian descent. Trigger for the production of this autoantibody remains unknown, but genetic factors are strongly suspected to be involved. We compared HLA genotyping between 32 patients with this clinical syndrome, and 38 controls. We found that this clinical syndrome was associated with very limited allele polymorphism, with HLA-DRB1 and DQB1 alleles, especially HLA-DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02. Odds ratio of DRB1*15:01, DRB1*16:02, DQB1*05:01 and DQB1*05:02 were 7.03 (95% CI, 2.18–22.69, P<0.0001, 9.06 (95% CI, 2.79–29.46, P<0.0001), 6.68 (95% CI, 2.29–19.52, P = 0.0004), and 6.64 (95% CI, 2.30–19.20, P = 0.0004), respectively. Further investigation is warranted to provide better understanding on pathogenesis of this association. PMID:26011559

Mink parvoviruses and interferons: in vitro studies.

PubMed Central

Wiedbrauk, D L; Bloom, M E; Lodmell, D L

1986-01-01

Although interferons can inhibit the replication of a number of viruses, little is known about their ability to inhibit parvovirus replication. Therefore, in vitro experiments were done to determine if Aleutian disease virus and mink enteritis virus, two autonomously replicating mink parvoviruses, induced interferon, were sensitive to the effects of interferon, or inhibited the production of interferon. The results indicated that these parvoviruses neither induced nor were sensitive to the effects of interferon. Furthermore, preexisting parvovirus infections did not inhibit poly(I).poly(C)-induced interferon production. This independence from the interferon system may, therefore, be a general property of the autonomously replicating parvoviruses. PMID:2431162

The interferons.

PubMed Central

Toy, J L

1983-01-01

An overview of the interferons is presented. A description of something of what is known about them is given, including: their genes; their protein structures and characteristics; their mechanisms of actions; and their varied biological effects emphasising particularly their immunomodulatory actions. Finally, a brief summary is made of the current status of human clinical studies that have been conducted with interferons in the oncological and viral fields, mentioning also recent findings in patients who have the acquired immunodeficiency syndrome (AIDS). PMID:6193915

Changes in serum hepatitis C virus RNA in interferon nonresponders retreated with interferon plus ribavirin: a preliminary report.

PubMed

Nyberg, L; Albrecht, J; Glue, P; Gianelli, G; Zambas, D; Elliot, M; Conrad, A; McHutchison, J

1999-06-01

Ribavirin, a nucleoside analogue, inhibits replication of RNA and DNA viruses and may control hepatitis C virus (HCV) infection through modulation of anti-inflammatory and antiviral actions. Ribavirin monotherapy has no effect on serum HCV RNA levels. In combination with interferon, this agent appears to enhance the efficacy of interferon. The aim of this study was to monitor serum HCV RNA levels early during therapy with interferon and ribavirin compared with that previously seen in the same patients during interferon monotherapy. Five patients who previously showed no response to therapy with interferon alfa 3 MU three times weekly for 6 months were retreated with the identical dose of interferon alfa 2b in combination with oral ribavirin 1,000 mg/day. Serum HCV RNA levels were monitored at baseline, week 4, week 8, and week 12 of therapy by a quantitative multicycle polymerase chain reaction assay. In the first 8 to 12 weeks, serum HCV RNA levels showed a greater decrease in all patients when retreated with combination therapy compared with interferon alone. Mean (+/- SEM) serum HCV RNA levels for interferon therapy alone were 3.3 +/- 0.95, 1.2 +/- 0.95, 1.6 +/- 1.2, and 2.3 +/- 1.2 x 10(6) copies/ml at week 0, 4, 8, and 12, respectively. This was compared with 3.3 +/- 0.83, 0.3 +/- 0.2, 0.03 +/- 0.02, and 0.15 +/- 0.14 x 10(6), respectively, for the interferon and ribavirin group (p < 0.07 at week 8). Two of five patients had undetectable serum HCV RNA during combination therapy. Combination therapy with interferon and ribavirin in prior interferon nonresponders reduces serum HCV RNA levels compared with interferon alone. This may suggest some additional antiviral effect of ribavirin when given with interferon.

Private sector tuberculosis prevention in the US: Characteristics associated with interferon-gamma release assay or tuberculin skin testing.

PubMed

Stockbridge, Erica L; Miller, Thaddeus L; Carlson, Erin K; Ho, Christine

2018-01-01

To determine whether latent tuberculosis infection risk factors are associated with an increased likelihood of latent tuberculosis infection testing in the US private healthcare sector. A national sample of medical and pharmacy claims representing services rendered January 2011 through December 2013 for 3,997,986 commercially insured individuals in the US who were 0 to 64 years of age. We used multivariable logistic regression models to determine whether TB/LTBI risk factors were associated with an increased likelihood of Interferon-Gamma Release Assay (IGRA) or Tuberculin Skin Test (TST) testing in the private sector. 4.31% (4.27-4.34%) received at least one TST/IGRA test between 2011 and 2013 while 1.69% (1.67-1.72%) received a TST/IGRA test in 2013. Clinical risk factors associated with a significantly increased likelihood of testing included HIV, immunosuppressive therapy, exposure to tuberculosis, a history of tuberculosis, diabetes, tobacco use, end stage renal disease, and alcohol use disorder. Other significant variables included gender, age, asthma, the state tuberculosis rate, population density, and percent of foreign-born persons in a county. Private sector TST/IGRA testing is not uncommon and testing varies with clinical risk indicators. Thus, the private sector can be a powerful resource in the fight against tuberculosis. Analyses of administrative data can inform how best to leverage private sector healthcare toward tuberculosis prevention activities.

Altered T-Cell Balance in Lymphoid Organs of a Mouse Model of Colorectal Cancer

PubMed Central

Tanner, Scott M.; Daft, Joseph G.; Hill, Stephanie A.; Martin, Colin A.; Lorenz, Robin G.

2016-01-01

The adenomatous polyposis coli (APC) gene is a known tumor suppressor gene, and mice with mutations in Apc (ApcMin/+) spontaneously form multiple intestinal neoplasms. In this model of human colorectal cancer (CRC), it has been reported that CD4+ T-cell-derived interleukin 17 (IL-17) promotes intestinal tumor development, but it is not known if the Apc mutation actually directly alters T-cell function and subsequently tumor immunosurveillance. To investigate the ApcMin/+ mutation on T-cell function, flow cytometric, histochemical, and immunofluorescent studies on both wild-type (Apc+/+) and ApcMin/+ mice were performed. We identified decreased levels of interferon gamma (IFN-γ+)IL-17+ double-positive CD4+ cells in the mesenteric lymph nodes and Peyer’s patches of ApcMin/+ mice. In addition, altered levels of CD8+ cells, and changes in CD8+ production of IFN-γ and granzyme B were observed. These T-cell alterations did modify tumor immunosurveillance, as the adoptive transfer of splenocytes from ApcMin/+ animals into a chemically induced CRC model resulted in the inability to prevent epithelial dysplasia. These results suggest an altered T-cell balance in ApcMin/+ mice may disrupt intestinal homeostasis, consequently limiting intestinal tumor immunosurveillance. PMID:27798287

Altered T-Cell Balance in Lymphoid Organs of a Mouse Model of Colorectal Cancer.

PubMed

Tanner, Scott M; Daft, Joseph G; Hill, Stephanie A; Martin, Colin A; Lorenz, Robin G

2016-12-01

The adenomatous polyposis coli (APC) gene is a known tumor suppressor gene, and mice with mutations in Apc (Apc Min/+ ) spontaneously form multiple intestinal neoplasms. In this model of human colorectal cancer (CRC), it has been reported that CD4 + T-cell-derived interleukin 17 (IL-17) promotes intestinal tumor development, but it is not known if the Apc mutation actually directly alters T-cell function and subsequently tumor immunosurveillance. To investigate the Apc Min/+ mutation on T-cell function, flow cytometric, histochemical, and immunofluorescent studies on both wild-type (Apc +/+ ) and Apc Min/+ mice were performed. We identified decreased levels of interferon gamma (IFN-γ + )IL-17 + double-positive CD4 + cells in the mesenteric lymph nodes and Peyer's patches of Apc Min/+ mice. In addition, altered levels of CD8 + cells, and changes in CD8 + production of IFN-γ and granzyme B were observed. These T-cell alterations did modify tumor immunosurveillance, as the adoptive transfer of splenocytes from Apc Min/+ animals into a chemically induced CRC model resulted in the inability to prevent epithelial dysplasia. These results suggest an altered T-cell balance in Apc Min/+ mice may disrupt intestinal homeostasis, consequently limiting intestinal tumor immunosurveillance. © 2016 The Histochemical Society.

CD34+ cells from dental pulp stem cells with a ZFN-mediated and homology-driven repair-mediated locus-specific knock-in of an artificial β-globin gene.

PubMed

Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K

2017-07-01

In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.

The importance of communication in promoting voluntary participation in an experimental trial: A qualitative study based on the assessment of the gamma-interferon test for the diagnosis of bovine tuberculosis in France

PubMed Central

Dufour, Barbara; Praud, Anne

2017-01-01

Understanding the factors leading each stakeholder to participate in an experimental trial is a key element for improving trial set-up and for identifying selection bias in statistical analyses. An experimental protocol, validated by the European Commission, was developed in France to assess the ability of the gamma-interferon test in terms of accuracy to replace the second intradermal skin test in cases of suspected bovine tuberculosis. Implemented between 2013 and 2015, this experimental trial was based on voluntary participation. To determine and understand the motivation or reluctance of farmers to take part in this trial, we carried out a sociological survey in France. Our study was based on semi-structured interviews with the farmers and other stakeholders involved. The analysis of findings demonstrated that shortening the lock-up period during tuberculosis suspicion, following the use of a gamma-interferon test, was an important aim and a genuine challenge for the animal health stakeholders. However, some farmers did not wish to continue the trial because it could potentially have drastic consequences for them. Moreover, misunderstandings and confusion concerning the objectives and consequences of the trial led stakeholders to reject it forcefully. Based on our results, we offer some recommendations: clear and appropriate communication tools should be prepared to explain the protocol and its aims. In addition, these types of animal health trials should be designed with the stakeholders’ interests in mind. This study provides a better understanding of farmer motivations and stakeholder influences on trial participation and outcomes. The findings can be used to help design trials so that they promote participation by farmers and by all animal health stakeholders in general. PMID:28973018

Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.

PubMed

Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K

2005-01-20

Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.

A novel mutation of the beta-globin gene promoter (-102 C>A) and pitfalls in family screening.

PubMed

Aguilar-Martinez, Patricia; Jourdan, Eric; Brun, Sophie; Cunat, Séverine; Giansily-Blaizot, Muriel; Pissard, Serge; Schved, Jean-François

2007-12-01

We describe a family with beta-thalassemia in which several pitfalls of genetic diagnoses were present. These include coherent family phenotypes with discrepancies in molecular findings because of nonpaternity, and a false beta-globin gene homozygous genotype due to a large deletion in the second locus. These findings underline the difficulties of family genetic studies and the need for tight relationship between professionals involved in laboratory studies and those in-charge of the clinical follow-up and genetic counselling. In this family, we also report a new silent beta-thalassemia mutation, -102 (C>A), in the distal CACCC box of the beta-globin gene promoter.

Real-time PCR assays using internal controls for quantitation of HPV-16 and beta-globin DNA in cervicovaginal lavages.

PubMed

Lefevre, Jonas; Hankins, Catherine; Pourreaux, Karina; Voyer, Hélène; Coutlée, François

2003-12-01

High-risk human papillomavirus 16 (HPV-16) DNA viral load has been measured with real-time PCR assays by amplifying HPV-16 and a human gene. However, these assays have not used internal controls (ICs) to screen for the presence of inhibitors contained in samples. To quantitate HPV-16 DNA and cell content with real-time PCR, ICs for HPV-16 DNA and beta-globin were synthesised and used to control for inhibition. The assays were sensitive and linear over 5 logs. Good reproducibility was achieved with inter-run coefficients of variation of 23% (10(2) HPV-16 copies), 12% (10(4) HPV-16 copies), 17% (274 beta-globin DNA copies) and 7% (27,400 beta-globin DNA copies). Samples containing 56,800,000, 306,000, 18,000, and 4,070 HPV-16 copies/microg of cellular DNA were tested blindly and estimated to contain 48,800,000, 479,000, 20,300, and 6,620 HPV-16 copies/microg of DNA (mean ratio of measured to expected viral load of 1.27+/-0.32). Inhibition of amplification of HPV-16 and beta-globin ICs by six samples known to contain PCR inhibitors was variable: four inhibited both ICs while two inhibited only the HPV-16 IC. The use of internal controls with real-time PCR for HPV-16 quantitation allows to screen for the presence of inhibitors that do not affect equally primer-driven genomic amplification.

The globins of cyanobacteria and algae.

PubMed

Johnson, Eric A; Lecomte, Juliette T J

2013-01-01

Approximately, 20 years ago, a haemoglobin gene was identified within the genome of the cyanobacterium Nostoc commune. Haemoglobins have now been confirmed in multiple species of photosynthetic microbes beyond N. commune, and the diversity of these proteins has recently come under increased scrutiny. This chapter summarizes the state of knowledge concerning the phylogeny, physiology and chemistry of globins in cyanobacteria and green algae. Sequence information is by far the best developed and the most rapidly expanding aspect of the field. Structural and ligand-binding properties have been described for just a few proteins. Physiological data are available for even fewer. Although activities such as nitric oxide dioxygenation and oxygen scavenging are strong candidates for cellular function, dedicated studies will be required to complete the story on this intriguing and ancient group of proteins. © 2013 Elsevier Ltd. All rights reserved.

Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

PubMed Central

Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

2013-01-01

Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

[Association between Fok I vitamin D receptor (VDR) gene polymorphism and plasmatic concentrations of transforming growth factor-beta1 and interferon gamma in type 1 diabetes mellitus].

PubMed

López, Tatiana; García, Diego; Angel, Bárbara; Carrasco, Elena; Codner, Ethel; Ugarte, Francisca; Pérez-Bravo, Francisco

2008-02-02

In order to assess whether Fok I vitamin D receptor gene (VDR) polymorphism is involved in the genetic susceptibility of type 1 diabetes, a case-control study was conducted and VDR genotypes were related to serum concentrations of 25(OH) vitamin D and cytokines transforming growth factor beta1 (TGF-beta1) and interferon gamma (INF-gamma). 151 incident cases of type 1 diabetes and 182 non related healthy controls from Santiago were studied for VDR polymorphisms in peripheral blood DNA. Exon 2 (Fok I) segments were amplified by polimerase chain reaction and analyzed by means of restriction fragment length polymorphism to determine each corresponding genotype. Differences for allele, genotype and serological markers as 25(OH) vitamin D, TGF-beta1 and INF-gamma levels distribution between patients and controls were analyzed. Fok I polymorphism distribution analysis showed no differences between patients and controls. Among diabetics, higher levels of TGF-beta1 (median, 282.6 pg/ml; range, 131.8-3,031.4) were observed compared with healthy children (median, 232.2 pg/ml; range, 135.7-506.5) (p < 0.0038). Similar results were observed for INF-gamma concentrations (median, 121.1 pg/ml, and range, 5.3-228.8, in cases, and median, 89.6 pg/ml, and range, 10.9-117.2 in controls) (p < 0.0004). The diabetic carriers of the ff genotype showed low levels of 25(OH) vitamin D compared with the carriers of the F allele: mean (standard deviation), 23.1 (5.9) versus 27.9 (10.3) ng/ml (p < 0.03). A similar result was observed for TGF-beta1 concentrations in diabetic carriers of ff genotype and patients carriers of the F allele (298.5 versus 276.6; p < 0.05). Fok I polymorphism of VDR could have a marginal role in the immunologic disturbance in type 1 diabetes.

Effects of positive results for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA on results of caudal fold tuberculin test and interferon-gamma assay for tuberculosis in cattle.

PubMed

Dunn, John R; Kaneene, John B; Grooms, Daniel L; Bolin, Steven R; Bolin, Carole A; Bruning-Fann, Colleen S

2005-02-01

To determine whether cattle testing positive for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA were more likely to have false-positive responses on the caudal fold tuberculin (CFT) test or interferon-gamma (IFN-gamma) assay for Mycobacterium bovis than cattle testing negative for M paratuberculosis. 1043 cattle from 10 herds in Michigan. Feces and blood samples for plasma were collected from cattle > or =24 months old on the day the CFT test was read. Fecal samples were submitted for microbial culture for M paratuberculosis. Plasma samples were tested for antibody against M paratuberculosis, and IFN-gamma after stimulation with purified protein derivative tuberculin from M bovis or M avium. Of 1043 cattle, 180 (17.3%) had positive CFT test results (suspects) and 8 (0.8%) had positive IFN-gamma assay results after stimulation with purified protein derivative tuberculin from M bovis. Forty-five (4.3%) and 115 (11.0%) cattle tested positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA, respectively. Cattle with positive responses for M paratuberculosis appeared to have an increased likelihood of false-positive results on the CFT test, although this association was not significant. No significant association was detected among cattle testing positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA and positive CFT test and IFN-gamma assay results for M bovis.

Altered modulation of gamma oscillation frequency by speed of visual motion in children with autism spectrum disorders.

PubMed

Stroganova, Tatiana A; Butorina, Anna V; Sysoeva, Olga V; Prokofyev, Andrey O; Nikolaeva, Anastasia Yu; Tsetlin, Marina M; Orekhova, Elena V

2015-01-01

Recent studies link autism spectrum disorders (ASD) with an altered balance between excitation and inhibition (E/I balance) in cortical networks. The brain oscillations in high gamma-band (50-120 Hz) are sensitive to the E/I balance and may appear useful biomarkers of certain ASD subtypes. The frequency of gamma oscillations is mediated by level of excitation of the fast-spiking inhibitory basket cells recruited by increasing strength of excitatory input. Therefore, the experimental manipulations affecting gamma frequency may throw light on inhibitory networks dysfunction in ASD. Here, we used magnetoencephalography (MEG) to investigate modulation of visual gamma oscillation frequency by speed of drifting annular gratings (1.2, 3.6, 6.0 °/s) in 21 boys with ASD and 26 typically developing boys aged 7-15 years. Multitaper method was used for analysis of spectra of gamma power change upon stimulus presentation and permutation test was applied for statistical comparisons. We also assessed in our participants visual orientation discrimination thresholds, which are thought to depend on excitability of inhibitory networks in the visual cortex. Although frequency of the oscillatory gamma response increased with increasing velocity of visual motion in both groups of participants, the velocity effect was reduced in a substantial proportion of children with ASD. The range of velocity-related gamma frequency modulation correlated inversely with the ability to discriminate oblique line orientation in the ASD group, while no such correlation has been observed in the group of typically developing participants. Our findings suggest that abnormal velocity-related gamma frequency modulation in ASD may constitute a potential biomarker for reduced excitability of fast-spiking inhibitory neurons in a subset of children with ASD.

Plasma interferon-gamma-inducible protein-10 (IP-10) levels during acute hepatitis C virus infection

PubMed Central

Grebely, Jason; Feld, Jordan J.; Applegate, Tanya; Matthews, Gail V.; Hellard, Margaret; Sherker, Alana; Petoumenos, Kathy; Zang, Geng; Shaw, Ineke; Yeung, Barbara; George, Jacob; Teutsch, Suzy; Kaldor, John M.; Cherepanov, Vera; Bruneau, Julie; Shoukry, Naglaa H.; Lloyd, Andrew R.; Dore, Gregory J.

2013-01-01

Systemic levels of interferon-gamma-inducible protein-10 (IP-10) are predictive of treatment-induced clearance in chronic HCV. In the present study, factors associated with plasma IP-10 levels at the time of acute HCV detection and the association between IP-10 levels and spontaneous clearance were assessed in three cohorts of acute HCV infection. Among 300 individuals, 245 (181 male, 47 HIV+) were HCV RNA+ at acute HCV detection. In adjusted analysis, factors independently associated with IP-10 levels ≥150 pg/mL (median level) included HCV RNA levels >6 log IU/mL, HIV co-infection and non-Aboriginal ethnicity. Among 245 HCV RNA+ at acute HCV detection, 214 were untreated (n=137) or had persistent infection (infection duration ≥26 weeks) at treatment initiation (n=77). Spontaneous clearance occurred in 14% (29 of 214). Individuals without spontaneous clearance had significantly higher mean plasma IP-10 levels at the time of acute HCV detection than those with clearance (248±32 vs. 142±22 pg/mL, P=0.008). The proportion of individuals with spontaneous clearance was 0% (0 of 22, P=0.048) and 16% (27 of 165) and in those in those with and without plasma IP-10 levels ≥380 pg/mL. In adjusted analyses, favourable IL28B genotype was associated with spontaneous clearance, while higher HCV RNA level was independently associated with lower odds of spontaneous clearance. Conclusion High IP-10 levels at acute HCV detection were associated with failure to spontaneously clear HCV. Patients with acute HCV and high baseline IP-10 levels, particularly >380 pg/mL, should be considered for early therapeutic intervention, and those with low levels should defer therapy for potential spontaneous clearance. PMID:23325615

No Love Lost Between Viruses and Interferons.

PubMed

Fensterl, Volker; Chattopadhyay, Saurabh; Sen, Ganes C

2015-11-01

The interferon system protects mammals against virus infections. There are several types of interferons, which are characterized by their ability to inhibit virus replication and resultant pathogenesis by triggering both innate and cell-mediated immune responses. Virus infection is sensed by a variety of cellular pattern-recognition receptors and triggers the synthesis of interferons, which are secreted by the infected cells. In uninfected cells, cell surface receptors recognize the secreted interferons and activate intracellular signaling pathways that induce the expression of interferon-stimulated genes; the proteins encoded by these genes inhibit different stages of virus replication. To avoid extinction, almost all viruses have evolved mechanisms to defend themselves against the interferon system. Consequently, a dynamic equilibrium of survival is established between the virus and its host, an equilibrium that can be shifted to the host's favor by the use of exogenous interferon as a therapeutic antiviral agent.

Adenoviral mediated interferon-alpha 2b gene therapy suppresses the pro-angiogenic effect of vascular endothelial growth factor in superficial bladder cancer.

PubMed

Adam, Liana; Black, Peter C; Kassouf, Wassim; Eve, Beryl; McConkey, David; Munsell, Mark F; Benedict, William F; Dinney, Colin P N

2007-05-01

Intravesical adenovirus mediated interferon-alpha gene transfer has a potent therapeutic effect against superficial human bladder carcinoma xenografts growing in the bladder of athymic nude mice. We determined whether the inhibition of angiogenesis might contribute to the antitumor effect. We treated several human urothelial carcinoma cells with adenovirus mediated interferon-alpha 2b and monitored its effects on the production of angiogenic factors using real-time reverse-transcription polymerase chain reaction, Western blotting, and immunohistochemical analysis and a gel shift based transcription factor array. To assess the role of adenovirus mediated interferon 2b in angiogenic activity we used in vitro invasion assays and evaluated the anti-angiogenic effects of adenovirus mediated interferon gene therapy in an orthotopic murine model of human superficial bladder cancer. In adenovirus mediated interferon-alpha infected 253J B-V cells vascular endothelial growth factor was decreased and anti-angiogenic interferon-gamma inducible protein 10 was up-regulated. In contrast, the addition of as much as 100,000 IU recombinant interferon had no apparent effect on vascular endothelial growth factor production. Conditioned medium derived from adenovirus mediated interferon 2b infected 253J B-V cells greatly decreased the invasive potential of human endothelial cells and down-regulated their matrix metalloproteinase 2 expression compared to controls. Furthermore, adenovirus mediated interferon 2b blocked pro-angiogenic nuclear signals, such as the transcription factors activating protein-1 and 2, stimulating protein-1, nuclear factor kappaB and c-myb. In vivo experiments revealed significant vascular endothelial growth factor down-regulation and decreased tumor vessel density in the adenovirus mediated interferon 2b treated group compared to controls. Treatment with adenovirus mediated interferon 2b increases the angiostatic activity of the bladder cancer microenvironment

Sequence change in the HS2-LCR and Ggamma-globin gene promoter region of sickle cell anemia patients.

PubMed

Adorno, E V; Moura-Neto, J P; Lyra, I; Zanette, A; Santos, L F O; Seixas, M O; Reis, M G; Goncalves, M S

2008-02-01

The fetal hemoglobin (HbF) levels and betaS-globin gene haplotypes of 125 sickle cell anemia patients from Brazil were investigated. We sequenced the Ggamma- and Agamma-globin gene promoters and the DNase I-2 hypersensitive sites in the locus control regions (HS2-LCR) of patients with HbF level disparities as compared to their betaS haplotypes. Sixty-four (51.2%) patients had CAR/Ben genotype; 36 (28.8%) Ben/Ben; 18 (14.4%) CAR/CAR; 2 (1.6%) CAR/Atypical; 2 (1.6%) Ben/Cam; 1 (0.8%) CAR/Cam; 1 (0.8%) CAR/Arab-Indian, and 1 (0.8%) Sen/Atypical. The HS2-LCR sequence analyses demonstrated a c.-10.677G>A change in patients with the Ben haplotype and high HbF levels. The Gg gene promoter sequence analyses showed a c.-157T>C substitution shared by all patients, and a c.-222_-225del related to the Cam haplotype. These results identify new polymorphisms in the HS2-LCR and Gg-globin gene promoter. Further studies are required to determine the correlation between HbF synthesis and the clinical profile of sickle cell anemia patients.

H3 K79 dimethylation marks developmental activation of the beta-globin gene but is reduced upon LCR-mediated high-level transcription.

PubMed

Sawado, Tomoyuki; Halow, Jessica; Im, Hogune; Ragoczy, Tobias; Bresnick, Emery H; Bender, M A; Groudine, Mark

2008-07-15

Genome-wide analyses of the relationship between H3 K79 dimethylation and transcription have revealed contradictory results. To clarify this relationship at a single locus, we analyzed expression and H3 K79 modification levels of wild-type (WT) and transcriptionally impaired beta-globin mutant genes during erythroid differentiation. Analysis of fractionated erythroid cells derived from WT/Delta locus control region (LCR) heterozygous mice reveals no significant H3 K79 dimethylation of the beta-globin gene on either allele prior to activation of transcription. Upon transcriptional activation, H3 K79 di-methylation is observed along both WT and DeltaLCR alleles, and both alleles are located in proximity to H3 K79 dimethylation nuclear foci. However, H3 K79 di-methylation is significantly increased along the DeltaLCR allele compared with the WT allele. In addition, analysis of a partial LCR deletion mutant reveals that H3 K79 dimethylation is inversely correlated with beta-globin gene expression levels. Thus, while our results support a link between H3 K79 dimethylation and gene expression, high levels of this mark are not essential for high level beta-globin gene transcription. We propose that H3 K79 dimethylation is destabilized on a highly transcribed template.

