Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko
2007-06-01
Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.
Petrov, R V; Saidov, M Z; Koval'chuk, L V; Sorokin, A M; Kaganov, B S
1984-04-01
The activity of natural killers was examined in peripheral blood of healthy subjects and patients with chronic hepatitis and disseminated sclerosis. An attempt was made to correct natural killer activity by human leukocyte interferon in vitro. To assess the activity of natural killers, use was made of the method of serial dilutions. An optimal effector/target ratio was employed in experiments. The patients with chronic hepatitis and disseminated sclerosis demonstrated a reduction in the activity of natural killers whatever the effector/target ratio. The action of interferon in vitro is specific immunomodulatory in nature. Administration of interferon in a dose of 250 Units/ml raises the magnitude of the cytotoxic index in healthy donors and in patients with chronic hepatitis and disseminated sclerosis, making the shape of the killer activity curve approach that of normal. Such an approach can be used for preliminary assessment of the sensitivity of natural killers to interferon in viral diseases of man. The potentialities and efficacy of interferon in clinical medicine are discussed.
Laouar, Yasmina; Sutterwala, Fayyaz S; Gorelik, Leonid; Flavell, Richard A
2005-06-01
Interferon-gamma and interleukin 12 produced by the innate arm of the immune system are important regulators of T helper type 1 (T(H)1) cell development, but signals that negatively regulate their expression remain controversial. Here we show that transforming growth factor-beta (TGF-beta) controlled T(H)1 differentiation through the regulation of interferon-gamma produced by natural killer (NK) cells. Blockade of TGF-beta signaling in NK cells caused the accumulation of a large pool of NK cells secreting copious interferon-gamma, responsible for T(H)1 differentiation and protection from leishmania infection. In contrast, blockade of TGF-beta signaling in dendritic cells did not affect dendritic cell homeostasis or interleukin 12 production, thus indicating a previously undescribed demarcation of the function of TGF-beta in NK cells versus dendritic cells.
Chromatin organization as an indicator of glucocorticoid induced natural killer cell dysfunction.
Misale, Michael S; Witek Janusek, Linda; Tell, Dina; Mathews, Herbert L
2018-01-01
It is well-established that psychological distress reduces natural killer cell immune function and that this reduction can be due to the stress-induced release of glucocorticoids. Glucocorticoids are known to alter epigenetic marks associated with immune effector loci, and are also known to influence chromatin organization. The purpose of this investigation was to assess the effect of glucocorticoids on natural killer cell chromatin organization and to determine the relationship of chromatin organization to natural killer cell effector function, e.g. interferon gamma production. Interferon gamma production is the prototypic cytokine produced by natural killer cells and is known to modulate both innate and adaptive immunity. Glucocorticoid treatment of human peripheral blood mononuclear cells resulted in a significant reduction in interferon gamma production. Glucocorticoid treatment also resulted in a demonstrable natural killer cell nuclear phenotype. This phenotype was localization of the histone, post-translational epigenetic mark, H3K27me3, to the nuclear periphery. Peripheral nuclear localization of H3K27me3 was directly related to cellular levels of interferon gamma. This nuclear phenotype was determined by direct visual inspection and by use of an automated, high through-put technology, the Amnis ImageStream. This technology combines the per-cell information content provided by standard microscopy with the statistical significance afforded by large sample sizes common to standard flow cytometry. Most importantly, this technology provides for a direct assessment of the localization of signal intensity within individual cells. The results demonstrate glucocorticoids to dysregulate natural killer cell function at least in part through altered H3K27me3 nuclear organization and demonstrate H3K27me3 chromatin organization to be a predictive indicator of glucocorticoid induced immune dysregulation of natural killer cells. Copyright © 2017 Elsevier Inc. All rights
Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes.
Lang, K S; Weigert, C; Braedel, S; Fillon, S; Palmada, M; Schleicher, E; Rammensee, H-G; Lang, F
2003-01-01
A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca(2+) ionophore ionomycin (1 microg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 microg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 microg/ml) and PMA (5 microg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappaB but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.
[Interferon. An overview of the state of basic research with special regard to interferon-gamma].
Günther, G; Otto, B
1993-02-01
Interferons / An overview on the state of basic research with special regard to interferon-gamma Interferons are multifunctional glycoproteins with a broad range of antiviral, antiproliferative and immunoregulatory effects on the target cell. This review deals with the basics as well as with more recent developments in interferon research. A historic overview of 35 years of interferon research since the discovery of interferons by Isaacs and Lindenmann in 1957 introduces the most important milestones in this field and appreciates the work of the participating researchers. A brief description of the classification of interferons based on different tissue sources, different antigenic properties and different induction behaviour is made. The main part of this review focuses on human interferon-gamma. We discuss recent work on the structure-function relationship of interferon-gamma. The interferon-gamma receptor and its role in signal transduction is another part of this paper. The structure and length of the C-terminal region of interferon-gamma seems to be important for receptor binding and expression of biological activities. A conservative estimate is that the family of IFN-activated genes numbers 15-20 in most cells.
Deficient natural killer cell function in preeclampsia
DOE Office of Scientific and Technical Information (OSTI.GOV)
Alanen, A.; Lassila, O.
1982-11-01
Natural killer cell activity of peripheral blood lymphocytes was measured against K-562 target cells with a 4-hour /sup 51/Cr release assay in 15 primigravid women with preeclamptic symptoms. Nineteen primigravid women with an uncomplicated pregnancy and 18 nonpregnant women served as controls. The natural killer cell activity of preeclamptic women was observed to be significantly lower than that of both control groups. Natural killer cells in preeclamptic women responded normally to augmentation caused by interferon. These findings give further evidence for the participation of the maternal immune system in this pregnancy disorder.
Bjerre, Anna; Brusletto, Berit; Høiby, Ernst Arne; Kierulf, Peter; Brandtzaeg, Petter
2004-02-01
To analyze plasma interferon-gamma and interleukin-10 concentrations in patients with systemic meningococcal disease and patients with severe Gram-positive septic shock caused by Streptococcus pneumoniae or Staphylococcus aureus. To study the in vitro cytokine (interferon-gamma and interleukin-10) responses in a whole blood model boosted with heat-killed Neisseria meningitidis, S. pneumoniae, and S. aureus before and after treatment with recombinant interleukin-10 or recombinant interferon-gamma. Experimental study. Laboratory. Plasma samples were collected from patients with systemic meningococcal disease (n = 66) and patients with severe Gram-positive septic shock caused by S. pneumoniae (n = 4) or S. aureus (n = 3). Whole blood was boosted with heat-killed N. meningitidis, S. pneumoniae, and S. aureus (1 x 106 colony forming units/mL), and plasmas were analyzed for interleukin-10 or interferon-gamma at 0, 5, 12, and 24 hrs. Furthermore, recombinant interleukin-10 or recombinant interferon-gamma was added before bacteria, and the effect on the secretion of interferon-gamma and interleukin-10, respectively, was analyzed after 24 hrs. The median concentration of interferon-gamma was 15 pg/mL and of interleukin-10 was 10,269 pg/mL in patients with meningococcal septic shock (n = 24) compared with median interferon-gamma concentration of 3400 pg/mL and interleukin-10 concentration of 465 pg/mL in patients with severe Gram-positive shock (p =.001). Increased interferon-gamma concentrations were associated with case fatality (p =.011). In a whole blood model we demonstrated that 1 x 106 colony forming units/mL of N. meningitidis induced more interleukin-10 but less interferon-gamma than S. pneumoniae. S. aureus induced minimal secretion of both cytokines. Recombinant interleukin-10 efficiently down-regulated the secretion of interferon-gamma, and vice versa, as shown in a whole blood model. We speculate whether high concentrations of interleukin-10 contribute to the
Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity
1984-01-01
Gamma-interferon (IFN-gamma) is the macrophage-activating factor (MAF) produced by normal murine splenic cells and the murine T cell hybridoma 24/G1 that induces nonspecific tumoricidal activity in macrophages. Incubation of 24/G1 supernatants diluted to 8.3 IRU IFN-gamma/ml with 6 X 10(6) elicited peritoneal macrophages or bone marrow-derived macrophages for 4 h at 37 degrees C, resulted in removal of 80% of the MAF activity from the lymphokine preparation. Loss of activity appeared to result from absorption and not consumption because (a) 40% of the activity was removed after exposure to macrophage for 30 min at 4 degrees C, (b) no reduction of MAF activity was detected when the 24/G1 supernatant was incubated with macrophage culture supernatants, and (c) macrophage-treated supernatants showed a selective loss of MAF activity but not interleukin 2 (IL-2) activity. Absorption was dependent on the input of either IFN-gamma or macrophages and was time dependent at 37 degrees C but not at 4 degrees C. With four rodent species tested, absorption of murine IFN-gamma displayed species specificity. However, cultured human peripheral blood monocytes and the human histiocytic lymphoma cell line U937 were able to absorb the murine lymphokine. Although the majority of murine cell lines tested absorbed 24/G1 MAF activity, two murine macrophage cell lines, P388D1 and J774, were identified which absorbed significantly reduced amounts of natural IFN- gamma. Purified murine recombinant IFN-gamma was absorbed by elicited macrophages but not by P388D1. Normal macrophages but not P388D1 bound fluoresceinated microspheres coated with recombinant IFN-gamma and binding was inhibited by pretreatment of the normal cells with 24/G1 supernatants. Scatchard plot analysis showed that 12,000 molecules of soluble 125I-recombinant IFN-gamma bound per bone marrow macrophage with a Ka of 0.9 X 10(8) M-1. Binding was quantitatively inhibitable by natural IFN-gamma but not by murine IFN alpha. IFN
Interferon-gamma inhibits HIV-induced invasiveness of monocytes.
Dhawan, S; Wahl, L M; Heredia, A; Zhang, Y; Epstein, J S; Meltzer, M S; Hewlett, I K
1995-12-01
HIV-infected monocytes form highly invasive network on basement membrane matrix and secrete high levels of 92-kd metalloproteinase (MMP-9), an enzyme that degrades basement membrane proteins. In the present study, using matrigel as a model basement membrane system, we demonstrate that treatment of human immunodeficiency virus (HIV)-infected monocytes with interferon-gamma at 50 U/ml inhibited the ability of infected monocytes to form an invasive network on matrigel and their invasion through the matrigel matrix. These effects were associated with a significant reduction in the levels of MMP-9 produced by HIV-infected monocytes treated with interferon-gamma 1 day prior to infection with HIV as compared with that of untreated HIV-infected monocytes. Monocytes treated with interferon-gamma 1 day after HIV infection showed the presence of integrated HIV sequences; however, the levels of MMP-9 were substantially lower than those produced by monocytes inoculated with live HIV, heat-inactivated HIV, or even the control uninfected monocytes. Exposure of monocytes to heat-inactivated HIV did not result in increased invasiveness or high MMP-9 production, suggesting that regulation of metalloproteinase by monocytes was independent of CD4-gp120 interactions and required active virus infection. Furthermore, addition of interferon-gamma to monocytes on day 10 after infection inhibited MMP-9 production by more than threefold with no significant reduction of virus replication. These results indicate that the mechanism of interferon-gamma-induced down-regulation of MMP-9 levels and reduced monocyte invasiveness may be mediated by a mechanism independent of antiviral activity of IFN-gamma in monocytes. Down-regulation of MMP-9 in HIV-infected monocytes by interferon-gamma may play an important role in the control of HIV pathogenesis.
Wachi, Masatada; Koyama, Masahiro; Utsuyama, Masanori; Bittman, Barry B; Kitagawa, Masanobu; Hirokawa, Katsuiku
2007-02-01
With growing evidence linking job stress to illness, finding an effective means of stress management has become a challenging international endeavor. Although music therapy has attracted the attention of various fields as a promising method for alleviating stress, lack of standardization and paucity of data have served as impediments to widespread utilization. The effects of a Recreational Music-Making (RMM) group drumming protocol was evaluated on Japanese male corporate employees. A total of 20 volunteers participated in a one-hour RMM session while 20 volunteers engaged in leisurely reading for one hour (controls). After a six-month interval, the groups switched activities and underwent one session each. Pre- and post-intervention data were collected using mood state questionnaires and blood samples. Individual and group mean values for natural killer (NK) cell activity, NK cell percentage, and cytokine gene expression were analyzed. NK cell activity in the RMM group increased among individuals with low pre-intervention levels, and decreased among those with high pre-intervention levels. A significant correlation was established between changes in NK cell activity and the changes in the level of gene expressions for interferon-gamma and interleukin-10. The RMM group demonstrated enhanced mood, lower gene expression levels of the stress-induced cytokine interleukin-10, and higher NK cell activity when compared to the control. Based upon documented changes in NK cell activity, coupled with gene expression changes for interferon-gamma, interleukin-10, and improved mood, this RMM protocol has significant potential for utilization in the corporate wellness environment.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung
2008-09-12
Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less
Asea, A; Hansson, M; Czerkinsky, C; Houze, T; Hermodsson, S; Strannegård, O; Hellstrand, K
1996-08-01
Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-gamma by CD3-/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-gamma production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-gamma production was operating on a pretranslational level, as indicated by the inability of enriched NK cells to accumulate IFN-gamma mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-gamma production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-gamma production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-gamma in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-gamma mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-gamma production by preventing monocyte-induced oxidative damage to NK cells.
Yun, Cheol H.; Lundgren, Anna; Azem, Josef; Sjöling, Åsa; Holmgren, Jan; Svennerholm, Ann-Mari; Lundin, B. Samuel
2005-01-01
Helicobacter pylori is known to induce a local immune response, which is characterized by activation of lymphocytes and the production of IFN-γ in the stomach mucosa. Since not only T cells, but also natural killer (NK) cells, are potent producers of gamma interferon (IFN-γ), we investigated whether NK cells play a role in the immune response to H. pylori infection. Our results showed that NK cells were present in both the gastric and duodenal mucosae but that H. pylori infection did not affect the infiltration of NK cells into the gastrointestinal area. Furthermore, we could show that NK cells could be activated directly by H. pylori antigens, as H. pylori bacteria, as well as lysate from H. pylori, induced the secretion of IFN-γ by NK cells. NK cells were also activated without direct contact when separated from the bacteria by an epithelial cell layer, indicating that the activation of NK cells by H. pylori can also occur in vivo, in the infected stomach mucosa. Moreover, the production of IFN-γ by NK cells was greatly enhanced when a small amount of interleukin-12 (IL-12) was added, and this synergistic effect was associated with increased expression of the IL-12 receptor β2. It was further evident that bacterial lysate alone was sufficient to induce the activation of cytotoxicity-related molecules. In conclusion, we demonstrated that NK cells are present in the gastroduodenal mucosa of humans and that NK cells produce high levels of IFN-γ when stimulated with a combination of H. pylori antigen and IL-12. We propose that NK cells play an active role in the local immune response to H. pylori infection. PMID:15731046
Interferon-γ-Mediated Natural Killer Cell Activation by an Aqueous Panax ginseng Extract
Takeda, Kazuyoshi; Okumura, Ko
2015-01-01
Panax ginseng extracts are used in traditional herbal medicines, particularly in eastern Asia, but their effect on natural killer (NK) cell activity is not completely understood. This study aimed to examine the effects of P. ginseng extracts on the cytotoxic activity of NK cells. We orally administered P. ginseng extracts or ginsenosides to wild-type (WT) C57BL/6 (B6) and BALB/c mice and to B6 mice deficient in either recombination activating gene 2 (RAG-2) or interferon-γ (IFN-γ). We then tested the cytotoxic activity of NK cells (of spleen and liver mononuclear cells) against NK-sensitive YAC-1 cells. Oral administration of P. ginseng aqueous extract augmented the cytotoxicity of NK cells in WT B6 and BALB/c mice and in RAG-2-deficient B6 mice, but not in IFN-γ-deficient B6 mice. This effect was only observed with the aqueous extract of P. ginseng. Interestingly, the ginsenosides Rb1 and Rg1 did not augment NK cell cytotoxicity. These results demonstrated that the aqueous P. ginseng extract augmented NK cell activation in vivo via an IFN-γ-dependent pathway. PMID:26649061
Flores, Jose; DuPont, Herbert L; Paredes-Paredes, Mercedes; Aguirre-Garcia, M Magdalena; Rojas, Araceli; Gonzalez, Alexei; Okhuysen, Pablo C
2010-05-01
Enterotoxigenic Escherichia coli (ETEC), which produces heat-labile toxin (LT), is a common cause of travelers' diarrhea (TD). The B subunit of ETEC LT is immunologically related to the B subunit of Vibrio cholerae toxin (CT). In this pilot study we evaluated the whole-blood gamma interferon response to CT B in 17 U.S. adults traveling to Mexico. Only one of nine subjects who demonstrated a cellular immune response as determined by whole-blood gamma interferon production to CT B on arrival to Mexico developed diarrhea, whereas five of eight without a cellular response developed diarrhea. Markers of the cellular immune response to ETEC LT could help in identifying individuals immune to ETEC LT, and these markers deserve additional study.
Yoneto, Toshihiko; Yoshimoto, Takayuki; Wang, Chrong-Reen; Takahama, Yasuhiro; Tsuji, Moriya; Waki, Seiji; Nariuchi, Hideo
1999-01-01
We have examined the roles of gamma interferon (IFN-γ), nitric oxide (NO), and natural killer (NK) cells in the host resistance to infection with the blood-stage malarial parasite Plasmodium berghei XAT, an irradiation-induced attenuated variant of the lethal strain P. berghei NK65. Although the infection with P. berghei XAT enhanced NK cell lytic activity of splenocytes, depletion of NK1.1+ cells caused by the treatment of mice with anti-NK1.1 antibody affected neither parasitemia nor IFN-γ production by their splenocytes. The P. berghei XAT infection induced a large amount of NO production by splenocytes during the first peak of parasitemia, while P. berghei NK65 infection induced a small amount. Unexpectedly, however, mice deficient in inducible nitric oxide synthase (iNOS−/−) cleared P. berghei XAT after two peaks of parasitemia were observed, as occurred for wild-type control mice. Although the infected iNOS−/− mouse splenocytes did not produce a detectable level of NO, they produced an amount of IFN-γ comparable to that produced by wild-type control mouse splenocytes, and treatment of these mice with neutralizing anti-IFN-γ antibody led to the progression of parasitemia and fatal outcome. CD4−/− mice infected with P. berghei XAT could not clear the parasite, and all these mice died with apparently reduced IFN-γ production. Furthermore, treatment with carrageenan increased the susceptibility of mice to P. berghei XAT infection. These results suggest that neither NO production nor NK cell activation is critical for the resistance to P. berghei XAT infection and that IFN-γ plays an important role in the elimination of malarial parasites, possibly by the enhancement of phagocytic activity of macrophages. PMID:10225894
Inada, Takefumi; Kubo, Kozue; Shingu, Koh
2010-10-01
Propofol is an intravenous anesthetic, widely used for general anesthesia during surgery, which inevitably involves tissue trauma with inflammation. At sites of inflammation, prostanoids, especially prostaglandin E₂ (PGE₂), are abundant. This study addresses the effect of propofol on macrophage PGE₂ production. Using thioglycollate-elicited murine peritoneal macrophages, propofol (7.5-30 μM) suppressed lipopolysaccharide-induced PGE₂ production. The suppression was via the direct inhibition of cyclooxygenase (COX) enzyme activity and due neither to the downregulation of COX expression nor the inhibition of arachidonic acid release from plasma membranes. In macrophage:natural killer (NK) cell co-culture, propofol dramatically increased interferon-gamma (IFN-γ) production, and the actions of propofol were mimicked by a selective COX-2 inhibitor, NS-398, as well as the selective EP4 receptor antagonist L-161,982, suggesting a role of PGE₂ suppression in the upregulation of IFN-γ production. Furthermore, in purified NK cell culture, PGE₂ directly suppressed the production of IFN-γ by activated NK cells, which was reversed by selective inhibition of EP4 activity. Taken together, our results show that, in macrophage:NK cell co-culture, propofol, through the suppression of macrophage PGE₂ production, upregulates NK cell IFN-γ production by alleviating EP4 receptor-mediated suppression of IFN-γ production. Propofol may potentially exert considerable influence on inflammation and immunity by suppressing PGE₂ synthesis. Copyright © 2010 Elsevier B.V. All rights reserved.
Effects of isolation on interferon production and hematological and immunological parameters
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Measel, J.; Loken, M. R.; Degioanni, J.; Follini, S.; Galvagno, A.; Montalbini, M.
1992-01-01
A 27-year-old woman was maintained in an isolated state for 131 days in Carlsbad Caverns, New Mexico. Her diet was vitamin D-depleted. Determinations on the effects of such isolation on levels and activities of peripheral blood cells that are important for hematological homeostasis and immunological function were carried out. Throughout the duration of the study, the percentage of lymphoid cells that expressed CD3, CD4, CD8, CD19, Leu 8, and other markers remained relatively constant although the absolute numbers of these cells varied. Although the percentage of natural killer (NK) cells did not vary, the activity of these cells did change. NK cell activity became elevated as the isolation study progressed. Production of interferon-gamma (IFN-gamma) in response to mitogen stimulation was higher than expected throughout the isolation periods, but returned to the normal range after termination of the isolation. Red and white cell counts dropped significantly upon entering isolation, but soon returned to normal.
Wang, Xiao Yang; Crowston, Jonathan G; White, Andrew J R; Zoellner, Hans; Healey, Paul R
2014-08-01
The aim of the study was to investigate, using a native mitomycin-C-resistant human Tenon's fibroblast cell line, the possibility that interferon-alpha and gamma could be used with Fas agonists as an alternative anti-fibrotic strategy to mitomycin-C in trabeculectomy. A clinically resistant and in vitro verified mitomycin-C-resistant human Tenon's fibroblast cell line was pretreated with interferon-alpha and interferon-gamma for 48 h before stimulation with an agonistic Fas antibody (CH11) for 2 days to induce cell death. Cell death assays were undertaken. Changes in apoptosis-related proteins were determined by flow cytometry and Western blot. Pretreatment with interferon-alpha or interferon-gamma for 48 h increased Fas, Fas-associated protein with death domain and caspase-8 expression. Protein expression was further increased by combined exposure to interferon-alpha and gamma. Pretreatment with cytokines had no effect on Fas-L and Bcl-2. Interferon-alpha alone did not change the rate of induced cell death. A combination of interferon-alpha and gamma synergistically increased the sensitivity of mitomycin-C-resistant human Tenon's fibroblast cell line to induced cell death. An antagonistic anti-Fas antibody (ZB4) completely blocked induced cell death. Broad caspase inhibitors specific for caspases-8 and -3 reduced induced deaths in interferon pretreated mitomycin-C-resistant human Tenon's fibroblast cell line in a dose-dependent manner. Interferon-alpha and interferon-gamma render mitomycin-C-resistant human Tenon's fibroblast cell line sensitive to Fas-mediated apoptosis. The mechanism involves increased death-inducing signalling complex formation by upregulation of Fas, Fas-associated protein with death domain and caspase-8 expression. © 2013 Royal Australian and New Zealand College of Ophthalmologists.
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
[Peptide Ala-Glu-Asp-Gly and interferon gamma: their role in immune response during aging].
Lin'kova, N S; Kuznik, B I; Khavinson, V Kh
2012-01-01
The decrease of lymphocyte interferon gamma expression during aging is one of the main mechanisms leading to the immunodeficiency state in the elderly. Cell penetrating geroprotective peptide Ala-Glu-Asp-Gly has the capability to activate the proliferation of lymphocytes in thymus during its aging. The nucleotide sequence which is complementary contacted with peptide Ala-Glu-Asp-Gly was found in promoter region of interferon gamma gene. Thus, the immune protection of this peptide can be explained by its activation of the interferon gamma production in T-cells.
Interferon system in women with genital papillomavirus infection receiving immunomodulatory therapy.
Rogovskaya, S I; Zhdanov, A V; Loginova, N S; Faizullin, L Z; Prilepskaya, V N; Van'ko, L V; Sukhikh, G T
2002-11-01
The interferon system was studied in women with genital papillomavirus infection. In most patients the interferon system was activated, while the ability of lymphocytes to respond to inductors decreased. Laserotherapy and immunomodulatory therapy with larifan, ridostin, and viferon for 1 month normalized blood interferon concentration (39.4% patients) and interferon-gamma production by lymphocytes in response to inductors (87.9% patients). After laser monotherapy these parameters returned to normal only in 13.2 and 7.6% patients, respectively. Correlation and regression analyses showed that changes in the interferon system were synchronized after immunomodulatory therapy. These data indicate that immunomodulatory therapy produces a complex effect on the interferon system. Measurements of blood interferon level can be used to predict the effect of further treatment with interferon-gamma inductors.
Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun
2012-06-29
The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.
Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M
1992-01-01
The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001
Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M
1992-04-01
The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.
(PCG) Protein Crystal Growth Gamma-Interferon
NASA Technical Reports Server (NTRS)
1989-01-01
(PCG) Protein Crystal Growth Gamma-Interferon. Stimulates the body's immune system and is used clinically in the treatment of cancer. Potential as an anti-tumor agent against solid tumors as well as leukemia's and lymphomas. It has additional utility as an anti-ineffective agent, including antiviral, anti-bacterial, and anti-parasitic activities. Principal Investigator on STS-26 was Charles Bugg.
The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis
2017-09-01
AWARD NUMBER: W81XWH-16-1-0537 TITLE: The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis PRINCIPAL INVESTIGATOR: Stanley...Sep 2016 - 31 Aug 2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER The Role of the Interferon-Gamma-Jak/STAT Pathway in Rheumatoid Arthritis 5b...subsets that likely counteracts IL-2 regulator activity and contribute to the pathogenesis of RA. 15. SUBJECT TERMS Rheumatoid arthritis ; Autoimmunity; T
T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.
Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong
2017-05-12
Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.
Circadian variations of interferon-induced enhancement of human natural killer (NK) cell activity.
Gatti, G; Cavallo, R; Sartori, M L; Carignola, R; Masera, R; Delponte, D; Salvadori, A; Angeli, A
1988-01-01
We searched for circadian changes in the enhancement of the NK activity after exposure to IFN-gamma of peripheral blood mononuclear (PBM) cells obtained serially throughout the 24-h cycle. In August-October 1986, blood was drawn from 7 healthy, diurnally active and nocturnally resting male volunteers (22-34 yr) at 4-h intervals for 24 h starting at 08:00. PBM cells were immediately separated and assayed for NK cell activity, using K 562 cultured cells as a target in a 4-h 51Cr release assay after prior incubation for 20 h with buffer or 300 IU rIFN-gamma. Circadian variations of the spontaneous NK cell cytotoxicity were apparent; the activity was at its maximum at the end of the night or in the early morning and then declined in the afternoon. The 24-h rhythmic pattern was validated with statistical significance by the Cosinor method (p less than 0.02; acrophase 04:22). Maximum enhancement by IFN-gamma was attained in the second part of the night or in the early morning, i.e. in phase with the peak of the spontaneous NK cell activity. A significant circadian rhythm of the percent increase above control levels was validated by the Cosinor method (p less than 0.01; acrophase 04:03). Our findings may be of relevance to a better understanding of the mechanisms of control of human NK activity and warrant consideration as an approach to improve the effectiveness of time-qualified immunotherapy.
Grau, G E; Heremans, H; Piguet, P F; Pointaire, P; Lambert, P H; Billiau, A; Vassalli, P
1989-01-01
Experimental cerebral malaria (ECM), a lethal hyperacute neurological syndrome associated with high blood levels of tumor necrosis factor, develops in genetically susceptible (CBA/Ca) mice 7 days after infection with Plasmodium berghei ANKA strain. Injections of neutralizing monoclonal antibody against recombinant murine interferon gamma, not later than 4 days after infection, markedly reduced the incidence of ECM and the elevation in serum levels of tumor necrosis factor. This treatment prevented the cerebral lesions (plugging of brain vessels by monocytes, lymphocytes, and parasitized erythrocytes). In contrast, the extent of macrophage infiltration in lymphoid organs (which is a characteristic feature of mice developing ECM), as well as the course of infection, remained unaffected by the antibody treatment. Protected mice died at a later time of severe anemia and overwhelming parasitemia, the usual outcome of P. berghei infection in mice that are not susceptible to ECM. The present data indicate that interferon gamma constitutes an important link in the cytokine network that leads to brain vessel inflammation in experimental malaria. It is proposed that interferon gamma released by activated CD4+ T cells acts by augmenting both production and action of tumor necrosis factor. PMID:2501793
... in people with severe, malignant osteopetrosis (an inherited bone disease). Interferon gamma-1b is in a class of ... you may have flu-like symptoms such as headache, fever, chills, muscle aches, and tiredness after your ...
D'Ombrain, Marthe C; Voss, Till S; Maier, Alexander G; Pearce, J Andrew; Hansen, Diana S; Cowman, Alan F; Schofield, Louis
2007-08-16
Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP-1) is a variable antigen expressed by P. falciparum, the malarial parasite. PfEMP-1, present on the surface of infected host erythrocytes, mediates erythrocyte binding to vascular endothelium, enabling the parasite to avoid splenic clearance. In addition, PfEMP-1 is proposed to regulate host immune responses via interactions with the CD36 receptor on antigen-presenting cells. We investigated the immunoregulatory function of PfEMP-1 by comparing host cell responses to erythrocytes infected with either wild-type parasites or transgenic parasites lacking PfEMP-1. We showed that PfEMP-1 suppresses the production of the cytokine interferon-gamma by human peripheral blood mononuclear cells early after exposure to P. falciparum. Suppression of this rapid proinflammatory response was CD36 independent and specific to interferon-gamma production by gammadelta-T, NK, and alphabeta-T cells. These data demonstrate a parasite strategy for downregulating the proinflammatory interferon-gamma response and further establish transgenic parasites lacking PfEMP-1 as powerful tools for elucidating PfEMP-1 functions.
Role of gamma interferon in a neonatal mouse model of group B streptococcal disease.
Cusumano, V; Mancuso, G; Genovese, F; Delfino, D; Beninati, C; Losi, E; Teti, G
1996-01-01
The aim of this study was to assess the role of gamma interferon (IFN-gamma) in a neonatal mouse model of group B streptococcal (GBS) sepsis. IFN-gamma was produced by spleen cells at 24, 48, and 72 h after GBS challenge. Treatment with anti-IFN-gamma at 6 h before challenge totally abrogated the IFN-gamma response but did not affect survival. Subcutaneous administration of recombinant IFN-gamma (2,500 IU per pup) at 18 h after challenge resulted in increased survival time and reduced blood colony counts at 48 and 72 h. In vitro preincubation of neonatal whole blood with IFN-gamma before the addition of GBS resulted in significant restriction of bacterial growth. These data indicate that administration of recombinant IFN-gamma can partially restore impaired host defenses against GBS in neonatal mice. This cytokine may be useful for the treatment of neonatal infections. PMID:8757817
Alternative activation of STAT1 and STAT3 in response to interferon-gamma.
Qing, Yulan; Stark, George R
2004-10-01
Interferon-gamma (IFNgamma) is a pluripotent cytokine whose major biological effects are mediated through a pathway in which STAT1 is the predominant and essential transcription factor. STAT3 can also be activated weakly by IFNgamma, but the mechanism of activation and function of STAT3 as a part of the interferon response are not known. Here we show that STAT3 activation is much stronger and more prolonged in STAT1-null mouse embryo fibroblasts than in wild-type cells. In response to IFNgamma, SRC-family kinases are required to activate STAT3 (but not STAT1) through tyrosine phosphorylation, whereas the receptor-bound kinases JAK1 and JAK2 are required to activate both STATs. Tyrosine 419 of the IFNgamma receptor subunit 1 (IFNGR1) is required to activate both STATs, suggesting that STAT1 and STAT3 compete with each other for the same receptor phosphotyrosine motif. Activated STAT3 can replace STAT1 in STAT1-null cells to drive the transcription of certain genes, for example, socs-3 and c/ebpdelta, which have gamma-activated sequence motifs in their promoters. Work from Ian Kerr's laboratory reveals that the gp130-linked interleukin-6 receptor, which usually activates STAT3 predominantly, activates STAT1 efficiently when STAT3 is absent. Because STAT1 and STAT3 have opposing biological effects (STAT3 is an oncogene, and STAT1 is a tumor suppressor), the reciprocal activation of these two transcription factors in response to IFNgamma or interleukin-6 suggests that their relative abundance, which may vary substantially in different normal cell types, under different conditions or in tumors is likely to have a major impact on how cells behave in response to different cytokines.
Interleukin-12- and interferon-γ-mediated natural killer cell activation by Agaricus blazei Murill
Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko
2007-01-01
Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-γ (IFN-γ) deficient mice. NK cell activation and IFN-γ production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-γ production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-γ-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-γ production. PMID:17346284
Ichimura, O.; Suzuki, S.; Sugawara, Y.; Osawa, T.
1984-01-01
The bacterial immunopotentiator OK-432 induced natural killer cell activating factor (NKAF) from mouse spleen cells. OK-432-induced NKAF showed a single peak with an apparent mol. wt of 70 Kd by Sephadex G-100 chromatography and OK-432-induced interleukin 2 (IL-2) had the same mol. wt as NKAF. However, OK-432-induced interferon (IFN) showed molecular heterogeneity with two peaks at 90 Kd and 45 Kd. Further purification was achieved by Blue Sepharose affinity chromatography which copurified NKAF and IFN. The affinity-purified NKAF, however, was stable to heat (56 degrees C) and acid (pH 2) treatments. Moreover, anti-IFN failed to abolish NKAF activity and this activity was not absorbed by IL-2 dependent T cells. From isoelectric focusing analysis, a dissociation of NKAF and IFN was observed over the range of pI 6.5 to 8.0. Based on these results, KNAF appears to be a new kind of cytokine distinguishable from IFN and IL-2. PMID:6204667
Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.
Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y
2017-10-01
Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bursuker, I.; Pearce, M.T.
1990-02-01
The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less
Razaghi, Ali; Owens, Leigh; Heimann, Kirsten
2016-12-20
Human interferon gamma is a cytokine belonging to a diverse group of interferons which have a crucial immunological function against mycobacteria and a wide variety of viral infections. To date, it has been approved for treatment of chronic granulomatous disease and malignant osteopetrosis, and its application as an immunotherapeutic agent against cancer is an increasing prospect. Recombinant human interferon gamma, as a lucrative biopharmaceutical, has been engineered in different expression systems including prokaryotic, protozoan, fungal (yeasts), plant, insect and mammalian cells. Human interferon gamma is commonly expressed in Escherichia coli, marketed as ACTIMMUNE ® , however, the resulting product of the prokaryotic expression system is unglycosylated with a short half-life in the bloodstream; the purification process is tedious and makes the product costlier. Other expression systems also did not show satisfactory results in terms of yields, the biological activity of the protein or economic viability. Thus, the review aims to synthesise available information from previous studies on the production of human interferon gamma and its glycosylation patterns in different expression systems, to provide direction to future research in this field. Copyright © 2016 Elsevier B.V. All rights reserved.
The immunomodulatory effects of interferon-gamma on mature B-lymphocyte responses.
Jurado, A; Carballido, J; Griffel, H; Hochkeppel, H K; Wetzel, G D
1989-06-15
Interferon-gamma (IFN-gamma) exerts a broad spectrum of activities which affect the responses of mature B-cells. It strongly inhibits B-cell activation, acts as a B-cell growth factor (BCGF), and also induces final differentiation to immunoglobulin (Ig) production. IFN-gamma is deeply involved in the differential control of isotype expression, as it enhances IgG2a production and suppresses both IgG1 and IgE production. Although it is now possible to draw a general scheme of the effects of IFN-gamma on B-cells, a number of paradoxical results still exist in the field. In this manuscript, different experimental systems are analyzed in an attempt to explain these apparent paradoxes.
Kang, Seung-Ji; Jin, Hye-Mi; Cho, Young-Nan; Kim, Seong Eun; Kim, Uh Jin; Park, Kyung-Hwa; Jang, Hee-Chang; Jung, Sook-In; Kee, Seung-Jung; Park, Yong-Wook
2017-07-01
Natural killer (NK) cells are essential immune cells against several pathogens. Not much is known regarding the roll of NK cells in Orientia tsutsugamushi infection. Thus, this study aims to determine the level, function, and clinical relevance of NK cells in patients with scrub typhus. This study enrolled fifty-six scrub typhus patients and 56 health controls (HCs). The patients were divided into subgroups according to their disease severity. A flow cytometry measured NK cell level and function in peripheral blood. Circulating NK cell levels and CD69 expressions were significantly increased in scrub typhus patients. Increased NK cell levels reflected disease severity. In scrub typhus patients, tests showed their NK cells produced higher amounts of interferon (IFN)-γ after stimulation with interleukin (IL)-12 and IL-18 relative to those of HCs. Meanwhile, between scrub typhus patients and HCs, the cytotoxicity and degranulation of NK cells against K562 were comparable. CD69 expressions were recovered to the normal levels in the remission phase. This study shows that circulating NK cells are activated and numerically increased, and they produced more IFN-γ in scrub typhus patients.
Cho, Young-Nan; Kim, Seong Eun; Kim, Uh Jin; Park, Kyung-Hwa; Jang, Hee-Chang; Jung, Sook-In; Kee, Seung-Jung
2017-01-01
Background Natural killer (NK) cells are essential immune cells against several pathogens. Not much is known regarding the roll of NK cells in Orientia tsutsugamushi infection. Thus, this study aims to determine the level, function, and clinical relevance of NK cells in patients with scrub typhus. Methodology/Principal findings This study enrolled fifty-six scrub typhus patients and 56 health controls (HCs). The patients were divided into subgroups according to their disease severity. A flow cytometry measured NK cell level and function in peripheral blood. Circulating NK cell levels and CD69 expressions were significantly increased in scrub typhus patients. Increased NK cell levels reflected disease severity. In scrub typhus patients, tests showed their NK cells produced higher amounts of interferon (IFN)-γ after stimulation with interleukin (IL)-12 and IL-18 relative to those of HCs. Meanwhile, between scrub typhus patients and HCs, the cytotoxicity and degranulation of NK cells against K562 were comparable. CD69 expressions were recovered to the normal levels in the remission phase. Conclusions This study shows that circulating NK cells are activated and numerically increased, and they produced more IFN-γ in scrub typhus patients. PMID:28750012
Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N
2006-01-01
Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.
Herpesvirus Evasion of Natural Killer Cells.
De Pelsmaeker, Steffi; Romero, Nicolas; Vitale, Massimo; Favoreel, Herman W
2018-06-01
Natural killer (NK) cells play an important role in the host response against viral infections and cancer development. They are able to kill virus-infected and tumor cells, and they produce different important cytokines that stimulate the antiviral and antitumor adaptive immune response, particularly interferon gamma. NK cells are of particular importance in herpesvirus infections, which is illustrated by systemic and life-threatening herpesvirus disease symptoms in patients with deficiencies in NK cell activity and by the myriad of reports describing herpesvirus NK cell evasion strategies. The latter is particularly obvious for cytomegaloviruses, but increasing evidence indicates that most, if not all, members of the herpesvirus family suppress NK cell activity to some extent. This review discusses the different NK cell evasion strategies described for herpesviruses and how this knowledge may translate to clinical applications. Copyright © 2018 American Society for Microbiology.
[Expression of gamma interferon during HPV and Chlamydia trachomatis infection in cervical samples].
Colín-Ferreyra, María Del Carmen; Mendieta-Zerón, Hugo; Romero-Figueroa, María Del Socorro; Martínez-Madrigal, Migdania; Martínez-Pérez, Sergio; Domínguez-García, María Victoria
2015-02-01
The aim of this study was to mesure the expression of gamma interferon in HPV and Chlamydia trachomatis infection in squamous intraepithelial lesions. Samples from 100 patients diagnosed by colposcopy with or without squamous intraepithelial lesions were used in the present study. Each patient was found to be infected by HPV and C.trachomatis. Relative gamma interferon mRNA expression was assessed using a real-time reverse transcriptase PCR assay (RT-PCR). The relative units of expression of gamma interferon mRNA were 13, 1.8 and 0.3, for HPV and C.trachomatis co-infection, or HPV or C.trachomatis infection, respectively. HPV and C.trachomatis could overstimulate the expression of gamma interferon. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
Cato, Anita; Celada, Lindsay; Kibakaya, Esther Caroline; Simmons, Nadia; Whalen, Margaret M
2014-12-01
Natural killer (NK) cells provide a vital surveillance against virally infected cells, tumor cells, and antibody-coated cells through the release of cytolytic mediators and gamma interferon (IFN-γ). Hexabromocyclododecane (HBCD) is a brominated flame retardant used primarily in expanded (EPS) and extruded (XPS) polystyrene foams for thermal insulation in the building and construction industry. Tetrabromobisphenol A (TBBPA) is used both as a reactive and an additive flame retardant in a variety of materials. HBCD and TBBPA contaminate the environment and are found in human blood samples. In previous studies, we have shown that other environmental contaminants, such as the dibutyltin (DBT) and tributyltin (TBT), decrease NK lytic function by activating mitogen-activated protein kinases (MAPKs) in the NK cells. HBCD and TBBPA also interfere with NK cell(s) lytic function. The current study evaluates whether HBCD and/or TBBPA have the capacity to activate MAPKs and MAPK kinases (MAP2Ks). The effects of concentrations of HBCD and TBBPA that inhibited lytic function on the phosphorylation state and total levels of the MAPKs (p44/42, p38, and JNK) and the phosphorylation and total levels of the MAP2Ks (MEK1/2 and MKK3/6) were examined. Results indicate that exposure of human NK cells to 10-0.5 μM HBCD or TBBPA activate MAPKs and MAP2Ks. This HBCD and TBBPA-induced activation of MAPKs may leave them unavailable for activation by virally infected or tumor target cells and thus contributes to the observed decreases in lytic function seen in NK cells exposed to HBCD and TBBPA.
Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels
NASA Technical Reports Server (NTRS)
Pierangeli, Silvia S.; Sonnenfeld, Gerald
1989-01-01
Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.
Huang, X L; Fan, Z; Murayama, T; Rinaldo, C
1995-01-01
A decrease in natural killer (NK) cell function has been related to the progression of human immunodeficiency virus (HIV) infection. In the present study, we assessed the ability of a streptococcus-derived biologic response modifier, OK-432, to augment NK lysis of uninfected K562 and U937 cells and HIV-infected U937 cells by peripheral blood mononuclear cells (PBMC) from HIV-seropositive homosexual men. Optimal two- to fourfold increases in lysis of the three targets were observed after pretreatment of PBMC from HIV-negative subjects for 4 h with 2 micrograms of OK-432 per ml. This effect was related primarily to gamma interferon (IFN-gamma) production induced by OK-432 and was not linked to production of tumor necrosis factors alpha and beta or to monocytes in the cultures. The enhancing effect of OK-432 on NK cell function was diminished but still evident in PBMC from subjects with relatively early-phase (< 3-year) HIV infection and high CD4+ cell counts and was lower in subjects with longer-term HIV infection (> 3 years), in association with reduced production of IFN-gamma. Augmentation of NK cell activity in HIV-infected men by OK-432 was comparable to that induced by treatment of cells with 1,000 U of IFN-alpha or interleukin 2 per ml. The data suggest that the NK cell-enhancing effects of OK-432 are at least in part mediated by IFN-gamma and that OK-432 may be effective in treatment of patients with early-phase HIV infection. PMID:7719919
Interferon-alpha and interferon-gamma sensitize human tenon fibroblasts to mitomycin-C.
Wang, Xiao Yang; Crowston, Jonathan G; Zoellner, Hans; Healey, Paul R
2007-08-01
To investigate the effect of interferon (IFN)-alpha and IFN-gamma pretreatment on mitomycin C (MMC)-induced cell death in human Tenon fibroblasts (HTFs) and the mechanisms by which IFN-alpha and IFN-gamma modulate the susceptibility of HTFs to MMC. HTFs were pretreated with IFN-alpha and IFN-gamma for 48 hours before 5-minute application of 0.4 mg/mL MMC. Cell death after 48 hours was determined by Annexin V/propidium iodide (PI) staining and lactate dehydrogenase (LDH) release assay. Fas, Fas-ligand, and Bcl-2 expression were determined by flow cytometry. Fas associated death domain (FADD), Bax, cytochrome c, and caspase expression were determined by Western blot analysis and immunofluorescence staining. MMC treatment increased cell death and upregulated Fas and FADD expression, but had no effect on Fas-Ligand, Bax, Bcl-2, or cytochrome c. Neither IFN-alpha nor IFN-gamma alone induced HTF death, but each increased cell death 2 days after MMC treatment in a dose-dependent fashion. Combination IFN-alpha and IFN-gamma had a synergistic effect. IFN-alpha and IFN-gamma pretreatment increased Fas expression. Fas upregulation was associated with increased sensitivity to MMC. IFN pretreatment increased procaspase-8, procaspase-9, and procaspase-3 expression, and caspase-3 activation. Caspase-8, caspase-3, and broad caspase inhibitors, but not caspase-9 inhibitor, inhibited MMC-induced cell death in nonpretreated and IFN-pretreated cells. IFN-alpha and IFN-gamma enhance the susceptibility of HTFs to MMC-induced cell death through a Fas-mediated and a caspase-3-dependent pathway. Pretreatment with IFN primed HTFs to MMC, providing a potential means for initially slowing the healing response with IFN and subsequently terminating fibroblast activity through MMC-induced cell death.
Rea, Delphine; Henry, Guylaine; Khaznadar, Zena; Etienne, Gabriel; Guilhot, François; Nicolini, Franck; Guilhot, Joelle; Rousselot, Philippe; Huguet, Françoise; Legros, Laurence; Gardembas, Martine; Dubruille, Viviane; Guerci-Bresler, Agnès; Charbonnier, Aude; Maloisel, Frédéric; Ianotto, Jean-Christophe; Villemagne, Bruno; Mahon, François-Xavier; Moins-Teisserenc, Hélène; Dulphy, Nicolas; Toubert, Antoine
2017-08-01
Despite persistence of leukemic stem cells, patients with chronic myeloid leukemia who achieve and maintain deep molecular responses may successfully stop the tyrosine kinase inhibitor imatinib. However, questions remain unanswered regarding the biological basis of molecular relapse after imatinib cessation. In IMMUNOSTIM, we monitored 51 patients from the French Stop IMatinib trial for peripheral blood T cells and natural killer cells. Molecular relapse-free survival at 24 months was 45.1% (95% CI: 31.44%-58.75%). At the time of imatinib discontinuation, non-relapsing patients had significantly higher numbers of natural killer cells of the cytotoxic CD56 dim subset than had relapsing patients, while CD56 bright natural killer cells, T cells and their subsets did not differ significantly. Furthermore, the CD56 dim natural killer-cell count was an independent prognostic factor of molecular-relapse free survival in a multivariate analysis. However, expression of natural killer-cell activating receptors, BCR-ABL1 + leukemia cell line K562-specific degranulation and cytokine-induced interferon-gamma secretion were decreased in non-relapsing and relapsing patients as compared with healthy individuals. After imatinib cessation, the natural killer-cell count increased significantly and stayed higher in non-relapsing patients than in relapsing patients, while receptor expression and functional properties remained unchanged. Altogether, our results suggest that natural killer cells may play a role in controlling leukemia-initiating cells at the origin of relapse after imatinib cessation, provided that these cells are numerous enough to compensate for their functional defects. Further research will decipher mechanisms underlying functional differences between natural killer cells from patients and healthy individuals and evaluate the potential interest of immunostimulatory approaches in tyrosine kinase inhibitor discontinuation strategies. (ClinicalTrial.gov Identifier NCT
Qi, Guoyan; Liu, Peng; Gu, Shanshan; Yang, Hongxia; Dong, Huimin; Xue, Yinping
2018-04-01
Our study is aimed to explore the underlying genetic basis of myasthenia gravis. We collected a Chinese pedigree with myasthenia gravis, and whole-exome sequencing was performed on the two affected siblings and their parents. The candidate pathogenic gene was identified by bioinformatics filtering, which was further verified by Sanger sequencing. The homozygous mutation c.G40A (p.V14M) in interferon gamma receptor 1was identified. Moreover, the mutation was also detected in 3 cases of 44 sporadic myasthenia gravis patients. The p.V14M substitution in interferon gamma receptor 1 may affect the signal peptide function and the translocation on cell membrane, which could disrupt the binding of the ligand of interferon gamma and antibody production, contributing to myasthenia gravis susceptibility. We discovered that a rare variant c.G40A in interferon gamma receptor 1 potentially contributes to the myasthenia gravis pathogenesis. Further functional studies are needed to confirm the effect of the interferon gamma receptor 1 on the myasthenia gravis phenotype.
Morimoto, K; Takeshita, T; Inoue-Sakurai, C; Maruyama, S
2001-04-10
We investigated the association of lifestyle and mental health status with natural killer (NK) cell and lymphokine-activated killer (LAK) cell activities in healthy males. NK cell activity was determined in 105 male workers and LAK cell activity was determined in 54 male workers. Peripheral blood was obtained from each subject and peripheral blood mononuclear cells (PBMC) were isolated from the blood. These PBMC were used as effector cells. LAK cells were generated by incubation of PBMC with interleukin-2 for 72 h. NK cell activity against NK-sensitive K562 cells and LAK cell activity against NK-resistant Raji cells were examined by 51Cr release assay. Overall lifestyles were evaluated according to the answers on a questionnaire regarding eight health practices (cigarette smoking, alcohol consumption, eating breakfast, hours of sleep, hours of work, physical exercise, nutritional balance, mental stress). Subjects with a good overall lifestyle showed significantly higher NK cell (P < 0.05) and LAK cell (P < 0.05) activities than those with a poor overall lifestyles. Among eight lifestyle factors, cigarette smoking has relatively strong effects on NK cell and LAK cell activities. Subjects who complained of unstable mental status had significantly lower NK cell activity than those who reported stable mental status. When subjects were divided into four groups by lifestyle and mental health status, subjects who had poor or moderate lifestyle and reported unstable mental status showed the lowest NK cell activity and subjects who had good lifestyle and reported stable mental status showed the highest NK cell activity among four groups.
Interferon-λ restricts West Nile virus neuroinvasion by tightening the blood-brain barrier.
Lazear, Helen M; Daniels, Brian P; Pinto, Amelia K; Huang, Albert C; Vick, Sarah C; Doyle, Sean E; Gale, Michael; Klein, Robyn S; Diamond, Michael S
2015-04-22
Although interferon-λ [also known as type III interferon or interleukin-28 (IL-28)/IL-29] restricts infection by several viruses, its inhibitory mechanism has remained uncertain. We used recombinant interferon-λ and mice lacking the interferon-λ receptor (IFNLR1) to evaluate the effect of interferon-λ on infection with West Nile virus, an encephalitic flavivirus. Cell culture studies in mouse keratinocytes and dendritic cells showed no direct antiviral effect of exogenous interferon-λ, even though expression of interferon-stimulated genes was induced. We observed no differences in West Nile virus burden between wild-type and Ifnlr1(-/-) mice in the draining lymph nodes, spleen, or blood. We detected increased West Nile virus infection in the brain and spinal cord of Ifnlr1(-/-) mice, yet this was not associated with a direct antiviral effect in mouse neurons. Instead, we observed an increase in blood-brain barrier permeability in Ifnlr1(-/-) mice. Treatment of mice with pegylated interferon-λ2 resulted in decreased blood-brain barrier permeability, reduced West Nile virus infection in the brain without affecting viremia, and improved survival against lethal virus challenge. An in vitro model of the blood-brain barrier showed that interferon-λ signaling in mouse brain microvascular endothelial cells increased transendothelial electrical resistance, decreased virus movement across the barrier, and modulated tight junction protein localization in a protein synthesis- and signal transducer and activator of transcription 1 (STAT1)-independent manner. Our data establish an indirect antiviral function of interferon-λ in which noncanonical signaling through IFNLR1 tightens the blood-brain barrier and restricts viral neuroinvasion and pathogenesis. Copyright © 2015, American Association for the Advancement of Science.
Dobashi, H; Seki, S; Habu, Y; Ohkawa, T; Takeshita, S; Hiraide, H; Sekine, I
1999-08-01
Although bacterial superantigens have been well characterized as potent stimulators of T cells, their role in natural killer (NK)-type cells remains largely unknown. In the present study, we examined the effect of bacterial superantigens on mouse liver NK cells and NK1.1 Ag(+) (NK1(+)) T cells. C57BL/6 mice were intravenously injected with staphylococcal enterotoxin B (SEB) or streptococcal pyrogenic exotoxin A (SPE-A), and mononuclear cells (MNC) of various organs were obtained from mice 4 hours after being injected with superantigen. MNC were cultured for 48 hours, and interferon gamma (IFN-gamma) levels of supernatants were measured. The antitumor cytotoxicities of the liver and spleen MNC were also evaluated 24 hours after the mice were injected with superantigen. Liver MNC produced more IFN-gamma than did splenocytes, and peripheral blood and lung MNC did not produce any detectable IFN-gamma. In addition, liver MNC acquired a potent antitumor cytotoxicity by the SEB injection, and both NK cells and NK1(+)T cells but not cluster of differentiation (CD)8(+) T cells were responsible for the cytotoxicity as demonstrated by either in vivo or in vitro cell depletion experiments, and the NK-type cells were partly responsible for the increased serum IFN-gamma. Activation of liver NK-type cells was also supported by the fact that liver NK cells proportionally increased and NK1(+) T cells augmented their CD11a expressions after SEB injection. The pretreatment of mice with anti-IFN-gamma Ab and/or with anti-interleukin-12 (IL-12) Ab diminished the SEB-induced cytotoxicity of liver MNC. Furthermore, the in vivo depletion of Kupffer cells decreased the SEB-induced cytotoxicity of liver MNC. Consistent with these results, liver MNC stimulated with superantigens in the presence of Kupffer cells in vitro produced a greater amount of IFN-gamma than did the liver MNC without Kupffer cells or splenocytes. Our results suggest that bacterial superantigen-primed Kupffer cells
Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret
2015-05-01
Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h, and 6 day exposures to TBT (200 - 2.5 nM) and DBT (5 - 0.05 µM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from immune cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. © 2013 Wiley Periodicals, Inc.
Kim, Choon Kwan; Choi, Youn Mi; Bae, Eunsin; Jue, Mihn Sook; So, Hyung Seok; Hwang, Eung-Soo
2018-01-01
The pathogenesis of herpes zoster is closely linked to reduced varicella-zoster virus-specific cell-mediated immunity. However, little is known about the interplay between natural killer cells and psychological stress in the pathogenesis of herpes zoster. This study aimed to investigate possible associations among natural killer cells, T cells and psychological stress in herpes zoster. Interferon-gamma secretion from natural killer cell, psychological stress events, stress cognition scale scores and cytomegalovirus-specific cell-mediated immunity were compared between 44 patients with herpes zoster and 44 age- and gender-matched control subjects. A significantly lower median level of interferon-gamma secreted by natural killer cells was observed in patients with a recent diagnosis of herpes zoster than in control subjects (582.7 pg/ml vs. 1783 pg/ml; P = 0.004), whereas cytomegalovirus-specific cell-mediated immunity was not associated with herpes zoster. Psychological stress events and high stress cognition scale scores were significantly associated in patients with herpes zoster (P<0.001 and P = 0.037, respectively). However, reduced interferon-gamma secretion from natural killer cell and psychological stress were not associated. In conclusion, patients with a recent diagnosis of herpes zoster display reduced interferon-gamma secretion from natural killer cells and frequent previous psychological stress events compared with controls. However, reduced natural killer cell activity is not an immunological mediator between psychological stress and herpes zoster.
Kim, Choon Kwan; Choi, Youn Mi; Bae, Eunsin; Jue, Mihn Sook; So, Hyung Seok
2018-01-01
The pathogenesis of herpes zoster is closely linked to reduced varicella-zoster virus-specific cell-mediated immunity. However, little is known about the interplay between natural killer cells and psychological stress in the pathogenesis of herpes zoster. This study aimed to investigate possible associations among natural killer cells, T cells and psychological stress in herpes zoster. Interferon-gamma secretion from natural killer cell, psychological stress events, stress cognition scale scores and cytomegalovirus-specific cell-mediated immunity were compared between 44 patients with herpes zoster and 44 age- and gender-matched control subjects. A significantly lower median level of interferon-gamma secreted by natural killer cells was observed in patients with a recent diagnosis of herpes zoster than in control subjects (582.7 pg/ml vs. 1783 pg/ml; P = 0.004), whereas cytomegalovirus-specific cell-mediated immunity was not associated with herpes zoster. Psychological stress events and high stress cognition scale scores were significantly associated in patients with herpes zoster (P<0.001 and P = 0.037, respectively). However, reduced interferon-gamma secretion from natural killer cell and psychological stress were not associated. In conclusion, patients with a recent diagnosis of herpes zoster display reduced interferon-gamma secretion from natural killer cells and frequent previous psychological stress events compared with controls. However, reduced natural killer cell activity is not an immunological mediator between psychological stress and herpes zoster. PMID:29466462
Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T
1996-01-01
We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819
Louagie, H; Philippé, J; Vral, A; Cornelissen, M; Thierens, H; De Ridder, L
1998-02-01
To investigate the chromosomal damage caused by gamma-irradiation in T lymphocytes and natural killer (NK) cells and compare this with apoptosis induction in both lymphocyte subsets. Apoptosis induction by gamma-irradiation in T lymphocytes and NK cells was quantified using the annexin V flow cytometric assay. The cytokinesis-block micronucleus (MN) assay was used to evaluate the induced cytogenetic damage. For the MN assays on NK cells, gamma-irradiated peripheral blood mononuclear cells were cultured and stimulated with interleukin 15 (IL-15). Afterwards the NK cells (characterized by the CD3-/CD56+ phenotype) were separated with the FACSort flow cytometer and the number of MN in the sorted binuclear cells was scored. Doses of 1 and 2 Gy gamma-irradiation were applied. Higher numbers of MN in NK cells were found compared with the MN yield in T lymphocytes. In contrast, NK cells were less than T lymphocytes prone to apoptosis after gamma-irradiation. The results support the view that cytogenetic damage and apoptosis after gamma-irradiation are not necessarily correlated.
Justo, G Z; Durán, N; Queiroz, M L S
2003-08-01
The present study examined the effects of MAPA, an antitumor aggregated polymer of protein magnesium ammonium phospholinoleate-palmitoleate anhydride, isolated from Aspergillus oryzae, on concanavalin A (Con A)-induced spleen cell proliferation, cytokine production and on natural killer (NK) cell activity in Ehrlich ascites tumor-bearing mice. The Ehrlich ascites tumor (EAT) growth led to diminished mitogen-induced expansion of spleen cell populations and total NK activity. This was accompanied by striking spleen enlargement, with a marked increase in total cell counts. Moreover, a substantial enhancement in IL-10 levels, paralleled by a significant decrease in IL-2 was observed, while production of IL-4 and interferon-gamma (IFN-gamma) was not altered. Treatment of mice with 5 mg/kg MAPA for 7 days promoted spleen cell proliferation, IL-2 production and NK cell activity regardless of tumor outgrowth. In addition, MAPA treatment markedly enhanced IFN-gamma levels and reduced IL-10 production relative to EAT mice. A 35% reduction in splenomegaly with normal number of nucleated cells was also found. Altogether, our results suggest that MAPA directly and/or indirectly modulates immune cell activity, and probably disengages tumor-induced suppression of these responses. Clearly, MAPA has an impact and may delay tumor outgrowth through immunotherapeutic mechanisms.
The expression of human natural killer cell receptors in early life.
Sundström, Y; Nilsson, C; Lilja, G; Kärre, K; Troye-Blomberg, M; Berg, L
2007-01-01
Natural killer (NK) cells play an important role in tumour immunosurveillance and the early defence against viral infections. Recognition of altered cells (i.e. infected- or tumour-cells) is achieved through a multiple receptor recognition strategy which gives the NK cells inhibitory or activating signals depending on the ligands present on the target cell. NK cells originate from the bone marrow where they develop and proliferate. However, further maturation processes and homeostasis of NK cells in peripheral blood are not well understood. To determine the proportions of cells and the expression of NK cell receptors, mononuclear cells from children at three time points during early childhood were compared, i.e. cord blood (CB), 2 and 5 years of age. The proportion of NK cells was high in CB, but the interferon-gamma (IFN-gamma) production low compared to later in life. In contrast, the proportion of T cells was low in CB. This may indicate a deviation of the regulatory function of NK cells in CB compared to later in life, implying an importance of innate immunity in early life before the adaptive immune system matures. Additionally, we found that the proportion of LIR-1(+) NK cells increased with increasing age while CD94(+)NKG2C(-) (NKG2A(+)) NK cells and the level of expression of NKG2D, NKp30 and NKp46 decreased with age. These age related changes in NK cell populations defined by the expression of activating and inhibitory receptors may be the result of pathogen exposure and/or a continuation of the maturation process that begins in the bone marrow.
Noh, G; Jang, E H
2014-01-01
Specific oral tolerance induction (SOTI) for IgE-mediated food allergy (IFA) can be successfully achieved using interfero gamma (classic SOTI). In this study, a tolerable dose was introduced during tolerance induction with interferon gamma (dual SOTI), and its effectiveness was evaluated. The study population comprised 25 IFA patients. Blood samples were taken for analysis, including complete blood count with differential counts of eosinophils, serum total IgE levels, and specific IgE for allergenic foods. Skin prick tests were conducted with the allergens. Oral food challenges were performed to diagnose IFA. Ten patients received dual SOTI, 5 received classic SOTI, 5 received SOTI without interferon gamma (original SOTI), and 5 were not treated (controls). Patients treated with dual SOTI and classic SOTI using interferon gamma became tolerant to the allergenic food. The tolerable dose was introduced successfully in dual SOTI. It was difficult to proceed with the same dosing protocol used for classic SOTI in cases treated with original SOTI. Following dual SOTI, the systemic reaction to oral intake subsided, but the local skin reaction to contact with the allergenic food persisted. Dual SOTI is an improved protocol for SOTI using interferon gamma for IFA.The local skin reaction and systemic reaction to oral intake were dissociated following dual SOTI. In cases of food allergy, tolerance appears to result from desensitization to allergens.
Gil, Olga; Vilaplana, Cristina; Guirado, Evelyn; Díaz, Jorge; Cáceres, Neus; Singh, Mahavir; Cardona, Pere-Joan
2008-11-01
Gamma interferon responses of spleen cells in mice were examined during postchemotherapy relapse of intraperitoneally induced latent tuberculous infection. The mycobacterial extract RUTI, which prevented the relapse, significantly enhanced the immune responses to secreted and structural recombinant mycobacterial antigens, suggesting that RUTI-mediated protection was mediated by activated T cells.
Gao, Y; Chenping; Lin, X P
1997-10-01
In order to determine whether interferon-gamma (IFN-gamma) inhibits eosinphil infiltration in the trachea of asthmatic guinea pigs induced by Rhizopus nigricans. We had administered aerosolized rIFN-gamma in the tracheas of 30 sensitized guinea pigs which had been divided into six groups, then teated animal inhaled rIFN-gamma of 5 x 10(4), 20 x 10(4), and 40 x 10(4) concentration, BDP and normal saline respectively at 24 h, 12 h, 2 h before being challenged. (1) Provocation positive rates decreased in 40 x 10(4) rIFN-gamma and BDP group compared with that in normal saline group and before intervention (P < 0.05), airway resistence decreased (P < 0.01). (2) The administration of aerosolized rIFN-gamma (40 x 10(4)) and BDP also decreased fungus-induced eosnophils but not other cells infiltration in the trachea. (3) In BALF, Eos count and ECP level were obviously lower than those in other groups. However, eosinophil numbers did not show significant change in the peripheral blood. Local administration of rIFN-gamma (40 x 10(4)) may reduce airway inflammation and intervene asthmatic attack by inhibition of Eos, ECP infiltration in airways.
Pai, Madhukar; Gokhale, Kaustubh; Joshi, Rajnish; Dogra, Sandeep; Kalantri, Shriprakash; Mendiratta, Deepak K; Narang, Pratibha; Daley, Charles L; Granich, Reuben M; Mazurek, Gerald H; Reingold, Arthur L; Riley, Lee W; Colford, John M
2005-06-08
Mycobacterium tuberculosis infection in health care workers has not been adequately studied in developing countries using newer diagnostic tests. To estimate latent tuberculosis infection prevalence in health care workers using the tuberculin skin test (TST) and a whole-blood interferon gamma (IFN-gamma) assay; to determine agreement between the tests; and to compare their correlation with risk factors. A cross-sectional comparison study of 726 health care workers aged 18 to 61 years (median age, 22 years) with no history of active tuberculosis conducted from January to May 2004, at a rural medical school in India. A total of 493 (68%) of the health care workers had direct contact with patients with tuberculosis and 514 (71%) had BCG vaccine scars. Tuberculin skin testing was performed using 1-TU dose of purified protein derivative RT23, and the IFN-gamma assay was performed by measuring IFN-gamma response to early secreted antigenic target 6, culture filtrate protein 10, and a portion of tuberculosis antigen TB7.7. Agreement between TST and the IFN-gamma assay, and comparison of the tests with respect to their association with risk factors. A large proportion of the health care workers were latently infected; 360 (50%) were positive by either TST or IFN-gamma assay, and 226 (31%) were positive by both tests. The prevalence estimates of TST and IFN-gamma assay positivity were comparable (41%; 95% confidence interval [CI], 38%-45% and 40%; 95% CI, 37%-43%, respectively). Agreement between the tests was high (81.4%; kappa = 0.61; 95% CI, 0.56-0.67). Increasing age and years in the health profession were significant risk factors for both IFN-gamma assay and TST positivity. BCG vaccination had little impact on TST and IFN-gamma assay results. Our study showed high latent tuberculosis infection prevalence in Indian health care workers, high agreement between TST and IFN-gamma assay, and similar association between positive test results and risk factors. Although TST and
Reiners, J J; Cantu, A; Thai, G; Pavone, A
1993-03-01
SENCAR mice develop more papillomas in two-stage skin carcinogenesis protocols if gamma interferon (IFN-gamma) is co-administered with 12-O-tetradecanoylphorbol-13-acetate (TPA) during the promotion phase. In the current study preparations of murine alpha, beta and gamma IFNs were surveyed for their abilities to modulate TPA-dependent promotion and induction of epidermal hyperplasia, inflammation and ornithine decarboxylase activity (ODC). Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (< or = 2500 units) did not induce epidermal hyperplasia, inflammation or ODC activity. Single or multiple i.p. administrations of IFN-alpha, -beta or -gamma (2500 units) to mice being topically promoted with 0.1 or 1 microgram of TPA did not alter the epidermal hyperplasia induced by the phorbol ester. The vascular permeability of the skin, as evaluated by the extravasation of Evans blue dye, was increased in a dose-dependent fashion by TPA over the range of 0.1-1 microgram. Treatment of mice promoted with 0.1 microgram of TPA with IFN-gamma (> or = 2500 units) significantly increased the skin's vascular permeability. Comparable effects were not obtained with IFN-beta (IFN-alpha not tested). Treatment of TPA-promoted mice with IFN-gamma, and to a lesser extent IFN-beta, weakly potentiated the TPA-dependent induction of epidermal ODC activity. Under conditions in which IFN-gamma had co-promoting activities in an initiation-promotion protocol, co-treatment of initiated mice with 1 microgram of TPA and IFN-alpha or -beta (100-5000 units) did not reproducibly alter tumor latency., or papilloma and carcinoma multiplicities. These findings suggest that the co-promoting activities of IFNs are restricted to the gamma class, and are not uniformly reflected by parameters commonly employed as short-term markers of tumor promotion.
Interferon-gamma: biologic functions and HCV therapy (type I/II) (1 of 2 parts).
Gattoni, A; Parlato, A; Vangieri, B; Bresciani, M; Derna, R
2006-01-01
This review is aimed at exhaustively presenting and discussing the interferon-gamma (IFN-gamma), a cytokine that plays an important role in inducing and modulating an array of immune responses. A review of the most significant and recent clinical trials was performed. Although IFN-gamma has some antiviral activity, it is much less active in this regard than type I IFNs. IFN-gamma is involved in the regulation of nearly all phases of the immune and inflammatory responses, including the activation and differentiation of T cells, B cells, NK cells, macrophages, and others. It is therefore best regarded as a distint immunoregulatory cytokine. IFN-gamma secretion is a hallmark of Th1 lymphocytes. It is also secreted by nearly all CD8 T cells, by some Th0 cells, and by NK cells. Each of these cell types secretes IFN-gamma only when activated, usually as part of immune response and especially in response to IL-2 and IL-12. IFN-gamma production is inhibited by IL-4, IL-10, TGFbeta, glucocorticoids, cyclosporin A and FK506. Nearly all cell types express the heterodimeric receptor for IFN-beta and respond to this cytokine by increasing the surface expression of class I MHC proteins. As a result, virtually any cell in the vicinity of an IFN-beta-secreting cell becomes more efficient at presenting endogenous antigens and hence a better target for cytotoxic killing if it harbors an intracellular pathogen. Unlike the type I IFNs, IFN-gamma also increases the expression of class II MHC proteins on professional APCs, and so promotes antigen presentation to helper T cells as well. It also induces de novo expression of class II MHC proteins on venular endothelial cells and on some other epithelial and connective tissue cells that do not otherwise express them, thus enabling these cell types to function as temporary APCs at sites of intense immune reactions. The effector functions of NK cells are to lyse virus-infected cells and to secrete IFN-gamma, which activates macrofages to
Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research
Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study suggests that interferon-gamma, which has been thought to contribute to an innate defense system against cancer, under some circumstances, may instead promote melanoma and incite the development of tumors.
Effect of gamma interferon on resolution of murine chlamydial genital infection.
Rank, R G; Ramsey, K H; Pack, E A; Williams, D M
1992-01-01
Mice infected in the genital tract with the Chlamydia trachomatis agent of mouse pneumonitis were treated with monoclonal rat anti-gamma interferon (anti-IFN-gamma) antibody to determine whether IFN-gamma participated in the resolution of the infection. In two experiments, anti-IFN-gamma antibody treatment resulted in significantly prolonged infections. In support of these data, passive administration of recombinant IFN-gamma to chronically infected nu/nu mice was able to bring about resolution of the infection in some animals. PMID:1398955
Testa, U; Care, A; Montesoro, E; Fossati, C; Giannella, G; Masciulli, R; Fagioli, M; Bulgarini, D; Habetswallner, D; Isacchi, G
1990-01-01
We have developed a culture system for "long-term" growth of human lymphokine-activated killer (LAK) cells exhibiting an elevated, wide-spectrum antitumor cytotoxicity. The system allows the exponential growth of monocyte-depleted low-density lymphocytes in the presence of human serum and recombinant human interleukin-2 (10(3) U/ml), alone or in combination with interleukin-1 alpha or beta (both at 10 U/ml). Eighteen cultures were established from 18 normal adult donors. The membrane phenotypes of the final LAK cell population, assessed by a panel of monoclonal antibodies (mAb), consist of three main types: (a) NKH-1+, Ti alpha/beta-, Ti gamma/delta-, and CD3- lymphocytes; (b) NKH-1+, Ti alpha/beta-, Ti gamma/delta+, and CD3+ lymphocytes and (c) NKH-1+, Ti alpha/beta+, Ti gamma/delta- and CD3+ lymphocytes. Northern blot analysis showed that all these cell populations express relatively high levels of perforin RNA, particularly cells exhibiting the first phenotype. This culture system may provide a tool for cellular and molecular studies on the mechanisms of antitumor cytotoxicity, as well as the basis for new adoptive immunotherapy protocols in advanced center.
Brar, Kanwaljit; Leung, Donald Y M
2016-01-01
Atopic dermatitis (AD) is the most common inflammatory skin disease in the general population. There are different endophenotypes of AD that likely have a unique immune and molecular basis, such as those who are predisposed to eczema herpeticum, or Staphylococcus aureus infections. In this review, we highlight the endophenotypes of AD where reduced interferon gamma expression may be playing a role. Additionally, we review the potential role of recombinant interferon gamma therapy in the treatment of atopic dermatitis and the particular phenotypes that may benefit from this treatment. Recombinant interferon gamma treatment will likely benefit the pediatric population with AD, as well as those with susceptibilities for skin infections. Future studies are needed to elucidate whether IFN-γ may reduce the prevalence of skin infection in AD.
Co-Expansion of Cytokine-Induced Killer Cells and Vγ9Vδ2 T Cells for CAR T-Cell Therapy
Chen, Can; Tan, Wee-Kiat; Chi, Zhixia; Xu, Xue-Hu; Wang, Shu
2016-01-01
Gamma delta (γδ) T cells and cytokine-induced killer (CIK) cells, which are a heterogeneous population of T lymphocytes and natural killer T (NKT) cells, have been separately expanded ex vivo and shown to be capable of targeting and mediating cytotoxicity against various tumor cells in a major histocompatibility complex-unrestricted manner. However, the co-expansion and co-administration of these immune cells have not been explored. In this study we describe an efficient method to expand simultaneously both CIK and Vγ9Vδ2 T cells, termed as CIKZ cells, from human peripheral blood mononuclear cells (PBMCs) using Zometa, interferon-gamma (IFN-γ), interleukin 2 (IL-2), anti-CD3 antibody and engineered K562 feeder cells expressing CD64, CD137L and CD86. A 21-day culture of PBMCs with this method yielded nearly 20,000-fold expansion of CIKZ cells with γδ T cells making up over 20% of the expanded population. The expanded CIKZ cells exhibited antitumor cytotoxicity and could be modified to express anti-CD19 chimeric antigen receptor (CAR), anti-CEA CAR, and anti-HER2 CAR to enhance their specificity and cytotoxicity against CD19-, CEA-, or HER2-positive tumor cells. The tumor inhibitory activity of anti-CD19 CAR-modified CIKZ cells was further demonstrated in vivo in a Raji tumor mouse model. The findings herein substantiate the feasibility of co-expanding CIK and γδ cells for adoptive cellular immunotherapy applications such as CAR T-cell therapy against cancer. PMID:27598655
Stevenson, Heather L; Estes, Mark D; Thirumalapura, Nagaraja R; Walker, David H; Ismail, Nahed
2010-08-01
Human monocytotropic ehrlichiosis is caused by Ehrlichia chaffeensis, a Gram-negative bacterium lacking lipopolysaccharide. We have shown that fatal murine ehrlichiosis is associated with CD8(+)T cell-mediated tissue damage, tumor necrosis factor-alpha, and interleukin (IL)-10 overproduction, and CD4(+)Th1 hyporesponsiveness. In this study, we examined the relative contributions of natural killer (NK) and NKT cells in Ehrlichia-induced toxic shock. Lethal ehrlichial infection in wild-type mice induced a decline in NKT cell numbers, and late expansion and migration of activated NK cells to the liver, a main infection site that coincided with development of hepatic injury. The spatial and temporal changes in NK and NKT cells in lethally infected mice correlated with higher NK cell cytotoxic activity, higher expression of cytotoxic molecules such as granzyme B, higher production of interferon-gamma and tumor necrosis factor-alpha, increased hepatic infiltration with CD8alphaCD11c(+) dendritic cells and CD8(+)T cells, decreased splenic CD4(+)T cells, increased serum concentrations of IL-12p40, IL-18, RANTES, and monocyte chemotactic protein-1, and elevated production of IL-18 by liver mononuclear cells compared with nonlethally infected mice. Depletion of NK cells prevented development of severe liver injury, decreased serum levels of interferon-gamma, tumor necrosis factor-alpha, and IL-10, and enhanced bacterial elimination. These data indicate that NK cells promote immunopathology and defective anti-ehrlichial immunity, possibly via decreasing the protective immune response mediated by interferon-gamma producing CD4(+)Th1 and NKT cells.
Kaisho, Tsuneyasu; Tsutsui, Hiroko; Tanaka, Takashi; Tsujimura, Tohru; Takeda, Kiyoshi; Kawai, Taro; Yoshida, Nobuaki; Nakanishi, Kenji; Akira, Shizuo
1999-01-01
We have investigated in vivo roles of CCAAT/enhancer binding protein γ (C/EBPγ) by gene targeting. C/EBPγ-deficient (C/EBPγ2/−) mice showed a high mortality rate within 48 h after birth. To analyze the roles of C/EBPγ in lymphoid lineage cells, bone marrow chimeras were established. C/EBPγ2/− chimeras showed normal T and B cell development. However, cytolytic functions of their splenic natural killer (NK) cells after stimulation with cytokines such as interleukin (IL)-12, IL-18, and IL-2 were significantly reduced as compared with those of control chimera NK cells. In addition, the ability of C/EBPγ−/− chimera splenocytes to produce interferon (IFN)-γ in response to IL-12 and/or IL-18 was markedly impaired. NK cells could be generated in vitro with normal surface marker expression in the presence of IL-15 from C/EBPγ2/− newborn spleen cells. However, they also showed lower cytotoxic activity and IFN-γ production when stimulated with IL-12 plus IL-18 than control NK cells, as observed in C/EBPγ2/− chimera splenocytes. In conclusion, our study reveals that C/EBPγ is a critical transcription factor involved in the functional maturation of NK cells. PMID:10587348
Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret
2013-01-01
Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and also alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h and 6 day exposures to TBT (200- 2.5 nM) and DBT (5- 0.05 μM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from NK cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. PMID:24357260
USDA-ARS?s Scientific Manuscript database
Gamma interferon (IFN-gamma)-induced protein 10 (IP-10) has recently shown promise as a diagnostic biomarker of Mycobacterium tuberculosis infection of humans. The aim of the current study was to compare IP-10 and IFN-gamma responses upon Mycobacterium bovis infection in cattle using archived sample...
Mechanisms of diminished natural killer cell activity in pregnant women and neonates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baley, J.E.; Schacter, B.Z.
1985-05-01
Because alterations in natural killer (NK) activity in the perinatal period may be important in the maintenance of a healthy pregnancy, the mechanisms by which these alterations are mediated in neonates and in pregnant and postpartum women was examined. NK activity, as measured in a 4-hr /sup 51/Cr-release assay and compared with adult controls, is significantly diminished in all three trimesters of pregnancy and in immediately postpartum women. In postpartum women, NK activity appears to be higher than in pregnant women, although this does not reach statistical significance. Pregnant and postpartum women have normal numbers of large granular lymphocytes andmore » normal target cell binding in an agarose single cell assay but decreased lysis of the bound target cells. NK activity of mononuclear cells from postpartum women, in addition, demonstrate a shift in distribution to higher levels of resistance to gamma-irradiation. Further, sera from postpartum women cause a similar shift to increased radioresistance in mononuclear cells from adult controls. Because radioresistance is a property of interleukin 2-stimulated NK, the shift to radioresistance may represent lymphokine-mediated stimulation occurring during parturition. In contrast, cord blood cells have a more profound decrease in NK activity as determined by /sup 51/Cr-release assay and decreases in both binding and lysis of bound target cells in the single cell assay. The resistance of NK activity in cord cells to gamma-irradiation is also increased, as seen in postpartum women. Cord blood serum, however, did not alter radioresistance or inhibit NK activity. The results suggest that the observed diminished NK activity in pregnant women and neonates arise by different mechanisms: an absence of mature NK cells in the neonate and an alteration of the NK cell in pregnancy leading to decreased killing.« less
Kawai, K; Enomoto, T; Fornasier, V; Resetkova, E; Volpé, R
1997-03-01
We have studied the in vivo effects of human interferon alpha (IFN-alpha) and interferon gamma (IFN-gamma) administration on human thyroid tissue xenografted into two mouse strains: severe combined immunodeficient (SCID) mice and nude mice. Human lymphocytes survive in SCID mice but are lysed in nude mice. Thyroid tissues from Graves' disease or Hashimoto's thyroiditis, or paranodular [normal, (N)] tissue was xenografted into SCID mice (0.8 g/mouse) pretreated with anti-asialo GM-1 antiserum and radiation and also into nude mice. One week after xenografting, SCID and nude mice were divided into three groups. Group A was treated with IFN-alpha intraperitoneally (2,000 units/mouse) three times weekly; group B was treated with IFN-gamma similarly; group C was treated with phosphate buffered saline (PBS) only (control). Autologous human peripheral blood mononuclear cells (PBMCs) were added to mice receiving N xenografts. Blood was taken every 2 weeks for levels of IgG and thyroid antibodies (TAb). After 6 weeks of treatment, mice were sacrificed, and xenograft thyrocyte histocompatibility leukocyte antigen (HLA-DR) and intercellular adhesion molecule (ICAM-1) expression were measured. In addition, thyrocyte cultures were stimulated in vitro with 200 units/ml of either IFN-alpha or IFN-gamma or PBS (control). SCID mice xenografted with autoimmune thyroid disease (AITD) in group A showed a significantly higher TAb production than group C, whereas in group B, TAb production was not statistically increased compared to control (group C). SCID mice xenografted with N did not produce TAb in any group, nor did nude mice xenografted with AITD. Thyrocyte HLA-DR expression was markedly increased in group A and B in SCID mice xenografted with Graves' disease, Hashimoto's thyroiditis, and N tissue compared to group C. In contrast, only group B (IFN-gamma) showed an increase in thyrocyte HLA-DR in nude mice. In the in vitro studies, only IFN-gamma (not IFN-alpha) stimulated
Inhibited interferon-gamma but normal interleukin-3 production from rats flown on the Space Shuttle
NASA Technical Reports Server (NTRS)
Gould, Cheryl L.; Lyte, Mark; Williams, Joann; Mandel, Adrian D.; Sonnenfeld, Gerald
1987-01-01
Rats were flown on Space Shuttle SL-3 for one week. When spleen cells were removed from these rats and challenged with concanavalin-A, interferon-gamma production was severely inhibited, while interleukin-3 production was unaffected compared to ground-based control rats. These data indicate that there is a defect in interferon-gamma production in rats that have been exposed to spaceflight. This defect could contribute to, and be one reason for, immunosuppression observed after spaceflight.
Wynn, Daniel; Kaufman, Michael; Montalban, Xavier; Vollmer, Timothy; Simon, Jack; Elkins, Jacob; O'Neill, Gilmore; Neyer, Lauri; Sheridan, James; Wang, Chungchi; Fong, Alice; Rose, John W
2010-04-01
34% to 88%; p=0.004) and 3.58 in the interferon beta and low-dose daclizumab group (25%, -76% to 68%; p=0.51). In the pharmacodynamic substudy, daclizumab was not associated with significant changes in absolute numbers of T cells, B cells, or natural killer cells, or T-cell proliferative response compared with interferon beta alone. The number of CD56(bright) natural killer cells was seven to eight times higher in both daclizumab groups than in the interferon beta and placebo group (interferon beta and low-dose daclizumab group p=0.002; interferon beta and high-dose daclizumab group p<0.0001). Common adverse events were equally distributed across groups. Add-on daclizumab treatment reduced the number of new or enlarged gadolinium contrast-enhancing lesions compared with interferon beta alone and might reduce multiple sclerosis disease activity to a greater extent than interferon beta alone. Facet Biotech and Biogen Idec. 2010 Elsevier Ltd. All rights reserved.
Badie, B; Schartner, J; Vorpahl, J; Preston, K
2000-04-01
Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.
Yoon, Wonsuck; Park, Yoo Chang; Kim, Jinseok; Chae, Yang Seok; Byeon, Jung Hye; Min, Sang-Hyun; Park, Sungha; Yoo, Young; Park, Yong Keun; Kim, Byeong Mo
2017-01-01
Salmonella have been experimentally used as anti-cancer agents, because they show selective growth in tumours. In this study, we genetically modified attenuated Salmonella typhimurium to express and secrete interferon-gamma (IFN-γ) as a tumouricidal agent to enhance the therapeutic efficacy of Salmonella. IFN-γ was fused to the N-terminal region (residues 1-160) of SipB (SipB160) for secretion from bacterial cells. Attenuated S. typhimurium expressing recombinant IFN-γ (S. typhimurium (IFN-γ)) invaded the melanoma cells and induced cytotoxicity. Subcutaneous administration of S. typhimurium (IFN-γ) also efficiently inhibited tumour growth and prolonged the survival of C57BL/6 mice bearing B16F10 melanoma compared with administration of phosphate-buffered saline (PBS), unmodified S. typhimurium or S. typhimurium expressing empty vector (S. typhimurium [Vec]) in a natural killer (NK) cell-dependent manner. Moreover, genetically modified Salmonella, including S. typhimurium (IFN-γ), showed little toxicity to normal tissues with no observable adverse effects. However, S. typhimurium (IFN-γ)-mediated tumour suppression was attributed to direct killing of tumour cells rather than to stable anti-tumour immunity. Collectively, these results suggest that tumour-targeted therapy using S. typhimurium (IFN-γ) has potential for melanoma treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.
Segura, S.; Gamazo, C.; Irache, J. M.; Espuelas, S.
2007-01-01
The aim of this study was to evaluate the activity of gamma interferon (IFN-γ) when it was either adsorbed onto or loaded into albumin nanoparticles. Brucella abortus-infected macrophages and infected BALB/c mice were selected as the models for testing of the therapeutic potentials of these cytokine delivery systems, in view of the well-established role of IFN-γ-activated macrophages for the control of Brucella sp. infections. Whereas the encapsulation of IFN-γ inside the matrix of nanoparticles completely abrogated its activity, adsorbed IFN-γ increased by 0.75 log unit the bactericidal effect induced by RAW macrophages activated with free IFN-γ, along with a higher level of production of nitric oxide. In infected BALB/c-mice, IFN-γ adsorbed onto nanoparticles was also more active than free cytokine in reducing the number of bacteria in the spleens, and the effect was mediated by an increased ratio of IFN-γ-secreting (Th1) to interleukin-4-secreting (Th2) cells. Overall, albumin nanoparticles would be suitable as carriers that target IFN-γ to macrophages and, thus, potentiate their therapeutic activity. PMID:17220401
Interferon Gamma as a Biomarker of Exposure to Enteric Viruses
Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...
Lee, Jung Nam; Ryu, Dong Yup; Park, Sung Han; You, Hyun Seok; Lee, Bong Eun; Kim, Dong Uk; Kim, Tae Oh; Heo, Jeong; Kim, Gwang Ha; Song, Geun Am; Kim, Suk; Park, Do Youn
2010-06-01
It is difficult to clinically and endoscopically differentiate intestinal tuberculosis (ITB) and Crohns disease (CD). The aim of this study was to evaluate the usefulness of in vitro interferon-gamma (INF-gamma) assay for differential diagnosis between ITB and CD. Sixty patients for whom differential diagnosis between ITB and CD was difficult were enrolled between January 2007 and January 2009. The INF-gamma-producing T-cell response to early secreted antigenic target 6 and culture filtrate protein 10 were measured by T-SPOT.TB blood test in vitro. We evaluated the usefulness of T-SPOT.TB blood test by comparing its results with the final diagnosis. Twenty and forty patients were revealed to be positive and negative in T-SPOT.TB blood test, respectively. Of the 20 patients found to be positive, 12 patients (60%) were finally diagnosed as ITB, 6 patients as CD, and 2 patients as Behcets enterocolitis. Of the 40 patients with negative results, 38 patients (95%) were diagnosed as CD; one as Behcets enterocolitis; one as nonspecific colitis; none as ITB. The sensitivity and specificity of T-SPOT.TB blood test for ITB were 100% and 83.3%, respectively. Positive and negative predictive values of T-SPOT.TB blood test for ITB were 60.0% and 100%, respectively. When differential diagnosis between ITB and CD is difficult, T-SPOT.TB blood test may be a helpful and rapid diagnostic tool to exclude ITB. Prospective large-scaled studies are required for further evaluation of the usefulness of T-SPOT.TB blood test for differential diagnosis between ITB and CD.
Anti-interferon-gamma antibodies in the treatment of autoimmune diseases.
Skurkovich, Boris; Skurkovich, Simon
2003-02-01
Interferon (IFN)-gamma is an important immune regulator in normal immunity. When IFN gamma production is disturbed, various autoimmune diseases (ADs) can develop, in which we suggest that anti-IFN gamma could have a beneficial effect. Depending on the cell type in which IFN gamma synthesis is disturbed, different clinical manifestations may result. We have also proposed to remove tumor necrosis factor (TNF)-alpha, together with certain types of IFNs, to treat various ADs and AIDS, also an autoimmune condition. Anti-IFN gamma has been tested in several T-helper cell (Th1) ADs, including rheumatoid arthritis (RA), multiple sclerosis (MS), corneal transplant rejection, uveitis, Type I diabetes, schizophrenia (anti-IFN gamma and anti-TNF alpha), and various autoimmune skin diseases (alopecia areata, psoriasis vulgaris, vitiligo, pemphigus vulgaris and epidermolysis bullosa). A strong, sometimes striking, therapeutic response followed administration of anti-IFN gamma, indicating that it may be a promising therapy for Th1 ADs.
Interferon-γ Inhibits Ebola Virus Infection.
Rhein, Bethany A; Powers, Linda S; Rogers, Kai; Anantpadma, Manu; Singh, Brajesh K; Sakurai, Yasuteru; Bair, Thomas; Miller-Hunt, Catherine; Sinn, Patrick; Davey, Robert A; Monick, Martha M; Maury, Wendy
2015-01-01
Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.
Interferon-gamma and T-bet expression in a patient with toxoplasmic lymphadenopathy.
Jöhrens, Korinna; Moos, Verena; Schneider, Thomas; Stein, Harald; Anagnostopoulos, Ioannis
2010-04-01
Infection with Toxoplasma gondii (TG) presents in some individuals as a self-limited disease with a predominant lymphadenopathy characterized by prominent B-cell activation. As this is in contrast to the in vitro based concept of a T(h)1-immune response against TG, we investigated native lymphoid tissue and peripheral blood of a patient with serologic evidence of toxoplasmosis to verify which cells show T(h)1-response features. High-level expression of T-bet in monocytoid B-cells, in germinal center B-cells, and in a lesser amount in T cells could be demonstrated by immunohistochemistry. In vitro stimulation of lymph node cells with either TG, staphylococcus enterotoxin B, or phorbol 12-myristate 13-acetate/ionomycin revealed an interferon-gamma expression in T-bet(+) B cells only in the patient and not in controls. Similar results were found for T-bet(+) T cells which were also present in controls. CD4(+) peripheral blood cells stimulated with TG antigens showed a TG-specific but attenuated T(h)1-reactivity in the patient associated with a reduced expression of IL-2 when compared with controls. We conclude that the pathogenesis and course of toxoplasmic lymphadenopathy is based on a T(h)1-cell defect, which becomes compensated by the B cells mounting a T(h)1-like immune response.
[Functional activity of the natural killers and macrophages in patients with breast tumors].
Andrianov, I G; Voronov, S M; Dobkin, A N; Okulov, V B; Orlov, A B
1988-01-01
The activity of natural killers (NK) and macrophages of peripheral blood was studied in 37 female donors, 40 patients with benign and 43 with malignant tumors of the breast of various stages prior to treatment. Also the effect of Soviet-made recombinant interleukin-2 on NK activity was assessed. Natural killer activity (cytotoxic index) was 34.1 +/- 1.42 in healthy donors, 44.2 +/- 3.64 in cases of fibroadenomatosis, 43.1 +/- 5.6 in patients with stages I-IIa, 64.4 +/- 3.93--stage IIb, 45.8 +/- 6.32--stage III and 16.6 +/- 7.21% in cases of stage IV breast cancer, the scatter of values being greater in the tumor group. As many as 40% of patients with stages I-IIa and III cancer showed increased NK-activity values. An in vitro stimulating effect of NK activity of peripheral blood mononuclear cells by Soviet-made recombinant interleukin-2 was established.
Don, Elena; Farafonova, Olga; Pokhil, Suzanna; Barykina, Darya; Nikiforova, Marina; Shulga, Darya; Borshcheva, Alena; Tarasov, Sergey; Ermolaeva, Tatyana; Epstein, Oleg
2016-01-01
In preliminary ELISA studies where released-active forms (RAF) of antibodies (Abs) to interferon-gamma (IFNg) were added to the antigen-antibody system, a statistically significant difference in absorbance signals obtained in their presence in comparison to placebo was observed. A piezoelectric immunosensor assay was developed to support these data and investigate the effects of RAF Abs to IFNg on the specific interaction between Abs to IFNg and IFNg. The experimental conditions were designed and optimal electrode coating, detection circumstances and suitable chaotropic agents for electrode regeneration were selected. The developed technique was found to provide high repeatability, intermediate precision and specificity. The difference between the analytical signals of RAF Ab samples and those of the placebo was up to 50.8%, whereas the difference between non-specific controls and the placebo was within 5%–6%. Thus, the piezoelectric immunosensor as well as ELISA has the potential to be used for detecting the effects of RAF Abs to IFNg on the antigen-antibody interaction, which might be the result of RAF’s ability to modify the affinity of IFNg to specific/related Abs. PMID:26791304
Identification of a human non-interferon lymphokine activating monocyte complement biosynthesis.
Drouet, C; Reboul, A; Colomb, M
1989-01-01
A monocyte-stimulating activity produced by mitogen-induced mononuclear cells has been defined by its ability to enhance the synthesis in vitro of complement C1 subcomponents, C2 and C3. A lymphokine responsible for this activity was purified from culture supernatants of peripheral blood mononuclear cells activated by staphylococcal enterotoxin A. From 0.5 litre of supernatant the purification procedure [(NH4)2SO4 precipitation, phenyl-Sepharose chromatography and preparative electrofocusing] yielded about 100 pmol of purified lymphokine. Its pI is 7.9 and its Mr, estimated by SDS/polyacrylamide-gel electrophoresis, is 14,600, 27,000 and 56,000, the high-Mr species representing oligomeric forms of the Mr-14,600 molecule. Its amino acid analysis reveals a high percentage of hydrophobic amino acids (34%); the absence of histidine residues suggests that it is a novel monocyte-activating lymphokine. It enhances C1r and C1s biosynthesis at a pretranslational level. From its structure and activity this lymphokine appears different from gamma-interferon. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:2481436
Soler, Concepció; Felipe, Antonio; García-Manteiga, José; Serra, Maria; Guillén-Gómez, Elena; Casado, F Javier; MacLeod, Carol; Modolell, Manuel; Pastor-Anglada, Marçal; Celada, Antonio
2003-01-01
The expressions of CNT and ENT (concentrative and equilibrative nucleoside transporters) in macrophages are differentially regulated by IFN-gamma (interferon-gamma). This cytokine controls gene expression through STAT1-dependent and/or -independent pathways (where STAT1 stands for signal transduction and activator of transcription 1). In the present study, the role of STAT1 in the response of nucleoside transporters to IFN-gamma was studied using macrophages from STAT1 knockout mice. IFN-gamma triggered an inhibition of ENT1-related nucleoside transport activity through STAT1-dependent mechanisms. Such inhibition of macrophage growth and ENT1 activity by IFN-gamma is required for DNA synthesis. Interestingly, IFN-gamma led to an induction of the CNT1- and CNT2-related nucleoside transport activities independent of STAT1, thus ensuring the supply of extracellular nucleosides for the STAT1-independent RNA synthesis. IFN-gamma up-regulated CNT2 mRNA and CNT1 protein levels and down-regulated ENT1 mRNA in both wild-type and STAT1 knockout macrophages. This is consistent with a STAT1-independent, long-term-mediated, probably transcription-dependent, regulation of nucleoside transporter genes. Moreover, STAT1-dependent post-transcriptional mechanisms are implicated in the regulation of ENT1 activity. Although nitric oxide is involved in the regulation of ENT1 activity in B-cells at a post-transcriptional level, our results show that STAT1-dependent induction of nitric oxide by IFN-gamma is not implicated in the regulation of ENT1 activity in macrophages. Our results indicate that both STAT1-dependent and -independent pathways are involved in the regulation of nucleoside transporters by IFN-gamma in macrophages. PMID:12868960
Development of a lion-specific interferon-gamma assay.
Maas, M; van Kooten, P J S; Schreuder, J; Morar, D; Tijhaar, E; Michel, A L; Rutten, V P M G
2012-10-15
The ongoing spread of bovine tuberculosis (BTB) in African free-ranging lion populations, for example in the Kruger National Park, raises the need for diagnostic assays for BTB in lions. These, in addition, would be highly relevant for zoological gardens worldwide that want to determine the BTB status of their lions, e.g. for translocations. The present study concerns the development of a lion-specific IFN-γ assay, following the production and characterization of monoclonal antibodies specific for lion interferon-gamma (IFN-γ). Recombinant lion IFN-γ (rLIFN-γ) was produced in mammalian cells and used to immunize mice to establish hybridoma cell lines producing monoclonal antibodies. These were used to develop a sensitive, lion IFN-γ-specific capture ELISA, able to detect rLIFN-γ to the level of 160 pg/ml. Recognition of native lion IFN-γ was shown in an initial assessment of supernatants of mitogen stimulated whole blood cultures of 11 known BTB-negative lions. In conclusion, the capture ELISA shows potential as a diagnostic assay for bovine tuberculosis in lions. Preliminary results also indicate the possible use of the test for other (feline) species. Copyright © 2012 Elsevier B.V. All rights reserved.
Potential mechanisms of cytosolic calcium modulation in interferon-gamma treated U937 cells
NASA Technical Reports Server (NTRS)
Klein, Jon B.; Mcleish, Kenneth R.; Sonnenfeld, Gerald; Dean, William L.
1987-01-01
The ability of interferon-gamma (IFN-gamma) to alter cytoplasmic Ca(2+) content in the monocytelike cell line U937 was investigated, using a slow Ca-channel blocker, diltiazem. In addition, the Ca-ATPase and the Ca-uptake activities were measured in isolated U937 membranes, together with the effect of inositol trisphosphate (IP3) upon the Ca(2+) release from Ca-loaded membranes. The addition of 50 U/ml INF-gamma to U937 cultures was found to increase internal Ca(2+) by about 100 percent within 3 min. The increase was significantly reduced by incubation in Ca-free buffer or by the addition of diltiazem. A crude membrane preparation from U937 cells was found to contain significant amounts of Ca-ATPase activity and to sequester Ca(2+) to a level of 8 nmol/mg in 30 sec; the addition of IP3 induced release of a portion of the sequestered Ca(2+) which was then resequestered. The results suggest that IFN-gamma causes an increase of cytoplasmic Ca(2+), in part, by the IP3-induced release from the internal storage sites and, in part, from the entry of extracellular Ca through slow channels.
Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H
2005-08-22
Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.
Effects of chicken interferon Gamma on Newcastle disease virus vaccine immunogenicity
USDA-ARS?s Scientific Manuscript database
More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFN') during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFN' wit...
Ghiringhelli, Francois; Ménard, Cédric; Martin, Francois; Zitvogel, Laurence
2006-12-01
Tumor immunosurveillance relies on cognate immune effectors [lymphocytes and interferon-gamma (IFN-gamma)] and innate immunity [natural killer (NK) cells, natural killer group 2, member D (NKG2D) ligands, perforin/granzyme, and tumor necrosis factor-related apoptosis-inducing ligand]. In parallel, tumor cells promote the expansion of CD4(+)CD25(+) regulatory T cells (Tregs) that counteract T-cell-based anti-tumor immunity. Moreover, accumulating evidence points to a critical role for Tregs in dampening NK cell immune responses. This review summarizes the findings showing that Tregs suppress NK cell effector functions in vitro and in vivo, i.e. homeostatic proliferation, cytotoxicity, and interleukin-12-mediated IFN-gamma production. The molecular mechanism involve selective expression of membrane-bound transforming growth factor-beta on Tregs, which downregulate NKG2D expression on NK cells in vitro and in vivo. The regulatory events dictating NK cell suppression by Tregs have been studied and are discussed. The pathological relevance of the Treg-NK cell interaction has been brought up in tumor models and in patients with cancer. Consequently, inhibition of Tregs through pharmacological interventions should be considered during NK-cell-based immunotherapy of cancer.
Interferon-gamma (INF-gamma) release test can detect cutaneous adverse effects to statins.
Goldberg, Ilan; Isman, Gila; Shirazi, Idit; Brenner, Sarah
2009-12-01
An increasing number of cutaneous adverse effects are being reported as use of statins becomes more widespread. A study was undertaken to establish the relationship between statin and a cutaneous reaction by the in vitro interferon-gamma (INF-gamma) release test. The lymphocytes of 20 patients with suspected drug-induced skin reaction were incubated with and without the drug. The level of INF-gamma from the supernatant was measured by enzyme-linked immunosorbent assay (ELISA), and the increase calculated. Response was positive in 27 (21.43%) of the 126 drugs. Statin was the only drug with a positive response in 80% of those cases. Nine of 20 patients (45.0%) had complete resolution after discontinuation of the drug; 6 (30.0%) who replaced one drug by another statin had partial or no resolution; and 5 (20.0%) had no resolution despite cessation of statins of all kinds. A positive INF-gamma release test was found in patients who developed skin reactions while taking statins; the test's reliability was strengthened by prompt improvement following elimination of the suspected drug in the majority of patients.
Mueller-Leisse, Johanna; Brueggemann, Sabrina; Bouzani, Maria; Schmitt, Anna-Lena; Einsele, Hermann; Loeffler, Juergen
2015-08-01
Invasive aspergillosis is a devastating infectious disease in immunocompromised patients. Besides neutrophils and macrophages, natural killer (NK) cells have recently emerged as important players in immunity to this infection. It was shown that NK cells comprise an essential role in the clearance of Aspergillus fumigatus (A. fumigatus) in neutropenic but not in nonneutropenic mice. However, the antifungal activity of NK cells and their regulation have not been fully characterized. In this study, we investigated the interplay between polymorphonuclear neutrophils (PMNs) or granulocyte myeloid-derived suppressor cells (Gr-MDSCs) with NK cells. Both cell types exhibited an equal inhibitory effect on NK cell activation through downregulation of NKp30 expression on the cell surface and cytotoxicity towards the cell line K562. Furthermore, we showed that NK cell activation and antifungal cytotoxicity were impaired when NK cells had been cultured in the presence of PMNs or Gr-MDSCs before fungal stimulation. Besides the reduced cytotoxicity a decreased release of interferon gamma (IFNγ), a key player in the clearance of an A. fumigatus infection, was observed. Thus, inhibition of NK cell activity by PMNs or Gr-MDSCs might impair an effective anti-fungal immune response during recovery from conditions such as hematopoietic stem cell transplantation. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Silva, J S; Vespa, G N; Cardoso, M A; Aliberti, J C; Cunha, F Q
1995-01-01
Cell invasion by Trypanosoma cruzi and its intracellular replication are essential for continuation of the parasite life cycle and for production of Chagas' disease. T. cruzi is able to replicate in nucleated cells and can be killed by activated macrophages. Gamma interferon (IFN-gamma) is one of the major stimuli for the activation of macrophages and has been shown to be a key activation factor for the killing of intracellular parasites through a mechanism dependent upon nitric oxide (NO) biosynthesis. We show that although the addition of exogenous tumor necrosis factor alpha (TNF-alpha) does not potentiate the trypanocidal activity of IFN-gamma in vitro, treatment of resistant C57BI/6 mice with an anti-TNF-alpha monoclonal antibody increased parasitemia and mortality. In addition, the anti-TNF-alpha-treated animals had decreased NO production, both in vivo and in vitro, suggesting an important role for TNF-alpha in controlling infection. In order to better understand the role of TNF-alpha in the macrophage-mediating killing of parasites, cultures of T. cruzi-infected macrophages were treated with an anti-TNF-alpha monoclonal antibody. IFN-gamma-activated macrophages failed to kill intracellular parasites following treatment with 100 micrograms of anti-TNF-alpha. In these cultures, the number of parasites released at various time points after infection was significantly increased while NO production was significantly reduced. We conclude that IFN-gamma-activated macrophages produce TNF-alpha after infection by T. cruzi and suggest that this cytokine plays a role in amplifying NO production and parasite killing. PMID:7591147
Conry, Sara J; Milkovich, Kimberly A; Yonkers, Nicole L; Rodriguez, Benigno; Bernstein, Helene B; Asaad, Robert; Heinzel, Frederick P; Tary-Lehmann, Magdalena; Lederman, Michael M; Anthony, Donald D
2009-11-01
Human immunodeficiency virus (HIV) and hepatitis C virus (HCV) infections impair plasmacytoid dendritic cell (PDC) and natural killer (NK) cell subset numbers and functions, though little is known about PDC-NK cell interactions during these infections. We evaluated PDC-dependent NK cell killing and gamma interferon (IFN-gamma) and granzyme B production, using peripheral blood mononuclear cell (PBMC)-based and purified cell assays of samples from HCV- and HIV-infected subjects. CpG-enhanced PBMC killing and IFN-gamma and granzyme B activity (dependent on PDC and NK cells) were impaired in viremic HIV infection. In purified PDC-NK cell culture experiments, CpG-enhanced, PDC-dependent NK cell activity was cell contact and IFN-alpha dependent, and this activity was impaired in viremic HIV infection but not in HCV infection. In heterologous PDC-NK cell assays, impaired PDC-NK cell killing activity was largely attributable to an NK cell defect, while impaired PDC-NK cell IFN-gamma-producing activity was attributable to both PDC and NK cell defects. Additionally, the response of NK cells to direct IFN-alpha stimulation was defective in viremic HIV infection, and this defect was not attributable to diminished IFN-alpha receptor expression, though IFN-alpha receptor and NKP30 expression was closely associated with killer activity in viremic HIV infection but not in healthy controls. These data indicate that during uncontrolled HIV infection, PDC-dependent NK cell function is impaired, which is in large part attributable to defective IFN-alpha-induced NK cell activity and not to altered IFN-alpha receptor, NKP30, NKP44, NKP46, or NKG2D expression.
Scorneaux, B; Ouadrhiri, Y; Anzalone, G; Tulkens, P M
1996-01-01
Listeria monocytogenes is a facultative intracellular pathogen which enters cells by endocytosis and reaches phagolysosomes from where it escapes and multiplies in the cytosol of untreated cells. Exposure of macrophages to gamma interferon (IFN-gamma) restricts L. monocytogenes to phagosomes and prevents its intracellular multiplication. We have tested whether IFN-gamma also modulates the susceptibility of L. monocytogenes to antibiotics. We selected drugs from three different classes displaying marked properties concerning their cellular accumulation and subcellular distribution, namely, ampicillin (not accumulated by cells but present in cytosol), azithromycin (largely accumulated by cells but mostly restricted to lysosomes), and sparfloxacin (accumulated to a fair extent but detected only in cytosol). We used a continuous line of myelomonocytic cells (THP-1 macrophages), which display specific surface receptors for IFN-gamma, and examined the activity of these antibiotics against L. monocytogenes Hly+ (virulent variant) and L. monocytogenes Hly- (a nonvirulent variant defective in hemolysin production). Untreated THP-1 and phorbol myristate acetate-differentiated THP-1 were permissive for infection and multiplication of intracellular L. monocytogenes Hly+ (virulent variant). All three antibiotics tested were bactericidal against this Listeria strain when added to an extracellular concentration of 10x their MIC. After preexposure of THP-1 to IFN-gamma, L. monocytogenes Hly+ was still phagocytosed but no longer grew intracellularly. The activity of ampicillin became almost undetectable (antagonistic effect), and that of azithromycin was unchanged (additive effect with that of IFN-gamma), whereas that of sparfloxacin was markedly enhanced (synergy). A similar behavior (lack of bacterial growth, associated with a loss of activity of ampicillin, an enhanced activity of sparfloxacin, and unchanged activity of azithromycin) was observed in cells infected with L
Calès, P; Zarski, J P; Chapplain, J Marc; Bertrais, S; Sturm, N; Michelet, C; Babany, G; Chaigneau, J; Eddine Charaf, M
2012-02-01
We evaluated whether quantitative measurements of liver fibrosis with recently developed diagnostics outperform histological staging in detecting natural or interferon-induced changes. We compared Metavir staging, morphometry (area and fractal dimension) and six blood tests in 157 patients with chronic hepatitis C from two trials testing maintenance interferon for 96 weeks. Paired liver biopsies and blood tests were available for 101 patients, and there was a significant improvement in Metavir activity and a significant increase in blood tests reflecting fibrosis quantity in patients treated with interferon when compared with controls - all per cent changes in histological fibrosis measures were significantly increased in F1 vs F2-4 stages only in the interferon group. For the whole population studied between weeks 0 and 96, there was significant progression only in the area of fibrosis (AOF) (P = 0.026), FibroMeter (P = 0.020) and CirrhoMeter (P = 0.003). With regards to dynamic reproducibility, agreement was good (r(ic) ≥ 0.72) only for Metavir fibrosis score, FibroMeter and CirrhoMeter. The per cent change in AOF was significantly higher than that of fractal dimension (P = 0.003) or Metavir fibrosis score (P = 0.015). CirrhoMeter was the only blood test with a change significantly higher than that of AOF (P = 0.039). AOF and two blood tests, reflecting fibrosis quantity, have high sensitivity and/or reproducibility permitting the detection of a small progression in liver fibrosis over two years. A blood test reflecting fibrosis quantity is more sensitive and reproducible than morphometry. The study also shows that maintenance interferon does not improve fibrosis, whatever its stage. © 2011 Blackwell Publishing Ltd.
Chang, Heng-Kwei
2015-01-01
Retinoic acid (RA), an active metabolite converted from vitamin A, plays an active role in immune function, such as defending against infections and immune regulation. Although RA affects various types of immune cells, including antigen-presenting cells, B lymphocytes, and T lymphocytes, whether it affects natural killer T (NKT) cells remain unknown. In this study, we found that RA decreased interferon (IFN)-γ production by activated NKT cells through T-cell receptor (TCR) and CD28. We also found that RA reduced extracellular signal-regulated kinase (ERK) phosphorylation, but increased phosphatase 2A (PP2A) activity in TCR/CD28-stimulated NKT cells. The increased PP2A activity, at least partly, contributed to the reduction of ERK phosphorylation. Since inhibition of ERK activation decreases IFN-γ production by TCR/CD28-stimulated NKT cells, RA may downregulate IFN-γ production by TCR/CD28-stimulated NKT cells through the PP2A-ERK pathway. Our results demonstrated a novel function of RA in modulating the IFN-γ expression by activated NKT cells. PMID:25343668
Activation of natural killer cells by hepatitis C virus particles in vitro
Farag, M M S; Weigand, K; Encke, J; Momburg, F
2011-01-01
Little is known about the ability of hepatitis C virus (HCV) to alter early innate immune responses in infected patients. Previous studies have shown that natural killer (NK) cells are functionally impaired after interaction of recombinant HCV glycoprotein E2 with the co-stimulatory CD81 molecule in vitro; however, the functional consequences of a prolonged contact of NK cells with HCV particles have remained unclear. We have examined the phenotypes of purified, interleukin-2-activated NK cells from healthy donors and HCV genotype 1b patients after culture for 5 days with HCV pseudoparticles (HCVpp) and serum samples containing HCV genotype 1b. NK cells from healthy donors and chronic HCV patients were found to up-regulate receptors associated with activation (NKp46, NKp44, NKp30, NKG2D), while NK receptors from the killer cell immunoglobulin-like receptor family (KIR/CD158), predominantly having an inhibitory function, were significantly down-modulated after culture in the presence of HCV particles compared with control cultures of NK cells. HCV-infected sera and HCVpp elicited significantly higher secretion of the NK effector lymphokines interferon-γ and tumour necrosis factor-α. Furthermore, HCV stimulated the cytotoxic potential of NK cells from normal donors and patients. The enhanced activation of NK cells after prolonged culture with HCVpp or HCV-containing sera for 5 days suggests that these innate effector cells may play an important role in viral control during early phases of HCV infection. PMID:21682720
Santin, Miguel; García-García, José-María; Rigau, David; Altet, Neus; Anibarro, Luis; Casas, Irma; Díez, Nuria; García-Gasalla, Mercedes; Martínez-Lacasa, Xavier; Penas, Antón; Pérez-Escolano, Elvira; Sánchez, Francisca; Domínguez, José
2016-09-01
Interferon-gamma release assays are widely used for the diagnosis of tuberculosis infection in Spain. However, there is no consensus on their application in specific clinical scenarios. To develop a guide-line for their use, a panel of experts comprising specialists in infectious diseases, respiratory diseases, microbiology, pediatrics and preventive medicine, together with a methodologist, conducted a systematic literature search, summarized the findings, rated the quality of the evidence, and formulated recommendations following the Grading of Recommendations of Assessment Development and Evaluations methodology. This document provides evidence-based guidance on the use of interferon-gamma release assays for the diagnosis of tuberculosis infection in patients at risk of tuberculosis or suspected of having active disease. The guidelines will be applicable to specialist and primary care, and public health. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.
Hunsicker, A; Kullich, W; Weissenhofer, W; Lorenz, D; Petermann, J; Rokos, H; Schwesinger, G
1997-05-01
To establish a standardised reproducible animal model of intraperitoneal sepsis, and to investigate early immunoserological responses to find a mediator-based system for evaluation and grading of diffuse peritonitis in patients Prospective experimental study 4 Teaching hospitals, Germany and Austria 42 LEW. 1W rats, 12 of which acted as controls Gram negative sepsis was induced by intraperitoneal injection of 6 ml of a mixture of Escherichia coli (K1:H+) 10(10) organisms/ml, autogenous haemoglobin 2.9 ml (haemoglobin concentration 3%), 0.9% sodium chloride 3 ml, and suspension 0.1 ml. Control rats were given physiological saline 6 ml alone. Concentrations of endotoxin, interferon gamma (IFN-gamma), and biopterin, and serum phospholipase A2 (PLA2) activity. There were significant differences between the septic and control rats in concentrations of endotoxin (EU/ml) (median (interquartile range) 21.85 (2.02-159.5) compared with 0, p < 0.0001; IFN-gamma (pg/ml) 1263.0 (271.0-7575.0) compared with 101.0 (89.0-141.0), p < 0.0001; biopterin (nmol/L) 111.0 (66.4-156.3) compared with 53.7 (38.3-67.6), p < 0.001; and PLA2 (U/L) 163.0 (125.8-209.0) compared with 112.5 (88.5-126.5) p < 0.01. Measurements of concentrations of endotoxin, IFN-gamma, pteridines, and PLA2 activity may well be adequate markers for early recognition of sepsis, and perhaps for grading it during the first 6 hours after induction. The allow a clear distinction to be made between septic and non-septic disorders in 87% of cases.
Tálas, M; Bátkai, L; Stöger, I; Nagy, K; Hiros, L; Konstantinova, I; Kozharinov, V
1983-01-01
The influence of spaceflight conditions on the biological activity of HuIFN-alpha preparations (lyophilized, in solution and in ointment) and interferon inducers was studied. In antiviral activity no difference was observed between the samples kept aboard the spaceship and the controls kept under ground conditions. The interferon inducers poly I:C, poly G:C and gossipol placed in the space laboratory for 7 days maintained their interferon-inducing capacity. The circulating interferon level in mice was the same irrespective of the induction being performed with flight or ground-control samples of inducers.
USDA-ARS?s Scientific Manuscript database
Currently the Bovigam assay is used as an official supplemental test within the bovine tuberculosis eradication program. This assay measures interferon-gamma (IFN-gamma) produced by lymphocytes in response to specific antigens. The objectives of the present study were to evaluate two Mycobacterium ...
[Interleukin 8 and interferon gamma in ocular toxoplasmosis].
Czepiel, Jacek; Biesiada, Grazyna; Sobczyk-Krupiarz, Iwona; Miklasszewska, Grazyna; Fedak, Danuta; Solnica, Bogdan; Mach, Tomasz; Garlicki, Aleksander
2011-01-01
Toxoplasmosis is one of the most common parasitic infections in the world, it is caused by Toxoplasma gondii. The infection is typically asymptomatic or the symptoms are very mild. Approximately 10% patients have limphadenopathy, involvement of the others organs, like eyes, nervous system, liver, heart, are observed more rarely. The aim of our study was to assess the level of selected cytokines in blood among patients with ocular toxoplasmosis. We have enrolled in the study 30 patients, 19-42 years old, treated for ocular toxoplasmosis, and 20 healthy volunteers, 20-48 years old, to the control group. Tests for blood morphology, C-reactive protein, the level of IL-8 and IFN-gamma were performed in all patients. The blood parameters in toxoplasmosis group were performed before antiparasitic treatment was given. The level of IFN-gamma in blood was lower among patients with ocular toxoplasmosis comparing with control group (1.52 vs. 4.18 pg/ml; p = 0.002). The level of IL-8 in blood was lower among patients with ocular toxoplasmosis comparing with control group (22.96 vs. 94.3 pg/ml; p = 0,007). There were no correlations between analyzed cytokines and blood morphology or CRP. The low level of IFN-gamma and IL-8 in blood is important factor leading to reactivation of the ocular toxoplasmosis.
Interferon-Gamma Promotes UV-Induced Melanoma in Mice | Center for Cancer Research
Scientists have made an unanticipated discovery in mice that interferon-gamma, a type of protein primarily used by the immune system for intercellular communication, acts as a promoter for the deadly form of skin cancer known as melanoma. This finding resulted from a series of experiments designed to understand how solar ultraviolet (UV) radiation causes melanoma. This study
Kim, Minjoo; Kim, Minkyung; Yoo, Hye Jin; Lee, Jong Ho
2017-01-01
The purpose of this study was to determine whether the immune system is involved in the different metabolic circumstances in healthy and unhealthy overweight individuals. We examined the metabolic and immune characteristics of 117 overweight individuals. Subjects were classified as metabolically healthy overweight (MHO, n = 72) or metabolically unhealthy overweight (MUO, n = 45). The immune response was measured by circulating levels of natural killer (NK) cell activity and cytokines. Both groups were comparable with regards to age, sex distribution, smoking and drinking status, and body mass index. When compared to the MHO group, the MUO group showed higher systolic and diastolic blood pressure, serum levels of triglyceride, glucose, glucose-related markers, and lower levels of HDL cholesterol. Compared to the MHO group, the MUO group showed 39% lower interferon-γ levels (not significant) and 41% lower interleukin (IL)-12 levels (significant). The MUO group also showed lower NK cell activity at E:T ratios of 10:1, 5:1, 2.5:1, and 1.25:1 (all Ps < 0.05) than the MHO group. This study indicates that individuals displaying the MUO phenotype present an unfavorable immune system with lower NK cell activities under all assay conditions and lower serum levels of IL-12 than the activities and levels in similarly overweight MHO individuals. This result suggests that the immune system may be altered in overweight individuals who are at risk for overweight/obesity-related comorbidities. PMID:29238351
Law, Becker M P; Wilkinson, Ray; Wang, Xiangju; Kildey, Katrina; Lindner, Mae; Rist, Melissa J; Beagley, Kenneth; Healy, Helen; Kassianos, Andrew J
2017-07-01
Natural killer (NK) cells are a population of lymphoid cells that play a significant role in mediating innate immune responses. Studies in mice suggest a pathological role for NK cells in models of kidney disease. In this study, we characterized the NK cell subsets present in native kidneys of patients with tubulointerstitial fibrosis, the pathological hallmark of chronic kidney disease. Significantly higher numbers of total NK cells (CD3 - CD56 + ) were detected in renal biopsies with tubulointerstitial fibrosis compared with diseased biopsies without fibrosis and healthy kidney tissue using multi-color flow cytometry. At a subset level, both the CD56 dim NK cell subset and particularly the CD56 bright NK cell subset were elevated in fibrotic kidney tissue. However, only CD56 bright NK cells significantly correlated with the loss of kidney function. Expression of the tissue-retention and -activation molecule CD69 on CD56 bright NK cells was significantly increased in fibrotic biopsy specimens compared with non-fibrotic kidney tissue, indicative of a pathogenic phenotype. Further flow cytometric phenotyping revealed selective co-expression of activating receptor CD335 (NKp46) and differentiation marker CD117 (c-kit) on CD56 bright NK cells. Multi-color immunofluorescent staining of fibrotic kidney tissue localized the accumulation of NK cells within the tubulointerstitium, with CD56 bright NK cells (NKp46 + CD117 + ) identified as the source of pro-inflammatory cytokine interferon-γ within the NK cell compartment. Thus, activated interferon-γ-producing CD56 bright NK cells are positioned to play a key role in the fibrotic process and progression to chronic kidney disease. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.
Kim, Eun-Ha; Choi, Young-Ki; Kim, Chul-Joong; Sung, Moon-Hee; Poo, Haryoung
2015-10-06
The global outbreak of a novel swine-origin strain of the 2009 H1N1 influenza A virus and the sudden, worldwide increase in oseltamivir-resistant H1N1 influenza A viruses highlight the urgent need for novel antiviral therapy. Here, we investigated the antiviral efficacy of poly-gamma glutamate (γ-PGA), a safe and edible biomaterial that is naturally synthesized by Bacillus subtilis, against A/Puerto Rico/8/1934 (PR8) and A/California/04/2009 (CA04) H1N1 influenza A virus infections in C57BL/6 mice. Intranasal administration of γ-PGA for 5 days post-infection improved survival, increased production of antiviral cytokines including interferon-beta (IFN-β) and interleukin-12 (IL-12), and enhanced activation of natural killer (NK) cells and influenza antigen-specific cytotoxic T lymphocytes (CTL) activity. These results suggest that γ-PGA protects mice against H1N1 influenza A virus by enhancing antiviral immune responses.
Activation of natural killer cells by hepatitis C virus particles in vitro.
Farag, M M S; Weigand, K; Encke, J; Momburg, F
2011-09-01
Little is known about the ability of hepatitis C virus (HCV) to alter early innate immune responses in infected patients. Previous studies have shown that natural killer (NK) cells are functionally impaired after interaction of recombinant HCV glycoprotein E2 with the co-stimulatory CD81 molecule in vitro; however, the functional consequences of a prolonged contact of NK cells with HCV particles have remained unclear. We have examined the phenotypes of purified, interleukin-2-activated NK cells from healthy donors and HCV genotype 1b patients after culture for 5 days with HCV pseudoparticles (HCVpp) and serum samples containing HCV genotype 1b. NK cells from healthy donors and chronic HCV patients were found to up-regulate receptors associated with activation (NKp46, NKp44, NKp30, NKG2D), while NK receptors from the killer cell immunoglobulin-like receptor family (KIR/CD158), predominantly having an inhibitory function, were significantly down-modulated after culture in the presence of HCV particles compared with control cultures of NK cells. HCV-infected sera and HCVpp elicited significantly higher secretion of the NK effector lymphokines interferon-γ and tumour necrosis factor-α. Furthermore, HCV stimulated the cytotoxic potential of NK cells from normal donors and patients. The enhanced activation of NK cells after prolonged culture with HCVpp or HCV-containing sera for 5 days suggests that these innate effector cells may play an important role in viral control during early phases of HCV infection. © 2011 The Authors. Clinical and Experimental Immunology © 2011 British Society for Immunology.
Yan, Wenwen; Zhou, Lin; Wen, Siwan; Duan, Qianglin; Huang, Feifei; Tang, Yu; Liu, Xiaohong; Chai, Yongyan; Wang, Lemin
2015-01-01
To evaluate the activity of natural killer cells through their inhibitory and activating receptors and quantity in peripheral blood mononuclear cells extracted from patients with acute myocardial infarction, stable angina pectoris and the controls. 100 patients with myocardial infarction, 100 with stable angina, and 20 healthy volunteers were recruited into the study. 20 randomly chosen people per group were examined for the whole human genome microarray analysis to detect the gene expressions of all 40 inhibitory and activating natural killer cell receptors. Flow cytometry analysis was applied to all 200 patients to measure the quantity of natural killer cells. In myocardial infarction group, the mRNA expressions of six inhibitory receptors KIR2DL2, KIR3DL3, CD94, NKG2A, KLRB1, KLRG1, and eight activating receptors KIR2DS3, KIR2DS5, NKp30, NTB-A, CRACC, CD2, CD7 and CD96 were significantly down-regulated (P<0.05) compared with both angina patients and the controls. There was no statistical difference in receptor expressions between angina patients and control group. The quantity of natural killer cells was significantly decreased in both infarction and angina patients compared with normal range (P<0.001). The significant mRNAs down-regulation of several receptors in myocardial infarction group and reduction in the quantity of natural killer cells in both myocardial infarction and angina patients showed a quantitative loss and dysfunction of natural killer cells in myocardial infarction patients.
Cannon, Grant W; Pincus, Seth H; Emkey, Ronald D; Denes, Alex; Cohen, Selwyn A; Wolfe, Frederick; Saway, P Anthony; Jaffer, Adrian M; Weaver, Arthur L; Cogen, Lewis; Schindler, John D
2008-02-01
One hundred five patients were enrolled in a 12-week, randomized, prospective, double-blind, placebo-controlled trial of recombinant human gamma-interferon (rHu gamma-IFN) for the treatment of rheumatoid arthritis. Fifty-four patients received rHu gamma-IFN and 51 received placebo. Forty-two patients in each group completed the 12-week trial. Some clinical improvement occurred in both groups of patients. Although the improvement with rHu gamma-IFN was greater than that with placebo, the differences were generally not statistically significant.
NASA Technical Reports Server (NTRS)
Lah, T. T.; Hawley, M.; Rock, K. L.; Goldberg, A. L.
1995-01-01
Previous studies have indicated that acid-optimal cysteine proteinase(s) in the endosomal-lysosomal compartments, cathepsins, play a critical role in the proteolytic processing of endocytosed proteins to generate the antigenic peptides presented to the immune system on major histocompatibility complex (MHC) class II molecules. The presentation of these peptides and the expression of MHC class II molecules by macrophages and lymphocytes are stimulated by gamma-interferon (gamma-IFN). We found that treatment of human U-937 monocytes with gamma-IFN increased the activities and the content of the two major lysosomal cysteine proteinases, cathepsins B and L. Assays of protease activity, enzyme-linked immunosorbant assays (ELISA) and immunoblotting showed that this cytokine increased the amount of cathepsin B 5-fold and cathepsin L 3-fold in the lysosomal fraction. By contrast, the aspartic proteinase, cathepsin D, in this fraction was not significantly altered by gamma-IFN treatment. An induction of cathepsins B and L was also observed in mouse macrophages, but not in HeLa cells. These results suggest coordinate regulation in monocytes of the expression of cathepsins B and L and MHC class II molecules. Presumably, this induction of cysteine proteases contributes to the enhancement of antigen presentation by gamma-IFN.
Natural Killer Cells Control Tumor Growth by Sensing a Growth Factor.
Barrow, Alexander D; Edeling, Melissa A; Trifonov, Vladimir; Luo, Jingqin; Goyal, Piyush; Bohl, Benjamin; Bando, Jennifer K; Kim, Albert H; Walker, John; Andahazy, Mary; Bugatti, Mattia; Melocchi, Laura; Vermi, William; Fremont, Daved H; Cox, Sarah; Cella, Marina; Schmedt, Christian; Colonna, Marco
2018-01-25
Many tumors produce platelet-derived growth factor (PDGF)-DD, which promotes cellular proliferation, epithelial-mesenchymal transition, stromal reaction, and angiogenesis through autocrine and paracrine PDGFRβ signaling. By screening a secretome library, we found that the human immunoreceptor NKp44, encoded by NCR2 and expressed on natural killer (NK) cells and innate lymphoid cells, recognizes PDGF-DD. PDGF-DD engagement of NKp44 triggered NK cell secretion of interferon gamma (IFN)-γ and tumor necrosis factor alpha (TNF-α) that induced tumor cell growth arrest. A distinctive transcriptional signature of PDGF-DD-induced cytokines and the downregulation of tumor cell-cycle genes correlated with NCR2 expression and greater survival in glioblastoma. NKp44 expression in mouse NK cells controlled the dissemination of tumors expressing PDGF-DD more effectively than control mice, an effect enhanced by blockade of the inhibitory receptor CD96 or CpG-oligonucleotide treatment. Thus, while cancer cell production of PDGF-DD supports tumor growth and stromal reaction, it concomitantly activates innate immune responses to tumor expansion. Copyright © 2017 Elsevier Inc. All rights reserved.
Jung, Yoon Suk; Park, Jung Ho; Park, Dong Il; Sohn, Chong Il; Lee, Jae Myun; Kim, Tae Il
2018-06-01
Several studies have reported relationships among physical activity, healthy metabolic status, and increased natural killer (NK) cell activity. However, large-scale data thereon are lacking. Thus, the present study aimed to assess NK cell activity according to physical activity and metabolic status. A cross-sectional study was performed on 12014 asymptomatic examinees. Using a patented stimulatory cytokine, NK cell activity was quantitated by the amount of interferon-γ secreted into the plasma by NK cells. Physical activity levels were assessed using the validated Korean version of the International Physical Activity Questionnaire Short Form. The physically inactive group showed lower NK cell activity than the minimally active group (median, 1461 vs. 1592 pg/mL, p<0.001) and health-enhancing physically active group (median, 1461 vs. 1712 pg/mL, p=0.001). Compared to women with a body mass index (BMI) of 18.5-27.5 kg/m², those with a BMI <18.5 kg/m² had significantly lower NK cell activity (1356 vs. 1024 g/mL, p<0.001), and those with a BMI ≥27.5 kg/m² tended to have lower NK cell activity (1356 vs. 1119 g/mL, p=0.070). Subjects with high hemoglobin A1c levels and low high-density lipoprotein cholesterol levels, as well as men with high blood pressure and women with high triglyceride levels, exhibited lower NK cell activity. Moreover, physical inactivity and metabolic abnormalities were independently associated with low NK cell activity, even after adjusting for confounders. Physical inactivity and metabolic abnormalities are associated with reduced NK cell activity. Immune systems may become altered depending on physical activity and metabolic status. © Copyright: Yonsei University College of Medicine 2018.
Berger, Michael; Ablasser, Andrea; Kim, Sarah; Bekeredjian-Ding, Isabelle; Giese, Thomas; Endres, Stefan; Hornung, Veit; Hartmann, Gunther
2009-04-01
Immunostimulatory RNA (isRNA) depending on sequence and structure can function as a ligand for Toll-like receptor (TLR) 7 and TLR8. Here we show that isRNA induces high levels of bioactive interleukin-12 in purified human monocytes, whereas purified natural killer (NK) cells did not respond. However, in a coculture of monocytes and NK cells, isRNA dramatically increased NK cell function. Activation of monocytes and NK cells was bidirectional, as monocytes in the presence of NK cells produced higher levels of bioactive interleukin-12. As a result of the monocyte-NK cell interaction in peripheral blood mononuclear cells isRNA induced high levels of interferon (IFN)-gamma in NK cells and strong NK cell-mediated cytotoxic activity. Induction of simultaneous IFN-gamma production and lytic activity by isRNA in NK cells was higher as compared with other established nucleic acid or small molecule TLR ligands. Our studies demonstrate that monocytes play a pivotal role in the orchestration of a strong NK cell response. With early NK cell-dependent IFN-gamma production being critical for the development of antigen-specific cytotoxic T lymphocyte responses, newly developed isRNA-based TLR8 ligands join the list of promising oligonucleotides for immunotherapy of viral infection and cancer.
Controlling nuclear JAKs and STATs for specific gene activation by IFN{gamma}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea
2011-07-08
Highlights: {yields} Gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interact with the promoter region of IFN{gamma}-associated genes along with transcription factor STAT1{alpha}. {yields} We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. {yields} The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFN{gamma}) and its receptor subunit, IFNGR1, interacted with the promoter region of IFN{gamma}-activated genes along with transcription factor STAT1{alpha}. Recent studies have suggested that activated Janus kinases pJAK2 andmore » pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFN{gamma}. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFN{gamma} treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The {beta}-actin gene, which is not activated by IFN{gamma}, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFN{gamma} treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFN{gamma} treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFN{gamma
Bellanger, Anne-Pauline; Mougey, Valentine; Pallandre, Jean-Rene; Gbaguidi-Haore, Houssein; Godet, Yann; Millon, Laurence
2017-08-25
Alveolar echinococcosis is a severe chronic helminthic disease that mimics slow-growing liver cancer. The immune evasion strategy of Echinococcus multilocularis Leuckart, 1863 remains poorly understood. The aim of this study was to investigate in vitro the impact of E. multilocularis vesicular fluid (Em-VF) on peripheral blood mononuclear cells (PBMC) and on natural killer (NK) cells. PBMC and NK cells were exposed to Em-VF (1 µg/ml) during six days. The effect of Em-VF was assessed on CD69, viability and proliferation, and on and transforming growth factor β (TGF-β), interferon γ (IFN-γ), interleukin 17 (IL-17) and interleukin 10, using flow cytometry and ELISA, respectively. Exposure to Em-VF had no bearing on PBMC's viability, proliferation and expression of CD69. In contrast, higher levels of IL-17 at day three and of TGF-β at day six were observed in PBMC supernatant after exposure to Em-VF (p < 0.05, Wilcoxon signed-rank test). Exposure to Em-VF induced a significant decrease of CD69 expression of NK cells at day three and a significant decrease of proliferation of NK cells at day six (p < 0.05, Wilcoxon signed-rank test). In contrast, NK cells viability and levels of cytokines did not vary significantly over Em-VF stimulation. Exposure to Em-VF had a significant bearing on activation and proliferation of NK cells. NK cells may play an important role in the immune response of the host against E. multilocularis.
Monocyte-Derived Signals Activate Human Natural Killer Cells in Response to Leishmania Parasites
Messlinger, Helena; Sebald, Heidi; Heger, Lukas; Dudziak, Diana; Bogdan, Christian; Schleicher, Ulrike
2018-01-01
Activated natural killer (NK) cells release interferon (IFN)-γ, which is crucial for the control of intracellular pathogens such as Leishmania. In contrast to experimental murine leishmaniasis, the human NK cell response to Leishmania is still poorly characterized. Here, we investigated the interaction of human blood NK cells with promastigotes of different Leishmania species (Leishmania major, Leishmania mexicana, Leishmania infantum, and Leishmania donovani). When peripheral blood mononuclear cells or purified NK cells and monocytes (all derived from healthy blood donors from Germany without a history of leishmaniasis) were exposed to promastigotes, NK cells showed increased surface expression of the activation marker CD69. The extent of this effect varied depending on the Leishmania species; differences between dermotropic and viscerotropic L. infantum strains were not observed. Upregulation of CD69 required direct contact between monocytes and Leishmania and was partly inhibitable by anti-interleukin (IL)-18. Unexpectedly, IL-18 was undetectable in most of the supernatants (SNs) of monocyte/parasite cocultures. Confocal fluorescence microscopy of non-permeabilized cells revealed that Leishmania-infected monocytes trans-presented IL-18 to NK cells. Native, but not heat-treated SNs of monocyte/Leishmania cocultures also induced CD69 on NK cells, indicating the involvement of a soluble heat-labile factor other than IL-18. A role for the NK cell-activating cytokines IL-1β, IL-2, IL-12, IL-15, IL-21, and IFN-α/β was excluded. The increase of CD69 was not paralleled by NK cell IFN-γ production or enhanced cytotoxicity. However, prior exposure of NK cells to Leishmania parasites synergistically increased their IFN-γ release in response to IL-12, which was dependent on endogenous IL-18. CD1c+ dendritic cells were identified as possible source of Leishmania-induced IL-12. Finally, we observed that direct contact between Leishmania and NK cells reduced the
Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.
2001-01-01
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339
Gamma Interferon Release Assays for Detection of Mycobacterium tuberculosis Infection
Denkinger, Claudia M.; Kik, Sandra V.; Rangaka, Molebogeng X.; Zwerling, Alice; Oxlade, Olivia; Metcalfe, John Z.; Cattamanchi, Adithya; Dowdy, David W.; Dheda, Keertan; Banaei, Niaz
2014-01-01
SUMMARY Identification and treatment of latent tuberculosis infection (LTBI) can substantially reduce the risk of developing active disease. However, there is no diagnostic gold standard for LTBI. Two tests are available for identification of LTBI: the tuberculin skin test (TST) and the gamma interferon (IFN-γ) release assay (IGRA). Evidence suggests that both TST and IGRA are acceptable but imperfect tests. They represent indirect markers of Mycobacterium tuberculosis exposure and indicate a cellular immune response to M. tuberculosis. Neither test can accurately differentiate between LTBI and active TB, distinguish reactivation from reinfection, or resolve the various stages within the spectrum of M. tuberculosis infection. Both TST and IGRA have reduced sensitivity in immunocompromised patients and have low predictive value for progression to active TB. To maximize the positive predictive value of existing tests, LTBI screening should be reserved for those who are at sufficiently high risk of progressing to disease. Such high-risk individuals may be identifiable by using multivariable risk prediction models that incorporate test results with risk factors and using serial testing to resolve underlying phenotypes. In the longer term, basic research is necessary to identify highly predictive biomarkers. PMID:24396134
Decreased non-MHC-restricted (CD56+) killer cell cytotoxicity after spaceflight
NASA Technical Reports Server (NTRS)
Mehta, S. K.; Kaur, I.; Grimm, E. A.; Smid, C.; Feeback, D. L.; Pierson, D. L.
2001-01-01
Cytotoxic activity of non-major histocompatibility complex-restricted (CD56+) (NMHC) killer cells and cell surface marker expression of peripheral blood mononuclear cells were determined before and after spaceflight. Ten astronauts (9 men, 1 woman) from two space shuttle missions (9- and 10-day duration) participated in the study. Blood samples were collected 10 days before launch, within 3 h after landing, and 3 days after landing. All peripheral blood mononuclear cell preparations were cryopreserved and analyzed simultaneously in a 4-h cytotoxicity (51)Cr release assay using K562 target cells. NMHC killer cell lytic activity was normalized per 1,000 CD56+ cells. When all 10 subjects were considered as one study group, NMHC killer cell numbers did not change significantly during the three sampling periods, but at landing lytic activity had decreased by approximately 40% (P < 0.05) from preflight values. Nine of ten astronauts had decreased lytic activity immediately after flight. NMHC killer cell cytotoxicity of only three astronauts returned toward preflight values by 3 days after landing. Consistent with decreased NMHC killer cell cytotoxicity, urinary cortisol significantly increased after landing compared with preflight levels. Plasma cortisol and ACTH levels at landing were not significantly different from preflight values. No correlation of changes in NMHC killer cell function or hormone levels with factors such as age, gender, mission, or spaceflight experience was found. After landing, expression of the major lymphocyte surface markers (CD3, CD4, CD8, CD14, CD16, CD56), as determined by flow cytometric analysis, did not show any consistent changes from measurements made before flight.
NASA Technical Reports Server (NTRS)
Mazumder, B.; Fox, P. L.
1999-01-01
Ceruloplasmin (Cp) is an acute-phase protein with ferroxidase, amine oxidase, and pro- and antioxidant activities. The primary site of Cp synthesis in human adults is the liver, but it is also synthesized by cells of monocytic origin. We have shown that gamma interferon (IFN-gamma) induces the synthesis of Cp mRNA and protein in monocytic cells. We now report that the induced synthesis of Cp is terminated by a mechanism involving transcript-specific translational repression. Cp protein synthesis in U937 cells ceased after 16 h even in the presence of abundant Cp mRNA. RNA isolated from cells treated with IFN-gamma for 24 h exhibited a high in vitro translation rate, suggesting that the transcript was not defective. Ribosomal association of Cp mRNA was examined by sucrose centrifugation. When Cp synthesis was high, i.e., after 8 h of IFN-gamma treatment, Cp mRNA was primarily associated with polyribosomes. However, after 24 h, when Cp synthesis was low, Cp mRNA was primarily in the nonpolyribosomal fraction. Cytosolic extracts from cells treated with IFN-gamma for 24 h, but not for 8 h, contained a factor which blocked in vitro Cp translation. Inhibitor expression was cell type specific and present in extracts of human cells of myeloid origin, but not in several nonmyeloid cells. The inhibitory factor bound to the 3' untranslated region (3'-UTR) of Cp mRNA, as shown by restoration of in vitro translation by synthetic 3'-UTR added as a "decoy" and detection of a binding complex by RNA gel shift analysis. Deletion mapping of the Cp 3'-UTR indicated an internal 100-nucleotide region of the Cp 3'-UTR that was required for complex formation as well as for silencing of translation. Although transcript-specific translational control is common during development and differentiation and global translational control occurs during responses to cytokines and stress, to our knowledge, this is the first report of translational silencing of a specific transcript following cytokine
Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K
2011-11-01
Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.
Tang, Bone Siu-Fai; Chan, Jasper Fuk-Woo; Chen, Min; Tsang, Owen Tak-Yin; Mok, M. Y.; Lai, Raymond Wai-Man; Lee, Rodney; Que, Tak-Lun; Tse, Herman; Li, Iris Wai-Sum; To, Kelvin Kai-Wang; Cheng, Vincent Chi-Chung; Chan, Eric Yuk-Tat; Zheng, Bojian; Yuen, Kwok-Yung
2010-01-01
Acquired immunodeficiency due to autoantibody against gamma interferon has recently been associated with opportunistic nontuberculous mycobacteriosis, especially among Southeast Asians. We report another 8 cases, all except one apparently immunocompetent hosts who suffered from concomitant or sequential infections by other intracellular pathogens causing penicilliosis, extraintestinal nontyphoidal salmonellosis, and burkholderiosis. The only case with an underlying immunodeficiency syndrome had systemic lupus erythematosus that was quiescent throughout the multiple infective episodes. Eight out of 10 (80.0%) patients with serological evidence of penicilliosis, 5 out of 7 (71.4%) with culture-positive extraintestinal nontyphoidal salmonellosis, 5 out of 28 (17.9%) with serological evidence of melioidosis, and 7 out of 13 (53.8%) with culture-positive nontuberculous mycobacteriosis possessed autoantibody against gamma interferon, whereas only 1 out of 100 patients with systemic lupus erythematosus did. Our study represents the first and largest case series linking this emerging immunodeficiency syndrome with these atypical infections in apparently immunocompetent hosts. Thus, we advocate that any patient with unexplained recurrent or polymicrobial infections due to these intracellular pathogens should be screened for acquired immunodeficiency due to autoantibody against gamma interferon. PMID:20445006
2012-01-01
Background In vitro and animal studies have demonstrated that Chlorella is a potent biological response modifier on immunity. However, there were no direct evidences for the effect of Chlorella supplementation on immune/inflammation response in healthy humans. Methods This study was designed for an 8-week randomized, double-blinded, placebo-controlled trial: 5g of Chlorella (n=23) or Placebo (n=28) as form of tablets. Mainly, cytotoxic activities of Natural killer (NK) cells and serum concentrations of interferon-γ, interleukin-1β and interleukin-12 were measured. Results After the 8-week, serum concentrations of interferon-γ (p<0.05) and interleukin-1β (p<0.001) significantly increased and that of interleukin-12 (p<0.1) tended to increase in the Chlorella group. The increments of these cytokines after the intervention were significantly bigger in the Chlorella group than those in the placebo group. In addition, NK cell activities (%) were significantly increased in Chlorella group, but not in Placebo group. The increments of NK cell activities (%) were also significantly bigger in the Chlorella group than the placebo group. Additionally, changed levels of NK cell activity were positively correlated with those of serum interleukin-1β (r=0.280, p=0.047) and interferon-γ (r=0.271, p<0.005). Signficantly positive correlations were also observed among the changed levels of serum cytokines; between interferon-γ and interleukin-1β (r=0.448, p<0.001), between interleukin-12 and interleukin-1β (r=0.416, p=0.003) and between interleukin-12 and interferon-γ (r=0.570, p<001). Conclusion These results may suggest a beneficial immunostimulatory effect of short-term Chlorella supplementation which enhances the NK cell activity and produces interferon-γ and interleukin-12 as well as interleukin-1β, the Th-1 cell-induced cytokines in healthy people. PMID:22849818
Lactic Acid Bacteria from Kefir Increase Cytotoxicity of Natural Killer Cells to Tumor Cells.
Yamane, Takuya; Sakamoto, Tatsuji; Nakagaki, Takenori; Nakano, Yoshihisa
2018-03-27
The Japanese fermented beverage, homemade kefir, contains six lactic acid bacteria: Lactococcus. lactis subsp. Lactis , Lactococcus . lactis subsp. Cremoris , Lactococcus. Lactis subsp. Lactis biovar diacetylactis , Lactobacillus plantarum , Leuconostoc meseuteroides subsp. Cremoris and Lactobacillus casei . In this study, we found that a mixture of the six lactic acid bacteria from kefir increased the cytotoxicity of human natural killer KHYG-1 cells to human chronic myelogenous leukemia K562 cells and colorectal tumor HCT116 cells. Furthermore, levels of mRNA expression and secretion of IFN-γ (interferon gamma) increased in KHYG-1 cells that had been treated with the six lactic acid bacteria mixture from kefir. The results suggest that the six lactic acid bacteria mixture from kefir has strong effects on natural immunity and tumor cell cytotoxicity.
EFFECT OF GAMMA IRRADIATION AND AET ON RAT BLOOD CHOLINESTERASE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Williams, M.W.; Baker, R.D.; Covill, R.W.
1961-03-01
Whole-body gamma irradiation in the rat produced significant whole-blood cholinesterase depression on the tenth day at a dosage level of 75 r. The levels tested when plotted and extrapolared indicated threshold changes in cholinesterase activity would be in the vicinity of 20 to 30 r. AET alone, while producing some mild cholinesterase depression, failed to protect whole-blood cholinesterase activity from the effects of gamma irradiation at the levels of agent and irradiation tested. (auth)
[Gamma interferon: basics aspects, clinic significance and terapeutic uses].
Mata-Espinosa, Dulce A; Hernández-Pando, Rogelio
2008-01-01
Interferons are a family of pleiotropic cytokines, their name was assigned because of their anti-replicative viral activity. IFNgamma or immune type II interferon does not share receptors with the type I interferon, its structure is different and its gene is located in different chromosome, although its biologic effects are similar. Along of several years of research, it has been found that IFNgamma enhances the transcription of genes involved in immunomodulation, antiviral responses and antitumoral activities. Regarding to the immune system, IFNgamma increases the cytotoxic and phagocytic activity of macrophages and upregulates the expression of major histocompatibility complex (MHC) class I and class II molecules in dendritics cells and other antigen presenting cells. IFNgamma also promotes the development and differentiation of naive CD4+ T lymphocytes to Th1 helper subset. Indeed, this cytokine has a key role in the control of bacterial, micotic, viral and parasitic infections. Depending of the micro-environment, IFNgamma has a dual role as pro or anti inflammatory cytokine. Novel therapeutic strategies are currently being developed with the aim to enhance the immune response or replace IFNgamma gene abnormal expression with beneficial results in humans, being recombinant IFNgamma safe and well tolerated.
Goodfellow, Alfred; Keeling, Douglas N; Hayes, Robert C; Webster, Duncan
2009-01-01
With increasing use of immunosuppressive therapy, including tumor necrosis factor alpha inhibitors, there is concern about infectious complications, including reactivation of latent Mycobacterium tuberculosis infection. Routine testing prior to administration of systemic immunosuppression includes the tuberculin skin test, which lacks sensitivity and specificity and may be difficult to interpret in the presence of extensive cutaneous disease. Treatment of individuals with latent tuberculosis infection is recommended when immunosuppressive medications are to be employed. We report a case in which a diagnosis of latent tuberculosis infection in a patient with extensive bullous pemphigoid was clarified by the use of an interferon-gamma release assay after equivocal tuberculin skin test results. Interferon-gamma release assays are useful adjuncts to the tuberculin skin test in the diagnosis of latent tuberculosis infection in the setting of extensive cutaneous disease.
Deckert-Schlüter, M; Rang, A; Weiner, D; Huang, S; Wiestler, O D; Hof, H; Schlüter, D
1996-12-01
Toxoplasma gondii may cause severe infections in immunocompromised patients including fetuses and those with AIDS. Among the factors mediating protection against T. gondii, IFN-gamma has gained special attention. To analyze the role of IFN-gamma in the early phase of toxoplasmosis, IFN-gamma receptor-deficient (IFN-gamma R0/0) mice were orally infected with low-virulent toxoplasms. IFN-gamma R0/0 mice died of the disease up to day 10 postinfection, whereas immunocompetent wild-type (WT) mice developed a chronic toxoplasmosis. Histopathology revealed that in IFN-gamma R0/0 mice, the parasite multiplied unrestrictedly in the small intestine, the intestinal lymphatic tissue, the liver, and the spleen. Ultimately, animals died of a necrotizing hepatitis. In WT mice, the same organs were effected, but multiplication of the parasite was effectively limited. Compared with WT mice, immunohistochemistry and flow cytometry demonstrated that in IFN-gamma R0/0 mice, macrophages were only marginally activated in response to the infection, as evidenced by a reduced expression of major histocompatability complex class II antigens. In addition, immunohistochemistry and RT-PCR showed a reduced production of the macrophage-derived cytokines tumor necrosis factor-alpha, inducible nitric oxide synthase, and IL-1 beta in the liver of IFN-gamma R0/0 mice. In contrast, activation of T cells, recruitment of immune cells to inflammatory foci, and anti-T. gondii IgM antibody production were unaffected by the mutation of the IFN-gamma R. Moreover, induction of IL-2, IL-4, and IL-10 mRNA transcripts in the liver was normal in IFN-gamma R0/0 mice. Adoptive transfer experiments revealed that the immune T cells of WT animals did not protect IFN-gamma R0/0 mice from lethal infection with highly virulent toxoplasms, whereas WT mice were significantly protected by the adoptive transfer. Based on these studies, we conclude that IFN-gamma is absolutely required for an efficient activation of
Diversity and killer activity of yeasts in Malaysian fermented food samples.
Lim, S L; Tay, S T
2011-08-01
The biodiversity and the killer activity of yeasts isolated from various types of fermented food in Malaysia were investigated in this study. Of 252 yeasts isolated from 48 fermented food samples in this study, 19 yeast species were identified based on sequence analysis of the ITS1-5.8S-ITS2 partial fragments of the yeasts. A total of 29 (11.5%) of the yeast isolates demonstrated killer activity to at least one Candida species tested in this study; including 22 isolates of Trichosporon asahii, 4 isolates of Pichia anomala, and one isolate each of Pichia norvegensis, Pichia fermentans and Issatchenkia orientalis, respectively. The presence of killer yeasts reflects antagonism that occurs during microbial interaction in the fermented food, whereby certain yeasts produce killer toxins and possibly other toxic substances in competition for limited nutrients and space. The anti-Candida activity demonstrated by killer yeasts in this study should be further explored for development of alternative therapy against candidiasis.
Development of an aptamer beacon for detection of interferon-gamma.
Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander
2010-03-01
Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.
Effect of gamma interferon on lung function of mustard gas exposed patients, after 15 years.
Ghanei, Mostafa; Panahi, Yoones; Mojtahedzadeh, Mojtaba; Khalili, Ali Reza Hosseini; Aslani, Jafar
2006-01-01
Bronchiolitis has been known to be among the main the pathological features of lung lesions in Mustard Gas (MG) exposed patients. The purpose of this research was to evaluate the efficacy of interferon gamma-1b on the lung function in MG exposed patients with bronchiolitis. Thirty-six bronchiolitis patients, whose lung lesion had been diagnosed through High Resolution Computerized Tomography (HRCT) of the chest and also pathological study, were divided into two 18-member case and control groups. Both groups were receiving their conventional treatment (inhaled Felixotide and Servent). The case group were treated for 6 months with a combination of 200 microg of interferon gamma-1b (given three times per week subcutaneously) plus 7.5 mg of prednisolone (given once a day), while the control group received their previous conventional medications. Lung function was measured at base line and after 1, 3 and 6 months of treatment. In case and control groups, Forced Expiratory Volume in first second (FEV1) did not have statistical differences at the base line (49.3 +/- 2.9 and 48.7 +/- 4.1, respectively = 0.6), whereas a significant increase was seen in the case group (66.3 +/- 5.4) compared control group (57.3 +/- 8.6) at the subsequent months (P = 0.001 for the difference between the groups). Similar pattern of increase was observed in Forced Vital Capacity (FVC). The findings of this study indicate that a 6-month treatment with interferon gamma-1b plus a low-dose prednisolone is associated with an improvement in the lung function in mustard-gas exposed patients with bronchiolitis.
Ohyama, K; Kikuchi, H; Oda, Y; Moritake, K; Yamasaki, T
1993-06-01
We studied the effects of mouse IFN-gamma on the cytotoxic activity of murine activated macrophages (M phi) against mouse VM-Glioma cells (H-2b). Activated M phi were obtained from peritoneal exudate cells of mice from four strains, C57BL/6 (H-2b), C3H/He(H-2k), DBA/2 (H-2d), and BALB/c (H-2d), following intraperitoneal injection of (1) LPS 200 micrograms, (2) BCG 200 micrograms, (3) C. parvum 200 micrograms, or (4) MDP 350 micrograms 7 days prior to 20-hr 51Cr release-assay. Of the various combination of mouse strains and activating agents tested, that of activated M phi of the C3H/He mouse with induction by LPS had the most tumoricidal effect against the glioma cells, which was not MHC restricted. Although LPS-activated M phi underwent marked loss of cytotoxicity following initiation of in vitro culture, this 24 hr pretreatment with IFN-gamma inhibited this reduction in tumoricidal effects in a dose-dependent fashion. On the other hand, 24 hr pretreatment of target cells with IFN-gamma did not increase their susceptibility to lysis by activated M phi. These findings suggest that IFN-gamma augments the in vitro tumoricidal activation of M phi; This effect appears to be unrelated to any influence of IFN-gamma on target sensitivity to lysis by macrophages.
Akahane, Y; Miyazaki, Y; Naitoh, S; Takeda, K; Tsuda, F; Okamoto, H; Itoh, K; Miyakawa, Y; Mayumi, M
1996-02-01
Because of its specific association with hepatitis C virus (HCV) infection, the cold activation of complement is an easy and inexpensive indicator of HCV viremia. It was evaluated for eligibility as a marker of response to interferon in patients with hepatitis C. The cold activation of complement was determined by the loss or decrease of hemolytic activity with the microtitration method in sera that had been stored at 4 degrees C overnight. We observed the loss of hemolytic activity by the cold activation of complement in 236 (72%) and a decrease in 56 (17%) of 327 sera from patients with HCV-associated chronic liver disease, which was much more (p < 0.001) that in 1 (1%) and 13 (14%), respectively, of 49 sera from patients with chronic liver disease associated with hepatitis B virus infection. Interferon-alpha (total dose 516 x 10(6) units) or interferon-alpha 2b (774 x 10(6) units) was given to 67 patients with chronic hepatitis C, of whom 56 had the cold activation of complement. The response to interferon was evaluated by the clearance of serum HCV RNA at 6 months after the completion of therapy. The cold activation of complement disappeared in 18 patients, of whom 15 (86%) responded. It persisted or fluctuated in the remaining 38 patients, only six (16%) of whom responded to interferon (p < 0.001). The cold activation of complement once disappeared at the completion of interferon and then reappeared in patients who relapsed after completing interferon therapy. These results indicate that the cold activation of complement may be associated with the presence of HCV in blood and a lower rate of durable response after completion of interferon therapy.
Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong
2010-01-01
Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.