Synergistic and additive properties of the beta-globin locus control region (LCR) revealed by 5'HS3 deletion mutations: implication for LCR chromatin architecture.

PubMed

Fang, Xiangdong; Sun, Jin; Xiang, Ping; Yu, Man; Navas, Patrick A; Peterson, Kenneth R; Stamatoyannopoulos, George; Li, Qiliang

2005-08-01

Deletion of the 234-bp core element of the DNase I hypersensitive site 3 (5'HS3) of the locus control region (LCR) in the context of a human beta-globin locus yeast artificial chromosome (beta-YAC) results in profound effects on globin gene expression in transgenic mice. In contrast, deletion of a 2.3-kb 5'HS3 region, which includes the 234-bp core sequence, has a much milder phenotype. Here we report the effects of these deletions on chromatin structure in the beta-globin locus of adult erythroblasts. The 234-bp 5'HS3 deletion abolished histone acetylation throughout the beta-globin locus; recruitment of RNA polymerase II (pol II) to the LCR and beta-globin gene promoter was reduced to a basal level; and formation of all the 5' DNase I hypersensitive sites of the LCR was disrupted. The 2.3-kb 5'HS3 deletion mildly reduced the level of histone acetylation but did not change the profile across the whole locus; the 5' DNase I hypersensitive sites of the LCR were formed, but to a lesser extent; and recruitment of pol II was reduced, but only marginally. These data support the hypothesis that the LCR forms a specific chromatin structure and acts as a single entity. Based on these results we elaborate on a model of LCR chromatin architecture which accommodates the distinct phenotypes of the 5'HS3 and HS3 core deletions.

[Plasma levels of interferon gamma and interleukin 10 in patients with lymphonodular toxoplasmosis].

PubMed

Bielec, D; Patorska-Mach, E; Semczuk, G; Toruń, E

1997-01-01

The concentrations of IFN gamma and IL 10 in plasma of sixteen patients with toxoplasmic lymphadenopathy were measured. These examinations were carried out two times in the interval of a month. We found increased level of IFN gamma and normal concentrations of IL 10 in both of these terms.

Versatile Cosmid Vectors for the Isolation, Expression, and Rescue of Gene Sequences: Studies with the Human α -globin Gene Cluster

NASA Astrophysics Data System (ADS)

Lau, Yun-Fai; Kan, Yuet Wai

1983-09-01

We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.

Roles of CD4+ T Cells and Gamma Interferon in Protective Immunity against Babesia microti Infection in Mice

PubMed Central

Igarashi, Ikuo; Suzuki, Reiko; Waki, Seiji; Tagawa, Yoh-Ichi; Seng, Seyha; Tum, Sothyra; Omata, Yoshitaka; Saito, Atsushi; Nagasawa, Hideyuki; Iwakura, Yohichiro; Suzuki, Naoyoshi; Mikami, Takeshi; Toyoda, Yutaka

1999-01-01

Babesia microti produces a self-limiting infection in mice, and recovered mice are resistant to reinfection. In the present study, the role of T cells in protective immunity against challenge infection was examined. BALB/c mice which recovered from primary infection showed strong protective immunity against challenge infection. In contrast, nude mice which failed to control the primary infection and were cured with an antibabesial drug did not show protection against challenge infection. Treatment of immune mice with anti-CD4 monoclonal antibody (MAb) diminished the protective immunity against challenge infection, but treatment with anti-CD8 MAb had no effect on the protection. Transfer of CD4+ T-cell-depleted spleen cells resulted in higher parasitemia than transfer of CD8+ T-cell-depleted spleen cells. A high level of gamma interferon (IFN-γ), which was produced by CD4+ T cells, was observed for the culture supernatant of spleen cells from immune mice, and treatment of immune mice with anti-IFN-γ MAb partially reduced the protection. Moreover, no protection against challenge infection was found in IFN-γ-deficient mice. On the other hand, treatment of immune mice with MAbs against interleukin-2 (IL-2), IL-4, or tumor necrosis factor alpha did not affect protective immunity. These results suggest essential requirements for CD4+ T cells and IFN-γ in protective immunity against challenge infection with B. microti. PMID:10417185

Role of α-globin H helix in the building of tetrameric human hemoglobin: interaction with α-hemoglobin stabilizing protein (AHSP) and heme molecule.

PubMed

Domingues-Hamdi, Elisa; Vasseur, Corinne; Fournier, Jean-Baptiste; Marden, Michael C; Wajcman, Henri; Baudin-Creuza, Véronique

2014-01-01

Alpha-Hemoglobin Stabilizing Protein (AHSP) binds to α-hemoglobin (α-Hb) or α-globin and maintains it in a soluble state until its association with the β-Hb chain partner to form Hb tetramers. AHSP specifically recognizes the G and H helices of α-Hb. To investigate the degree of interaction of the various regions of the α-globin H helix with AHSP, this interface was studied by stepwise elimination of regions of the α-globin H helix: five truncated α-Hbs α-Hb1-138, α-Hb1-134, α-Hb1-126, α-Hb1-123, α-Hb1-117 were co-expressed with AHSP as two glutathione-S-transferase (GST) fusion proteins. SDS-PAGE and Western Blot analysis revealed that the level of expression of each truncated α-Hb was similar to that of the wild type α-Hb except the shortest protein α-Hb1-117 which displayed a decreased expression. While truncated GST-α-Hb1-138 and GST-α-Hb1-134 were normally soluble; the shorter globins GST-α-Hb1-126 and GST-α-Hb1-117 were obtained in very low quantities, and the truncated GST-α-Hb1-123 provided the least material. Absorbance and fluorescence studies of complexes showed that the truncated α-Hb1-134 and shorter forms led to modified absorption spectra together with an increased fluorescence emission. This attests that shortening the H helix leads to a lower affinity of the α-globin for the heme. Upon addition of β-Hb, the increase in fluorescence indicates the replacement of AHSP by β-Hb. The CO binding kinetics of different truncated AHSPWT/α-Hb complexes showed that these Hbs were not functionally normal in terms of the allosteric transition. The N-terminal part of the H helix is primordial for interaction with AHSP and C-terminal part for interaction with heme, both features being required for stability of α-globin chain.

The elephant interferon gamma assay: a contribution to diagnosis of tuberculosis in elephants.

PubMed

Angkawanish, T; Morar, D; van Kooten, P; Bontekoning, I; Schreuder, J; Maas, M; Wajjwalku, W; Sirimalaisuwan, A; Michel, A; Tijhaar, E; Rutten, V

2013-11-01

Mycobacterium tuberculosis (M. tb) has been shown to be the main causative agent of tuberculosis in elephants worldwide. M. tb may be transmitted from infected humans to other species including elephants and vice versa, in case of prolonged intensive contact. An accurate diagnostic approach covering all phases of the infection in elephants is required. As M. tb is an intracellular pathogen and cell-mediated immune (CMI) responses are elicited early after infection, the skin test is the CMI assay of choice in humans and cattle. However, this test is not applicable in elephants. The interferon gamma (IFN-γ) assay is considered a good alternative for the skin test in general, validated for use in cattle and humans. This study was aimed at development of an IFN-γ assay applicable for diagnosis of tuberculosis in elephants. Recombinant elephant IFN-γ (rEpIFN-γ) produced in eukaryotic cells was used to immunize mice and generate the monoclonal antibodies. Hybridomas were screened for IFN-γ-specific monoclonal antibody production and subcloned, and antibodies were isotyped and affinity purified. Western blot confirmed recognition of the rEpIFN-γ. The optimal combination of capture and detection antibodies selected was able to detect rEpIFN-γ in concentrations as low as 1 pg/ml. The assay was shown to be able to detect the native elephant IFN-γ, elicited in positive-control cultures (pokeweed mitogen (PWM), phorbol myristate acetate plus ionomycin (PMA/I)) of both Asian and African elephant whole-blood cultures (WBC). Preliminary data were generated using WBC from non-infected elephants, a M. tb infection-suspected elephant and a culture-confirmed M. tb-infected elephant. The latter showed measurable production of IFN-γ after stimulation with ESAT6/CFP10 PPDB and PPDA in concentration ranges as elicited in WBC by Mycobacterium tuberculosis complex (MTBC)-specific antigens in other species. Hence, the IFN-γ assay presented potential as a diagnostic tool for the

Altered polymorphonuclear leukocyte Fc gamma R expression contributes to decreased candicidal activity during intraabdominal sepsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simms, H.H.; D'Amico, R.; Monfils, P.

We investigated the effects of untreated intraabdominal sepsis on polymorphonuclear leukocyte (PMN) candicidal activity. Two groups of swine were studied. Group I (n=6) underwent sham laparotomy, group II (n=7) underwent cecal ligation and incision. Untreated intraabdominal sepsis resulted in a progressive decrease in PMN candicidal activity. Concomitant rosetting and phagocytosis assays demonstrated a decrease in both the attachment and phagocytosis of Candida albicans opsonized with both normal and septic swine serum by PMNs in group II. Iodine 125-labeled swine immunoglobulin G (IgG) and fluorescein isothioalanate (FITC)-labeled swine IgG were used to investigate Fc gamma receptor ligand interactions. Scatchard analyses demonstratedmore » a progressive decline in both the binding affinity constant and number of IgG molecules bound per PMN. Stimulation of the oxidative burst markedly reduced 125I-labeled IgG binding in both group I and group II, with a greater decrement being seen in animals with intraabdominal sepsis. Further, in group II, PMN recycling of the Fc gamma receptor to the cell surface after generation of the oxidative burst was reduced by postoperative day 4. Binding of monoclonal antibodies to Fc gamma receptor II, but not Fc gamma receptor I/III markedly reduced intracellular candicidal activity. Immunofluorescence studies revealed a homogeneous pattern of FITC-IgG uptake by nearly all group I PMNs, whereas by postoperative day 8 a substantial number of PMNs from group II failed to internalize the FITC-IgG. These studies suggest that untreated intraabdominal sepsis reduces PMN candicidal activity and that this is due, in part, to altered PMN Fc gamma receptor ligand interactions.« less

[Fish interferon response and its molecular regulation: a review].

PubMed

Zhang, Yibing; Gui, Jianfang

2011-05-01

Interferon response is the first line of host defense against virus infection. Recent years have witnessed tremendous progress in understanding of fish innate response to virus infection, especially in fish interferon antiviral response. A line of fish genes involved in interferon antiviral response have been identified and functional studies further reveal that fish possess an IFN antiviral system similar to mammals. However, fish virus-induced interferon genes contain introns similar to mammalian type III interferon genes although they encode proteins similar to type I interferons, which makes it hard to understand the evolution of vertebrate interferon genes directly resulting in a debate on nomenclature of fish interferon genes. Actually, fish display some unique mechanisms underlying interferon antiviral response. This review documents the recent progress on fish interferon response and its molecular mechanism.

Effects of isolation on interferon production and hematological and immunological parameters

NASA Technical Reports Server (NTRS)

Sonnenfeld, G.; Measel, J.; Loken, M. R.; Degioanni, J.; Follini, S.; Galvagno, A.; Montalbini, M.

1992-01-01

A 27-year-old woman was maintained in an isolated state for 131 days in Carlsbad Caverns, New Mexico. Her diet was vitamin D-depleted. Determinations on the effects of such isolation on levels and activities of peripheral blood cells that are important for hematological homeostasis and immunological function were carried out. Throughout the duration of the study, the percentage of lymphoid cells that expressed CD3, CD4, CD8, CD19, Leu 8, and other markers remained relatively constant although the absolute numbers of these cells varied. Although the percentage of natural killer (NK) cells did not vary, the activity of these cells did change. NK cell activity became elevated as the isolation study progressed. Production of interferon-gamma (IFN-gamma) in response to mitogen stimulation was higher than expected throughout the isolation periods, but returned to the normal range after termination of the isolation. Red and white cell counts dropped significantly upon entering isolation, but soon returned to normal.

Human macrophage gamma interferon decreases gene expression but not replication of Mycobacterium tuberculosis: analysis of the host-pathogen reciprocal influence on transcription in a comparison of strains H37Rv and CMT97.

PubMed

Cappelli, G; Volpe, P; Sanduzzi, A; Sacchi, A; Colizzi, V; Mariani, F

2001-12-01

Mycobacterium tuberculosis is an intracellular pathogen that readily survives and replicates in human macrophages (MPhi). Host cells have developed different mycobactericidal mechanisms, including the production of inflammatory cytokines. The aim of this study was to compare the MPhi response, in terms of cytokine gene expression, to infection with the M. tuberculosis laboratory strain H37Rv and the clinical M. tuberculosis isolate CMT97. Both strains induce the production of interleukin-12 (IL-12) and IL-16 at comparable levels. However, the clinical isolate induces a significantly higher and more prolonged MPhi activation, as shown by reverse transcription-PCR analysis of IL-1beta, IL-6, IL-10, transforming growth factor beta, tumor necrosis factor alpha, and gamma interferon (IFN-gamma) transcripts. Interestingly, when IFN-gamma transcription is high, the number of M. tuberculosis genes expressed decreases and vice versa, whereas no mycobactericidal effect was observed in terms of bacterial growth. Expression of 11 genes was also studied in the two M. tuberculosis strains by infecting resting or activated MPhi and compared to bacterial intracellular survival. In both cases, a peculiar inverse correlation between expression of these genes and multiplication was observed. The number and type of genes expressed by the two strains differed significantly.

A new gene deletion in the alpha-like globin gene cluster as the molecular basis for the rare alpha-thalassemia-1(--/alpha alpha) in blacks: HbH disease in sickle cell trait.

PubMed

Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P

1986-02-01

A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.

A randomized Phase I/II Trial of HQK-1001, an oral fetal globin gene inducer, in β–thalassaemia intermedia and HbE/β–thalassaemia

PubMed Central

Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.

2014-01-01

β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969

mNotch1 signaling and erythropoietin cooperate in erythroid differentiation of multipotent progenitor cells and upregulate beta-globin.

PubMed

Henning, Konstanze; Schroeder, Timm; Schwanbeck, Ralf; Rieber, Nikolaus; Bresnick, Emery H; Just, Ursula

2007-09-01

In many developing tissues, signaling mediated by activation of the transmembrane receptor Notch influences cell-fate decisions, differentiation, proliferation, and cell survival. Notch receptors are expressed on hematopoietic cells and cognate ligands on bone marrow stromal cells. Here, we investigate the role of mNotch1 signaling in the control of erythroid differentiation of multipotent progenitor cells. Multipotent FDCP-mix cell lines engineered to permit the conditional induction of the constitutively active intracellular domain of mNotch1 (mN1(IC)) by the 4-hydroxytamoxifen (OHT)-inducible system were used to analyze the effects of activated mNotch1 on erythroid differentiation and on expression of Gata1, Fog1, Eklf, NF-E2, and beta-globin. Expression was analyzed by Northern blotting and real-time polymerase chain reaction. Enhancer activity of reporter constructs was determined with the dual luciferase system in transient transfection assays. Induction of mN1(IC) by OHT resulted in increased and accelerated differentiation of FDCP-mix cells along the erythroid lineage. Erythroid maturation was induced by activated Notch1 also under conditions that normally promote self-renewal, but required the presence of erythropoietin for differentiation to proceed. While induction of Notch signaling rapidly upregulated Hes1 and Hey1 expression, the expression of Gata1, Fog1, Eklf, and NF-E2 remained unchanged. Concomitantly with erythroid differentiation, activated mNotch1 upregulated beta-globin RNA. Notch signaling transactivated a reporter construct harboring a conserved RBP-J (CBF1) binding site in the hypersensitive site 2 (HS2) of human beta-globin. Transactivation by activated Notch was completely abolished when this RBP-J site was mutated to prevent RBP-J binding. Our results show that activation of mNotch1 induces erythroid differentiation in cooperation with erythropoietin and upregulates beta-globin expression.

Controlling nuclear JAKs and STATs for specific gene activation by IFN{gamma}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea

2011-07-08

Highlights: {yields} Gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interact with the promoter region of IFN{gamma}-associated genes along with transcription factor STAT1{alpha}. {yields} We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. {yields} The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interacted with the promoter region of IFN{gamma}-activated genes along with transcription factor STAT1{alpha}. Recent studies have suggested that activated Janus kinases pJAK2 andmore » pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFN{gamma}. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFN{gamma} treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The {beta}-actin gene, which is not activated by IFN{gamma}, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFN{gamma} treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFN{gamma} treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFN{gamma

Combination alpha-interferon and lamivudine therapy for alpha-interferon-resistant chronic hepatitis B infection: results of a pilot study.

PubMed

Mutimer, D; Naoumov, N; Honkoop, P; Marinos, G; Ahmed, M; de Man, R; McPhillips, P; Johnson, M; Williams, R; Elias, E; Schalm, S

1998-06-01

Alpha-interferon achieves seroconversion in about one third of naive patients. Attempts to achieve seroconversion in patients who have previously failed alpha-interferon have proved disappointing. Combination chemotherapy (alpha-interferon with a nucleoside analogue) might provide a treatment alternative for these patients. We have undertaken a phase 2 study in 20 patients who had previously failed at least one course of alpha-interferon. The study was designed to assess the safety, tolerability and efficacy of the combination. All patients were treated for 16 weeks with alpha-interferon in combination with 12 or 16 weeks of Lamivudine (3'TC). Patients were followed for 16 weeks post-treatment. Pharmacokinetic studies were performed to identify/exclude significant pharmacokinetic drug interaction. The combination was well tolerated, and side-effects of the combination were indistinguishable from the recognised side-effects of alpha-interferon. Pharmacokinetic studies performed on days 1 and 29 did not show any significant interaction. All patients achieved HBV DNA clearance during treatment, but 19 relapsed at the end of treatment. HBeAg/anti-HBe seroconversion was observed for four patients, but was sustained for a single patient (who also had sustained DNA clearance). Combination therapy with alpha-interferon and lamivudine given for 16 weeks appears safe and is well tolerated. However, for this group of patients who had previously failed interferon monotherapy, the efficacy of combination interferon/lamivudine therapy appears disappointing, and other treatment strategies should be investigated.

A randomized phase II trial comparing two different sequence combinations of autologous vaccine and human recombinant interferon gamma and human recombinant interferon alpha2B therapy in patients with metastatic renal cell carcinoma: clinical outcome and analysis of immunological parameters.

PubMed

Schwaab, T; Heaney, J A; Schned, A R; Harris, R D; Cole, B F; Noelle, R J; Phillips, D M; Stempkowski, L; Ernstoff, M S

2000-04-01

The clinical observation of spontaneous regression in patients with renal cell carcinoma (RCC) and the response to various immunotherapeutic therapies strongly suggest a role for the host immune system in this disease. Prior studies showed that sequential administration of interferon (IFN) gamma and IFN alpha to RCC patients was safe. Clinical responses as well as immune changes in the peripheral blood mononuclear cell compartment were observed. Autologous tumor cell vaccines (AV) have also demonstrated activity in renal cell carcinoma. We hypothesize that the addition of AV to sequential IFN gamma and a therapy might improve the tumor-specific immune response by providing an appropriate source of antigen in the appropriate cytokine environment. To our knowledge, this is the first trial using AV combined with IFN alpha and IFN gamma. The purpose of this study was to evaluate the feasibility of manufacturing and administering (AV) from resected tumor samples, and administration of AV with combination IFN gamma and IFN alpha therapy. Finally, the impact on immunological parameters of these treatment options was assessed. Patients with metastatic RCC were randomly assigned to receive AV plus bCG along with a sequential administration of IFN gamma and a either together or after initiation of vaccine. Toxicity and clinical responses were evaluated. Modulations of the immune system were investigated by analyzing phenotype, cytokine mRNA expression, T cell proliferation and cytotoxicity in the peripheral blood mononuclear cell compartment. Fourteen patients with metastatic renal cell carcinoma were enrolled in this study; 9 were available for response evaluation. In a 70 day period, 3 (33%) showed mixed responses, 5 (56%) stable disease and 1 (11%) progression of disease. Toxicities were consistent with previous clinical reports. In the flow-cytometry phenotype analysis, stimulation of distinct subsets of circulating T-lymphocytes and a decrease of CD8+ T cell subsets was

Perforin and gamma interferon expression are required for CD4+ and CD8+ T-cell-dependent protective immunity against a human parasite, Trypanosoma cruzi, elicited by heterologous plasmid DNA prime-recombinant adenovirus 5 boost vaccination.

PubMed

de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M

2009-10-01

A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.

Interferon gamma peptidomimetic targeted to hepatic stellate cells ameliorates acute and chronic liver fibrosis in vivo.

PubMed

Bansal, Ruchi; Prakash, Jai; De Ruiter, Marieke; Poelstra, Klaas

2014-04-10

Hepatic stellate cells play a crucial role in the pathogenesis of hepatic fibrosis. Thus, pharmacological inhibition of pro-fibrotic activities of these cells might lead to an effective therapy for this disease. Among the potent anti-fibrotics, interferon gamma (IFNγ), a proinflammatory cytokine, is highly efficacious but it failed in clinical trials due to the poor efficacy and multiple adverse effects attributed to the ubiquitous IFNγ receptor (IFNγR) expression. To resolve these drawbacks, we chemically synthesized a chimeric molecule containing (a) IFNγ signaling peptide (IFNγ peptidomimetic, mimγ) that retains the agonistic activities of IFNγ but lacks an extracellular receptor recognition sequence for IFNγR; coupled via heterobifunctional PEG linker to (b) bicyclic platelet derived growth factor beta receptor (PDGFβR)-binding peptide (BiPPB) to induce internalization into the stellate cells that express PDGFβR. The synthesized targeted IFNγ peptidomimetic (mimγ-BiPPB) was extensively investigated for its anti-fibrotic and adverse effects in acute and chronic CCl4-induced liver fibrosis models in mice. Treatment with mimγ-BiPPB, after the onset of disease, markedly inhibited both early and established hepatic fibrosis as reflected by a reduced intrahepatic α-SMA, desmin and collagen-I mRNA expression and protein levels. While untargeted mimγ and BiPPB had no effect, and native IFNγ only induced a moderate reduction. Additionally, no off-target effects, e.g. systemic inflammation, were found with mimγ-BiPPB, which were substantially observed in mice treated with native IFNγ. The present study highlights the beneficial effects of a novel BiPPB mediated cell-specific targeting of IFNγ peptidomimetic to the disease-inducing cells and therefore represents a highly potential therapeutic approach to treat fibrotic diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

Effects of type I/type II interferons and transforming growth factor-beta on B-cell differentiation and proliferation. Definition of costimulation and cytokine requirements for immunoglobulin synthesis and expression.

PubMed

Estes, D M; Tuo, W; Brown, W C; Goin, J

1998-12-01

In this report, we sought to determine the role of selected type I interferons [interferon-alpha (IFN-alpha) and interferon-tau (IFN-tau)], IFN-gamma and transforming growth factor-beta (TGF-beta) in the regulation of bovine antibody responses. B cells were stimulated via CD40 in the presence or absence of B-cell receptor (BCR) cross-linking. IFN-alpha enhanced IgM, IgG2 and IgA responses but did not enhance IgG1 responses. BCR signalling alone was more effective at inducing IgG2 responses with IFN-alpha than dual cross-linking with CD40. Recombinant ovine IFN-tau was less effective at inducing IgG2 responses when compared with IFN-alpha, though IgA responses were similar in magnitude following BCR cross-linking. At higher concentrations, IFN-tau enhanced IgA responses greater than twofold over the levels observed with IFN-alpha. Previous studies have shown that addition of IFN-gamma to BCR or pokeweed mitogen-activated bovine B cells stimulates IgG2 production. However, following CD40 stimulation alone, IFN-gamma was relatively ineffective at stimulating high-rate synthesis of any non-IgM isotype. Dual cross-linking via CD40 and the BCR resulted in decreased synthesis of IgM with a concomitant increase in IgA and similar levels of IgG2 production to those obtained via the BCR alone. We also assessed the effects of endogenous and exogenous TGF-beta on immunoglobulin synthesis by bovine B cells. Exogenous TGF-beta stimulates both IgG2 and IgA production following CD40 and BCR cross-linking in the presence of IL-2. Blocking endogenous TGF-beta did not inhibit the up-regulation of IgG2 or IgA by interferons.

[The expression of interferon-lambda1 in CHO cell].

PubMed

Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu

2013-06-01

To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.

Risk of tuberculosis among air passengers estimated by interferon gamma release assay: survey of contact investigations, Japan, 2012 to 2015

PubMed Central

Ota, Masaki; Kato, Seiya

2017-01-01

Although the World Health Organization recommends contact investigations around air travel-associated sputum smear-positive tuberculosis (TB) patients, evidence suggests that the information thus obtained may have overestimated the risk of TB infection because it involved some contacts born in countries with high TB burden who were likely to have been infected with TB in the past, or because tuberculin skin tests were used, which are less specific than the interferon gamma release assay (IGRA) particularly in areas where Bacillus Calmette-Guérin (BCG) vaccination coverage is high. We conducted a questionnaire survey on air travel-associated TB contact investigations in local health offices of Japan from 2012 to 2015, focusing on IGRA positivity. Among 651 air travel-associated TB contacts, average positivity was 3.8% (95% confidence interval (CI): 2.5–5.6) with a statistically significant increasing trend with older age (p < 0.0094). Positivity among 0–34 year-old contacts was 1.0% (95% CI: 0.12–3.5%), suggesting their risk of TB infection is as small as among Japanese young adults with low risk of TB infection (positivity: 0.85–0.90%). Limiting the contact investigation to fewer passengers (within two seats surrounding the index case, rather than two rows) seems reasonable in the case of aircraft with many seats per row. PMID:28367799

Analyzing the Utilization of Interferon-Gamma Screening for Tuberculosis at Recruit Training Command, Great Lakes

DTIC Science & Technology

2006-05-31

the project through a business case analysis conducted on this same subject. CAPT Monestersky, Preventive Medicine; LCDR Jacobs, Occupational Medicine...TB and LTBI (Taylor, Nolan, & Blumberg , Interferon-y screening for TB 8 2005). They are based on science founded in the 1 9 th century. The current...identify individuals who may not be suitable for service. For the majority who are suitable, the "P" days allow time to complete necessary business

Beyond Tryptophan Synthase: Identification of Genes That Contribute to Chlamydia trachomatis Survival during Gamma Interferon-Induced Persistence and Reactivation

PubMed Central

Muramatsu, Matthew K.; Brothwell, Julie A.; Stein, Barry D.; Putman, Timothy E.; Rockey, Daniel D.