Buer, J; Hilse, R; Dallmann, I; Grosse, J; Kirchner, H; Zorn, U; Hänninen, E L; Franzke, A; Duensing, S; Poliwoda, H
1995-03-01
In this study, effective antitumour immunity was transferred by autologous short activated killer (SHAK) cells induced over four hours with lymphocyte conditioned medium (LCM) and recombinant interleukin-2 (rIL-2). Among eight patients with progressive metastatic renal cell carcinoma refractory to standard therapy, there were six objective tumour responses to SHAKs. Progression-free survival ranged from 0 to 8+ months, and overall survival ranged from 2 to 14+ months, with a median of 9+ months. Systemic toxicity of SHAKs was limited to flulike symptoms. Patient SHAKs provided a tumour-specific immunity, both cellular and humoral (expression and secretion of secondary cytokines, including IL-2, GM-CSF, INF-gamma and TNF-alpha), far superior to rIL-2 activated killer cells.
Sperber, K; Silverstein, L; Brusco, C; Yoon, C; Mullin, G E; Mayer, L
1995-01-01
Superantigens are potent inducers of T-cell proliferation and induce a broad range of cytokines, including tumor necrosis factor (TNF), gamma interferon, and interleukin 2 (IL-2). In the present study, we compared the abilities of different staphylococcal superantigens (staphylococcal enterotoxin B [SEB], staphylococcal enterotoxin E [SEE], and toxic shock syndrome toxin 1 [TSST-1]) to stimulate distinct cytokine profiles in peripheral blood mononuclear cells (PBMC), lamina propria lymphocytes (LPL), and intraepithelial lymphocytes (IEL). One million PBMC, LPL, and IEL were stimulated with various concentrations of superantigen (10 to 0.001 ng/ml) for 24, 48, and 72 h. Maximum cytokine production by PBMC, LPL, and IEL was observed for all three superantigens at 48 h at a concentration of 1 ng/ml. In PBMC, SEE and TSST-1 stimulated more IL-2 and gamma interferon than SEB. SEE and TSST-1 also stimulated more TNF and IL-4 production than SEB. In contrast, SEB stimulated more IL-6 than either SEE or TSST-1. In LPL, there was no SEE-induced IL-2 or IL-4 production, but IL-6, TNF, and gamma interferon were induced. SEB similarly induced no IL-2 or gamma interferon from the LPL, but IL-4, IL-6, and TNF were detected. TSST-1 stimulation of LPL resulted in IL-2 and TNF production but no IL-4, IL-6, or gamma interferon. In IEL, SEE induced no IL-2, IL-4, or gamma interferon but produced IL-6 and TNF, while SEB stimulation resulted in no IL-2 or gamma interferon but did result in detectable IL-4, IL-6, and TNF. Taken together, these data indicate that there are significant differences in the cytokine profiles induced by superantigens in LPL and IEL compared with those in PBMC, and these differences may relate to differences in activation requirements. PMID:7583927
Melvydas, Vytautas; Bružauskaitė, Ieva; Gedminienė, Genovaitė; Šiekštelė, Rimantas
2016-09-01
It was determined that Kx strains secrete an X factor which can inhibit all known Saccharomyces cerevisiae killer toxins (K1, K2, K28) and some toxins of other yeast species-the phenomenon not yet described in the scientific literature. It was shown that Kx type yeast strains posess a killer phenotype producing small but clear lysis zones not only on the sensitive strain α'1 but also on the lawn of S. cerevisiae K1, K2 and K28 type killer strains at temperatures between 20 and 30 °C. The pH at which killer/antikiller effect of Kx strain reaches its maximum is about 5.0-5.2. The Kx yeast were identified as to belong to S. cerevisiae species. Another newly identified S. cerevisiae killer strain N1 has killer activity but shows no antikilller properties against standard K1, K2 and K28 killer toxins. The genetic basis for Kx killer/antikiller phenotype was associated with the presence of M-dsRNA which is bigger than M-dsRNA of standard S. cerevisiae K1, K2, K28 type killer strains. Killer and antikiller features should be encoded by dsRNA. The phenomenon of antikiller (inhibition) properties was observed against some killer toxins of other yeast species. The molecular weight of newly identified killer toxins which produces Kx type strains might be about 45 kDa.
Morar, D; Tijhaar, E; Negrea, A; Hendriks, J; van Haarlem, D; Godfroid, J; Michel, A L; Rutten, V P M G
2007-01-15
Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-gamma) assay is used as a routine diagnostic tool to determine infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop reagents to set up a rhinoceros IFN-gamma (RhIFN-gamma) assay. The white rhinoceros IFN-gamma gene was cloned, sequenced and expressed as a mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-gamma shares a homology of 90% with equine IFN-gamma. Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant RhIFN-gamma were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that recombinant as well as native white rhinoceros IFN-gamma was recognised. This preliminary IFN-gamma enzyme-linked immunosorbent assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.
ElAlfy, Mohsen Saleh; Adly, Amira Abdel Moneam; Ebeid, Fatma Soliman ElSayed; Eissa, Deena Samir; Ismail, Eman Abdel Rahman; Mohammed, Yasser Hassan; Ahmed, Manar Elsayed; Saad, Aya Sayed
2018-06-20
Sickle cell disease (SCD) is associated with alterations in immune phenotypes. CD4 + CD28 null T lymphocytes have pro-inflammatory functions and are linked to vascular diseases. To assess the percentage of CD4 + CD28 null T lymphocytes, natural killer cells (NK), and IFN-gamma levels, we compared 40 children and adolescents with SCD with 40 healthy controls and evaluated their relation to disease severity and response to therapy. Patients with SCD steady state were studied, focusing on history of frequent vaso-occlusive crisis, hydroxyurea therapy, and IFN-gamma levels. Analysis of CD4 + CD28 null T lymphocytes and NK cells was done by flow cytometry. Liver and cardiac iron overload were assessed. CD4 + CD28 null T lymphocytes, NK cells, and IFN-gamma levels were significantly higher in patients than controls. Patients with history of frequent vaso-occlusive crisis and those with vascular complications had higher percentage of CD4 + CD28 null T lymphocytes and IFN-gamma while levels were significantly lower among hydroxyurea-treated patients. CD4 + CD28 null T lymphocytes were positively correlated to transfusional iron input while these cells and IFN-gamma were negatively correlated to cardiac T2* and duration of hydroxyurea therapy. NK cells were correlated to HbS and indirect bilirubin. Increased expression of CD4 + CD28 null T lymphocytes highlights their role in immune dysfunction and pathophysiology of SCD complications.
Lee, Sung Won; Park, Hyun Jung; Kim, Nayoung; Hong, Seokmann
2013-01-01
Natural killer dendritic cells (NKDCs) possess potent anti-tumor activity, but the cellular effect of NKDC interactions with other innate immune cells is unclear. In this study, we demonstrate that the interaction of NKDCs and natural killer T (NKT) cells is required for the anti-tumor immune responses that are elicited by α -galactosylceramide ( α -GC) in mice. The rapid and strong expression of interferon- γ by NKDCs after α -GC stimulation was dependent on NKT cells. Various NK and DC molecular markers and cytotoxic molecules were up-regulated following α -GC administration. This up-regulation could improve NKDC presentation of tumor antigens and increase cytotoxicity against tumor cells. NKDCs were required for the stimulation of DCs, NK cells, and NKT cells. The strong anti-tumor immune responses elicited by α -GC may be due to the down-regulation of regulatory T cells. Furthermore, the depletion of NKDCs dampened the tumor clearance mediated by α -GC-stimulated NKT cells in vivo. Taken together, these results indicate that complex interactions of innate immune cells might be required to achieve optimal anti-tumor immune responses during the early stages of tumorigenesis.
Bozeman, Ronald; Abel, Erika L; Macias, Everardo; Cheng, Tianyi; Beltran, Linda; DiGiovanni, John
2015-08-01
The current study was designed to explore the role of signal transducer and activator of transcription 1 (Stat1) during tumor promotion using the mouse skin multistage carcinogenesis model. Topical treatment with both 12-O-tetradecanoylphorbol-13-acetate (TPA) and 3-methyl-1,8-dihydroxy-9-anthrone (chrysarobin or CHRY) led to rapid phosphorylation of Stat1 on both tyrosine (Y701) and serine (S727) residues in epidermis. CHRY treatment also led to upregulation of unphosphorylated Stat1 (uStat1) at later time points. CHRY treatment also led to upregulation of interferon regulatory factor 1 (IRF-1) mRNA and protein, which was dependent on Stat1. Further analyses demonstrated that topical treatment with CHRY but not TPA upregulated interferon-gamma (IFNγ) mRNA in the epidermis and that the induction of both IRF-1 and uStat1 was dependent on IFNγ signaling. Stat1 deficient (Stat1(-/-) ) mice were highly resistant to skin tumor promotion by CHRY. In contrast, the tumor response (in terms of both papillomas and squamous cell carcinomas) was similar in Stat1(-/-) mice and wild-type littermates with TPA as the promoter. Maximal induction of both cyclooxygenase-2 and inducible nitric oxide synthase in epidermis following treatment with CHRY was also dependent on the presence of functional Stat1. These studies define a novel mechanism associated with skin tumor promotion by the anthrone class of tumor promoters involving upregulation of IFNγ signaling in the epidermis and downstream signaling through activated (phosphorylated) Stat1, IRF-1 and uStat1. © 2014 Wiley Periodicals, Inc.
NASA Technical Reports Server (NTRS)
Wirth, J. J.; Kierszenbaum, F.; Sonnenfeld, G.; Zlotnik, A.
1985-01-01
Results are reported from a study of the influence gamma interferon (GIFN) and interleukin 2 (IL2) have on the capability of P388D1 cells and mouse resident peritoneal macrophages (MPM) to attach to the blood-resident parasites Trypanosoma cruzi and kill them. Cultures of trypomastigote forms of the Tulahuen strain of T. cruzi grown in bovine serum were introduced into peritoneal cells of mice, along with P388D1 cells incubated with GIFN, IL2 and both. Control cells were also maintained. Statistical analysis were then performed on data on counts of the number of dead T. Cruzi cells. The GIFN enhanced the interaction of MPM and P388D1 cells with the surface of T. Cruzi, provided the interaction was given over 12 hr to take place. A depression of the cytotoxicity of P388D1 cells was attributed to mediation by H2O2, an effect partially offset by incubation with the lymphokine GIFN.
α-Galactosylceramide-activated Vα14 natural killer T cells mediate protection against murine malaria
Gonzalez-Aseguinolaza, Gloria; de Oliveira, Camila; Tomaska, Margaret; Hong, Seokmann; Bruna-Romero, Oscar; Nakayama, Toshinori; Taniguchi, Masaru; Bendelac, Albert; Van Kaer, Luc; Koezuka, Yasuhiko; Tsuji, Moriya
2000-01-01
Natural killer T (NKT) cells are a unique population of lymphocytes that coexpress a semiinvariant T cell and natural killer cell receptors, which are particularly abundant in the liver. To investigate the possible effect of these cells on the development of the liver stages of malaria parasites, a glycolipid, α-galactosylceramide (α-GalCer), known to selectively activate Vα14 NKT cells in the context of CD1d molecules, was administered to sporozoite-inoculated mice. The administration of α-GalCer resulted in rapid, strong antimalaria activity, inhibiting the development of the intrahepatocytic stages of the rodent malaria parasites Plasmodium yoelii and Plasmodium berghei. The antimalaria activity mediated by α-GalCer is stage-specific, since the course of blood-stage-induced infection was not inhibited by administration of this glycolipid. Furthermore, it was determined that IFN-γ is essential for the antimalaria activity mediated by the glycolipid. Taken together, our results provide the clear evidence that NKT cells can mediate protection against an intracellular microbial infection. PMID:10900007
Lactic Acid Bacteria from Kefir Increase Cytotoxicity of Natural Killer Cells to Tumor Cells
Yamane, Takuya; Sakamoto, Tatsuji; Nakagaki, Takenori; Nakano, Yoshihisa
2018-01-01
The Japanese fermented beverage, homemade kefir, contains six lactic acid bacteria: Lactococcus. lactis subsp. Lactis, Lactococcus. lactis subsp. Cremoris, Lactococcus. Lactis subsp. Lactis biovar diacetylactis, Lactobacillus plantarum, Leuconostoc meseuteroides subsp. Cremoris and Lactobacillus casei. In this study, we found that a mixture of the six lactic acid bacteria from kefir increased the cytotoxicity of human natural killer KHYG-1 cells to human chronic myelogenous leukemia K562 cells and colorectal tumor HCT116 cells. Furthermore, levels of mRNA expression and secretion of IFN-γ (interferon gamma) increased in KHYG-1 cells that had been treated with the six lactic acid bacteria mixture from kefir. The results suggest that the six lactic acid bacteria mixture from kefir has strong effects on natural immunity and tumor cell cytotoxicity. PMID:29584690
Clancy, R L; Gleeson, M; Cox, A; Callister, R; Dorrington, M; D'Este, C; Pang, G; Pyne, D; Fricker, P; Henriksson, A
2006-04-01
Fatigue and impaired performance in athletes is well recognised and has been loosely linked to "overtraining". Reduced concentration of IgA in the saliva and increased shedding of Epstein Barr virus (EBV) have been associated with intense training in elite athletes. To determine whether athletes presenting with fatigue and impaired performance had an immune defect relevant to defective containment of EBV infection, and whether a probiotic preparation (Lactobacillus acidophilus) shown to enhance mucosal immunity in animal models could reverse any detected abnormality. The fatigued athletes had clinical characteristics consistent with re-activation of EBV infection and significantly (p = 0.02) less secretion of interferon (IFN) gamma from blood CD4 positive T cells. After one month of daily capsules containing 2 x 10(10) colony forming units of L acidophilus, secretion of IFNgamma from T cells had increased significantly (p = 0.01) to levels found in healthy control athletes. A significant (p = 0.03) increase in salivary IFNgamma concentrations in healthy control athletes after the one month course of L acidophilus demonstrated in man the capacity for this probiotic to enhance the mucosal IFNgamma concentration. This is the first evidence of a T cell defect in fatigued athletes, and of its reversal following probiotic therapy.
Decreased natural killer cell activity in atopic eczema.
Hall, T J; Rycroft, R; Brostoff, J
1985-01-01
We have studied NK cell activity in atopic and non-atopic subjects using a standard 51Cr-release assay and K562 target cells. In atopics (AT) with allergic rhinitis and/or asthma, NK cell activity was similar to that in non-atopic (N) subjects, whilst patients with severe atopic eczema (AE) had depressed NK cell activity compared to AT or N subjects. In addition, circulating T-cell numbers and Con A responsiveness was decreased in AE, although neither parameter was correlated with decreased NK cell activity. However, decreased NK cell activity in atopic eczema was positively correlated with decreased numbers of Fc gamma + lymphocytes (P = 0.01) and decreased effector: target cell binding (P = 0.05), and negatively correlated with increased monocytes in AE (P = 0.09). AE NK cell activity was equally or more sensitive to the inhibitory effects of drugs such as dibutyryl cyclic AMP, prostaglandins (PG) D2,E2 and histamine. The relative percentage increase in NK cell activity by the interferon inducer poly I:C was similar in AE patients and controls. The results suggest that reduced numbers of circulating NK cells and pre-NK cells account for the depressed level of NK cell activity in subjects with severe atopic eczema. PMID:3876984
Shin, K Y; Moon, H S; Park, H Y; Lee, T Y; Woo, Y N; Kim, H J; Lee, S J; Kong, G
2000-10-31
We have investigated the effects of tumor necrosis factor-alpha (TNF-alpha) and interferon (INF-gamma), the potent Bacillus Calmette-Guerin (BCG)-induced cytokines on the production of MMP-2, MMP-9, TIMP-1, TIMP-2 and MT1-MMP in high grade human bladder cancer cell lines, T-24, J-82 and HT-1376 cell lines. MMP-2 expression and activity were decreased in T-24 cells treated with both cytokines in a dose dependent manner. However, J-82 cells treated with TNF-alpha and INF-gamma revealed dose dependent increases of MMP-9 expression and activity with similar baseline expression and activity of MMP-2. HT-1376 cells after exposure to TNF-alpha only enhanced the expression and activity of MMP-9. These results indicate that TNF-alpha and INF-gamma could regulate the production of MMP-2 or MMP-9 on bladder cancer cells and their patterns of regulation are cell specific. Furthermore, this diverse response of bladder cancer cells to TNF-alpha and INF-gamma suggests that BCG immunotherapy may enhance the invasiveness of bladder cancer in certain conditions with induction of MMPs.
Immune responses in humans after 60 days of confinement
NASA Technical Reports Server (NTRS)
Schmitt, D. A.; Peres, C.; Sonnenfeld, G.; Tkackzuk, J.; Arquier, M.; Mauco, G.; Ohayon, E.
1995-01-01
A confinement experiment in a normobaric diving chamber was undertaken to better understand the effect of confinement and isolation on human psychology and physiology. Pre- and postconfinement blood samples were obtained from four test subjects and control donors to analyze immune responses. No modification in the levels of CD2+, CD3+, CD4+, CD8+, CD19+, and CD56+ cells was observed after confinement. Mitogen-induced T-lymphocyte proliferation and interleukin-2 receptor expression were not altered significantly. Whole blood interferon-alpha and gamma-induction and plasma cortisol levels were also unchanged, as was natural killer cell activity. These data suggest that in humans, no specific components of the immune response are affected by a 2-month isolation and confinement of a small group.
de Matos, Cristina Teixeira; Berg, Louise; Michaëlsson, Jakob; Felländer-Tsai, Li; Kärre, Klas; Söderström, Kalle
2007-01-01
Natural killer (NK) cells are activated early during inflammatory events and contribute to the shaping of the ensuing adaptive immune response. To further understand the role for NK cells in inflammation, we investigated the phenotype and function of synovial fluid (SF) NK cells from patients with chronic joint inflammation, as well as from patients with transient inflammation of the knee following trauma. We confirm that synovial NK cells are similar to the well-characterized CD56bright peripheral blood (PB) NK-cell subset present in healthy individuals. However, compared to this PB subset the synovial NK cells express a higher degree of activation markers including CD69 and NKp44, the latter being up-regulated also on CD56bright NK cells in the PB of patients. Activated synovial NK cells produced interferon-γ and tumour necrosis factor, and the production was further up-regulated by antibody masking of CD94/NKG2A, and down-regulated by target cells expressing human leucocyte antigen-E in complex with peptides known to engage CD94/NKG2A. We conclude that synovial NK cells have an activated phenotype and that CD94/NKG2A is a key regulator of synovial NK-cell cytokine synthesis. PMID:17521371
Defective Response of Natural Killer Activity to Thyroxine in Graves’ Disease
Lee, Myung-Shik; Hong, Weon-Seon; Hong, Seong Woon; Lee, Jhin-Oh; Kang, Tae-Woong
1990-01-01
The effect of thyroxine (T4) on natural killer (NK) activity of peripheral blood lymphocytes (PBL) was investigated, using a 4-hr 51Cr release assay, in 18 patients with previously untreated Graves’ disease and in 18 controls. NK activity in patients with Graves disease was not significantly different from that in the controls. Normal T4 (NT) and high T4 (HT) medium, free T4 concentrations in which were 1.01 and 16.3 ng/dl, respectively, were used to evaluate the effect of T4 on NK activity. In the controls, NK activity increased in the NT or HT medium compared with that in the control medium at effector to target cell (E : T) ratios of 25 : 1 and 50 : 1. NK activity in the Graves’ disease patients, however, did not increase when either the NT or HT medium was used at E : T ratios of 25 : 1 and 50 : 1. These results suggest that patients with Graves’ disease have a similar NK activity to the controls but have a defect in the peripheral blood lymphocytes to increase NK activity in response to T4. PMID:2098098
Coppen, S R; Newsam, R; Bull, A T; Baines, A J
1995-04-20
The Chinese hamster ovary (CHO) cell line has great commercial importance in the production of recombinant human proteins, especially those for therapeutic use. Much attention has been paid to CHO cell population physiology in order to define factors affecting product fidelity and yield. Such studies have revealed that recombinant proteins, including human interferon-gamma (IFN-gamma), can be heterogeneous both in glycosylation and in proteolytic processing. The type of heterogeneity observed depends on the growth physiology of the cell population, although the relationship between them is complex. In this article we report results of a cytological study of the CHO320 line which expresses recombinant human IFN-gamma. When grown in suspension culture, this cell line exhibited three types of heterogeneity: (1) heterogeneity of the production of IFN-gamma within the cell population, (2) heterogeneity of the number of nuclei and mitotic spindles in dividing cells, and (3) heterogeneity of cellular environment. The last of these arises from cell aggregates which form in suspension culture: Some cells are exposed to the culture medium; others are fully enclosed within the mass with little or no direct access to the medium. Thus, live cells producing IFN-gamma are heterogeneous in their environment, with variable access to O(2) and nutrients. Within the aggregates, it appears that live cells proliferate on a dead cell mass. The layer of live cells can be several cells deep. Specific cell-cell attachments are observed between the living cells in these aggregates. Two proteins, known to be required for the formation of certain types of intercellular junctions, spectrin and vinculin, have been localized to the regions of cell-cell contact. The aggregation of the cells appears to be an active process requiring protein synthesis. (c) 1995 John Wiley & Sons, Inc.
NASA Astrophysics Data System (ADS)
Priwahyuningtyas, N. B.; Sinaga, B. Y. M.; Pandia, P.; Eyanoer, P. C.
2018-03-01
Tuberculosis is an infectious disease which caused by Mycobacterium tuberculosis (M. tuberculosis) that infected numerous organ especially the lung. A person’s immunity is very affecting for a person exposed to pulmonary tuberculosis. T-helper-1 cell (Th1) is very influential in the immune system especially in interfering intracellular bacterial infection. One of the cytokines known produced by Th1 cell is interferon gamma (IFN-γ) which is in eliminating M. tuberculosis. The study aims to identify the association between level of IFN-γ and AFB positivity in pulmonary tuberculosis patients in Medan. It is a case-control study. The subjects of the study were 60 new cases of pulmonary tuberculosis with AFB sputum smear- positive that never received ATT consisting 20 cases AFB (+1), 20 cases AFB (+2) and 20 cases AFB (+3).Samples were plasma collected from the venous blood of pulmonary tuberculosis patients. The plasma then underwent laboratory assay with ELISA techniques. Independent t-test was p<0.05 considered significant. Level of IFN-γ in TB AFB (+1) is higher than TB AFB (+2) and (+3), with thesignificant statistical result (p=0.001).
NASA Technical Reports Server (NTRS)
Gould, Cheryl L.; Sonnenfeld, Gerald
1987-01-01
The effect of pretreatment of mice with 34 units/day, for five days, of interferon-gamma (IFN-gamma) on the course of infection with LD50 of Salmonella typhimurium strain LT-2 was assessed, using two IFN preparations: (1) a hybridoma supernatant fluid containing concanavalin-A-induced IFN-gamma activity and (2) pure murine IFN-gamma produced by recombinant DNA technology. The hybridoma supernatant-treated Salmonella-infected mice were found to die faster than mice treated only with Salmonella. Pure murine IFN-gamma was found to protect infected mice significantly, with 95 percent of mice surviving LD50 infection. In contrast, the Salmonella-infected mice treated with hybridoma supernatant were found to die faster than the Salmonella-infected untreated controls. Mice treated with concanavalin A alone prior to infection with S. typhimurium died more quickly than the untreated infected controls, suggesting that contamination with concanavalin A had a detrimental effect on mice survival.
Schmidt, Stanislaw; Tramsen, Lars; Hanisch, Mitra; Latgé, Jean-Paul; Huenecke, Sabine; Koehl, Ulrike
2011-01-01
Because natural killer (NK) cells kill tumor cells and combat infections, there is growing interest in adoptively transferring NK cells to hematopoietic stem cell recipients. Unfortunately, in humans, the activity of NK cells against Aspergillus species, the major cause of invasive fungal infection in stem cell recipients, are poorly characterized. Our results show that unstimulated and interleukin-2 prestimulated human NK cells kill Aspergillus fumigatus hyphae but do not affect resting conidia. Killing is also induced by the supernatant of prestimulated NK cells and human perforin. The high levels of interferon-γ and granulocyte macrophage colony-stimulating factor produced by prestimulated NK cells are significantly reduced by Aspergillus, indicating an immunosuppressive effect of the fungus. Whereas Aspergillus hyphae activate NK cells, resting, and germinating, conidia and conidia of ΔrodA mutants lacking the hydrophobic surface layer do not. Our results suggest that adoptively transferred human NK cells may be a potential antifungal tool in the transplantation context. PMID:21208932
Jeong, Won-Il; Park, Ogyi; Suh, Yang-Gun; Byun, Jin-Seok; Park, So-Young; Choi, Earl; Kim, Ja-Kyung; Ko, Hyojin; Wang, Hua; Miller, Andrew M.; Gao, Bin
2011-01-01
Activation of innate immunity (natural killer cell/interferon-γ: NK cell/IFN-γ) has been shown to play an important role in anti-viral and anti-tumor defenses as well as anti-fibrogenesis. However, little is known about the regulation of innate immunity during chronic liver injury. Here, we compared the functions of NK cells in early and advanced liver fibrosis induced by a 2-week or a 10 week-carbon tetrachloride (CCl4) challenge, respectively. Injection of poly I:C or IFN-γ induced NK cell activation and NK cell killing of hepatic stellate cells (HSCs) in the 2-week CCl4 model. Such activation was diminished in the 10-week CCl4 model. Consistent with these findings, the inhibitory effect of poly I:C and IFN-γ on liver fibrosis was markedly reduced in the 10-week vs. the 2-week CCl4 model. In vitro co-culture experiments demonstrated that 4-day cultured (early-activated) HSCs induce NK cell activation via an NKG2D-retinoic acid-induced early gene 1 (RAE1)-dependent mechanism. Such activation was reduced when co-cultured with 8-day cultured (intermediately-activated) HSCs due to the production of transforming growth factor-β (TGF-β) by HSCs. Moreover, early-activated HSCs were sensitive, while intermediately-activated HSCs were resistant to IFN-γ mediated inhibition of cell proliferation, likely due to elevated expression of suppressor of cytokine signaling 1 (SOCS1). Disruption of the SOCS1 gene restored the IFN-γ inhibition of cell proliferation in intermediately-activated HSCs. Production of retinol metabolites by HSCs contributed to SOCS1 induction and subsequently inhibited IFN-γ signaling and functioning, while production of TGF-β by HSCs inhibited NK cell function and cytotoxicity against HSCs. Conclusion The anti-fibrogenic effects of NK cell/IFN-γ are suppressed during advanced liver injury, which is likely due to the increased production of TGF-β and expression of SOCS1 in intermediately-activated HSCs. PMID:21480338
Jenny, M; Santer, E; Klein, A; Ledochowski, M; Schennach, H; Ueberall, F; Fuchs, D
2009-03-18
The fruits of Theobroma cacao L. (Sterculiaceae) have been used as food and a remedy for more than 4000 years. Today, about 100 therapeutic applications of cacao are described involving the gastrointestinal, nervous, cardiovascular and immune systems. Pro-inflammatory cytokine interferon-gamma and related biochemical pathways like tryptophan degradation by indoleamine 2,3-dioxygenase and neopterin formation are closely associated with the pathogenesis of such disorders. To determine the anti-inflammatory effect of cacao extracts on interferon-gamma and biochemical consequences in immunocompetent cells. Effects of aqueous or ethanolic extracts of cacao were examined on mitogen-induced human peripheral blood mononuclear cells (PBMC) of healthy donors and on lipopolysaccharide-stimulated myelomonocytic THP-1 cells. Antioxidant activity of extracts was determined by oxygen radical absorption capacity (ORAC) assay. In mitogen-stimulated PBMC, enhanced degradation of tryptophan, formation of neopterin and interferon-gamma were almost completely suppressed by the cacao extracts at doses of > or = 5 microg/mL. Cacao extracts had no effect on tryptophan degradation in lipopolysaccharide-stimulated THP-1 cells. There is a significant suppressive effect of cacao extracts on pro-inflammatory pathways in activated T-cells. Particularly the influence on indoleamine 2,3-dioxygenase could relate to some of the beneficial health effects ascribed to cacao.
May, Rebecca M.; Okumura, Mariko; Hsu, Chin-Jung; Bassiri, Hamid; Yang, Enjun; Rak, Gregory; Mace, Emily M.; Philip, Naomi H.; Zhang, Weiguo; Baumgart, Tobias; Orange, Jordan S.; Nichols, Kim E.
2013-01-01
Signaling pathways leading to natural killer (NK)–cell effector function are complex and incompletely understood. Here, we investigated the proximal signaling pathways downstream of the immunotyrosine-based activation motif (ITAM) bearing activating receptors. We found that the adaptor molecule SH2 domain-containing leukocyte protein of 76 kD (SLP-76) is recruited to microclusters at the plasma membrane in activated NK cells and that this is required for initiation of downstream signaling and multiple NK-cell effector functions in vitro and in vivo. Surprisingly, we found that 2 types of proximal signaling complexes involving SLP-76 were formed. In addition to the canonical membrane complex formed between SLP-76 and linker for activation of T cells (LAT) family members, a novel LAT family–independent SLP-76–dependent signaling pathway was identified. The LAT family–independent pathway involved the SH2 domain of SLP-76 and adhesion and degranulation-promoting adaptor protein (ADAP). Both the LAT family–dependent and ADAP-dependent pathway contributed to interferon-gamma production and cytotoxicity; however, they were not essential for other SLP-76–dependent events, including phosphorylation of AKT and extracellular signal–related kinase and cellular proliferation. These results demonstrate that NK cells possess an unexpected bifurcation of proximal ITAM-mediated signaling, each involving SLP-76 and contributing to optimal NK-cell function. PMID:23407547
Fasting Enhances TRAIL-Mediated Liver Natural Killer Cell Activity via HSP70 Upregulation
Dang, Vu T. A.; Tanabe, Kazuaki; Tanaka, Yuka; Tokumoto, Noriaki; Misumi, Toshihiro; Saeki, Yoshihiro; Fujikuni, Nobuaki; Ohdan, Hideki
2014-01-01
Acute starvation, which is frequently observed in clinical practice, sometimes augments the cytolytic activity of natural killer cells against neoplastic cells. In this study, we investigated the molecular mechanisms underlying the enhancement of natural killer cell function by fasting in mice. The total number of liver resident natural killer cells in a unit weight of liver tissue obtained from C57BL/6J mice did not change after a 3-day fast, while the proportions of tumor necrosis factor–related apoptosis-inducing ligand (TRAIL)+ and CD69+ natural killer cells were significantly elevated (n = 7, p <0.01), as determined by flow cytometric analysis. Furthermore, we found that TRAIL− natural killer cells that were adoptively transferred into Rag-2−/− γ chain−/− mice could convert into TRAIL+ natural killer cells in fasted mice at a higher proportion than in fed mice. Liver natural killer cells also showed high TRAIL-mediated antitumor function in response to 3-day fasting. Since these fasted mice highly expressed heat shock protein 70 (n = 7, p <0.05) in liver tissues, as determined by western blot, the role of this protein in natural killer cell activation was investigated. Treatment of liver lymphocytes with 50 µg/mL of recombinant heat shock protein 70 led to the upregulation of both TRAIL and CD69 in liver natural killer cells (n = 6, p <0.05). In addition, HSP70 neutralization by intraperitoneally injecting an anti- heat shock protein 70 monoclonal antibody into mice prior to fasting led to the downregulation of TRAIL expression (n = 6, p <0.05). These findings indicate that acute fasting enhances TRAIL-mediated liver natural killer cell activity against neoplastic cells through upregulation of heat shock protein 70. PMID:25356750
Shiba, Masahiro; Nonomura, Norio; Nakai, Yasutomo; Nakayama, Masashi; Takayama, Hitoshi; Inoue, Hitoshi; Tsujimura, Akira; Nishimura, Kazuo; Okuyama, Akihiko
2009-04-01
To investigate the regulation of interferon-alpha (IFN-alpha) receptor expression in metastatic renal cell carcinoma (RCC) after IFN-alpha administration. Blood sampling was carried out in eight patients with metastatic RCC and six healthy volunteers. Flow-cytometric analysis using a monoclonal antibody against the active subunit of the type-I IFN-alpha receptor (IFNAR2) was carried out to examine the circadian rhythm of IFNAR2 expression in peripheral blood mononuclear cells (PBMC) as well as its downregulation after IFN-alpha administration. According to its circadian rhythm IFNAR2 in PBMC had a peak expression at night. Once IFN-alpha is administered, IFNAR2 levels in PBMC showed downregulation within 48 h and recovered within another 48 h. Our findings might support the establishment of an optimal schedule for IFN-alpha administration.
Smith, Steven G.; Kleinnijenhuis, Johanneke; Netea, Mihai G.; Dockrell, Hazel M.
2017-01-01
Vaccination of infants with bacillus Calmette–Guérin (BCG) activates both the innate and adaptive arms of the immune response. The antimycobacterial effects of these responses most likely account for the ability of BCG to protect against childhood forms of tuberculosis (TB). There is also evidence for a heterologous protective effect of BCG vaccination against TB-unrelated mortality in low birth weight infants. A possible mechanism of action of this effect, the induction of trained innate immunity, has been demonstrated when cells from BCG-vaccinated adults are restimulated in vitro with non-related microbial stimuli. Our aim was to examine an extensive panel of secreted immune biomarkers to characterize the profile of trained innate immunity in infants. Stimulation of whole blood for 48 h was performed 4 months after BCG vaccination, or in control unvaccinated infants. Stimulants were lipopolysaccharide; Pam3Cys (P3C); heat-killed Candida albicans, Staphylococcus aureus, Escherichia coli, and a lysate of Mycobacterium tuberculosis. Culture supernatants were tested for secreted cytokines and chemokines by 42-plex bead array and monocytes and natural killer (NK) cells assessed for expression of activation markers by flow cytometry. BCG-vaccinated infants displayed increases in 11 cytokines and chemokines in response to different non-specific innate immunity stimuli: epidermal growth factor (EGF); eotaxin; IL-6; IL-7; IL-8; IL-10; IL-12p40; monocyte chemotactic protein-3; macrophage inflammatory protein-1α; soluble CD40 ligand and platelet-derived growth factor (PDGF)-AB/BB. Although each stimulant induced a distinct response profile, three analytes, EGF, IL-6, and PDGF-AB/BB, were commonly higher after stimulation with Pam3Cys, C. albicans, and S. aureus. Conversely, certain cytokines such as interferon gamma-inducible protein-10, IL-2, IL-13, IL-17, GM-CSF, and GRO were suppressed in BCG-vaccinated infants, while no increases in TNFα or IL-1β production
Keck, Nicolas; Boschiroli, Maria-Laura; Smyej, Florence; Vogler, Valérie; Moyen, Jean-Louis; Desvaux, Stéphanie
2018-01-01
In the French Camargue region, where bovine tuberculosis had been enzootic for several years in bullfighting cattle herds, the gamma-interferon (IFN) assay was used since 2003 in parallel with the intradermal test in order to increase overall disease detection sensitivity in infected herds. This study presents the results of a field-evaluation of the assay during a 10-year period (2004-2014) of disease control and surveillance program and explores the particular pattern of IFN assay results in bullfight herds in comparison to cattle from other regions of France. The low sensitivity [59.2% (50.6; 67.3)] of IFN assay using the tuberculin stimulation could be related to the poor gamma-IFN production from bullfight cattle blood cells which is significantly lower than in animals of conventional breeds. The characteristics of the assay were progressively adapted to the epidemiological situation and the desired strategic applications. Data analysis with a receiver operating characteristic curve based on a simple S/P value algorithm allowed for the determination of a new cutoff adapted for a global screening, giving a high specificity of 99.9% results and a high accuracy of the assay. Having regularly risen to above 5% since 2005, with a peak around 10% in 2010, the annual incidence dropped to under 1% in 2014. The positive predictive value relative to the bacteriological confirmation evolved during the years, from 33% in 2009 to 12% during the last screening period, a normal trend in a context of decreasing prevalence. The estimated rate of false-positive reactions during screening campaigns was 0.67%, confirming the high specificity of the test, measured in bTB negative herds, in this epidemiological context. The proportion of false-positive reactions decreased with the age and was higher in males than in females. Although these results indicate that the IFN assay is accurate in the field, it also emphasizes great differences between interferon quantities produced by
Devane, John G; Martin, Mary L; Matson, Mark A
2014-06-01
Flu-like symptoms (FLS) are commonly experienced by patients receiving interferon gamma-1b which may cause discontinuation or disruption of dosing during initial therapy or on re-initiation following a break in therapy. In contrast to Type I interferons, the impact of dose-titration on FLS has not been reported and is not a practice described or included in the approved prescribing information for interferon gamma-1b.The objective of this study was to assess the effect of a 2 week titration regimen on the severity of FLS during the initial 3 weeks of therapy with three times weekly subcutaneous injections of interferon gamma-1b. Healthy men and women were randomized into a double-blind, two-period, crossover study. Each study period was 3 weeks in duration and there was a minimum 15 day washout between treatment periods. Two treatment regimens were compared: No Titration dosing (full 50 mcg/m(2) subcutaneously [s.c.] three times weekly for 3 weeks) and Titration (15 mcg/m(2) s.c. three times weekly during week 1, 30 mcg/m(2) s.c. three times weekly during week 2 followed by the full dose of 50 mcg/m(2) s.c. three times weekly during week 3). Subjects remained in the clinic for at least 12 hours following each injection. FLS was based on a composite score for fever, chills, tiredness and muscle aches assessed at baseline and 4, 8 and 12 hours following each injection. Acetaminophen was allowed at the discretion of the PI. The primary endpoint was the change from baseline in FLS severity at 8 hours averaged over the 3 weeks of treatment. Additional endpoints included FLS at 4 and 12 hours, individual flu-like symptoms, rates of discontinuation, incidence of FLS and acetaminophen use. NCT 01929382. Of the 40 subjects randomized, there were 15 (37.5%) discontinuations. Titration resulted in a significant reduction in FLS severity at 8 hours (p = 0.023) averaged over the 3 week treatment period. The difference in 3 week FLS severity reflects differences
Yamamoto, Kana; Furuya, Kanon; Yamada, Kazuki; Takahashi, Fuka; Hamajima, Chisato; Tanaka, Sachi
2018-04-01
Certain food components possess immunomodulatory effects. The aim of this study was to elucidate the mechanism of the immunostimulatory activity of Brassica rapa L. We demonstrated an enhancement of natural killer (NK) activity and interferon (IFN)-γ production in mice that were orally administered an insoluble fraction of B. rapa L. The insoluble fraction of B. rapa L. significantly induced IFN-γ production in mouse spleen cells in an interleukin (IL)-12-dependent manner, and NK1.1 + cells were the main cells responsible for producing IFN-γ. Additionally, the results suggested that the active compounds in the insoluble fraction were recognized by Toll-like receptor (TLR) 2, TLR4, and C-type lectin receptors on dendritic cells, and they activated signaling cascades such as MAPK, NF-κB, and Syk. These findings suggest that B. rapa L. is a potentially promising immuno-improving material, and it might be useful for preventing immunological disorders such as infections and cancers by activating innate immunity.
Wang, Liming; Huang, Shigao; Dang, Yazheng; Li, Ming; Bai, Wen; Zhong, Zhanqiang; Zhao, Hongliang; Li, Yang; Liu, Yongjun; Wu, Mingyuan
2014-12-01
Esophageal cancer is a serious malignancy with regards to mortality and prognosis. Current treatment options include multimodality therapy mainstays of current treatment including surgery, radiation, and chemotherapy. Cell therapy for esophageal cancer is an advancing area of research. We report a case of esophageal cancer following cord blood-derived cytokine-induced killer cell infusion and adjuvant radiotherapy. Initially, she presented with poor spirit, full liquid diets, and upper abdominal pain. Through cell therapy plus adjuvant radiotherapy, the patient remitted and was self-reliant. Recognition of this curative effect of sequent therapy for esophageal cancer is important to enable appropriate treatment. This case highlights cord blood-derived cytokine-induced killer cell therapy significantly alleviates the adverse reaction of radiation and improves the curative effect. Cell therapy plus adjuvant radiotherapy can be a safe and effective treatment for esophageal cancer.
Montoya, Carlos J; Pollard, David; Martinson, Jeffrey; Kumari, Kumud; Wasserfall, Clive; Mulder, Candice B; Rugeles, Maria T; Atkinson, Mark A; Landay, Alan L; Wilson, S Brian
2007-09-01
Identification of human CD1d-restricted T-cell receptor (TCR)-invariant natural killer T (iNKT) cells has been dependent on utilizing combinations of monoclonal antibodies or CD1d tetramers, which do not allow for the most specific analysis of this T-cell subpopulation. A novel monoclonal antibody (clone 6B11), specific for the invariant CDR3 loop of human canonical Valpha24Jalpha18 TCR alpha chain, was developed and used to specifically characterize iNKT cells. In healthy individuals studied for up to 1 year, a wide but stable frequency of circulating iNKT cells (range: 0.01-0.92%) was observed, with no differences in frequency by gender. Four stable iNKT cell subsets were characterized in peripheral blood based on the expression of CD4 and CD8, with CD8(+) iNKT cells being a phenotypic and functionally different subset from CD4(+) and double negative iNKT cells; in particular, LAG-3 was preferentially expressed on CD8(+) iNKT cells. In addition, a strong negative linear correlation between the frequency of total iNKT cells and percentage of the CD4(+) subset was observed. In terms of their potential association with disease, patients at risk for type 1 diabetes had significantly expanded frequencies of double negative iNKT cells when compared to matched controls and first-degree relatives. Moreover, peripheral blood CD4(+) iNKT cells were the highest producers of interleukin-4, while the production of interferon-gamma and tumour necrosis factor-alpha was similar amongst all iNKT cell subsets. These differences in iNKT cell subsets suggest that in humans the relative ratio of iNKT cell subsets may influence susceptibility vs. resistance to immune-mediated diseases.
Berri, Fatma; Haffar, Ghina; Lê, Vuong Ba; Sadewasser, Anne; Paki, Katharina; Lina, Bruno; Wolff, Thorsten
2014-01-01
ABSTRACT During the budding process, influenza A viruses (IAVs) incorporate multiple host cell membrane proteins. However, for most of them, their significance in viral morphogenesis and infectivity remains unknown. We demonstrate here that the expression of annexin V (A5) is upregulated at the cell surface upon IAV infection and that a substantial proportion of the protein is present in lipid rafts, the site of virus budding. Western blotting and immunogold analysis of highly purified IAV particles showed the presence of A5 in the virion. Significantly, gamma interferon (IFN-γ)-induced Stat phosphorylation and IFN-γ-induced 10-kDa protein (IP-10) production in macrophage-derived THP-1 cells was inhibited by purified IAV particles. Disruption of the IFN-γ signaling pathway was A5 dependent since downregulation of its expression or its blockage reversed the inhibition and resulted in decreased viral replication in vitro. The functional significance of these results was also observed in vivo. Thus, IAVs can subvert the IFN-γ antiviral immune response by incorporating A5 into their envelope during the budding process. IMPORTANCE Many enveloped viruses, including influenza A viruses, bud from the plasma membrane of their host cells and incorporate cellular surface proteins into viral particles. However, for the vast majority of these proteins, only the observation of their incorporation has been reported. We demonstrate here that the host protein annexin V is specifically incorporated into influenza virus particles during the budding process. Importantly, we showed that packaged annexin V counteracted the antiviral activity of gamma interferon in vitro and in vivo. Thus, these results showed that annexin V incorporated in the viral envelope of influenza viruses allow viral escape from immune surveillance. Understanding the role of host incorporated protein into virions may reveal how enveloped RNA viruses hijack the host cell machinery for their own purposes. PMID
Education of human natural killer cells by activating killer cell immunoglobulin-like receptors.
Fauriat, Cyril; Ivarsson, Martin A; Ljunggren, Hans-Gustaf; Malmberg, Karl-Johan; Michaëlsson, Jakob
2010-02-11
Expression of inhibitory killer cell immunoglobulin-like receptors (KIRs) specific for self-major histocompatibility complex (MHC) class I molecules provides an educational signal that generates functional natural killer (NK) cells. However, the effects of activating KIRs specific for self-MHC class I on NK-cell education remain elusive. Here, we provide evidence that the activating receptor KIR2DS1 tunes down the responsiveness of freshly isolated human NK cells to target cell stimulation in donors homozygous for human leukocyte antigen (HLA)-C2, the ligand of KIR2DS1. The tuning was apparent in KIR2DS1(+) NK cells lacking expression of inhibitory KIRs and CD94/NKG2A, as well as in KIR2DS1(+) NK cells coexpressing the inhibitory MHC class I-specific receptors CD94/NKG2A and KIR2DL3, but not KIR2DL1. However, the tuning of responsiveness was restricted to target cell recognition because KIR2DS1(+) NK cells responded well to stimulation with exogenous cytokines. Our results provide the first example of human NK-cell education by an activating KIR and suggest that the education of NK cells via activating KIRs is a mechanism to secure tolerance that complements education via inhibitory KIRs.
COULD INTERFERON-GAMMA BE A THERAPEUTIC TARGET FOR TREATING HEART FAILURE?
Levick, Scott P.; Goldspink, Paul H.
2013-01-01
The cytokine interferon-gamma (IFN-γ), is the only known member of the type II family of interferons, and as such, binds to its own distinct receptor. It is important in host defense against infection, as well as adaptive immune responses. Whilst a wide array of cytokines are known to be involved in adverse remodeling of the heart and the progression to heart failure, the role of IFN-γ is unclear. Recent evidence from clinical studies, animal models of myocarditis and hypertension, as well as isolated cell studies, provide conflicting data as to whether IFN-γ is pathological or protective in the heart. Thus, it is important to highlight these discrepant findings so that areas of future investigation can be identified to more clearly determine the precise role of IFN-γ in the heart. Accordingly, this review will: 1) discuss the source of IFN-γ in the diseased heart; 2) summarize the data from animal studies; 3) discuss the effects of IFN-γ on isolated cardiac fibroblasts and cardiomyocytes; 4) identify signaling mechanisms that may be invoked by IFN-γ in the heart; and 5) present the clinical evidence supporting a role for IFN-γ in heart failure. PMID:23589353
Ho, Nathan K.; Crandall, Ian; Sherman, Philip M.
2012-01-01
Enterohemorrhagic Escherichia coli serotype O157:H7 is a food borne enteric bacterial pathogen that causes significant morbidity and mortality in both developing and industrialized nations. E. coli O157:H7 infection of host epithelial cells inhibits the interferon gamma pro-inflammatory signaling pathway, which is important for host defense against microbial pathogens, through the inhibition of Stat-1 tyrosine phosphorylation. The aim of this study was to determine which bacterial factors are involved in the inhibition of Stat-1 tyrosine phosphorylation. Human epithelial cells were challenged with either live bacteria or bacterial-derived culture supernatants, stimulated with interferon-gamma, and epithelial cell protein extracts were then analyzed by immunoblotting. The results show that Stat-1 tyrosine phosphorylation was inhibited by E. coli O157:H7 secreted proteins. Using sequential anion exchange and size exclusion chromatography, YodA was identified, but not confirmed to mediate subversion of the Stat-1 signaling pathway using isogenic mutants. We conclude that E. coli O157:H7 subverts Stat-1 tyrosine phosphorylation in response to interferon-gamma through a still as yet unidentified secreted bacterial protein. PMID:22253910
Effect of interferon-gamma on complement gene expression in different cell types.
Lappin, D F; Guc, D; Hill, A; McShane, T; Whaley, K
1992-01-15
We have studied the expression of the complement components C2, C3, factor B, C1 inhibitor (C1-inh), C4-binding protein (C4-bp) and factor H in human peripheral blood monocytes, skin fibroblasts, umbilical vein endothelial cells (HUVEC) and the human hepatoma cell line G2 (Hep G2) in the absence and the presence of interferon-gamma (IFN-gamma). E.l.i.s.a. performed on culture fluids, run-on transcription assays, Northern blot and double-dilution dot-blot techniques confirmed that monocytes expressed all six components, whereas fibroblasts, HUVEC and HepG2 each expressed five of the six components. Fibroblasts and HUVEC did not synthesize C4-bp, and Hep G2 did not produce factor H. In addition to these differences, the synthesis rates of C3, C1-inh and factor H were not the same in all cell types. However, the synthesis rates of C2 and factor B were similar in all four cell types. The half-lives of the mRNAs were shorter in monocytes than in other cell types. Monocyte factor H mRNA had a half-life of 12 min in monocytes, compared with over 3 h in fibroblasts and HUVEC. The instability of factor H mRNA in monocytes may contribute to their low factor H secretion rate. IFN-gamma produced dose-dependent stimulation of C2, factor B, C1-inh, C4-bp and factor H synthesis by all cell types expressing these proteins, but decreased C3 synthesis in all four cell types. Cell-specific differences in the response to IFN-gamma were observed. The increased rates of transcription of the C1-inh and factor H genes in HUVEC were greater than in other cell types, while the increased rate of transcription of the C2, factor B and C1-inh genes in Hep G2 cells was less than in other cell types. IFN-gamma did not affect the stability of C3, factor H or C4 bp mRNAs, but increased the stability of factor B and C1-inh mRNAs and decreased the stability of C2 mRNA. Although these changes occurred in all four cell types studied, the half-life of C1-inh mRNA in monocytes was increased almost 4-fold
Al-Tawfiq, Jaffar A; Al-Abdely, Hail M
2010-05-01
We report a case of invasive aspergillosis due to Aspergillus fumigatus involving the cervical and thoracic vertebrae and upper mediastinum of a 17 year-old Saudi male with chronic granulomatous disease (CGD). The patient did not respond to a long course of liposomal amphotericin B but did to surgical drainage and a combination of caspofungin and itraconazole with subsequent suppression with oral voriconazole. Fourteen months after the start of therapy, the patient had anterior dislocation of T2 thoracic vertebra with cord transection and quadriplegia. He was then treated intravenously with liquid itraconazole and interferon-gamma. The patient made a remarkable recovery over a 2-year period and was eventually able to walk independently. Thus, a combination of antifungals and interferon-gamma may have resulted in the positive outcome in this case.
Ruiz-Ruiz, Carmen; López-Rivas, Abelardo
2002-01-01
Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL/APO-2L) induces apoptosis in a variety of tumour cells upon binding to death receptors TRAIL-R1 and TRAIL-R2. Here we describe the sensitization by interferon (IFN)-gamma to TRAIL-induced apoptosis in the breast tumour cell lines MCF-7 and MDA-MB231. IFN-gamma promoted TRAIL-mediated activation of caspase-8, Bcl-2 interacting domain death agonist (Bid) degradation, Bcl-2-associated X protein (Bax) translocation to mitochondria, cytochrome c release to the cytosol and activation of caspase-9 in these cell lines. No changes in the expression of TRAIL receptors were observed upon IFN-gamma treatment. Overexpression of Bcl-2 in MCF-7 cells completely inhibited IFN-gamma-induced sensitization to TRAIL-mediated cell death. Interestingly, TRAIL-induced apoptosis was also clearly enhanced by IFN-gamma in caspase-3-overexpressing MCF-7 cells, in the absence of Bax translocation to mitochondria and cytochrome c release to the cytosol. In summary, our results suggest that IFN-gamma facilitates TRAIL-induced activation of mitochondria-regulated as well as mitochondria-independent apoptotic pathways in breast tumour cells. PMID:11936954
Interferon alfa-2b injection is used to treat a number of conditions.Interferon alfa-2b injection is used alone or in combination ... lymphoma (NHL; a slow-growing blood cancer). Interferon alfa-2b is in a class of medications called ...
[Interferons--its method of administration and adverse effect related to pharmacokinetics ].
Furue, H
1984-02-01
The potential role of interferons in the treatment of malignant diseases is currently being evaluated. This paper reviews experimental and clinical findings regarding pharmacokinetics, method of administration, and side reactions of interferons. Interferon in the blood is rapidly cleared from the circulation. Intramuscular injection of alpha-interferon causes low but stable interferon levels in the blood. However, in the case of beta-interferon, interferon is never detected consistently in the blood after intramuscular or subcutaneous administration. The studies with animal models suggest that doses higher than those given in current clinical trials will be necessary to obtain clearly beneficial effects in human. The maximum safely tolerated daily dose is appreciably higher than that used in most previous studies, although even at this level, considerable toxicity may be encountered. Adequate method of administration, route, dose and interval are not yet established at all. Exact mechanism of anticancer activity is not yet well defined. The most frequent side reaction is fever. However, the exact mechanism to cause these side reactions is also not yet clarified. Dose limiting central nervous system toxicities, hypotension, hypocalcaemia etc. are occasionally encountered in some instances. Antibody to interferon is demonstrated in some cases. Purification of interferon does not always causes reduction of side reactions. The treatment of cancer cases with interferon has just started and there are many problems to be solved. However, therapeutic beneficial may be achieved in the treatment of malignant tumors by appropriate combinations of interferon with conventional treatment. More laboratory studies as well as carefully controlled clinical observations are warranted.
Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade
2006-12-15
Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.
Interferon Gamma in African Trypanosome Infections: Friends or Foes?
Wu, Hui; Liu, Gongguan; Shi, Meiqing
2017-01-01
African trypanosomes cause fatal infections in both humans and livestock. Interferon gamma (IFN-γ) plays an essential role in resistance to African trypanosomes. However, increasing evidence suggests that IFN-γ, when excessively synthesized, also induces immunopathology, enhancing susceptibility to the infection. Thus, production of IFN-γ must be tightly regulated during infections with African trypanosomes to ensure that a robust immune response is elicited without tissue destruction. Early studies have shown that secretion of IFN-γ is downregulated by interleukin 10 (IL-10). More recently, IL-27 has been identified as a negative regulator of IFN-γ production during African trypanosome infections. In this review, we discuss the current state of our understanding of the role of IFN-γ in African trypanosome infections. We have focused on the cellular source of IFN-γ, its beneficial and detrimental effects, and mechanisms involved in regulation of its production, highlighting some recent advances and offering some perspectives on future directions.
Prokaryotic Expression and Anti-IBDV Activity of Chicken Interleukin-18 and Interferon-γ.
Song, Baifen; Li, Xiaoting; Ma, Jinzhu; Yu, Liquan; Feng, Zhenyue; Liu, Zhenhua; Cui, Yudong
2017-01-01
Interferon-γ (IFN-γ), a cytokine produced by activated natural killer cells and T lymphocytes, is an important regulator of innate and adaptive immunity. Interleukin (IL)-18, also known as IFN-γ-inducing factor, is a cytokine that induces T and natural killer cells to produce IFN-γ. In this study, the chicken IL-18 (ChIL-18) and chicken IFN-γ (ChIFN-γ) genes were inserted into the pET28a prokaryotic expression vector, resulting in pET28a-IL-18 and pET28a-IFN-γ, respectively. These plasmids were transformed into Escherichia coli strain BL21, and the ChIL-18 and ChIFN-γ proteins were expressed and purified. To determine their antiviral activities, 200 ng/mL of ChIL-18 and/or ChIFN-γ were inoculated into chicken embryonic fibroblast cells. After 24 h, one 50% tissue culture infective dose (TCID50) of infectious bursal disease virus (IBDV) was inoculated into the chicken embryonic fibroblast cells. The results showed that the antiviral effect of ChIL-18 and ChIFN-γ in combination was better than that of ChIL-18 or ChIFN-γ alone. Next, 14-day-old chicken were injected with 200 µg of ChIL-18 and/or ChIFN-γ and then were challenged with 103 TCID50 of IBDV via intraperitoneal injection. The results showed that the proliferation of IBDV was inhibited by the injection of the recombinant proteins, especially the combination of ChIL-18 and ChIFN-γ, as evidenced by cytokine detection, quantitative PCR, and pathology analyses. These results indicate that ChIL-18 and ChIFN-γ could inhibit IBDV infection and the combination of ChIL-18 and ChIFN-γ has a better inhibitory effect than either cytokine alone. © 2017 S. Karger AG, Basel.
Van den Bergh, Johan M J; Guerti, Khadija; Willemen, Yannick; Lion, Eva; Cools, Nathalie; Goossens, Herman; Vorsters, Alex; Van Tendeloo, Viggo F I; Anguille, Sébastien; Van Damme, Pierre; Smits, Evelien L J M
2014-01-01
Cervarix™ is approved as a preventive vaccine against infection with the human papillomavirus (HPV) strains 16 and 18, which are causally related to the development of cervical cancer. We are the first to investigate in vitro the effects of this HPV vaccine on interleukin (IL)-15 dendritic cells (DC) as proxy of a naturally occurring subset of blood DC, and natural killer (NK) cells, two innate immune cell types that play an important role in antitumour immunity. Our results show that exposure of IL-15 DC to the HPV vaccine results in increased expression of phenotypic maturation markers, pro-inflammatory cytokine production and cytotoxic activity against HPV-positive tumour cells. These effects are mediated by the vaccine adjuvant, partly through Toll-like receptor 4 activation. Next, we demonstrate that vaccine-exposed IL-15 DC in turn induce phenotypic activation of NK cells, resulting in a synergistic cytotoxic action against HPV-infected tumour cells. Our study thus identifies a novel mode of action of the HPV vaccine in boosting innate immunity, including killing of HPV-infected cells by DC and NK cells. PMID:24979331
Sahiratmadja, Edhyana; Alisjahbana, Bachti; de Boer, Tjitske; Adnan, Iskandar; Maya, Anugrah; Danusantoso, Halim; Nelwan, Ronald H. H.; Marzuki, Sangkot; van der Meer, Jos W. M.; van Crevel, Reinout; van de Vosse, Esther; Ottenhoff, Tom H. M.
2007-01-01
Pro- and anti-inflammatory cytokines and their signaling pathways play key roles in protection from and pathogenesis of mycobacterial infection, and their balance and dynamic changes may control or predict clinical outcome. Peripheral blood cells' capacity to produce proinflammatory (tumor necrosis factor alpha [TNF-α], interleukin-12/23p40 [IL-12/23p40], and gamma interferon [IFN-γ]) and anti-inflammatory (IL-10) cytokines in response to Mycobacterium tuberculosis or unrelated stimuli (lipopolysaccharide, phytohemagglutinin) was studied in 93 pulmonary tuberculosis (TB) patients and 127 healthy controls from Indonesia. Their cells' ability to respond to IFN-γ was examined to investigate whether M. tuberculosis infection can also inhibit IFN-γ receptor (IFN-γR) signaling. Although there was interindividual variability in the observed responses, the overall results revealed that M. tuberculosis-induced TNF-α and IFN-γ levels showed opposite trends. Whereas TNF-α production was higher in active-TB patients than in controls, IFN-γ production was strongly depressed during active TB, correlated inversely with TB disease severity, and increased during therapy. By contrast, mitogen-induced IFN-γ production, although lower in patients than in controls, did not change during treatment, suggesting an M. tuberculosis-specific and reversible component in the depression of IFN-γ. Depressed IFN-γ production was not due to decreased IL-12/IL-23 production. Importantly, IFN-γ-inducible responses were also significantly depressed during active TB and normalized during treatment, revealing disease activity-related and reversible impairment in IFN-γR signaling in TB. Finally, IFN-γ/IL-10 ratios significantly correlated with TB cure. Taken together, these results show that M. tuberculosis-specific stimulation of IFN-γ (but not TNF-α) production and IFN-γR signaling are significantly depressed in active TB, correlate with TB disease severity and activity, and
Kojima, Shuji
2006-10-01
We first examined the relation between the induction of glutathione and immune functions in mice after low-dose gamma-ray irradiation. Thereafter, inhibition of tumor growth by radiation was confirmed in Ehrlich solid tumor (EST)-bearing mice. The total glutathione level of the splenocytes transiently increased soon after irradiation and reached a maximum at around 4 h postirradiation. Thereafter, the level reverted to the 0 h value by 24 h postirradiation. A significantly high splenocyte proliferative response was also recognized 4 h postirradiation. Natural killer (NK) activity was also increased significantly in a similar manner. The time at which the response reached the maximum coincided well with that of maximum total glutathione levels of the splenocytes in the gamma-ray-irradiated mice. Reduced glutathione exogenously added to splenocytes obtained from normal mice enhanced the proliferative response and NK activity in a dose-dependent manner. The inhibitory effects of radiation on tumor growth was then examined in EST-bearing mice. Repeated low-dose irradiation (0.5 Gy, four times, before and within an early time after inoculation) significantly delayed the tumor growth. Finally, the effect of single low-dose (0.5 Gy), whole-body gamma-ray irradiation on immune balance was examined to elucidate the mechanism underlying the antitumor immunity. The percentage of B cells in blood lymphocytes was selectively decreased after radiation, concomitant with an increase in that of the helper T cell population. The IFN-gamma level in splenocyte culture prepared from EST-bearing mice was significantly increased 48 h after radiation, although the level of IL-4 was unchanged. IL-12 secretion from macrophages was also enhanced by radiation. These results suggest that low-dose gamma-rays induce Th1 polarization and enhance the activities of tumoricidal effector cells, leading to an inhibition of tumor growth.
Oelsner, Sarah; Wagner, Juliane; Friede, Miriam E; Pfirrmann, Verena; Genßler, Sabrina; Rettinger, Eva; Buchholz, Christian J; Pfeifer, Heike; Schubert, Ralf; Ottmann, Oliver G; Ullrich, Evelyn; Bader, Peter; Wels, Winfried S
2016-10-15
Pre-emptive cancer immunotherapy by donor lymphocyte infusion (DLI) using cytokine-induced killer (CIK) cells may be beneficial to prevent relapse with a reduced risk of causing graft-versus-host-disease. CIK cells are a heterogeneous effector cell population including T cells (CD3(+) CD56(-) ), natural killer (NK) cells (CD3(-) CD56(+) ) and natural killer T (T-NK) cells (CD3(+) CD56(+) ) that exhibit non-major histocompatibility complex (MHC)-restricted cytotoxicity and are generated by ex vivo expansion of peripheral blood mononuclear cells in the presence of interferon (IFN)-γ, anti-CD3 antibody, interleukin-2 (IL-2) and interleukin-15 (IL-15). To facilitate selective target-cell recognition and enhance specific cytotoxicity against B-cell acute lymphoblastic leukemia (B-ALL), we transduced CIK cells with a lentiviral vector encoding a chimeric antigen receptor (CAR) that carries a composite CD28-CD3ζ domain for signaling and a CD19-specific scFv antibody fragment for cell binding (CAR 63.28.z). In vitro analysis revealed high and specific cell killing activity of CD19-targeted CIK/63.28.z cells against otherwise CIK-resistant cancer cell lines and primary B-ALL blasts, which was dependent on CD19 expression and CAR signaling. In a xenograft model in immunodeficient mice, treatment with CIK/63.28.z cells in contrast to therapy with unmodified CIK cells resulted in complete and durable molecular remissions of established primary pre-B-ALL. Our results demonstrate potent antileukemic activity of CAR-engineered CIK cells in vitro and in vivo, and suggest this strategy as a promising approach for adoptive immunotherapy of refractory pre-B-ALL. © 2016 UICC.
Evaluation of Gamma Interferon and Antibody Tuberculosis Tests in Alpacas
Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin
2012-01-01
We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a “test package,” although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations. PMID:22914362
Evaluation of gamma interferon and antibody tuberculosis tests in alpacas.
Rhodes, Shelley; Holder, Tom; Clifford, Derek; Dexter, Ian; Brewer, Jacky; Smith, Noel; Waring, Laura; Crawshaw, Tim; Gillgan, Steve; Lyashchenko, Konstantin; Lawrence, John; Clarke, John; de la Rua-Domenech, Ricardo; Vordermeier, Martin
2012-10-01
We describe the performance of cell-based and antibody blood tests for the antemortem diagnosis of tuberculosis (TB) in South American camelids (SAC). The sensitivity and specificity of the gamma interferon (IFN-γ) release assay, two lateral flow rapid antibody tests (Stat-Pak and Dual Path Platform [DPP]), and two enzyme-linked immunosorbent assay (ELISA)-based antibody tests (Idexx and Enferplex) were determined using diseased alpacas from Mycobacterium bovis culture-confirmed breakdown herds and TB-free alpacas from geographical areas with no history of bovine TB, respectively. Our results show that while the sensitivities of the IFN-γ and antibody tests were similar (range of 57.7% to 66.7%), the specificity of the IFN-γ test (89.1%) was lower than those of any of the antibody tests (range of 96.4% to 97.4%). This lower specificity of the IFN-γ test was at least in part due to undisclosed Mycobacterium microti infection in the TB-free cohort, which stimulates a positive purified protein derivative (PPD) response. The sensitivity of infection detection could be increased by combining two antibody tests, but even the use of all four antibody tests failed to detect all diseased alpacas. These antibody-negative alpacas were IFN-γ positive. We found that the maximum sensitivity could be achieved only by the combination of the IFN-γ test with two antibody tests in a "test package," although this resulted in decreased specificity. The data from this evaluation of tests with defined sensitivity and specificity provide potential options for antemortem screening of SAC for TB in herd breakdown situations and could also find application in movement testing and tracing investigations.
Cato, Anita; Celada, Lindsay; Kibakaya, Esther Caroline; Simmons, Nadia; Whalen, Margaret M.
2014-01-01
NK cells provide a vital surveillance against virally infected cells, tumor cells, and antibody-coated cells through the release of cytolytic mediators and gamma interferon (IFN-γ). Hexabromocyclododecane (HBCD) is a brominated flame retardant used primarily in expanded (EPS) and extruded (XPS) polystyrene foams for thermal insulation in the building and construction industry. Tetrabromobisphenol A (TBBPA) is used both as a reactive and an additive flame retardant in a variety of materials. HBCD and TBBPA contaminate the environment and are found in human blood samples. In previous studies, we have shown that other environmental contaminants, such as the dibutyltin (DBT) and tributyltin (TBT), decrease NK lytic function by activating mitogen-activated protein kinases (MAPKs) in the NK cells. HBCD and TBBPA also interfere with NK cell(s) lytic function. The current study evaluates whether HBCD and/or TBBPA have the capacity to activate MAPKs and MAPK kinases (MAP2Ks). The effects of concentrations of HBCD and TBBPA that inhibited lytic function on the phosphorylation state and total levels of the MAPKs (p44/42, p38, and JNK) and the phosphorylation and total levels of the MAP2Ks (MEK1/2 and MKK3/6) were examined. Results indicate that exposure of human NK cells to 10-0.5 µM HBCD or TBBPA activate MAPKs and MAP2Ks. This HBCD and TBBPA-induced activation of MAPKs may leave them unavailable for activation by virally infected or tumor target cells and thus contributes to the observed decreases in lytic function seen in NK cells exposed to HBCD and TBBPA. PMID:25341744
Occurrence of killer Candida glabrata clinical isolates
Arroyo-Helguera, O; Penas Alejandro, De Las; Irene, Castaño
2012-01-01
In this work we characterized the occurrence of killer activity in 64 Candida glabrata clinical isolates under different conditions. We found that only 6.25 % of the clinical isolates tested were positive for killer activity against a Saccharomyces cerevisiae W303 sensitive strain. Sensitivity of killer activity to different values of pH and temperatures was analyzed. We found that the killer activity presented by all isolates was resistant to every pH and temperature tested, although optimal activity was found at a range of pH values from 4 to 7 and at 37°C. We did not observe extrachromosomal genetic elements associated with killer activity in any of the positive C. glabrata isolates. The killer effect was due to a decrease in viability and DNA fragmentation in sensitive yeast. PMID:24031902
Galkina, Elena; Harry, Brian L; Ludwig, Andreas; Liehn, Elisa A; Sanders, John M; Bruce, Anthony; Weber, Christian; Ley, Klaus
2007-10-16
T lymphocytes are thought to be important in atherosclerosis, but very little is known about the mechanisms of lymphocyte recruitment into atherosclerosis-prone aortas. In this study we tested the hypothesis that CXCR6, a chemokine receptor that is expressed on a subset of CD4+ T helper 1 cells and natural killer T cells, is involved in lymphocyte homing into the aortic wall and modulates the development and progression of atherosclerosis. To investigate the role of CXCR6 in the development and progression of atherosclerosis, we bred CXCR6-deficient (CXCR6(GFP/GFP)) mice with apolipoprotein E-deficient (ApoE(-/-)) mice. We found that CXCR6(GFP/GFP)/ApoE(-/-) mice fed a Western diet for 17 weeks or a chow diet for 56 weeks had decreased atherosclerosis compared with ApoE(-/-) controls. Flow cytometry analysis of the aortas from CXCR6(GFP/GFP)/ApoE(-/-) mice showed that the reduction of atherosclerosis was accompanied by a decreased percentage of CXCR6+ T cells within the aortas. Short-term homing experiments demonstrated that CXCR6 is involved in the recruitment of CXCR6+ leukocytes into the atherosclerosis-prone aortic wall. The reduced percentage of CXCR6+ T cells within the aortas resulted in significantly diminished production of interferon-gamma and reduction of CD11b+/CD68+ macrophages in the aorta. These data provide evidence for a proatherosclerotic role of CXCR6. Absence of CXCR6 alters the recruitment of CXCR6+ leukocytes and modulates the local immune response within the aortic wall.
Role of natural killer cells in antibacterial immunity.
Schmidt, Stanislaw; Ullrich, Evelyn; Bochennek, Konrad; Zimmermann, Stefanie-Yvonne; Lehrnbecher, Thomas
2016-12-01
Bacteria are a significant cause of infectious complications, in particular in immunocompromised patients. There is an increasing understanding that Natural Killer (NK) cells not only exhibit direct activity against bacteria, but also exert indirect antibacterial activity through interaction with other immune cells via cytokines and interferons. Areas covered: This review seeks to give a global overview of in vitro and in vivo data how NK cells interact with bacteria. In this regard, the review describes how NK cells directly damage and kill bacteria by soluble factors such as perforin, the impact of NK cells on other arms of the immune system, as well as how bacteria may inhibit NK cell activities. Expert commentary: A better characterization of the antibacterial effects of NK cells is urgently needed. With a better understanding of the interaction of NK cells and bacteria, NK cells may become a promising tool to prevent or to combat bacterial infections, e.g. by adoptively transferring NK cells to immunocompromised patients.
Choi, Jang-Gi; Jin, Young-Hee; Lee, Heeeun; Oh, Tae Woo; Yim, Nam-Hui; Cho, Won-Kyung; Ma, Jin Yeul
2017-01-01
Influenza is an acute respiratory illness caused by the influenza A virus, which causes economic losses and social disruption mainly by increasing hospitalization and mortality rates among the elderly and people with chronic diseases. Influenza vaccines are the most effective means of preventing seasonal influenza, but can be completely ineffective if there is an antigenic mismatch between the seasonal vaccine virus and the virus circulating in the community. In addition, influenza viruses resistant to antiviral drugs are emerging worldwide. Thus, there is an urgent need to develop new vaccines and antiviral drugs against these viruses. In this study, we conducted in vitro and in vivo analyses of the antiviral effect of Panax notoginseng root (PNR), which is used as an herbal medicine and nutritional supplement in Korea and China. We confirmed that PNR significantly prevented influenza virus infection in a concentration-dependent manner in mouse macrophages. In addition, PNR pretreatment inhibited viral protein (PB1, PB2, HA, NA, M1, PA, M2, and NP) and viral mRNA (NS1, HA, PB2, PA, NP, M1, and M2) expression. PNR pretreatment also increased the secretion of pro-inflammatory cytokines [tumor necrosis factor alpha and interleukin 6] and interferon (IFN)-beta and the phosphorylation of type-I IFN-related proteins (TANK-binding kinase 1, STAT1, and IRF3) in vitro. In mice exposed to the influenza A H1N1 virus, PNR treatment decreased mortality by 90% and prevented weight loss (by approximately 10%) compared with the findings in untreated animals. In addition, splenocytes from PNR-administered mice displayed significantly enhanced natural killer (NK) cell activity against YAC-1 cells. Taking these findings together, PNR stimulates an antiviral response in murine macrophages and mice that protects against viral infection, which may be attributable to its ability to stimulate NK cell activity. Further investigations are needed to reveal the molecular mechanisms
Visser, J; Blauw, B; Hinloopen, B; Brommer, E; de Kloet, E R; Kluft, C; Nagelkerken, L
1998-02-01
A disturbed hypothalamus-pituitary-adrenal gland axis and alterations at the immune system level have been observed in patients with chronic fatigue syndrome (CFS). Glucocorticoids are known to modulate T cell responses; therefore, purified CD4 T cells from CFS patients were studied to determine whether they have an altered sensitivity to dexamethasone (DEX). CD4 T cells from CFS patients produced less interferon-gamma than did cells from controls; by contrast, interleukin-4 production and cell proliferation were comparable. With CD4 T cells from CFS patients (compared with cells from controls), a 10- to 20-fold lower DEX concentration was needed to achieve 50% inhibition of interleukin-4 production and proliferation, indicating an increased sensitivity to DEX in CFS patients. Surprisingly, interferon-gamma production in patients and controls was equally sensitive to DEX. A differential sensitivity of cytokines or CD4 T cell subsets to glucocorticoids might explain an altered immunologic function in CFS patients.
O'Brien, Kevin B; Schultz-Cherry, Stacey; Knoll, Laura J
2011-09-01
Outbreaks of influenza A viruses are associated with significant human morbidity worldwide. Given the increasing resistance to the available influenza drugs, new therapies for the treatment of influenza virus infection are needed. An alternative approach is to identify products that enhance a protective immune response. In these studies, we demonstrate that infecting mice with the Th1-inducing parasite Toxoplasma gondii prior to highly pathogenic avian H5N1 influenza virus infection led to decreased lung viral titers and enhanced survival. A noninfectious fraction of T. gondii soluble antigens (STAg) elicited an immune response similar to that elicited by live parasites, and administration of STAg 2 days after H5N1 influenza virus infection enhanced survival, lowered viral titers, and reduced clinical disease. STAg administration protected H5N1 virus-infected mice lacking lymphocytes, suggesting that while the adaptive immune response was not required for enhanced survival, it was necessary for STAg-mediated viral clearance. Mechanistically, we found that administration of STAg led to increased production of gamma interferon (IFN-γ) from natural killer (NK) cells, which were both necessary and sufficient for survival. Further, administration of exogenous IFN-γ alone enhanced survival from H5N1 influenza virus infection, although not to the same level as STAg treatment. These studies demonstrate that a noninfectious T. gondii extract enhances the protective immune response against severe H5N1 influenza virus infections even when a single dose is administered 2 days postinfection.
Nagamine, Ichiro; Yamaguchi, Yoshiyuki; Ohara, Masahiro; Ikeda, Takuhiro; Okada, Morihito
2009-03-01
A loss of human leukocyte antigen (HLA) expression in clinical tumors is one of their escape mechanisms from immune attack by HLA-restricted effector cells. In this study, the induction of HLA-unrestricted effector cells, gamma delta T cells, using zoledronate (ZOL) and interleukin (IL)-2 in vitro was investigated in patients with metastatic cancer. Peripheral blood mononuclear cells (PBMCs) from 10 cancer patients (8 colorectal and 2 esophageal) with multiple metastases and ascites lymphocytes from 3 cancer patients (1 gastric and 2 colorectal) were stimulated with varied concentrations of ZOL plus 100 U/ml IL-2 for 48 hr followed by culturing with IL-2 alone for 12 days. Lymphocyte proliferative responses were determined using 3H-TdR uptakes and interferon (IFN)-gamma production was evaluated using enzyme-linked immunosorbent assay. Surface phenotyping was performed using flow cytometry. Cytotoxic activity of effector cells was determined using 51Cr-releasing assay. It was found that proliferative responses of PBMCs were significantly stimulated with ZOL plus IL-2 when compared with IL-2 alone, showing 200 to 500-fold expansions for 2 weeks, although ZOL alone induced no response. The optimal concentration of ZOL was 1-5 microM. Ascites lymphocytes could also be stimulated with ZOL plus IL-2. The proliferative responses were remarkable in patients whose PBMCs could produce high levels of IFN-gamma during an initial 48-hr stimulation using ZOL plus IL-2. Removal of an adherent cell fraction before the induction augmented the proliferative responses in patients who otherwise had low-grade proliferative responses. Generated cells comprising approximately 90 or 20% in PBMCs from healthy donors or cancer patients, respectively, expressed gamma delta-type T-cell receptor. Gamma delta T cells showed high cytotoxic activity against CD166-positive TE12 and TE13 cancer cells but not against CD166-negative MKN45 cells. The cytotoxic activity against TE13 cells was augmented
Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma.
Magee, Kelsey E; Kelsey, Christina E; Kurzinski, Katherine L; Ho, Jonhan; Mlakar, Logan R; Feghali-Bostwick, Carol A; Torok, Kathryn S
2013-01-01
The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS.
Interferon-gamma inducible protein-10 as a potential biomarker in localized scleroderma
2013-01-01
Introduction The purpose of this study was to evaluate the presence and levels of interferon-gamma inducible protein-10 (IP-10) in the plasma and skin of pediatric localized scleroderma (LS) patients compared to those of healthy pediatric controls and to determine if IP-10 levels correlate to clinical disease activity measures. Methods The presence of IP-10 in the plasma was analyzed using a Luminex panel in 69 pediatric patients with LS and compared to 71 healthy pediatric controls. Of these patients, five had available skin biopsy specimens with concurrent clinical and serological data during the active disease phase, which were used to analyze the presence and location of IP-10 in the skin by immunohistochemistry (IHC). Results IP-10 levels were significantly elevated in the plasma of LS patients compared to that of healthy controls and correlated to clinical disease activity measures in LS. Immunohistochemistry staining of IP-10 was present in the dermal infiltrate of LS patients and was similar to that found in psoriasis skin specimens, the positive disease control. Conclusions Elevation of IP-10 levels in the plasma compared to those of healthy controls and the presence of IP-10 staining in the affected skin of LS patients indicates that IP-10 is a potential biomarker in LS. Furthermore, significant elevation of IP-10 in LS patients with active versus inactive disease and correlations between IP-10 levels and standardized disease outcome measures of activity in LS strongly suggest that IP-10 may be a biomarker for disease activity in LS. PMID:24499523
Mycobacterium avium Complex Empyema in a Patient with Interferon Gamma Autoantibodies
Chung, Heath H; Opal, Steven M; Dworkin, Jonathan D
2014-01-01
Interferon gamma (IFN-γ) autoantibodies are a relatively recently discovered clinical entity, which have been shown to be associated with disseminated non-tuberculous mycobacterial (NTM) infections and other opportunistic infections. Interestingly, isolated NTM infections (without disseminated NTM infection) have not been shown to be a good predictor of the presence of IFN-γ autoantibodies. This case describes an isolated NTM empyema in a patient with IFN-γ autoantibodies and makes the argument that the development of an NTM empyema in a patient with no known immunodeficiency should prompt consideration for IFN-γ testing. Additionally, this case underscores the importance for clinicians to recognize that an unusual infection without the typical cause of impairment in immunity should prompt a more thorough investigation of the patient's immune system. PMID:25285250
Petri, Robert Michael; Hackel, Alexander; Hahnel, Katrin; Dumitru, Claudia Alexandra; Bruderek, Kirsten; Flohe, Stefanie B; Paschen, Annette; Lang, Stephan; Brandau, Sven
2017-09-12
The interaction of mesenchymal stromal cells (MSCs) with natural killer (NK) cells is traditionally thought of as a static inhibitory model, whereby resting MSCs inhibit NK cell effector function. Here, we use a dynamic in vitro system of poly(I:C) stimulation to model the interaction of NK cells and tissue-resident MSCs in the context of infection or tissue injury. The experiments suggest a time-dependent system of regulation and feedback, where, at early time points, activated MSCs secrete type I interferon to enhance NK cell effector function, while at later time points TGF-β and IL-6 limit NK cell effector function and terminate inflammatory responses by induction of a regulatory senescent-like NK cell phenotype. Importantly, feedback of these regulatory NK cells to MSCs promotes survival, proliferation, and pro-angiogenic properties. Our data provide additional insight into the interaction of stromal cells and innate immune cells and suggest a model of time-dependent MSC polarization and licensing. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Delisle, Jean-Sébastien; Gaboury, Louis; Bélanger, Marie-Pier; Tassé, Eliane; Yagita, Hideo; Perreault, Claude
2008-09-01
The immunopathologic condition known as graft-versus-host disease (GVHD) results from a type I T-cell process. However, a prototypical type I cytokine, interferon-gamma (IFN-gamma), can protect against several manifestations of GVHD in recipients of major histocompatibility complex (MHC)-mismatched hematopoietic cells. We transplanted hematopoietic cells from C3H.SW donors in wild-type (wt) and IFN-gamma-receptor-deficient (IFN-gammaRKO) MHC-matched C57BL/6 recipients. In IFN-gammaRKO recipients, host cells were unresponsive to IFN-gamma, whereas wt donor cells were exposed to exceptionally high levels of IFN-gamma. From an IFN-gamma perspective, we could therefore evaluate the impact of a loss-of-function on host cells and gain-of-function on donor cells. We found that lack of IFN-gammaR prevented up-regulation of MHC proteins on host cells but did not mitigate damage to most target organs. Two salient phenotypes in IFN-gammaRKO recipients involved donor cells: lymphoid hypoplasia and hematopoietic failure. Lymphopenia was due to FasL-induced apoptosis and decreased cell proliferation. Bone marrow aplasia resulted from a decreased proliferation of hematopoietic stem/progenitor cells that was associated with down-regulation of 2 genes negatively regulated by IFN-gamma: Ccnd1 and Myc. We conclude that IFN-gamma produced by alloreactive T cells may entail a severe graft-versus-graft reaction and could be responsible for cytopenias that are frequently observed in subjects with GVHD.
Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.
Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G
2010-04-15
Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.
ERIC Educational Resources Information Center
Birch, Samantha J.; Golbeck, Amanda L.
2015-01-01
Objective: This analysis examined the effectiveness of utilizing interferon-gamma release assay (IGRA) technology in a TB (TB) screening program at a university. Participants: Participants were 2299 students at a Montana university who had presented to the university health center for TB screening during 2012 and 2013. Methods: A retrospective…
Kremers, Marjolein N. T.; Hodemaekers, Hennie M.; Hagenaars, Julia C. J. P.; Koning, Olivier H. J.; Renders, Nicole H. M.; Hermans, Mirjam H. A.; de Klerk, Arja; Notermans, Daan W.; Wever, Peter C.; Janssen, Riny
2015-01-01
A large community outbreak of Q fever occurred in the Netherlands in the period 2007 to 2010. Some of the infected patients developed chronic Q fever, which typically includes pathogen dissemination to predisposed cardiovascular sites, with potentially fatal consequences. To identify the immune mechanisms responsible for ineffective clearance of Coxiella burnetii in patients who developed chronic Q fever, we compared serum concentrations of 47 inflammation-associated markers among patients with acute Q fever, vascular chronic Q fever, and past resolved Q fever. Serum levels of gamma interferon were strongly increased in acute but not in vascular chronic Q fever patients, compared to past resolved Q fever patients. Interleukin-18 levels showed a comparable increase in acute as well as vascular chronic Q fever patients. Additionally, vascular chronic Q fever patients had lower serum levels of gamma interferon-inducible protein 10 (IP-10) and transforming growth factor β (TGF-β) than did acute Q fever patients. Serum responses for these and other markers indicate that type I immune responses to C. burnetii are affected in chronic Q fever patients. This may be attributed to an affected immune system in cardiovascular patients, which enables local C. burnetii replication at affected cardiovascular sites. PMID:25924761
Yoo, J C; Pae, H O; Choi, B M; Kim, W I; Kim, J D; Kim, Y M; Chung, H T
2000-02-01
The effects of ionizing irradiation on the nitric oxide (NO) production in murine embryonic liver cell line, BNL CL.2 cells, were investigated. Various doses (5-40 Gy) of radiation made BNL CL.2 cells responsive to interferon-gamma alone for the production of NO in a dose-dependent manner. Small amounts of lipopolysaccharide (LPS) or tumor necrosis factor-alpha (TNF-alpha) synergized with IFN-gamma in the production of NO from irradiated BNL CL.2 cells, even though LPS or TNF-alpha alone did not induce NO production from the same cells. Immunoblots showed parallel induction of inducible nitric oxide synthase (iNOS). NO production in irradiated BNL CL.2 cells by IFN-gamma or IFN-gamma plus LPS was decreased by the addition of catalase, suggesting that H(2)O(2) produced by ionizing irradiation primed the cells to trigger NO production in response to IFN-gamma or IFN-gamma plus LPS. Furthermore, the treatment of nongamma-irradiated BNL CL.2 cells with H(2)O(2) made the cells responsive to IFN-gamma or IFN-gamma plus LPS for the production of NO. This study shows that ionizing irradiation has the ability to induce iNOS gene expression in responsive to IFN-gamma via the formation of H(2)O(2) in BNL CL.2 murine embryonic liver cells.
Soldevila, Berta; Alonso, Núria; Martínez-Arconada, Maria J; Granada, Maria L; Boada, Aram; Vallejos, Virginia; Fraile, Manuel; Fernández-Sanmartín, Marco A; Pujol-Borrell, Ricardo; Puig-Domingo, Manel; Sanmartí, Anna; Martínez-Cáceres, Eva M
2013-04-01
One of the side effects of interferon-alpha therapy is interferon-induced thyroiditis (IIT). The role of lymphocyte subpopulations in IIT melanoma patients remains to be defined. Our objective was to assess different peripheral blood lymphocyte subpopulations, mainly regulatory T cells (Tregs), in melanoma patients who developed IIT. From 30 melanoma patients receiving high-dose interferon (HDI)-alpha 2b (IFN-α2b) treatment, those who developed IIT (IIT patients) were selected and compared with patients who did not develop IIT (Co-MM) and healthy controls (Co-H). Peripheral blood mononuclear cells were obtained before treatment (BT), mid-treatment (MT), end of treatment (ET), 24 weeks post-treatment and at appearance of IIT (TT). Nine patients developed IIT (30%): four Hashimoto's thyroiditis and five destructive thyroiditis. An increase in Tregs was observed in both melanoma groups during HDI treatment. A decrease in CD3(+) , NKT lymphocyte subpopulations and Bcl2 expression on B cells was also observed in both groups. However, no changes were observed in the percentage of CD4(+) , CD8(+) , CD3(+) γδ(+) , CD19(+) , transitional B cells (CD24(high) CD38(high) CD19(+) CD27(-) ), natural killer (NK), invariant NKT (iNKT) lymphocytes and Th1/Th2 balance when BT was compared with ET. At TT, IIT patients had a higher Tregs percentage than Co-MM (P = 0·012) and Co-H (P = 0·004), a higher iNKT percentage than Co-MM (P = 0·011), a higher transitional B cells percentage than Co-H (P = 0·015), a lower CD3(+) percentage than Co-H (P = 0·001) and a lower Bcl2 expression on B cells than Co-H (P < 0·001). Our results point to the immunomodulatory effects of IFN-α on different lymphocyte subpopulations and a possible role of Tregs in melanoma patients who developed IIT. © 2012 Blackwell Publishing Ltd.
[Allergic asthma and interleukins 2, 4, 5, 6 and 12 and gamma interferon levels].
Bastida Segura, Diana Lyzbeth; López Velásquez, Benjamin; Castrejón Vázquez, María Isabel; Galicia Tapía, Jorge; Cano Altamirano, Silvia; Miranda Feria, Alfonso Javier
2004-01-01
Asthma is an inflammatory chronic illness, in which mastocyt cells, basophils, T lymphocytes, eosinophils and cytokines play a role. Its association with the production of TH2 cytokines is not well known, but it is considered an aberrant immune response, yielding the activation and recruitment of a number of effector cells (mastocyts/eosinophils) and the appearance of clinical symptoms. To determine the serum values of the interleukins 2, 4, 5, 6 and 12 and gamma interferon in relation to the severity degree of asthma and the time of immunotherapy in patients with stable chronic allergic bronchial asthma. Clinical records of allergic asthmatic patients from the external consultation at Servicio de Alergia e Immunología Clínica were reviewed in a period of 12 months (1st January 2002 to 1st January 2003) and those of healthy volunteers, forming three groups: Group 1, allergic asthmatics with immunotherapy less than 24 months; Group 2, allergic asthmatics with more than 24 months of immunotherapy, and Group 3, healthy volunteers (control group). Previous informed consent, a serum sample was taken of all subjects. Ninety-two subjects were included: 41 (45%) allergic asthmatics and 51 (55%) healthy volunteers. Significant differences were found in interleukins 2, 4, 5, 6 and 12 levels between healthy volunteers and asthmatics without relating the immunotherapy time. In the total group gamma interferon levels were not found. A relation of interleukins Th2 levels with the severity degree of asthma was not found. Differences of serum interleukins Th1 and Th2 in allergic patients related to immunotherapy time were not significant; even though, irrespective of immunotherapy time, IgG levels were always high. Patients with allergic asthma have a predominance of serum interleukins Th2 and, despite of the immunotherapy, in the maintaining phase, these continue high, which may be due to an immune system dysregulation maybe including other factors. Immunotherapy continues
Interferon-gamma enhances radiation-induced cell death via downregulation of Chk1
Kim, Kwang Seok; Choi, Kyu Jin; Bae, Sangwoo
2012-01-01
Interferon-gamma (IFNγ) is a cytokine with roles in immune responses as well as in tumor control. Interferon is often used in cancer treatment together with other therapies. Here we report a novel approach to enhancement of cancer cell killing by combined treatment of IFNγ with ionizing radiation. We found that IFNγ treatment alone in HeLa cells induced phosphorylation of Chk1 in a time- and dose-dependent manner, and resulted in cell arrest. Moreover IFNγ treatment was correlated with attenuation of Chk1 as the treatment shortened protein half-life of Chk1. As Chk1 is an essential cell cycle regulator for viability after DNA damage, attenuation of Chk1 by IFNγ pre-treatment in HeLa cells resulted in increased cell death following ionizing radiation about 2-folds than ionizing radiation treatment alone whereas IFNγ treatment alone had little effect on cell death. X-linked inhibitor of apoptosis-associated factor 1 (XAF1), an IFN-induced gene, seems to partly regulate IFNγ-induced Chk1 destabilization and radiation sensitivity because transient depletion of XAF1 by siRNA prevented IFNγ-induced Chk1 attenuation and partly protected cells from IFNγ-enhanced radiation cell killing. Therefore the results provide a novel rationale to combine IFNγ pretreatment and DNA-damaging anti-cancer drugs such as ionizing radiation to enhance cancer cell killing. PMID:22825336
Electrochemical impedance spectroscopy based-on interferon-gamma detection
NASA Astrophysics Data System (ADS)
Li, Guan-Wei; Kuo, Yi-Ching; Tsai, Pei-I.; Lee, Chih-Kung
2014-03-01
Tuberculosis (TB) is an ancient disease constituted a long-term menace to public health. According to World Health Organization (WHO), mycobacterium tuberculosis (MTB) infected nearly a third of people of the world. There is about one new TB occurrence every second. Interferon-gamma (IFN-γ) is associated with susceptibility to TB, and interferongamma release assays (IGRA) is considered to be the best alternative of tuberculin skin test (TST) for diagnosis of latent tuberculosis infection (LTBI). Although significant progress has been made with regard to the design of enzyme immunoassays for IFN-γ, adopting this assay is still labor-intensive and time-consuming. To alleviate these drawbacks, we used IFN-γ antibody to facilitate the detection of IFN-γ. An experimental verification on the performance of IGRA was done in this research. We developed two biosensor configurations, both of which possess high sensitivity, specificity, and rapid IFN-γ diagnoses. The first is the electrochemical method. The second is a circular polarization interferometry configuration, which incorporates two light beams with p-polarization and s-polarization states individually along a common path, a four photo-detector quadrature configuration to arrive at a phase modulated ellipsometer. With these two methods, interaction between IFN-γ antibody and IFN-γ were explored and presented in detail.
Ayello, Janet; Hochberg, Jessica; Flower, Allyson; Chu, Yaya; Baxi, Laxmi V; Quish, William; van de Ven, Carmella; Cairo, Mitchell S
2017-02-01
Natural killer (NK) cells play a significant role in reducing relapse in patients with hematological malignancies after allogeneic stem cell transplantation, but NK cell number and naturally occurring inhibitory signals limit their capability. Interleukin-15 (IL-15) and 4-1BBL are important modulators of NK expansion and functional activation. To overcome these limitations, cord blood mononuclear cells (CB MNCs) were ex vivo expanded for 7 days with genetically modified K562-mbIL15-41BBL (MODK562) or wild-type K562 (WTK562). NK cell expansion; expression of lysosome-associated membrane protein-1 (LAMP-1), granzyme B, and perforin; and in vitro and in vivo cytotoxicity against B-cell non-Hodgkin lymphoma (B-NHL) were evaluated. In vivo tumor growth in B-NHL-xenografted nonobese diabetic severe combined immune deficient (NOD-scid) gamma (NSG) mice was monitored by tumor volume, cell number, and survival. CB MNCs cultured with MODK562 compared with WTK562 demonstrated significantly increased NK expansion (thirty-fivefold, p < 0.05); LAMP-1 (p < 0.05), granzyme B, and perforin expression (p < 0.001); and in vitro cytotoxicity against B-NHL (p < 0.01). Xenografted mice treated with MODK562 CB experienced significantly decreased B-NHL tumor volume (p = 0.0086) and B-NHL cell numbers (p < 0.01) at 5 weeks and significantly increased survival (p < 0.001) at 10 weeks compared with WTK562. In summary, MODK562 significantly enhanced CB NK expansion and cytotoxicity, enhanced survival in a human Burkitt's lymphoma xenograft NSG model, and could be used in the future as adoptive cellular immunotherapy after umbilical CB transplantation. Future directions include expanding anti-CD20 chimeric receptor-modified CB NK cells to enhance B-NHL targeting in vitro and in vivo. Copyright © 2016 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.
O'Shea, Donal; Cawood, Tom J.; O'Farrelly, Cliona; Lynch, Lydia
2010-01-01
Background Obese individuals who smoke have a 14 year reduction in life expectancy. Both obesity and smoking are independantly associated with increased risk of malignancy. Natural killer cells (NK) are critical mediators of anti-tumour immunity and are compromised in obese patients and smokers. We examined whether NK cell function was differentially affected by cigarette smoke in obese and lean subjects. Methodology and Principal Findings Clinical data and blood were collected from 40 severely obese subjects (BMI>40 kg/m2) and 20 lean healthy subjects. NK cell levels and function were assessed using flow cytometry and cytotoxicity assays. The effect of cigarette smoke on NK cell ability to kill K562 tumour cells was assessed in the presence or absence of the adipokines leptin and adiponectin. NK cell levels were significantly decreased in obese subjects compared to lean controls (7.6 vs 16.6%, p = 0.0008). NK function was also significantly compromised in obese patients (30% +/− 13% vs 42% +/−12%, p = 0.04). Cigarette smoke inhibited NK cell ability to kill tumour cell lines (p<0.0001). NK cells from obese subjects were even more susceptible to the inhibitory effects of smoke compared to lean subjects (33% vs 28%, p = 0.01). Cigarette smoke prevented NK cell activation, as well as perforin and interferon-gamma secretion upon tumour challenge. Adiponectin but not leptin partially reversed the effects of smoke on NK cell function in both obese (p = 0.002) and lean controls (p = 0.01). Conclusions/Significance Obese subjects have impaired NK cell activity that is more susceptible to the detrimental effects of cigarette smoke compared to lean subjects. This may play a role in the increase of cancer and infection seen in this population. Adiponectin is capable of restoring NK cell activity and may have therapeutic potential for immunity in obese subjects and smokers. PMID:20107494
Wingender, Gerhard; Schumak, Beatrix; Schurich, Anna; Gessner, J Engelbert; Endl, Elmar; Limmer, Andreas; Knolle, Percy A
2006-01-01
Dissemination of soluble molecules or antigens via the blood stream is considered to lead to a uniform distribution in the various organs of the body, but organ-specific microarchitecture and vascularization may influence this. Following intravenous injection of αCD3ε antibody (αCD3εAb) we observed clear differences in antibody binding to Fcγ receptor (FcγR)+ antigen-presenting cells (APCs) or T lymphocytes in different organs. Significant binding of blood-borne αCD3εAb was only detected in the spleen and liver and not in the thymus or lymph node. In the spleen, only 10% of dendritic cells/macrophages and 40% of T-cell receptor (TCR)-β+ cells were positive for αCD3εAb, and, dependent on FcγR-mediated cross-linking of αCD3εAb, a similar percentage of splenic TCR-β+ cells were stimulated and became CD69+. Stimulation of TCR-β+ cells in the liver was at least as efficient as in the spleen, but almost all T cells and all scavenger liver sinusoidal endothelial cells bound αCD3εAb. In contrast to CD69 up-regulation, only CD4+ natural killer T (NKT) cells and CD11ahigh CD8+ T cells were activated by αCD3εAb and expressed interferon (IFN)-γ. Again, IFN-γ release from NKT/T cells was at least as efficient in the liver as in the spleen. Taken together, our results support the notion that the combination of extensive hepatic vascularization and very high scavenger activity allows the liver to fulfill its metabolic tasks and to promote stimulation of the large but widely distributed hepatic population of NKT/T cells. PMID:16423047
Natural killer cells mediate severe liver injury in a murine model of halothane hepatitis.
Dugan, Christine M; Fullerton, Aaron M; Roth, Robert A; Ganey, Patricia E
2011-04-01
Severe halothane (HAL)-induced hepatotoxicity occurs in one in 6000-30,000 patients by an unknown mechanism. Female sex is a risk factor in humans and rodents. We tested the hypothesis that a sex difference in natural killer (NK) cell activity contributes to HAL-induced liver injury. HAL (15 mmol/kg, ip) treatment resulted in severe liver injury by 12 h in female, wild-type BALB/cJ mice, and the magnitude of liver injury varied with stage of the estrous cycle. Ovariectomized (OVX) mice developed only mild liver injury. Plasma interferon-gamma (IFN-γ) was elevated 10-fold in HAL-treated females compared with similarly treated male mice or with OVX female mice. IFN-γ knockout mice were resistant to severe HAL-induced liver injury. The deactivation of NK cells with anti-asialo GM1 treatment attenuated liver injury and the increase in plasma IFN-γ compared with immunoglobulin G-treated control mice. Mice with a mutated form of perforin, a protein involved in granule-mediated cytotoxicity, were protected from severe liver injury. Furthermore, HAL increased the activity of NK cells in vivo, as indicated by increased surface expression of CD69, an early activation marker. In response to HAL, NK cell receptor ligands on the surface of hepatocytes were expressed in a manner that can activate NK cells. These results confirm the sexual dimorphic hepatotoxic response to HAL in mice and suggest that IFN-γ and NK cells have essential roles in the development of severe HAL-induced hepatotoxicity.
Natural Killer Cells Mediate Severe Liver Injury in a Murine Model of Halothane Hepatitis
Dugan, Christine M.; Fullerton, Aaron M.; Roth, Robert A.; Ganey, Patricia E.
2011-01-01
Severe halothane (HAL)-induced hepatotoxicity occurs in one in 6000–30,000 patients by an unknown mechanism. Female sex is a risk factor in humans and rodents. We tested the hypothesis that a sex difference in natural killer (NK) cell activity contributes to HAL-induced liver injury. HAL (15 mmol/kg, ip) treatment resulted in severe liver injury by 12 h in female, wild-type BALB/cJ mice, and the magnitude of liver injury varied with stage of the estrous cycle. Ovariectomized (OVX) mice developed only mild liver injury. Plasma interferon-gamma (IFN-γ) was elevated 10-fold in HAL-treated females compared with similarly treated male mice or with OVX female mice. IFN-γ knockout mice were resistant to severe HAL-induced liver injury. The deactivation of NK cells with anti-asialo GM1 treatment attenuated liver injury and the increase in plasma IFN-γ compared with immunoglobulin G–treated control mice. Mice with a mutated form of perforin, a protein involved in granule-mediated cytotoxicity, were protected from severe liver injury. Furthermore, HAL increased the activity of NK cells in vivo, as indicated by increased surface expression of CD69, an early activation marker. In response to HAL, NK cell receptor ligands on the surface of hepatocytes were expressed in a manner that can activate NK cells. These results confirm the sexual dimorphic hepatotoxic response to HAL in mice and suggest that IFN-γ and NK cells have essential roles in the development of severe HAL-induced hepatotoxicity. PMID:21245496
Zhang, Xiaobo; De Paiva, Cintia S; Su, Zhitao; Volpe, Eugene A; Li, De-Quan; Pflugfelder, Stephen C
2014-01-01
Evidence suggests that the cytokine interferon (IFN)-γ released by natural killer and CD4(+) T cells contributes to the conjunctival goblet cell (GC) loss in dry eye. The purpose of this study was to investigate if topical neutralization of IFN-γ prevents or alleviates GC loss in an experimental desiccating stress (DS) model of dry eye. In this study, we found that topical IFN-γ neutralization significantly decreased DS-induced conjunctival GC loss. This was accompanied by decreased epithelial apoptosis, and increased IL-13 and decreased FoxA2 expression in the forniceal conjunctiva. To establish that IFN-γ produced by pathogenic CD4(+) T cells contributes to DS-induced GC loss, adoptive transfer of CD4(+) T cells isolated from DS exposed donors to naïve RAG-1(-/-) recipient mice was performed. Similar to the donor mice, topical IFN-γ neutralization decreased conjunctival GC loss, suppressed apoptosis and increased IL-13 expression in adoptive transfer recipients. In summary, this study demonstrated that topical neutralization of IFN-γ prevents GC loss via modulating apoptosis and maintaining IL-13 signaling. Copyright © 2013 Elsevier Ltd. All rights reserved.
Role of natural killer cells in innate protection against lethal ebola virus infection.
Warfield, Kelly L; Perkins, Jeremy G; Swenson, Dana L; Deal, Emily M; Bosio, Catharine M; Aman, M Javad; Yokoyama, Wayne M; Young, Howard A; Bavari, Sina
2004-07-19
Ebola virus is a highly lethal human pathogen and is rapidly driving many wild primate populations toward extinction. Several lines of evidence suggest that innate, nonspecific host factors are potentially critical for survival after Ebola virus infection. Here, we show that nonreplicating Ebola virus-like particles (VLPs), containing the glycoprotein (GP) and matrix protein virus protein (VP)40, administered 1-3 d before Ebola virus infection rapidly induced protective immunity. VLP injection enhanced the numbers of natural killer (NK) cells in lymphoid tissues. In contrast to live Ebola virus, VLP treatment of NK cells enhanced cytokine secretion and cytolytic activity against NK-sensitive targets. Unlike wild-type mice, treatment of NK-deficient or -depleted mice with VLPs had no protective effect against Ebola virus infection and NK cells treated with VLPs protected against Ebola virus infection when adoptively transferred to naive mice. The mechanism of NK cell-mediated protection clearly depended on perforin, but not interferon-gamma secretion. Particles containing only VP40 were sufficient to induce NK cell responses and provide protection from infection in the absence of the viral GP. These findings revealed a decisive role for NK cells during lethal Ebola virus infection. This work should open new doors for better understanding of Ebola virus pathogenesis and direct the development of immunotherapeutics, which target the innate immune system, for treatment of Ebola virus infection.
Schwaab, T; Heaney, J A; Schned, A R; Harris, R D; Cole, B F; Noelle, R J; Phillips, D M; Stempkowski, L; Ernstoff, M S
2000-04-01
The clinical observation of spontaneous regression in patients with renal cell carcinoma (RCC) and the response to various immunotherapeutic therapies strongly suggest a role for the host immune system in this disease. Prior studies showed that sequential administration of interferon (IFN) gamma and IFN alpha to RCC patients was safe. Clinical responses as well as immune changes in the peripheral blood mononuclear cell compartment were observed. Autologous tumor cell vaccines (AV) have also demonstrated activity in renal cell carcinoma. We hypothesize that the addition of AV to sequential IFN gamma and a therapy might improve the tumor-specific immune response by providing an appropriate source of antigen in the appropriate cytokine environment. To our knowledge, this is the first trial using AV combined with IFN alpha and IFN gamma. The purpose of this study was to evaluate the feasibility of manufacturing and administering (AV) from resected tumor samples, and administration of AV with combination IFN gamma and IFN alpha therapy. Finally, the impact on immunological parameters of these treatment options was assessed. Patients with metastatic RCC were randomly assigned to receive AV plus bCG along with a sequential administration of IFN gamma and a either together or after initiation of vaccine. Toxicity and clinical responses were evaluated. Modulations of the immune system were investigated by analyzing phenotype, cytokine mRNA expression, T cell proliferation and cytotoxicity in the peripheral blood mononuclear cell compartment. Fourteen patients with metastatic renal cell carcinoma were enrolled in this study; 9 were available for response evaluation. In a 70 day period, 3 (33%) showed mixed responses, 5 (56%) stable disease and 1 (11%) progression of disease. Toxicities were consistent with previous clinical reports. In the flow-cytometry phenotype analysis, stimulation of distinct subsets of circulating T-lymphocytes and a decrease of CD8+ T cell subsets was
Enstrom, A M; Lit, L; Onore, C E; Gregg, J P; Hansen, R; Pessah, I N; Hertz-Picciotto, I; Van de Water, J A; Sharp, F R; Ashwood, P
2009-01-01
Immune related abnormalities have repeatedly been reported in autism spectrum disorders (ASD), including evidence of immune dysregulation and autoimmune phenomena. NK cells may play an important role in neurodevelopmental disorders such as ASD. Here we performed a gene expression screen and cellular functional analysis on peripheral blood obtained from 52 children with ASD and 27 typically developing control children enrolled in the case-control CHARGE study. RNA expression of NK cell receptors and effector molecules were significantly upregulated in ASD. Flow cytometric analysis of NK cells demonstrated increased production of perforin, granzyme B, and interferon gamma (IFNγ) under resting conditions in children with ASD (p<0.01). Following NK cell stimulation in the presence of K562 target cells, the cytotoxicity of NK cells was significantly reduced in ASD compared with controls (p<0.02). Furthermore, under similar stimulation conditions the presence of perforin, granzyme B, and IFNγ in NK cells from ASD children was significantly lower compared with controls (p<0.001). These findings suggest possible dysfunction of NK cells in children with ASD. Abnormalities in NK cells may represent a susceptibility factor in ASD and may predispose to the development of autoimmunity and/or adverse neuroimmune interactions during critical periods of development. PMID:18762240
Manneberg, M.; Friedlein, A.; Kurth, H.; Lahm, H. W.; Fountoulakis, M.
1994-01-01
A soluble form of the human interferon gamma receptor that is required for the identification of interferon gamma antagonists was expressed in baculovirus-infected insect cells. The protein carried N-linked carbohydrate and showed a heterogeneity on denaturing polyacrylamide gels. We investigated the utilization of the potential sites for N-linked glycosylation and the structure of the carbohydrate moieties of this soluble receptor. Amino acid sequence analysis and ion spray mass spectrometry revealed that of the five potential sites for N-linked glycosylation, Asn17 and Asn69 were always utilized, whereas Asn62 and Asn162 were utilized in approximately one-third of the protein population. Asn223 was never found to be glycosylated. The soluble receptor was treated with N-glycosidase F and the oligosaccharides released were analyzed by matrix-assisted laser desorption mass spectrometry, which showed that the protein carried six types of short carbohydrate chains. The predominant species was a hexasaccharide of molecular mass 1,039, containing a fucose subunit linked to the proximal N-acetylglucosamine residue: [formula: see text] PMID:8142896
Inhibited interferon production after space flight
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Gould, C. L.; Williams, J.; Mandel, A. D.
1988-01-01
Several studies have been performed in our laboratories indicating that interferon production may be impaired in rodents after space flight. Using an antiorthostatic suspension model that simulates some of the effects of microgravity seen during space flight, we have shown that interferon-alpha/beta production was inhibited. The inhibition was not due solely to the stress of suspension. The inhibited interferon production was transient, as suspended animals returned to normal caging recovered the ability to produce interferon. Antiorthostatic suspension of mice also resulted in a loss of resistance to infection with the diabetogenic strain of encephalomyocarditis virus, which correlated with the drop in interferon production. In rats flown in US Space Shuttle mission SL-3, interferon-gamma production was inhibited severely when spleen cells were challenged with concanavalin-A upon return to earth. In contrast, interleukin-3 production by these cells was normal. These results suggest that immune responses may be altered after antiorthostatic modeling or space flight, and the resistance to viral infections may be especially affected.
Cerebrospinal fluid interferon-gamma-inducible protein 10 (IP-10, CXCL10) in HIV-1 infection.
Cinque, Paola; Bestetti, Arabella; Marenzi, Roberta; Sala, Serena; Gisslen, Magnus; Hagberg, Lars; Price, Richard W
2005-11-01
Interferon-gamma-inducible protein (IP-10 or CXCL10) is a potent chemoattractant and has been suggested to enhance retrovirus infection and mediate neuronal injury. In order to assess this chemokine in central nervous system (CNS) HIV infection, we measured the cerebrospinal fluid (CSF) and plasma concentrations of CXCL10 by immunoassay in samples derived from 97 HIV-infected subjects across a spectrum of immunological progression and CNS complications and from 16 HIV seronegative control subjects studied at three clinical centers between 1994 and 2001. We also examined changes in the CSF and plasma CXCL10 concentrations in 30 subjects starting and three stopping antiretroviral therapy. CSF CXCL10 concentrations: (1) correlated with CSF HIV RNA and white blood cell (WBC) counts, but not with blood CXCL10, HIV RNA, or CD4 counts; (2) were increased in subjects with primary and asymptomatic HIV infections and AIDS dementia complex, but less frequently in those with more advanced infection, with or without CNS opportunistic diseases except cytomegalovirus encephalitis; (3) decreased in subjects starting antiretroviral in association with decreases in CSF and plasma HIV RNA and CSF WBCs; and (4) conversely, increased in subjects stopping treatment in parallel with CSF HIV RNA and WBCs. These results confirm that CSF CXCL10 associates closely with both CSF HIV and WBCs and suggest that this chemokine may be both a response to and contributing determinant of local infection. High CSF levels may be useful in the diagnosis of ADC in subjects with advanced immunosuppression in whom CMV encephalitis has been ruled out, though this issue requires further study.
Rodríguez-Güell, Elisabeth; Agustí, Gemma; Corominas, Mercè; Cardona, Pere-Joan; Luquin, Marina; Julián, Esther
2008-01-01
Whole heat-killed Mycobacterium vaccae is used as an immunotherapeutic agent in tuberculosis (TB), but the compound(s) that triggers its immunostimulatory ability is not known. Here, we show that among different subcellular fractions, the cell wall skeleton induced a prominent expression of gamma interferon in splenocytes from both non-TB and TB M. vaccae-treated mice. PMID:18337379
Gamma Interferon-Induced T-Cell Loss in Virulent Mycobacterium avium Infection
Flórido, Manuela; Pearl, John E.; Solache, Alejandra; Borges, Margarida; Haynes, Laura; Cooper, Andrea M.; Appelberg, Rui
2005-01-01
Infection by virulent Mycobacterium avium caused progressive severe lymphopenia in C57BL/6 mice due to increased apoptosis rates. T-cell depletion did not occur in gamma interferon (IFN-γ)-deficient mice which showed increased T-cell numbers and proliferation; in contrast, deficiency in nitric oxide synthase 2 did not prevent T-cell loss. Although T-cell loss was IFN-γ dependent, expression of the IFN-γ receptor on T cells was not required for depletion. Similarly, while T-cell loss was optimal if the T cells expressed IFN-γ, CD8+ T-cell depletion could occur in the absence of T-cell-derived IFN-γ. Depletion did not require that the T cells be specific for mycobacterial antigen and was not affected by deficiencies in the tumor necrosis factor receptors p55 or p75, the Fas receptor (CD95), or the respiratory burst enzymes or by forced expression of bcl-2 in hematopoietic cells. PMID:15908387
Williams, Roderick; Dias, Daniel A; Jayasinghe, Nirupama; Roessner, Ute; Bennett, Louise E
2016-04-15
Regulation of the human immune system requires controlled pro- and anti-inflammatory responses for host defence against infection and disease states. Yeasts (Saccharomyces cerevisiae), as used in brewing and baking, are mostly known for ability to stimulate the human immune-system predominantly reflecting the pro-inflammatory cell wall β-glucans. However, in this study, using food-compatible processing methods, glycopeptide-enriched and β-glucan-depleted products were each prepared from Brewer's and Baker's yeasts, which suppressed production of interferon-γ (IFN-γ) in human whole blood cell assay, signifying that anti-inflammatory factors are also present in yeast. Anti-inflammatory bioactivities of products prepared from Brewer's and Baker's yeast were compared with the commercial yeast product, Epicor®. While unfractionated Epicor was inactive, the C18 resin-binding fractions of Brewer's and Baker's yeast products and Epicor dose-dependently lowered IFN-γ, demonstrating that Epicor also contained both pro-inflammatory (β-glucans) and anti-inflammatory components. Anti-inflammatory activity was attributed to C18 resin-binding species glyco-peptides in Epicor and experimental yeast products. This study demonstrated that pro- and anti-inflammatory factors could be resolved and enriched in yeasts by suitable processing, with potential to improve specific activities. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.
Giavedoni, Luis D.; Velasquillo, M. Cristina; Parodi, Laura M.; Hubbard, Gene B.; Hodara, Vida L.
2000-01-01
We studied the innate and adaptive immune system of rhesus macaques infected with the virulent simian immunodeficiency virus isolate SIVmac251 by evaluating natural killer (NK) cell activity, cytokine levels in plasma, humoral and virological parameters, and changes in the activation markers CD25 (interleukin 2R [IL-2R] α chain), CD69 (early activation marker), and CD154 (CD40 ligand) in lymphoid cells. We found that infection with SIVmac251 induced the sequential production of interferon-α/β (IFN-α/β), IL-18, and IL-12. IFN-γ, IL-4, and granulocyte-macrophage colony-stimulating factor were undetected in plasma by the assays used. NK cell activity peaked at 1 to 2 weeks postinfection and paralleled changes in viral loads. Maximum expression of CD69 on CD3−CD16+ lymphocytes correlated with NK cytotoxicity during this period. CD25 expression, which is associated with proliferation, was static or slightly down-regulated in CD4+ T cells from both peripheral blood (PB) and lymph nodes (LN). CD69, which is normally present in LN CD4+ T cells and absent in peripheral blood leukocyte (PBL) CD4+ T cells, was down-regulated in LN CD4+ T cells and up-regulated in PBL CD4+ T cells immediately after infection. CD8+ T cells increased CD69 but not CD25 expression, indicating the activation of this cellular subset in PB and LN. Finally, CD154 was transiently up-regulated in PBL CD4+ T cells but not in LN CD4+ T cells. Levels of antibodies to SIV Gag and Env did not correlate with the level of activation of CD154, a critical costimulatory molecule for T-cell-dependent immunity. In summary, we present the first documented evidence that the innate immune system of rhesus macaques recognizes SIV infection by sequential production of proinflammatory cytokines and transient activation of NK cytotoxic activity. Additionally, pathogenic SIV induces drastic changes in the level of activation markers on T cells from different anatomic compartments. These changes involve activation
Pokryszko-Dragan, A; Frydecka, I; Kosmaczewska, A; Ciszak, L; Bilińska, M; Gruszka, E; Podemski, R; Frydecka, D
2012-10-01
The aim of the study was to evaluate the stimulated production of interferon-gamma (IFNγ) by peripheral CD3+CD4+ T lymphocytes in patients with multiple sclerosis (MS) with regard to the degree of fatigue, and to investigate relationships between immunological parameters, level of depression and clinical variables. Forty MS patients (30 women, 10 men, aged 22-60 years): 20 fatigued and 20 non-fatigued were involved in the study. Fatigue was evaluated using the Fatigue Severity Scale (FSS) and Modified Fatigue Impact Scale (MFIS), depression level - using Beck Depression Inventory (BDI). Production of IFNγ by stimulated peripheral blood CD3+CD4+ T lymphocytes, assessed using flow cytometry, was compared between MS patients with different levels of fatigue and controls. Correlations were searched out between immunological findings and BDI, age, duration and course of MS, relapse rate, disability (assessed in Expanded Disability Status Scale - EDSS) and its progression. Stimulated production of IFNγ by CD3+CD4+ T lymphocytes was higher in severely fatigued patients in comparison with non-fatigued ones and controls, tended to correlate with FSS and MFIS, and correlated with BDI. No relationships were found between immunological findings and disease-related variables. Stimulated production of IFNγ by peripheral CD3+CD4+ T lymphocytes is related to fatigue and depression in MS patients. Copyright © 2012 Elsevier B.V. All rights reserved.
The tuberculin skin test increases the responses measured by T cell interferon-gamma release assays.
Vilaplana, C; Ruiz-Manzano, J; Gil, O; Cuchillo, F; Montané, E; Singh, M; Spallek, R; Ausina, V; Cardona, P J
2008-06-01
RUTI is a vaccine consisting of Mycobacterium tuberculosis bacilli grown in stress conditions that is fragmented, detoxified and liposomed. RUTI was designed to shorten the treatment of latent tuberculosis infection (LTBI) with isoniazid from 9 months to just 1 month, by additional treatment with two inoculations of RUTI 4 weeks apart. During the validation process for monitoring the immunogenicity of administration of RUTI in a Phase I clinical trial, the question arose whether to introduce the tuberculin skin test (TST) in the screening of non-LTBI volunteers. This study was designed to evaluate the effect of TST on subsequent different T-cell interferon-gamma release assay (TIGRA) responses, using a spectrum of M. tuberculosis-related antigens (ESAT-6, CFP-10, 16 kDa, 19 kDa, MPT64, Ag 85B, 38 kDa, hsp65, PPD and BCG). The results showed an increase in post-TST response even in non-LTBI subjects for most antigens tested, as measured both by whole blood assay (WBA) and ELISPOT. Increased ELISPOT response decreased toward pre-TST levels within 1 month whereas the WBA response did not. Taking into account that there is no definitive correlation between TST and TIGRA tests to diagnose LTBI and the feasibility that TST might alter the immune monitoring included in clinical trials, these data suggest that TST determination should be carefully planned to avoid any interference with TIGRA.
Designing of interferon-gamma inducing MHC class-II binders
2013-01-01
Background The generation of interferon-gamma (IFN-γ) by MHC class II activated CD4+ T helper cells play a substantial contribution in the control of infections such as caused by Mycobacterium tuberculosis. In the past, numerous methods have been developed for predicting MHC class II binders that can activate T-helper cells. Best of author’s knowledge, no method has been developed so far that can predict the type of cytokine will be secreted by these MHC Class II binders or T-helper epitopes. In this study, an attempt has been made to predict the IFN-γ inducing peptides. The main dataset used in this study contains 3705 IFN-γ inducing and 6728 non-IFN-γ inducing MHC class II binders. Another dataset called IFNgOnly contains 4483 IFN-γ inducing epitopes and 2160 epitopes that induce other cytokine except IFN-γ. In addition we have alternate dataset that contains IFN-γ inducing and equal number of random peptides. Results It was observed that the peptide length, positional conservation of residues and amino acid composition affects IFN-γ inducing capabilities of these peptides. We identified the motifs in IFN-γ inducing binders/peptides using MERCI software. Our analysis indicates that IFN-γ inducing and non-inducing peptides can be discriminated using above features. We developed models for predicting IFN-γ inducing peptides using various approaches like machine learning technique, motifs-based search, and hybrid approach. Our best model based on the hybrid approach achieved maximum prediction accuracy of 82.10% with MCC of 0.62 on main dataset. We also developed hybrid model on IFNgOnly dataset and achieved maximum accuracy of 81.39% with 0.57 MCC. Conclusion Based on this study, we have developed a webserver for predicting i) IFN-γ inducing peptides, ii) virtual screening of peptide libraries and iii) identification of IFN-γ inducing regions in antigen (http://crdd.osdd.net/raghava/ifnepitope/). Reviewers This article was reviewed by Prof Kurt
Agosti, J M; Coombs, R W; Collier, A C; Paradise, M A; Benedetti, J K; Jaffe, H S; Corey, L
1992-05-01
To determine safety and efficacy of tumor necrosis factor (TNF) and interferon-gamma (IFN gamma) in the treatment of patients with acquired immunodeficiency syndrome (AIDS)-related complex, a randomized, double-blind study was conducted. Twenty-five patients with AIDS-related complex and CD4 lymphocytes less than or equal to 500 x 10(6)/L attended an AIDS Clinical Trials Unit of a tertiary referral center. Patients were administered tumor necrosis factor (TNF) (10 micrograms/m2) or IFN gamma (10 micrograms/m2), or both intramuscularly three times weekly for 16 weeks. Side effects from all three preparations included fever, constitutional symptoms, and local reactions. No significant hematologic, hepatic, renal, or coagulation abnormalities were observed. CD4 lymphocyte counts, beta 2-microglobulin, p24 antigen levels, and anti-p24 antibody did not change significantly during therapy. Similarly, no significant change was noted in rates of HIV isolation from peripheral blood mononuclear cells or plasma. TNF and IFN gamma were tolerable after premedication with acetaminophen; however, no significant change in markers of human immunodeficiency virus infection was demonstrated. These cytokines alone do not appear to be of benefit, nor do they appear to hasten the progression of HIV infection.
Komohara, Yoshihiro; Takemura, Kenichi; Lei, Xiao Feng; Sakashita, Naomi; Harada, Mamoru; Suzuki, Hiroshi; Kodama, Tatsuhiko; Takeya, Motohiro
2009-11-01
Class A scavenger receptors (SR-A, CD204) are highly expressed in tumor-associated macrophages (TAM). To investigate the function of SR-A in TAM, wild-type and SR-A-deficient (SR-A(-/-)) mice were injected with EL4 cells. Although these groups of mice did not differ in the numbers of infiltrating macrophages and lymphocytes and in neovascularization, SR-A(-/-) mice had delayed growth of EL4 tumors. Expression of inducible nitric oxide (NO) synthase and interferon (IFN)-gamma mRNA increased significantly in tumor tissues from SR-A(-/-) mice. Engulfment of necrotic EL4 cells induced upregulation of NO and IFN-gamma production by cultured macrophages, and production of NO and IFN-gamma increased in SR-A(-/-) macrophages in vitro. IFN-beta production by cultured macrophages was also elevated in SR-A(-/-) macrophages in vitro. These results suggested that the antitumor activity of macrophages increased in SR-A(-/-) mice because of upregulation of NO and IFN-gamma production. These data indicate an important role of SR-A in regulating TAM function by inhibiting toll-like receptor (TLR)4-IFN-beta signaling.
Qin, Xin-Tian; Lu, Yue; Tan, Yin-Duo; Chen, Xiao-Qin; Gen, Qi-Rong
2008-01-01
We have constructed plasmid "pTre-IFN-gamma" and proved that the Tet-off system could regulate the expression of human interferon-gamma (IFN-gamma) gene in murine marrow stromal cells in vitro. This study was to investigate the regulatory reversibility of Tet-off system and its effect on the expression of human IFN-gamma gene in murine marrow stromal cells in mice. Plasmids pTet-off and pTre-IFN-gamma were co-transfected into murine marrow stromal cells. The expression of IFN-gamma in marrow stromal cells was detected with ELISA. The marrow stromal cells were transfused into BABL/c naked mice after co-transfection. The expression of IFN-gamma mRNA in the spleen was detected by real-time fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR). IFN-gamma protein was detected in the culture solution of marrow stromal cells after co-transfection. The secretion peak appeared within the first 72 h. The protein level of IFN-gamma was significantly lower in 300 ng/ml tetracycline hydrochloride-treated marrow stroma cells than in untreated cells [(67.11+/-22.14) pg/1 x 10(7) cells vs. (319.96+/-29.04) pg/1 x 10(7) cells, P<0.001]; its expression was increased when removed tetracycline hydrochloride (P=0.032). The expression of human IFN-gamma mRNA was detected in the spleen. The mRNA level of IFN-gamma was significantly higher in untreated group than in continuous tetracycline hydrochloride-treated group [(1.5+/-0.7)x10(5) copies . (100 mg)(-1) vs. (6.9+/-5.3)x10(2) copies . (100 mg)(-1), P<0.001]; its expression in the mice received tetracycline hydrochloride for one single time lay between the above two groups with significant difference. In mice, Tet-off system could rapidly, efficiently and reversibly regulate the expression of human IFN-gamma gene in marrow stromal cells in vitro and in vivo.
Clarke, Michael W; Ward, Natalie C; Wu, Jason H Y; Hodgson, Jonathan M; Puddey, Ian B; Croft, Kevin D
2006-01-01
Some studies have shown potential benefit of vitamin E on platelet function, but several clinical trials failed to show improved cardiovascular outcome with alpha-tocopherol supplementation. Gamma-tocopherol, a major dietary form of vitamin E, may have protective properties different from those of alpha-tocopherol. We compared the effects of supplementation with alpha-tocopherol (500 mg) and a gamma-tocopherol-rich compound (500 mg, containing 60% gamma-tocopherol) on serum and cellular tocopherol concentrations, urinary tocopherol metabolite excretion, and in vivo platelet activation in subjects with type 2 diabetes. Fifty-eight subjects were randomly assigned to receive either 500 mg alpha-tocopherol/d, 500 mg mixed tocopherols/d, or matching placebo. Serum, erythrocyte, and platelet tocopherol and urinary metabolite concentrations were measured at baseline and after the 6-wk intervention. Soluble CD40 ligand, urinary 11-dehydro-thromboxane B2, serum thromboxane B2, soluble P-selectin, and von Willebrand factor were measured as biomarkers of in vivo platelet activation. Serum alpha-tocopherol increased with both tocopherol treatments. Serum and cellular gamma-tocopherol increased 4-fold (P < 0.001) in the mixed tocopherol group, whereas red blood cell gamma-tocopherol decreased significantly after alpha-tocopherol supplementation. Excretion of alpha-carboxyethyl-hydroxychroman increased significantly after supplementation with alpha-tocopherol and mixed tocopherols. Excretion of gamma-carboxyethyl-hydroxychroman increased significantly after supplementation with mixed tocopherols and after that with alpha-tocopherol, which may reflect the displacement of gamma-tocopherol by alpha-tocopherol due to incorporation of the latter into lipoproteins in the liver. Neither treatment had any significant effect on markers of platelet activation. Supplementation with alpha-tocopherol decreased red blood cell gamma-tocopherol, whereas mixed tocopherols increased both serum
Morris, L; Troutt, A B; McLeod, K S; Kelso, A; Handman, E; Aebischer, T
1993-01-01
For murine cutaneous leishmaniasis, data to date suggest a correlation between the presence of gamma interferon (IFN-gamma) and resistance in C57BL/6 mice and the presence of interleukin-4 (IL-4) and disease in BALB/c mice. In this study, 13 inbred strains of mice covering the range of susceptibility to disease were infected with Leishmania major to determine whether the subsequent expression of IFN-gamma or IL-4 is a reliable indicator of cure or progressive disease. The presence of IL-4 and IFN-gamma mRNAs in the draining lymph nodes was examined 9 weeks after infection, when differences in disease severity became obvious. There were large differences in the levels of IL-4 mRNA among the different strains, whereas IFN-gamma mRNA was detected at similar levels in all strains. The levels of IL-4 mRNA correlated with lesion score, with susceptible and intermediate strains containing up to 100-fold more than any of the resistant strains. Differences in the levels of IFN-gamma mRNA were within only a fourfold range, with significant overlap among susceptible, intermediate, and resistant strains. Similarly, the levels of IFN-gamma secreted in vitro by lymph node cells from infected mice in response to L. major antigens were within a 10-fold range for most strains, and there was no correlation with lesion score. Analysis of Leishmania-specific antibody levels revealed a correlation between immunoglobulin G1 (IgG1) titers and lesion score, consistent with the role of IL-4 as a switch factor for IgG1. In contrast, there was no correlation between IgG2a titers and lesion score, supporting the notion that IFN-gamma synthesis (which promotes IgG2a production) is not correlated with disease state. These data suggest that along the spectrum of murine cutaneous leishmaniasis, IL-4 is a reliable indicator of disease, but IFN-gamma is not prognostic for resistance. Images PMID:8335376
DOE Office of Scientific and Technical Information (OSTI.GOV)
Badger, A.M.; Swift, B.; Sung, C.P.
1986-03-05
Recombinant murine gamma interferon (IFN-..gamma..) activates oil elicited C57BL/6 peritoneal macrophages to inhibit the growth of Listeria. Maximum activity is obtained with 10-20 units/ml, can be demonstrated in the absence of antibiotics and is not due to LPS contamination. Studies of the kinetics of this phenomenon demonstrate that a 30 minute incubation with IFN-..gamma.. is sufficient to initiate the antiproliferative state and full activity can be obtained with a 4 hour incubation. Alpha/beta interferon (IFN-..cap alpha../..beta..) is also active but requires 100X more units to obtain equivalent activity. The evaluation of a number of other BRMS demonstrated that MDP andmore » LPS could stimulate phagocytosis of Listeria but could not inhibit their growth. Bestatin, tuftsin, Con A, A23187 and Poly I:C did not stimulate either phagocytosis or growth inhibitory activity. These compounds were also tested for their ability to enhance the release of superoxide anion from PMA stimulated macrophages. With the exception of tuftsin and bestatin all of the BRMS tested were able to enhance the production of oxidative burst products confirming the findings of others of the dissociation between the two functions.« less
Zribi, Lilia; El-Goulli, Amel F; Ben-Abid, Meriem; Gharbi, Mohamed; Ben-Sghaier, Ines; Boufaden, Imed; Aoun, Karim; Bouratbine, Aïda
2017-11-15
Interferon-Gamma (IFN-γ) Release Assays (IGRAs) are easy tests that allow rapid screening of primed memory T-cells immunity in response to antigen. The aim of this study was to use IGRA to assess IFN-γ release in response to Soluble Leishmania infantum antigen (SLA) in whole blood of dogs living in endemic area of visceral leishmaniasis and to interpret IGRA results according to clinical examination, specific anti-Leishmania humoral response and presence of L. infantum DNA in blood. The study was carried out on 56 dogs living in greater Tunis area. Physical examination, quantitative serology and PCR on blood were used to characterize dogs' status in relation to Leishmania infection and disease. IGRA consisted on testing by ELISA for IFN-γ-secretion in whole blood after a 20-h challenge with SLA. PBS and Phytohemagglutinin (PHA) stimulations were used as controls. Four groups of dogs were characterized: 31 were negative by both serology and PCR, two had doubtful serology, 10 presented no to mild clinical signs but low antibodies levels and 13 were affected by Canine Leishmaniasis (CanL). In seronegative dogs, IGRA was little contributory in 4 puppies (age <6months) and 5 old dogs (median age=72months, IQR: 45-84 months) that didn't respond to PHA stimulation, IGRA was negative in 19 and positive in three animals with lymph node enlargement. In dogs with doubtful serology, IGRA was positive in one dog and negative in the other. In infected dogs with no to mild clinical signs, one dog exhibited high level of IFN-γ in absence of antigenic stimulation and all the other were positive by IGRA. CanL dogs showed variable IGRA results. Negative IGRAs (n=4) were shown in animals with the highest parasitic burden whereas positive IGRAs (n=5) were shown in dogs with negative PCR or low parasitic load. The 4 remaining dogs either didn't respond to PHA (n=2) or showed non-specific secretion in PBS tube (n=2). The results of this study showed that IGRA is a useful new tool
Urushiol (poison ivy)-triggered suppressor T cell clone generated from peripheral blood.
Kalish, R S; Morimoto, C
1988-01-01
Allergic contact dermatitis to Toxicodendron radicans (poison ivy) is mediated by the hapten urushiol. An urushiol-specific, interleukin 2 (IL-2)-dependent T cell clone (RLB9-7) was generated from the peripheral blood of a patient with a history of allergic contact dermatitis to T. radicans. This clone proliferated specifically to both leaf extract and pure urushiol. Although the clone had the phenotype CD3+CD4+CD8+, proliferation to antigen was blocked by anti-CD8 and anti-HLA-A, B, C, but not by anti-CD4, suggesting that CD4 was not functionally associated with the T cell receptor. Furthermore, studies with antigen-presenting cells from MHC-typed donors indicated that the clone was MHC class 1 restricted. RLB9-7 was WT31 positive, indicating it bears the alpha beta T cell receptor. The clone lacked significant natural killer cell activity and produced only low levels of IL-2 or gamma-interferon upon antigen stimulation. Addition of RLB9-7 to autologous peripheral blood mononuclear cells in the presence of urushiol inhibited the pokeweed mitogen-driven IgG synthesis. This suppression was resistant to irradiation (2,000 rad) and was not seen when RLB9-7 was added to allogeneic cells, even in the presence of irradiated autologous antigen-presenting cells, suggesting that suppression was MHC restricted and not mediated by nonspecific soluble factors. However, RLB9-7 cells in the presence of urushiol inhibited the synthesis of tetanus toxoid-specific IgG by autologous lymphocytes, indicating that the suppression, although triggered specifically by urushiol, was nonspecific. PMID:2458387
Inflammation activates the interferon signaling pathways in taste bud cells.
Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan
2007-10-03
Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.
van Gorkom, T; Sankatsing, S U C; Voet, W; Ismail, D M; Muilwijk, R H; Salomons, M; Vlaminckx, B J M; Bossink, A W J; Notermans, D W; Bouwman, J J M; Kremer, K; Thijsen, S F T
2018-04-01
Two-tier serology testing is most frequently used for the diagnosis of Lyme borreliosis (LB); however, a positive result is no proof of active disease. To establish a diagnosis of active LB, better diagnostics are needed. Tests investigating the cellular immune system are available, but studies evaluating the utility of these tests on well-defined patient populations are lacking. Therefore, we investigated the utility of an enzyme-linked immunosorbent spot (ELISpot) assay to diagnose active Lyme neuroborreliosis. Peripheral blood mononuclear cells (PBMCs) of various study groups were stimulated by using Borrelia burgdorferi strain B31 and various recombinant antigens, and subsequently, the number of Borrelia -specific interferon gamma (IFN-γ)-secreting T cells was measured. We included 33 active and 37 treated Lyme neuroborreliosis patients, 28 healthy individuals treated for an early manifestation of LB in the past, and 145 untreated healthy individuals. The median numbers of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs did not differ between active Lyme neuroborreliosis patients (6.0; interquartile range [IQR], 0.5 to 14.0), treated Lyme neuroborreliosis patients (4.5; IQR, 2.0 to 18.6), and treated healthy individuals (7.4; IQR, 2.3 to 14.9) ( P = 1.000); however, the median number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs among untreated healthy individuals was lower (2.0; IQR, 0.5 to 3.9) ( P ≤ 0.016). We conclude that the Borrelia ELISpot assay, measuring the number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs, correlates with exposure to the Borrelia bacterium but cannot be used for the diagnosis of active Lyme neuroborreliosis. Copyright © 2018 van Gorkom et al.
van Gorkom, T.; Sankatsing, S. U. C.; Voet, W.; Ismail, D. M.; Muilwijk, R. H.; Salomons, M.; Vlaminckx, B. J. M.; Bossink, A. W. J.; Notermans, D. W.; Bouwman, J. J. M.; Kremer, K.
2018-01-01
ABSTRACT Two-tier serology testing is most frequently used for the diagnosis of Lyme borreliosis (LB); however, a positive result is no proof of active disease. To establish a diagnosis of active LB, better diagnostics are needed. Tests investigating the cellular immune system are available, but studies evaluating the utility of these tests on well-defined patient populations are lacking. Therefore, we investigated the utility of an enzyme-linked immunosorbent spot (ELISpot) assay to diagnose active Lyme neuroborreliosis. Peripheral blood mononuclear cells (PBMCs) of various study groups were stimulated by using Borrelia burgdorferi strain B31 and various recombinant antigens, and subsequently, the number of Borrelia-specific interferon gamma (IFN-γ)-secreting T cells was measured. We included 33 active and 37 treated Lyme neuroborreliosis patients, 28 healthy individuals treated for an early manifestation of LB in the past, and 145 untreated healthy individuals. The median numbers of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs did not differ between active Lyme neuroborreliosis patients (6.0; interquartile range [IQR], 0.5 to 14.0), treated Lyme neuroborreliosis patients (4.5; IQR, 2.0 to 18.6), and treated healthy individuals (7.4; IQR, 2.3 to 14.9) (P = 1.000); however, the median number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs among untreated healthy individuals was lower (2.0; IQR, 0.5 to 3.9) (P ≤ 0.016). We conclude that the Borrelia ELISpot assay, measuring the number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 105 PBMCs, correlates with exposure to the Borrelia bacterium but cannot be used for the diagnosis of active Lyme neuroborreliosis. PMID:29367297
NASA Astrophysics Data System (ADS)
Taik Lim, Yong; Cho, Mi Young; Noh, Young-Woock; Chung, Jin Woong; Chung, Bong Hyun
2009-11-01
This study describes the development of near-infrared optical imaging technology for the monitoring of immunotherapeutic cell-based cancer therapy using natural killer (NK) cells labeled with fluorescent nanocrystals. Although NK cell-based immunotherapeutic strategies have drawn interest as potent preclinical or clinical methods of cancer therapy, there are few reports documenting the molecular imaging of NK cell-based cancer therapy, primarily due to the difficulty of labeling of NK cells with imaging probes. Human natural killer cells (NK92MI) were labeled with anti-human CD56 antibody-coated quantum dots (QD705) for fluorescence imaging. FACS analysis showed that the NK92MI cells labeled with anti-human CD56 antibody-coated QD705 have no effect on the cell viability. The effect of anti-human CD56 antibody-coated QD705 labeling on the NK92MI cell function was investigated by measuring interferon gamma (IFN- γ) production and cytolytic activity. Finally, the NK92MI cells labeled with anti-human CD56 antibody-coated QD705 showed a therapeutic effect similar to that of unlabeled NK92MI cells. Images of intratumorally injected NK92MI cells labeled with anti-human CD56 antibody-coated could be acquired using near-infrared optical imaging both in vivo and in vitro. This result demonstrates that the immunotherapeutic cells labeled with fluorescent nanocrystals can be a versatile platform for the effective tracking of injected therapeutic cells using optical imaging technology, which is very important in cell-based cancer therapies.
Kim, S; Ponka, P
2000-03-03
Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.
Viral Evasion of Natural Killer Cell Activation
Ma, Yi; Li, Xiaojuan; Kuang, Ersheng
2016-01-01
Natural killer (NK) cells play a key role in antiviral innate defenses because of their abilities to kill infected cells and secrete regulatory cytokines. Additionally, NK cells exhibit adaptive memory-like antigen-specific responses, which represent a novel antiviral NK cell defense mechanism. Viruses have evolved various strategies to evade the recognition and destruction by NK cells through the downregulation of the NK cell activating receptors. Here, we review the recent findings on viral evasion of NK cells via the impairment of NK cell-activating receptors and ligands, which provide new insights on the relationship between NK cells and viral actions during persistent viral infections. PMID:27077876
Viral Evasion of Natural Killer Cell Activation.
Ma, Yi; Li, Xiaojuan; Kuang, Ersheng
2016-04-12
Natural killer (NK) cells play a key role in antiviral innate defenses because of their abilities to kill infected cells and secrete regulatory cytokines. Additionally, NK cells exhibit adaptive memory-like antigen-specific responses, which represent a novel antiviral NK cell defense mechanism. Viruses have evolved various strategies to evade the recognition and destruction by NK cells through the downregulation of the NK cell activating receptors. Here, we review the recent findings on viral evasion of NK cells via the impairment of NK cell-activating receptors and ligands, which provide new insights on the relationship between NK cells and viral actions during persistent viral infections.
Phototoxic effects of lysosome-associated genetically encoded photosensitizer KillerRed
NASA Astrophysics Data System (ADS)
Serebrovskaya, Ekaterina O.; Ryumina, Alina P.; Boulina, Maria E.; Shirmanova, Marina V.; Zagaynova, Elena V.; Bogdanova, Ekaterina A.; Lukyanov, Sergey A.; Lukyanov, Konstantin A.
2014-07-01
KillerRed is a unique phototoxic red fluorescent protein that can be used to induce local oxidative stress by green-orange light illumination. Here we studied phototoxicity of KillerRed targeted to cytoplasmic surface of lysosomes via fusion with Rab7, a small GTPase that is known to be attached to membranes of late endosomes and lysosomes. It was found that lysosome-associated KillerRed ensures efficient light-induced cell death similar to previously reported mitochondria- and plasma membrane-localized KillerRed. Inhibitory analysis demonstrated that lysosomal cathepsins play an important role in the manifestation of KillerRed-Rab7 phototoxicity. Time-lapse monitoring of cell morphology, membrane integrity, and nuclei shape allowed us to conclude that KillerRed-Rab7-mediated cell death occurs via necrosis at high light intensity or via apoptosis at lower light intensity. Potentially, KillerRed-Rab7 can be used as an optogenetic tool to direct target cell populations to either apoptosis or necrosis.
Histaminergic regulation of interferon-gamma (IFN-γ) production by human natural killer (NK) cells
ASEA, A; HANSSON, M; CZERKINSKY, C; HOUZE, T; HERMODSSON, S; STRANNEGÅRD, Ö; HELLSTRAND, K
1996-01-01
Monocytes, recovered from human peripheral blood by counter-current centrifugal elutriation, effectively inhibit the production of IFN-γ by CD3−/56+ NK cells in response to IL-2. This study aimed at defining the nature of the inhibitory signal, particularly the importance of monocyte-derived reactive metabolites of oxygen. It was found that monocytes recovered from patients with chronic granulomatous disease (CGD), a condition characterized by deficient NADPH-oxidase activity of phagocytes, did not inhibit IFN-γ production by NK cells. Further, catalase, a scavenger of hydrogen peroxide, completely reversed the inhibitory signal, whereas scavengers of the superoxide anion, hypohalous acids, the hydroxyl radical, or nitric oxide synthesis inhibitors such as L-NMMA were ineffective. Inhibition of IFN-γ production was operating on a pre-translational level, as indicated by the inability of enriched NK cells to accumulate IFN-γ mRNA in the presence of elutriated monocytes. Hydrogen peroxide, at micromolar concentrations, reconstituted the inhibition of IFN-γ production when added to enriched NK cells. Histamine, a biogenic amine which inhibits the generation of reactive oxygen metabolites in monocytes, abrogated the inhibition of IFN-γ production in NK cells; by this mechanism, histamine strongly synergized with IL-2 to induce IFN-γ in mixtures of NK cells and monocytes. The synergizing effect of histamine was specifically mediated by H2-type histamine receptors. We conclude that: (i) the induction of IFN-γ mRNA in NK cells is effectively down-regulated by products of the oxidative metabolism of monocytes; and (ii) histamine effectively enhances IFN-γ production by preventing monocyte-induced oxidative damage to NK cells. PMID:8706348
Morales-Menchén, Ana; Navarro-García, Federico; Guirao-Abad, José P.; Román, Elvira; Prieto, Daniel; Coman, Ioana V.; Pla, Jesús; Alonso-Monge, Rebeca
2018-01-01
Certain yeasts secrete peptides known as killer toxins or mycocins with a deleterious effect on sensitive yeasts or filamentous fungi, a common phenomenon in environmental species. In a recent work, different Debaryomyces hansenii (Dh) strains isolated from a wide variety of cheeses were identified as producing killer toxins active against Candida albicans and Candida tropicalis. We have analyzed the killer activity of these toxins in C. albicans mutants defective in MAPK signaling pathways and found that the lack of the MAPK Hog1 (but not Cek1 or Mkc1) renders cells hypersensitive to Dh mycocins while mutants lacking other upstream elements of the pathway behave as the wild type strain. Point mutations in the phosphorylation site (T174A-176F) or in the kinase domain (K52R) of HOG1 gene showed that both activities were relevant for the survival of C. albicans to Dh killer toxins. Moreover, Hog1 phosphorylation was also required to sense and adapt to osmotic and oxidative stress while the kinase activity was somehow dispensable. Although the addition of supernatant from the killer toxin- producing D. hansenii 242 strain (Dh-242) induced a slight intracellular increase in Reactive Oxygen Species (ROS), overexpression of cytosolic catalase did not protect C. albicans against this mycocin. This supernatant induced an increase in intracellular glycerol concentration suggesting that this toxin triggers an osmotic stress. We also provide evidence of a correlation between sensitivity to Dh-242 killer toxin and resistance to Congo red, suggesting cell wall specific alterations in sensitive strains. PMID:29774204
Interferon in lyssavirus infection.
Rieder, Martina; Finke, Stefan; Conzelmann, Karl-Klaus
2012-01-01
Rabies is a zoonosis still claiming more than 50 000 human deaths per year. Typically, human cases are due to infection with rabies virus, the prototype of the Lyssavirus genus, but sporadic cases of rabies-like encephalitis caused by other lyssaviruses have been reported. In contrast to rabies virus, which has an extremely broad host range including many terrestrial warm-blooded animals, rabies-related viruses are associated predominantly with bats and rarely infect terrestrial species. In spite of a very close genetic relationship of rabies and rabies-related viruses, the factors determining the limited host range of rabies-related viruses are not clear. In the past years the importance of viral countermeasures against the host type I interferon system for establishment of an infection became evident. The rabies virus phosphoprotein (P) has emerged as a critical factor required for paralysing the signalling cascades leading to transcriptional activation of interferon genes as well as interferon signalling pathways, thereby limiting expression of antiviral and immune stimulatory genes. Comparative studies would be of interest in order to determine whether differential abilities of the lyssavirus P proteins contribute to the restricted host range of lyssaviruses.
Shaw, Patrick J; Ditewig, Amy C; Waring, Jeffrey F; Liguori, Michael J; Blomme, Eric A; Ganey, Patricia E; Roth, Robert A
2009-01-01
The antibiotic trovafloxacin (TVX) has caused severe idiosyncratic hepatotoxicity in people, whereas levofloxacin (LVX) has not. Mice cotreated with TVX and lipopolysaccharide (LPS), but not with LVX and LPS, develop severe hepatocellular necrosis. Mice were treated with TVX and/or LPS, and hepatic gene expression changes were measured before liver injury using gene array. Hepatic gene expression profiles from mice treated with TVX/LPS clustered differently from those treated with LPS or TVX alone. Several of the probe sets expressed differently in TVX/LPS-treated mice were involved in interferon (IFN) signaling and the janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. A time course of plasma concentrations of IFN-gamma and interleukin (IL)-18, which directly induces IFN-gamma production, revealed that both cytokines were selectively increased in TVX/LPS-treated mice. Both IL-18(-/-) and IFN-gamma(-/-) mice were significantly protected from TVX/LPS-induced liver injury. In addition, IFN-gamma(-/-) mice had decreased plasma concentrations of tumor necrosis factor-alpha, IL-18, and IL-1beta when compared to wild-type mice. In conclusion, the altered expression of genes involved in IFN signaling in TVX/LPS-treated mice led to the finding that IL-18 and IFN-gamma play a critical role in TVX/LPS-induced liver injury.
Nguyen, Minh-Hiep; Pham, Ngoc-Duy; Dong, Bingxue; Nguyen, Thi-Huynh-Nga; Bui, Chi-Bao; Hadinoto, Kunn
2017-11-01
While the radioprotective activity of curcumin against genotoxicity has been well established, its poor oral bioavailability has limited its successful clinical applications. Nanoscale formulations, including liposomes, have been demonstrated to improve curcumin bioavailability. The objective of the present work was (1) to prepare and characterize curcumin-encapsulated liposomes (i.e. size, colloidal stability, encapsulation efficiency, and payload), and (2) subsequently to evaluate their radioprotective activity against genotoxicity in human blood cells caused by Gamma Cobalt-60 irradiation. The curcumin-encapsulated liposomes were prepared by lipid-film hydration method using commercial phosphatidylcholine (i.e. Phospholipon ® 90G). The blood cells were obtained from healthy male donors (n = 3) under an approved ethics protocol. The cell uptake and the radioprotective activity of the curcumin-encapsulated liposomes were characterized by fluorescence microscopy and micronucleus assay, respectively. Nanoscale curcumin-encapsulated liposomes exhibiting good physical characteristics and successful uptake by the human blood cells were successfully prepared. The radioprotective activity of the curcumin-encapsulated liposomes was found to be dependent on the curcumin concentration, where an optimal concentration existed (i.e. 30 μg/mL) independent of the irradiation dose, above which the radioprotective activity had become stagnant (i.e. no more reduction in the micronuclei frequency). The present results established for the first time the radioprotective activity of curcumin-encapsulated liposomes in human blood cells, which coupled by its well-established bioavailability, boded well for its potential application as a nanoscale delivery system of other radioprotective phytochemicals.
A high-throughput assay of NK cell activity in whole blood and its clinical application
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Saet-byul; Cha, Junhoe; Kim, Im-kyung
2014-03-14
Graphical abstract: - Highlights: • We demonstrated a simple assay of NK cell activity from whole blood. • The measurement of secreted IFN-γ from NK cell enables high-throughput screening. • The NKA assay was validated by clinical results of colorectal cancer patients. - Abstract: Natural killer (NK) cells are lymphocytes of the innate immune system and have the ability to kill tumor cells and virus-infected cells without prior sensitization. Malignant tumors and viruses have developed, however, strategies to suppress NK cells to escape from their responses. Thus, the evaluation of NK cell activity (NKA) could be invaluable to estimate themore » status and the outcome of cancers, viral infections, and immune-mediated diseases. Established methods that measure NKA, such as {sup 51}Cr release assay and CD107a degranulation assay, may be used to determine NK cell function, but they are complicated and time-consuming because they require isolation of peripheral blood mononuclear cells (PBMC) or NK cells. In some cases these assays require hazardous material such as radioactive isotopes. To overcome these difficulties, we developed a simple assay that uses whole blood instead of PBMC or isolated NK cells. This novel assay is suitable for high-throughput screening and the monitoring of diseases, because it employs serum of ex vivo stimulated whole blood to detect interferon (IFN)-γ secreted from NK cells as an indicator of NKA. After the stimulation of NK cells, the determination of IFNγ concentration in serum samples by enzyme-linked immunosorbent assay (ELISA) provided a swift, uncomplicated, and high-throughput assay of NKA ex vivo. The NKA results microsatellite stable (MSS) colorectal cancer patients was showed significantly lower NKA, 263.6 ± 54.5 pg/mL compared with healthy subjects, 867.5 ± 50.2 pg/mL (p value <0.0001). Therefore, the NKA could be utilized as a supportive diagnostic marker for microsatellite stable (MSS) colorectal cancer.« less
Recognition of unusual presentation of natural killer cell leukemia.
Gardiner, C M; Reen, D J; O'Meara, A
1995-10-01
Expansion of the natural killer (NK) subset of lymphocytes represents a rare leukemia phenotype with variations in clinical presentation, morphology, surface phenotype, and effector function. This paper reports on a 5-year-old male patient who had an unusual presentation of an NK cell leukemia that was initially diagnosed as neuroblastoma. A bone marrow (BM) aspirate showed clumps of undifferentiated cells with the following phenotype: CD56bright+, CD33dim+, CD45-, CD2-, CD19-, CD16-, and CD57-. Cytochemistry was noncontributory. The patient, having failed to respond to conventional neuroblastoma chemotherapy, was subsequently diagnosed as having NK cell leukemia based on functional in vitro assays. The patient responded to acute lymphoblastic leukemia (ALL) chemotherapy but relapsed 4 weeks into treatment and eventually died 25 weeks after initial presentation. The cell surface phenotype observed is consistent with a rare NK cell subset, the biology of which has not been well defined. Freshly isolated BM cells killed K562 cells in a conventional 51Cr-release assay. Both interleukin-2 (IL-2) and interferon-alpha (IFN-alpha) induced LAK activity against the Daudi cell line. IL-2 induced proliferation of the leukemic cells. TNF-alpha, IFN-gamma, IL-6, IL-1ra, and TGF-beta levels were assessed and found to be concentrated in BM, in contrast to plasma samples. TNF-alpha was present at a high concentration in BM (150.9 pg/ml), probably a reflection of the associated disease pathology of severe bone pain and pyrexia. In summary, this paper details clinical and laboratory investigations of a leukemia of a rare NK cell subset.