2016-01-01

Chlamydia trachomatis can enter a viable but nonculturable state in vitro termed persistence. A common feature of C. trachomatis persistence models is that reticulate bodies fail to divide and make few infectious progeny until the persistence-inducing stressor is removed. One model of persistence that has relevance to human disease involves tryptophan limitation mediated by the host enzyme indoleamine 2,3-dioxygenase, which converts l-tryptophan to N-formylkynurenine. Genital C. trachomatis strains can counter tryptophan limitation because they encode a tryptophan-synthesizing enzyme. Tryptophan synthase is the only enzyme that has been confirmed to play a role in interferon gamma (IFN-γ)-induced persistence, although profound changes in chlamydial physiology and gene expression occur in the presence of persistence-inducing stressors. Thus, we screened a population of mutagenized C. trachomatis strains for mutants that failed to reactivate from IFN-γ-induced persistence. Six mutants were identified, and the mutations linked to the persistence phenotype in three of these were successfully mapped. One mutant had a missense mutation in tryptophan synthase; however, this mutant behaved differently from previously described synthase null mutants. Two hypothetical genes of unknown function, ctl0225 and ctl0694, were also identified and may be involved in amino acid transport and DNA damage repair, respectively. Our results indicate that C. trachomatis utilizes functionally diverse genes to mediate survival during and reactivation from persistence in HeLa cells. PMID:27430273

A Luciferase Reporter Gene System for High-Throughput Screening of γ-Globin Gene Activators.

PubMed

Xie, Wensheng; Silvers, Robert; Ouellette, Michael; Wu, Zining; Lu, Quinn; Li, Hu; Gallagher, Kathleen; Johnson, Kathy; Montoute, Monica

2016-01-01

Luciferase reporter gene assays have long been used for drug discovery due to their high sensitivity and robust signal. A dual reporter gene system contains a gene of interest and a control gene to monitor non-specific effects on gene expression. In our dual luciferase reporter gene system, a synthetic promoter of γ-globin gene was constructed immediately upstream of the firefly luciferase gene, followed downstream by a synthetic β-globin gene promoter in front of the Renilla luciferase gene. A stable cell line with the dual reporter gene was cloned and used for all assay development and HTS work. Due to the low activity of the control Renilla luciferase, only the firefly luciferase activity was further optimized for HTS. Several critical factors, such as cell density, serum concentration, and miniaturization, were optimized using tool compounds to achieve maximum robustness and sensitivity. Using the optimized reporter assay, the HTS campaign was successfully completed and approximately 1000 hits were identified. In this chapter, we also describe strategies to triage hits that non-specifically interfere with firefly luciferase.

Monomethylfumarate Induces γ-Globin Expression and Fetal Hemoglobin Production in Cultured Human Retinal Pigment Epithelial (RPE) and Erythroid Cells, and in Intact Retina

PubMed Central

Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B.; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S.; Martin, Pamela M.

2014-01-01

Purpose. Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Methods. Human globin gene expression was evaluated by RT–quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase–qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous βs mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Results. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. Conclusions. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. PMID:24825111

Essential Cell-Autonomous Role for Interferon (IFN) Regulatory Factor 1 in IFN-γ-Mediated Inhibition of Norovirus Replication in Macrophages

PubMed Central

Maloney, Nicole S.; Thackray, Larissa B.; Goel, Gautam; Hwang, Seungmin; Duan, Erning; Vachharajani, Punit; Xavier, Ramnik

2012-01-01

Noroviruses (NVs) cause the majority of cases of epidemic nonbacterial gastroenteritis worldwide and contribute to endemic enteric disease. However, the molecular mechanisms responsible for immune control of their replication are not completely understood. Here we report that the transcription factor interferon regulatory factor 1 (IRF-1) is required for control of murine NV (MNV) replication and pathogenesis in vivo. This led us to studies documenting a cell-autonomous role for IRF-1 in gamma interferon (IFN-γ)-mediated inhibition of MNV replication in primary macrophages. This role of IRF-1 in the inhibition of MNV replication by IFN-γ is independent of IFN-αβ signaling. While the signal transducer and activator of transcription STAT-1 was also required for IFN-γ-mediated inhibition of MNV replication in vitro, class II transactivator (CIITA), interferon regulatory factor 3 (IRF-3), and interferon regulatory factor 7 (IRF-7) were not required. We therefore hypothesized that there must be a subset of IFN-stimulated genes (ISGs) regulated by IFN-γ in a manner dependent only on STAT-1 and IRF-1. Analysis of transcriptional profiles of macrophages lacking various transcription factors confirmed this hypothesis. These studies identify a key role for IRF-1 in IFN-γ-dependent control of norovirus infection in mice and macrophages. PMID:22973039

Rapid activation of the interferon system in vivo.

PubMed Central

Dianzani, F; Gullino, P; Baron, S

1978-01-01

Experiments were carried out to study the kinetics of local interferon production in the subcutaneous tissues of rats stimulated with Newcastle disease virus. Specifically, the interferon produced and released in the extracellular fluids was collected at various intervals of time in micropore chambers implanted into the subcutaneous tissue of rats. Interferon was detected at moderate titers 1 h after induction, and it was present at high titer at 2 h. The interferon levels remained remarkably high in the samples collected after 3, 5, and 24 h, and in some rats it was still detectable after 48 and 72 h. Since control experiments showed that it requires 2 to 3 h for interferon to penetrate the chambers, it may be concluded that high concentrations of interferon are present in the extracellular fluid within 1 h of induction. The evaluation of the kinetics of production and of the concentrations attained in the extracellular fluid suggests that in a solid tissue a cell infected by a potent interferon inducer may produce interferon early enough and in sufficient quantity to protect neighboring cells before the production of progeny virions. PMID:669799

Human B cells fail to secrete type I interferons upon cytoplasmic DNA exposure.

PubMed

Gram, Anna M; Sun, Chenglong; Landman, Sanne L; Oosenbrug, Timo; Koppejan, Hester J; Kwakkenbos, Mark J; Hoeben, Rob C; Paludan, Søren R; Ressing, Maaike E

2017-11-01

Most cells are believed to be capable of producing type I interferons (IFN I) as part of an innate immune response against, for instance, viral infections. In macrophages, IFN I is potently induced upon cytoplasmic exposure to foreign nucleic acids. Infection of these cells with herpesviruses leads to triggering of the DNA sensors interferon-inducible protein 16 (IFI16) and cyclic GMP-AMP (cGAMP) synthase (cGAS). Thereby, the stimulator of interferon genes (STING) and the downstream molecules TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3) are sequentially activated culminating in IFN I secretion. Human gamma-herpesviruses, such as Epstein-Barr virus (EBV), exploit B cells as a reservoir for persistent infection. In this study, we investigated whether human B cells, similar to macrophages, engage the cytoplasmic DNA sensing pathway to induce an innate immune response. We found that the B cells fail to secrete IFN I upon cytoplasmic DNA exposure, although they express the DNA sensors cGAS and IFI16 and the signaling components TBK1 and IRF3. In primary human B lymphocytes and EBV-negative B cell lines, this deficiency is explained by a lack of detectable levels of the central adaptor protein STING. In contrast, EBV-transformed B cell lines did express STING, yet both these lines as well as STING-reconstituted EBV-negative B cells did not produce IFN I upon dsDNA or cGAMP stimulation. Our combined data show that the cytoplasmic DNA sensing pathway is dysfunctional in human B cells. This exemplifies that certain cell types cannot induce IFN I in response to cytoplasmic DNA exposure providing a potential niche for viral persistence. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

In vivo induction of interferon gamma expression in grey horses with metastatic melanoma resulting from direct injection of plasmid DNA coding for equine interleukin 12.

PubMed

Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K

2011-11-01

Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.

[Effects of interferon-gamma on cytotoxicity of murine activated macrophages against murine glioma cells].

PubMed

Ohyama, K; Kikuchi, H; Oda, Y; Moritake, K; Yamasaki, T

1993-06-01

We studied the effects of mouse IFN-gamma on the cytotoxic activity of murine activated macrophages (M phi) against mouse VM-Glioma cells (H-2b). Activated M phi were obtained from peritoneal exudate cells of mice from four strains, C57BL/6 (H-2b), C3H/He(H-2k), DBA/2 (H-2d), and BALB/c (H-2d), following intraperitoneal injection of (1) LPS 200 micrograms, (2) BCG 200 micrograms, (3) C. parvum 200 micrograms, or (4) MDP 350 micrograms 7 days prior to 20-hr 51Cr release-assay. Of the various combination of mouse strains and activating agents tested, that of activated M phi of the C3H/He mouse with induction by LPS had the most tumoricidal effect against the glioma cells, which was not MHC restricted. Although LPS-activated M phi underwent marked loss of cytotoxicity following initiation of in vitro culture, this 24 hr pretreatment with IFN-gamma inhibited this reduction in tumoricidal effects in a dose-dependent fashion. On the other hand, 24 hr pretreatment of target cells with IFN-gamma did not increase their susceptibility to lysis by activated M phi. These findings suggest that IFN-gamma augments the in vitro tumoricidal activation of M phi; This effect appears to be unrelated to any influence of IFN-gamma on target sensitivity to lysis by macrophages.

Human beta-globin mRNAs that harbor a nonsense codon are degraded in murine erythroid tissues to intermediates lacking regions of exon I or exons I and II that have a cap-like structure at the 5' termini.

PubMed Central

Lim, S K; Maquat, L E

1992-01-01

Previous studies have demonstrated that nonsense codons within beta zero-thalassemic or in vitro-mutagenized human beta-globin transgenes result in the production of mRNAs that are degraded abnormally rapidly in the cytoplasm of murine erythroid cells. As a consequence, three RNA degradative intermediates are formed that lack sequences from either exon I or exons I and II. We show here that the intermediates, like the full-length mRNA from which they derive and the endogenous murine beta maj-globin mRNA, bind to the anticap monoclonal antibody H-20 in a way that is competed by the cap analogue m7G and eliminated by prior exposure to tobacco acid pyrophosphatase. Furthermore, the intermediates, like the two full-length mRNAs, are resistant to a 5'----3' exonuclease activity isolated from HeLa cell nuclei that degrades uncapped but not capped ribopolymers. Based on these observations, the intermediates appear to possess a structure that is indistinguishable from the cap at the 5' end of mRNA, i.e. a methylated nucleoside that is linked to the RNA by a 5'-5' phosphodiester bond. Detection of the intermediates during murine development was concomitant with detection of full-length thalassemic mRNA. Intermediate production appears to be influenced by RNA structure as indicated by the products that derive from a beta zero-thalassemic beta-globin transgene harboring a structural alteration (a 4 bp deletion) that was larger than any of those previously studied. Images PMID:1324170

C-Reactive Protein (CRP), Interferon Gamma-Inducible Protein 10 (IP-10), and Lipopolysaccharide (LPS) Are Associated with Risk of Tuberculosis after Initiation of Antiretroviral Therapy in Resource-Limited Settings

PubMed Central

Tenforde, Mark W.; Gupte, Nikhil; Dowdy, David W.; Asmuth, David M.; Balagopal, Ashwin; Pollard, Richard B.; Sugandhavesa, Patcharaphan; Lama, Javier R.; Pillay, Sandy; Cardoso, Sandra W.; Pawar, Jyoti; Santos, Breno; Riviere, Cynthia; Mwelase, Noluthando; Kanyama, Cecilia; Kumwenda, Johnstone; Hakim, James G.; Kumarasamy, Nagalingeswaran; Bollinger, Robert; Semba, Richard D.; Campbell, Thomas B.; Gupta, Amita

2015-01-01

Objective The association between pre-antiretroviral (ART) inflammation and immune activation and risk for incident tuberculosis (TB) after ART initiation among adults is uncertain. Design Nested case-control study (n = 332) within ACTG PEARLS trial of three ART regimens among 1571 HIV-infected, treatment-naïve adults in 9 countries. We compared cases (participants with incident TB diagnosed by 96 weeks) to a random sample of controls (participants who did not develop TB, stratified by country and treatment arm). Methods We measured pre-ART C-reactive protein (CRP), EndoCab IgM, ferritin, interferon gamma (IFN-γ), interleukin 6 (IL-6), interferon gamma-inducible protein 10 (IP-10), lipopolysaccharide (LPS), soluble CD14 (sCD14), tumor necrosis factor alpha (TNF-α), and CD4/DR+/38+ and CD8/DR+/38+ T cells. Markers were defined according to established cutoff definitions when available, 75th percentile of measured values when not, and detectable versus undetectable for LPS. Using logistic regression, we measured associations between biomarkers and incident TB, adjusting for age, sex, study site, treatment arm, baseline CD4 and log10 viral load. We assessed the discriminatory value of biomarkers using receiver operating characteristic (ROC) analysis. Results Seventy-seven persons (4.9%) developed incident TB during follow-up. Elevated baseline CRP (aOR 3.25, 95% CI: 1.55–6.81) and IP-10 (aOR 1.89, 95% CI: 1.05–3.39), detectable plasma LPS (aOR 2.39, 95% CI: 1.13–5.06), and the established TB risk factors anemia and hypoalbuminemia were independently associated with incident TB. In ROC analysis, CRP, albumin, and LPS improved discrimination only modestly for TB risk when added to baseline routine patient characteristics including CD4 count, body mass index, and prior TB. Conclusion Incident TB occurs commonly after ART initiation. Although associated with higher post-ART TB risk, baseline CRP, IP-10, and LPS add limited value to routine patient characteristics

Gene expression and production of tumor necrosis factor alpha, interleukin 1, interleukin 6, and gamma interferon in C3H/HeN and C57BL/6N mice in acute Mycoplasma pulmonis disease.