NASA Technical Reports Server (NTRS)
Degee, Antonie L. W.; Mansfield, John M.; Sonnenfeld, Gerald
1986-01-01
Earlier studies have demonstrated that mice resistant to Trypanosoma brucei rhodesiense (the B10.BR/SgSnJ strain) produces, upon infection by this parasite, two peaks of serum interferon (IFN), while the susceptible mice (C3HeB/FeJ) produces no IFN. In the present study, survival times were compared for B10.BR/SgSnJ, C3HeB/FeJ, and CBA/J (an intermediately resistant strain) mice that were injected, prior to infection with the parasite, with either of the following three preparations (1) IFN-gamma, (2) an antibody to IFN-gamma and (3) polyriboinosinic-polyribocytidylic acid (to induce IFN-alpha/beta). No effect on the survival times of mice by any of these preparations could be demonstrated, contrary to some previous reports.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Deng, Zhiqun; Carlson, Thomas J.; Xu, Jinshan
2011-09-30
Before final approval is given to the Snohomish County Public Utility District No. 1 for deploying the first tidal power devices in the United States in an open water environment, a system to manage the potential risk of injury to killer whales due to collision with moving turbine blades must be demonstrated. The Pacific Northwest National Laboratory (PNNL) is tasked with establishing the performance requirements for, constructing, and testing a prototype marine animal alert system for triggering temporary turbine shutdown when there is risk of collision with a killer whale. To develop a system that relies on active sonar twomore » critical areas must be investigated - the target strength of killer whales and the frequency content of commercially available active sonar units. PNNL studied three target strength models: a simple model, the Fourier matching model, and the Kirchoff-ray mode model. Using target strength measurements of bottlenose dolphins obtained by previous researchers and assuming killer whales share similar morphology and structure, PNNL extrapolated the target strength of an adult killer whale 7.5 m in length at a frequency of 67 kHz. To study the frequency content of a commercially available sonar unit, direct measurements of the signal transmitted by the sonar were obtained by using a hydrophone connected to a data acquisition system in both laboratory and field conditions. The measurements revealed that in addition to the primary frequency of 200 kHz, there is a secondary frequency component at 90 kHz, which is within the hearing range of killer whales. The amplitude of the 90-kHz frequency component is above the hearing threshold of killer whales but below the threshold for potential injuries.« less
Possible role of natural killer cells in pemphigus vulgaris − preliminary observations
Stern, J N H; Keskin, D B; Barteneva, N; Zuniga, J; Yunis, E J; Ahmed, A R
2008-01-01
Pemphigus vulgaris (PV) is an autoimmune blistering disease that affects the skin and multiple mucous membranes, and is caused by antibodies to desmoglein (Dsg) 1 and 3. Natural killer (NK) cells have a role in autoimmunity, but their role in PV is not known. NK cells in the peripheral blood leucocytes (PBL) of 15 untreated Caucasian patients with active PV were studied and compared with healthy controls for the expression of major histocompatibility complex (MHC) class II and co-stimulatory molecules. CD56+ CD16- CD3- NK or CD56+ CD16+ CD3- NK cells from the PBL of PV patients co-express MHC class II and co-stimulatory molecule B7-H3 without exogenous stimulation. CD4+ T cells from the PBL and perilesional skin of PV patients were co-cultured with CD56+ CD3- NK cells from the PBL of the same patients; in the presence of Dsg3 peptides underwent statistically significant proliferation, indicating that NK cells functioned as antigen-presenting cells. Supernatants from these co-cultures and serum of the same patients with active PV had statistically significantly elevated levels of interleukin (IL)-6, IL-8 and interferon-γ, compared with controls indicating that the NK cells stimulated CD4+ T cells to produce proinflammatory cytokines. In these experiments, we present preliminary evidence that NK cells may play a role in the pathobiology of PV. PMID:18373702
Franssila, R; Auramo, J; Modrow, S; Möbs, M; Oker-Blom, C; Käpylä, P; Söderlund-Venermo, M; Hedman, K
2005-01-01
Human parvovirus B19 is a small non-enveloped DNA virus with an icosahedral capsid consisting of proteins of only two species, the major protein VP2 and the minor protein VP1. VP2 is contained within VP1, which has an additional unique portion (VP1u) of 227 amino acids. We determined the ability of eukaryotically expressed parvovirus B19 virus-like particles consisting of VP1 and VP2 in the ratio recommended for vaccine use, or of VP2 alone, to stimulate, in an HLA class II restricted manner, peripheral blood mononuclear cells (PBMC) to proliferate and to secrete interferon gamma (IFN-γ) and interleukin (IL)-10 cytokines among recently and remotely B19 infected subjects. PBMC reactivity with VP1u was determined specifically with a prokaryotically expressed VP1u antigen. In general, B19-specific IFN-γ responses were stronger than IL-10 responses in both recent and remote infection; however, IL-10 responses were readily detectable among both groups, with the exception of patients with relapsed or persisting symptoms who showed strikingly low IL-10 responses. Whereas VP1u-specific IFN-γ responses were very strong among the recently infected subjects, the VP1u-specific IFN-γ and IL-10 responses were virtually absent among the remotely infected subjects. The disappearance of VP1u-specific IFN-γ expression is surprising, as B-cell immunity against VP1u is well maintained. PMID:16178856
Choi, Ji-Young; Paik, Doo-Jin; Kwon, Dae Young; Park, Yongsoon
2014-04-22
The purpose of this study was to investigate the hypothesis that dietary supplementation with rice bran fermented with Lentinus edodes (rice bran exo-biopolymer, RBEP), a substance known to contain arabinoxylan, enhances natural killer (NK) cell activity and modulates cytokine production in healthy adults. This study was designed in a randomized, double-blind, placebo-controlled, and parallel-group format. Eighty healthy participants with white blood cell counts of 4,000-8,000 cells/μL were randomly assigned to take six capsules per day of either 3 g RBEP or 3 g placebo for 8 weeks. Three participants in the placebo group were excluded after initiation of the protocol; no severe adverse effects from RBEP supplementation were reported. NK cell activity of peripheral blood mononuclear cells was measured using nonradioactive cytotoxicity assay kits and serum cytokine concentrations included interferon (IFN)-γ, tumor necrosis factor (TNF)-α, interleukin (IL)-2, IL-4, IL-10, and IL-12 were measured by Bio-Plex cytokine assay kit. This study was registered with the Clinical Research Information Service (KCT0000536). Supplementation of RBEP significantly increased IFN-γ production compared with the placebo group (P = 0.012). However, RBEP supplementation did not affect either NK cell activity or cytokine levels, including IL-2, IL-4, IL-10, IL-12, and TNF-α, compared with the placebo group. The data obtained in this study indicate that RBEP supplementation increases IFN-γ secretion without causing significant adverse effects, and thus may be beneficial to healthy individuals. This new rice bran-derived product may therefore be potentially useful to include in the formulation of solid and liquid foods designed for treatment and prevention of pathological states associated with defective immune responses.
Cellular immunity and lymphokine production during spaceflights
NASA Technical Reports Server (NTRS)
Konstantinova, I. V.; Sonnenfeld, G.; Lesniak, A. T.; Shaffar, L.; Mandel, A.; Rykova, M. P.; Antropova, E. N.; Ferrua, B.
1991-01-01
Results are presented on changes in cellular immunity and in the production of lymphokine in spacecrews during spaceflights. Measurements were carried out on blood samples collected from 50 cosmonauts before and after spaceflights of different duration, on board Salyut-6, Salyut-7, or Mir. Additional data were obtained from rats flown on board the Cosmos-1667 and Cosmos-1887 biosatellites. The parameters measured included the PHA responsiveness of T lymphocytes, the activity of T-helper cells and of nonspecific T suppressors, the activity of the so-called natural killer lymphocytes, the production of gamma-interferon, and the cell-surface markers. Results showed that the frequency and the extent of changes in the immunologic resistance of subjects depended on the duration of the flight. However, even after the most prolonged (365 days) spaceflight, the changes observed were mostly of a functional character with subsequent rapid return to normal.
1994-01-01
Interleukin 15 (IL-15) is a novel cytokine that has recently been cloned and expressed. Whereas it has no sequence homology with IL-2, IL- 15 interacts with components of the IL-2 receptor (IL-2R). In the present study we performed a functional analysis of recombinant IL-15 on phenotypically and functionally distinct populations of highly purified human natural killer (NK) cells. The CD56bright subset of human NK cells constitutively expresses the high affinity IL-2R and exhibits a brisk proliferative response after the binding of picomolar amounts of IL-2. Using a proliferation assay, IL-15 demonstrated a very steep dose-response curve that was distinct from the dose-response curve for IL-2. The proliferative effects of IL-15 could be abrogated by anti-IL-2R beta (p75), but not by anti-IL-2R alpha (p55). The proliferative effects of IL-2 on CD56bright NK cells could be inhibited by both antibodies. CD56dim NK cells express the intermediate affinity IL-2R in the absence of the high affinity IL-2R. Activation of CD56dim NK cells by IL-15 was similar to that of IL-2 as measured by enhanced NK cytotoxic activity, antibody-dependent cellular cytotoxicity, and NK cell production of interferon gamma, tumor necrosis factor alpha, and granulocyte/macrophage colony-stimulating factor. The IL-15-enhanced NK cytotoxic activity could be completely blocked by anti-IL-2R beta monoclonal antibody. The binding of radiolabeled IL-2 and IL-15 to CD56dim NK cells was inhibited in the presence of anti-IL-2R beta. Scatchard analysis of radiolabeled IL-15 and IL-2 binding to NK- enriched human lymphocytes revealed the presence of high and intermediate affinity receptors for both ligands. IL-15 is a ligand that activates human NK cells through components of the IL-2R in a pattern that is similar but not identical to that of IL-2. Unlike IL-2, IL-15 is produced by activated monocytes/macrophages. The discovery of IL-15 may increase our understanding of how monocytes
Brigl, Manfred; Tatituri, Raju V V; Watts, Gerald F M; Bhowruth, Veemal; Leadbetter, Elizabeth A; Barton, Nathaniel; Cohen, Nadia R; Hsu, Fong-Fu; Besra, Gurdyal S; Brenner, Michael B
2011-06-06
Invariant natural killer T cells (iNKT cells) are critical for host defense against a variety of microbial pathogens. However, the central question of how iNKT cells are activated by microbes has not been fully explained. The example of adaptive MHC-restricted T cells, studies using synthetic pharmacological α-galactosylceramides, and the recent discovery of microbial iNKT cell ligands have all suggested that recognition of foreign lipid antigens is the main driver for iNKT cell activation during infection. However, when we compared the role of microbial antigens versus innate cytokine-driven mechanisms, we found that iNKT cell interferon-γ production after in vitro stimulation or infection with diverse bacteria overwhelmingly depended on toll-like receptor-driven IL-12. Importantly, activation of iNKT cells in vivo during infection with Sphingomonas yanoikuyae or Streptococcus pneumoniae, pathogens which are known to express iNKT cell antigens and which require iNKT cells for effective protection, also predominantly depended on IL-12. Constitutive expression of high levels of IL-12 receptor by iNKT cells enabled instant IL-12-induced STAT4 activation, demonstrating that among T cells, iNKT cells are uniquely equipped for immediate, cytokine-driven activation. These findings reveal that innate and cytokine-driven signals, rather than cognate microbial antigen, dominate in iNKT cell activation during microbial infections.
Kim, C J; Yuasa, T; Kushima, R; Tomoyoshi, T; Seto, A
1998-05-01
Peripheral blood lymphocytes (PBL) from patients with bladder cancer also contain cells possessing cytotoxic activity against autologous tumor cells. These cells are phenotypically heterogenous and include natural killer (NK) and cytotoxic T cells. This study investigated the role of cytotoxic lymphocytes directed against autologous bladder cancer cells. PBL were obtained at intervals before and after surgery and analyzed for cytotoxic activity against autologous bladder cancer cells in 4-hour 51Cr release assay. PBL stimulated with autologous tumor cells were also transformed with human T-lymphotropic virus type-1, establishing a cell line (KB31) which was analyzed for phenotype and cytotoxic activity against the autologous tumor cells. PBL preoperative cytotoxic activity was low, but increased after surgery. Cytotoxic activity was found not only against autologous bladder cancer cells, but also against heterologous bladder cancer (KK-47) and myeloid leukemia (K562) cells, with the highest activity against the heterologous cell lines. The cytotoxic activity of KB31 was 40% against autologous tumor cells 6 weeks after initiation of the cell line, but decreased to 5% by 6 months. This activity was lower than that against the other cell lines, and was similar to that of PBL in short-term culture. Fluorescence-activated cell sorter (FACS) analysis demonstrated that in KB31 cells at 6 weeks, CD8+ cells were dominant, but CD56+ cells predominated at 6 months. These results suggest that the presence of cytotoxic activity in the peripheral blood of the patient was due to both cytotoxic T cells and NK cells. The cytotoxic activity was lowest prior to surgery and increased postoperatively.
Joshi, Manish; Monson, Thomas P; Woods, Gail L
2012-01-01
Interferon-gamma release assays including the QuantiFERON-TB Gold In-Tube test (QFT-GIT [Cellestis Ltd, Australia]) may be used in place of the tuberculin skin test (TST) in surveillance programs for Mycobacterium tuberculosis infection control. However, data on performance and practicality of the QFT-GIT in such programs for health care workers (HCWs) are limited. To assess the performance, practicality and reversion rate of the QFT-GIT among HCWs at a tertiary health care institution in the United States. Retrospective chart review of HCWs at Central Arkansas Veterans Healthcare System (Arkansas, USA) who underwent QFT-GIT testing as a part of their employee screening between November 1, 2008 and October 31, 2009. QFT-GIT was used to screen 3290 HCWs. The initial QFT-GIT was interpreted as positive for 129 (3.9%) HCWs, negative for 3155 (95.9%) and indeterminate for six (0.2%). Testing with QFT-GIT was repeated in 45 HCWs who had positive results on the initial test. The QFT-GIT reverted to negative in 18 (40.0%) HCWs, all of whom had negative TST status and initial interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL. The QFT-GIT test is feasible in large health care setting as an alternative to TST for M tuberculosis infection screening in HCWs but is not free from challenges. The major concerns are the high number of positive test results and high reversion rates on repeat testing, illustrating poor short-term reproducibility of positive QFT-GIT test results. These results suggest adopting a borderline zone between interferon-gamma values of 0.35 IU⁄mL to 2.0 IU⁄mL, and cautious clinical interpretation of values in this range.
Tuo, Wenbin; Fetterer, Raymond; Jenkins, Mark; Dubey, J. P.
2005-01-01
Gamma interferon (IFN-γ) response is essential to the development of a host protective immunity in response to infections by intracellular parasites. Neosporosis, an infection caused by the intracellular protozoan parasite Neospora caninum, is fatal when there is a complete lack of IFN-γ in the infected host. However, the mechanism by which IFN-γ is elicited by the invading parasite is unclear. This study has identified a microbial protein in the N. caninum tachyzoite N. caninum cyclophilin (NcCyP) as a major component of the parasite responsible for the induction of IFN-γ production by bovine peripheral blood mononuclear cells (PBMC) and antigen-specific CD4+ T cells. NcCyP has high sequence homology (86%) with Toxoplasma gondii 18-kDa CyP with a calculated molecular mass of 19.4 kDa. NcCyP is a secretory protein with a predicted signal peptide of 17 amino acids. Abundant NcCyP was detected in whole-cell N. caninum tachyzoite lysate antigen (NcAg) and N. caninum tachyzoite culture supernatant. In N. caninum tachyzoite culture supernatant, three NcCyP bands of 19, 22, and 24 kDa were identified. NcAg stimulated high levels of IFN-γ production by PBMC and CD4+ T cells. The IFN-γ-inducing effect of NcAg was blocked by cyclosporine, a specific ligand for CyP, in a dose-dependent manner. Furthermore, cyclosporine abolished IFN-γ production by PBMC from naïve cows as well as PBMC and CD4+ T cells from infected/immunized cows. These results indicate that the N. caninum tachyzoite naturally produces a potent IFN-γ-inducing protein, NcCyP, which may be important for parasite survival as well as host protection. PMID:16041025
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Cunnick, J. E.; Armfield, A. V.; Wood, P. G.; Rabin, B. S.
1992-01-01
Mild electric foot-shock has been shown to be a stressor that can alter immune responses. Male Lewis rats were exposed to one session of 16 5.0-s 1.6-mA foot-shocks. Production of interferon-gamma by splenocytes in response to concanavalin-A was decreased in spleens from the shocked rats compared to control spleens. Spleen cells from rats treated with nadolol, a peripherally acting beta-adrenergic receptor antagonist, and then shocked, showed dose-dependent attenuation of the suppression of interferon-gamma production. This suggests that catecholamines mediate shock-induced suppression of interferon-gamma production. The percentage of splenic mononuclear cells expressing class II histocompatibility (Ia) antigens on their surfaces from spleens of shocked rats was determined by flow cytometry. Significantly decreased class II positive mononuclear cells were present in the spleens of shocked rats in comparison to the spleens of control rats. This may reflect an alteration of cell trafficking or decreased production of class II antigens.
Jouanguy, E; Lamhamedi-Cherradi, S; Altare, F; Fondanèche, M C; Tuerlinckx, D; Blanche, S; Emile, J F; Gaillard, J L; Schreiber, R; Levin, M; Fischer, A; Hivroz, C; Casanova, J L
1997-01-01
Complete interferon-gamma receptor 1 (IFNgammaR1) deficiency has been identified previously as a cause of fatal bacillus Calmette-Guérin (BCG) infection with lepromatoid granulomas, and of disseminated nontuberculous mycobacterial (NTM) infection in children who had not been inoculated with BCG. We report here a kindred with partial IFNgammaR1 deficiency: one child afflicted by disseminated BCG infection with tuberculoid granulomas, and a sibling, who had not been inoculated previously with BCG, with clinical tuberculosis. Both responded to antimicrobials and are currently well without prophylactic therapy. Impaired response to IFN-gamma was documented in B cells by signal transducer and activator of transcription 1 nuclear translocation, in fibroblasts by cell surface HLA class II induction, and in monocytes by cell surface CD64 induction and TNF-alpha secretion. Whereas cells from healthy children responded to even low IFN-gamma concentrations (10 IU/ml), and cells from a child with complete IFNgammaR1 deficiency did not respond to even high IFN-gamma concentrations (10,000 IU/ml), cells from the two siblings did not respond to low or intermediate concentrations, yet responded to high IFN-gamma concentrations. A homozygous missense IFNgR1 mutation was identified, and its pathogenic role was ascertained by molecular complementation. Thus, whereas complete IFNgammaR1 deficiency in previously identified kindreds caused fatal lepromatoid BCG infection and disseminated NTM infection, partial IFNgammaR1 deficiency in this kindred caused curable tuberculoid BCG infection and clinical tuberculosis. PMID:9389728
Eldin, Eman N.; Omar, Asmaa; Khairy, Mahmoud; Mekawy, Adel H. M.; Ghanem, Maha K.
2012-01-01
BACKGROUND: Noninvasive diagnosis of pleural tuberculosis (TB) remains a challenge due to the paucibacillary nature of the disease. As Mycobacterium tuberculosis (MTB)-specific T cells are recruited into pleural space in TB effusion; their indirect detection may provide useful clinical information. OBJECTIVES: Evaluation of pleural fluid interferon (INF)-γ levels vs Quantiferon–TB Gold In tube assay (QFT- IT) in blood and its adapted variants, using pleural fluid or isolated pleural fluid cells in the diagnosis of pleural TB. METHODS: Thirty-eight patients with pleural effusion of unknown etiology presented at Assiut University Hospital, Egypt, were recruited. Blood and pleural fluid were collected at presentation for INF-γ assays. Ex vivo pleural fluid INF-γ levels, QFT-IT in blood and its adapted variants were compared with final diagnosis as confirmed by other tools including blind and/or thoracoscopic pleural biopsy. RESULTS: The final clinical diagnosis was TB in 20 (53%), malignancy in 10 (26%), and effusion due to other causes in eight patients (21%). Ex vivo pleural fluid INF-γ levels accurately identified TB in all patients and were superior to the QFT-IT assays using blood or pleural fluid (70 and 78% sensitivity, with 60 and 83% specificity, respectively). QFT-IT assay applied to isolated pleural fluid cells had 100% sensitivity and 72% specificity. The optimal cut-off obtained with ROC analysis was 0.73 for TB Gold assay in blood assay, 0.82 IU/ml for the cultured pleural fluid assay, and 0.94 for isolated pleural cells assay. CONCLUSION: The ex vivo pleural fluid INF-γ level is an accurate marker for the diagnosis of pleural TB. QFT- IT assay in peripheral blood or its adapted versions of the assay using pleural fluid and/or washed pleural fluid cells had no diagnostic advantage over pleural fluid INF-γ in the diagnosis of pleural TB. PMID:23189099
Shah, Nina; Martin-Antonio, Beatriz; Yang, Hong; Ku, Stephanie; Lee, Dean A; Cooper, Laurence J N; Decker, William K; Li, Sufang; Robinson, Simon N; Sekine, Takuya; Parmar, Simrit; Gribben, John; Wang, Michael; Rezvani, Katy; Yvon, Eric; Najjar, Amer; Burks, Jared; Kaur, Indreshpal; Champlin, Richard E; Bollard, Catherine M; Shpall, Elizabeth J
2013-01-01
Natural killer (NK) cells are important mediators of anti-tumor immunity and are active against several hematologic malignancies, including multiple myeloma (MM). Umbilical cord blood (CB) is a promising source of allogeneic NK cells but large scale ex vivo expansion is required for generation of clinically relevant CB-derived NK (CB-NK) cell doses. Here we describe a novel strategy for expanding NK cells from cryopreserved CB units using artificial antigen presenting feeder cells (aAPC) in a gas permeable culture system. After 14 days, mean fold expansion of CB-NK cells was 1848-fold from fresh and 2389-fold from cryopreserved CB with >95% purity for NK cells (CD56(+)/CD3(-)) and less than 1% CD3(+) cells. Though surface expression of some cytotoxicity receptors was decreased, aAPC-expanded CB-NK cells exhibited a phenotype similar to CB-NK cells expanded with IL-2 alone with respect to various inhibitory receptors, NKG2C and CD94 and maintained strong expression of transcription factors Eomesodermin and T-bet. Furthermore, CB-NK cells formed functional immune synapses with and demonstrated cytotoxicity against various MM targets. Finally, aAPC-expanded CB-NK cells showed significant in vivo activity against MM in a xenogenic mouse model. Our findings introduce a clinically applicable strategy for the generation of highly functional CB-NK cells which can be used to eradicate MM.
Suzuki, C; Nikkuni, S
1994-01-28
A halotolerant yeast, Pichia farinosa KK1 strain, produces a unique killer toxin termed SMK toxin (salt-mediated killer toxin) which shows its maximum killer activity in the presence of 2 M NaCl. The toxin consists of two distinct subunits, alpha and beta, which are tightly linked without a disulfide bond under acidic conditions, even in the presence of 6 M urea. Under neutral conditions, however, the alpha subunit precipitates, resulting in the dissociation of the subunits and the loss of killer activity. The nucleotide sequence of the SMK1 gene predicts a 222 amino acid preprotoxin with a typical signal sequence, the hydrophobic alpha, an interstitial gamma polypeptide with a putative glycosylation site, and the hydrophilic beta. Amino acid sequence analyses of peptide fragments including the carboxyl-terminal peptides fragments including the carboxyl-terminal peptides from each subunit suggest that the alpha and beta subunits consist of amino acid residues 19-81 and 146-222 of the preprotoxin, respectively, and the molecular weight of the mature alpha beta dimer is 14,214. The KEX2-like endopeptidase and KEX1-like carboxypeptidase may be involved in the stepwise processing of the SMK preprotoxin. The maturation process and the functions of the SMK toxin are compared with the K1 toxin of Saccharomyces cerevisiae.
Lachance, Claude; Gottschalk, Marcelo; Gerber, Pehuén P; Lemire, Paul; Xu, Jianguo; Segura, Mariela
2013-06-01
Streptococcus suis, a major porcine pathogen, can be transmitted to humans and cause severe symptoms. A large human outbreak associated with an unusual streptococcal toxic shock-like syndrome (STSLS) was described in China. Albeit an early burst of proinflammatory cytokines following Chinese S. suis infection was suggested to be responsible for STSLS case severity, the mechanisms involved are still poorly understood. Using a mouse model, the host response to S. suis infection with a North American intermediately pathogenic strain, a European highly pathogenic strain, and the Chinese epidemic strain was investigated by a whole-genome microarray approach. Proinflammatory genes were expressed at higher levels in mice infected with the Chinese strain than those infected with the European strain. The Chinese strain induced a fast and strong gamma interferon (IFN-γ) response by natural killer (NK) cells. In fact, IFN-γ-knockout mice infected with the Chinese strain showed significantly better survival than wild-type mice. Conversely, infection with the less virulent North American strain resulted in an IFN-β-subjugated, low inflammatory response that might be beneficial for the host to clear the infection. Overall, our data suggest that a highly virulent epidemic strain has evolved to massively activate IFN-γ production, mainly by NK cells, leading to a rapid and lethal STSLS.
Pae, H O; Yoo, J C; Choi, B M; Paik, S G; Kim, Y H; Jin, H S; Chung, H T
1999-01-01
A previous study has demonstrated that both interferon-gamma (IFN-gamma) and lipopolysaccharide (LPS) were needed to induce the production of nitric oxide (NO) in BNL CL.2 cells, murine embryonic liver cells. We here demonstrate that when BNL CL.2 cells were cultured with serum-free medium, they were induced to produce NO by the stimulation of IFN-gamma alone. BNL CL.2 cells were cultured with serum-free or serum-containing medium for 1-3 days and then stimulated to synthesize NO by IFN-gamma. Surprisingly, only serum-starved cells showed significant amount of nitrite accumulation and iNOS protein expression in response to IFN-gamma in dose- and time-dependent manners, but serum-supplied cells did not. When the cells were stimulated with IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), or LPS in combinations, only the combination of IFN-gamma and LPS produced more NO than that produced by IFN-gamma alone. The production of NO by the cells stimulated with IFN-gamma or IFN-gamma plus LPS was blocked by the addition of N(G)-monomethyl-L-arginine (N(G)MMA), a NO synthesis inhibitor. To address the intracellular signal pathway responsible for the production of NO by the cells stimulated with IFN-gamma aloneor IFN-gamma plus LPS, we examined the effects of several protein kinase inhibitors on the production of NO from the cells. The production of NO was significantly inhibited by protein tyrosine kinase (PTK) inhibitors, genistein and herbimycin A, but not by protein kinase A or C inhibitors. These results suggest that the deprivation of serum from BNL CL.2 cell culture medium might prime the cells to induce NO synthesis when the cells are triggered by IFN-gamma and the involvement of PTK signal transduction pathway in the expression of inducible NO synthase gene in murine hepatoma cells.
Wang, C Q; Udupa, K B; Lipschitz, D A
1995-01-01
Interferon-gamma (INF-gamma) has been shown to suppress erythropoiesis and perhaps to contribute to the anemia of chronic disease. In this study we demonstrated that the concentration of INF gamma required to suppress murine burst forming unit-erythroid (BFU-E) growth was significantly less than that required to suppress colony forming unit-erythroid (CFU-E) growth. INF gamma acted at the most primitive step in erythroid progenitor cell differentiation and proliferation, as inhibition was maximal when added at the time of BFU-E culture initiation. Inhibition was progressively less if INF gamma addition was delayed after culture initiation. The effects of INF gamma on BFU-E did not require the presence of interleukin-1 alpha (IL-1 alpha), tumor necrosis factor-alpha (TNF alpha), or granulocyte macrophage colony stimulating factor (GM-CSF), as its effects were not neutralized by monoclonal antibodies against IL-1 alpha, TNF alpha, or GM-CSF. This applied whether INF gamma was added to culture with individual antibodies or with a combination of all three antibodies. INF gamma was not required for IL-1 alpha- or TNF alpha-induced suppression of BFU-E, as their effects were not neutralized by a monoclonal anti-INF gamma antibody. In contrast, GM-CSF-induced suppression of BFU-E was negated by the simultaneous addition of anti-INF gamma. We have previously shown that the addition of TNF alpha does not suppress BFU-E growth in cultures from marrow depleted of macrophages. Suppression did occur, however, if a small concentration of INF gamma that does not inhibit and increasing concentration of TNF alpha were added to culture, suggesting a synergistic effect between INF-gamma and TNF alpha. These observations suggest that INF gamma is a potent direct inhibitor of erythroid colony growth in vitro. It exerts its negative regulatory effect primarily on the earliest stages of erythroid progenitor cell differentiation and proliferation, as much higher doses are required to
Molecular characterization of a novel gammaretrovirus in killer whales (Orcinus orca).
Lamere, Sarah A; St Leger, Judy A; Schrenzel, Mark D; Anthony, Simon J; Rideout, Bruce A; Salomon, Daniel R
2009-12-01
There are currently no published data documenting the presence of retroviruses in cetaceans, though the occurrences of cancers and immunodeficiency states suggest the potential. We examined tissues from adult killer whales and detected a novel gammaretrovirus by degenerate PCR. Reverse transcription-PCR also demonstrated tissue and serum expression of retroviral mRNA. The full-length sequence of the provirus was obtained by PCR, and a TaqMan-based copy number assay did not demonstrate evidence of productive infection. PCR on blood samples from 11 healthy captive killer whales and tissues from 3 free-ranging animals detected the proviral DNA in all tissues examined from all animals. A survey of multiple cetacean species by PCR for gag, pol, and env sequences showed homologs of this virus in the DNA of eight species of delphinids, pygmy and dwarf sperm whales, and harbor porpoises, but not in beluga or fin whales. Analysis of the bottlenose dolphin genome revealed two full-length proviral sequences with 97.4% and 96.9% nucleotide identity to the killer whale gammaretrovirus. The results of single-cell PCR on killer whale sperm and Southern blotting are also consistent with the conclusion that the provirus is endogenous. We suggest that this gammaretrovirus entered the delphinoid ancestor's genome before the divergence of modern dolphins or that an exogenous variant existed following divergence that was ultimately endogenized. However, the transcriptional activity demonstrated in tissues and the nearly intact viral genome suggest a more recent integration into the killer whale genome, favoring the latter hypothesis. The proposed name for this retrovirus is killer whale endogenous retrovirus.
Rapid activation of the interferon system in vivo.
Dianzani, F; Gullino, P; Baron, S
1978-01-01
Experiments were carried out to study the kinetics of local interferon production in the subcutaneous tissues of rats stimulated with Newcastle disease virus. Specifically, the interferon produced and released in the extracellular fluids was collected at various intervals of time in micropore chambers implanted into the subcutaneous tissue of rats. Interferon was detected at moderate titers 1 h after induction, and it was present at high titer at 2 h. The interferon levels remained remarkably high in the samples collected after 3, 5, and 24 h, and in some rats it was still detectable after 48 and 72 h. Since control experiments showed that it requires 2 to 3 h for interferon to penetrate the chambers, it may be concluded that high concentrations of interferon are present in the extracellular fluid within 1 h of induction. The evaluation of the kinetics of production and of the concentrations attained in the extracellular fluid suggests that in a solid tissue a cell infected by a potent interferon inducer may produce interferon early enough and in sufficient quantity to protect neighboring cells before the production of progeny virions. PMID:669799
A new assay system for guinea pig interferon biological activity.
Yamamoto, Toshiko; Jeevan, Amminikutty; Ohishi, Kazue; Nojima, Yasuhiro; Umemori, Kiyoko; Yamamoto, Saburo; McMurray, David N
2002-07-01
We have developed an assay system for guinea pig interferon (IFN) based on reduction of viral cytopathic effect (CPE) in various cell lines. CPE inhibition was detected optimally in the guinea pig fibroblast cell line 104C1 infected with encephalomyocarditis virus (EMCV). The amount of biologically active guinea pig IFN was quantified by estimating viable cell numbers colorimetrically by means of a tetrazolium compound, 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium monosodium salt (WST-1) and 1-methoxy-5-methylphenazinium methylsulfate (PMS). WST-1 color developed until stopped by the addition of sulfuric acid. This had no effect on the colorimetric assay, and the color was stable for at least 24 h. The acid also inactivated the EMCV and, thus, eliminated the viral hazard. Inhibition of CPE activity was highly correlated with the concentration of culture supernatants from BCG-vaccinated guinea pig splenocytes stimulated in vitro with tuberculin or an immunostimulatory oligoDNA. This assay detected guinea pig IFN and human IFN-alpha, but not IFN-gamma from human, mouse, rat, pig, or dog. This assay system has proved useful for the titration of guinea pig IFN, being easy to perform, free from viral hazard, relatively species specific, highly reproducible, and inexpensive.
Reproducibility of Interferon Gamma (IFN-γ) Release Assays. A Systematic Review
Tagmouti, Saloua; Slater, Madeline; Benedetti, Andrea; Kik, Sandra V.; Banaei, Niaz; Cattamanchi, Adithya; Metcalfe, John; Dowdy, David; van Zyl Smit, Richard; Dendukuri, Nandini
2014-01-01
Rationale: Interferon gamma (IFN-γ) release assays for latent tuberculosis infection result in a larger-than-expected number of conversions and reversions in occupational screening programs, and reproducibility of test results is a concern. Objectives: Knowledge of the relative contribution and extent of the individual sources of variability (immunological, preanalytical, or analytical) could help optimize testing protocols. Methods: We performed a systematic review of studies published by October 2013 on all potential sources of variability of commercial IFN-γ release assays (QuantiFERON-TB Gold In-Tube and T-SPOT.TB). The included studies assessed test variability under identical conditions and under different conditions (the latter both overall and stratified by individual sources of variability). Linear mixed effects models were used to estimate within-subject SD. Measurements and Main Results: We identified a total of 26 articles, including 7 studies analyzing variability under the same conditions, 10 studies analyzing variability with repeat testing over time under different conditions, and 19 studies reporting individual sources of variability. Most data were on QuantiFERON (only three studies on T-SPOT.TB). A considerable number of conversions and reversions were seen around the manufacturer-recommended cut-point. The estimated range of variability of IFN-γ response in QuantiFERON under identical conditions was ±0.47 IU/ml (coefficient of variation, 13%) and ±0.26 IU/ml (30%) for individuals with an initial IFN-γ response in the borderline range (0.25–0.80 IU/ml). The estimated range of variability in noncontrolled settings was substantially larger (±1.4 IU/ml; 60%). Blood volume inoculated into QuantiFERON tubes and preanalytic delay were identified as key sources of variability. Conclusions: This systematic review shows substantial variability with repeat IFN-γ release assays testing even under identical conditions, suggesting that reversions
Molecular analysis of human gamma/delta+ clones from thymus and peripheral blood
1989-01-01
We analyzed the V gamma and V delta gene usage in TCR-gamma/delta- bearing T cell clones isolated from human peripheral blood and postnatal thymus using V-specific mAbs and Southern and Northern analyses. In peripheral blood most of the gamma/delta cells express the V gamma 9-JP-C gamma 1 chain paired with a delta chain bearing the V delta 2 gene product. This heterodimer is very rare in the postnatal thymus, where a different and less restricted pairing of V gamma 9 and V delta 2 chains is found. These findings indicate that physical constraints cannot explain the overrepresentation of a particular V gamma 9-JP/V delta 2 heterodimer in the peripheral blood, and we discuss alternative mechanisms that may account for this differential distribution. In addition, this analysis allowed us to map the specificity of the delta TCS1 mAb to V delta 1-J delta 1 and to identify at least five different expressed V delta genes. PMID:2572670
Vanhaverbeke, Cécile; Simorre, Jean-Pierre; Sadir, Rabia; Gans, Pierre; Lortat-Jacob, Hugues
2004-01-01
Interferons are cytokines that play a complex role in the resistance of mammalian hosts to pathogens. IFNγ (interferon-γ) is secreted by activated T-cells and natural killer cells. IFNγ is involved in a wide range of physiological processes, including antiviral activity, immune response, cell proliferation and apoptosis, as well as the stimulation and repression of a variety of genes. IFNγ activity is modulated by the binding of its C-terminal domain to HS (heparan sulphate), a glycosaminoglycan found in the extracellular matrix and at the cell surface. In the present study, we analysed the interaction of isolated heparin-derived oligosaccharides with the C-terminal peptide of IFNγ by NMR, in aqueous solution. We observed marked changes in the chemical shifts of both peptide and oligosaccharide compared with the free state. Our results provide evidence of a binding through electrostatic interactions between the charged side chains of the protein and the sulphate groups of heparin that does not induce specific conformation of the C-terminal part of IFNγ. Our data also indicate that an oligosaccharide size of at least eight residues displays the most efficient binding. PMID:15270718
Funke, Christina; King, Donald P; McBain, Jim F; Adelung, Dieter; Stott, Jeffrey L
2003-05-30
Interleukin-6 (IL-6) is a cytokine that can reach detectable systemic levels and is a major inducer of the acute phase response. As such, clinical assays to identify this cytokine in mammalian sera are of diagnostic value. A 558 base-pair (bp) fragment of killer whale IL-6 was cloned and expressed as a 21 kDa protein in Escherichia coli. Biological activity of the recombinant killer whale IL-6 (rkwIL-6) was demonstrated using the IL-6-dependent B9 mouse hybridoma cell line; acute phase sera from a killer whale and supernatants from lipopolysaccharide (LPS)-stimulated killer whale peripheral blood mononuclear cells (PBMCs) also supported the proliferation of the B9 hybridoma. Rat anti-mouse IL-6 receptor antibody effectively blocked biological activity of all three sources of IL-6. Polyclonal antisera, specific for the recombinant protein, were obtained by successive immunization of a rabbit with rkwIL-6. The polyclonal antibody was capable of neutralizing the biological activity of both recombinant and native kwIL-6. A competitive enzyme-linked immunosorbent assay (ELISA) was developed using the polyclonal rabbit anti-rkwIL-6 and the recombinant protein; sensitivity of the assay was in the range of 1 ng/ml. The ELISA was subsequently used to identify the presence of native IL-6 in acute phase sera of two species of delphinidae, a killer whale and a bottlenose dolphin. The application of quantitative cytokine assays as diagnostic tools for monitoring cetacean health are becoming feasible as many animals are now being trained for fluke presentation, making blood collection a routine procedure.
Stegemann-Koniszewski, Sabine; Behrens, Sarah; Boehme, Julia D; Hochnadel, Inga; Riese, Peggy; Guzmán, Carlos A; Kröger, Andrea; Schreiber, Jens; Gunzer, Matthias; Bruder, Dunja
2018-01-01
The innate immune system senses influenza A virus (IAV) through different pathogen-recognition receptors including Toll-like receptor 7 (TLR7). Downstream of viral recognition natural killer (NK) cells are activated as part of the anti-IAV immune response. Despite the known decisive role of TLR7 for NK cell activation by therapeutic immunostimulatory RNAs, the contribution of TLR7 to the NK cell response following IAV infection has not been addressed. We have analyzed lung cytokine responses as well as the activation, interferon (IFN)-γ production, and cytotoxicity of lung and splenic NK cells following sublethal respiratory IAV infection in wild-type and TLR7ko mice. Early airway IFN-γ levels as well as the induction of lung NK cell CD69 expression and IFN-γ production in response to IAV infection were significantly attenuated in TLR7-deficient hosts. Strikingly, respiratory IAV infection also primed splenic NK cells for IFN-γ production, degranulation, and target cell lysis, all of which were fully dependent on TLR7. At the same time, lung type I IFN levels were significantly reduced in TLR7ko mice early following IAV infection, displaying a potential upstream mechanism of the attenuated NK cell activation observed. Taken together, our data clearly demonstrate a specific role for TLR7 signaling in local and systemic NK cell activation following respiratory IAV infection despite the presence of redundant innate IAV-recognition pathways.
Stegemann-Koniszewski, Sabine; Behrens, Sarah; Boehme, Julia D.; Hochnadel, Inga; Riese, Peggy; Guzmán, Carlos A.; Kröger, Andrea; Schreiber, Jens; Gunzer, Matthias; Bruder, Dunja
2018-01-01
The innate immune system senses influenza A virus (IAV) through different pathogen-recognition receptors including Toll-like receptor 7 (TLR7). Downstream of viral recognition natural killer (NK) cells are activated as part of the anti-IAV immune response. Despite the known decisive role of TLR7 for NK cell activation by therapeutic immunostimulatory RNAs, the contribution of TLR7 to the NK cell response following IAV infection has not been addressed. We have analyzed lung cytokine responses as well as the activation, interferon (IFN)-γ production, and cytotoxicity of lung and splenic NK cells following sublethal respiratory IAV infection in wild-type and TLR7ko mice. Early airway IFN-γ levels as well as the induction of lung NK cell CD69 expression and IFN-γ production in response to IAV infection were significantly attenuated in TLR7-deficient hosts. Strikingly, respiratory IAV infection also primed splenic NK cells for IFN-γ production, degranulation, and target cell lysis, all of which were fully dependent on TLR7. At the same time, lung type I IFN levels were significantly reduced in TLR7ko mice early following IAV infection, displaying a potential upstream mechanism of the attenuated NK cell activation observed. Taken together, our data clearly demonstrate a specific role for TLR7 signaling in local and systemic NK cell activation following respiratory IAV infection despite the presence of redundant innate IAV-recognition pathways. PMID:29497422
Jacques, Alexandre; Bleau, Christian; Turbide, Claire; Beauchemin, Nicole; Lamontagne, Lucie
2009-01-01
The production of interferon-γ (IFN-γ) by infiltrating natural killer (NK) cells in liver is involved in the control of mouse hepatitis virus (MHV) infection. The objectives of this study were to identify the mechanisms used by MHV type 3 to modulate the production of IFN-γ by NK cells during the acute hepatitis in susceptible C57BL/6 mice. Ex vivo and in vitro experiments revealed that NK cells, expressing carcinoembryonic antigen-related cell adhesion molecules (CEACAM) 1a (the MHV receptor), can produce a higher level of IFN-γ in the presence of both L2-MHV3 and interleukin-12 (IL-12)/IL-18. The synergistic production of IFN-γ by NK cells depends on viral replication rather than viral fixation only, because it is inhibited or not induced in cells infected with ultraviolet-inactivated viruses and in cells from Ceacam1a−/− mice infected with virulent viruses. The synergistic IFN-γ production involves the p38 mitogen-activated protein kinase (MAPK) rather than the extracellular signal-regulated kinase-1/2 MAPK signalling pathway. However, the signal triggered through the engagement of CEACAM1a decreases the production of IFN-γ, when these molecules are cross-linked using specific monoclonal antibodies. These results suggest that control of acute hepatitis by IFN-γ-producing NK cells may depend on both production of IL-12 and IL-18 in the liver environment and viral infection of NK cells. PMID:19740316
Lee, Ayoung; Lee, Young Ju; Yoo, Hye Jin; Kim, Minkyung; Chang, Yeeun; Lee, Dong Seog; Lee, Jong Ho
2017-05-31
The aim of this study was to investigate the impact of consuming dairy yogurt containing Lactobacillus paracasei ssp. paracasei ( L. paracasei ), Bifidobacterium animalis ssp. lactis ( B. lactis ) and heat-treated Lactobacillus plantarum ( L. plantarum ) on immune function. A randomized, open-label, placebo-controlled study was conducted on 200 nondiabetic subjects. Over a twelve-week period, the test group consumed dairy yogurt containing probiotics each day, whereas the placebo group consumed milk. Natural killer (NK) cell activity, interleukin (IL)-12 and immunoglobulin (Ig) G1 levels were significantly increased in the test group at twelve weeks compared to baseline. Additionally, the test group had significantly greater increases in serum NK cell activity and interferon (IFN)-γ and IgG1 than placebo group. Daily consumption of dairy yogurt containing L. paracasei , B. lactis and heat-treated L. plantarum could be an effective option to improve immune function by enhancing NK cell function and IFN-γ concentration (ClinicalTrials.gov: NCT03051425).
Lee, Ayoung; Lee, Young Ju; Yoo, Hye Jin; Kim, Minkyung; Chang, Yeeun; Lee, Dong Seog; Lee, Jong Ho
2017-01-01
The aim of this study was to investigate the impact of consuming dairy yogurt containing Lactobacillus paracasei ssp. paracasei (L. paracasei), Bifidobacterium animalis ssp. lactis (B. lactis) and heat-treated Lactobacillus plantarum (L. plantarum) on immune function. A randomized, open-label, placebo-controlled study was conducted on 200 nondiabetic subjects. Over a twelve-week period, the test group consumed dairy yogurt containing probiotics each day, whereas the placebo group consumed milk. Natural killer (NK) cell activity, interleukin (IL)-12 and immunoglobulin (Ig) G1 levels were significantly increased in the test group at twelve weeks compared to baseline. Additionally, the test group had significantly greater increases in serum NK cell activity and interferon (IFN)-γ and IgG1 than placebo group. Daily consumption of dairy yogurt containing L. paracasei, B. lactis and heat-treated L. plantarum could be an effective option to improve immune function by enhancing NK cell function and IFN-γ concentration (ClinicalTrials.gov: NCT03051425). PMID:28561762
Poznanski, Sophie M; Lee, Amanda J; Nham, Tina; Lusty, Evan; Larché, Margaret J; Lee, Dean A; Ashkar, Ali A
2017-01-01
The combination of interleukin (IL)-18 and IL-12 (IL-18+IL-12) potently stimulates natural killer (NK) cells, triggering an innate immune response to infections and cancers. Strategies exploiting the effects of IL-18+IL-12 have shown promise for cancer immunotherapy. However, studies have primarily characterized the NK cell response to IL-18+IL-12 in terms of interferon (IFN)-γ production, with little focus on other cytokines produced. IL-8 plays a critical role in activating and recruiting immune cells, but it also has tumor-promoting functions. IL-8 is classically produced by regulatory NK cells; however, cytotoxic NK cells do not typically produce IL-8. In this study, we uncover that stimulation with IL-18+IL-12 induces high levels of IL-8 production by ex vivo expanded and freshly isolated NK cells and NK cells in peripheral blood mononuclear cells. We further report that tumor necrosis factor (TNF)-α, produced by NK cells following IL-18+IL-12 stimulation, regulates IL-8 production. The IL-8 produced is in turn required for maximal IFN-γ and TNF-α production. These findings may have important implications for the immune response to infections and cancer immunotherapies. This study broadens our understanding of NK cell function and IL-18+IL-12 synergy by uncovering an unprecedented ability of IL-18+IL-12-activated peripheral blood NK cells to produce elevated levels of IL-8 and identifying the requirement for intermediates induced by IL-18+IL-12 for maximal cytokine production following stimulation. © 2017 S. Karger AG, Basel.
Forest bathing enhances human natural killer activity and expression of anti-cancer proteins.
Li, Q; Morimoto, K; Nakadai, A; Inagaki, H; Katsumata, M; Shimizu, T; Hirata, Y; Hirata, K; Suzuki, H; Miyazaki, Y; Kagawa, T; Koyama, Y; Ohira, T; Takayama, N; Krensky, A M; Kawada, T
2007-01-01
In order to explore the effect of forest bathing on human immune function, we investigated natural killer (NK) activity; the number of NK cells, and perforin, granzymes and granulysin-expression in peripheral blood lymphocytes (PBL) during a visit to forest fields. Twelve healthy male subjects, age 37-55 years, were selected with informed consent from three large companies in Tokyo, Japan. The subjects experienced a three-day/two-night trip in three different forest fields. On the first day, subjects walked for two hours in the afternoon in a forest field; and on the second day, they walked for two hours in the morning and afternoon, respectively, in two different forest fields. Blood was sampled on the second and third days, and NK activity; proportions of NK, T cells, granulysin, perforin, and granzymes A/B-expressing cells in PBL were measured. Similar measurements were made before the trip on a normal working day as the control. Almost all of the subjects (11/12) showed higher NK activity after the trip (about 50 percent increased) compared with before. There are significant differences both before and after the trip and between days 1 and 2 in NK activity. The forest bathing trip also significantly increased the numbers of NK, perforin, granulysin, and granzymes A/B-expressing cells. Taken together, these findings indicate that a forest bathing trip can increase NK activity, and that this effect at least partially mediated by increasing the number of NK cells and by the induction of intracellular anti-cancer proteins.
Analysis of cytotoxic activity of the CD4+ T lymphocytes generated by local immunotherapy.
Katsumoto, Y.; Monden, T.; Takeda, T.; Haba, A.; Ito, Y.; Wakasugi, E.; Wakasugi, T.; Sekimoto, M.; Kobayashi, T.; Shiozaki, H.; Shimano, T.; Monden, M.
1996-01-01
We previously reported that the anti-tumour effect of OK-432 is considerably enhanced by its intratumoral injection together with fibrinogen. In the present study, we generated killer T cells by culturing tumour-infiltrating lymphocytes from thyroid cancer patients who had received this local immunotherapy. Phenotypic analysis revealed that the T cells were positive for CD3+, CD4+, Leu8-, CD45RO+ and T-cell receptor (TCR)alpha beta+, as well as showing strong surface expression of HLA-DR, CD25, LFA-1 and ICAM-1. The generated CD4+ T cells secreted interferon (IFN)-gamma, tumour necrosis factor (TNF)-alpha, TNF-beta, and interleukin (IL)-6 (but not IL-4), and exhibited a high level of cytolytic activity against several tumour cell lines. The cytolytic activity of these T cells for Daudi cells was inhibited by preincubation with an anti-intercellular adhesion molecule (ICAM)-1 antibody, but not by preincubation with anti-TCR alpha beta, anti-CD2, or anti-LFA-1 antibodies. Pretreatment with anti-ICAM-1 antibody inhibited T-cell cytolytic activity, but not conjugation with target cells. In addition, incubation with immobilised anti-ICAM-1 enhanced the secretion of IFN-gamma by T cells. We conclude that ICAM-1 expressed on the effector cytotoxic CD4+ T lymphocytes delivers regulatory signals that enhance IFN-gamma secretion. PMID:8554971
Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza
2014-03-01
The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.
Kurtasova, L M; Tolstikova, A E; Savchenko, A A
2013-01-01
Explore the immunological parameters, levels of activity of NAD(P)-dependent dehydrogenases lymphocytes, interferon status parameters, phagocytic activity and chemiluminescence response of neutrophils in the blood of children in the acute phase of infectious mononucleosis caused by the Epstein-Barr virus. 65 children at the age of 4-6 years old with infectious mononucleosis caused by EBV in acute phase were observed. Such indexes as cell-mediated, humoral and interferon immunity, NAD(P)-depended dehydrogenases activity in blood lymphocyte, phagocytes activity, levels of spontaneous and induced chemiluminescence ofperipheral blood neutrophils were studied. Children with EVB-infection have immunophenotype spectrum changes and changes of enzymes status of blood lymphocytes against the increasing in leucocytes and the useful increasing in lymphocytes. The useful increasing in IgA, IgM, IgG contenting in serum blood were found. The decreasing of spontaneous production of IFN alpha and the decreasing of induced production of IFNalpha, IFNgamma were determined. The breach of phagocytes activity and chemiluminescent response of blood neutrophils were found. The children in the acute phase of infectious mononucleosis caused by the Epstein-Barr virus, there are changes in the immune status, changes the activity of NAD(P)-dependent dehydrogenases in blood lymphocytes, marked changes in functional and metabolic state of peripheral blood neutrophils.
Suck, G; Branch, D R; Keating, A
2006-05-01
To evaluate gamma-irradiation on KHYG-1, a highly cytotoxic natural killer (NK) cell line and potential candidate for cancer immunotherapy. The NK cell line KHYG-1 was irradiated at 1 gray (Gy) to 50 Gy with gamma-irradiation, and evaluated for cell proliferation, cell survival, and cytotoxicity against tumor targets. We showed that a dose of at least 10 Gy was sufficient to inhibit proliferation of KHYG-1 within the first day but not its cytolytic activity. While 50 Gy had an apoptotic effect in the first hours after irradiation, the killing of K562 and HL60 targets was not different from non-irradiated cells but was reduced for the Ph + myeloid leukemia lines, EM-2 and EM-3. gamma-irradiation (at least 10 Gy) of KHYG-1 inhibits cell proliferation but does not diminish its enhanced cytolytic activity against several tumor targets. This study suggests that KHYG-1 may be a feasible immunotherapeutic agent in the treatment of cancers.
The Violence of Collection: "Indian Killer"'s Archives
ERIC Educational Resources Information Center
Dean, Janet
2008-01-01
At the close of Sherman Alexie's "Indian Killer," in a final chapter titled "Creation Story," a killer carries a backpack containing, among other things, "dozens of owl feathers, a scrapbook, and two bloody scalps in a plastic bag." Readers schooled in the psychopathologies of real and fictional serial killers will be familiar with the detail:…
NASA Technical Reports Server (NTRS)
Crucian, B. E.; Cubbage, M. L.; Sams, C. F.
2000-01-01
In this study, flow cytometry was used to positively identify the specific lymphocyte subsets exhibiting space flight-induced alterations in cytokine production. Whole blood samples were collected from 27 astronauts at three points (one preflight, two postflight) surrounding four space shuttle missions. Assays performed included serum/urine stress hormones, white blood cell (WBC) phenotyping, and intracellular cytokine production following mitogenic stimulation. Absolute levels of peripheral granulocytes were significantly elevated following space flight, but the levels of circulating lymphocytes and monocytes were unchanged. Lymphocyte subset analysis demonstrated a decreased percentage of T cells, whereas percentages of B cells and natural killer (NK) cells remained unchanged after flight. Nearly all the astronauts exhibited an increased CD4/CD8 T cell ratio. Assessment of naive (CD45RA+) vs. memory (CD45RO+) CD4+ T cell subsets was ambiguous, and subjects tended to group within specific missions. Although no significant trend was seen in absolute monocyte levels, a significant decrease in the percentage of the CD14+ CD16+ monocytes was seen following space flight in all subjects tested. T cell (CD3+) production of interleukin-2 (IL-2) was significantly decreased after space flight, as was IL-2 production by both CD4+ and CD8+ T cell subsets. Production of interferon-gamma (IFN-gamma) was not altered by space flight for the CD8+ cell subset, but there was a significant decrease in IFN-gamma production for the CD4+ T cell subset. Serum and urine stress hormone analysis indicated significant physiologic stresses in astronauts following space flight. Altered peripheral leukocyte subsets, altered serum and urine stress hormone levels, and altered T cell cytokine secretion profiles were all observed postflight. In addition, there appeared to be differential susceptibility to space flight regarding cytokine secretion by T cell subsets. These alterations may be the
Kamaladasa, A.; Wickramasinghe, N.; Adikari, T. N.; Gomes, L.; Shyamali, N. L. A.; Salio, M.; Cerundolo, V.; Ogg, G. S.
2016-01-01
Summary Invariant natural killer T (iNKT) cells are capable of rapid activation and production of cytokines upon recognition of antigenic lipids presented by CD1d molecules. They have been shown to play a significant role in many viral infections and were observed to be highly activated in patients with acute dengue infection. In order to characterize further their role in dengue infection, we investigated the proportion of iNKT cells and their phenotype in adult patients with acute dengue infection. The functionality of iNKT cells in patients was investigated by both interferon (IFN)‐γ and interleukin (IL)−4 ex‐vivo enzyme‐linked immunospot (ELISPOT) assays following stimulation with alpha‐galactosyl‐ceramide (αGalCer). We found that circulating iNKT cell proportions were significantly higher (P = 0·03) in patients with acute dengue when compared to healthy individuals and were predominantly of the CD4+ subset. iNKT cells of patients with acute dengue had reduced proportions expressing CD8α and CD161 when compared to healthy individuals. The iNKT cells of patients were highly activated and iNKT activation correlated significantly with dengue virus‐specific immunoglobulin (Ig)G antibody levels. iNKT cells expressing Bcl‐6 (P = 0·0003) and both Bcl‐6 and inducible T cell co‐stimulator (ICOS) (P = 0·006) were increased significantly in patients when compared to healthy individuals. Therefore, our data suggest that in acute dengue infection there is an expansion of highly activated CD4+ iNKT cells, with reduced expression of CD161 markers. PMID:26874822
Leaphart, Cynthia L; Qureshi, Faisal; Cetin, Selma; Li, Jun; Dubowski, Theresa; Baty, Catherine; Batey, Catherine; Beer-Stolz, Donna; Guo, Fengli; Murray, Sandra A; Hackam, David J
2007-06-01
Necrotizing enterocolitis (NEC) is characterized by interferon-gamma (IFN-gamma) release and inadequate intestinal restitution. Because enterocytes migrate together, mucosal healing may require interenterocyte communication via connexin 43-mediated gap junctions. We hypothesize that enterocyte migration requires interenterocyte communication, that IFN impairs migration by impairing connexin 43, and that impaired healing during NEC is associated with reduced gap junctions. NEC was induced in Swiss-Webster or IFN(-/-) mice, and restitution was determined in the presence of the gap junction inhibitor oleamide, or via time-lapse microscopy of IEC-6 cells. Connexin 43 expression, trafficking, and localization were detected in cultured or primary enterocytes or mouse or human intestine by confocal microscopy and (35)S-labeling, and gap junction communication was assessed using live microscopy with oleamide or connexin 43 siRNA. Enterocytes expressed connexin 43 in vitro and in vivo, and exchanged fluorescent dye via gap junctions. Gap junction inhibition significantly reduced enterocyte migration in vitro and in vivo. NEC was associated with IFN release and loss of enterocyte connexin 43 expression. IFN inhibited enterocyte migration by reducing gap junction communication through the dephosphorylation and internalization of connexin 43. Gap junction inhibition significantly increased NEC severity, whereas reversal of the inhibitory effects of IFN on gap junction communication restored enterocyte migration after IFN exposure. Strikingly, IFN(-/-) mice were protected from the development of NEC, and showed restored connexin 43 expression and intestinal restitution. IFN inhibits enterocyte migration by preventing interenterocyte gap junction communication. Connexin 43 loss may provide insights into the development of NEC, in which restitution is impaired.
The Jak-STAT pathway stimulated by interferon alpha or interferon beta.
Horvath, Curt M
2004-11-23
Type I interferons, such as interferon alpha and interferon beta (IFN-alpha and beta), signal through a Janus kinase (Jak) to signal transduction and activator of transcription (STAT) pathway to stimulate gene expression. In response to ligand binding, the receptors dimerize, Jaks phosphorylate STAT1 and STAT2, which then dimerize and interact with a third transcriptional regulator IFN regulatory factor 9 (IRF9) to stimulate gene expression. IFN-alpha is the main innate antiviral cytokine and is essential for effective immune response to viral infection. The animation shows activation of STAT-responsive gene expression in response to type I IFNs.
Liu, San-du; Cheng, Ming-liang; Ren, Hong; Yang, Qing-kun; Shu, De-yun
2012-08-01
To investigate the efficacy of interferon alpha 2 b plus ribavirin combination therapy in sixty-two patients with chronic hepatitis c (CHC) infection originating from a single blood donor. The 62 patients who developed CHC following blood transfusion from a known single infected donor were treated with interferon and ribavirin combination therapy for 48 weeks and followed-up for 96 weeks. The therapy regimen consisted of subcutaneous administration of 3-500 MIU interferon alpha 2 b every other day and daily oral administration of 0.6-1.0 g of ribavirin. Patients were monitored during treatment and in follow-up for sustained virological response (SVR), early virology response (EVR), treatment end virology response (ETVR), biochemical response of withdrawals, and side effects. The SVR rate was 83.9% (52/62). The EVR rate was 95.2% (59/62). The ETVR rate was 87.1% (54/62). The biochemical response rate after withdrawal of treatment was 100.0%. Eight patients developed mildly abnormal thyroid function as a result of the interferon therapy, but all were able to complete the antiviral treatment regimen under the care of endocrinologists. Younger age, relatively short course of disease, low viral load, and better compliance, but not sex, were correlated to curative effect of the combination therapy. Interferon alpha 2 b plus ribavirin combination therapy had a significant curative effect on a group of 62 CHC patients originating from a single case, with 52 of the patients showing SVR out to 96 weeks after therapy. Antiviral treatment is recommended for hepatitis C virus-positive patients to eradicate the virus and prevent disease progression.
Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M
1993-01-01
Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454
Gugssa, A; Gebru, S; Lee, C M; Baccetti, B; Anderson, W
2005-08-01
Trypanosoma musculi-macrophage co-cultures were studied to investigate the biological role of lipopolysaccharide (LPS) induced cytokines in controlling the proliferation of parasites in vitro. Macrophages, isolated by peritoneal lavage, sustained the growth and proliferation of the parasites. Macrophages activated with LPS were characterized by up-regulation of nitric oxide synthase (iNOS) and phagocytosis of fluorescent latex spheres. Activated macrophages showed marked inhibition of the association and proliferation of the parasites. The LPS treated macrophages produced cytokines, especially interferon gamma (INF-gamma), which was detected by Western blot. Trypanosomes, inhibited from association with macrophages, did not proliferate and instead formed clusters held together by their flagella. Cells in these clusters were apoptotic, as demonstrated by the Apoptag reaction and gel fragmentation assay. In addition, high levels of caspase 8 and caspase 3 were shown in floating trypanosome clusters. The results would suggest that INF-gamma and other cytokines released by activated macrophages, possibly functioning through the INF-gammaR1, Fas ligand, CD95 or other death ligands in the trypanosome plasma membrane initiates the apoptosis cascade in trypanosomes.
Fast, Loren D; Nevola, Martha; Tavares, Jennifer; Reddy, Heather L; Goodrich, Ray P; Marschner, Susanne
2013-02-01
Exposure of blood products to gamma irradiation is currently the standard of care in the prevention of transfusion-associated graft-versus-host disease (TA-GVHD). Regulatory, technical, and clinical challenges associated with the use of gamma irradiators are driving efforts to develop alternatives. Pathogen reduction methods were initially developed to reduce the risk of microbial transmission by blood components. Through modifications of nucleic acids, these technologies interfere with the replication of both pathogens and white blood cells (WBCs). To date, systems for pathogen and WBC inactivation of products containing red blood cells are less well established than those for platelets and plasma. In this study, the in vitro and in vivo function of WBCs present in whole blood after exposure to riboflavin plus ultraviolet light (Rb-UV) was examined and compared to responses of WBCs obtained from untreated or gamma-irradiated blood by measuring proliferation, cytokine production, activation, and antigen presentation and xenogeneic (X-)GVHD responses in an in vivo mouse model. In vitro studies demonstrated that treatment of whole blood with Rb-UV was as effective as gamma irradiation in preventing WBC proliferation, but was more effective in preventing antigen presentation, cytokine production, and T-cell activation. Consistent with in vitro findings, treatment with Rb-UV was as effective as gamma irradiation in preventing X-GVHD, a mouse model for TA-GVHD. The ability to effectively inactivate WBCs in fresh whole blood using Rb-UV, prior to separation into components, provides the transfusion medicine community with a potential alternative to gamma irradiation. © 2012 American Association of Blood Banks.
Fiala, Milan
2015-02-12
STAT-3 and STAT-1 signaling have opposite effects in oncogenesis with STAT-3 acting as an oncogene and STAT-1 exerting anti-oncogenic activities through interferon-γ and interferon-α. The cytokine IL-6 promotes oncogenesis by stimulation of NFκB and STAT-3 signaling. Curcuminoids have bi-functional effects by blocking NFκB anti-apoptotic signaling but also blocking anti-oncogenic STAT-1 signaling and interferon-γ production. In our recent study (unpublished work [1]) in pancreatic cancer cell cultures, curcuminoids enhanced cancer cell apoptosis both directly and by potentiating natural killer (NK) cell cytotoxic function. The cytotoxic effects of curcuminoids were increased by incubation of cancer cells and NK cells in an emulsion with omega-3 fatty acids and antioxidants (Smartfish), which enhanced cancer cell apoptosis and protected NK cells against degradation. However, as also shown by others, curcuminoids blocked interferon-γ production by NK cells. The combined use of curcuminoids and omega-3 in cancer immunotherapy will require deeper understanding of their in vivo interactions with the immune system.
Mossman, K; Nation, P; Macen, J; Garbutt, M; Lucas, A; McFadden, G
1996-01-01
Myxoma virus is a leporipoxvirus of New World rabbits (Sylvilagus sp.) that induces a rapidly lethal infection known as myxomatosis in the European rabbit (Oryctolagus cuniculus). Like all poxviruses, myxoma virus encodes a plethora of proteins to circumvent or inhibit a variety of host antiviral immune mechanisms. M-T7, the most abundantly secreted protein of myxoma virus-infected cells, was originally identified as an interferon-gamma receptor homolog (Upton, Mossman, and McFadden, Science 258, 1369-1372, 1992). Here, we demonstrate that M-T7 is dispensable for virus replication in cultured cells but is a critical virulence factor for virus pathogenesis in European rabbits. Disruption of both copies of the M-T7 gene in myxoma virus was achieved by the deletion of 372 bp of M-T7 coding sequences, replacement with a selectable marker, p7.5Ecogpt, and selection of a recombinant virus (vMyxlac-T7gpt) resistant to mycophenolic acid. vMyxlac-T7gpt expressed no detectable M-T7 protein and infected cells supernatants were devoid of any detectable interferon-gamma binding activities. Immunohistochemical staining with anti-beta-galactosidase and anti-CD43 antibodies demonstrated that in vMyxlac-T7gpt-infected rabbits the loss of M-T7 not only caused a dramatic reduction in disease symptoms and viral dissemination to secondary sites, but also dramatically influenced host leukocyte behavior. Notably, primary lesions in wild-type virus infections were generally underlayed by large masses of inflammatory cells that did not effectively migrate into the dermal sites of viral replication, whereas in vMyxlac-T7gpt infections this apparent block to leukocyte influx was relieved. A second major phenotypic distinction noted for the M-T7 knockout virus was the extensive activation of lymphocytes in secondary immune organs, particularly the spleen and lymph nodes, by Day 4 of the infection. This is in stark contrast to infection by wild-type myxoma virus, which results in relatively
Occurrence of killer yeasts in leaf-cutting ant nests.
Carreiro, S C; Pagnocca, F C; Bacci, M; Bueno, O C; Hebling, M J A; Middelhoven, W J
2002-01-01
Killer activity was screened in 99 yeast strains isolated from the nests of the leaf-cutting ant Atta sexdens against 6 standard sensitive strains, as well as against each other. Among this yeast community killer activity was widespread since 77 strains (78%) were able to kill or inhibit the growth of at least one standard strain or nest strain. Toxin production was observed in representatives of all the studied genera including Aureobasidium, Rhodotorula, Tremella and Trichosporon, whose killer activity has not yet been described.
Dampened STING-Dependent Interferon Activation in Bats.
Xie, Jiazheng; Li, Yang; Shen, Xurui; Goh, Geraldine; Zhu, Yan; Cui, Jie; Wang, Lin-Fa; Shi, Zheng-Li; Zhou, Peng
2018-03-14
Compared with terrestrial mammals, bats have a longer lifespan and greater capacity to co-exist with a variety of viruses. In addition to cytosolic DNA generated by these viral infections, the metabolic demands of flight cause DNA damage and the release of self-DNA into the cytoplasm. However, whether bats have an altered DNA sensing/defense system to balance high cytosolic DNA levels remains an open question. We demonstrate that bats have a dampened interferon response due to the replacement of the highly conserved serine residue (S358) in STING, an essential adaptor protein in multiple DNA sensing pathways. Reversing this mutation by introducing S358 restored STING functionality, resulting in interferon activation and virus inhibition. Combined with previous reports on bat-specific changes of other DNA sensors such as TLR9, IFI16, and AIM2, our findings shed light on bat adaptation to flight, their long lifespan, and their unique capacity to serve as a virus reservoir. Copyright © 2018 Elsevier Inc. All rights reserved.
Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor
Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian
2014-01-01
Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970
Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael
2014-01-01
Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.
Effect of spaceflight on natural killer cell activity
NASA Technical Reports Server (NTRS)
Rykova, Marina P.; Sonnenfeld, Gerald; Lesniak, A. T.; Taylor, Gerald R.; Meshkov, Dimitrii O.; Mandel, Adrian D.; Medvedev, Andrei E.; Berry, Wallace D.; Fuchs, Boris B.; Konstantinova, Irina V.
1992-01-01
The effects of spaceflight on immune cell function were determined in rats flown on Cosmos 2044. Control groups included vivarium, synchronous, and antiorthostatically suspended rats. The ability of natural killer cells to lyse two different target cell lines was determined. Spleen and bone marrow cells obtained from flight rats showed significantly inhibited cytotoxicity for YAC-1 target cells compared with cells from synchronous control rats. This could have been due to exposure of the rats to microgravity. Antiorthostatic suspension did not affect the level of cytotoxicity from spleen cells of suspended rats for YAC-1 cells. On the other hand, cells from rats flown in space showed no significant differences from vivarium and synchronous control rats in cytotoxicity for K-562 target cells. Binding of natural killer cells to K-562 target cells was unaffected by spaceflight. Antiorthostatic suspension resulted in higher levels of cytotoxicity from spleen cells for Cr-51-labeled K-562 cells. The results indicate differential effects of spaceflight on function of natural killer cells. This shows that spaceflight has selective effects on the immune response.
López-Alvarez, María R; Martínez-Sánchez, María V; Salgado-Cecilia, María G; Campillo, José A; Heine-Suñer, Damian; Villar-Permuy, Florentina; Fuster, José L; Bas, Agueda; Gil-Herrera, Juana; Muro, Manuel; García-Alonso, Ana M; Alvarez-López, María R; Minguela, Alfredo
2009-01-01
We report the first case of hemophagocytic lymphohistiocytosis (HLH) induced by the monoclonal expansion of Epstein-Barr virus (EBV)-negative NK cells. Consanguinity of the patient's parents made it necessary to discard familial HLH in the patient and her sister with identical HLA markers and demonstrate that no cause other than the expansion of NK cells, which secrete high levels of gamma interferon, was inducing HLH in this patient.
Active echolocation beam focusing in the false killer whale, Pseudorca crassidens.
Kloepper, Laura N; Nachtigall, Paul E; Donahue, Megan J; Breese, Marlee
2012-04-15
The odontocete sound production system is highly complex and produces intense, directional signals that are thought to be focused by the melon and the air sacs. Because odontocete echolocation signals are variable and the emitted click frequency greatly affects the echolocation beam shape, investigations of beam focusing must account for frequency-related beam changes. In this study we tested whether the echolocation beam of a false killer whale changed depending on target difficulty and distance while also accounting for frequency-related changes in the echolocation beam. The data indicate that the false killer whale changes its beam size according to target distance and difficulty, which may be a strategy of maximizing the energy of the target echo. We propose that the animal is using a strategy of changing the focal region according to target distance and that this strategy is under active control.
ERIC Educational Resources Information Center
Lampert, Evan
2014-01-01
"Biology Myth-Killers" is an activity designed to identify and correct common misconceptions for high school and college introductory biology courses. Students identify common myths, which double as biology misconceptions, and use appropriate sources to share the "truth" about the myths. This learner-centered activity is a fun…
Saldan, Alda; Mengoli, Carlo; Fiscon, Marta; Silvestre, Cristina; Fallico, Loredana; Peracchi, Marta; Furian, Lucrezia; Cusinato, Riccardo; Bonfante, Luciana; Rossi, Barbara; Marchini, Francesco; Sgarabotto, Dino; Rigotti, Paolo; Palù, Giorgio
2013-01-01
Assessing cytomegalovirus (CMV)-specific cell-mediated immunity (CMI) represents an appealing strategy for identifying transplant recipients at risk of infection. In this study, we compared two gamma interferon-releasing assays (IGRAs), Quantiferon-CMV and CMV enzyme-linked immunosorbent spot (ELISPOT), to determine the ability of each test to predict protective CMV-specific T-cell responses. Two hundred twenty-one Quantiferon-CMV and ELISPOT tests were conducted on 120 adult kidney transplant recipients (KTRs), including 100 CMV-seropositive transplant recipients (R+) and 20 CMV-seronegative transplant recipients of a CMV-positive donor (D+/R−). As a control cohort, 39 healthy adult subjects (including 33 CMV-seropositive and 6 CMV-seronegative subjects) were enrolled. CMV IgG serology was used as a reference for both tests. In the CMV-seropositive individuals, the ELISPOT and Quantiferon-CMV assays provided 46% concordance with the serology, 12% discordance, 18% disagreement between ELISPOT or Quantiferon-CMV and the serology, and 24% gray areas when one or both tests resulted in weak positives. None of the CMV-seronegative subjects showed detectable responses in the ELISPOT or the Quantiferon-CMV test. In transplant recipients, both the ELISPOT and Quantiferon-CMV assays positively correlated with each other and negatively correlated with CMV DNAemia in a significant way (P < 0.05). During the antiviral prophylaxis, all 20 D+/R− KTRs we examined displayed undetectable Quantiferon-CMV and ELISPOT results, and there was no evidence of CMV seroconversion. The receiving operator curve (ROC) statistical analysis revealed similar specificities and sensitivities in predicting detectable viremia (areas under the curve [AUC], 0.66 and 0.62 for Quantiferon-CMV and ELISPOT, respectively). ELISPOT and Quantiferon-CMV values of >150 spots/200,000 peripheral blood mononuclear cells (PBMCs) and >1 to 6 IU gamma interferon (IFN-γ) were associated with protection from CMV
Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao
2003-10-31
Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF
Shaik, Junaid; Pillay, Manormoney; Jeena, Prakash
2014-09-01
Successful control of childhood TB requires early diagnosis, effective chemotherapy and a method of evaluating the response to therapy. Identification of suitable biomarkers that predict the response to anti-TB therapy may allow the duration of treatment to be shortened. The majority of biomarker studies in paediatric TB have focused on the role of T cell-based interferon-gamma (IFN-γ) release assays (IGRAs) in the diagnosis of either latent or active disease. Little has been published on the role of IGRAs in the monitoring response to therapy in children. We reviewed the available literature to ascertain the value of IGRAs in the monitoring of response to anti-TB therapy in children. We explored the results of the few studies that have investigated the role of IGRAs as markers of response to anti-TB treatment in children. We conclude that the role of IGRAs as surrogate markers appears promising. Robust clinical trials are, however, needed to entrench the value of IGRAs as surrogate biomarkers of response to anti-TB therapy in children. Copyright © 2013 Elsevier Ltd. All rights reserved.
Leung, Donald YM; Gao, Pei-Song; Grigoryev, Dmitry N; Rafaels, Nicholas M; Streib, Joanne E; Howell, Michael D; Taylor, Patricia A; Boguniewicz, Mark; Canniff, Jennifer; Armstrong, Brian; Zaccaro, Daniel J; Schneider, Lynda C; Hata, Tissa R; Hanifin, Jon M; Beck, Lisa A; Weinberg, Adriana; Barnes, Kathleen C
2011-01-01
Background The basis for increased susceptibility of atopic dermatitis (AD) patients to develop disseminated viral skin infections such as eczema herpeticum (ADEH+) is poorly understood. Objective We sought to determine whether atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Methods GeneChip profiling was used to identify differences in gene expression of peripheral blood mononuclear cells (PBMC) from patients with a history of ADEH+ as compared to ADEH− and non-atopic controls. Key differences in protein expression were verified by ELISPOT and/or ELISA. Clinical relevance was further demonstrated by a mouse model of disseminated viral skin infection and genetic association analysis for genetic variants in IFNG and IFNGR1 and ADEH among 435 cases and controls. Results We demonstrate by global gene expression analysis selective transcriptomic changes within the interferon (IFN) superfamily of PBMCs from ADEH+ subjects reflecting low IFNγ and IFNγ receptor gene expression. IFNγ protein production was also significantly lower in ADEH+ (N=24) compared to ADEH− (N=20) and non-atopic (NA; N=20) controls. IFNγ receptor knockout (KO) mice developed disseminated viral skin infection after epicutaneous challenge with vaccinia virus (VV). Genetic variants in IFNG and IFNGR1 SNPs were significantly associated with ADEH (112 cases, 166 controls) and IFNγ production: a 2-SNP (A–G) IFNGR1 haplotype (rs10457655 and rs7749390) showed the strongest association with a reduced risk of ADEH+ ((13.2% ADEH+ vs 25.5% ADEH−, P = 0.00057). Conclusions ADEH+ patients have reduced IFNγ production, and IFNG and IFNGR1 SNPs are significantly associated with ADEH+ and may contribute to an impaired immune response to herpes simplex virus (HSV). Clinical Implications Atopic dermatitis subjects prone to disseminated viral skin infections have defects in their interferon responses. Capsule summary Using genomic
Stochastic modeling of a serial killer
Simkin, M.V.; Roychowdhury, V.P.
2014-01-01
We analyze the time pattern of the activity of a serial killer, who during twelve years had murdered 53 people. The plot of the cumulative number of murders as a function of time is of “Devil’s staircase” type. The distribution of the intervals between murders (step length) follows a power law with the exponent of 1.4. We propose a model according to which the serial killer commits murders when neuronal excitation in his brain exceeds certain threshold. We model this neural activity as a branching process, which in turn is approximated by a random walk. As the distribution of the random walk return times is a power law with the exponent 1.5, the distribution of the inter-murder intervals is thus explained. We illustrate analytical results by numerical simulation. Time pattern activity data from two other serial killers further substantiate our analysis. PMID:24721476
Werner-Felmayer, G; Werner, E R; Fuchs, D; Hausen, A; Reibnegger, G; Wachter, H
1990-05-15
Determination of neopterin [D-erythro-6-(1',2',3'-trihydroxypropyl)pterin] in body fluids is a powerful diagnostic tool in a variety of diseases in which activation of cellular immune mechanisms is involved, such as certain malignancies, allograft rejection, and autoimmune and infectious diseases. In vitro, neopterin is released into the supernatant by peripheral blood-derived monocytes/macrophages upon stimulation with gamma-interferon. In parallel, cleavage of tryptophan by indoleamine 2,3-dioxygenase is induced. We report here that the human myelomonocytic cell line THP-1 forms neopterin and degrades tryptophan upon treatment with gamma-interferon. Like in macrophages alpha-interferon and beta-interferon induce these pathways only to a much smaller degree. The action of interferons is enhanced by cotreatment with tumor necrosis factor alpha, lipopolysaccharide, or dexamethasone. gamma-Interferon-induced neopterin formation and indoleamine 2,3-dioxygenase activity are increased by raising extracellular tryptophan concentrations. The pattern of intracellularly formed pteridines upon stimulation with gamma-interferon shows the unique characteristics of human monocytes/macrophages. Neopterin, monapterin, and biopterin are produced in a 50:2:1 ratio. Thus, the THP-1 cell line provides a permanent, easily accessible in vitro system for studying the induction and mechanism of neopterin formation.
Tanabe, Y; Dan, K; Kuriya, S; Nomura, T
1989-10-01
The effects of recombinant human interferon (IFN) alpha-2b and gamma on the bone marrow megakaryocyte progenitors (CFU-Meg) were compared between eight patients in the chronic phase of Ph1-positive chronic myelocytic leukemia (CML) and five hematologically normal patients. CFU-Meg was assayed in plasma clot culture added with phytohemagglutinin-stimulated leukocyte-conditioned medium as a source of colony stimulating activity. The average count of CFU-Meg colonies formed from the bone marrow of CML patients was 5.5 times that of normal controls. Spontaneous CFU-Meg colonies were grown in seven of eight CML patients, but in none of five controls. Colony formation by CFU-Meg in CML as well as normal bone marrow was suppressed by the two preparations of IFN in a dose dependent fashion. Their suppressive influence on colonies from CFU-Meg was comparable between CML and normal bone marrow at lower concentrations, but was less marked for CML than normal bone marrow at higher concentrations. The formation of CFU-Meg colonies from CML bone marrow was more severely suppressed by IFN-gamma than IFN-alpha-2b. Depletion of either T lymphocytes or adherent cells from the CML bone marrow cells diminished the suppressive effects of IFN-gamma, but had no influence on the effects of IFN-alpha-2b.
Cohen, Jeffrey I.; Dropulic, Lesia; Hsu, Amy P.; Zerbe, Christa S.; Krogmann, Tammy; Dowdell, Kennichi; Hornung, Ronald L.; Lovell, Jana; Hardy, Nancy; Hickstein, Dennis; Cowen, Edward W.; Calvo, Katherine R.; Pittaluga, Stefania; Holland, Steven M.
2016-01-01
Background. Most patients infected with Epstein-Barr virus (EBV) are asymptomatic, have nonspecific symptoms, or have self-limiting infectious mononucleosis. EBV, however, may result in severe primary disease or cancer. Methods. We report EBV diseases associated with GATA2 deficiency at one institution and describe the hematology, virology, and cytokine findings. Results. Seven patients with GATA2 deficiency developed severe EBV disease. Three presented with EBV infectious mononucleosis requiring hospitalization, 1 had chronic active EBV disease (B-cell type), 1 had EBV-associated hydroa vacciniforme–like lymphoma with hemophagocytic lymphohistiocytosis, and 2 had EBV-positive smooth muscle tumors. Four of the 7 patients had severe warts and 3 had disseminated nontuberculous mycobacterial infections. All of the patients had low numbers of monocytes, B cells, CD4 T cells, and natural killer cells. All had elevated levels of EBV in the blood; 2 of 3 patients tested had expression of the EBV major immediate-early gene in the blood indicative of active EBV lytic infection. Mean plasma levels of tumor necrosis factor α, interferon γ, and interferon gamma-induced protein 10 were higher in patients with GATA2 deficiency than in controls. Conclusions. GATA2 is the first gene associated with EBV hydroa vacciniforme–like lymphoma. GATA2 deficiency should be considered in patients with severe primary EBV infection or EBV-associated cancer, especially in those with disseminated nontuberculous mycobacterial disease and warts. PMID:27169477
Effects of Chicken Interferon Gamma on Newcastle Disease Virus Vaccine Immunogenicity
Cardenas-Garcia, Stivalis; Dunwoody, Robert P.; Marcano, Valerie; Diel, Diego G.; Williams, Robert J.; Gogal, Robert M.; Brown, Corrie C.; Miller, Patti J.; Afonso, Claudio L.
2016-01-01
More effective vaccines are needed to control avian diseases. The use of chicken interferon gamma (chIFNγ) during vaccination is a potentially important but controversial approach that may improve the immune response to antigens. In the present study, three different systems to co-deliver chIFNγ with Newcastle disease virus (NDV) antigens were evaluated for their ability to enhance the avian immune response and their protective capacity upon challenge with virulent NDV. These systems consisted of: 1) a DNA vaccine expressing the Newcastle disease virus fusion (F) protein co-administered with a vector expressing the chIFNγ gene for in ovo and booster vaccination, 2) a recombinant Newcastle disease virus expressing the chIFNγ gene (rZJ1*L/IFNγ) used as a live vaccine delivered in ovo and into juvenile chickens, and 3) the same rZJ1*L/IFNγ virus used as an inactivated vaccine for juvenile chickens. Co-administration of chIFNγ with a DNA vaccine expressing the F protein resulted in higher levels of morbidity and mortality, and higher amounts of virulent virus shed after challenge when compared to the group that did not receive chIFNγ. The live vaccine system co-delivering chIFNγ did not enhanced post-vaccination antibody response, nor improved survival after hatch, when administered in ovo, and did not affect survival after challenge when administered to juvenile chickens. The low dose of the inactivated vaccine co-delivering active chIFNγ induced lower antibody titers than the groups that did not receive the cytokine. The high dose of this vaccine did not increase the antibody titers or antigen-specific memory response, and did not reduce the amount of challenge virus shed or mortality after challenge. In summary, regardless of the delivery system, chIFNγ, when administered simultaneously with the vaccine antigen, did not enhance Newcastle disease virus vaccine immunogenicity. PMID:27409587
Antiviral activity of ovine interferon tau 4 against foot-and-mouth disease virus.
Usharani, Jayaramaiah; Park, Sun Young; Cho, Eun-Ju; Kim, Chungsu; Ko, Young-Joon; Tark, Dongseob; Kim, Su-Mi; Park, Jong-Hyeon; Lee, Kwang-Nyeong; Lee, Myoung-Heon; Lee, Hyang-Sim
2017-07-01
Foot-and-mouth disease (FMD) is an economically important disease in most parts of the world and new therapeutic agents are needed to protect the animals before vaccination can trigger the host immune response. Although several interferons have been used for their antiviral activities against Foot-and-mouth disease virus (FMDV), ovine interferon tau 4 (OvIFN-τ4), with a broad-spectrum of action, cross-species antiviral activity, and lower incidence of toxicity in comparison to other type І interferons, has not yet been evaluated for this indication. This is the first study to evaluate the antiviral activity of OvIFN-τ4 against various strains of FMDV. The effective anti-cytopathic concentration of OvIFN-τ4 and its effectiveness pre- and post-infection with FMDV were tested in vitro in LFBK cells. In vivo activity of OvIFN-τ4 was then confirmed in a mouse model of infection. OvIFN-τ4 at a concentration of 500 ng, protected mice until 5days post-FMDV challenge and provided 90% protection for 10 days following FMDV challenge. These results suggest that OvIFN-τ4 could be used as an alternative to other interferons or antiviral agents at the time of FMD outbreak. Copyright © 2017. Published by Elsevier B.V.
Disseminated mycosis in a killer whale (Orcinus orca).
Abdo, Walied; Kawachi, Takeshi; Sakai, Hiroki; Fukushi, Hideto; Kano, Rui; Shibahara, Tomoyuki; Shirouzu, Hiroshi; Kakizoe, Yuko; Tuji, Hajime; Yanai, Tokuma
2012-01-01
Hematological findings in a female killer whale (Orcinus orca) undergoing rehabilitation after sudden severe anorexia revealed continuing increases in serum lactate dehydrogenase and aspartate aminotransferase activities as well as fibrinogen concentration. Serologic evidence of herpesvirus infection and skin vesicles were detected 2 weeks into the treatment regimen of antibiotics and corticosteroids. The whale showed signs of improvement after treatment with anti-herpesvirus drugs, but sudden severe anorexia reappeared, along with marked elevation of fibrinogen concentration that continued until the death. Postmortem examination revealed multiple light tan foci of necrosis in the skeletal and cardiac muscles, and lung consolidation. Microscopic findings indicated disseminated fungal granulomas in the skeletal and cardiac muscles, as well as myocarditis, mycotic embolic thromboarteritis of cardiac blood vessels, and bronchopneumonia with numerous typical Aspergillus-like fungi. Mucor-like structures in granulomas in the heart and skeletal muscle and Aspergillus-like fungi in the lungs were identified using periodic acid-Schiff, Gomori methenamine silver stain, and immunohistochemistry. The present case involves dual infection with Mucor and Aspergillus species in a killer whale with concurrent herpesvirus.
Thiopurine use associated with reduced B and natural killer cells in inflammatory bowel disease
Lord, James D; Shows, Donna M
2017-01-01
AIM To identify which blood and mucosal lymphocyte populations are specifically depleted by thiopurine use in vivo. METHODS The thiopurines azathioprine and 6-mercaptopurine have been a mainstay of inflammatory bowel disease (IBD) therapy for decades, but their mechanism of action in vivo remains obscure. Although thiopurines are lymphotoxic at high doses, and have been reported to cause T cell apoptosis in vitro, their ability to control IBD at lower doses suggests that they may selectively deplete particular lymphocyte populations. Blood cells from 19 IBD patients on a thiopurine, 19 IBD patients not on a thiopurine, and 38 matched healthy control subjects were analyzed by multiple multi-color flow cytometry panels to quantify the immune cell subsets contained therein, both as a percent of cells, and as an absolute cell count. Similar analyses were performed on colon biopsies from 17 IBD patients on a thiopurine, 17 IBD patients not on a thiopurine, and 49 healthy screening colonoscopy recipients. RESULTS Complete blood counts revealed lower lymphocyte, but not monocyte or granulocyte, counts in IBD patients who were taking thiopurines at the time of sampling. This reduction was restricted to CD3-negative lymphocytes, wherein both natural killer (NK) and B cells were significantly reduced among thiopurine recipients. Among CD19+ B cells, the transitional B cells were particularly depleted, being nearly absent in both blood and colon biopsies of thiopurine recipients. No differences were associated with thiopurine use in CD8+ T cells, mucosa-associated invariant T (MAIT) cells, invariant natural killer T (iNKT) cells, gamma/delta T cells, Th1, Th17, regulatory T cells (Tregs) or naïve CD4+ T cells. However, patients with IBD had significantly more circulating FOXP3+, Helios+ Tregs and fewer iNKT and MAIT cells than healthy controls. CONCLUSION Thiopurine use is associated with reduced B and NK cell, but not T cell, subpopulations in the blood of IBD patients
Stochastic modeling of a serial killer.
Simkin, M V; Roychowdhury, V P
2014-08-21
We analyze the time pattern of the activity of a serial killer, who during 12 years had murdered 53 people. The plot of the cumulative number of murders as a function of time is of "Devil's staircase" type. The distribution of the intervals between murders (step length) follows a power law with the exponent of 1.4. We propose a model according to which the serial killer commits murders when neuronal excitation in his brain exceeds certain threshold. We model this neural activity as a branching process, which in turn is approximated by a random walk. As the distribution of the random walk return times is a power law with the exponent 1.5, the distribution of the inter-murder intervals is thus explained. We illustrate analytical results by numerical simulation. Time pattern activity data from two other serial killers further substantiate our analysis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Isobe, Yasushi; Hamano, Yasuharu; Ito, Yoshinori; Kimura, Hiroshi; Tsukada, Nobuhiro; Sugimoto, Koichi; Komatsu, Norio
2013-02-01
Here, we describe a Japanese woman showing a monoclonal expansion of EBV-infected natural killer (NK) cells after receiving allogeneic peripheral blood stem cell transplantation (PBSCT). The patient initially had T-cell-type chronic active EBV disease (CAEBV) and subsequently developed liver T-cell lymphoma. L-Asparaginase-containing chemotherapy led to a favorable lymphoma response. To eradicate CAEBV and the lymphoma, she further received allogeneic PBSCT from a human leukocyte antigen-matched sibling donor. After the PBSCT, the patient presented with transient lymphocytosis of NK cells, which were infected with a monoclonal EBV strain other than previously detected ones. These NK cells seemed to have been transmitted from the healthy donor to the recipient. The patient and donor remain well in spite of carrying these NK cells. This is the first report of an asymptomatic Japanese carrier harboring monoclonal EBV-infected NK cells. Copyright © 2012 Elsevier B.V. All rights reserved.
Daily intake of Lactobacillus casei Shirota increases natural killer cell activity in smokers.
Reale, Marcella; Boscolo, Paolo; Bellante, Veronica; Tarantelli, Chiara; Di Nicola, Marta; Forcella, Laura; Li, Qing; Morimoto, Kanehisa; Muraro, Raffaella
2012-07-01
Dietary probiotics supplementation exerts beneficial health effects. Since cigarette smoking reduces natural killer (NK) activity, we evaluated the effect of Lactobacillus casei Shirota (LcS) intake on NK cytotoxic activity in male smokers. The double-blind, placebo-controlled, randomised study was conducted on seventy-two healthy Italian blue-collar male smokers randomly divided for daily intake of LcS powder or placebo. Before and after 3 weeks of intake, peripheral blood mononuclear cells were isolated and NK activity and CD16⁺ cells' number were assessed. Daily LcS intake for 3 weeks significantly increased NK activity (P < 0.001). The increase in NK activity was paralleled by an increase in CD16⁺ cells (P < 0.001). Before intake, NK cytotoxic activity inversely correlated with the number of cigarettes smoked (R - 0.064). LcS intake prevented the smoke-dependent expected NK activity reduction. The analysis of the distribution of changes in smoke-adjusted NK activity demonstrated that the positive variations were significantly associated with LcS intake, while the negative variations were associated with placebo intake (median value of distributions of differences, 20.98 lytic unit (LU)/10⁷ cells for LcS v. - 4.38 LU/10⁷ cells for placebo, P = 0.039). In conclusion, 3 weeks of daily LcS intake in Italian male smokers was associated with a higher increase in cytotoxic activity and CD16⁺ cells' number in comparison to the placebo intake group.
Dunn, John R; Kaneene, John B; Grooms, Daniel L; Bolin, Steven R; Bolin, Carole A; Bruning-Fann, Colleen S
2005-02-01
To determine whether cattle testing positive for Mycobacterium avium subsp paratuberculosis as determined by microbial culture of feces or antibody ELISA were more likely to have false-positive responses on the caudal fold tuberculin (CFT) test or interferon-gamma (IFN-gamma) assay for Mycobacterium bovis than cattle testing negative for M paratuberculosis. 1043 cattle from 10 herds in Michigan. Feces and blood samples for plasma were collected from cattle > or =24 months old on the day the CFT test was read. Fecal samples were submitted for microbial culture for M paratuberculosis. Plasma samples were tested for antibody against M paratuberculosis, and IFN-gamma after stimulation with purified protein derivative tuberculin from M bovis or M avium. Of 1043 cattle, 180 (17.3%) had positive CFT test results (suspects) and 8 (0.8%) had positive IFN-gamma assay results after stimulation with purified protein derivative tuberculin from M bovis. Forty-five (4.3%) and 115 (11.0%) cattle tested positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA, respectively. Cattle with positive responses for M paratuberculosis appeared to have an increased likelihood of false-positive results on the CFT test, although this association was not significant. No significant association was detected among cattle testing positive for M paratuberculosis as determined by microbial culture of feces and antibody ELISA and positive CFT test and IFN-gamma assay results for M bovis.
van Rensburg, Ilana C; Loxton, Andre G
2018-01-01
Regulatory B cells (Bregs) have been shown to be present during several disease states. The phenotype of the cells is not completely defined and the function of these cells differ between disease. The presence of FASL expressing (killer) B cells during latent and successfully treated TB disease have been shown but whether these cells are similar to regulatory B cells remain unclear. We assessed the receptor expression of FASL/IL5 (killer B cells), CD24/CD38 (regulatory B cells) on whole peripheral blood of participants with untreated active TB and healthy controls. We then isolated B cells from a second cohort of M.tb exposed (Quantiferon (QFN) positive) and unexposed (Quantiferon negative) HIV negative participants, and evaluated the frequency of killer B cells induced following stimulation with BCG and/or CD40 and IL5. Our data reveal no difference in the expression on CD24 and CD38 between participants with active TB and the controls. There was also no difference in the frequency of regulatory B cells measured in the peripheral blood mononuclear cells (PBMC) fraction between latent TB and uninfected controls. We did however notice that regulatory B cells (CD24hiCD38hi) population express the FASL receptor. The expression of killer B cell phenotype (CD178+IL5RA+) was significantly higher in controls compared to those with active TB disease (1,06% vs 0,455%). Furthermore, we found that BCG restimulation significantly induced the FASL/IL5RA B cells but this was only evident in the QFN positive group. Our data suggest that both regulatory and killer B cells are present during latent and active TB disease but that the frequency of these populations are increased during latent disease. We also show that the FASL+IL5RA+ B killer B cells are induced in latent TB infection following BCG restimulation but whether these cells are indicative of protection remains unclear. Copyright © 2017 Elsevier Ltd. All rights reserved.
Roquilly, Antoine; Broquet, Alexis; Jacqueline, Cédric; Masson, Damien; Segain, Jean Pierre; Braudeau, Cecile; Vourc'h, Mickael; Caillon, Jocelyne; Altare, Frédéric; Josien, Regis; Retière, Christelle; Villadangos, Jose; Asehnoune, Karim
2014-12-01
Trauma induces a state of immunosuppression, which is responsible for the development of nosocomial infections. Hydrocortisone reduces the rate of pneumonia in patients with trauma. Because alterations of dendritic cells and natural killer cells play a central role in trauma-induced immunosuppression, we investigated whether hydrocortisone modulates the dendritic cell/natural killer cell cross talk in the context of posttraumatic pneumonia. Experimental study. Research laboratory from an university hospital. Bagg Albino/cJ mice (weight, 20-24 g). First, in an a priori substudy of a multicenter, randomized, double-blind, placebo-controlled trial of hydrocortisone (200 mg/d for 7 d) in patients with severe trauma, we have measured the blood levels of five cytokines (tumor necrosis factor-α, interleukin-6, interleukin-10, interleukin-12, interleukin-17) at day 1 and day 8. In a second step, the effects of hydrocortisone on dendritic cell/natural killer cell cross talk were studied in a mouse model of posttraumatic pneumonia. Hydrocortisone (0.6 mg/mice i.p.) was administered immediately after hemorrhage. Twenty-four hours later, the mice were challenged with Staphylococcus aureus (7 × 10 colony-forming units). Using sera collected during a multicenter study in patients with trauma, we found that hydrocortisone decreased the blood level of interleukin-10, a cytokine centrally involved in the regulation of dendritic cell/natural killer cell cluster. In a mouse model of trauma-hemorrhage-induced immunosuppression, splenic natural killer cells induced an interleukin-10-dependent elimination of splenic dendritic cell. Hydrocortisone treatment reduced this suppressive function of natural killer cells and increased survival of mice with posthemorrhage pneumonia. The reduction of the interleukin-10 level in natural killer cells by hydrocortisone was partially dependent on the up-regulation of glucocorticoid-induced tumor necrosis factor receptor-ligand (TNFsf18) on
Longbottom, E Rebecca; Torrance, Hew D T; Owen, Helen C; Fragkou, Paraskevi C; Hinds, Charles J; Pearse, Rupert M; O'Dwyer, Michael J
2016-08-01
The aim of this study was to evaluate the role of interleukin (IL)-6 pathways in postoperative immune suppression and to assess the reversibility of this phenomenon. The postoperative period is characterized by increased IL-6 production and features of immune suppression. In vitro, IL-6 mediates anti-inflammatory effects through inhibition of interferon gamma (IFN-γ) pathways. The significance of the immunomodulatory effects of IL-6 in the clinical setting of postoperative immune suppression remains unclear. Patients over 45 years old undergoing elective surgery, involving the gastrointestinal tract, were recruited. IL-6 levels were assayed using an enzyme linked immunosorbent assay preoperatively, and at 24 and 48 hours. Peripheral blood mononuclear cells from healthy volunteers were cultured in perioperative serum and CD14Human Leukocyte Antigen-DR (HLA-DR) [monocyte HLA-DR (mHLA-DR)] geometric mean florescent intensity was measured in the presence and absence of IL-6 neutralizing antibody and recombinant IFN-γ. Of the 108 patients, 41 developed a postoperative infection. The IL-6 levels increased 19-fold from the preoperative sample to 24 hours postoperatively (P < 0.0001). Higher IL-6 levels at 24 (P = 0.0002) and 48 hours (P = 0.003) were associated with subsequent postoperative infectious complications. mHLA-DR mean florescent intensity fell when healthy peripheral blood mononuclear cells were cultured with postoperative serum compared with preoperative serum (P = 0.008). This decrease was prevented by the presence of IFN-γ in the culture media, but not by the presence of IL-6-neutralizing antibody. IL-6 levels increase after a major surgery and are associated with an increased susceptibility to postoperative infections. Serum obtained from postoperative patients induces an immunosuppressive response, reflected in reduced mHLA-DR levels, mediated through IL-6 independent pathways and is reversible with IFN-γ. These data may have
Nguyen, S; Beziat, V; Dhedin, N; Kuentz, M; Vernant, J P; Debre, P; Vieillard, V
2009-05-01
Natural killer (NK) cells generated after haploidentical hematopoietic SCT in patients with AML are characterized by specific phenotypic features and impaired functioning that may affect transplantation outcome. We show that IFN-gamma produced by immature CD56(bright) NK cells upregulates cell surface expression of HLA-E on AML blasts and that this upregulation protects leukemic cells from NK-mediated cell lysis through the mediation of CD94/NKG2A, an inhibitory receptor overexpressed on NK cells after haploidentical SCT. Two years after transplantation, however, maturing NK cells were functionally active, as evidenced by high cytotoxicity and poor IFN-gamma production. This implies that maturation of NK cells is the key to improved immune responses and transplantation outcome.
NASA Astrophysics Data System (ADS)
Daulay, R. S.; Daulay, R. M.
2018-03-01
Cellular immunity was mediated the host immune response against Mycobacterium tuberculosis, in which cytokine and T-helper (Th) 1 cells play an important role. Interferon-gamma (IFN-γ) is a leading cytokine involved in the immune response of tuberculosis (TB).The primary function of IFN-γ is to activate macrophages in opposition Mycobacterium tuberculosis. Contrast from IFN-γ, interleukin-10 (IL-10) is considered inhibitory cytokine, important to an adequate balance between inflammatory responses. To analyze cytokine profile, particularly IFN-γ and IL-10 of the children with TB in Indonesia, a cross-sectional study was conducted at two general hospitals and seven primary health care located in Medan and Batubara, North Sumatera, Indonesia. Among 51 children with TB disease and 51 healthy children, found that IFN-γ and IL-10 levels were lower in TB patients compared to healthy children. Statistically significant decreased production of the IFN-γ levels (p=0.042) were found in TB patients 9.41 (1.10-28.06) pg/ml contrast to healthy children 6.30 (1.30-89.76) pg/ml. Homologue finding of the IL-10 levels were also found in TB patients 4.93 (0.22-48.01) pg/ml and 4.93 (0.07-81.60) pg/ml in healthy children, but not statistically significant (p=0.784). High levels of IL-10 were not proven to suppress the levels production of IFN-γ in TB patients.
Immunomodulatory intervention with Gamma interferon in mice with sepsis.
Wang, Yu; Kong, Bing-Bing; Yang, Wen-Ping; Zhao, Xin; Zhang, Rong
2017-09-15
Sepsis-triggered immune paralysis including T-cell dysfunction increase susceptibility to infection. Gamma interferon (IFNg) exert beneficial effects in patients with sepsis. Herein, we speculated that IFNg may attenuate T-cell dysfunction induced by sepsis, although the mechanisms remain elusive. To test this hypothesis, we used a model based on cecal ligation and puncture (CLP) to induce sepsis in mice. Male C57BL/6 mice were pretreated with recombinant human IFNg (0.01μg/g of body weight) before CLP. The immunophenotyping of cell surface receptor expression, and regulatory T cells (CD4+CD25+Foxp3+) were quantified by flow cytometry. Immunohistochemical staining was performed to evaluate the loss of immune effector cells. Formation of IFNg and interleukin 4 (IL-4) in the spleen and plasma levels of TNF-α, IL-6, high-mobility group box 1 (HMGB1) were determined using enzyme-linked immunosorbent assay. IFNg markedly inhibited the reduction in cytokine secretion from lipopolysaccharide (LPS)-stimulated splenocytes. IFNg-treated mices had significantly decreased percentages of programmed cell death 1 (PD-1) receptors, increased the percentages of positive costimulatory receptor CD28 on CD4 T cells expressing. IFNg markedly reduced T-cell apoptosis through upregulating the expression of Bcl-2. CLP-induced formation of regulatory T cells in the spleen was abolished in IFNg -treated mices. Moreover, IFNg treatment reduced plasma levels of TNF-α, IL-6, HMGB1. IFNg can be a powerful regulator of immune function under sepsis conditions. Therefore, targeted immune-enhancement with IFNg may be a valid therapeutic approach in sepsis. Copyright © 2017 Elsevier Inc. All rights reserved.
Medina, K; Carrau, F M; Gioia, O; Bracesco, N
1997-01-01
The competition between selected or commercial killer strains of type K2 and sensitive commercial strains of Saccharomyces cerevisiae was studied under various conditions in sterile grape juice fermentations. The focus of this study was the effect of yeast inoculation levels and the role of assimilable nitrogen nutrition on killer activity. A study of the consumption of free amino nitrogen (FAN) by pure and mixed cultures of killer and sensitive cells showed no differences between the profiles of nitrogen assimilation in all cases, and FAN was practically depleted in the first 2 days of fermentation. The effect of the addition of assimilable nitrogen and the size of inoculum was examined in mixed killer and sensitive strain competitions. Stuck and sluggish wine fermentations were observed to depend on nitrogen availability when the ratio of killer to sensitive cells was low (1:10 to 1:100). A relationship between the initial assimilable nitrogen content of must and the proportion of killer cells during fermentation was shown. An indirect relationship was found between inoculum size and the percentage of killer cells: a smaller inoculum resulted in a higher proportion of killer cells in grape juice fermentations. In all cases, wines obtained with pure-culture fermentations were preferred to mixed-culture fermentations by sensory analysis. The reasons why killer cells do not finish fermentation under competitive conditions with sensitive cells are discussed. PMID:9212430
Tumour ischaemia by interferon-γ resembles physiological blood vessel regression.
Kammertoens, Thomas; Friese, Christian; Arina, Ainhoa; Idel, Christian; Briesemeister, Dana; Rothe, Michael; Ivanov, Andranik; Szymborska, Anna; Patone, Giannino; Kunz, Severine; Sommermeyer, Daniel; Engels, Boris; Leisegang, Matthias; Textor, Ana; Fehling, Hans Joerg; Fruttiger, Marcus; Lohoff, Michael; Herrmann, Andreas; Yu, Hua; Weichselbaum, Ralph; Uckert, Wolfgang; Hübner, Norbert; Gerhardt, Holger; Beule, Dieter; Schreiber, Hans; Blankenstein, Thomas
2017-05-04
The relative contribution of the effector molecules produced by T cells to tumour rejection is unclear, but interferon-γ (IFNγ) is critical in most of the analysed models. Although IFNγ can impede tumour growth by acting directly on cancer cells, it must also act on the tumour stroma for effective rejection of large, established tumours. However, which stroma cells respond to IFNγ and by which mechanism IFNγ contributes to tumour rejection through stromal targeting have remained unknown. Here we use a model of IFNγ induction and an IFNγ-GFP fusion protein in large, vascularized tumours growing in mice that express the IFNγ receptor exclusively in defined cell types. Responsiveness to IFNγ by myeloid cells and other haematopoietic cells, including T cells or fibroblasts, was not sufficient for IFNγ-induced tumour regression, whereas responsiveness of endothelial cells to IFNγ was necessary and sufficient. Intravital microscopy revealed IFNγ-induced regression of the tumour vasculature, resulting in arrest of blood flow and subsequent collapse of tumours, similar to non-haemorrhagic necrosis in ischaemia and unlike haemorrhagic necrosis induced by tumour necrosis factor. The early events of IFNγ-induced tumour ischaemia resemble non-apoptotic blood vessel regression during development, wound healing or IFNγ-mediated, pregnancy-induced remodelling of uterine arteries. A better mechanistic understanding of how solid tumours are rejected may aid the design of more effective protocols for adoptive T-cell therapy.
Nakata, Shinsuke; Imagawa, Akihisa; Miyata, Yugo; Yoshikawa, Atsushi; Kozawa, Junji; Okita, Kohei; Funahashi, Tohru; Nakamura, Seiji; Matsubara, Kenichi; Iwahashi, Hiromi; Shimomura, Iichiro
2013-01-01
Fulminant type 1 diabetes is an independent subtype of type 1 diabetes characterized by extremely rapid onset and absence of islet-related autoantibodies. However, detailed pathophysiology of this subtype is poorly understood. In this study, a comprehensive approach was applied to understand the pathogenesis of fulminant type 1 diabetes. We determined the genes that were differentially expressed in fulminant type 1 diabetes compared with type 1A diabetes and healthy control, using gene expression microarray in peripheral blood cells. Using volcano plot analysis, we found reduced expression of killer cell lectin-like receptor subfamily C, member 3 (KLRC3) which encodes NKG2E, a natural killer (NK) cell activating receptor, in fulminant type 1 diabetes, compared with healthy controls. This difference was confirmed by real-time RT-PCR among NK-enriched cells. The expression of KLRD1 (CD94), which forms heterodimer with NKG2E (KLRC3), was also reduced in NK-enriched cells in fulminant type 1 diabetes. Furthermore, flow cytometry showed significantly lower proportion of NK cells among peripheral blood mononuclear cells (PBMCs) in fulminant type 1 diabetes than in healthy controls. In patients with fulminant type 1 diabetes, the relative proportion of NK cells correlated significantly with the time period between onset of fever to the appearance of hyperglycemic-related symptoms. We conclude the presence of reduced NK activating receptor gene expression and low proportion of NK cells in fulminant type 1 diabetes. Copyright © 2013 Elsevier B.V. All rights reserved.
López, Tatiana; García, Diego; Angel, Bárbara; Carrasco, Elena; Codner, Ethel; Ugarte, Francisca; Pérez-Bravo, Francisco
2008-02-02
In order to assess whether Fok I vitamin D receptor gene (VDR) polymorphism is involved in the genetic susceptibility of type 1 diabetes, a case-control study was conducted and VDR genotypes were related to serum concentrations of 25(OH) vitamin D and cytokines transforming growth factor beta1 (TGF-beta1) and interferon gamma (INF-gamma). 151 incident cases of type 1 diabetes and 182 non related healthy controls from Santiago were studied for VDR polymorphisms in peripheral blood DNA. Exon 2 (Fok I) segments were amplified by polimerase chain reaction and analyzed by means of restriction fragment length polymorphism to determine each corresponding genotype. Differences for allele, genotype and serological markers as 25(OH) vitamin D, TGF-beta1 and INF-gamma levels distribution between patients and controls were analyzed. Fok I polymorphism distribution analysis showed no differences between patients and controls. Among diabetics, higher levels of TGF-beta1 (median, 282.6 pg/ml; range, 131.8-3,031.4) were observed compared with healthy children (median, 232.2 pg/ml; range, 135.7-506.5) (p < 0.0038). Similar results were observed for INF-gamma concentrations (median, 121.1 pg/ml, and range, 5.3-228.8, in cases, and median, 89.6 pg/ml, and range, 10.9-117.2 in controls) (p < 0.0004). The diabetic carriers of the ff genotype showed low levels of 25(OH) vitamin D compared with the carriers of the F allele: mean (standard deviation), 23.1 (5.9) versus 27.9 (10.3) ng/ml (p < 0.03). A similar result was observed for TGF-beta1 concentrations in diabetic carriers of ff genotype and patients carriers of the F allele (298.5 versus 276.6; p < 0.05). Fok I polymorphism of VDR could have a marginal role in the immunologic disturbance in type 1 diabetes.
NASA Technical Reports Server (NTRS)
Gridley, Daila S.; Nelson, Gregory A.; Peters, Luanne L.; Kostenuik, Paul J.; Bateman, Ted A.; Morony, Sean; Stodieck, Louis S.; Lacey, David L.; Simske, Steven J.; Pecaut, Michael J.
2003-01-01
This portion of the study quantified the effects of a 12-day space shuttle mission (Space Transport System-108/UF-1) on body and lymphoid organ masses, activation marker expression, cytokine secretion, and erythrocyte and thrombocyte characteristics in C57BL/6 mice. Animals in flight (Flt group) had 10-12% lower body mass compared with ground controls housed either in animal enclosure modules or under standard vivarium conditions (P < 0.001) and the smallest thymus and spleen masses. Percentages of CD25(+) lymphocytes, CD3(+)/CD25(+) T cells, and NK1.1(+)/CD25(+) natural killer cells from Flt mice were higher compared with both controls (P < 0.05). In contrast, CD71 expression was depressed in the Flt and animal enclosure module control mice compared with vivarium control animals (P < 0.001). Secretion of interferon-gamma, IL-2, and IL-4, but not tumor necrosis factor-alpha and IL-5, by splenocytes from Flt mice was decreased relative to either one or both ground controls (P < 0.05). Flt mice also had high red blood cell and thrombocyte counts compared with both sets of controls; low red blood cell volume and distribution width, percentage of reticulocytes, and platelet volume were also noted (P < 0.05) and were consistent with dehydration. These data indicate that relatively short exposure to the spaceflight environment can induce profound changes that may become significant during long-term space missions.
Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J
2018-05-01
To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.
Nordén, Rickard; Martner, Anna; Samuelsson, Ebba; Hynsjö, Lars; Wold, Agnes E.
2017-01-01
ABSTRACT A peculiar trait of pneumococci (Streptococcus pneumoniae) is their propensity to undergo spontaneous lysis during stationary growth due to activation of the enzyme autolysin (LytA), which fragments the peptidoglycan cell wall. The fragments that are generated upon autolysis impair phagocytosis and reduce production of interleukin-12 (IL-12) and gamma interferon (IFN-γ) by human leukocytes in response to intact pneumococci, thereby impeding crucial host defenses. The objective was to identify additional monocyte genes whose transcription is induced by intact pneumococci and subverted by autolyzed bacteria. Monocytes were isolated from healthy blood donors and stimulated for 3 h with UV-inactivated S. pneumoniae (Rx1PLY− LytA+ strain), which is capable of autolyzing, its LytA− isogenic autolysin-deficient mutant, or a mixture of the two (containing twice the initial bacterial concentration). Gene expression was assessed by Illumina microarray, and selected findings were confirmed by reverse transcription-quantitative real-time PCR (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and flow cytometry. In all, we identified 121 genes that were upregulated to a significantly higher degree by intact than autolyzed pneumococci. These included IFNB1 and a large set of interferon-induced genes, such as IFIT3, RSAD2, CFCL1, and CXCL10 genes, as well as IL12B and CD40 genes. RT-qPCR revealed that transcription of these genes in response to intact pneumococci diminished when autolyzed pneumococci were admixed and that this pattern was independent of pneumolysin. Thus, transcription of interferon-related genes is triggered by intact pneumococci and subverted by fragments generated by spontaneous bacterial autolysis. We suggest that interferon-related pathways are important for elimination of pneumococci and that autolysis contributes to virulence by extinguishing these pathways. PMID:28223347
Yano, E; Komai, T; Kawasaki, T; Kaifu, K; Atsuta, T; Kubo, Y; Fujiwara, Y
1985-09-01
The film surface of poly(gamma-benzyl-L-glutamate) (PBLG) was modified with 2-aminoethanol to enhance its hydrophilicity. Controlling the reaction conditions of PBLG and 2-aminoethanol, various types of copoly(gamma-benzyl-L-glutamate, gamma-hydroxyethyl-L-glutamine) film surfaces were obtained. Surface free energy (gamma sv), the dispersive component of gamma sv (gamma dsv), the nondispersive component of gamma sv (gamma psv), and the interfacial free energy of polymer surface with water (gamma sw), which were obtained by using the contact angle measurement and calculation method proposed by Andrade et al., were changed remarkably by the aminolysis. The gamma sv value increased after 2 h of aminolysis from 48.2 (PBLG) to 65.3 dyn/cm and gradually increased to around 70 dyn/cm after 12 h reaction. (gamma dsv) and (gamma psv) changed from 31.0 and 17.2 dyn/cm (PBLG) to 26.5 and 44.3 dyn/cm, respectively. These parameters of the material surfaces, modified over 12 h reaction, were found to be similar to those of the surfaces of canine aorta, vein, and human fibrin membrane. Blood clotting times on these polymer surfaces were comparatively longer than on siliconized glass surfaces.
On the communicative significance of whistles in wild killer whales (Orcinus orca)
NASA Astrophysics Data System (ADS)
Thomsen, Frank; Franck, Dierk; Ford, John
2002-08-01
Killer whales (Orcinus orca) use pulsed calls and whistles in underwater communication. Unlike pulsed calls, whistles have received little study and thus their function is poorly known. In this study, whistle activities of groups of individually known killer whales were compared quantitatively across behavioural categories. Acoustic recordings and simultaneous behavioural observations were made of northern resident killer whales off Vancouver Island in 1996 and 1997. Whistles were produced at greater rates than discrete calls during close-range behavioural activities than during long-range activities. They were the predominant sound-type recorded during socializing. The number of whistles per animal per minute was significantly higher during close-range behavioural activities than during long-range activities. Evidently, whistles play an important role in the close-range acoustic communication in northern resident killer whales.
On the communicative significance of whistles in wild killer whales (Orcinus orca).
Thomsen, Frank; Franck, Dierk; Ford, John K B
2002-09-01
Killer whales (Orcinus orca) use pulsed calls and whistles in underwater communication. Unlike pulsed calls, whistles have received little study and thus their function is poorly known. In this study, whistle activities of groups of individually known killer whales were compared quantitatively across behavioural categories. Acoustic recordings and simultaneous behavioural observations were made of northern resident killer whales off Vancouver Island in 1996 and 1997. Whistles were produced at greater rates than discrete calls during close-range behavioural activities than during long-range activities. They were the predominant sound-type recorded during socializing. The number of whistles per animal per minute was significantly higher during close-range behavioural activities than during long-range activities. Evidently, whistles play an important role in the close-range acoustic communication in northern resident killer whales.
Xu, Chen; Liu, Dongning; Chen, Zhixin; Zhuo, Fan; Sun, Huankui; Hu, Jiaping; Li, Taiyuan
2018-06-19
Colorectal cancer (CRC) is among cancers with highest incidence globally and currently ranks fourth as the leading cause of cancer-related deaths worldwide. It remains an urgent need for novel strategies in the management of patients with advanced CRC. Adoptive transfer of allogeneic natural killer (NK) cells represent an attractive option in the treatment of patients with CRC. In this study, we successfully expanded NK cells from umbilical cord blood (UCB) with membrane-bound IL-21, termed eUCB-NK cells. eUCB-NK cells efficiently lysed CRC cell lines in vitro and secreted significantly higher levels of IFN-γ, TNF-α, GM-CSF and CCL3 compared with IL-2 stimulated NK cells. Adoptive transfer of these NK cells significantly inhibited the growth of HT29 xenografts, whereas LoVo tumors were not effectively controlled with eUCB-NK cells. More NK cells inside HT29 tumors, not seen in LoVo tumors, might contribute to the differences in response to eUCB-NK cells. Combination of bevacizumab can increase extravasation of adoptively transferred NK cells into the LoVo tumors and improve the therapeutic activity of eUCB-NK cells. These results justified clinical translation of this UCB-derived NK cell-based therapeutics, either used alone or combined with bevacizumab, as a novel treatment option for patients with CRC.
Streck, R J; Helinski, E H; Ovak, G M; Pauly, J L
1990-09-01
Lymphokine (i.e., interleukin 2; IL-2)-activated killer (LAK) cells derived from normal human blood are known to destroy human tumor target cells. Accordingly, immunotherapy modalities using IL-2, either alone or in combination with LAK cells, have been evaluated for eradicating metastatic cancer. In studies conducted to characterize receptors on LAK cell membrane ultrastructures, we observed that LAK cells kill autologous human monocyte-derived macrophages (M phi). In these experiments, peripheral blood mononuclear cells of a healthy adult donor were cultured to generate LAK cells and autologous non-adherent M phi. Thereafter, conjugates were prepared by incubating for 3 h autologous populations of LAK cells and M phi. Examination of the conjugates by scanning electron microscopy (SEM) identified LAK cell-mediated killing of M phi. Moreover, SEM analysis of the LAK cell membrane architecture identified microvilli-like ultrastructures that provided a physical bridge that joined together the LAK cell and M phi. The immunological mechanism(s) underling LAK cell killing of autologous M phi is not known; nevertheless, these conjugates will provide a useful model to study membrane receptors on ultrastructures that mediate the initial stages of cytolysis that include target cell recognition and cell-to-cell adhesion. The results of our observations and the findings of other investigators who have also demonstrated LAK cell killing of autologous normal human leukocytes are discussed in the context of the association of IL-2 and IL-2-activated killer cells with side effects observed in ongoing clinical trials and with autoimmune disorders.
Harris, Sam; Ma, Hongtao; Zhao, Mingrui; Boorman, Luke; Zheng, Ying; Kennerley, Aneurin; Bruyns-Haylett, Michael; Overton, Paul G; Berwick, Jason; Schwartz, Theodore H
2014-08-15
Characterization of neural and hemodynamic biomarkers of epileptic activity that can be measured using non-invasive techniques is fundamental to the accurate identification of the epileptogenic zone (EZ) in the clinical setting. Recently, oscillations at gamma-band frequencies and above (>30 Hz) have been suggested to provide valuable localizing information of the EZ and track cortical activation associated with epileptogenic processes. Although a tight coupling between gamma-band activity and hemodynamic-based signals has been consistently demonstrated in non-pathological conditions, very little is known about whether such a relationship is maintained in epilepsy and the laminar etiology of these signals. Confirmation of this relationship may elucidate the underpinnings of perfusion-based signals in epilepsy and the potential value of localizing the EZ using hemodynamic correlates of pathological rhythms. Here, we use concurrent multi-depth electrophysiology and 2-dimensional optical imaging spectroscopy to examine the coupling between multi-band neural activity and cerebral blood volume (CBV) during recurrent acute focal neocortical seizures in the urethane-anesthetized rat. We show a powerful correlation between gamma-band power (25-90 Hz) and CBV across cortical laminae, in particular layer 5, and a close association between gamma measures and multi-unit activity (MUA). Our findings provide insights into the laminar electrophysiological basis of perfusion-based imaging signals in the epileptic state and may have implications for further research using non-invasive multi-modal techniques to localize epileptogenic tissue. Copyright © 2014. Published by Elsevier Inc.
Effects of interferon on antibody formation
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.
1984-01-01
Studies of the effects of interferon on primary and secondary antibody responses and of the relationship of interferon to other cytokines, or cell products, are presented. Dosage- and timing-dependent immunoenhancing and immunosuppressive activities of interferon are documented for mouse spleen cell cultures and for mice infected with murine hepatitis virus (MHV-3). A possibility that altered interferon production might lead to immunopathological disorders, such as lupus erythematosus, AIDS, arthritis, etc., is discussed. Latest technological developments are presented that indicate that interferon does apparently play a major role in the regulation of antibody responses.
Interferon-gamma promoter hypomethylation and increased expression in chronic periodontitis
Zhang, Shaoping; Crivello, Antonino; Offenbacher, Steven; Moretti, Antonio; Paquette, David W.; Barros, Silvana P.
2011-01-01
Aim The goal of this investigation was to determine whether epigenetic modifications in the IFNG promoter are associated with an increase of IFNG transcription in different stages of periodontal diseases. Materials and Methods DNA was extracted from gingival biopsy samples collected from 47 total sites from 47 different subjects: 23 periodontally healthy sites, 12 experimentally induced gingivitis sites and 12 chronic periodontitis sites. Levels of DNA methylation within the IFNG promoter containing six CpG dinucleotides were determined using pyrosequencing technology. Interferon gamma mRNA expression was analysed by quantitative polymerase chain reactions using isolated RNA from part of the biological samples mentioned above. Results The methylation level of all six analysed CpG sites within the IFNG promoter region in the periodontitis biopsies {52% [interquartile range, IQR (43.8%, 63%)]} was significantly lower than periodontally healthy samples {62% [IQR (51.3%, 74%)], p =0.007} and gingivitis biopsies {63% [IQR (55%, 74%)], p =0.02}. The transcriptional level of IFNG in periodontitis biopsies was 1.96-fold and significantly higher than tissues with periodontal health (p =0.04). Although the mRNA level from experimental gingivitis samples exhibited an 8.5-fold increase as compared with periodontally healthy samples, no significant methylation difference was observed in experimental gingivitis sample. Conclusions A hypomethylation profile within IFNG promoter region is related to an increase of IFNG transcription present in the chronic periodontitis biopsies, while such an increase of IFNG in experimentally induced gingivitis seems independent of promoter methylation alteration. PMID:20958339
Pane, Jessica A.; Webster, Nicole L.; Coulson, Barbara S.
2014-01-01
It has been proposed that rotavirus infection promotes the progression of genetically-predisposed children to type 1 diabetes, a chronic autoimmune disease marked by infiltration of activated lymphocytes into pancreatic islets. Non-obese diabetic (NOD) mice provide a model for the human disease. Infection of adult NOD mice with rhesus monkey rotavirus (RRV) accelerates diabetes onset, without evidence of pancreatic infection. Rather, RRV spreads to the pancreatic and mesenteric lymph nodes where its association with antigen-presenting cells, including dendritic cells, induces cellular maturation. RRV infection increases levels of the class I major histocompatibility complex on B cells and proinflammatory cytokine expression by T cells at these sites. In autoimmunity-resistant mice and human mononuclear cells from blood, rotavirus-exposed plasmacytoid dendritic cells contribute to bystander polyclonal B cell activation through type I interferon expression. Here we tested the hypothesis that rotavirus induces bystander activation of lymphocytes from NOD mice by provoking dendritic cell activation and proinflammatory cytokine secretion. NOD mouse splenocytes were stimulated with rotavirus and assessed for activation by flow cytometry. This stimulation activated antigen-presenting cells and B cells independently of virus strain and replicative ability. Instead, activation depended on virus dose and was prevented by blockade of virus decapsidation, inhibition of endosomal acidification and interference with signaling through Toll-like receptor 7 and the type I interferon receptor. Plasmacytoid dendritic cells were more efficiently activated than conventional dendritic cells by RRV, and contributed to the activation of B and T cells, including islet-autoreactive CD8+ T cells. Thus, a double-stranded RNA virus can induce Toll-like receptor 7 signaling, resulting in lymphocyte activation. Our findings suggest that bystander activation mediated by type I interferon
Allen, Frederick; Rauhe, Peter; Askew, David; Tong, Alexander A.; Nthale, Joseph; Eid, Saada; Myers, Jay T.; Tong, Caryn; Huang, Alex Y.
2017-01-01
Lymph node (LN) plays a critical role in tumor cell survival outside of the primary tumor sites and dictates overall clinical response in many tumor types (1, 2). Previously, we and others have demonstrated that CCL3 plays an essential role in orchestrating T cell—antigen-presenting cell (APC) encounters in the draining LN following vaccination, and such interactions enhance the magnitude of the memory T cell pool (3–5). In the current study, we investigate the cellular responses in the tumor-draining lymph nodes (TDLNs) of a CCL3-secreting CT26 colon tumor (L3TU) as compared to wild-type tumor (WTTU) during the priming phase of an antitumor response (≤10 days). In comparison to WTTU, inoculation of L3TU resulted in suppressed tumor growth, a phenomenon that is accompanied by altered in vivo inflammatory responses on several fronts. Autologous tumor-derived CCL3 (aCCL3) secretion by L3TU bolstered the recruitment of T- and B-lymphocytes, tissue-migratory CD103+ dendritic cells (DCs), and CD49b+ natural killer (NK) cells, resulting in significant increases in the differentiation and activation of multiple Interferon-gamma (IFNγ)-producing leukocytes in the TDLN. During this early phase of immune priming, NK cells constitute the major producers of IFNγ in the TDLN. CCL3 also enhances CD8+ T cell proliferation and differentiation by augmenting DC capacity to drive T cell activation in the TDLN. Our results revealed that CCL3-dependent IFNγ production and CCL3-induced DC maturation drive the priming of effective antitumor immunity in the TDLN. PMID:29109732
Role of interferon in resistance and immunity to protozoa
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Degee, A. L. W.; Mansfield, J. M.; Newsome, A. L.; Arnold, R. R.
1985-01-01
Production of interferon (I) in response to protozoan infection, and the interferon-mediated inhibition of parasite replication were studied in order to determine if these effects may be related to immunologic-mediated resistance of the hosts. Two extracellular parasites-Trypanosoma brucei rhodesiense and Naegleria fowlei were used. Upon infection with the trypanosome, only resistant strains of mice produced I. An early peak of alpha/beta I is followed by appearance of gamma I, which coincided with antibody production and a drop in parasitemia. In case of the amoeba, pretreatment of its suspension with alpha/beta I inhibits its replication in vitro, and appears to protect mice from the infection and the disease. It is proposed that production of interferon, with its regulatory effect on the immune responses, may play a major role in regulating the processes of protozoan-caused diseases.
Alecsandru, Diana; García-Velasco, Juan A
2017-06-01
The immune system's role in recurrent reproductive failure is a controversial issue in assisted reproduction. Most studies into immune system implication in reproduction have focused on finding markers of peripheral blood and less on the uterine environment. Peripheral blood natural killer cells have become an "immune study core" for women with recurrent miscarriage or recurrent implantation failure, based on the mistaken notion that they cause reproductive failure by killing or "rejecting" the embryo. Maternal-fetal tolerance begins at the uterine level, so successful adaptation to the fetus occurs after a complicated process. Insufficient uterine lining invasion by an invading extravillous trophoblast is the primary defect in pregnancy disorders such as recurrent miscarriage. This process is regulated by the interaction between maternal killer immunoglobulin-like receptors (KIRs), expressed by uterine natural killer cells (uNK), and their ligand human leukocyte antigen (HLA) C, expressed by the extravillous trophoblast. Pregnancies are an increased risk of disorders in mothers with KIR AA when the fetus has paternal HLA-C2. A recent report has indicated that the expression of more than one paternal HLA-C by the extravillous trophoblast in assisted reproduction may affect placentation in mothers with KIR AA. This review provides insight into the immune system's role in assisted reproductive treatments. These insights can have an impact on the selection of single-embryo transfer and/or oocyte/sperm donor according to HLA-C in patients with recurrent implantation failure and recurrent miscarriage depending on their KIR haplotype. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Inhibition of human mast cell growth and differentiation by interferon gamma-1b.
Kirshenbaum, A S; Worobec, A S; Davis, T A; Goff, J P; Semere, T; Metcalfe, D D
1998-03-01
In an effort to identify cytokines that inhibit human mast cell growth, we cultured HMC-1 cells and recombinant human stem cell factor (rhSCF)-dependent human bone marrow-derived mast cells (HBMCs) in the presence of interferon gamma (IFNgamma)-1b and interferon alpha (IFNalpha)-2b. HMC-1 cell numbers decreased in the presence of 1000 U/mL IFNgamma-1b but were unaffected by 1000 U/mL of IFNalpha-2b. HBMCs were then cultured for 0 to 7 days with 100 ng/mL rhSCF and 10 ng/mL recombinant human IL-3 (rhIL-3), followed by culture in rhSCF and administration of either 1000 U/mL IFNalpha-2b or 1000 U/mL IFNgamma-1b. HBMCs appearing in cultures with rhSCF alone or in combination with IFNalpha-2b were virtually identical in number through 8 weeks of culture. In cultures supplemented with IFNgamma-1b, HBMCs significantly decreased in number and incidence of granular metachromasia by 4 to 5 weeks (p<0.001). Similar results were obtained when human marrow was cultured from day 0 with rhSCF and IFNgamma-1b. Mature rhSCF-dependent HBMCs were also cultured at 5 weeks with rhSCF alone or in combination with IFNgamma-1b. Compared with cells cultured in rhSCF, mature 5-week HBMC cultures treated with rhSCF plus IFNgamma-1b revealed a decrease in mast cells, and those mast cells that remained had fewer toluidine blue- and tryptase-positive granules after 5 to 8 weeks. FACS analysis of rhSCF plus IFNgamma-1b-treated mature HBMCs revealed increased c-kit and Fc(epsilon)RI expression. Mast cell releasibility was not increased. IFNgamma-lb was thus able to suppress mast cell growth from CD34+ cells, suggesting that this agent should be considered as a candidate cytokine for the treatment of disorders of mast cell proliferation.
Okafor, C C; Grooms, D L; Bolin, S R; Averill, J J; Kaneene, J B
2014-12-01
Development of point of concentration (POC) surveillance strategies for bovine tuberculosis (bTB) would facilitate global efforts to eradicate bTB. The interferon-gamma (IFNγ) assay can detect IFNγ responses to Mycobacterium bovis in blood collected at commencement of exsanguination (COE) of experimentally challenged cattle but has not been evaluated under field conditions. The current study was aimed at determining (i) whether blood collected at COE of cattle at slaughter, under field conditions, is practical to obtain and useful for identifying cattle as IFNγ positive for bTB, (ii) whether the results of the IFNγ assay obtained at COE reliably compare with results obtained from live animals in the field, and (iii) whether the identified animal(s) originated from bTB-infected or bTB-exposed herds. Cattle from three risk groups were used: the highest risk group consisted of 49 cattle from 3 bTB-infected herds; the medium risk group consisted of 24 cattle from a potentially exposed herd; and the lowest risk group consisted of 60 cattle from herds with no known history of bTB exposure. The IFNγ assay was performed on blood collected both before stunning and at COE of cattle at slaughter. An enhanced slaughter inspection for gross lesions consistent with bTB was performed on all cattle. In addition, lymph nodes were cultured for M. bovis for cattle that tested positive for bTB via the IFNγ assay and for most cattle that tested negative for bTB. Cattle, both with and without lesions consistent with bTB, were identified as positive for bTB by the IFNγ assay using blood collected at COE, but none of the positive cattle originated from the lowest risk group. The current study demonstrates that blood collected at COE of cattle is both a practical and moderately reliable sample for accessing bTB infection using the IFNγ assay. © 2013 Blackwell Verlag GmbH.
Anticonvulsant properties of alpha, gamma, and alpha, gamma-substituted gamma-butyrolactones.
Klunk, W E; Covey, D F; Ferrendelli, J A
1982-09-01
Derivatives of gamma-butyrolactone (GBL) substituted on the alpha- and/or gamma-positions were synthesized and tested for their effects on behavior in mice, on the electroencephalographs and blood pressure of paralyzed-ventilated guinea pigs, and on electrical activity of incubated hippocampal slices. Several compounds, including alpha-ethyl-alpha-methyl GBL (alpha-EMGBL), alpha, alpha-dimethyl GBL, alpha, gamma-diethyl-alpha, gamma-dimethyl GBL, and gamma-ethyl-gamma-methyl GBL, prevented seizures induced by pentylenetetrazol, beta-ethyl-beta-methyl-gamma-butyrolactone (beta-EMGBL), picrotoxin, or all three compounds in mice and guinea pigs but had no effect on seizures induced by maximal electroshock or bicuculline. Neither gamma-hydroxybutyrate (GHB) nor alpha-isopropylidine GBL had any anticonvulsant activity. The anticonvulsant alpha-substituted compounds had a potent hypotensive effect and antagonized the hypertensive effect of beta-EMGBL, alpha-EMGBL was tested in incubated hippocampal slices and was found to depress basal activity and antagonize excitation induced by beta-EMGBL. These results demonstrate that alpha-alkyl-substituted GBL and, to a lesser extent, gamma-substituted derivatives are anticonvulsant agents and that their effects are strikingly different from those of GHB or beta-alkyl-substituted GBLs, which are epileptogenic. Possibly beta- and alpha-substituted GBLs act at the same site as agonists and antagonists, respectively.
Kubo, Takahiko; Yoshimura, Atsushi; Kurata, Nori
2016-05-03
Pollen killer genes disable noncarrier pollens, and are responsible for male sterility and segregation distortion in hybrid populations of distantly related plant species. The genetic networks and the molecular mechanisms underlying the pollen killer system remain largely unknown. Two pollen killer genes, S24 and S35, have been found in an intersubspecific cross of Oryza sativa ssp. indica and japonica The effect of S24 is counteracted by an unlinked locus EFS Additionally, S35 has been proposed to interact with S24 to induce pollen sterility. These genetic interactions are suggestive of a single S24-centric genetic pathway (EFS-S24-S35) for the pollen killer system. To examine this hypothetical genetic pathway, the S35 and the S24 regions were further characterized and genetically dissected in this study. Our results indicated that S35 causes pollen sterility independently of both the EFS and S24 genes, but is dependent on a novel gene close to the S24 locus, named incentive for killing pollen (INK). We confirmed the phenotypic effect of the INK gene separately from the S24 gene, and identified the INK locus within an interval of less than 0.6 Mb on rice chromosome 5. This study characterized the genetic effect of the two independent genetic pathways of INK-S35 and EFS-S24 in indica-japonica hybrid progeny. Our results provide clear evidence that hybrid male sterility in rice is caused by several pollen killer networks with multiple factors positively and negatively regulating pollen killer genes. Copyright © 2016 Kubo et al.
Kubo, Takahiko; Yoshimura, Atsushi; Kurata, Nori
2016-01-01
Pollen killer genes disable noncarrier pollens, and are responsible for male sterility and segregation distortion in hybrid populations of distantly related plant species. The genetic networks and the molecular mechanisms underlying the pollen killer system remain largely unknown. Two pollen killer genes, S24 and S35, have been found in an intersubspecific cross of Oryza sativa ssp. indica and japonica. The effect of S24 is counteracted by an unlinked locus EFS. Additionally, S35 has been proposed to interact with S24 to induce pollen sterility. These genetic interactions are suggestive of a single S24-centric genetic pathway (EFS–S24–S35) for the pollen killer system. To examine this hypothetical genetic pathway, the S35 and the S24 regions were further characterized and genetically dissected in this study. Our results indicated that S35 causes pollen sterility independently of both the EFS and S24 genes, but is dependent on a novel gene close to the S24 locus, named incentive for killing pollen (INK). We confirmed the phenotypic effect of the INK gene separately from the S24 gene, and identified the INK locus within an interval of less than 0.6 Mb on rice chromosome 5. This study characterized the genetic effect of the two independent genetic pathways of INK–S35 and EFS–S24 in indica–japonica hybrid progeny. Our results provide clear evidence that hybrid male sterility in rice is caused by several pollen killer networks with multiple factors positively and negatively regulating pollen killer genes. PMID:27172610
Cohen, Jeffrey I; Dropulic, Lesia; Hsu, Amy P; Zerbe, Christa S; Krogmann, Tammy; Dowdell, Kennichi; Hornung, Ronald L; Lovell, Jana; Hardy, Nancy; Hickstein, Dennis; Cowen, Edward W; Calvo, Katherine R; Pittaluga, Stefania; Holland, Steven M
2016-07-01
Most patients infected with Epstein-Barr virus (EBV) are asymptomatic, have nonspecific symptoms, or have self-limiting infectious mononucleosis. EBV, however, may result in severe primary disease or cancer. We report EBV diseases associated with GATA2 deficiency at one institution and describe the hematology, virology, and cytokine findings. Seven patients with GATA2 deficiency developed severe EBV disease. Three presented with EBV infectious mononucleosis requiring hospitalization, 1 had chronic active EBV disease (B-cell type), 1 had EBV-associated hydroa vacciniforme-like lymphoma with hemophagocytic lymphohistiocytosis, and 2 had EBV-positive smooth muscle tumors. Four of the 7 patients had severe warts and 3 had disseminated nontuberculous mycobacterial infections. All of the patients had low numbers of monocytes, B cells, CD4 T cells, and natural killer cells. All had elevated levels of EBV in the blood; 2 of 3 patients tested had expression of the EBV major immediate-early gene in the blood indicative of active EBV lytic infection. Mean plasma levels of tumor necrosis factor α, interferon γ, and interferon gamma-induced protein 10 were higher in patients with GATA2 deficiency than in controls. GATA2 is the first gene associated with EBV hydroa vacciniforme-like lymphoma. GATA2 deficiency should be considered in patients with severe primary EBV infection or EBV-associated cancer, especially in those with disseminated nontuberculous mycobacterial disease and warts. Published by Oxford University Press for the Infectious Diseases Society of America 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Hodge, Greg; Mukaro, Violet; Holmes, Mark; Reynolds, Paul N; Hodge, Sandra
2013-02-01
Natural killer (NK) and natural killer T (NKT)-like cells represent a small but important proportion of effector lymphocytes that we have previously shown to be major sources of pro-inflammatory cytokines and granzymes. We hypothesized that these cells would be increased in the airway in chronic obstructive pulmonary disease (COPD), accompanied by reduced expression of the inhibitory receptor CD94 (Kp43) and increased expression of cytotoxic mediators granzyme B and perforin. We measured NK and NKT-like cells and their expression of CD94 in the blood of COPD patients (n = 71; 30 current and 41 ex-smokers), smokers (16) and healthy controls (25), and bronchoalveolar lavage fluid (BALF) from a cohort of subjects (19 controls, 12 smokers, 33 COPD). Activation was assessed by measuring CD69 in blood and the cytotoxic potential of NK cells by measuring granzymes A and B, and using a cytotoxicity assay in blood and BALF. In blood in COPD, there were no significant changes in the proportion of NK or NKT-like cells or expression of granzyme A or NK cytotoxic potential versus controls. There was, however, increased expression of granzyme B and decreased expression of CD94 by both cell types versus controls. The proportion of NK and NKT-like cells were increased in BALF in COPD, associated with increased NK cytotoxicity, increased expression of granzyme B and decreased expression of the inhibitory receptor CD94 by both cell types. Treatment strategies that target NK and NKT-like cells, their cytotoxicity and production of inflammatory mediators in the airway may improve COPD morbidity. © 2012 The Authors. Respirology © 2012 Asian Pacific Society of Respirology.
Natural born killers?: the development of the sexually sadistic serial killer.
Johnson, B R; Becker, J V
1997-01-01
Today's society seems enthralled with serial killers in the news and the media. Forensic psychiatrists often interview serial killers after they have been caught. There are retrospective studies and case reports of individuals who have committed sexually sadistic serial murders. However, there exists a dearth of case reports on adolescents who have expressed serious fantasies about becoming serial killer prior to actualizing their fantasy. This article presents nine clinical cases of 14- to 18-year-olds who have clinically significant fantasies of becoming a serial killer. Similarities exist in these adolescent cases when compared with retrospective studies and case reports of serial killers on the role of sexually sadistic fantasies and actual killings. Since it has been established that sexual paraphilias may develop at a young age, one can surmise that sadistic paraphilias may also develop in some adolescents. The question is posed, can we predict which of these adolescents may go on to actually become serial killers? This article focuses on how the sexually sadistic fantasy can eventually be acted out and possible motives for the act to be repeated multiple times. Finally, recommendations are made about assessing and treating a youngster who expresses violent sexually sadistic killing fantasies so that attempts can be made to interrupt the progression to actual killing.
Amniotic fluid gamma-glutamyl transpeptidase activity during the second trimester.
Legge, M; Potter, H C
1986-03-12
Gamma glutamyl transpeptidase (GGTP) activity was determined in second trimester amniotic fluid taken from normal fetuses and those with fetal abnormalities. GGTP activity decreased with advancing gestation. Increasing meconium contamination correlated with an increase in GGTP activity as did increasing fetal blood contamination. Maternal blood did not affect GGTP activity. Anencephaly did not significantly alter the GGTP activity, however, fetuses with spina bifida had significantly lower activity. Klinefelters and Turners syndromes both had GGTP activity close to the 50th percentile, and two trisomy 21 fetuses had GGTP activity below the 40th percentile. Two trisomy 18 fetuses and two translocation Downs syndromes (46 XY, t (14;21) had GGTP activities considerably lower than the 20th percentile as did a fetus with gastroschisis. Second trimester amniotic fluid GGTP activity may provide an easy preliminary test to screen amniotic fluids for the possibility of certain fetal chromosome abnormalities.
Gharesi-Fard, Behrouz; Zolghadri, Jaleh; Kamali-Sarvestani, Eskandar
2008-03-01
Considering the deleterious role of T helper1 (Th1) cells in pregnancy outcome, a successful treatment for recurrent spontaneous abortion (RSA) should be able to make a significant shift away from Th1 responses. Although paternal leukocyte immunization has been used for treatment of RSA for years, because of methodological differences there is no consensus on the mechanism of action and effectiveness of this method. Twenty-five Iranian non-pregnant women with RSA and 16 non-pregnant control women with at least two successful pregnancies were included in this study. All cases were followed up after leukocyte therapy for pregnancy outcome. Mononuclear cells from women were co-cultured with the husband's mononuclear cells before and after immunotherapy. The levels of tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) were checked on culture supernatant by enzyme-linked immunosorbent assay method. The mean concentration of TNF-alpha was significantly higher in patients compared with that in normal controls (P=0.0001). After immunotherapy, the TNF-alpha level was only significantly decreased in women with successful outcome (P=0.0001). Immunotherapy also induced a significant reduction in the IFN-gamma level (P=0.009). The results of this investigation confirm the role of TNF-alpha in RSA and propose the assessment of TNF-alpha production as a valuable prognostic parameter for the prediction of abortion after leukocyte therapy.
Recognition of peptide-MHC class I complexes by activating killer immunoglobulin-like receptors.
Stewart, C Andrew; Laugier-Anfossi, Fanny; Vély, Frédéric; Saulquin, Xavier; Riedmuller, Jenifer; Tisserant, Agnès; Gauthier, Laurent; Romagné, François; Ferracci, Géraldine; Arosa, Fernando A; Moretta, Alessandro; Sun, Peter D; Ugolini, Sophie; Vivier, Eric
2005-09-13
Inhibitory receptors for MHC class I molecules increase the threshold of lymphocyte activation. Natural Killer (NK) cells express a large number of such inhibitory receptors, including the human killer Ig-like receptors (KIR). However, activating members of the KIR family have poorly defined ligands and functions. Here we describe the use of activating KIR tetramer reagents as probes to detect their ligands. Infection of cells with Epstein-Barr virus leads to expression of a detectable ligand for the activating receptor KIR2DS1. In this case, KIR2DS1 interacts with up-regulated peptide-MHC class I complexes on Epstein-Barr virus-infected cells in a transporter associated with antigen processing (TAP)-dependent manner. In tetramer-based cellular assays and direct affinity measurements, this interaction with MHC class I is facilitated by a broad spectrum of peptides. KIR2DS1 and its inhibitory homologue, KIR2DL1, share sensitivity to peptide sequence alterations at positions 7 and 8. These results fit a model in which activating and inhibitory receptors recognize the same sets of self-MHC class I molecules, differing only in their binding affinities. Importantly, KIR2DS1 is not always sufficient to trigger NK effector responses when faced with cognate ligand, consistent with fine control during NK cell activation. We discuss how our results for KIR2DS1 and parallel studies on KIR2DS2 relate to the association between activating KIR genes and susceptibility to autoimmune disorders.
Magliani, W; Conti, S; Gerloni, M; Bertolotti, D; Polonelli, L
1997-01-01
The killer phenomenon in yeasts has been revealed to be a multicentric model for molecular biologists, virologists, phytopathologists, epidemiologists, industrial and medical microbiologists, mycologists, and pharmacologists. The surprisingly widespread occurrence of the killer phenomenon among taxonomically unrelated microorganisms, including prokaryotic and eukaryotic pathogens, has engendered a new interest in its biological significance as well as its theoretical and practical applications. The search for therapeutic opportunities by using yeast killer systems has conceptually opened new avenues for the prevention and control of life-threatening fungal diseases through the idiotypic network that is apparently exploited by the immune system in the course of natural infections. In this review, the biology, ecology, epidemiology, therapeutics, serology, and idiotypy of yeast killer systems are discussed. PMID:9227858
Adam, Liana; Black, Peter C; Kassouf, Wassim; Eve, Beryl; McConkey, David; Munsell, Mark F; Benedict, William F; Dinney, Colin P N
2007-05-01
Intravesical adenovirus mediated interferon-alpha gene transfer has a potent therapeutic effect against superficial human bladder carcinoma xenografts growing in the bladder of athymic nude mice. We determined whether the inhibition of angiogenesis might contribute to the antitumor effect. We treated several human urothelial carcinoma cells with adenovirus mediated interferon-alpha 2b and monitored its effects on the production of angiogenic factors using real-time reverse-transcription polymerase chain reaction, Western blotting, and immunohistochemical analysis and a gel shift based transcription factor array. To assess the role of adenovirus mediated interferon 2b in angiogenic activity we used in vitro invasion assays and evaluated the anti-angiogenic effects of adenovirus mediated interferon gene therapy in an orthotopic murine model of human superficial bladder cancer. In adenovirus mediated interferon-alpha infected 253J B-V cells vascular endothelial growth factor was decreased and anti-angiogenic interferon-gamma inducible protein 10 was up-regulated. In contrast, the addition of as much as 100,000 IU recombinant interferon had no apparent effect on vascular endothelial growth factor production. Conditioned medium derived from adenovirus mediated interferon 2b infected 253J B-V cells greatly decreased the invasive potential of human endothelial cells and down-regulated their matrix metalloproteinase 2 expression compared to controls. Furthermore, adenovirus mediated interferon 2b blocked pro-angiogenic nuclear signals, such as the transcription factors activating protein-1 and 2, stimulating protein-1, nuclear factor kappaB and c-myb. In vivo experiments revealed significant vascular endothelial growth factor down-regulation and decreased tumor vessel density in the adenovirus mediated interferon 2b treated group compared to controls. Treatment with adenovirus mediated interferon 2b increases the angiostatic activity of the bladder cancer microenvironment
[The expression of interferon-lambda1 in CHO cell].
Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu
2013-06-01
To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.
Utsumi, J; Yamazaki, S; Kawaguchi, K; Kimura, S; Shimizu, H
1989-10-05
Human interferon-beta 1 is extremely stable is a low ionic strength solution of pH 2 such as 10 mM HCl at 37 degrees C. However, the presence of 0.15 M NaCl led to a remarkable loss of antiviral activity. The molecular-sieve high-performance liquid chromatography revealed that, whereas completely active human interferon-beta 1 eluted as a 25 kDa species (monomeric form), the inactivated preparation eluted primarily as a 90 kDa species (oligomeric form). The specific activity (units per mg protein) of the oligomeric form was approx. 10% of that of the monomeric form. This observation shows that oligomeric human interferon-beta 1 is apparently in an inactive form. When the oligomeric eluate was resolved by polyacrylamide gel containing sodium dodecyl sulphate (SDS), it appeared to be monomeric under non-reducing conditions. Monomerization of the oligomeric human interferon-beta 1 by treatment with 1% SDS, fully regenerated its antiviral activity. These results suggest that the inactivation of the human interferon-beta 1 preparation was caused by its oligomerization via hydrophobic interactions without the formation of intermolecular disulphide bonds. These oligomers can be dissociated by SDS to restore biological activity.
DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis
Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra
2016-01-01
Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227
Gamma Band Activity in the Reticular Activating System
Urbano, Francisco J.; Kezunovic, Nebojsa; Hyde, James; Simon, Christen; Beck, Paige; Garcia-Rill, Edgar
2012-01-01
This review considers recent evidence showing that cells in three regions of the reticular activating system (RAS) exhibit gamma band activity, and describes the mechanisms behind such manifestation. Specifically, we discuss how cells in the mesopontine pedunculopontine nucleus (PPN), intralaminar parafascicular nucleus (Pf), and pontine subcoeruleus nucleus dorsalis (SubCD) all fire in the beta/gamma band range when maximally activated, but no higher. The mechanisms behind this ceiling effect have been recently elucidated. We describe recent findings showing that every cell in the PPN have high-threshold, voltage-dependent P/Q-type calcium channels that are essential, while N-type calcium channels are permissive, to gamma band activity. Every cell in the Pf also showed that P/Q-type and N-type calcium channels are responsible for this activity. On the other hand, every SubCD cell exhibited sodium-dependent subthreshold oscillations. A novel mechanism for sleep–wake control based on well-known transmitter interactions, electrical coupling, and gamma band activity is described. The data presented here on inherent gamma band activity demonstrates the global nature of sleep–wake oscillation that is orchestrated by brainstem–thalamic mechanism, and questions the undue importance given to the hypothalamus for regulation of sleep–wakefulness. The discovery of gamma band activity in the RAS follows recent reports of such activity in other subcortical regions like the hippocampus and cerebellum. We hypothesize that, rather than participating in the temporal binding of sensory events as seen in the cortex, gamma band activity manifested in the RAS may help stabilize coherence related to arousal, providing a stable activation state during waking and paradoxical sleep. Most of our thoughts and actions are driven by pre-conscious processes. We speculate that continuous sensory input will induce gamma band activity in the RAS that could participate in the processes of
Titze-de-Almeida, Simoneide S; Lustosa, Cátia Faria; Horst, Camila Hillesheim; Bel, Elaine Del; Titze-de-Almeida, Ricardo
2014-12-01
This study examined whether the cytokine interferon (IFN) gamma plays a role in the injury of SH-SY5Y cells caused by MPP(+) (1-methyl-4-phenylpyridinium). First of all, IFN-gamma sensitized cells to the neurotoxin MPP(+), as determined by MTT (3-(4,5-dimethylthiazol-2-y1)-2,5-diphenyltetrazolium bromide) assay. MPP(+)-injured cells showed higher reactive oxygen species (ROS) levels, which was reinforced by IFN-gamma. The injury triggered a marked expression of the neuronal NOS (nNOS) enzyme. L-NAME [N(ω)-nitro-L-arginine methyl ester, a non-specific NOS inhibitor] reestablished the cell viability after IFN-gamma challenging, and recovered cells from MPP(+) injury (95.0 vs. 84.7 %; P < 0.05). Seven-NI (7-nitroindazole, a nNOS inhibitor) protected cells against the injury by MPP(+) co-administered with IFN-gamma. Both inhibitors restrained the apoptosis of SH-SY5Y cells caused by MPP(+)/IFN-gamma. Regarding oxidative stress, L-NAME and 7-NI attenuated the increase in ROS levels caused by MPP(+) (45.3 or 48.4 vs. 87.9 %, P < 0.05). Indeed, L-NAME was more effective than 7-NI for reducing oxidative stress caused by MPP(+) under IFN-gamma exposition. The nNOS gene silencing by small-interfering RNAs recovered cells challenged by IFN-gamma (24 h), or MPP(+) (8 h). In conclusion, IFN-gamma sensitizes cells to MPP(+)-induced injury, also causing an increase in ROS levels. Pretreating cells with L-NAME or 7-NI reverts both the oxidative stress and apoptosis triggered by the neurotoxin MPP(+). Taking together, our data reinforce that IFN-gamma and NOS enzymes play a role in oxidative stress and dopaminergic cell death triggered by MPP(+).
Martínez, I; Fernández, L; Valentín, J; Castillo, C; Chamorro, C; Pérez-Martínez, A
2015-05-01
To determine the role of natural killer (NK) cytotoxic activity in patients with suspected hemophagocytic lymphohistiocytosis syndrome (HLH). A prospective study was conducted from September 2008 to February 2014. The study was carried out in the Hematological Oncology Laboratory of Hospital Infantil Universitario Niño Jesús, Madrid (Spain). We analyzed 30 peripheral blood samples from intensive care patients with suspected HLH. There were 18 males and 12 females, with a mean age of 4.7 years (range 0.2-22). NK cell cytotoxicity was compared with healthy controls according to age and sex. In vitro NK cell cytotoxicity against the K562 cell line was determined by time-resolved fluorescence (Europium-TDA) under resting conditions, after interleukin 15 stimulation, and following block with Fas ligand antibody. NK cell cytotoxicity. A total of 20 patients showed a significant decrease of NK cell activity compared with controls (P=.001). Nine of these patients were diagnosed with primary HLH. A total of 10 patients were diagnosed with secondary HLH. Cytotoxic activity was normal in 10 subjects. None of them were diagnosed with HLH. Interleukin 15 stimulation increased NK cell cytotoxicity in secondary HLH, and blocking Fas ligand on NK cells decreased cytotoxic activity in primary HLH patients (P=.001). In our experience, NK cell cytotoxic activity measured by time-resolved fluorescence is a simple and useful clinical diagnostic test for HLH. Interleukin 15 stimulation and Fas ligand blocking on NK cells could help differentiate between primary and secondary HLH. Copyright © 2014 Elsevier España, S.L.U. and SEMICYUC. All rights reserved.
CMOS image sensor for detection of interferon gamma protein interaction as a point-of-care approach.
Marimuthu, Mohana; Kandasamy, Karthikeyan; Ahn, Chang Geun; Sung, Gun Yong; Kim, Min-Gon; Kim, Sanghyo
2011-09-01
Complementary metal oxide semiconductor (CMOS)-based image sensors have received increased attention owing to the possibility of incorporating them into portable diagnostic devices. The present research examined the efficiency and sensitivity of a CMOS image sensor for the detection of antigen-antibody interactions involving interferon gamma protein without the aid of expensive instruments. The highest detection sensitivity of about 1 fg/ml primary antibody was achieved simply by a transmission mechanism. When photons are prevented from hitting the sensor surface, a reduction in digital output occurs in which the number of photons hitting the sensor surface is approximately proportional to the digital number. Nanoscale variation in substrate thickness after protein binding can be detected with high sensitivity by the CMOS image sensor. Therefore, this technique can be easily applied to smartphones or any clinical diagnostic devices for the detection of several biological entities, with high impact on the development of point-of-care applications.
Pittari, Gianfranco; Filippini, Perla; Gentilcore, Giusy; Grivel, Jean-Charles; Rutella, Sergio
2015-01-01
Natural killer (NK) cells belong to innate immunity and exhibit cytolytic activity against infectious pathogens and tumor cells. NK-cell function is finely tuned by receptors that transduce inhibitory or activating signals, such as killer immunoglobulin-like receptors, NK Group 2 member D (NKG2D), NKG2A/CD94, NKp46, and others, and recognize both foreign and self-antigens expressed by NK-susceptible targets. Recent insights into NK-cell developmental intermediates have translated into a more accurate definition of culture conditions for the in vitro generation and propagation of human NK cells. In this respect, interleukin (IL)-15 and IL-21 are instrumental in driving NK-cell differentiation and maturation, and hold great promise for the design of optimal NK-cell culture protocols. Cytokine-induced killer (CIK) cells possess phenotypic and functional hallmarks of both T cells and NK cells. Similar to T cells, they express CD3 and are expandable in culture, while not requiring functional priming for in vivo activity, like NK cells. CIK cells may offer some advantages over other cell therapy products, including ease of in vitro propagation and no need for exogenous administration of IL-2 for in vivo priming. NK cells and CIK cells can be expanded using a variety of clinical-grade approaches, before their infusion into patients with cancer. Herein, we discuss GMP-compliant strategies to isolate and expand human NK and CIK cells for immunotherapy purposes, focusing on clinical trials of adoptive transfer to patients with hematological malignancies.