PubMed Central

Faulkner, C B; Simecka, J W; Davidson, M K; Davis, J K; Schoeb, T R; Lindsey, J R; Everson, M P

1995-01-01

Studies were conducted to determine whether the production of various cytokines is associated with Mycoplasma pulmonis disease expression. Susceptible C3H/HeN and resistant C57BL/6N mice were inoculated intranasally with 10(7) CFU of virulent M. pulmonis UAB CT or avirulent M. pulmonis UAB T. Expression of genes for tumor necrosis factor alpha (TNF-alpha), interleukin 1 alpha (IL-1 alpha), IL-1 beta, IL-6, and gamma interferon (IFN-gamma) in whole lung tissue and TNF-alpha gene expression in bronchoalveolar lavage (BAL) cells was determined by reverse transcription-PCR using specific cytokine primers at various times postinoculation. In addition, concentrations of TNF-alpha, IL-1, IL-6, and IFN-gamma were determined in BAL fluid and serum samples at various times postinoculation. Our results showed that there was a sequential appearance of cytokines in the lungs of infected mice: TNF-alpha, produced primarily by BAL cells, appeared first, followed by IL-1 and IL-6, which were followed by IFN-gamma. Susceptible C3H/HeN mice had higher and more persistent concentrations of TNF-alpha and IL-6 in BAL fluid than did resistant C57BL/6N mice, indicating that TNF-alpha and possibly IL-6 are important factors in pathogenesis of acute M. pulmonis disease in mice. Serum concentrations of IL-6 were elevated in C3H/HeN mice, but not C57BL/6N mice, following infection with M. pulmonis, suggesting that IL-6 has both local and systemic effects in M. pulmonis disease. PMID:7558323

Interferon-gamma increased epithelial barrier function via upregulating claudin-7 expression in human submandibular gland duct epithelium.

PubMed

Abe, Ayumi; Takano, Kenichi; Kojima, Takashi; Nomura, Kazuaki; Kakuki, Takuya; Kaneko, Yakuto; Yamamoto, Motohisa; Takahashi, Hiroki; Himi, Tetsuo

2016-06-01

Tight junctions (TJs) are necessary for salivary gland function and may serve as indicators of salivary gland epithelial dysfunction. IgG4-related disease (IgG4-RD) is a newly recognized fibro-inflammatory condition which disrupts the TJ associated epithelial barrier. The salivary glands are one of the most frequently involved organs in IgG4-RD, however, changes of the TJ associated epithelial barrier in salivary gland duct epithelium is poorly understood. Here, we investigated the regulation and function of TJs in human submandibular gland ductal epithelial cells (HSDECs) in normal and IgG4-RD. We examined submandibular gland (SMG) tissue from eight control individuals and 22 patients with IgG4-RD and established an HSDEC culture system. Immunohistochemistry, immunocytochemistry, western blotting, and measurement of transepithelial electrical resistance (TER) were performed. Claudin-4, claudin-7, occludin, and JAM-A were expressed at the apical side of the duct epithelium in submandibular gland (SMG) tissue and at the cell borders in HSDECs of normal and IgG4-RD. The expression and distribution of TJs in SMG tissue were not different in control individuals and patients with IgG4-RD in vivo and in vitro. Although interferon-gamma (IFNγ) generally disrupts the integrity and function of TJs, as manifested by decreased epithelial barrier function, IFNγ markedly increased the epithelial barrier function of HSDECs via upregulation of claudin-7 expression in HSDECs from patients with IgG4-RD. This is the first report showing an IFNγ-dependent increase in epithelial barrier function in the salivary gland duct epithelium. Our results provide insights into the functional significance of TJs in salivary gland duct epithelium in physiological and pathological conditions, including IgG4-RD.

Genetic ablation of calcium-independent phospholipase A2gamma leads to alterations in mitochondrial lipid metabolism and function resulting in a deficient mitochondrial bioenergetic phenotype.

PubMed

Mancuso, David J; Sims, Harold F; Han, Xianlin; Jenkins, Christopher M; Guan, Shao Ping; Yang, Kui; Moon, Sung Ho; Pietka, Terri; Abumrad, Nada A; Schlesinger, Paul H; Gross, Richard W

2007-11-30

Previously, we identified a novel calcium-independent phospholipase, designated calcium-independent phospholipase A(2) gamma (iPLA(2)gamma), which possesses dual mitochondrial and peroxisomal subcellular localization signals. To identify the roles of iPLA(2)gamma in cellular bioenergetics, we generated mice null for the iPLA(2)gamma gene by eliminating the active site of the enzyme through homologous recombination. Mice null for iPLA(2)gamma display multiple bioenergetic dysfunctional phenotypes, including 1) growth retardation, 2) cold intolerance, 3) reduced exercise endurance, 4) greatly increased mortality from cardiac stress after transverse aortic constriction, 5) abnormal mitochondrial function with a 65% decrease in ascorbate-induced Complex IV-mediated oxygen consumption, and 6) a reduction in myocardial cardiolipin content accompanied by an altered cardiolipin molecular species composition. We conclude that iPLA(2)gamma is essential for maintaining efficient bioenergetic mitochondrial function through tailoring mitochondrial membrane lipid metabolism and composition.

Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

PubMed

Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

2014-05-09

The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

VNTR internal structure mapping at the {alpha}-globin 3{prime}HVR locus reveals a hierachy of related lineages in oceania

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

1994-09-01

Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. Wemore » have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.« less

Sickle cell disease caused by heterozygosity for Hb S and novel LCR deletion: Report of two patients.

PubMed

Koenig, Sara C; Becirevic, Esmira; Hellberg, Miriam S C; Li, Michael Y; So, Jason C C; Hankins, Jane S; Ware, Russell E; McMahon, Lillian; Steinberg, Martin H; Luo, Hong-Yuan; Chui, David H K

2009-09-01

The b-globin gene LCR is located approximately 6 kb upstream of the embryonic epsilon-globin gene, and is made up of five DNase I hypersensitive sites (HSs), HS 1-5. LCR plays a pivotal role in regulating the expression of downstream epsilon-, (G)gamma-, (A)gamma-, delta-, and beta-globin genes in cis [1]. Deletions removing the LCR and parts of the downstream beta-globin gene cluster in patients have been described [2]. These individuals present with a (gammadeltabeta)0-thalassemia carrier phenotype. We now report two patients with severe sickle cell disease who were compound heterozygous for Hb S mutation and novel LCR deletion. In one case, HS 1-3 were deleted; in the other, HS 1-5 were deleted. In both cases, the b-like globin genes in cis to the LCR deletions were intact. Genotypically, both patients appeared to have sickle cell trait. Coinherited with either LCR deletion, these individuals presented as sickle cell disease patients. The breakpoints of these LCR deletions were defined. These results affirm that HS 2 and 3 are primarily responsible for conferring erythroid specific high-level expression of cis-linked beta-like globin genes. Furthermore, LCR deletions might cause hemolytic disease of newborns.

Interferon-gamma +874 T/A and interleukin-10 -1082 A/G single nucleotide polymorphism in Egyptian children with tuberculosis.

PubMed

Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M

2010-10-01

The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.

[Alterations of glial fibrillary acidic protein in rat brain after gamma knife irradiation].

PubMed

Ma, Z M; Jiang, B; Ma, J R

2001-08-28

To study glial fibrillary acidic protein (GFAP) immunoreactivity in different time and water content of the rat brain treated with gamma knife radiotherapy and to understand the alteration course of the brain lesion after a single high dose radiosurgical treatment. In the brains of the normal rats were irradiated by gamma knife with 160 Gy-high dose. The irradiated rats were then killed on the 1st day, 7th day, 14th day, and 28th day after radiotherapy, respectively. The positive cells of GFAP in brain tissue were detected by immunostaining; the water content of the brain tissue was measured by microgravimetry. The histological study of the irradiated brain tissue was performed with H.E. and examined under light microscope. The numbers of GFAP-positive astrocytes began to increase on the 1st day after gamma knife irradiation. It was enlarged markedly in the number and size of GFAP-stained astrocytes over the irradiated areas. Up to the 28th day, circumscribed necrosis foci (4 mm in diameter) was seen in the central area of the target. In the brain tissue around the necrosis, GFAP-positive astrocytes significantly increased (P < 0.01, compared with the control group). The swelling of cells in irradiated region was observed on the 1st day; after irradiation endothelial cells degenerated and red blood cells escaped from blood vessel on the 7th day; leakage of Evans blue dye was observed in the target region on the 14th day. There was a significant decrease of specific gravity in the irradiated brain tissue the 14th and 28th day after irradiation. The results suggest that GFAP can be used as a marker for the radiation-induced brain injury. The brain edema and disruption of brain-blood barrier can be occurred during the acute stage after irradiation.

Effect of interferon on the replication of mink cell focus-inducing virus in murine cells: synthesis, processing, assembly, and release of viral proteins.

PubMed Central

Bilello, J A; Wivel, N A; Pitha, P M

1982-01-01

Treatment of mink cell focus-inducing (MCF) virus (isolate AK-13) producing SC-1 cells with mouse fibroblast interferon (150 to 600 U/ml) led to a 100-fold decrease in the release of infectious virus, whereas there was a 2.5- to 10-fold decrease in various parameters of virus particle release. Analysis of labeled virion proteins indicated that a temporal change in virion protein composition occurred after interferon treatment. After a 24-h exposure of chronically infected cells to interferon, the virions produced contained a 85,000-dalton glycoprotein (apparently of nonviral origin) which was in excess of the virus envelope glycoprotein gp70. Particles produced from cells treated with interferon for 32 to 48 h were nearly devoid of gp70 and contained substantially lower quantities of p30. Intracellular processing of viral precursor polyproteins to the mature virion structural proteins was not altered in the presence of interferon. However, an accumulation of the viral p30 and p12E proteins was observed in interferon-treated cells, consistent with an increase in cell-associated virions. Immunoprecipitation analysis of the tissue culture fluids from [35S]methionine-labeled control and interferon-treated cells revealed marked decrease in p30 and p15E/p12E released after interferon treatment. In contrast, gp70 did not accumulate in interferon-treated cells, but was released into the culture medium in a form that was neither pelletable nor associated with p15E/p12E. Images PMID:6180173

Sequential changes in chromatin structure during transcriptional activation in the beta globin LCR and its target gene.

PubMed

Kim, Kihoon; Kim, AeRi

2010-09-01

Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Interferon-γ alters downstream signaling originating from epidermal growth factor receptor in intestinal epithelial cells: functional consequences for ion transport.

PubMed

Paul, Gisela; Marchelletta, Ronald R; McCole, Declan F; Barrett, Kim E

2012-01-13

The epidermal growth factor receptor (EGFr) regulates many cellular functions, such as proliferation, apoptosis, and ion transport. Our aim was to investigate whether long term treatment with interferon-γ (IFN-γ) modulates EGF activation of downstream signaling pathways in intestinal epithelial cells and if this contributes to dysregulation of epithelial ion transport in inflammation. Polarized monolayers of T(84) and HT29/cl.19A colonocytes were preincubated with IFN-γ prior to stimulation with EGF. Basolateral potassium transport was studied in Ussing chambers. We also studied inflamed colonic mucosae from C57BL/6 mice treated with dextran sulfate sodium or mdr1a knock-out mice and controls. IFN-γ increased intestinal epithelial EGFr expression without increasing its phosphorylation. Conversely, IFN-γ caused a significant decrease in EGF-stimulated phosphorylation of specific EGFr tyrosine residues and activation of ERK but not Akt-1. In IFNγ-pretreated cells, the inhibitory effect of EGF on carbachol-stimulated K(+) channel activity was lost. In inflamed colonic tissues, EGFr expression was significantly increased, whereas ERK phosphorylation was reduced. Thus, although it up-regulates EGFr expression, IFN-γ causes defective EGFr activation in colonic epithelial cells via reduced phosphorylation of specific EGFr tyrosine residues. This probably accounts for altered downstream signaling consequences. These observations were corroborated in the setting of colitis. IFN-γ also abrogates the ability of EGF to inhibit carbachol-stimulated basolateral K(+) currents. Our data suggest that, in the setting of inflammation, the biological effect of EGF, including the inhibitory effect of EGF on Ca(2+)-dependent ion transport, is altered, perhaps contributing to diarrheal and other symptoms in vivo.

Chromatin organization as an indicator of glucocorticoid induced natural killer cell dysfunction.

PubMed

Misale, Michael S; Witek Janusek, Linda; Tell, Dina; Mathews, Herbert L

2018-01-01

It is well-established that psychological distress reduces natural killer cell immune function and that this reduction can be due to the stress-induced release of glucocorticoids. Glucocorticoids are known to alter epigenetic marks associated with immune effector loci, and are also known to influence chromatin organization. The purpose of this investigation was to assess the effect of glucocorticoids on natural killer cell chromatin organization and to determine the relationship of chromatin organization to natural killer cell effector function, e.g. interferon gamma production. Interferon gamma production is the prototypic cytokine produced by natural killer cells and is known to modulate both innate and adaptive immunity. Glucocorticoid treatment of human peripheral blood mononuclear cells resulted in a significant reduction in interferon gamma production. Glucocorticoid treatment also resulted in a demonstrable natural killer cell nuclear phenotype. This phenotype was localization of the histone, post-translational epigenetic mark, H3K27me3, to the nuclear periphery. Peripheral nuclear localization of H3K27me3 was directly related to cellular levels of interferon gamma. This nuclear phenotype was determined by direct visual inspection and by use of an automated, high through-put technology, the Amnis ImageStream. This technology combines the per-cell information content provided by standard microscopy with the statistical significance afforded by large sample sizes common to standard flow cytometry. Most importantly, this technology provides for a direct assessment of the localization of signal intensity within individual cells. The results demonstrate glucocorticoids to dysregulate natural killer cell function at least in part through altered H3K27me3 nuclear organization and demonstrate H3K27me3 chromatin organization to be a predictive indicator of glucocorticoid induced immune dysregulation of natural killer cells. Copyright © 2017 Elsevier Inc. All rights

Evasion of interferon responses by Ebola and Marburg viruses.

PubMed

Basler, Christopher F; Amarasinghe, Gaya K

2009-09-01

The filoviruses, Ebola virus (EBOV) and Marburg virus (MARV), cause frequently lethal viral hemorrhagic fever. These infections induce potent cytokine production, yet these host responses fail to prevent systemic virus replication. Consistent with this, filoviruses have been found to encode proteins VP35 and VP24 that block host interferon (IFN)-alpha/beta production and inhibit signaling downstream of the IFN-alpha/beta and the IFN-gamma receptors, respectively. VP35, which is a component of the viral nucleocapsid complex and plays an essential role in viral RNA synthesis, acts as a pseudosubstrate for the cellular kinases IKK-epsilon and TBK-1, which phosphorylate and activate interferon regulatory factor 3 (IRF-3) and interferon regulatory factor 7 (IRF-7). VP35 also promotes SUMOylation of IRF-7, repressing IFN gene transcription. In addition, VP35 is a dsRNA-binding protein, and mutations that disrupt dsRNA binding impair VP35 IFN-antagonist activity while leaving its RNA replication functions intact. The phenotypes of recombinant EBOV bearing mutant VP35s unable to inhibit IFN-alpha/beta demonstrate that VP35 IFN-antagonist activity is critical for full virulence of these lethal pathogens. The structure of the VP35 dsRNA-binding domain, which has recently become available, is expected to provide insight into how VP35 IFN-antagonist and dsRNA-binding functions are related. The EBOV VP24 protein inhibits IFN signaling through an interaction with select host cell karyopherin-alpha proteins, preventing the nuclear import of otherwise activated STAT1. It remains to be determined to what extent VP24 may also modulate the nuclear import of other host cell factors and to what extent this may influence the outcome of infection. Notably, the Marburg virus VP24 protein does not detectably block STAT1 nuclear import, and, unlike EBOV, MARV infection inhibits STAT1 and STAT2 phosphorylation. Thus, despite their similarities, there are fundamental differences by which

[Interferon alpha-2b modified with polyethylene glycol].

PubMed

Wu, Yingxin; Zhai, Yanqin; Lei, Jiandu; Ma, Guanghui; Su, Zhiguo

2008-09-01

In order to obtain a more stable PEGylated interferon alpha-2b, and prolong its half life, interferon alpha-2b (IFN alpha-2b) was modified with monomethoxy polyethylene glycol propionaldehyde (mPEG-ALD) 20000. It was found that the optimized reaction condition for the maximum bioactivity and highest PEGylation degree of the mono PEGylated interferon alpha-2b was as follows: in 20 mmol/L, pH 6.5, citric acid and sodium dihydrogen phosphate buffer, the concentration of IFN alpha-2b was 4 mg/mL, and the molar ratio of PEG/IFN alpha-2b was 8:1, and the reaction time was 20 h at 4 degrees C. Under the optimized reaction condition, the mono PEGylation degree reached to 55%. Ion exchange chromatography was used to separate and purify mono PEGylated interferon alpha-2b from the reaction mixture. The purity of mono PEGylated interferon alpha-2b was higher than 97% characterized by HPLC. The bioactivity of the mono PEGylated interferon alpha-2b was 13.4% of the native IFN alpha-2b, while its half life in SD rat is much longer than the native IFN alpha-2b. The mono PEGylated interferon alpha-2b is also stable in aqueous.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Features of Postoperative Immune Suppression Are Reversible With Interferon Gamma and Independent of Interleukin-6 Pathways.

PubMed

Longbottom, E Rebecca; Torrance, Hew D T; Owen, Helen C; Fragkou, Paraskevi C; Hinds, Charles J; Pearse, Rupert M; O'Dwyer, Michael J

2016-08-01

The aim of this study was to evaluate the role of interleukin (IL)-6 pathways in postoperative immune suppression and to assess the reversibility of this phenomenon. The postoperative period is characterized by increased IL-6 production and features of immune suppression. In vitro, IL-6 mediates anti-inflammatory effects through inhibition of interferon gamma (IFN-γ) pathways. The significance of the immunomodulatory effects of IL-6 in the clinical setting of postoperative immune suppression remains unclear. Patients over 45 years old undergoing elective surgery, involving the gastrointestinal tract, were recruited. IL-6 levels were assayed using an enzyme linked immunosorbent assay preoperatively, and at 24 and 48 hours. Peripheral blood mononuclear cells from healthy volunteers were cultured in perioperative serum and CD14Human Leukocyte Antigen-DR (HLA-DR) [monocyte HLA-DR (mHLA-DR)] geometric mean florescent intensity was measured in the presence and absence of IL-6 neutralizing antibody and recombinant IFN-γ. Of the 108 patients, 41 developed a postoperative infection. The IL-6 levels increased 19-fold from the preoperative sample to 24 hours postoperatively (P < 0.0001). Higher IL-6 levels at 24 (P = 0.0002) and 48 hours (P = 0.003) were associated with subsequent postoperative infectious complications. mHLA-DR mean florescent intensity fell when healthy peripheral blood mononuclear cells were cultured with postoperative serum compared with preoperative serum (P = 0.008). This decrease was prevented by the presence of IFN-γ in the culture media, but not by the presence of IL-6-neutralizing antibody. IL-6 levels increase after a major surgery and are associated with an increased susceptibility to postoperative infections. Serum obtained from postoperative patients induces an immunosuppressive response, reflected in reduced mHLA-DR levels, mediated through IL-6 independent pathways and is reversible with IFN-γ. These data may have

Continuous in vivo infusion of interferon-gamma (IFN-γ) enhances engraftment of syngeneic wild-type cells in Fanca–/– and Fancg–/– mice

PubMed Central

Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J.; Critser, John; Arwert, Fre; Haneline, Laura S.; Clapp, D. Wade

2006-01-01

Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc–/– cells to interferon-gamma (IFN-γ), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc–/– mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca–/– and Fancg–/– mice are hypersensitive to IFN-γ and that in vivo infusion of IFN-γ at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-γ conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients. PMID:16946306

Cooperativeness of the higher chromatin structure of the beta-globin locus revealed by the deletion mutations of DNase I hypersensitive site 3 of the LCR.

PubMed

Fang, Xiangdong; Xiang, Ping; Yin, Wenxuan; Stamatoyannopoulos, George; Li, Qiliang

2007-01-05

High-level transcription of the globin genes requires the enhancement by a distant element, the locus control region (LCR). Such long-range regulation in vivo involves spatial interaction between transcriptional elements, with intervening chromatin looping out. It has been proposed that the clustering of the HS sites of the LCR, the active globin genes, as well as the remote 5' hypersensitive sites (HSs) (HS-60/-62 in mouse, HS-110 in human) and 3'HS1 forms a specific spatial chromatin structure, termed active chromatin hub (ACH). Here we report the effects of the HS3 deletions of the LCR on the spatial chromatin structure of the beta-globin locus as revealed by the chromatin conformation capture (3C) technology. The small HS3 core deletion (0.23 kb), but not the large HS3 deletion (2.3 kb), disrupted the spatial interactions among all the HS sites of the LCR, the beta-globin gene and 3'HS1. We have previously demonstrated that the large HS3 deletion barely impairs the structure of the LCR holocomplex, while the structure is significantly disrupted by the HS3 core deletion. Taken together, these results suggest that the formation of the ACH is dependent on a largely intact LCR structure. We propose that the ACH indeed is an extension of the LCR holocomplex.

Silver nanoparticle-induced hemoglobin decrease involves alteration of histone 3 methylation status.

PubMed

Qian, Yi; Zhang, Jie; Hu, Qinglin; Xu, Ming; Chen, Yue; Hu, Guoqing; Zhao, Meirong; Liu, Sijin

2015-11-01

Silver nanoparticles (nanosilver, AgNPs) have been shown to induce toxicity in vitro and in vivo; however, the molecular bases underlying the detrimental effects have not been thoroughly understood. Although there are numerous studies on its genotoxicity, only a few studies have investigated the epigenetic changes, even less on the changes of histone modifications by AgNPs. In the current study, we probed the AgNP-induced alterations to histone methylation that could be responsible for globin reduction in erythroid cells. AgNP treatment caused a significant reduction of global methylation level for histone 3 (H3) in erythroid MEL cells at sublethal concentrations, devoid of oxidative stress. The ChIP-PCR analyses demonstrated that methylation of H3 at lysine (Lys) 4 (H3K4) and Lys 79 (H3K79) on the β-globin locus was greatly reduced. The reduction in methylation could be attributed to decreased histone methyltransferase DOT-1L and MLL levels as well as the direct binding between AgNPs to H3/H4 that provide steric hindrance to prevent methylation as predicted by the all-atom molecular dynamics simulations. This direct interaction was further proved by AgNP-mediated pull-down assay and immunoprecipitation assay. These changes, together with decreased RNA polymerase II activity and chromatin binding at this locus, resulted in decreased hemoglobin production. By contrast, Ag ion-treated cells showed no alterations in histone methylation level. Taken together, these results showed a novel finding in which AgNPs could alter the methylation status of histone. Our study therefore opens a new avenue to study the biological effects of AgNPs at sublethal concentrations from the perspective of epigenetic mechanisms. Copyright © 2015 Elsevier Ltd. All rights reserved.

Altered erythropoiesis and iron metabolism in carriers of thalassemia

PubMed Central

Guimarães, Jacqueline S.; Cominal, Juçara G.; Silva-Pinto, Ana Cristina; Olbina, Gordana; Ginzburg, Yelena Z.; Nandi, Vijay; Westerman, Mark; Rivella, Stefano; de Souza, Ana Maria

2014-01-01

The thalassemia syndromes (α- and β-thalassemia) are the most common and frequent disorders associated with ineffective erythropoiesis. Imbalance of α- or β-globin chain production results in impaired red blood cell synthesis, anemia and more erythroid progenitors in the blood stream. While patients affected by these disorders show definitive altered parameters related to erythropoiesis, the relationship between the degree of anemia, altered erythropoiesis and dysfunctional iron metabolism have not been investigated in both α-thalassemia carriers (ATC) and β-thalassemia carriers (BTC). Here we demonstrate that ATC have a significantly reduced hepcidin and increased soluble transferrin receptor levels but relatively normal hematological findings. In contrast, BTC have several hematological parameters significantly different from controls, including increased soluble transferrin receptor and erythropoietin levels. These changings in both groups suggest an altered balance between erythropoiesis and iron metabolism. The index sTfR/log ferrin and (hepcidin/ferritin)/sTfR are respectively increased and reduced relative to controls, proportional to the severity of each thalassemia group. In conclusion, we showed in this study, for the first time in the literature, that thalassemia carriers have altered iron metabolism and erythropoiesis. PMID:25307880

Interferon-based treatment of chronic hepatitis C.

PubMed

Souvignet, Claude; Lejeune, Olivier; Trepo, Christian

2007-01-01

The treatment of patients with chronic hepatitis C has rapidly evolved in the past 10 years centered on the use of interferon alpha 2 as an antiviral and immunomodulatory agent against hepatitis C virus. Firstly used as a monotherapy associated with a deceiving long-term efficacy, interferon alpha was then combined with ribavirin, a nucleoside analog with large antiviral properties. Combination of both drugs dramatically improved the efficacy of treatment with 50% of patients reaching a sustained viral response, characterized by the final eradication of the virus from the infected individual. Surprisingly, this synergistic effect remains greatly unexplained. The third step consisted in the use of pegylated interferon in order to adapt its pharmacokinetics and to allow a better efficacy with a more tolerable dosing schedule: once weekly subcutaneous injection instead of thrice weekly. Pegylated interferon combined with ribavirin during 24-48 weeks of treatment is the current standard of care with nearly 60% of sustained virologic response, overall. Development of new forms of interferon alpha are on the way with promising preliminary results.

Stability of human interferon-beta 1: oligomeric human interferon-beta 1 is inactive but is reactivated by monomerization.

PubMed

Utsumi, J; Yamazaki, S; Kawaguchi, K; Kimura, S; Shimizu, H

1989-10-05

Human interferon-beta 1 is extremely stable is a low ionic strength solution of pH 2 such as 10 mM HCl at 37 degrees C. However, the presence of 0.15 M NaCl led to a remarkable loss of antiviral activity. The molecular-sieve high-performance liquid chromatography revealed that, whereas completely active human interferon-beta 1 eluted as a 25 kDa species (monomeric form), the inactivated preparation eluted primarily as a 90 kDa species (oligomeric form). The specific activity (units per mg protein) of the oligomeric form was approx. 10% of that of the monomeric form. This observation shows that oligomeric human interferon-beta 1 is apparently in an inactive form. When the oligomeric eluate was resolved by polyacrylamide gel containing sodium dodecyl sulphate (SDS), it appeared to be monomeric under non-reducing conditions. Monomerization of the oligomeric human interferon-beta 1 by treatment with 1% SDS, fully regenerated its antiviral activity. These results suggest that the inactivation of the human interferon-beta 1 preparation was caused by its oligomerization via hydrophobic interactions without the formation of intermolecular disulphide bonds. These oligomers can be dissociated by SDS to restore biological activity.

Protein-expression profiles in mouse blood-plasma following acute whole-body exposure to (137)Cs gamma rays.