Cappelli, G; Volpe, P; Sanduzzi, A; Sacchi, A; Colizzi, V; Mariani, F
2001-12-01
Mycobacterium tuberculosis is an intracellular pathogen that readily survives and replicates in human macrophages (MPhi). Host cells have developed different mycobactericidal mechanisms, including the production of inflammatory cytokines. The aim of this study was to compare the MPhi response, in terms of cytokine gene expression, to infection with the M. tuberculosis laboratory strain H37Rv and the clinical M. tuberculosis isolate CMT97. Both strains induce the production of interleukin-12 (IL-12) and IL-16 at comparable levels. However, the clinical isolate induces a significantly higher and more prolonged MPhi activation, as shown by reverse transcription-PCR analysis of IL-1beta, IL-6, IL-10, transforming growth factor beta, tumor necrosis factor alpha, and gamma interferon (IFN-gamma) transcripts. Interestingly, when IFN-gamma transcription is high, the number of M. tuberculosis genes expressed decreases and vice versa, whereas no mycobactericidal effect was observed in terms of bacterial growth. Expression of 11 genes was also studied in the two M. tuberculosis strains by infecting resting or activated MPhi and compared to bacterial intracellular survival. In both cases, a peculiar inverse correlation between expression of these genes and multiplication was observed. The number and type of genes expressed by the two strains differed significantly.
Durante, Marco; Formenti, Silvia C
2018-01-01
Radiation-induced chromosomal aberrations represent an early marker of late effects, including cell killing and transformation. The measurement of cytogenetic damage in tissues, generally in blood lymphocytes, from patients treated with radiotherapy has been studied for many years to predict individual sensitivity and late morbidity. Acentric fragments are lost during mitosis and create micronuclei (MN), which are well correlated to cell killing. Immunotherapy is rapidly becoming a most promising new strategy for metastatic tumors, and combination with radiotherapy is explored in several pre-clinical studies and clinical trials. Recent evidence has shown that the presence of cytosolic DNA activates immune response via the cyclic GMP-AMP synthase/stimulator of interferon genes pathway, which induces type I interferon transcription. Cytosolic DNA can be found after exposure to ionizing radiation either as MN or as small fragments leaking through nuclear envelope ruptures. The study of the dependence of cytosolic DNA and MN on dose and radiation quality can guide the optimal combination of radiotherapy and immunotherapy. The role of densely ionizing charged particles is under active investigation to define their impact on the activation of the interferon pathway.
Werner-Felmayer, G; Baier-Bitterlich, G; Fuchs, D; Hausen, A; Murr, C; Reibnegger, G; Werner, E R; Wachter, H
1995-01-01
In a number of mammalian cell types, pteridine biosynthesis from guanosine 5'-triphosphate and formation of nitric oxide from L-arginine are induced by gamma interferon (IFN-gamma) and bacterial lipopolysaccharide (LPS). We assessed the possibility of using such metabolic alterations for the in vitro detection of pyrogens. Products from gram-negative and gram-positive bacteria and related synthetic compounds were tested for their potential to induce either of these pathways. Stimulation of pteridine biosynthesis was monitored as the formation of neopterin in the human myelomonocytic cell line THP-1. The formation of nitric oxide was determined as nitrite in murine J774A.1 macrophage cultures. The substances tested included toxic and detoxified parts of LPS and lipid A from Escherichia coli, Salmonella typhimurium, Salmonella minnesota, and Klebsiella pneumoniae as well as lipoteichoic acid and toxic shock syndrome toxin 1 from Staphylococcus aureus. Furthermore, two cell wall compounds from Mycobacterium tuberculosis, trehalose 6,6'-dimycolate and N-acetylmuramyl-L-alanyl-D-isoglutamine, which are active components of Freund's adjuvant, were used. When applied as a single stimulus, only the whole LPS molecule potently stimulated neopterin or nitrite formation. Lipid A and products from gram-positive bacteria were weakly active. For neopterin formation, lipid A required the presence of fetal calf serum. Besides detoxified LPS and independently from the presence of serum, all bacterial compounds tested strongly increased the effects mediated by IFN-gamma. Our results show that bacterial pyrogens can be detected by monitoring the formation of neopterin or nitrite. This may provide a basis for the development of an in vitro assay for the detection of pyrogenic contamination with the aim of replacing the currently used animal test. PMID:7664177
The elephant interferon gamma assay: a contribution to diagnosis of tuberculosis in elephants.
Angkawanish, T; Morar, D; van Kooten, P; Bontekoning, I; Schreuder, J; Maas, M; Wajjwalku, W; Sirimalaisuwan, A; Michel, A; Tijhaar, E; Rutten, V
2013-11-01
Mycobacterium tuberculosis (M. tb) has been shown to be the main causative agent of tuberculosis in elephants worldwide. M. tb may be transmitted from infected humans to other species including elephants and vice versa, in case of prolonged intensive contact. An accurate diagnostic approach covering all phases of the infection in elephants is required. As M. tb is an intracellular pathogen and cell-mediated immune (CMI) responses are elicited early after infection, the skin test is the CMI assay of choice in humans and cattle. However, this test is not applicable in elephants. The interferon gamma (IFN-γ) assay is considered a good alternative for the skin test in general, validated for use in cattle and humans. This study was aimed at development of an IFN-γ assay applicable for diagnosis of tuberculosis in elephants. Recombinant elephant IFN-γ (rEpIFN-γ) produced in eukaryotic cells was used to immunize mice and generate the monoclonal antibodies. Hybridomas were screened for IFN-γ-specific monoclonal antibody production and subcloned, and antibodies were isotyped and affinity purified. Western blot confirmed recognition of the rEpIFN-γ. The optimal combination of capture and detection antibodies selected was able to detect rEpIFN-γ in concentrations as low as 1 pg/ml. The assay was shown to be able to detect the native elephant IFN-γ, elicited in positive-control cultures (pokeweed mitogen (PWM), phorbol myristate acetate plus ionomycin (PMA/I)) of both Asian and African elephant whole-blood cultures (WBC). Preliminary data were generated using WBC from non-infected elephants, a M. tb infection-suspected elephant and a culture-confirmed M. tb-infected elephant. The latter showed measurable production of IFN-γ after stimulation with ESAT6/CFP10 PPDB and PPDA in concentration ranges as elicited in WBC by Mycobacterium tuberculosis complex (MTBC)-specific antigens in other species. Hence, the IFN-γ assay presented potential as a diagnostic tool for the
Kubin, M; Chow, J M; Trinchieri, G
1994-04-01
Natural killer cell-stimulatory factor or interleukin-12 (NKSF/IL-12) was originally identified and purified from the conditioned medium of Epstein-Barr virus (EBV)-transformed B-cell lines. Phorbol diesters were observed to be potent stimulators of NKSF/IL-12 production from the B-cell lines. Although monocytes were found to be the major producers of NKSF/IL-12 in peripheral blood (PB) in response to lipopolysaccharide (LPS) or to Staphylococcus aureus, several myeloid leukemia cell lines tested did not produce detectable NKSF/IL-12 either constitutively or upon stimulation with phorbol diesters. However, three lines, ML-3, HL-60, and THP-1, responded to LPS with significant levels of NKSF/IL-12 production, whereas S aureus was effective only on THP-1 cells. When the cell lines were preincubated with compounds known to induce them to differentiate, production of tumor necrosis factor alpha (TNF alpha) and IL-1 beta was in most cases maximal in cells with differentiated characteristics, whereas NKSF/IL-12 production in response to LPS in all three producing cell lines was significantly enhanced only by pretreatment with dimethylsulfoxide (DMSO) for 24 hours, or by costimulation with interferon gamma (IFN gamma). The efficiency of DMSO enhancement of NKSF/IL-12 production decreased after 2 to 5 days of incubation, when the cells acquired differentiated characteristics. Unlike DMSO, IFN gamma enhanced NKSF/IL-12 production, and IL-10 and dexamethasone inhibited it in cell lines and PB mononuclear cells stimulated by either LPS or S aureus. The ability of the cell lines to respond to these mediators of possibly physiologically relevant function provides a tissue-culture model for studying their mechanism of action.
The role of natural killer cells in chronic myeloid leukemia
Danier, Anna Carolyna Araújo; de Melo, Ricardo Pereira; Napimoga, Marcelo Henrique; Laguna-Abreu, Maria Theresa Cerávolo
2011-01-01
Chronic myeloid leukemia is a neoplasia resulting from a translocation between chromosomes 9 and 22 producing the BCR-ABL hybrid known as the Philadelphia chromosome (Ph). In chronic myeloid leukemia a proliferation of malignant myeloid cells occurs in the bone marrow due to excessive tyrosine kinase activity. In order to maintain homeostasis, natural killer cells, by means of receptors, identify the major histocompatibility complex on the surface of tumor cells and subsequently induce apoptosis. The NKG2D receptor in the natural killer cells recognizes the transmembrane proteins related to major histocompatibility complex class I chain-related genes A and B (MICA and MICB), and it is by the interaction between NKG2D and MICA that natural killer cells exert cytotoxic activity against chronic myeloid leukemia tumor cells. However, in the case of chronic exposure of the NKG2D receptor, the MICA ligand releases soluble proteins called sMICA from the tumor cell surface, which negatively modulate NKG2D and enable the tumor cells to avoid lysis mediated by the natural killer cells. Blocking the formation of sMICA may be an important antitumor strategy. Treatment using tyrosine kinase inhibitors induces modulation of NKG2DL expression, which could favor the activity of the natural killer cells. However this mechanism has not been fully described in chronic myeloid leukemia. In the present study, we analyze the role of natural killer cells to reduce proliferation and in the cellular death of tumor cells in chronic myeloid leukemia. PMID:23049299
Recognition of peptide–MHC class I complexes by activating killer immunoglobulin-like receptors
Stewart, C. Andrew; Laugier-Anfossi, Fanny; Vély, Frédéric; Saulquin, Xavier; Riedmuller, Jenifer; Tisserant, Agnès; Gauthier, Laurent; Romagné, François; Ferracci, Géraldine; Arosa, Fernando A.; Moretta, Alessandro; Sun, Peter D.; Ugolini, Sophie; Vivier, Eric
2005-01-01
Inhibitory receptors for MHC class I molecules increase the threshold of lymphocyte activation. Natural Killer (NK) cells express a large number of such inhibitory receptors, including the human killer Ig-like receptors (KIR). However, activating members of the KIR family have poorly defined ligands and functions. Here we describe the use of activating KIR tetramer reagents as probes to detect their ligands. Infection of cells with Epstein–Barr virus leads to expression of a detectable ligand for the activating receptor KIR2DS1. In this case, KIR2DS1 interacts with up-regulated peptide–MHC class I complexes on Epstein–Barr virus-infected cells in a transporter associated with antigen processing (TAP)-dependent manner. In tetramer-based cellular assays and direct affinity measurements, this interaction with MHC class I is facilitated by a broad spectrum of peptides. KIR2DS1 and its inhibitory homologue, KIR2DL1, share sensitivity to peptide sequence alterations at positions 7 and 8. These results fit a model in which activating and inhibitory receptors recognize the same sets of self-MHC class I molecules, differing only in their binding affinities. Importantly, KIR2DS1 is not always sufficient to trigger NK effector responses when faced with cognate ligand, consistent with fine control during NK cell activation. We discuss how our results for KIR2DS1 and parallel studies on KIR2DS2 relate to the association between activating KIR genes and susceptibility to autoimmune disorders. PMID:16141329
Sonoda, Soichiro; Yamaza, Haruyoshi; Ma, Lan; Tanaka, Yosuke; Tomoda, Erika; Aijima, Reona; Nonaka, Kazuaki; Kukita, Toshio; Shi, Songtao; Nishimura, Fusanori; Yamaza, Takayoshi
2016-01-01
Clinically, irreversible pulpitis is treated by the complete removal of pulp tissue followed by replacement with artificial materials. There is considered to be a high potential for autologous transplantation of human dental pulp stem cells (DPSCs) in endodontic treatment. The usefulness of DPSCs isolated from healthy teeth is limited. However, DPSCs isolated from diseased teeth with irreversible pulpitis (IP-DPSCs) are considered to be suitable for dentin/pulp regeneration. In this study, we examined the stem cell potency of IP-DPSCs. In comparison with healthy DPSCs, IP-DPSCs expressed lower colony-forming capacity, population-doubling rate, cell proliferation, multipotency, in vivo dentin regeneration, and immunosuppressive activity, suggesting that intact IP-DPSCs may be inadequate for dentin/pulp regeneration. Therefore, we attempted to improve the impaired in vivo dentin regeneration and in vitro immunosuppressive functions of IP-DPSCs to enable dentin/pulp regeneration. Interferon gamma (IFN-γ) treatment enhanced in vivo dentin regeneration and in vitro T cell suppression of IP-DPSCs, whereas treatment with tumor necrosis factor alpha did not. Therefore, these findings suggest that IFN-γ may be a feasible modulator to improve the functions of impaired IP-DPSCs, suggesting that autologous transplantation of IFN-γ-accelerated IP-DPSCs might be a promising new therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:26775677
Kim, K H; Oh, E-J; Jung, E-S; Park, Y-J; Choi, J Y; Kim, D-G; Lee, K Y; Kang, C S
2006-06-01
The aim of the present study was to identify whether the serum interferon-gamma (IFNgamma), a Th1 cytokine, or soluble CD30 (sCD30), a marker for activation of Th2 cytokine-producing T cells, predict acute cellular rejection episodes among liver graft patients. Pretransplant and posttransplant sera from 32 living donor liver transplant recipients obtained on days 1, 3, and 7 after surgery were tested for serum IFNgamma and sCD30 concentrations using commercial enzyme-linked immunosorbent assay kits. Recipients with an acute rejection episode (ARE) (n=14) displayed significantly higher IFNgamma concentrations pretransplant than did the patients with no ARE (n=18) (P<.05). The pretransplant serum levels of sCD30 were not different between the non-ARE and ARE groups. However, in comparison with the non-ARE group, who showed steadily decreasing serum sCD30 levels after transplantation, 12 among the 14 patients in the ARE group showed increasing sCD30 levels from day 1 to day 3 after transplantation (P<.05). These results suggest that the sCD30 increment during the early period after liver transplantation affects the immune response of rejection. This observation emphasizes the clinical relevance of serum sCD30, in addition to serum IFNgamma, as predictive markers for acute liver graft rejection.
Evolutionary Dynamics of Spore Killers
Nauta, M. J.; Hoekstra, R. F.
1993-01-01
Spore killing in ascomycetes is a special form of segregation distortion. When a strain with the Killer genotype is crossed to a Sensitive type, spore killing is expressed by asci with only half the number of ascospores as usual, all surviving ascospores being of the Killer type. Using population genetic modeling, this paper explores conditions for invasion of Spore killers and for polymorphism of Killers, Sensitives and Resistants (which neither kill, nor get killed), as found in natural populations. The models show that a population with only Killers and Sensitives can never be stable. The invasion of Killers and stable polymorphism only occur if Killers have some additional advantage during the process of spore killing. This may be due to the effects of local sib competition or some kind of ``heterozygous'' advantage in the stage of ascospore formation or in the short diploid stage of the life cycle. This form of segregation distortion appears to be essentially different from other, well-investigated forms, and more field data are needed for a better understanding of spore killing. PMID:8293989
Alvarez, Guillermo Cabrera; Madrid-Marina, Vicente; Jimenez-Mendez, Ricardo; Buitimea, Angel Leon; Román, Margarita Bahena; Cortez-Gomez, Rudyard; Esparza, Jorge Reyes; Rodríguez-Fragoso, Lourdes
2007-01-01
The aim of this study was to investigate the effects of combinations of pegilated-interferon (PEG-IFN), ribavirin, and danazol on thrombocytopenia and liver injury in rats with fibrosis. Male adult Wistar rats were treated with either mineral oil, danazol (0.83 mg/kg per day), PEG-interferon alpha-2a (PEG-IFN, 0.3 microg/ week) + ribavirin (12 mg/kg per day), PEG-IFN + ribavirin + danazol, CCl(4) (4 g/kg for eight weeks), CCl(4) + PEG-IFN + ribavirin, or CCl(4) + PEG-IFN + ribavirin+ danazol. The following assays were conducted: hematology, clinical chemistry, liver function, liver fibrosis, lymphocyte cytokine mRNA expression, and bone-marrow DNA content. Platelet counts were low in sham-treated animals and animals treated with PEG- IFN + ribavirin (30% and 25% respectively; P < 0.05). PEG-IFN + ribavirin + danazol reduced platelet counts of fibrotic animals by only 9% (P < 0.05). PEG- IFN + ribavirin reduced hepatic collagen content by 50%, whereas danazol + PEG-IFN + ribavirin reduced hepatic collagen content by 60% (P < 0.05). PEG-IFN + ribavirin reduced the total bilirubin concentration by 27%, alanine amino transferase (ALT) activity by 75% and gamma-glutamyl transpeptidase (gamma-GTP) activity by 74% (P < 0.05). In contrast, danazol + PEG-IFN + ribavirin reduced total bilirubin levels by 61%, alkaline phosphatase activity by 45%, ALT activity by 76%, and gamma-GTP activity by 74% (P < 0.05). The only treatment that increased interleukin 10 (IL-10) mRNA in fibrotic rats was PEG-IFN + ribavirin. However, danazol + PEG-IFN + ribavirin reduced the expression of IL-6, IL-10, tumor necrosis factor alpha and transforming growth factor ss. Bone-marrow DNA content was not altered by any treatment. In conclusion, PEG-IFN + ribavirin + danazol could be a new therapeutic option for patients with liver injury, fibrosis, and thrombocytopenia.
Interferon effects on protozoan infections
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.; Wirth, J.; Kierszenbaum, F.; Degee, A. L. W.; Mansfield, J. M.
1985-01-01
The effects of interferon (IFN) on mice infected with two different parasitic protozoans, Trypanosoma cruzi and Trypanosoma brucei rhodesiense, are investigated experimentally. The preparation of the cell cultures, IFN and assays, antibody, and the experimental procedures are described. It is observed that in cells treated with IFN-gamma there is an increased association of T. cruzi with murine macrophages and an increase in the killing of T. cruzi by IFN-gamma-treated murine macrophages. For spleen cells infected with T.b. rhodesiense in vitro, it is detected that live trypanosomes cannot induce IFN in cells from normal mice, but can in cells from immunized mice; and that trypanosome-lysates induce IFN in vitro in cells from normal mice. The data suggest that there is a two-step mechanism for mice against T. cruzi and T.b. rhodesiense.
Sareneva, T; Mørtz, E; Tölö, H; Roepstorff, P; Julkunen, I
1996-12-01
Interferon-gamma (IFN-gamma) is a secretory glycoprotein produced by T cells in response to antigenic or mitogenic stimuli. We studied the kinetics of the synthesis, N-glycosylation, and secretion of IFN-gamma in human CD8+ T lymphocytes stimulated via T-cell receptor. Highly elevated IFN-gamma mRNA levels were found as early as 1 h after stimulation. Maximal IFN-gamma protein synthesis was observed 2-4 h after induction and appeared to correlate to steady-state IFN-gamma mRNA levels. As analyzed by pulse/chase experiments, the secretion of IFN-gamma from T cells was very rapid, the secretion half-time being approximately 20-25 min. Inhibition of N-glycosylation by tunicamycin dramatically reduced the expression of IFN-gamma, but did not block its secretion. Natural IFN-gamma is heterogeneously glycosylated and doubly, singly, and unglycosylated forms exist. Experiments performed in a cell-free translation/glycosylation system with mutated IFN-gamma constructs lacking either one of the potential glycosylation sites suggested that Asn25 is more efficiently glycosylated than Asn97. Site-specific oligosaccharide analysis of natural IFN-gamma by glycosidase treatment followed by matrix-assisted-laser-desorption-ionization mass spectrometry revealed considerable variation in the carbohydrate structures, with more than 30 different forms. The glycans at Asn25 consisted of fucosylated, mainly complex-type oligosaccharides, whereas the glycans at Asn97 were more heterogeneous, with hybrid and high-mannose structures. Our results emphasize the essential role of N-linked glycans in the biology of IFN-gamma and show that there is a considerable heterogeneity in the individual sugar chains of this important human cytokine.
Endogenous cannabinoid receptor ligand induces the migration of human natural killer cells.
Kishimoto, Seishi; Muramatsu, Mayumi; Gokoh, Maiko; Oka, Saori; Waku, Keizo; Sugiura, Takayuki
2005-02-01
2-Arachidonoylglycerol is an endogenous ligand for the cannabinoid receptors (CB1 and CB2). Evidence is gradually accumulating which shows that 2-arachidonoylglycerol plays important physiological roles in several mammalian tissues and cells, yet the details remain ambiguous. In this study, we first examined the effects of 2-arachidonoylglycerol on the motility of human natural killer cells. We found that 2-arachidonoylglycerol induces the migration of KHYG-1 cells (a natural killer leukemia cell line) and human peripheral blood natural killer cells. The migration of natural killer cells induced by 2-arachidonoylglycerol was abolished by treating the cells with SR144528, a CB2 receptor antagonist, suggesting that the CB2 receptor is involved in the 2-arachidonoylglycerol-induced migration. In contrast to 2-arachidonoylglycerol, anandamide, another endogenous cannabinoid receptor ligand, did not induce the migration. Delta9-tetrahydrocannabinol, a major psychoactive constituent of marijuana, also failed to induce the migration; instead, the addition of delta9-tetrahydrocannabinol together with 2-arachidonoylglycerol abolished the migration induced by 2-arachidonoylglycerol. It is conceivable that the endogenous ligand for the cannabinoid receptor, that is, 2-arachidonoylglycerol, affects natural killer cell functions such as migration, thereby contributing to the host-defense mechanism against infectious viruses and tumor cells.
Peripheral Blood Signatures of Lead Exposure
LaBreche, Heather G.; Meadows, Sarah K.; Nevins, Joseph R.; Chute, John P.
2011-01-01
Background Current evidence indicates that even low-level lead (Pb) exposure can have detrimental effects, especially in children. We tested the hypothesis that Pb exposure alters gene expression patterns in peripheral blood cells and that these changes reflect dose-specific alterations in the activity of particular pathways. Methodology/Principal Finding Using Affymetrix Mouse Genome 430 2.0 arrays, we examined gene expression changes in the peripheral blood of female Balb/c mice following exposure to per os lead acetate trihydrate or plain drinking water for two weeks and after a two-week recovery period. Data sets were RMA-normalized and dose-specific signatures were generated using established methods of supervised classification and binary regression. Pathway activity was analyzed using the ScoreSignatures module from GenePattern. Conclusions/Significance The low-level Pb signature was 93% sensitive and 100% specific in classifying samples a leave-one-out crossvalidation. The high-level Pb signature demonstrated 100% sensitivity and specificity in the leave-one-out crossvalidation. These two signatures exhibited dose-specificity in their ability to predict Pb exposure and had little overlap in terms of constituent genes. The signatures also seemed to reflect current levels of Pb exposure rather than past exposure. Finally, the two doses showed differential activation of cellular pathways. Low-level Pb exposure increased activity of the interferon-gamma pathway, whereas high-level Pb exposure increased activity of the E2F1 pathway. PMID:21829687
Beels, Laurence; Werbrouck, Joke; Thierens, Hubert
2010-09-01
Dose response and repair kinetics of phosphorylated histone H2A isoform X (gamma-H2AX) foci in T-lymphocytes were investigated in the low-dose range after in vitro irradiation of whole blood and T-lymphocytes with 100 kVp X-rays and (60)Co gamma-rays. Whole blood or isolated T-lymphocytes were irradiated in vitro and gamma-H2AX foci were scored. Dose response was determined in the 0-500 mGy dose range. Foci kinetics were studied at doses of 5 and 200 mGy up to 24 h post-irradiation. After X-irradiation, the dose response for whole blood shows a biphasic behaviour with a low-dose hypersensitivity, which is less pronounced for isolated T-lymphocytes. In contrast, gamma-radiation shows a linear dose response for both irradiation conditions. Concerning repair kinetics, delayed repair was found after X-ray whole blood irradiation (5 and 200 mGy) with 40% of the foci persisting 24 h post-irradiation. This number of foci is reduced to 10% after irradiation of isolated T-lymphocytes with 200 mGy X-rays. On the contrary, gamma-H2AX foci are reduced to background levels 24 h post-irradiation with 200 mGy (60)Co gamma-rays. gamma-H2AX foci response and repair kinetics depend on irradiation conditions and radiation quality, possibly linked to Bystander response.
Distinct interferon-gamma and interleukin-9 expression in cutaneous and oral lichen planus.
Weber, B; Schlapbach, C; Stuck, M; Simon, H-U; Borradori, L; Beltraminelli, H; Simon, D
2017-05-01
Cutaneous (CLP) and oral lichen planus (OLP) as the main subtypes of lichen planus (LP) present with different clinical manifestation and disease course, although their histopathologic features such as the band-like lymphocyte infiltrate and keratinocyte apoptosis are similar. So far, the underlying cellular and molecular mechanisms remain poorly understood. The aim of this study was to characterize and compare the in situ cellular infiltrates, cytokine expression profiles and apoptosis markers in CLP and OLP. Using immunofluorescence staining and laser scanning microscopy, we evaluated the cellular infiltrate (CD1a, CD3, CD4, CD8, CD21, CD57, CD123), cytokine expression (interleukin (IL)-1, IL-6, IL-9, IL-10, IL-17, IL-22, IL-23, tumour necrosis factor-α, transforming growth factor-β, interferon (IFN)-γ), and apoptosis markers (Fas, Fas ligand, cleaved caspase-3, TUNEL) of 21 anonymized biopsy specimens of LP (11 CLP, 10 OLP). Among infiltrating cells mainly T cells and natural killer (NK) cells as well as plasmacytoid dendritic cells (DC) were observed. A predominance of CD8+ T cells was noted in OLP. In both CLP and OLP, T helper (Th)1, Th9, Th17, and Th22-type cytokines were expressed. The expression of IL-9, IFN-γ and IL-22 was higher in CLP compared to that of OLP (P = 0.0165; P = 0.0016; P = 0.052 respectively). Expression of Fas and Fas ligand as well as cleaved caspase-3-positive cells was observed in the epithelium of all LP samples. The cell and cytokine patterns of CLP and OLP were partially distinct and generally resembled those reported for autoimmune diseases. The presence of CD8+ and NK cells as well as Fas/Fas ligand expression suggested that various pathways involved in keratinocyte apoptosis are relevant for LP. These results might help to establish targeted therapies for LP. © 2016 European Academy of Dermatology and Venereology.
Solis, B; Nova, E; Gómez, S; Samartín, S; Mouane, N; Lemtouni, A; Belaoui, H; Marcos, A
2002-12-01
For several years cytokine production has been associated with infections but it was not suspected that some types of food could also induce cytokines, even in a state of non-infection. Lactic bacteria can induce interferon (IFN) production in human healthy subjects, thus, a better protection against infections would be expected. Therefore, we planned to evaluate the effect of two diets including yoghurt or milk on IFN-gamma production during nutritional recovery in two different situations of malnutrition: (1) children with diarrhoea; and (2) patients with anorexia nervosa (AN). Both the diet including yoghurt of that including milk seemed to increase IFN-gamma production at the end of nutritional recovery in the malnourished children with diarrhoea. The significance of interferon production and the lymphocyte subset increase should be explored to know if a better resistance against pathogens is related to them. Regulation of intestinal absorption and moderate stimulation of interferon production make the yoghurt-based diet a good choice in the nutritional care of children. In the same way, an increase in the IFN-gamma production was observed in AN patients consuming yoghurt. This increase of IFN-gamma production could be considered a biological marker to detect the effect of probiotics on the immune response, especially in the improvement of a deficient nutritional status.
Cloning, sequencing, and expression of interferon-γ from elk in North America
Sweeney, Steven J.; Emerson, Carlene; Eriks, Inge S.
2001-01-01
Eradication of Mycobacterium bovis relies on accurate detection of infected animals, including potential domestic and wildlife reservoirs. Available diagnostic tests lack the sensitivity and specificity necessary for accurate detection, particularly in infected wildlife populations. Recently, an in vitro diagnostic test for cattle which measures plasma interferon-gamma (IFN-γ) levels in blood following in vitro incubation with M. bovis purified protein derivative has been enveloped. This test appears to have increased sensitivity over traditional testing. Unfortunately, it does not detect IFN-γ from Cervidae. To begin to address this problem, the IFN-γ gene from elk (Cervus elaphus) was cloned, sequenced, expressed, and characterized. cDNA was cloned from mitogen stimulated peripheral blood mononuclear cells. The predicted amino acid (aa) sequence was compared to known sequences from cattle, sheep, goats, red deer (Cervus elaphus), humans, and mice. Biological activity of the recombinant elk IFN-γ (rElkIFN-γ) was confirmed in a vesicular stomatitis virus cytopathic effect reduction assay. Production of monoclonal antibodies to IFN-γ epitopes conserved between ruminant species could provide an important tool for the development of reliable, practical diagnostic assays for detection of a delayed type hypersensitivity response to a variety of persistent infectious agents in ruminants, including M. bovis and Brucella abortus. Moreover, development of these reagents will aid investigators in studies to explore immunological responses of elk that are associated with resistance to infectious diseases.
Evasion of interferon responses by Ebola and Marburg viruses.
Basler, Christopher F; Amarasinghe, Gaya K
2009-09-01
The filoviruses, Ebola virus (EBOV) and Marburg virus (MARV), cause frequently lethal viral hemorrhagic fever. These infections induce potent cytokine production, yet these host responses fail to prevent systemic virus replication. Consistent with this, filoviruses have been found to encode proteins VP35 and VP24 that block host interferon (IFN)-alpha/beta production and inhibit signaling downstream of the IFN-alpha/beta and the IFN-gamma receptors, respectively. VP35, which is a component of the viral nucleocapsid complex and plays an essential role in viral RNA synthesis, acts as a pseudosubstrate for the cellular kinases IKK-epsilon and TBK-1, which phosphorylate and activate interferon regulatory factor 3 (IRF-3) and interferon regulatory factor 7 (IRF-7). VP35 also promotes SUMOylation of IRF-7, repressing IFN gene transcription. In addition, VP35 is a dsRNA-binding protein, and mutations that disrupt dsRNA binding impair VP35 IFN-antagonist activity while leaving its RNA replication functions intact. The phenotypes of recombinant EBOV bearing mutant VP35s unable to inhibit IFN-alpha/beta demonstrate that VP35 IFN-antagonist activity is critical for full virulence of these lethal pathogens. The structure of the VP35 dsRNA-binding domain, which has recently become available, is expected to provide insight into how VP35 IFN-antagonist and dsRNA-binding functions are related. The EBOV VP24 protein inhibits IFN signaling through an interaction with select host cell karyopherin-alpha proteins, preventing the nuclear import of otherwise activated STAT1. It remains to be determined to what extent VP24 may also modulate the nuclear import of other host cell factors and to what extent this may influence the outcome of infection. Notably, the Marburg virus VP24 protein does not detectably block STAT1 nuclear import, and, unlike EBOV, MARV infection inhibits STAT1 and STAT2 phosphorylation. Thus, despite their similarities, there are fundamental differences by which
1989-01-01
The severe complications of dengue virus infections, hemorrhagic manifestation and shock, are much more commonly observed during secondary infections caused by a different serotype of dengue virus than that which caused the primary infections. It has been speculated, therefore, that dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) are caused by serotype crossreactive immunopathological mechanisms. We analyzed clones of dengue serotype crossreactive T lymphocytes derived from the PBMC of a donor who had been infected with dengue 3 virus. These PBMC responded best to dengue 3 antigen, but also responded to dengue 1, 2, and 4 antigens, in bulk culture proliferation assays. 12 dengue antigen-specific clones were established using a limiting dilution technique. All of the clones had CD3+ CD4+ CD8 phenotypes. Eight clones responded to dengue 1, 2, 3, and 4 antigens and are crossreactive, while four other clones responded predominantly to dengue 3 antigen. These results indicate that the serotype crossreactive dengue-specific T lymphocyte proliferation observed in bulk cultures reflects the crossreactive responses detected at the clonal level. Serotype crossreactive clones produced high titers of IFN- gamma after stimulation with dengue 3 antigens, and also produced IFN- gamma to lower levels after stimulation with dengue 1, 2, and 4 antigens. The crossreactive clones lysed autologous lymphoblastoid cell line (LCL) pulsed with dengue antigens, and the crossreactivity of CTL lysis by T cell clones was consistent with the crossreactivity observed in proliferation assays. Epidemiological studies have shown that secondary infections with dengue 2 virus cause DHF/DSS at a higher rate than the other serotypes. We hypothesized that the lysis of dengue virus-infected cells by CTL may lead to DHF/DSS; therefore, the clones were examined for cytotoxic activity against dengue 2 virus-infected LCL. All but one of the serotype crossreactive clones lysed dengue 2 virus
van der Ploeg, Kattria; Chang, Chiwen; Ivarsson, Martin A.; Moffett, Ashley; Wills, Mark R.; Trowsdale, John
2017-01-01
The interaction of inhibitory killer cell Ig-like receptors (KIRs) with human leukocyte antigen (HLA) class I molecules has been characterized in detail. By contrast, activating members of the KIR family, although closely related to inhibitory KIRs, appear to interact weakly, if at all, with HLA class I. KIR2DS1 is the best studied activating KIR and it interacts with C2 group HLA-C (C2-HLA-C) in some assays, but not as strongly as KIR2DL1. We used a mouse 2B4 cell reporter system, which carries NFAT-green fluorescent protein with KIR2DS1 and a modified DAP12 adaptor protein. KIR2DS1 reporter cells were not activated upon coculture with 721.221 cells transfected with different HLA-C molecules, or with interferon-γ stimulated primary dermal fibroblasts. However, KIR2DS1 reporter cells and KIR2DS1+ primary natural killer (NK) cells were activated by C2-HLA-C homozygous human fetal foreskin fibroblasts (HFFFs) but only after infection with specific clones of a clinical strain of human cytomegalovirus (HCMV). Active viral gene expression was required for activation of both cell types. Primary NKG2A−KIR2DS1+ NK cell subsets degranulated after coculture with HCMV-infected HFFFs. The W6/32 antibody to HLA class I blocked the KIR2DS1 reporter cell interaction with its ligand on HCMV-infected HFFFs but did not block interaction with KIR2DL1. This implies a differential recognition of HLA-C by KIR2DL1 and KIR2DS1. The data suggest that modulation of HLA-C by HCMV is required for a potent KIR2DS1-mediated NK cell activation. PMID:28424684
No Love Lost Between Viruses and Interferons.
Fensterl, Volker; Chattopadhyay, Saurabh; Sen, Ganes C
2015-11-01
The interferon system protects mammals against virus infections. There are several types of interferons, which are characterized by their ability to inhibit virus replication and resultant pathogenesis by triggering both innate and cell-mediated immune responses. Virus infection is sensed by a variety of cellular pattern-recognition receptors and triggers the synthesis of interferons, which are secreted by the infected cells. In uninfected cells, cell surface receptors recognize the secreted interferons and activate intracellular signaling pathways that induce the expression of interferon-stimulated genes; the proteins encoded by these genes inhibit different stages of virus replication. To avoid extinction, almost all viruses have evolved mechanisms to defend themselves against the interferon system. Consequently, a dynamic equilibrium of survival is established between the virus and its host, an equilibrium that can be shifted to the host's favor by the use of exogenous interferon as a therapeutic antiviral agent.
Target Strength of Southern Resident Killer Whales (Orcinus orca): Measurement and Modeling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Jinshan; Deng, Zhiqun; Carlson, Thomas J.
2012-04-04
A major criterion for tidal power licensing in Washington’s Puget Sound is the management of the risk of injury to killer whales due to collision with moving turbine blades. An active monitoring system is being proposed for killer whale detection, tracking, and alerting that links to and triggers temporary turbine shutdown when there is risk of collision. Target strength (TS) modeling of the killer whale is critical to the design and application of any active monitoring system. A 1996 study performed a high-resolution measurement of acoustic reflectivity as a function of frequency of a female bottlenose dolphin (2.2 m length)more » at broadside aspect and TS as a function of incident angle at 67 kHz frequency. Assuming that killer whales share similar morphology structure with the bottlenose dolphin, we extrapolated the TS of an adult killer whale 7.5 m in length at 67 kHz frequency with -8 dB at broadside aspect and -28 dB at tail side. The backscattering data from three Southern Resident killer whales were analyzed to obtain the TS measurement. These data were collected at Lime Kiln State Park using a split-beam system deployed from a boat. The TS of the killer whale at higher frequency (200 kHz) was estimated based on a three-layer model for plane wave reflection from the lung of the whale. The TS data of killer whales were in good agreement with our model. In this paper, we also discuss and explain possible causes for measurement estimation error.« less
Panthong, Sumalee; Itharat, Arunporn
2014-08-01
Immune system is the most important system ofhuman body. Thaifolk doctors have used some medicinal plants as an adaptogenic drug or immunomodulatory agent. Piper chaba Hunter, Piper sarmentosum Roxb. and Piper interruptum Opiz. are used by folk doctors to activate immune response in cancer patients. To investigate the effect on natural killer cell activity and on lymphocyte proliferation activity of water extract of P chaba Hunter P. sarmentosum Roxb. and P interruptum Opiz. MATERIAL ANDMETHOD: Plant materials were extracted by decoction method. All extracts were testedfor an immunomodulatory effect using PBMCs from twelve healthy donors by chromium release assay. Lymphocyte proliferation was also determined by 3H-thymidine uptake assay. The degree of activation was expressed as the stimulation index. The water extract of P chaba Hunter significantly increased lymphocyte proliferation at concentrations ofl ng/ml, 10 ng/ml, 1 μg/ml, 5 μg/ml, 10 μg/ml and 100 μg/ml. P sarmentosum Roxb., and P interruptum Opiz. extracts at those concentrations significantly stimulated lymphocyteproliferation. P sarmentosum Roxb. extractsignificantly increased natural killer (NK) cell activity at a concentration of 100 μg/ml but P chaba Hunter and P interruptum Opiz. extracts did not significantly stimulate natural killer cell activity. P chaba Hunter, P interruptum Opiz. andP sarmentosum Roxb. have an immunomodulatory effect especially for P sarmentosum Roxb. extract which can activate both lymphocyte proliferation and NK cell activity.
Hines, Stephen A.; Stone, Diana M.; Hines, Melissa T.; Alperin, Debby C.; Knowles, Donald P.; Norton, Linda K.; Hamilton, Mary J.; Davis, William C.; McGuire, Travis C.
2003-01-01
Rhodococcus equi is a gram-positive bacterium that infects alveolar macrophages and causes rhodococcal pneumonia in horses and humans. The virulence plasmid of R. equi appears to be required for both pathogenicity in the horse and the induction of protective immunity. An understanding of the mechanisms by which virulent R. equi circumvents protective host responses and by which bacteria are ultimately cleared is important for development of an effective vaccine. Six adult horses were challenged with either virulent R. equi or an avirulent, plasmid-cured derivative. By using a flow cytometric method for intracytoplasmic detection of gamma interferon (IFN-γ) in equine bronchoalveolar lavage fluid (BALF) cells, clearance of the virulent strain was shown to be associated with increased numbers of pulmonary CD4+ and CD8+ T lymphocytes producing IFN-γ. There was no change in IFN-γ-positive cells in peripheral blood, suggesting that a type 1 recall response at the site of challenge was protective. The plasmid-cured strain of R. equi was cleared in horses without a significant increase in IFN-γ-producing T lymphocytes in BALF. In contrast to these data, a previous report in foals suggested an immunomodulating role for R. equi virulence plasmid-encoded products in downregulating IFN-γ expression by equine CD4+ T lymphocytes. Intracytoplasmic detection of IFN-γ provides a method to better determine whether modulation of macrophage-activating cytokines by virulent strains occurs uniquely in neonates and contributes to their susceptibility to rhodococcal pneumonia. PMID:12626444
The Biology of Pichia membranifaciens Killer Toxins
Belda, Ignacio; Ruiz, Javier; Alonso, Alejandro; Marquina, Domingo; Santos, Antonio
2017-01-01
The killer phenomenon is defined as the ability of some yeast to secrete toxins that are lethal to other sensitive yeasts and filamentous fungi. Since the discovery of strains of Saccharomyces cerevisiae capable of secreting killer toxins, much information has been gained regarding killer toxins and this fact has substantially contributed knowledge on fundamental aspects of cell biology and yeast genetics. The killer phenomenon has been studied in Pichia membranifaciens for several years, during which two toxins have been described. PMKT and PMKT2 are proteins of low molecular mass that bind to primary receptors located in the cell wall structure of sensitive yeast cells, linear (1→6)-β-d-glucans and mannoproteins for PMKT and PMKT2, respectively. Cwp2p also acts as a secondary receptor for PMKT. Killing of sensitive cells by PMKT is characterized by ionic movements across plasma membrane and an acidification of the intracellular pH triggering an activation of the High Osmolarity Glycerol (HOG) pathway. On the contrary, our investigations showed a mechanism of killing in which cells are arrested at an early S-phase by high concentrations of PMKT2. However, we concluded that induced mortality at low PMKT2 doses and also PMKT is indeed of an apoptotic nature. Killer yeasts and their toxins have found potential applications in several fields: in food and beverage production, as biocontrol agents, in yeast bio-typing, and as novel antimycotic agents. Accordingly, several applications have been found for P. membranifaciens killer toxins, ranging from pre- and post-harvest biocontrol of plant pathogens to applications during wine fermentation and ageing (inhibition of Botrytis cinerea, Brettanomyces bruxellensis, etc.). PMID:28333108
Stockbridge, Erica L; Miller, Thaddeus L; Carlson, Erin K; Ho, Christine
2018-01-01
To determine whether latent tuberculosis infection risk factors are associated with an increased likelihood of latent tuberculosis infection testing in the US private healthcare sector. A national sample of medical and pharmacy claims representing services rendered January 2011 through December 2013 for 3,997,986 commercially insured individuals in the US who were 0 to 64 years of age. We used multivariable logistic regression models to determine whether TB/LTBI risk factors were associated with an increased likelihood of Interferon-Gamma Release Assay (IGRA) or Tuberculin Skin Test (TST) testing in the private sector. 4.31% (4.27-4.34%) received at least one TST/IGRA test between 2011 and 2013 while 1.69% (1.67-1.72%) received a TST/IGRA test in 2013. Clinical risk factors associated with a significantly increased likelihood of testing included HIV, immunosuppressive therapy, exposure to tuberculosis, a history of tuberculosis, diabetes, tobacco use, end stage renal disease, and alcohol use disorder. Other significant variables included gender, age, asthma, the state tuberculosis rate, population density, and percent of foreign-born persons in a county. Private sector TST/IGRA testing is not uncommon and testing varies with clinical risk indicators. Thus, the private sector can be a powerful resource in the fight against tuberculosis. Analyses of administrative data can inform how best to leverage private sector healthcare toward tuberculosis prevention activities.
Montoya, Carlos J; Pollard, David; Martinson, Jeffrey; Kumari, Kumud; Wasserfall, Clive; Mulder, Candice B; Rugeles, Maria T; Atkinson, Mark A; Landay, Alan L; Wilson, S Brian
2007-01-01
Identification of human CD1d-restricted T-cell receptor (TCR)-invariant natural killer T (iNKT) cells has been dependent on utilizing combinations of monoclonal antibodies or CD1d tetramers, which do not allow for the most specific analysis of this T-cell subpopulation. A novel monoclonal antibody (clone 6B11), specific for the invariant CDR3 loop of human canonical Vα24Jα18 TCR α chain, was developed and used to specifically characterize iNKT cells. In healthy individuals studied for up to 1 year, a wide but stable frequency of circulating iNKT cells (range: 0·01–0·92%) was observed, with no differences in frequency by gender. Four stable iNKT cell subsets were characterized in peripheral blood based on the expression of CD4 and CD8, with CD8+ iNKT cells being a phenotypic and functionally different subset from CD4+ and double negative iNKT cells; in particular, LAG-3 was preferentially expressed on CD8+ iNKT cells. In addition, a strong negative linear correlation between the frequency of total iNKT cells and percentage of the CD4+ subset was observed. In terms of their potential association with disease, patients at risk for type 1 diabetes had significantly expanded frequencies of double negative iNKT cells when compared to matched controls and first-degree relatives. Moreover, peripheral blood CD4+ iNKT cells were the highest producers of interleukin-4, while the production of interferon-γ and tumour necrosis factor-α was similar amongst all iNKT cell subsets. These differences in iNKT cell subsets suggest that in humans the relative ratio of iNKT cell subsets may influence susceptibility vs. resistance to immune-mediated diseases. PMID:17662044
Kawano, M; Matsushima, K; Oppenheim, J J
1987-08-01
A bioassay was developed using human small B cells adherent to anti-human IgM (anti-mu)-coated wells. These B cells were stimulated to proliferate by culture supernatants of concanavalin A (Con A)-activated human peripheral blood lymphocytes (Con A Sup) even in the presence of high concentrations of anti-mu coated on assay wells. Human B-cell growth factor (BCGF) activities were partially purified from Con A Sup. Preparative chromatography (Sephacryl S-200 and isoelectrofocusing) yielded a major peak of BCGF activity for B cells adherent to anti-mu-coated wells with a molecular weight of 50,000 (50 kDa) and a pI 7.6. The 50-kDa BCGF was further purified by sequential chromatography using DEAE-Sephacel, CM-Sepharose, Sephacryl S-200, CM-high performance liquid chromatography (HPLC), and hydroxyapatite (HA)-HPLC. The HA-HPLC-purified 50-kDa BCGF was free of interleukin-1 (IL-1), interleukin-2 (IL-2), and interferon activities, but could support growth of BCL1 cells, similar to BCGF-II. Neither IL-1 nor interferon-gamma had any growth-stimulating effect in our B-cell proliferation assay with or without BCGF in Iscove's synthetic assay medium. BCGF-induced proliferation of B cells adherent to anti-mu-coated wells could be markedly augmented by the simultaneous or sequential addition of recombinant human IL-2 (rIL-2). When cultured for 3 days with 50-kDa BCGF, about 40% of B cells adherent to anti-mu-coated wells expressed Tac antigen, and monoclonal anti-Tac antibody inhibited rIL-2 enhancement of proliferation of 50-kDa BCGF-preactivated B cells. In addition, 50-kDa BCGF could induce Tac antigen on an Epstein-Barr virus-transformed B-cell line (ORSON) in the presence of a suboptimal dose of phorbol myristate acetate (PMA) and also on a natural killer-like cell line (YT cells). We have therefore identified a major 50-kDa BCGF activity with Tac antigen-inducing activity that also has a synergistic effect with IL-2 on normal B-cell proliferation.
Veinotte, Linnea; Gebremeskel, Simon; Johnston, Brent
2016-01-01
ABSTRACT Crosstalk interactions between dendritic cells (DCs) and invariant natural killer T (iNKT) cells are important in regulating antitumor responses elicited by glycolipid antigens. iNKT cells constitutively express the chemokine receptor CXCR6, while cytokine-activated DCs upregulate the transmembrane chemokine ligand, CXCL16. This study examined the co-stimulatory role of CXCR6/CXCL16 interactions in glycolipid-dependent iNKT cell activation and tumor control. Spleen and liver DCs in wild-type mice, but not iNKT cell deficient (Jα18−/−) mice, transiently upregulated surface CXCL16 following in vivo administration of the glycolipid antigen α-galactosylceramide. Recombinant CXCL16 did not directly induce iNKT cell activation in vitro but enhanced interferon (IFN)-γ production when mouse or human iNKT cells were stimulated with plate-bound anti-CD3. Compared with glycolipid-loaded CXCL16neg DCs, CXCL16hi DCs induced higher levels of IFNγ production in iNKT cell cultures and following adoptive transfer in vivo. The number of IFNγ+ iNKT cells and expansion of T-bet+ iNKT cells were reduced in vivo when CXCL16−/− DCs were used to activate iNKT cells. Enhanced IFNγ production in vivo was not dependent on CXCR6 expression on natural killer (NK) cells. Adoptive transfer of glycolipid-loaded CXCL16hi DCs provided superior protection against tumor metastasis compared to CXCL16neg DC transfers. Similarly, wild-type DCs provided superior protection against metastasis compared with CXCL16−/− DCs. These experiments implicate an important role for CXCR6/CXCL16 interactions in regulating iNKT cell IFNγ production and tumor control. The selective use of CXCL16hi DCs in adoptive transfer immunotherapies may prove useful for enhancing T helper (Th) type 1 responses and clinical outcomes in cancer patients. PMID:27471636
Bansal, Ruchi; Prakash, Jai; De Ruiter, Marieke; Poelstra, Klaas
2014-04-10
Hepatic stellate cells play a crucial role in the pathogenesis of hepatic fibrosis. Thus, pharmacological inhibition of pro-fibrotic activities of these cells might lead to an effective therapy for this disease. Among the potent anti-fibrotics, interferon gamma (IFNγ), a proinflammatory cytokine, is highly efficacious but it failed in clinical trials due to the poor efficacy and multiple adverse effects attributed to the ubiquitous IFNγ receptor (IFNγR) expression. To resolve these drawbacks, we chemically synthesized a chimeric molecule containing (a) IFNγ signaling peptide (IFNγ peptidomimetic, mimγ) that retains the agonistic activities of IFNγ but lacks an extracellular receptor recognition sequence for IFNγR; coupled via heterobifunctional PEG linker to (b) bicyclic platelet derived growth factor beta receptor (PDGFβR)-binding peptide (BiPPB) to induce internalization into the stellate cells that express PDGFβR. The synthesized targeted IFNγ peptidomimetic (mimγ-BiPPB) was extensively investigated for its anti-fibrotic and adverse effects in acute and chronic CCl4-induced liver fibrosis models in mice. Treatment with mimγ-BiPPB, after the onset of disease, markedly inhibited both early and established hepatic fibrosis as reflected by a reduced intrahepatic α-SMA, desmin and collagen-I mRNA expression and protein levels. While untargeted mimγ and BiPPB had no effect, and native IFNγ only induced a moderate reduction. Additionally, no off-target effects, e.g. systemic inflammation, were found with mimγ-BiPPB, which were substantially observed in mice treated with native IFNγ. The present study highlights the beneficial effects of a novel BiPPB mediated cell-specific targeting of IFNγ peptidomimetic to the disease-inducing cells and therefore represents a highly potential therapeutic approach to treat fibrotic diseases. Copyright © 2014 Elsevier B.V. All rights reserved.
Keiko, Killer Whale. [Lesson Plan].
ERIC Educational Resources Information Center
Discovery Communications, Inc., Bethesda, MD.
This lesson plan presents activities designed to help students understand that Keiko, the killer whale, lived for a long time in an aquarium and had to be taught to live independently; and that computer users can get updates on how Keiko is doing. The main activity of the lesson involves middle school students working in small groups to produce a…
Antioxidative activity of microencapsulated gamma-oryzanol on high cholesterol-fed rats.
Suh, Mun-Hee; Yoo, Sang-Ho; Chang, Pahn-Shick; Lee, Hyeon Gyu
2005-12-14
The effectiveness of microencapsulated gamma-oryzanol (M-gamma-OZ) was evaluated as an antioxidant in Sprague-Dawley rats. Lard containing 100 ppm of gamma-OZ (HCD III) or 100 ppm of M-gamma-OZ (HCD IV) was heated in an oven for 7 days, and the heat-treated lard as an ingredient in a high cholesterol diet (HCD) formulation was tested for analyzing in vivo cholesterol and lipid profiles. The HCDs containing fresh lard (HCD I) and heat-treated lard (HCD II) were fed to the rats for 4 weeks as control groups A and B, respectively, in this experiment. The liver thiobarbituric acid reactive substances values of group C (fed with HCD III) and group D (with HCD IV) were significantly lower (p < 0.05) than that of negative control, group B. One of the cholesterol oxidation products, 7-ketocholesterol, was not detected from group D, indicating that microencapsulation preserved antioxidative activity effectively. The levels of serum total cholesterol and lipoproteins, high-density lipoprotein (HDL), low-density lipoprotein (LDL), and very low-density lipoprotein were also affected by heat-induced lipid oxidation.The M-gamma-OZ evidently decreased LDL-cholesterol content and increased HDL-cholesterol in blood samples of tested rats. These results suggested that the M-gamma-OZ was not only effective in inhibiting the hypercholesterolemia of serum and liver but also reduced the oxidation degree of lipids and cholesterol. Therefore, this microencapsulation can be a good potential technique to protect the antioxidant activity of gamma-OZ from heat-induced lipid oxidation.
Sandmaier, B M; Oparin, D V; Holmberg, L A; Reddish, M A; MacLean, G D; Longenecker, B M
1999-01-01
Seven ovarian and 33 breast high-risk stage II/III and stage IV cancer patients received high-dose chemotherapy followed by stem cell rescue. Thirty to 151 days after stem cell transplantation, the patients received their first immunotherapy treatment with Theratope STn-KLH cancer vaccine. Most patients developed increasing IgG anti-STn titers to a sustained peak after the fourth or fifth immunizations. Only one patient had elevated CA27.29 (MUC1 mucin) serum levels at trial entry. Five of the seven patients with preimmunotherapy elevated serum CA125 levels demonstrated decreasing CA125 levels during immunotherapy, consistent with an antitumor response. Evidence of STn antigen-specific T-cell proliferation was obtained from 17 of the 27 evaluable patients who received at least three immunotherapy treatments. Eleven of the 26 patients tested had evidence of an anti-STn TH1 antigen-specific T-cell response as determined by interferon-gamma, but not interleukin (IL)-4, production. After immunization, lytic activity of peripheral blood lymphocytes (PBLs) tested against a lymphokine activated killer (LAK)-sensitive cell line, a natural killer (NK)-sensitive cell line, and an STn-expressing cancer cell line (OVCAR) increased significantly. In vitro IL-2 treatment of the PBLs after vaccination greatly enhanced killing of the STn+ cancer cell line. Evidence of the development of OVCAR specific killing activity, over and above that seen due to LAK or NK killing, is presented. These studies provide the strongest evidence in humans of the development of an antitumor T-cell response after immunization with a cancer-associated carbohydrate antigen.
Zafirova, Biljana; This, Sébastien; Coléon, Séverin; Décembre, Elodie; Paidassi, Helena; Bouvier, Isabelle; Joubert, Pierre-Emmanuel; Duffy, Darragh; Walzer, Thierry
2018-01-01
Type I interferon (IFN-I) responses are critical for the control of RNA virus infections, however, many viruses, including Dengue (DENV) and Chikungunya (CHIKV) virus, do not directly activate plasmacytoid dendritic cells (pDCs), robust IFN-I producing cells. Herein, we demonstrated that DENV and CHIKV infected cells are sensed by pDCs, indirectly, resulting in selective IRF7 activation and IFN-I production, in the absence of other inflammatory cytokine responses. To elucidate pDC immunomodulatory functions, we developed a mouse model in which IRF7 signaling is restricted to pDC. Despite undetectable levels of IFN-I protein, pDC-restricted IRF7 signaling controlled both viruses and was sufficient to protect mice from lethal CHIKV infection. Early pDC IRF7-signaling resulted in amplification of downstream antiviral responses, including an accelerated natural killer (NK) cell-mediated type II IFN response. These studies revealed the dominant, yet indirect role of pDC IRF7-signaling in directing both type I and II IFN responses during arbovirus infections. PMID:29914621
Woolard, Matthew D; Hensley, Lucinda L; Kawula, Thomas H; Frelinger, Jeffrey A
2008-06-01
Two key routes of Francisella tularensis infection are through the skin and airway. We wished to understand how the route of inoculation influenced the primary acute adaptive immune response. We show that an intranasal inoculation of the F. tularensis live vaccine strain (LVS) with a 1,000-fold-smaller dose than an intradermal dose results in similar growth kinetics and peak bacterial burdens. In spite of similar bacterial burdens, we demonstrate a difference in the quality, magnitude, and kinetics of the primary acute T-cell response depending on the route of inoculation. Further, we show that prostaglandin E(2) secretion in the lung is responsible for the difference in the gamma interferon (IFN-gamma) response. Intradermal inoculation led to a large number of IFN-gamma(+) T cells 7 days after infection in both the spleen and the lung. In contrast, intranasal inoculation induced a lower number of IFN-gamma(+) T cells in the spleen and lung but an increased number of Th17 cells in the lung. Intranasal infection also led to a significant increase of prostaglandin E(2) (PGE(2)) in the bronchoalveolar lavage fluid. Inhibition of PGE(2) production with indomethacin treatment resulted in increased numbers of IFN-gamma(+) T cells and decreased bacteremia in the lungs of intranasally inoculated mice. This research illuminates critical differences in acute adaptive immune responses between inhalational and dermal infection with F. tularensis LVS mediated by the innate immune system and PGE(2).
Sonoda, Junichiro; Laganière, Josée; Mehl, Isaac R; Barish, Grant D; Chong, Ling-Wa; Li, Xiangli; Scheffler, Immo E; Mock, Dennis C; Bataille, Alain R; Robert, Francois; Lee, Chih-Hao; Giguère, Vincent; Evans, Ronald M
2007-08-01
Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.
Oliveira, Sandra Maria do Valle Leone de; Trajman, Anete; Paniago, Anamaria Mello Miranda; Motta-Castro, Ana Rita Coimbra; Ruffino-Netto, Antonio; Maciel, Ethel Leonor Noia; Croda, Julio; Bonecini-Almeida, Maria da Gloria
2017-01-01
To evaluate the frequency of and factors associated with indeterminate interferon-gamma release assay (IGRA) results in people living with HIV/AIDS (PLWHA). We tested 81 PLWHA in the central-west region of Brazil, using the tuberculin skin test and an IGRA. Information on sociodemographic and clinical variables was gathered through the use of questionnaires and from medical records. The association of those variables with indeterminate results was analyzed by calculating the adjusted ORs in a multivariate logistic regression model. Concordance was evaluated by determining the kappa statistic. Among the 81 patients evaluated, the tuberculin skin test results were positive in 18 (22.2%) of the patients, and the IGRA results were positive in 10 (12.3%), with a kappa of 0.62. The IGRA results were indeterminate in 22 (27.1%) of the patients (95% CI: 17.8-38.1%). The odds of obtaining indeterminate results were significantly higher in smokers (adjusted OR = 6.0; 95% CI: 1.4-26.7) and in samples stored for less than 35 days (adjusted OR = 14.0; 95% CI: 3.1-64.2). Patients with advanced immunosuppression (CD4+ T-cell count < 200 cells/mm3) were at a higher risk for indeterminate results (OR adjusted for smoking and inadequate duration of sample storage = 4.7; 95% CI: 0.91-24.0), although the difference was not significant. The high prevalence of indeterminate results can be a major limitation for the routine use of IGRAs in PLWHA. The need to repeat the test increases its costs and should be taken into account in cost-effectiveness studies. The processing of samples can significantly alter the results. Avaliar a frequência de resultados indeterminados de um interferon-gamma release assay (IGRA, ensaio de liberação de interferon-gama) e os fatores relacionados com esses resultados em pessoas vivendo com HIV/AIDS (PVHA). Foram avaliadas 81 PVHA na região Centro-Oeste do Brasil, por meio do teste tuberculínico e de um IGRA. Informações a respeito de vari
K2 killer toxin-induced physiological changes in the yeast Saccharomyces cerevisiae.
Orentaite, Irma; Poranen, Minna M; Oksanen, Hanna M; Daugelavicius, Rimantas; Bamford, Dennis H
2016-03-01
Saccharomyces cerevisiae cells produce killer toxins, such as K1, K2 and K28, that can modulate the growth of other yeasts giving advantage for the killer strains. Here we focused on the physiological changes induced by K2 toxin on a non-toxin-producing yeast strain as well as K1, K2 and K28 killer strains. Potentiometric measurements were adjusted to observe that K2 toxin immediately acts on the sensitive cells leading to membrane permeability. This correlated with reduced respiration activity, lowered intracellular ATP content and decrease in cell viability. However, we did not detect any significant ATP leakage from the cells treated by killer toxin K2. Strains producing heterologous toxins K1 and K28 were less sensitive to K2 than the non-toxin producing one suggesting partial cross-protection between the different killer systems. This phenomenon may be connected to the observed differences in respiratory activities of the killer strains and the non-toxin-producing strain at low pH. This might also have practical consequences in wine industry; both as beneficial ones in controlling contaminating yeasts and non-beneficial ones causing sluggish fermentation. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Celada, Lindsay J.; Whalen, Margaret M.
2013-01-01
Butyltins (BTs) contaminate the environment and are found in human blood. BTs, tributyltin (TBT) and dibutyltin (DBT), diminish the cytotoxic function and levels of key proteins of human natural killer (NK) cells. NK cells are an initial immune defense against tumors, virally-infected cells and antibody-coated cells and thus critical to human health. The signaling pathways that regulate NK cell functions include mitogen-activated protein kinases (MAPKs). Studies have shown that exposure to BTs leads to the activation of specific MAPKs and MAPK kinases (MAP2Ks) in human NK cells. MAP2K kinases (MAP3Ks) are upstream activators of MAP2Ks, which then activate MAPKs. The current study examined if BT-induced activation of MAP3Ks was responsible for MAP2K and thus, MAPK activation. This study examines the effects of TBT and DBT on the total levels of two MAP3Ks, c-Raf and ASK1, as well as activating and inhibitory phosphorylation sites on these MAP3Ks. In addition, the immediate upstream activator of c-Raf, Ras, was examined for BT-induced alterations. Our results show significant activation of the MAP3K, c-Raf, in human NK cells within 10 minutes of TBT exposure and the MAP3K, ASK1, after one hour exposures to TBT. In addition, our results suggest that both TBT and DBT are impacting the regulation of c-Raf. PMID:24038145
Liu, Hui; Li, Jianyu; Wang, Fengmei; Gao, Yingtang; Luo, Ying; Wang, Peng; Li, Chenglong; Zhu, Zhengyan
2015-04-01
Cytokine-induced killer (CIK) cell immunotherapy exhibits significant advantages in the clinical treatment of tumors. This study was designed to compare the biological characteristics of autologous CIK cells from patients with hepatocarcinoma following different procedures for the separation of peripheral blood mononuclear cells (PBMCs). Forty-four hepatocarcinoma patients were enrolled and distributed into two groups. PBMCs were isolated either using a blood cell separator (apheresis method) or Ficoll lymphocyte separation medium (Ficoll method). The total amount, collection efficacy, and cell status of PBMCs in the two groups were determined. According to the number and status of collected PBMCs, different cultivation procedures were used for their amplification and activation and the proliferation ability, phenotype, and killing activity of CIK cells in the two groups were evaluated. Our results indicated that the number of collected PBMCs in the apheresis group was far more than that in the Ficoll group. However, the isolation rate was lower, and more cellular debris was observed in the apheresis group, which may be the cause of some untoward effects. Following in vitro culture, the enrichment time of CIK cells was longer in the Ficoll group, and the percentages of CD3(+)CD4(+) (Th) and CD4(+)CD25(+) (Treg) cells were higher. In the apheresis group, the percentages of CD3(-)CD56(+) (NK) and CD3(+)CD56(+) (NKT) cells were higher, and the CIK cells exhibited a higher cytolytic activity against HepG2 hepatoma cells. In conclusion, different procedures for PBMCs separation can influence the biological activities of CIK cells, and the apheresis method is more effective at enhancing the antitumor efficacy of CIK cells. However, significant attention should be paid to the possibility of adverse reactions in apheresis donors.
Inhibition of Interferon Regulatory Factor 3 Activation by Paramyxovirus V Protein
Irie, Takashi; Kiyotani, Katsuhiro; Igarashi, Tomoki; Yoshida, Asuka
2012-01-01
The V protein of Sendai virus (SeV) suppresses innate immunity, resulting in enhancement of viral growth in mouse lungs and viral pathogenicity. The innate immunity restricted by the V protein is induced through activation of interferon regulatory factor 3 (IRF3). The V protein has been shown to interact with melanoma differentiation-associated gene 5 (MDA5) and to inhibit beta interferon production. In the present study, we infected MDA5-knockout mice with V-deficient SeV and found that MDA5 was largely unrelated to the innate immunity that the V protein suppresses in vivo. We therefore investigated the target of the SeV V protein. We previously reported interaction of the V protein with IRF3. Here we extended the observation and showed that the V protein appeared to inhibit translocation of IRF3 into the nucleus. We also found that the V protein inhibited IRF3 activation when induced by a constitutive active form of IRF3. The V proteins of measles virus and Newcastle disease virus inhibited IRF3 transcriptional activation, as did the V protein of SeV, while the V proteins of mumps virus and Nipah virus did not, and inhibition by these proteins correlated with interaction of each V protein with IRF3. These results indicate that IRF3 is important as an alternative target of paramyxovirus V proteins. PMID:22532687
Baculovirus directly activates murine NK cells via TLR9.
Moriyama, T; Suzuki, T; Chang, M O; Kitajima, M; Takaku, H
2017-04-01
The importance of natural killer (NK) cells in innate immune responses against tumors or viral infections enhances the appeal of NK cell-based immunotherapeutic approaches. We have recently reported that baculovirus (BV)-infected dendritic cells (DCs; BV-DCs) induce antitumor immunity against established tumors in mice. These antitumor effects were CD8 + T-cell and NK cell dependent; however, they were found to be CD4 + T-cell independent. In this study, we investigated the involvement of Toll-like receptor 9 (TLR9) in the process of BV recognition by NK cells. We found that BV directly stimulated NK cells, induced the expression of the activation marker CD69 and promoted interferon-gamma (IFN-γ) production and cytotoxicity. Moreover, TLR9 knockout in mice (tlr9-/- NK cells) inhibited NK cell responses to BV, indicating that TLR9 may have a relevant role in the BV-induced upregulation of NK cell functions. Our data demonstrated for the first time that NK cells directly recognize BV via TLR9, which provides opportunities for the use of this technique as an effective tool for BV-based immunotherapies against malignancies.
Branched-chain amino acid supplementation and the immune response of long-distance athletes.
Bassit, Reinaldo A; Sawada, Letícia A; Bacurau, Reury F P; Navarro, Franciso; Martins, Eivor; Santos, Ronaldo V T; Caperuto, Erico C; Rogeri, Patrícia; Costa Rosa, Luís F B P
2002-05-01
Intense long-duration exercise has been associated with immunosuppression, which affects natural killer cells, lymphokine-activated killer cells, and lymphocytes. The mechanisms involved, however, are not fully determined and seem to be multifactorial, including endocrine changes and alteration of plasma glutamine concentration. Therefore, we evaluated the effect of branched-chain amino acid supplementation on the immune response of triathletes and long-distance runners. Peripheral blood was collected prior to and immediately after an Olympic Triathlon or a 30k run. Lymphocyte proliferation, cytokine production by cultured cells, and plasma glutamine were measured. After the exercise bout, athletes from the placebo group presented a decreased plasma glutamine concentration that was abolished by branched-chain amino acid supplementation and an increased proliferative response in their peripheral blood mononuclear cells. Those cells also produced, after exercise, less tumor necrosis factor, interleukins-1 and -4, and interferon and 48% more interleukin-2. Supplementation stimulated the production of interleukin-2 and interferon after exercise and a more pronounced decrease in the production of interleukin-4, indicating a diversion toward a Th1 type immune response. Our results indicate that branched-chain amino acid (BCAA) supplementation recovers the ability of peripheral blood mononuclear cells proliferate in response to mitogens after a long distance intense exercise, as well as plasma glutamine concentration. The amino acids also modify the pattern of cytokine production leading to a diversion of the immune response toward a Th1 type of immune response.
Walker, D H; Popov, V L; Feng, H M
2000-09-01
A mouse model of typhus rickettsiosis that reproduces the hematogenous dissemination to the critical target organs, including brain, lungs, heart, and kidneys, primary endothelial and, to a lesser degree, macrophage intracellular rickettsial infection, and typical vascular-based lesions of louse-borne typhus and murine typhus was established. Intravenous inoculation of C3H/HeN mice with Rickettsia typhi caused disease with a duration of the incubation period and mortality rate that were dependent on the infective dose of rickettsiae. Lethal infection was associated with high concentrations of R. typhi in the lungs and brain, despite a brisker humoral immune response to the rickettsiae than in the sublethal infection. Gamma interferon and CD8 T lymphocytes were demonstrated to be crucial to clearance of the rickettsiae and recovery from infection in experiments in which specific monoclonal antibodies were administered to deplete these components. Death of animals depleted of gamma interferon or CD8 T lymphocytes was associated with overwhelming rickettsial infection demonstrated by titers of infectious rickettsiae and by immunohistochemistry. An effective antirickettsial immune response was associated with elevated serum concentrations of IL-12 on Day 5 and increased secretion of IL-12 by concanavalin-A-stimulated spleen cells on Day 5. Evidence for transient suppression of the immune response consisted of marked reduction in the secretion of IL-2 and IL-12 by concanavalin-A-stimulated spleen cells on Days 10 and 15. This model offers excellent opportunities for study of attenuation and pathogenetic mechanisms of typhus rickettsiae, which are established biologic weapons of potential use in bioterrorism.
Ordway, Diane J; Costa, Leonor; Martins, Marta; Silveira, Henrique; Amaral, Leonard; Arroz, Maria J; Ventura, Fernando A; Dockrell, Hazel M
2004-08-15
We evaluated immune responses to Mycobacterium tuberculosis in 10 health-care workers (HCWs) and 10 non-HCWs and correlated their immune status with the development of active tuberculosis (TB). Twenty individuals were randomly recruited, tested, and monitored longitudinally for TB presentation. Peripheral blood mononuclear cells (PBMCs) from donors were stimulated with M. tuberculosis and tested for cell proliferation and the production of interferon (IFN)- gamma, interleukin (IL)-5, and IL-4, by use of enzyme-linked immunosorbent or flow-cytometric assays. HCWs had higher levels of cell proliferation (24,258 cpm) and IFN- gamma (6373 pg/mL) to M. tuberculosis than did non-HCWs (cell proliferation, 11,462 cpm; IFN- gamma, 3228 pg/mL). Six of 10 HCWs showed increased median percentages of CD8+IL-4+ (4.7%) and gammadelta +IL-4+ (2.3%) T cells and progressed to active TB. HCWs who remained healthy showed increased median percentages of CD8+IFN- gamma+ (25.0%) and gammadelta +IFN- gamma+ (8.0%) and lower percentages of CD8+IL-4+ (0.05%) and gammadelta +IL-4+ (0.03%) T cells.
Alvares, C T G; Cruz, J F; Romano, C C; Brandão, F Z
2016-04-15
This study evaluated the influence of artificial insemination (AI) by cervical retraction (CRI) on serum levels of interferon gamma (IFNγ) and interleukin-10 (IL-10) in ewes. Synchronized pluriparous Santa Inês ewes were subjected to natural mating (NM, n = 8) and AI, which was performed for a fixed time (55 ± 1 hour) by CRI (n = 8) or laparoscopy (n = 8). Ewes were classified as pregnant, with return to estrus (RE) or with embryonic loss (EL). Blood samples were collected on Day 0, Day 3, Day 5, Day 12, and Day 17 (Day 0 = AI/NM) for progesterone dosage and cytokines were quantified from Day 0 to Day 12. Progesterone levels were constant, except for a decrease in ewes with RE at Day 17 (P < 0.05). Regardless of the reproductive method used, there was no difference in the IFNγ and IL-10 levels at any time, with averages of 642.1, 713.2, and 741.2 pg/mL for IFNγ and 667.1, 616.8, and 721.1 pg/mL for IL-10 when using CRI, laproscopy, and NM, respectively. Regarding the physiological status, ewes with EL had lower serum levels of IFNγ and IL-10 than pregnant ewes and ewes with RE, regardless of the reproductive method used, with averages of 769.1, 714.9, and 555.7 pg/mL for IFNγ and 713.8, 699.3, and 578.7 pg/mL for IL-10 in pregnant ewes, ewes with RE and EL, respectively (P < 0.01). In conclusion, AI by CRI in Santa Inês ewes does not alter the profile of serum cytokines IFNγ and IL-10 and does not induce an inflammatory reaction that can compromise pregnancy. Copyright © 2016 Elsevier Inc. All rights reserved.
The eyeball killer: serial killings with postmortem globe enucleation.
Coyle, Julie; Ross, Karen F; Barnard, Jeffrey J; Peacock, Elizabeth; Linch, Charles A; Prahlow, Joseph A
2015-05-01
Although serial killings are relatively rare, they can be the cause of a great deal of anxiety while the killer remains at-large. Despite the fact that the motivations for serial killings are typically quite complex, the psychological analysis of a serial killer can provide valuable insight into how and why certain individuals become serial killers. Such knowledge may be instrumental in preventing future serial killings or in solving ongoing cases. In certain serial killings, the various incidents have a variety of similar features. Identification of similarities between separate homicidal incidents is necessary to recognize that a serial killer may be actively killing. In this report, the authors present a group of serial killings involving three prostitutes who were shot to death over a 3-month period. Scene and autopsy findings, including the unusual finding of postmortem enucleation of the eyes, led investigators to recognize the serial nature of the homicides. © 2015 American Academy of Forensic Sciences.
Triggianese, Paola; Conigliaro, Paola; Chimenti, Maria Sole; Biancone, Livia; Monteleone, Giovanni; Perricone, Roberto; Monteleone, Ivan
2016-01-01
Both the innate and the adaptive immune responses contribute to the onset of chronic inflammation in spondyloarthritis (SpA). The association between SpA and inflammatory bowel disease (IBD, enteropathic SpA-ESpA) has been largely established and suggests a shared pathophysiology. There is evidence that innate lymphoid cells (ILC) are involved in the pathogenesis of both SpA and IBD while no evidence has been reported to date on ESpA. We aimed to analyse for the first time the frequency and cytokine expression of ILC in peripheral blood from ESpA patients compared with both IBD and healthy subjects. Correlations between immunophenotyping and disease activity were also explored. ESpA patients (n=20) were prospectively enrolled. Healthy controls (HC, n=10) and IBD patients (n=10) served as control groups. Peripheral blood Interferon (IFN)-γ and interleukin (IL)-17 expressing T and non-T cells as well as ILC subsets (ILC-1: IFN- γ +; ILC-3: IL-17+; natural killer-NK) were characterised by flowcytometry. Correlations between IL-17+ cells and SpA disease activity were analysed. ESpA patients showed higher levels of ROR-γ expressing non T-cells with the respect to the controls. IL-17 producing non-T cells were higher than the HC and positively correlated with IFN-γ expressing cells levels as well as with SpA disease activity. ESpA showed higher levels of ILC-1 and ILC-3 than both IBD and HC. IFN-γ expressing NK cells were higher in ESpA than HC. Our preliminary findings indicate that peripheral blood of ESpA patients is enriched for IL-17 expressing ILC which distinguishes the blood compartment from both IBD and HC. The increased IL-17 production by ILC indicates a novel role for ILC in ESpA.
Breckler, L A; Hale, J; Taylor, A; Dunstan, J A; Thornton, C A; Prescott, S L
2008-11-01
During pregnancy, variations in maternal-foetal cellular interactions may influence immune programming. This study was carried out to determine if maternal responses to foetal alloantigens are altered by maternal allergic disease and/or previous pregnancies. For this cohort study, peripheral blood was collected from allergic (n = 69) and nonallergic (n = 63) pregnant women at 20, 30, 36-week gestation and 6-week postpartum (pp). Cord blood was collected at delivery. Mixed lymphocyte reactions were used to measure maternal cytokine responses [interleukin-6 (IL-6), IL-10, IL-13 and (interferon-gamma) IFN-gamma] at each time point towards foetal mononuclear cells. Maternal cytokine responses during pregnancy (20, 30 and 36 weeks) were suppressed compared to the responses at 6-week pp. The ratio of maternal IFN-gamma/IL-13 and IFN-gamma/IL-10 responses were lower during pregnancy. Allergic mothers had lower IFN-gamma responses at each time-point during pregnancy with the greatest difference in responses observed at 36-week gestation. When allergic and nonallergic women were further stratified by gravidity group, IFN-gamma responses of allergic multigravid mothers were significantly lower than nonallergic multigravid mothers during pregnancy. During normal pregnancy, peripheral T-cell cytokine responses to foetal alloantigens may be altered by both allergic status of the mother and previous pregnancies. These factors could influence the cytokine milieu experienced by the foetus and will be further explored in the development of allergic disease during early life.
NASA Technical Reports Server (NTRS)
Chapes, S. K.; Hoynowski, S. M.; Woods, K. M.; Armstrong, J. W.; Beharka, A. A.; Iandolo, J. J.; Spooner, B. S. (Principal Investigator)
1993-01-01
We used major histocompatibility complex class II antigen-deficient transgenic mice to show that in vitro natural killer cell cytotoxicity and T-cell activation by staphylococcal exotoxins (superantigens) are not dependent upon the presence of major histocompatibility complex class II molecules. T cells can be activated by exotoxins in the presence of exogenously added interleukin 1 or 2 or in the presence of specific antibody without exogenously added cytokines.
Natural Killer (NK) Cells in Antibacterial Innate Immunity: Angels or Devils?