PubMed

Rithidech, Kanokporn Noy; Honikel, Louise; Rieger, Robert; Xie, Weiping; Fischer, Thomas; Simon, Sanford R

2009-05-01

To compare the pattern of protein-expression profiles in blood-plasma after exposure of CBA/CaJ mice to 0 or 3 Gy of (137)Cs gamma rays. Two-dimensional electrophoresis gel coupled with mass spectrometry was used to analyze blood-samples collected at days 2 and 7 post-irradiation. At each sacrifice-time, alterations in expression-level of protein spots between control- and exposed-groups were analyzed statistically by the PDQuest software using Student's t-test (at the significance level of p < 0.05). Mass spectrometry was used to identify the identity of protein-spots with significantly altered expression-level. At day 2, 18 proteins were significantly up-regulated in exposed-mice. These included: alpha-2-Heremans-Schmid (HS)-glycoprotein, apolipoprotein (Apo)-AII-precursor, Apo-E, beta-2-glycoprotein-I, clusterin, fibrinogen-alpha-chain, fibrinogen-gamma-polypeptide, fetuin-B, haptoglobin, high-molecular-weight (HMW)-kininogen (Kng), low-MW-Kng, Kng1-precursor, liver-carboxylesterase-I-precursor, major-urinary-protein-6-precursor, mannose-binding-protein-C-precursor, mannose-binding-lectin-C, and prothrombin-precursor. Gelsolin was detected in control-mice only. At day 7, high expression-levels of 14 proteins were detected in control-mice (i.e., alpha-1-antitrypsin-precursor, carboxylesterase-N, cholesterol-7-alpha-hydroxylase, contraspin, coagulation-factor-II, coagulation-factor-XIII, gelsolin, immunoglobulin-G-heavy-chain, neurexin, prothrombin-precursor, protein-phosphatase, putative-calcium-influx-channel, vitamin-D-binding-protein, and 1110018G07Rik); while 15 proteins were highly expressed in exposed-mice. These included: alpha-1-acid-glycoprotein, alpha-2-HS-glycoprotein, alpha-1-protease-inhibitor-2, ApoA-IV, ApoC-I, ApoH, beta-1-globin, clusterin, complement-component-3, fibrinogen-beta-chain, HMW-Kng, major-histocompatibility-complex-class-Ia-H2-K, serine-(cysteine)-proteinase-inhibitor, retinoblastoma-associated-protein-140, and vascular

Screening of (-SEA) α-thalassaemia using an immunochromatographic strip assay for the ζ-globin chain in a population with a high prevalence and heterogeneity of haemoglobinopathies.

PubMed

Jomoui, Wittaya; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

2017-01-01

The presence of the ζ-globin chain is a good marker of (-- SEA ) α 0 -thalassaemia. We evaluated an immunochromatographic (IC) strip assay for ζ-globin in screening for (-- SEA ) α 0 -thalassaemia in a population with a high prevalence and heterogeneity of haemoglobinopathies. The study was carried out on 300 screen positive blood samples of Thai individuals. The IC strip assay for the ζ-globin chain was performed on all samples. The results were interpreted with thalassaemia genotyping using standard haemoglobin and DNA analyses. Several thalassaemia genotypes were noted. Among the 300 subjects investigated, 79 had a positive IC strip assay for ζ-globin and (-- SEA ) α 0 -thalassaemia was identified in 40 of them. No (-- SEA ) α 0 -thalassaemia was detected in the remaining 39 samples with a positive IC strip test result or in the 221 samples with a negative IC strip test result. Further DNA analysis identified α + -thalassaemia in 25 of the 39 (-- SEA ) α 0 -thalassaemia negative samples. Using this IC strip assay in combination with a conventional screening protocol for (-- SEA ) α 0 -thalassaemia could provide sensitivity and specificity of 100% and 90.4%, respectively. IC strip assay for ζ-globin is simple, rapid and does not require sophisticated equipment. Use of this test in addition to the existing screening protocol could detect potential (-- SEA ) α 0 -thalassaemia leading to a significant reduction in the workload of DNA analysis. This could be used in areas where haemoglobinopathies are prevalent and heterogeneous but molecular testing is not available. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Prolonged illness after infectious mononucleosis is associated with altered immunity but not with increased viral load.

PubMed

Cameron, Barbara; Bharadwaj, Mandvi; Burrows, Jacqueline; Fazou, Chrysa; Wakefield, Denis; Hickie, Ian; Ffrench, Rosemary; Khanna, Rajiv; Lloyd, Andrew

2006-03-01

Primary Epstein-Barr virus (EBV) infection causes a spectrum of characteristics that range from asymptomatic seroconversion to severe infectious mononucleosis (IM), sometimes with prolonged symptoms and disability. We examined the relationships between clinical course, number of viral copies, and immunological parameters in a prospective cohort of subjects with recent IM. Eight case patients with at least 6 months of disabling symptoms and 31 matched control subjects who had recovered promptly were included. Symptom scores were recorded at regular intervals over the course of 12 months. Cellular EBV load, EBV-specific antibody responses, lymphocyte subsets, and EBV-specific interferon (IFN)- gamma induction were measured. In case patients with prolonged illness, the severity of acute-phase symptoms was greater, the development of anti-EBV nuclear antigen-1 immunoglobulin G was more rapid, and the time to development of the peak IFN- gamma response to the majority of latent-cycle EBV peptides was generally slower than those in control subjects. However, in both groups, neither viral nor immune parameters correlated with the severity or duration of symptoms. The resolution of symptomatic IM is not determined by control of viremia, nor is it easily explained by altered host responses to EBV infection. The detailed determinants of delayed recovery remain to be elucidated.

Interferon in resistance to bacterial and protozoan infections

NASA Technical Reports Server (NTRS)

Sonnenfeld, Gerald; Gould, Cheryl L.; Kierszenbaum, Felipe; Degee, Antonie L. W.; Mansfield, John M.

1986-01-01

The effects of genetic differences in mouse strains on the modulation of protozoan infections by interferon (IFN) were investigated. In one set of experiments, three different strains of mice were injected with T. cruzi, and their sera were assayed at five time intervals for IFN titer. A greater quantity of IFN was produced by mouse strains that were susceptible to T. cruzi infection than by the more resistant strain. In another set of experiments, spleen cell cultures from inbred strains of mice were challenged with an antigen made from T.b. rhodesiense. The cells from mice resistant to infection, produced greater amounts of IFN-gamma than did cells from the susceptible mice. In a third set of experiments, it was found that mice injected with T.b. rhodesiense before being infected with a diabetogenic virus (EMC-D) were resistant to the effects of the virus and did not produce virus-specific antibody.

Parasite-mediated upregulation of NK cell-derived gamma interferon protects against severe highly pathogenic H5N1 influenza virus infection.

PubMed

O'Brien, Kevin B; Schultz-Cherry, Stacey; Knoll, Laura J

2011-09-01

Outbreaks of influenza A viruses are associated with significant human morbidity worldwide. Given the increasing resistance to the available influenza drugs, new therapies for the treatment of influenza virus infection are needed. An alternative approach is to identify products that enhance a protective immune response. In these studies, we demonstrate that infecting mice with the Th1-inducing parasite Toxoplasma gondii prior to highly pathogenic avian H5N1 influenza virus infection led to decreased lung viral titers and enhanced survival. A noninfectious fraction of T. gondii soluble antigens (STAg) elicited an immune response similar to that elicited by live parasites, and administration of STAg 2 days after H5N1 influenza virus infection enhanced survival, lowered viral titers, and reduced clinical disease. STAg administration protected H5N1 virus-infected mice lacking lymphocytes, suggesting that while the adaptive immune response was not required for enhanced survival, it was necessary for STAg-mediated viral clearance. Mechanistically, we found that administration of STAg led to increased production of gamma interferon (IFN-γ) from natural killer (NK) cells, which were both necessary and sufficient for survival. Further, administration of exogenous IFN-γ alone enhanced survival from H5N1 influenza virus infection, although not to the same level as STAg treatment. These studies demonstrate that a noninfectious T. gondii extract enhances the protective immune response against severe H5N1 influenza virus infections even when a single dose is administered 2 days postinfection.

Interferon-alpha in the treatment of multiple myeloma.

PubMed

Khoo, Teh Liane; Vangsted, Annette Juul; Joshua, Douglas; Gibson, John

2011-03-01

Interferons are soluble proteins produced naturally by cells in response to viruses. It has both anti-proliferative and immunomodulating properties and is one of the first examples of a biological response modifier use to treat the haematological malignancy multiple myeloma. Interferon has been used in this clinical practice for over thirty years. However, despite considerable efforts, numerous clinical trials and two large meta-analysis, its exact role in the management of multiple myeloma still remains unclear. Its role in the treatment of multiple myeloma has been as a single induction agent, a co-induction agent with other chemotherapy regimens, and as maintenance therapy after conventional chemotherapy or complete remission after autologous or allogeneic transplantation. Interferon as a single induction agent or co-induction agent with other chemotherapy agents appears only to have minimal benefit in myeloma. Its role as maintenance therapy in the plateau phase of myeloma also remains uncertain. More recently, the use of interferon must now compete with the "new drugs"--thalidomide, lenalidomide and bortezomib in myeloma treatment. Will there be a future role of interferon in the treatment of multiple myeloma or will interferon be resigned to the history books remains to be seen.

Relaxed functional constraints on triplicate α-globin gene in the bank vole suggest a different evolutionary history from other rodents

PubMed Central

Marková, S; Searle, J B; Kotlík, P

2014-01-01

Gene duplication plays an important role in the origin of evolutionary novelties, but the mechanisms responsible for the retention and functional divergence of the duplicated copy are not fully understood. The α-globin genes provide an example of a gene family with different numbers of gene duplicates among rodents. Whereas Rattus and Peromyscus each have three adult α-globin genes (HBA-T1, HBA-T2 and HBA-T3), Mus has only two copies. High rates of amino acid evolution in the independently derived HBA-T3 genes of Peromyscus and Rattus have been attributed to positive selection. Using RACE PCR, reverse transcription-PCR (RT–PCR) and RNA-seq, we show that another rodent, the bank vole Clethrionomys glareolus, possesses three transcriptionally active α-globin genes. The bank vole HBA-T3 gene is distinguished from each HBA-T1 and HBA-T2 by 20 amino acids and is transcribed 23- and 4-fold lower than HBA-T1 and HBA-T2, respectively. Polypeptides corresponding to all three genes are detected by electrophoresis, demonstrating that the translated products of HBA-T3 are present in adult erythrocytes. Patterns of codon substitution and the presence of low-frequency null alleles suggest a postduplication relaxation of purifying selection on bank vole HBA-T3. PMID:24595364

Effect of carprofen administration during banding or burdizzo castration of bulls on plasma cortisol, in vitro interferon-gamma production, acute-phase proteins, feed intake, and growth.

PubMed

Pang, W Y; Earley, B; Sweeney, T; Crowe, M A

2006-02-01

The objective of this study was to determine the effect of carprofen (C) administration before banding or burdizzo castration of bulls on cortisol, in vitro interferon-gamma (IFN-gamma) production, acute-phase proteins, feed intake, and growth. Fifty Holstein Friesian bulls (5.5 mo old; 191 +/- 3.7 kg) were blocked by weight and assigned randomly to 1 of 5 treatments (n = 10/treatment): 1) untreated control (2) banding castration at 0 min (Band); 3) Band following an i.v. injection of 1.4 mg/kg of BW of C at -20 min (Band+C); 4) Burdizzo castration at 0 min (Burd); or 5) Burd following 1.4 mg/kg of BW of C at -20 min (Burd+C). Castration acutely increased plasma cortisol concentrations compared with control; no significant differences occurred in peak and interval to peak cortisol responses between Band and Band+C or Burd and Burd+C groups. The administration of C in Band+C reduced (P < 0.05) the cortisol concentration between 6 and 12 h postcastration compared with Band animals. Overall, the integrated cortisol response was greater (P < 0.05) in the castrates than in control, whereas C treatments tended to reduce this response compared with Band (P = 0.08) and Burd (P = 0.07), respectively. Plasma fibrinogen was elevated in Band animals on d 14 and in Burd animals on d 3 and 14. Carprofen administration reduced Band- and Burd-induced fibrinogen production on d 14 and 3, respectively. Plasma haptoglobin was elevated in Band animals on d 3 and 35 compared with control, and C administration was effective in reducing the haptoglobin elevation on d 35 in Band+C compared with Band. There were no differences among treatments in in vitro IFN-gamma production induced by concanavalin A and phytohemagglutinin on d 1 and 2. Overall from d -1 to 16, there were no DMI differences among treatments. From d -1 to 35, there were no ADG differences among treatments. In conclusion, banding and burdizzo castration increased plasma cortisol with no change in in vitro IFN-gamma

Specificity, cross-talk and adaptation in Interferon signaling

NASA Astrophysics Data System (ADS)

Zilman, Anton

Innate immune system is the first line of defense of higher organisms against pathogens. It coordinates the behavior of millions of cells of multiple types, achieved through numerous signaling molecules. This talk focuses on the signaling specificity of a major class of signaling molecules - Type I Interferons - which are also used therapeutically in the treatment of a number of diseases, such as Hepatitis C, multiple sclerosis and some cancers. Puzzlingly, different Interferons act through the same cell surface receptor but have different effects on the target cells. They also exhibit a strange pattern of temporal cross-talk resulting in a serious clinical problem - loss of response to Interferon therapy. We combined mathematical modeling with quantitative experiments to develop a quantitative model of specificity and adaptation in the Interferon signaling pathway. The model resolves several outstanding experimental puzzles and directly affects the clinical use of Type I Interferons in treatment of viral hepatitis and other diseases.