Souza-Fonseca-Guimaraes, Fernando; Adib-Conquy, Minou; Cavaillon, Jean-Marc
2012-01-01
Natural killer (NK) cells were first described as immune leukocytes that could kill tumor cells and soon after were reported to kill virus-infected cells. In the mid-1980s, 10 years after their discovery, NK cells were also demonstrated to contribute to the fight against bacterial infection, particularly because of crosstalk with other leukocytes. A wide variety of immune cells are now recognized to interact with NK cells through the production of cytokines such as interleukin (IL)-2, IL-12, IL-15 and IL-18, which boost NK cell activities. The recent demonstration that NK cells express pattern recognition receptors, namely Toll-like and nucleotide oligomerization domain (NOD)-like receptors, led to the understanding that these cells are not only under the control of accessory cells, but can be directly involved in the antibacterial response thanks to their capacity to recognize pathogen-associated molecular patterns. Interferon (IFN)-γ is the predominant cytokine produced by activated NK cells. IFN-γ is a key contributor to antibacterial immune defense. However, in synergy with other inflammatory cytokines, IFN-γ can also lead to deleterious effects similar to those observed during sepsis. Accordingly, as the main source of IFN-γ in the early phase of infection, NK cells display both beneficial and deleterious effects, depending on the circumstances. PMID:22105606
Paciello, O; Borzacchiello, G; Varricchio, E; Papparella, S
2007-10-01
Peroxisome proliferator-activated receptor gamma (PPAR-gamma) is a ligand-activated transcriptional factor belonging to the steroid receptor superfamily. PPAR-gamma is expressed in multiple normal and neoplastic tissues, such as the breast, colon, lung, ovary and placenta. In addition to adipogenic and anti-inflammatory effects, PPAR-gamma activation has been shown to be anti-proliferative by its differentiation-promoting effect, suggesting that activation of PPAR-gamma may be useful in slowing or arresting the proliferation of de-differentiated tumour cells. In this study, we investigated the expression of PPAR-gamma in normal and neoplastic canine nasal epithelium. Twenty-five samples composed of five normal nasal epithelia and 20 canine nasal carcinomas, were immunohistochemically stained for PPAR-gamma. The specificity of the antibody was verified by Western Blot analysis. Confocal laser scanning microscopical investigation was also performed. In normal epithelium, the staining pattern was cytoplasmic and polarized at the cellular free edge. In carcinomas, the neoplastic cells showed mainly strong cytoplasmatic PPAR-gamma expression; moreover, perinuclear immunoreactivity was also detected and few neoplastic cells exhibited a nuclear positivity. Our results demonstrate different patterns of PPAR-gamma expression in normal canine nasal epithelium when compared with canine nasal carcinoma. The importance of this transcription factor in the pathophysiology of several different tumours has stimulated much research in this field and has opened new opportunities for the treatment of the tumours.
Lester, David; White, John
2010-02-01
In a sample of 248 killers of two victims in America from 1900 to 2005, obtained from an encyclopedia of serial killers by Newton (2006), those completing suicide did not differ in sex, race, or the motive for the killing from those who were arrested.
Stable isotopes of captive cetaceans (killer whales and bottlenose dolphins).
Caut, Stéphane; Laran, Sophie; Garcia-Hartmann, Emmanuel; Das, Krishna
2011-02-15
There is currently a great deal of interest in using stable isotope methods to investigate diet, trophic level and migration in wild cetaceans. In order to correctly interpret the results stemming from these methods, it is crucial to understand how diet isotopic values are reflected in consumer tissues. In this study, we investigated patterns of isotopic discrimination between diet and blood constituents of two species of cetaceans (killer whale, Orcinus orca, and bottlenose dolphin, Tursiops truncatus) fed controlled diets over 308 and 312 days, respectively. Diet discrimination factors (Δ; mean ± s.d.) for plasma were estimated to Δ(13)C=2.3±0.6‰ and Δ(15)N=1.8±0.3‰, respectively, for both species and to Δ(13)C=2.7±0.3‰ and Δ(15)N=0.5±0.1‰ for red blood cells. Delipidation did not have a significant effect on carbon and nitrogen isotopic values of blood constituents, confirming that cetacean blood does not serve as a reservoir of lipids. In contrast, carbon isotopic values were higher in delipidated samples of blubber, liver and muscle from killer whales. The potential for conflict between fisheries and cetaceans has heightened the need for trophic information about these taxa. These results provide the first published stable isotope incorporation data for cetaceans, which are essential if conclusions are to be drawn on issues concerning trophic structures, carbon sources and diet reconstruction.
Comitini, Francesca; Ciani, Maurizio
2011-03-01
Brettanomyces/Dekkera yeasts have been identified as part of the grape yeast flora. They are well known for colonizing the cellar environmental and spoiling wines, causing haze, turbidity and strong off-flavours in wines and enhancing the volatile acidity. As the general practices applied to combat Brettanomyces/Dekkera yeasts are not particularly appropriate during wine ageing and storage, a biological alternative to curtailing their growth would be welcomed in winemaking. In this study, we investigated the Kluyveromyces wickerhamii killer toxin (Kwkt) that is active against Brettanomyces/Dekkera spoilage yeasts. Purification procedures allowed the identification of Kwkt as a protein with an apparent molecular mass of 72 kDa and without any glycosyl residue. Interestingly, purified Kwkt has fungicidal effects at low concentrations under the physicochemical conditions of winemaking. The addition of 40 and 80 mg L(-1) purified Kwkt showed efficient antispoilage effects, controlling both growth and metabolic activity of sensitive spoilage yeasts. At these two killer toxin concentrations, compounds known to contribute to the 'Brett' character of wines, such as ethyl phenols, were not produced. Thus, purified Kwkt appears to be a suitable biological strategy to control Brettanomyces/Dekkera yeasts during fermentation, wine ageing and storage. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Li, Jian-Ting; Guo, Cheng; Li, Ming-Long; Wei, Yong-Qing; Hou, Yan-Feng; Jiao, Yu-Lian; Zhao, Yue-Ran; Sun, Hui; Xu, Jin; Cao, Ming-Feng; Feng, Li; Yu, Gui-Na; Gao, Ling; Liu, Yi-Qing; Zhang, Bing-Chang; Zhao, Jia-Jun; Zhang, Hai-Qing
2016-08-01
Natural killer (NK) cells serve as primary immune surveillance and are partially regulated by combinations of killer immunoglobulin-like receptors (KIR) and their human leukocyte antigen-C (HLA-C) ligands. Alterations in NK cell activity have been associated with Hashimoto thyroiditis (HT). The aim of this study was to determine whether certain KIR/HLA-C genotype combinations play a role in HT pathogenesis. The present study enrolled 107 unrelated HT patients and 108 random healthy individuals in a case-control study. Blood was collected for DNA extraction; typing of KIR genes and HLA-C alleles was performed by polymerase chain reaction with sequence specific primers (PCR-SSP), followed by electrophoresis on agarose gels. Among a panel of KIR2D/HLA-C genotype combinations, the frequency of KIR2DS2/HLA-C1 was significantly increased in HT patients compared to controls (33.64% vs. 12.96%, P<.001). To further analyze the precise genotype, we investigated inhibitory or activating KIR/HLA-C gene pairs when their corresponding activating or inhibitory KIR genes were absent in the 2 groups. Only the frequency of KIR2DS2(-)2DL2/3(+)HLA-C1(+) was significantly decreased in HT patients compared to controls (48.60% vs. 70.37%, P = .001). Our data suggest that KIR2DS2/HLA-C1 may correlate with HT pathogenesis. On the contrary, the predominance of KIR2DL2/3/HLA-C1 in the absence of KIR2DS2 suggests a potential inhibitory role in HT pathogenesis. In conclusion, our findings may further elucidate the mechanisms underlying the pathogenesis of HT and other autoimmune diseases. HLA-C = human leukocyte antigen-C HT = Hashimoto thyroiditis KIR = killer immunoglobulin-like receptor NK = natural killer PCR = polymerase chain reaction.
Cyclosporin a inhibits T cell-mediated augmentation of mouse natural killer activity.
Yanagihara, R H; Adler, W H
1982-06-01
Cyclosporin A (CSA) in vitro inhibited the spontaneous cytotoxic activity of mouse spleen cells against YAC target cells in a 4 hr 51Cr release assay. While natural killer (NK) cells were inhibited directly by CSA, these suppressive effects were largely reversible by coculture of effector cells for an optimal period with polyinosinic-polycytidylic acid (Poly I:C) or lipopolysaccharide (LPS). In contrast concanavalin A (Con A), in the presence of CSA, was unable to augment NK activity. The supernatant, however, of mouse spleen cells cultured with Con A was fully able to augment the NK the activity by freshly cultured spleen cells in the presence of CSA. The results indicate that CSA inhibits NK activity by two distinct mechanisms: a) a direct inactivation of NK cells and b) a suppression of production or release of an NK-activating factor from T cells, but not B cells or macrophages.
Shirmanova, Marina; Yuzhakova, Diana; Snopova, Ludmila; Perelman, Gregory; Serebrovskaya, Ekaterina; Lukyanov, Konstantin; Turchin, Ilya; Subochev, Pavel; Lukyanov, Sergey; Kamensky, Vladislav; Zagaynova, Elena
2015-01-01
The strong phototoxicity of the red fluorescent protein KillerRed allows it to be considered as a potential genetically encoded photosensitizer for the photodynamic therapy (PDT) of cancer. The advantages of KillerRed over chemical photosensitizers are its expression in tumor cells transduced with the appropriate gene and direct killing of cells through precise damage to any desired cell compartment. The ability of KillerRed to affect cell division and to induce cell death has already been demonstrated in cancer cell lines in vitro and HeLa tumor xenografts in vivo. However, the further development of this approach for PDT requires optimization of the method of treatment. In this study we tested the continuous wave (593 nm) and pulsed laser (584 nm, 10 Hz, 18 ns) modes to achieve an antitumor effect. The research was implemented on CT26 subcutaneous mouse tumors expressing KillerRed in fusion with histone H2B. The results showed that the pulsed mode provided a higher rate of photobleaching of KillerRed without any temperature increase on the tumor surface. PDT with the continuous wave laser was ineffective against CT26 tumors in mice, whereas the pulsed laser induced pronounced histopathological changes and inhibition of tumor growth. Therefore, we selected an effective regimen for PDT when using the genetically encoded photosensitizer KillerRed and pulsed laser irradiation.
Spores of two probiotic Bacillus species enhance cellular immunity in BALB/C mice.
Gong, Li; Huang, Qin; Fu, Aikun; Wu, YanPing; Li, Yali; Xu, Xiaogang; Huang, Yi; Yu, Dongyou; Li, Weifen
2018-01-01
Previous studies found that Bacillus subtilis BS02 and B. subtilis subsp. natto BS04 isolated in our laboratory could activate the immune response of murine macrophages in vitro. This study aims to investigate the effects of dietary supplementation with Bacillus species spores on the systemic cellular immune response in BALB/C mice. Results showed that both B. subtilis BS02 and B. subtilis natto BS04 enhanced the phagocytic function of the mononuclear phagocyte system (MPS) and the cytotoxicity of natural killer (NK) cells. In addition, B. subtilis BS02 could increase the respiratory burst activity of blood phagocytes. Furthermore, B. subtilis BS02 and B. subtilis natto BS04 increased the percentage of gamma-interferon-producing CD4 + cells and CD8 + T-cells, but only BS04 increased the percentage of CD3 + cells and CD3 + CD4 + cells in splenocytes. However, there were no effects on other subsets of splenic lymphocytes and mitogen-induced splenic lymphocyte proliferation. All data suggested that oral administration of B. subtilis BS02 or B. subtilis natto BS04 could significantly enhance cellular immunity in BALB/C mice by increasing phagocytic activity of MPS and cytotoxic activity of NK cells in a strain-specific manner.
Hodge, D.L.; Subleski, J.J.; Reynolds, D.A.; Buschman, M.D.; Schill, W.B.; Burkett, M.W.; Malyguine, A.M.; Young, H.A.
2006-01-01
The proinflammatory cytokine, interleukin-18 (IL-18), is a natural killer (NK) cell activator that induces NK cell cytotoxicity and interferon-?? (IFN-??) expression. In this report, we define a novel role for IL-18 as an NK cell protective agent. Specifically, IL-18 prevents NK cell death initiated by different and distinct stress mechanisms. IL-18 reduces NK cell self-destruction during NK-targeted cell killing, and in the presence of staurosporin, a potent apoptotic inducer, IL-18 reduces caspase-3 activity. The critical regulatory step in this process is downstream of the mitochondrion and involves reduced cleavage and activation of caspase-9 and caspase-3. The ability of IL-18 to regulate cell survival is not limited to a caspase death pathway in that IL-18 augments tumor necrosis factor (TNF) signaling, resulting in increased and prolonged mRNA expression of c-apoptosis inhibitor 2 (cIAP2), a prosurvival factor and caspase-3 inhibitor, and TNF receptor-associated factor 1 (TRAF1), a prosurvival protein. The cumulative effects of IL-18 define a novel role for this cytokine as a molecular survival switch that functions to both decrease cell death through inhibition of the mitochondrial apoptotic pathway and enhance TNF induction of prosurvival factors. ?? Mary Ann Liebert, Inc.
Hecker, Michael; Thamilarasan, Madhan; Koczan, Dirk; Schröder, Ina; Flechtner, Kristin; Freiesleben, Sherry; Füllen, Georg; Thiesen, Hans-Jürgen; Zettl, Uwe Klaus
2013-01-01
MicroRNAs (miRNAs) are small non-coding RNA molecules acting as post-transcriptional regulators of gene expression. They are involved in many biological processes, and their dysregulation is implicated in various diseases, including multiple sclerosis (MS). Interferon-beta (IFN-beta) is widely used as a first-line immunomodulatory treatment of MS patients. Here, we present the first longitudinal study on the miRNA expression changes in response to IFN-beta therapy. Peripheral blood mononuclear cells (PBMC) were obtained before treatment initiation as well as after two days, four days, and one month, from patients with clinically isolated syndrome (CIS) and patients with relapsing-remitting MS (RRMS). We measured the expression of 651 mature miRNAs and about 19,000 mRNAs in parallel using real-time PCR arrays and Affymetrix microarrays. We observed that the up-regulation of IFN-beta-responsive genes is accompanied by a down-regulation of several miRNAs, including members of the mir-29 family. These differentially expressed miRNAs were found to be associated with apoptotic processes and IFN feedback loops. A network of miRNA-mRNA target interactions was constructed by integrating the information from different databases. Our results suggest that miRNA-mediated regulation plays an important role in the mechanisms of action of IFN-beta, not only in the treatment of MS but also in normal immune responses. miRNA expression levels in the blood may serve as a biomarker of the biological effects of IFN-beta therapy that may predict individual disease activity and progression. PMID:23921681
Psychosocial predictors of natural killer cell mobilization during marital conflict.
Miller, G E; Dopp, J M; Myers, H F; Stevens, S Y; Fahey, J L
1999-05-01
This study examined how specific emotions relate to autonomic nervous and immune system parameters and whether cynical hostility moderates this relationship. Forty-one married couples participated in a 15-min discussion about a marital problem. Observers recorded spouses' emotional expressions during the discussion, and cardiovascular, neuroendocrine, and immunologic parameters were assessed throughout the laboratory session. Among men high in cynical hostility, anger displayed during the conflict was associated with greater elevations in systolic and diastolic blood pressure, cortisol, and increases in natural killer cell numbers and cytotoxicity. Among men low in cynical hostility, anger was associated with smaller increases in heart rate and natural killer cell cytotoxicity. These findings suggest that models describing the impact of stress on physiology should be refined to reflect the joint contribution of situational and dispositional variables.
Adjuvant immunotherapy of feline fibrosarcoma with recombinant feline interferon-omega.
Hampel, Verena; Schwarz, Bianca; Kempf, Christine; Köstlin, Roberto; Schillinger, Ulrike; Küchenhoff, Helmut; Fenske, Nora; Brill, Thomas; Hirschberger, Johannes
2007-01-01
Recombinant feline interferon-omega (rFeIFN-omega) was tested as a treatment option for cats with fibrosarcoma to assess safety and feasibility. Treatment with rFeIFN-omega in cats with fibrosarcoma is safe and feasible. Twenty domestic cats. In an open-labeled uncontrolled clinical trial 12 injections of 1 x 10(6) U/kg rFeIFN-omega were administered over a 5-week period: the 1st through 4th injections were given intratumorally, and the 5th through 12th injections were administered subcutaneously at the tumor excision site. Wide surgical excision of the tumors was carried out after the 4th injection and before the 5th injection of rFeIFN-omega. A Common Terminology Criteria for Adverse Events (CTCAE) analysis was conducted. Flow cytometry of fibrosarcoma cells after incubation with rFeIFN-omega and recombinant feline interferon-gamma was performed to assess the biological effect of rFeIFN-omega. Changes in blood cell count, increases in serum aspartate-amino-transferase activity, serum bilirubin concentration, serum creatinine and serum electrolyte concentrations, weight loss, anorexia, increased body temperature, and reduced general condition were observed but were mostly minor (grade 1 and 2) and self limiting. Eosinophilia (P = .025), neutropenia (P = .021), and weight loss (P < .001) were statistically correlated with rFeIFN-omega-treatment (analysis of parameters before treatment and after 3 injections of rFeIFN-omega). Flow cytometry of 5 unrelated feline fibrosarcoma cell lines showed increased expression of major histocompatibility complex (MHC) class I molecules (P = .026) in response to in vitro incubation with rFeIFN-omega, whereas expression of MHC class II molecules was not affected significantly. RFeIFN-omega for the treatment of feline fibrosarcoma is safe, well tolerated, and can be easily performed in practice. To assess the efficacy of the treatment, it should be tested in a placebo-controlled trial.
Georgieva, Svetlana; Popov, Borislav; Bonev, Georgi
2013-01-01
Different concentrations of H. rhodopensis total extract (HRE; 0.03, 0.06 and 0.12 g/kg body weight) were injected im, into rabbits 2 h before collecting the blood samples. The whole blood samples were exposed in vitro to 2.0 Gy 60Co gamma-radiation. The radiation-induced changes were estimated by using the chromosome aberration test (CA) and cytokinesis blocked micronucleus assay (CBMN) in peripheral lymphocytes, and by determining the malondialdehyde levels (MDA) in blood plasma and the superoxide dismutase (SOD) and catalase (CAT) activity in erythrocytes. Radiation significantly increased the chromosome aberration and micronuclei frequencies as well as MDA levels and decreased the antioxidant enzyme activity. On the other hand, the HRE pretreatment significantly decreased the CA, MN frequencies and MDA levels and increased the SOD and CAT activity in a concentration dependent manner. The most effective was the highest concentration of HRE (0.12 g/kg body weight). The results suggest that HRE as a natural product with a nantioxidant capacity could play a modulatory role against the cellular damage induced by gamma-irradiation. The possible mechanism involved in the radioprotective potential of HRE is discussed.
Gamma Band Activity in the RAS-intracellular mechanisms
Garcia-Rill, E.; Kezunovic, N.; D’Onofrio, S.; Luster, B.; Hyde, J.; Bisagno, V.; Urbano, F.J.
2014-01-01
Gamma band activity participates in sensory perception, problem solving, and memory. This review considers recent evidence showing that cells in the reticular activating system (RAS) exhibit gamma band activity, and describes the intrinsic membrane properties behind such manifestation. Specifically, we discuss how cells in the mesopontine pedunculopontine nucleus (PPN), intralaminar parafascicular nucleus (Pf), and pontine Subcoeruleus nucleus dorsalis (SubCD) all fire in the gamma band range when maximally activated, but no higher. The mechanisms involve high threshold, voltage-dependent P/Q-type calcium channels or sodium-dependent subthreshold oscillations. Rather than participating in the temporal binding of sensory events as in the cortex, gamma band activity in the RAS may participate in the processes of preconscious awareness, and provide the essential stream of information for the formulation of many of our actions. We address three necessary next steps resulting from these discoveries, an intracellular mechanism responsible for maintaining gamma band activity based on persistent G-protein activation, separate intracellular pathways that differentiate between gamma band activity during waking vs during REM sleep, and an intracellular mechanism responsible for the dysregulation in gamma band activity in schizophrenia. These findings open several promising research avenues that have not been thoroughly explored. What are the effects of sleep or REM sleep deprivation on these RAS mechanisms? Are these mechanisms involved in memory processing during waking and/or during REM sleep? Does gamma band processing differ during waking vs REM sleep after sleep or REM sleep deprivation? PMID:24309750
Gamma band activity in the RAS-intracellular mechanisms.
Garcia-Rill, E; Kezunovic, N; D'Onofrio, S; Luster, B; Hyde, J; Bisagno, V; Urbano, F J
2014-05-01
Gamma band activity participates in sensory perception, problem solving, and memory. This review considers recent evidence showing that cells in the reticular activating system (RAS) exhibit gamma band activity, and describes the intrinsic membrane properties behind such manifestation. Specifically, we discuss how cells in the mesopontine pedunculopontine nucleus, intralaminar parafascicular nucleus, and pontine SubCoeruleus nucleus dorsalis all fire in the gamma band range when maximally activated, but no higher. The mechanisms involve high-threshold, voltage-dependent P/Q-type calcium channels, or sodium-dependent subthreshold oscillations. Rather than participating in the temporal binding of sensory events as in the cortex, gamma band activity in the RAS may participate in the processes of preconscious awareness and provide the essential stream of information for the formulation of many of our actions. We address three necessary next steps resulting from these discoveries: an intracellular mechanism responsible for maintaining gamma band activity based on persistent G-protein activation, separate intracellular pathways that differentiate between gamma band activity during waking versus during REM sleep, and an intracellular mechanism responsible for the dysregulation in gamma band activity in schizophrenia. These findings open several promising research avenues that have not been thoroughly explored. What are the effects of sleep or REM sleep deprivation on these RAS mechanisms? Are these mechanisms involved in memory processing during waking and/or during REM sleep? Does gamma band processing differ during waking versus REM sleep after sleep or REM sleep deprivation?
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ismail, Asaad H.; Yaba, Sardar P.; Ismail, Haider J.
An impact of alpha and gamma irradiation on human blood components have been evaluated and compared for healthy blood samples (male and females). Irradiation dose and time of irradiation calibrated and considered as a main comparison factors. Density of blood components measured for each in vitro irradiation before and after irradiation for males and females. Survey radiation dosimeter (Inspector Exp) and nuclear track detectors type CR-39 used to evaluate exposure dose rate and incident density of alpha particles, respectively. Experiment results verified that the irradiation of blood makes ionizing of blood components, either alpha or gamma irradiation dose, and themore » impacts of ionizing radiation were relativity for WBC, RBC, and PLT. Limited irradiation doses of 1-5 μSv/hr considered as a low radiation dose of alpha and gamma radiation sources ({sup 226}Ra, and {sup 137}Cs). Density of alpha particles accumulated on the blood surface was 34 (alpha particle/cm{sup 2}) for selected dose of incident alpha particle. Optimum value of irradiation dose and time of irradiation were 5 μSv/hr and 4 second for males and females. On the other hands, the values of irradiation dose and time of irradiation were 2.1 μSv/hr and 2 second for males and females for gamma irradiation. Thus, present results demonstrated that densities of RBC and WBC cells are capable of inducing reproduction in vitro for both type of irradiation. (authors)« less
Wilden, Holger; Schirrmacher, Volker; Fournier, Philippe
2011-08-01
Newcastle disease virus (NDV) is an interesting agent for activating innate immune activity in macrophages including secretion of TNF-α and IFN-α, upregulation of TRAIL and activation of NF-κB and iNOS. However, the molecular mechanism of such cellular activities remains largely unknown. Tumor selectivity of replication of NDV has been described to be linked to deviations in tumor cells of the type I interferon response. We therefore focused on the interferon response to NDV of macrophages as part of innate anti-viral and anti-tumor activity. In particular, we investigated the functional significance of the interferon regulatory factor genes (IRF)-3 and IRF-7. Deletion of the IRF-3 or IRF-7 gene was found to increase susceptibility of mouse macrophages to virus infection. Surprisingly, NDV replicated better in IRF-3 KO than in IRF-7 KO macrophages. Further analysis showed that IRF-3 KO macrophages have a lower basal and NDV-induced RIG-I expression in comparison to IRF-7 KO macrophages. This might explain why, in IRF-3 KO macrophages, the secretion of type I interferons after NDV infection is delayed, when compared to IRF-7 KO and wild-type macrophages. In addition, IRF-3 KO cells showed reduced NDV-induced levels of IRF-7. This effect could be prevented by priming the cells first by interferon-α. Further results indicated that an early production of type I interferon rather than high maximal levels at later time points are important for resistance to infection by NDV. In conclusion, these results demonstrate an important role of IRF-3 for the innate anti-viral response to NDV of mouse macrophages.
Chuke, Stella O; Yen, Nguyen Thi Ngoc; Laserson, Kayla F; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G; Whitworth, William C; Shah, J Jina; Painter, John A; Mazurek, Gerald H; Maloney, Susan A
2014-01-01
Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB.
Roliński, Jacek; Grywalska, Ewelina; Pyzik, Aleksandra; Dzik, Michał; Opoka-Winiarska, Violetta; Surdacka, Agata; Maj, Maciej; Burdan, Franciszek; Pirożyński, Michał; Grabarczyk, Piotr; Starosławska, Elżbieta
2018-04-20
Chronic active Epstein-Barr virus (EBV) disease (CAEBV) is defined as a severe, progressive lymphoproliferative disorder associated with active EBV infection persisting longer than 6 months and developing in patients without recognised immunodeficiency. Rarely, interstitial pneumonitis (IP) occurs as a serious complication in CAEBV patients. The standard therapeutic regimen for IP in CAEBV has not yet been defined. Although interferon alpha (IFN-alpha) is known to suppress viral DNA replication by affecting its basal promoter activation process, it is rarely used in CAEBV patients. A 22-year-old Caucasian woman, diagnosed with CAEBV 1.5 years earlier, was admitted to the Immunology Clinic due to a 4-week history of productive cough, fever and general weakness. Cultures of blood, urine and sputum were negative, but EBV DNA copies were found in the sputum, whole blood, isolated peripheral blood lymphocytes as well as in the blood plasma. Cytokine assessment in peripheral blood revealed the lack of IFN-alpha synthesis. Disseminated maculate infiltrative areas in both lungs were observed on a computed tomography (CT) chest scan. The patient was not qualified for the allogeneic hematopoietic stem cell transplantation (allo-HSCT) due to the risk of immunosuppression-related complications of infectious IP. Inhaled (1.5 million units 3 times a day) and subcutaneous (6 million units 3 times a week) IFN-alpha was implemented. To the best of our knowledge, this was the first documented use of inhaled IFN-alpha in a patient with CAEBV and concomitant IP. Patient's status has improved, and she was eventually qualified to allo-HSCT with reduced conditioning. Currently, the patient feels well, no EBV was detected and further regression of pulmonary changes was documented. CAEBV should be considered in patients who present with interstitial lung infiltration and involvement of other organs. Although more promising results have been obtained with allo-HSCT, inhaled IFN-alpha may
Li, Ya-Jun; Yi, Ping-Yong; Li, Ji-Wei; Liu, Xian-Ling; Tang, Tian; Zhang, Pei-Ying; Jiang, Wen-Qi
2017-07-31
The prognostic significance of ABO blood type for lymphoma is largely unknown. We evaluated the prognostic role of ABO blood type in patients with extranodal natural killer (NK)/T-cell lymphoma (ENKTL). We retrospectively analyzed clinical data of 697 patients with newly diagnosed ENKTL from three cancer centers. The prognostic value of ABO blood type was evaluated using Kaplan-Meier curves and Cox proportional hazard models. The prognostic values of the International Prognostic Index (IPI) and the Korean Prognostic Index (KPI) were also evaluated. Compared with patients with blood type O, those with blood type non-O tended to display elevated baseline serum C-reactive protein levels (P = 0.038), lower rate of complete remission (P = 0.005), shorter progression-free survival (PFS, P < 0.001), and shorter overall survival (OS, P = 0.001). Patients with blood type O/AB had longer PFS (P < 0.001) and OS (P = 0.001) compared with those with blood type A/B. Multivariate analysis demonstrated that age >60 years (P < 0.001), mass ≥5 cm (P = 0.001), stage III/IV (P < 0.001), elevated serum lactate dehydrogenase (LDH) levels (P = 0.001), and blood type non-O were independent adverse predictors of OS (P = 0.001). ABO blood type was found to be superior to both the IPI in discriminating patients with different outcomes in the IPI low-risk group and the KPI in distinguishing between the intermediate-to-low- and high-to-intermediate-risk groups. ABO blood type was an independent predictor of clinical outcome for patients with ENKTL.
Cui, Junqing; Watanabe, Naohiro; Kawano, Tetsu; Yamashita, Masakatsu; Kamata, Tohru; Shimizu, Chiori; Kimura, Motoko; Shimizu, Eiko; Koike, Jyunzo; Koseki, Haruhiko; Tanaka, Yujiro; Taniguchi, Masaru; Nakayama, Toshinori
1999-01-01
Murine Vα14 natural killer T (NKT) cells are thought to play a crucial role in various immune responses, including infectious, allergic, and autoimmune diseases. Because Vα14 NKT cells produce large amounts of both interleukin (IL)-4 and interferon (IFN)-γ upon in vivo stimulation with a specific ligand, α-galactosylceramide (α-GalCer), or after treatment with anti-CD3 antibody, a regulatory role on helper T (Th) cell differentiation has been proposed for these cells. However, the identity of the cytokine produced by Vα14 NKT cells that play a dominant role on the Th cell differentiation still remains controversial. Here, we demonstrate by using Vα14 NKT-deficient mice that Vα14 NKT cells are dispensable for the induction of antigen-specific immunoglobulin (Ig)E responses induced by ovalbumin immunization or Nippostrongylus brasiliensis infection. However, upon in vivo activation with α-GalCer, Vα14 NKT cells are found to suppress antigen-specific IgE production. The suppression appeared to be IgE specific, and was not detected in either Vα14 NKT– or IFN-γ–deficient mice. Consistent with these results, we also found that ligand-activated Vα14 NKT cells inhibited Th2 cell differentiation in an in vitro induction culture system. Thus, it is likely that activated Vα14 NKT cells exert a potent inhibitory effect on Th2 cell differentiation and subsequent IgE production by producing a large amount of IFN-γ. In marked contrast, our studies have revealed that IL-4 produced by Vα14 NKT cells has only a minor effect on Th2 cell differentiation. PMID:10499917
Protective Role of Gamma Interferon during the Recall Response to Influenza Virus
Bot, Adrian; Bot, Simona; Bona, Constantin A.
1998-01-01
During secondary immune responses to influenza virus, virus-specific T memory cells are a major source of gamma interferon (IFN-γ). We assessed the contribution of IFN-γ to heterologous protection against the A/WSN/33 (H1N1) virus of wild-type and IFN-γ−/− mice previously immunized with the A/HK/68 (H3N2) virus. The IFN-γ−/− mice displayed significantly reduced survival rates subsequent to a challenge with various doses of the A/WSN/33 virus. This was associated with an impaired ability of the IFN-γ−/− mice to completely clear the pulmonary virus by day 7 after the challenge, although significant reduction of the virus titers was noted. However, the IFN-γ−/− mice developed type A influenza virus cross-reactive cytotoxic T lymphocytes (CTLs) similar to the wild-type mice, as demonstrated by both cytotoxicity and a limiting-dilution assay for the estimation of CTL precursor frequency. The pulmonary recruitment of T cells in IFN-γ−/− mice was not dramatically affected, and the percentage of CD4+ and CD8+ T cells was similar to that of wild-type mice. The T cells from IFN-γ−/− mice did not display a significant switch toward a Th2 profile. Furthermore, the IFN-γ−/− mice retained the ability to mount significant titers of WSN and HK virus-specific hemagglutination-inhibiting antibodies. Together, these results are consistent with a protective role of IFN-γ during the heterologous response against influenza virus independently of the generation and local recruitment of cross-reactive CTLs. PMID:9658110
Freeman, J; Baglino, S; Friborg, J; Kraft, Z; Gray, T; Hill, M; McPhee, F; Hillson, J; Lopez-Talavera, J C; Wind-Rotolo, M
2014-06-01
Pegylated interferon-lambda-1a (Lambda), a type III interferon (IFN) in clinical development for the treatment of chronic HCV infection, has shown comparable efficacy and an improved safety profile to a regimen based on pegylated IFN alfa-2a (alfa). To establish a mechanistic context for this improved profile, we investigated the ex vivo effects of Lambda and alfa on cytokine and chemokine release, and on expression of IFN-stimulated genes (ISGs) in primary human hepatocytes and peripheral blood mononuclear cells (PBMCs) from healthy subjects. Our findings were further compared with changes observed in blood analysed from HCV-infected patients treated with Lambda or alfa in clinical studies. mRNA transcript and protein expression of the IFN-λ-limiting receptor subunit was lower compared with IFN-α receptor subunits in all cell types. Upon stimulation, alfa and Lambda induced ISG expression in hepatocytes and PBMCs, although in PBMCs Lambda-induced ISG expression was modest. Furthermore, alfa and Lambda induced release of cytokines and chemokines from hepatocytes and PBMCs, although differences in their kinetics of induction were observed. In HCV-infected patients, alfa treatment induced ISG expression in whole blood after single and repeat dosing. Lambda treatment induced modest ISG expression after single dosing and showed no induction after repeat dosing. Alfa and Lambda treatment increased IP-10, iTAC, IL-6, MCP-1 and MIP-1β levels in serum, with alfa inducing higher levels of all mediators compared with Lambda. Overall, ex vivo and in vivo induction profiles reported in this analysis strongly correlate with clinical observations of fewer related adverse events for Lambda vs those typically associated with alfa. © 2014 John Wiley & Sons Ltd.
Tenforde, Mark W.; Gupte, Nikhil; Dowdy, David W.; Asmuth, David M.; Balagopal, Ashwin; Pollard, Richard B.; Sugandhavesa, Patcharaphan; Lama, Javier R.; Pillay, Sandy; Cardoso, Sandra W.; Pawar, Jyoti; Santos, Breno; Riviere, Cynthia; Mwelase, Noluthando; Kanyama, Cecilia; Kumwenda, Johnstone; Hakim, James G.; Kumarasamy, Nagalingeswaran; Bollinger, Robert; Semba, Richard D.; Campbell, Thomas B.; Gupta, Amita
2015-01-01
Objective The association between pre-antiretroviral (ART) inflammation and immune activation and risk for incident tuberculosis (TB) after ART initiation among adults is uncertain. Design Nested case-control study (n = 332) within ACTG PEARLS trial of three ART regimens among 1571 HIV-infected, treatment-naïve adults in 9 countries. We compared cases (participants with incident TB diagnosed by 96 weeks) to a random sample of controls (participants who did not develop TB, stratified by country and treatment arm). Methods We measured pre-ART C-reactive protein (CRP), EndoCab IgM, ferritin, interferon gamma (IFN-γ), interleukin 6 (IL-6), interferon gamma-inducible protein 10 (IP-10), lipopolysaccharide (LPS), soluble CD14 (sCD14), tumor necrosis factor alpha (TNF-α), and CD4/DR+/38+ and CD8/DR+/38+ T cells. Markers were defined according to established cutoff definitions when available, 75th percentile of measured values when not, and detectable versus undetectable for LPS. Using logistic regression, we measured associations between biomarkers and incident TB, adjusting for age, sex, study site, treatment arm, baseline CD4 and log10 viral load. We assessed the discriminatory value of biomarkers using receiver operating characteristic (ROC) analysis. Results Seventy-seven persons (4.9%) developed incident TB during follow-up. Elevated baseline CRP (aOR 3.25, 95% CI: 1.55–6.81) and IP-10 (aOR 1.89, 95% CI: 1.05–3.39), detectable plasma LPS (aOR 2.39, 95% CI: 1.13–5.06), and the established TB risk factors anemia and hypoalbuminemia were independently associated with incident TB. In ROC analysis, CRP, albumin, and LPS improved discrimination only modestly for TB risk when added to baseline routine patient characteristics including CD4 count, body mass index, and prior TB. Conclusion Incident TB occurs commonly after ART initiation. Although associated with higher post-ART TB risk, baseline CRP, IP-10, and LPS add limited value to routine patient characteristics
The DNA methylation profile of activated human natural killer cells.
Wiencke, John K; Butler, Rondi; Hsuang, George; Eliot, Melissa; Kim, Stephanie; Sepulveda, Manuel A; Siegel, Derick; Houseman, E Andres; Kelsey, Karl T
2016-05-03
Natural killer (NK) cells are now recognized to exhibit characteristics akin to cells of the adaptive immune system. The generation of adaptive memory is linked to epigenetic reprogramming including alterations in DNA methylation. The study herein found reproducible genome wide DNA methylation changes associated with human NK cell activation. Activation led predominately to CpG hypomethylation (81% of significant loci). Bioinformatics analysis confirmed that non-coding and gene-associated differentially methylated sites (DMS) are enriched for immune related functions (i.e., immune cell activation). Known DNA methylation-regulated immune loci were also identified in activated NK cells (e.g., TNFA, LTA, IL13, CSF2). Twenty-one loci were designated high priority and further investigated as potential markers of NK activation. BHLHE40 was identified as a viable candidate for which a droplet digital PCR assay for demethylation was developed. The assay revealed high demethylation in activated NK cells and low demethylation in naïve NK, T- and B-cells. We conclude the NK cell methylome is plastic with potential for remodeling. The differentially methylated region signature of activated NKs revealed similarities with T cell activation, but also provided unique biomarker candidates of NK activation, which could be useful in epigenome-wide association studies to interrogate the role of NK subtypes in global methylation changes associated with exposures and/or disease states.
Conservation Status of Killer Whales, Orcinus orca, in the Strait of Gibraltar.
Esteban, R; Verborgh, P; Gauffier, P; Alarcón, D; Salazar-Sierra, J M; Giménez, J; Foote, A D; de Stephanis, R
Killer whales (Orcinus orca) in the Mediterranean Sea are currently restricted to the Strait of Gibraltar and surrounding waters. Thirty-nine individuals were present in 2011, with a well-differentiated social structure, organized into five pods. Killer whale occurrence in the Strait is apparently related to the migration of their main prey, Atlantic bluefin tuna (Thunnus thynnus). In spring, whale distribution was restricted to shallow waters off the western coast of the Strait where all pods were observed actively hunting tuna. In summer, the whales were observed in the shallow central waters of the Strait. A relatively new feeding strategy has been observed among two of the five pods. These two pods interact with an artisanal drop-line fishery. Pods depredating the fishery had access to larger tuna in comparison with pods that were actively hunting. The Strait of Gibraltar killer whales are socially and ecologically different from individuals in the Canary Islands. Molecular genetic research has indicated that there is little or no female-mediated gene migration between these areas. Conservation threats include small population size, prey depletion, vessel traffic, and contaminants. We propose the declaration of the Strait of Gibraltar killer whales as an endangered subpopulation. A conservation plan to protect the Strait of Gibraltar killer whales is urgently needed, and we recommend implementation of a seasonal management area where activities producing underwater noise are restricted, and the promotion of bluefin tuna conservation. © 2016 Elsevier Ltd. All rights reserved.
Feng, Xuan; Han, Diana; Kilaru, Bharat K.; Franek, Beverly S.; Niewold, Timothy B.; Reder, Anthony T.
2014-01-01
Objective To determine whether statins affect type 1 interferon responses in relapsing-remitting multiple sclerosis (RRMS). Design Study effects of atorvastatin on type 1 interferon responses in Jurkat cells, mononuclear cells (MNCs) from therapy-naive patients with RRMS in vitro, and MNCs from interferon-treated RRMS patients in vivo in 4 conditions: no drug, statin only, interferon-beta only, and statin added on to interferon-beta therapy. Patients The study examined clinically stable patients with RRMS: 21 therapy-naive patients and 14 patients receiving interferon-beta with a statin. Interventions Statin effects on in vitro and in vivo interferon-beta–induced STAT1 transcription factor activation, expression of interferon-stimulated proteins in MNCs, and serum type 1 interferon activity. Results In vitro, atorvastatin dose dependently inhibited expression of interferon-stimulated P-Y-STAT1 by 44% (P< .001), interferon regulatory factor 1 protein by 30% (P= .006), and myxovirus resistance 1 protein by 32% (P=.004) compared with no-statin control in MNCs from therapy-naive RRMS patients. In vivo, 9 of 10 patients who received high-dose statins (80 mg) had a significant reduction in interferon-beta therapy–induced serum interferon-α/β activity, whereas only 2 of 4 patients who received medium-dose statins (40 mg) had reductions. High-dose add-on statin therapy significantly blocked interferon-beta function, with less P-Y-STAT1 transcription factor activation, and reduced myxovirus resistance 1 protein and viperin protein production. Medium doses of statins did not change STAT1 activation. Conclusions High-dose add-on statin therapy significantly reduces interferon-beta function and type 1 interferon responses in RRMS patients. These data provide a putative mechanism for how statins could counteract the beneficial effects of interferon-beta and worsen disease. PMID:22801747
Li, Qiuling; Weng, Kaizhi; Zhu, Ling; Mei, Xuqiao; Xu, Liping; Lin, Jiehua
2014-10-01
To detect the percentage of total natural killer (NK) cells and its different populations in the peripheral blood from neonates with bacterial pneumonia and discuss the clinical significance of NK cells in the pathogenesis of bacterial pneumonia. Flow cytometry was performed to detect the percentages of NK cells and its subsets in peripheral blood lymphocytes from 38 cases of neonatal bacterial pneumonias and 18 cases of normal neonates. Patients recruited were divided into two groups according to hospitalization days and numbers of peripheral leukocytes: hospitalization days within 10 days (including 10 days) as group A, and more than 10 days as group B; the number of peripheral blood leukocytes <5.0×10(9)/L or >20.0×10(9)/L as severe infection group, and 5.0×10(9)/L< number of peripheral blood leukocytes <20.0×10(9)/L as mild infection group. The percentages of peripheral blood NK cells and CD3(-)CD56(neg)CD16(bright) subset in the neonates with bacterial pneumonia were significantly lower than those of the normal newborns (P<0.01), but there were no statistically significant differences in CD3(-)CD56(bright)CD16(neg/dim) and CD3(-)CD56(dim)CD16(bright) subsets. The percentage of CD3(-)CD56(neg)CD16(bright) subset in group A was significantly lower than that of the normal newborns (P<0.01), while the percentages of the total NK cells and other subsets had no statistical significance. The neonates with bacterial pneumonia had significantly lower percentages of the total NK cells and CD3(-)CD56(neg)CD16(bright) subset in group B as compared with the normal neonates (P<0.01). And the percentages of the total NK cells and its subsets in group B were also lower than those in group A (P<0.05). The percentages of NK cells and each subset in severe infection group were significantly lower than those in mild infection group (P<0.05). To the neonates who suffer from bacterial pneumonia, the more serious and the longer hospital stay, the lower the percentages of NK
Bartolo, M J; Gieselmann, M A; Vuksanovic, V; Hunter, D; Sun, L; Chen, X; Delicato, L S; Thiele, A
2011-01-01
The functional magnetic resonance imaging (fMRI) blood oxygenation level-dependent (BOLD) signal is regularly used to assign neuronal activity to cognitive function. Recent analyses have shown that the local field potential (LFP) gamma power is a better predictor of the fMRI BOLD signal than spiking activity. However, LFP gamma power and spiking activity are usually correlated, clouding the analysis of the neural basis of the BOLD signal. We show that changes in LFP gamma power and spiking activity in the primary visual cortex (V1) of the awake primate can be dissociated by using grating and plaid pattern stimuli, which differentially engage surround suppression and cross-orientation inhibition/facilitation within and between cortical columns. Grating presentation yielded substantial V1 LFP gamma frequency oscillations and significant multi-unit activity. Plaid pattern presentation significantly reduced the LFP gamma power while increasing population multi-unit activity. The fMRI BOLD activity followed the LFP gamma power changes, not the multi-unit activity. Inference of neuronal activity from the fMRI BOLD signal thus requires detailed a priori knowledge of how different stimuli or tasks activate the cortical network. PMID:22081989
El Eit, Rabab M; Iskandarani, Ahmad N; Saliba, Jessica L; Jabbour, Mark N; Mahfouz, Rami A; Bitar, Nizar M A; Ayoubi, Hanadi R El; Zaatari, Ghazi S; Mahon, Francois-Xavier; De Thé, Hugues B; Bazarbachi, Ali A; Nasr, Rihab R
2014-02-15
Imatinib is the standard of care in chronic meloid leukemia (CML) therapy. However, imatinib is not curative since most patients who discontinue therapy relapse indicating that leukemia initiating cells (LIC) are resistant. Interferon alpha (IFN) induces hematologic and cytogenetic remissions and interestingly, improved outcome was reported with the combination of interferon and imatinib. Arsenic trioxide was suggested to decrease CML LIC. We investigated the effects of arsenic and IFN on human CML cell lines or primary cells and the bone marrow retroviral transduction/transplantation murine CML model. In vitro, the combination of arsenic and IFN inhibited proliferation and activated apoptosis. Importantly, arsenic and IFN synergistically reduced the clonogenic activity of primary bone marrow cells derived from CML patients. Finally, in vivo, combined interferon and arsenic treatment, but not single agents, prolonged the survival of primary CML mice. Importantly, the combination severely impaired engraftment into untreated secondary recipients, with some recipients never developing the disease, demonstrating a dramatic decrease in CML LIC activity. Arsenic/IFN effect on CML LIC activity was significantly superior to that of imatinib. These results support further exploration of this combination, alone or with imatinib aiming at achieving CML eradication rather than long-term disease control. © 2013 UICC.
DOE Office of Scientific and Technical Information (OSTI.GOV)
el-Mofty, M.M.; Sakr, S.A.; Younis, M.W.
Bed bugs, Cimex lectularius, irradiated with gamma rays were allowed to suck blood from shaved areas of the skin of rabbits, Oryctolagus cuniculus, 2 times/week for 5 months and then once weekly for another 5 months. This significantly induced the formation of skin papillomas and sweat gland hyperplasia in five out of nine experimental animals. It is speculated that the saliva of the irradiated bugs was activated by gamma rays and was responsible for the induction of skin papillomas. Because bed bugs play a significant role in the transmission of virus, it is also speculated that there is a virusmore » in the saliva of bugs; this virus may be activated by gamma radiation and causes the development of papillomas in the skin.« less
Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu
2008-08-01
The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.
Clausen, Johannes; Kircher, Brigitte; Auberger, Jutta; Schumacher, Petra; Ulmer, Hanno; Hetzenauer, Gabriele; Wolf, Dominik; Gastl, Günther; Nachbaur, David
2010-02-01
The contribution of natural killer (NK) cells to graft-versus-malignancy (GVM) effects following hematopoietic stem cell transplantation (HSCT) remains uncertain, particularly in the HLA-identical setting. A model considering missing HLA ligands to the donor's inhibitory killer cell immunoglobulin-like receptor (KIR), termed the missing KIR ligand model, has been established in T cell depleted bone marrow transplantation (BMT), but lacks validity in other cohorts with different treatment characteristics. We hypothesized that the impact of missing KIR ligands on relapse-free survival (RFS) and overall survival (OS) in T cell replete peripheral blood SCT (PBSCT) differs from that in the T cell depleted BMT setting, and retrospectively evaluated 100 consecutive, HLA-identical sibling transplantations for hematologic malignancies. In addition to KIR ligand status, we considered the donors' activating KIRs and grafted NK, T, and CD34(+) cell doses. Our findings demonstrate noninferiority for OS (P = .005) and RFS (P = .002) for the heterozygous HLA-C group KIR ligand status (C1/2; n = 47) compared with patients missing either C1 or C2 (n = 53). Similarly, OS (P = .031) and RFS (P = .034) of Bw4-positive patients was noninferior to that of patients missing a Bw4 ligand to KIR3DL1. By multivariate analysis, C1/2 heterozygous patients had a favorable risk ratio (RR) for relapse (RR = 0.28; P = .003), RFS (RR = 0.56; P = .046), and acute graft-versus-host disease grade II-IV (RR = 0.36; P = .05). Following reduced-intensity conditioning (RIC), but not standard-intensity conditioning, myeloablative (MA) transplantation, a grafted NK cell dose above the median (3.4 x 10(7)/kg) was associated with a lower risk of relapse (RR = 0.57; P = .003) and improved survival (RR = 0.78; P = .03). Overall, our findings support a role for NK alloreactivity in HLA-identical HSCT, but argue against a favorable impact of missing KIR ligands in the given setting. We conclude that the mechanism
Chang, Ruey-Yi; Hsu, Ta-Wen; Chen, Yen-Lin; Liu, Shu-Fan; Tsai, Yi-Jer; Lin, Yun-Tong; Chen, Yi-Shiuan; Fan, Yi-Hsin
2013-09-27
Noncoding RNA (ncRNA) plays a critical role in modulating a broad range of diseases. All arthropod-borne flaviviruses produce short fragment ncRNA (sfRNA) collinear with highly conserved regions of the 3'-untranslated region (UTR) in the viral genome. We show that the molar ratio of sfRNA to genomic RNA in Japanese encephalitis virus (JEV) persistently infected cells is greater than that in acutely infected cells, indicating an sfRNA role in establishing persistent infection. Transfecting excess quantities of sfRNA into JEV-infected cells reduced interferon-β (IFN-β) promoter activity by 57% and IFN-β mRNA levels by 52%, compared to mock-transfected cells. Transfection of sfRNA into JEV-infected cells also reduced phosphorylation of interferon regulatory factor-3 (IRF-3), the IFN-β upstream regulator, and blocked roughly 30% of IRF-3 nuclear localization. Furthermore, JEV-infected sfRNA transfected cells produced 23% less IFN-β-stimulated apoptosis than mock-transfected groups did. Taken together, these results suggest that sfRNA plays a role against host-cell antiviral responses, prevents cells from undergoing apoptosis, and thus contributes to viral persistence. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Jeong, Hyeon-Ho; Erdene, Norov; Lee, Seung-Ki; Jeong, Dae-Hong; Park, Jae-Hyoung
2011-12-01
A fiber-optic localized surface plasmon (FO LSPR) sensor was fabricated by gold nanoparticles (Au NPs) immobilized on the end-face of an optical fiber. When Au NPs were formed on the end-face of an optical fiber by chemical reaction, Au NPs aggregation occurred and the Au NPs were immobilized in various forms such as monomers, dimers, trimers, etc. The component ratio of the Au NPs on the end-face of the fabricated FO LSPR sensor was slightly changed whenever the sensors were fabricated in the same condition. Including this phenomenon, the FO LSPR sensor was fabricated with high sensitivity by controlling the density of Au NPs. Also, the fabricated sensors were measured for the resonance intensity for the different optical systems and analyzed for the effect on sensitivity. Finally, for application as a biosensor, the sensor was used for detecting the antibody-antigen reaction of interferon-gamma.
Interferon Induced Transfer of Viral Resistance
1982-02-01
released from the cell membrane. We have also shown that CM’s activity is removed by a gelatin /sepharose affinity column which selectively binds...interferon preparation adsorbing to the WISH cells, interferon was subjected to gelatin /sepharose affinity chromatography to remove endogenous...caused an increase in the amount of H-.amnino acids incorporated into a gelatin binding protein, presumably fibronectin. This suggests that in addition to
Miller, Patrick J O
2006-05-01
Signal source intensity and detection range, which integrates source intensity with propagation loss, background noise and receiver hearing abilities, are important characteristics of communication signals. Apparent source levels were calculated for 819 pulsed calls and 24 whistles produced by free-ranging resident killer whales by triangulating the angles-of-arrival of sounds on two beamforming arrays towed in series. Levels in the 1-20 kHz band ranged from 131 to 168 dB re 1 microPa at 1 m, with differences in the means of different sound classes (whistles: 140.2+/-4.1 dB; variable calls: 146.6+/-6.6 dB; stereotyped calls: 152.6+/-5.9 dB), and among stereotyped call types. Repertoire diversity carried through to estimates of active space, with "long-range" stereotyped calls all containing overlapping, independently-modulated high-frequency components (mean estimated active space of 10-16 km in sea state zero) and "short-range" sounds (5-9 km) included all stereotyped calls without a high-frequency component, whistles, and variable calls. Short-range sounds are reported to be more common during social and resting behaviors, while long-range stereotyped calls predominate in dispersed travel and foraging behaviors. These results suggest that variability in sound pressure levels may reflect diverse social and ecological functions of the acoustic repertoire of killer whales.
(1-->6)-beta-D-glucan as cell wall receptor for Pichia membranifaciens killer toxin.
Santos, A; Marquina, D; Leal, J A; Peinado, J M
2000-05-01
The killer toxin from Pichia membranifaciens CYC 1106, a yeast isolated from fermenting olive brines, binds primarily to the (1-->6)-beta-D-glucan of the cell wall of a sensitive yeast (Candida boidinii IGC 3430). The (1-->6)-beta-D-glucan was purified from cell walls of C. boidinii by alkali and hot-acetic acid extraction, a procedure which solubilizes glucans. The major fraction of receptor activity remained with the alkali-insoluble (1-->6)-beta- and (1-->3)-beta-D-glucans. The chemical (gas-liquid chromatography) and structural (periodate oxidation, infrared spectroscopy, and (1)H nuclear magnetic resonance) analyses of the fractions obtained showed that (1-->6)-beta-D-glucan was a receptor. Adsorption of most of the killer toxin to the (1-->6)-beta-D-glucan was complete within 2 min. Killer toxin adsorption to the linear (1-->6)-beta-D-glucan, pustulan, and a glucan from Penicillium allahabadense was observed. Other polysaccharides with different linkages failed to bind the killer toxin. The specificity of the killer toxin for its primary receptor provides an effective means to purify the killer toxin, which may have industrial applications for fermentations in which salt is present as an adjunct, such as olive brines. This toxin shows its maximum killer activity in the presence of NaCl. This report is the first to identify the (1-->6)-beta-D-glucan as a receptor for this novel toxin.
Maloney, Nicole S.; Thackray, Larissa B.; Goel, Gautam; Hwang, Seungmin; Duan, Erning; Vachharajani, Punit; Xavier, Ramnik
2012-01-01
Noroviruses (NVs) cause the majority of cases of epidemic nonbacterial gastroenteritis worldwide and contribute to endemic enteric disease. However, the molecular mechanisms responsible for immune control of their replication are not completely understood. Here we report that the transcription factor interferon regulatory factor 1 (IRF-1) is required for control of murine NV (MNV) replication and pathogenesis in vivo. This led us to studies documenting a cell-autonomous role for IRF-1 in gamma interferon (IFN-γ)-mediated inhibition of MNV replication in primary macrophages. This role of IRF-1 in the inhibition of MNV replication by IFN-γ is independent of IFN-αβ signaling. While the signal transducer and activator of transcription STAT-1 was also required for IFN-γ-mediated inhibition of MNV replication in vitro, class II transactivator (CIITA), interferon regulatory factor 3 (IRF-3), and interferon regulatory factor 7 (IRF-7) were not required. We therefore hypothesized that there must be a subset of IFN-stimulated genes (ISGs) regulated by IFN-γ in a manner dependent only on STAT-1 and IRF-1. Analysis of transcriptional profiles of macrophages lacking various transcription factors confirmed this hypothesis. These studies identify a key role for IRF-1 in IFN-γ-dependent control of norovirus infection in mice and macrophages. PMID:22973039
Seo, Kwang Won; Ahn, Jong-Joon; Ra, Seung Won; Kwon, Woon-Jung; Jegal, Yangjin
2014-06-01
The interferon gamma (IFN-γ) release assays (IGRAs) are the best method of detecting Mycobacterium tuberculosis infection. However, reports on IGRAs results obtained during and right after the treatment of tuberculosis (TB) have presented differing results. Some studies have shown declining responses, whereas other reports described persistent, fluctuating, or increasing responses. We postulated that the IGRA-positivity will decrease or revert long time after treatment of TB, and thus, evaluated the response of IGRA in subjects with a history of pulmonary TB. Seventy subjects (M:F = 51:19; age = 53.2 ± 11.8 years) underwent tuberculin skin tests (TSTs) and IGRA. The interval of time elapsed after the completion of anti-TB treatment was < 10 years for 16 subjects, 10-20 years for 13 subjects, 20-30 years for 16 subjects, and ≥ 30 years for 25 subjects. The TST was positive in 49 subjects (74%) and negative in 17 subjects (26%). The IGRA was positive in 52 subjects (74%) and negative in 18 subjects (26%). The IFN-γ level and the size of induration showed good correlation (r = 0.525, P < 0.001). However, the correlation between time elapsed after the completion of anti-TB treatment and the size of induration or that between time and the IFN-γ level was not significant. The TST and IGRA were positive in 72.7% and 68.0% of subjects ≥ 30 years after the treatment of pulmonary TB. In conclusion, majority of subjects with a history of pulmonary TB are IGRA-positive, even a few decades after the completion of anti-TB treatment.
Hecker, M.; Preiss, C.; Klemm, P.; Busse, R.
1996-01-01
1. In view of the potential deleterious effects of high amounts of nitric oxide (NO) produced by the inducible isoform of NO synthase (iNOS) in inflammation, the prevention of the expression of this enzyme represents an important therapeutic goal. In cytokine-stimulated cells, activation of nuclear factor kappa B (NF-kappa B) is crucial for the increase in iNOS gene expression. Since NF-kappa B activation appears to involve a redox-sensitive step, we have investigated whether three structurally unrelated antioxidants, 5,7-dihydroxyflavone (chrysin), 3,4-dichloroisocoumarin (DCI) and N-acetyl 5-hydroxytryptamine (N-acetylserotonin, NAS), affect iNOS expression in cultured RAW 264.7 monocyte/macrophages stimulated with bacterial lipopolysaccharide (LPS, 140 ng ml-1) and interferon-gamma (IFN gamma, 5 u ml-1). 2. During a 6 h incubation period neither LPS nor IFN gamma alone exerted a significant effect but when combined, caused a prominent increase in nitrite formation, iNOS mRNA and protein abundance. Co-incubation with chrysin (50 microM), DCI (50 microM) or NAS (1 mM) markedly attenuated this increase in iNOS gene expression. 3. DCI, but not chrysin or NAS, prevented the activation of NF-kappa B in cells exposed to LPS plus IFN gamma for 30 min. In contrast, all three antioxidants significantly blunted the DNA-binding activity of interferon regulatory factor 1 (IRF-1), which mediates the synergistic effect of IFN gamma on iNOS gene expression in cells treated for 2 h with LPS plus IFN gamma. 4. DCI thus appears to inhibit iNOS gene expression at the transcriptional level by preventing the activation of both NF-kappa B and IRF-1. The inhibitory effect of DCI on NF-kappa B activation, however, does not seem to be related to its antioxidative properties, since DCI, unlike chrysin or NAS, is a potent serine protease inhibitor which stabilizes the inactive NF-kappa B complex by protecting the inhibitory I kappa B-alpha subunit from proteolytic degradation. 5. The
Shape-Shifted Red Blood Cells: A Novel Red Blood Cell Stage?
Chico, Verónica; Puente-Marin, Sara; Ciordia, Sergio; Mena, María Carmen; Carracedo, Begoña; Mercado, Luis; Coll, Julio
2018-01-01
Primitive nucleated erythroid cells in the bloodstream have long been suggested to be more similar to nucleated red cells of fish, amphibians, and birds than the red cells of fetal and adult mammals. Rainbow trout Ficoll-purified red blood cells (RBCs) cultured in vitro undergo morphological changes, especially when exposed to stress, and enter a new cell stage that we have coined shape-shifted RBCs (shRBCs). We have characterized these shRBCs using transmission electron microscopy (TEM) micrographs, Wright–Giemsa staining, cell marker immunostaining, and transcriptomic and proteomic evaluation. shRBCs showed reduced density of the cytoplasm, hemoglobin loss, decondensed chromatin in the nucleus, and striking expression of the B lymphocyte molecular marker IgM. In addition, shRBCs shared some features of mammalian primitive pyrenocytes (extruded nucleus surrounded by a thin rim of cytoplasm and phosphatidylserine (PS) exposure on cell surface). These shRBCs were transiently observed in heat-stressed rainbow trout bloodstream for three days. Functional network analysis of combined transcriptomic and proteomic studies resulted in the identification of proteins involved in pathways related to the regulation of cell morphogenesis involved in differentiation, cellular response to stress, and immune system process. In addition, shRBCs increased interleukin 8 (IL8), interleukin 1 β (IL1β), interferon ɣ (IFNɣ), and natural killer enhancing factor (NKEF) protein production in response to viral hemorrhagic septicemia virus (VHSV). In conclusion, shRBCs may represent a novel cell stage that participates in roles related to immune response mediation, homeostasis, and the differentiation and development of blood cells. PMID:29671811
Shape-Shifted Red Blood Cells: A Novel Red Blood Cell Stage?
Chico, Verónica; Puente-Marin, Sara; Nombela, Iván; Ciordia, Sergio; Mena, María Carmen; Carracedo, Begoña; Villena, Alberto; Mercado, Luis; Coll, Julio; Ortega-Villaizan, María Del Mar
2018-04-19
Primitive nucleated erythroid cells in the bloodstream have long been suggested to be more similar to nucleated red cells of fish, amphibians, and birds than the red cells of fetal and adult mammals. Rainbow trout Ficoll-purified red blood cells (RBCs) cultured in vitro undergo morphological changes, especially when exposed to stress, and enter a new cell stage that we have coined shape-shifted RBCs (shRBCs). We have characterized these shRBCs using transmission electron microscopy (TEM) micrographs, Wright⁻Giemsa staining, cell marker immunostaining, and transcriptomic and proteomic evaluation. shRBCs showed reduced density of the cytoplasm, hemoglobin loss, decondensed chromatin in the nucleus, and striking expression of the B lymphocyte molecular marker IgM. In addition, shRBCs shared some features of mammalian primitive pyrenocytes (extruded nucleus surrounded by a thin rim of cytoplasm and phosphatidylserine (PS) exposure on cell surface). These shRBCs were transiently observed in heat-stressed rainbow trout bloodstream for three days. Functional network analysis of combined transcriptomic and proteomic studies resulted in the identification of proteins involved in pathways related to the regulation of cell morphogenesis involved in differentiation, cellular response to stress, and immune system process. In addition, shRBCs increased interleukin 8 (IL8), interleukin 1 β (IL1β), interferon ɣ (IFNɣ), and natural killer enhancing factor (NKEF) protein production in response to viral hemorrhagic septicemia virus (VHSV). In conclusion, shRBCs may represent a novel cell stage that participates in roles related to immune response mediation, homeostasis, and the differentiation and development of blood cells.
Pérez de Val, Bernat; Vidal, Enric; López-Soria, Sergio; Marco, Alberto; Cervera, Zoraida; Martín, Maite; Mercader, Irene; Singh, Mahavir; Raeber, Alex; Domingo, Mariano
2016-02-10
Vaccination of domestic animals has emerged as an alternative long-term strategy for the control of tuberculosis (TB). A trial under field conditions was conducted in a TB-free goat herd to assess the safety of the Mycobacterium bovis BCG vaccine. Eleven kids and 10 milking goats were vaccinated with BCG. Bacterial shedding and interferon gamma (IFN-γ) responses were monitored throughout the study. Comprehensive pathological examination and mycobacterial culture of target tissues were performed. BCG vaccine strain was only isolated from the draining lymph node of the injection site of a kid euthanized at week 8 post-vaccination. The remaining animals were euthanized at week 24. Six out of 20 showed small granulomas at the injection site. BCG shedding was not detected in either faeces or in milk throughout the study. All vaccinated kids showed BCG-induced IFN-γ responses at week 8 post-vaccination. BCG vaccination of goats showed no lack of biological safety for the animals, environment and public health, and local adverse reactions were negligible. Copyright © 2016 Elsevier Ltd. All rights reserved.
The human immune response to tuberculosis and its treatment: a view from the blood
Cliff, Jacqueline M; Kaufmann, Stefan H E; McShane, Helen; van Helden, Paul; O'Garra, Anne
2015-01-01
The immune response upon infection with the pathogen Mycobacterium tuberculosis is poorly understood, hampering the discovery of new treatments and the improvements in diagnosis. In the last years, a blood transcriptional signature in tuberculosis has provided knowledge on the immune response occurring during active tuberculosis disease. This signature was absent in the majority of asymptomatic individuals who are latently infected with M. tuberculosis (referred to as latent). Using modular and pathway analyses of the complex data has shown, now in multiple studies, that the signature of active tuberculosis is dominated by overexpression of interferon-inducible genes (consisting of both type I and type II interferon signaling), myeloid genes, and inflammatory genes. There is also downregulation of genes encoding B and T-cell function. The blood signature of tuberculosis correlates with the extent of radiographic disease and is diminished upon effective treatment suggesting the possibility of new improved strategies to support diagnostic assays and methods for drug treatment monitoring. The signature suggested a previously under-appreciated role for type I interferons in development of active tuberculosis disease, and numerous mechanisms have now been uncovered to explain how type I interferon impedes the protective response to M. tuberculosis infection. PMID:25703554
Tamura, Takahiko; Kimura, Kazumi; Yui, Katsuyuki; Yoshida, Shigeto
2015-12-01
Dendritic cells (DCs) play critical roles in innate and adaptive immunity and in pathogenesis during the blood stage of malaria infection. The mechanisms underlying DC homeostasis during malaria infection are not well understood. In this study, the numbers of conventional DCs (cDCs) and plasmacytoid DCs (pDCs) in the spleens after lethal rodent malaria infection were examined, and were found to be significantly reduced. Concomitant with up-regulation of maturation-associated molecules, activation of caspase-3 was significantly increased, suggesting induction of cell death. Studies using neutralizing antibody and gene-deficient mice showed that type I and II interferons were critically involved in activation induced cell death of cDCs during malaria infection. These results demonstrate that DCs rapidly disappeared following IFN-mediated DC activation, and that homeostasis of DCs was significantly impaired during malaria infection. Copyright © 2015 Elsevier Inc. All rights reserved.
Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long
2006-11-17
The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.
Suppressing the killer instinct.
Campbell, Kerry S
2016-05-24
Natural killer (NK) cells are innate lymphoid cells that have adopted activating and inhibitory signaling mechanisms enabling them to be tolerant of normal cells but to distinguish and eliminate tumor cells and virus-infected cells. In this issue of Science Signaling, Matalon et al show how inhibitory receptors disrupt NK cell activation by stimulating dephosphorylation of the adaptor protein LAT (linker of activated T cells) and phospholipase C-γ by the phosphatase SHP-1 [Src homology 2 (SH2) domain-containing protein tyrosine phosphatase 1], as well as ubiquitylation of LAT by Cbl family E3 ubiquitin ligases. Copyright © 2016, American Association for the Advancement of Science.
He, Qiao; Cai, Shaolei; Li, Shi; Zeng, Jian; Zhang, Qing; Gao, Yu; Yu, Sisi
2017-01-01
We retrospectively enrolled 191 nasal-type, extranodal natural killer/T-cell lymphoma (ENKTL) patients newly diagnosed from 2008 to 2016 at the Sichuan Cancer Hospital, in order to evaluate the relationship between disease outcomes, demographic and clinical factors, and red blood cell distribution width (RDW). C-index, fisher's exact test, univariate analysis, and cox regression analysis were applied. The median age of patients was 44 years and 134 (70%) were men. The cutoff of RDW was 46.2 fL determined by Cutoff Finder. Patients with RDW≤46.2 fL had significantly better progression-free survival (PFS) (3-year PFS, 80.4% vs. 63.1%; P=0.01) and overall survival (OS) (3-year OS, 83.2% vs. 65.5%; P=0.004) than those with RDW>46.2 fL. Multivariate analysis demonstrated that elevated RDW is an independent adverse predictor of OS (P=0.021, HR=2.04). RDW is an independent predictor of survival outcomes in ENKTL, which we found to be superior to both the prognostic index of natural killer lymphoma (PINK) and the Korean Prognostic Index (KPI) in discriminating patients with different outcomes in low-risk and high-risk groups (all P < 0.05). The new models combining RDW with the International Prognostic Index (IPI), KPI, and PINK showed more powerful prognostic value than corresponding original models. RDW represents an easily available and inexpensive marker for risk stratification in patients with ENKTL treated with radiotherapy-based treatment. Further prospective studies are warranted to confirm the prognostic value of RDW in ENKTL. PMID:29190934
Luo, Huaichao; Quan, Xiaoying; Song, Xiao-Yu; Zhang, Li; Yin, Yilin; He, Qiao; Cai, Shaolei; Li, Shi; Zeng, Jian; Zhang, Qing; Gao, Yu; Yu, Sisi
2017-11-03
We retrospectively enrolled 191 nasal-type, extranodal natural killer/T-cell lymphoma (ENKTL) patients newly diagnosed from 2008 to 2016 at the Sichuan Cancer Hospital, in order to evaluate the relationship between disease outcomes, demographic and clinical factors, and red blood cell distribution width (RDW). C-index, fisher's exact test, univariate analysis, and cox regression analysis were applied. The median age of patients was 44 years and 134 (70%) were men. The cutoff of RDW was 46.2 fL determined by Cutoff Finder. Patients with RDW≤46.2 fL had significantly better progression-free survival (PFS) (3-year PFS, 80.4% vs. 63.1%; P =0.01) and overall survival (OS) (3-year OS, 83.2% vs. 65.5%; P =0.004) than those with RDW>46.2 fL. Multivariate analysis demonstrated that elevated RDW is an independent adverse predictor of OS ( P =0.021, HR=2.04). RDW is an independent predictor of survival outcomes in ENKTL, which we found to be superior to both the prognostic index of natural killer lymphoma (PINK) and the Korean Prognostic Index (KPI) in discriminating patients with different outcomes in low-risk and high-risk groups (all P < 0.05). The new models combining RDW with the International Prognostic Index (IPI), KPI, and PINK showed more powerful prognostic value than corresponding original models. RDW represents an easily available and inexpensive marker for risk stratification in patients with ENKTL treated with radiotherapy-based treatment. Further prospective studies are warranted to confirm the prognostic value of RDW in ENKTL.
Smirnova, Natalia P; Webb, Brett T; McGill, Jodi L; Schaut, Robert G; Bielefeldt-Ohmann, Helle; Van Campen, Hana; Sacco, Randy E; Hansen, Thomas R
2014-04-01
Development of transplacental infection depends on the ability of the virus to cross the placenta and replicate within the fetus while counteracting maternal and fetal immune responses. Unfortunately, little is known about this complex process. Non-cytopathic (ncp) strains of bovine viral diarrhea virus (BVDV), a pestivirus in the Flaviviridae family, cause persistent infection in early gestational fetuses (<150 days; persistently infected, PI), but are cleared by immunocompetent animals and late gestational fetuses (>150 days; transiently infected, TI). Evasion of innate immune response and development of immunotolerance to ncp BVDV have been suggested as possible mechanisms for the establishment of the persistent infection. Previously we have observed a robust temporal induction of interferon (IFN) type I (innate immune response) and upregulation of IFN stimulated genes (ISGs) in BVDV TI fetuses. Modest chronic upregulation of ISGs in PI fetuses and calves reflects a stimulated innate immune response during persistent BVDV infection. We hypothesized that establishing persistent fetal BVDV infection is also accompanied by the induction of IFN-gamma (IFN-γ). The aims of the present study were to determine IFN-γ concentration in blood and amniotic fluid from control, TI and PI fetuses during BVDV infection and analyze induction of the IFN-γ downstream pathways in fetal lymphoid tissues. Two experiments with in vivo BVDV infections were completed. In Experiment 1, pregnant heifers were infected with ncp BVDV type 2 on day 75 or 175 of gestation or kept naïve to generate PI, TI and control fetuses, respectively. Fetuses were collected by Cesarean section on day 190. In Experiment 2, fetuses were collected on days 82, 89, 97, 192 and 245 following infection of pregnant heifers on day 75 of gestation. The results were consistent with the hypothesis that ncp BVDV infection induces IFN-γ secretion during acute infection in both TI and PI fetuses and that lymphoid
The adaptor protein Crk controls activation and inhibition of natural killer cells.
Liu, Dongfang; Peterson, Mary E; Long, Eric O
2012-04-20
Natural killer (NK) cell inhibitory receptors recruit tyrosine phosphatases to prevent activation, induce phosphorylation and dissociation of the small adaptor Crk from cytoskeleton scaffold complexes, and maintain NK cells in a state of responsiveness to subsequent activation events. How Crk contributes to inhibition is unknown. We imaged primary NK cells over lipid bilayers carrying IgG1 Fc to stimulate CD16 and human leukocyte antigen (HLA)-E to inhibit through receptor CD94-NKG2A. HLA-E alone induced Crk phosphorylation in NKG2A(+) NK cells. At activating synapses with Fc alone, Crk was required for the movement of Fc microclusters and their ability to trigger activation signals. At inhibitory synapses, HLA-E promoted central accumulation of both Fc and phosphorylated Crk and blocked the Fc-induced buildup of F-actin. We propose a unified model for inhibitory receptor function: Crk phosphorylation prevents essential Crk-dependent activation signals and blocks F-actin network formation, thereby reducing constraints on subsequent engagement of activation receptors. Copyright © 2012 Elsevier Inc. All rights reserved.
Three-dimensional crystal structure of recombinant murine interferon-beta.
Senda, T; Shimazu, T; Matsuda, S; Kawano, G; Shimizu, H; Nakamura, K T; Mitsui, Y
1992-01-01
The crystal structure of recombinant murine interferon-beta (IFN-beta) has been solved by the multiple isomorphous replacement method and refined to an R-factor of 20.5% against 2.6 A X-ray diffraction data. The structure shows a variant of the alpha-helix bundle with a new chain-folding topology, which seems to represent a basic structural framework of all the IFN-alpha and IFN-beta molecules belonging to the type I family. Functionally important segments of the polypeptide chain, as implied through numerous gene manipulation studies carried out so far, are spatially clustered indicating the binding site(s) to the receptor(s). Comparison of the present structure with those of other alpha-helical cytokine proteins, including porcine growth hormone, interleukin 2 and interferon gamma, indicated either a topological similarity in chain folding or a similar spatial arrangement of the alpha-helices. Images PMID:1505514
Tumor necrosis factor-{alpha} enhances IL-15-induced natural killer cell differentiation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Jiwon; Lee, Suk Hyung; Korea University of Science and Technology, Yusong, Daejeon 305-333
2009-09-04
The differentiation of natural killer (NK) cells is regulated by various factors including soluble growth factors and transcription factors. Here, we have demonstrated that tumor necrosis factor-{alpha} (TNF-{alpha}) is a positive regulator of NK cell differentiation. TNF-{alpha} augmented the IL-15-induced expression of NK1.1 and CD122 in mature NK cells, and TNF-{alpha} alone also induced NK cell maturation as well as IL-15. TNF-{alpha} also increased IFN-{gamma} production in NK cells in the presence of IL-15. Meanwhile, mRNA expression of several transcription factors, including T-bet and GATA-3, was increased by the addition of TNF-{alpha} and IL-15. In addition, TNF-{alpha} increased nuclear factor-kappamore » B (NF-{kappa}B) activity in NK cells and inhibition of NF-{kappa}B impeded TNF-{alpha}-enhanced NK cell maturation. Overall, these data suggest that TNF-{alpha} significantly increased IL-15-driven NK cell differentiation by increasing the expression of transcription factors that play crucial roles in NK cell maturation and inducing the NF-{kappa}B activity.« less
Household food insecurity is associated with low interferon-gamma levels in pregnant Indian women.
Vaidya, A; Bhosale, R; Sambarey, P; Suryavanshi, N; Young, S; Mave, V; Kanade, S; Kulkarni, V; Deshpande, P; Balasubramanian, U; Elf, J; Gupte, N; Gupta, A; Mathad, J S
2017-07-01
Over 20% of tuberculosis (TB) cases during pregnancy occur in India. To determine the association between household food insecurity and interferon-gamma (IFN-γ) levels in pregnancy. Pregnant women in India were administered the Household Food Insecurity Access Scale (HFIAS) questionnaire and underwent an IFN-γ release assay. Logistic regression was used to identify factors associated with food insecurity. Of 538 women, 60 (11%) had household food insecurity, 47 (78%) of which were moderate or severe food insecure. After mitogen stimulation, moderate or severe food insecure women had a median IFN-γ concentration of 4.2 IU/ml (IQR 2.2-9.8) vs. 8.4 IU/ml (IQR 3.0-10) in women with no or mild food insecurity (P = 0.03). In multivariate analysis, higher IFN-γ concentrations were associated with human immunodeficiency virus infection (OR 1.3, 95%CI 0.51-2.1, P = 0.001), and inversely associated with moderate or severe food insecurity (OR -1.6, 95%CI -2.9 to -0.27, P = 0.02) and the number of adults in the household (OR -0.08, 95%CI -0.16 to -0.01, P = 0.03). There was no association between food insecurity and IFN-γ response to Mycobacterium tuberculosis antigen. Food insecurity in pregnancy is associated with low IFN-γ levels. There was no association between food insecurity and IFN-γ response to M. tuberculosis antigen, but our study was underpowered to detect this outcome.
Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Se-Kyung; You, Su-Hwa; Kim, Taeseong; Tark, Dongseob; Lee, Hyang-Sim; Seo, Min-Goo; Kim, Byounghan
2015-01-01
ABSTRACT Because the currently available vaccines against foot-and-mouth disease (FMD) provide no protection until 4 to 7 days postvaccination, the only alternative method to halt the spread of the FMD virus (FMDV) during outbreaks is the application of antiviral agents. Combination treatment strategies have been used to enhance the efficacy of antiviral agents, and such strategies may be advantageous in overcoming viral mechanisms of resistance to antiviral treatments. We have developed recombinant adenoviruses (Ads) for the simultaneous expression of porcine alpha and gamma interferons (Ad-porcine IFN-αγ) as well as 3 small interfering RNAs (Ad-3siRNA) targeting FMDV mRNAs encoding nonstructural proteins. The antiviral effects of Ad-porcine IFN-αγ and Ad-3siRNA expression were tested in combination in porcine cells, suckling mice, and swine. We observed enhanced antiviral effects in porcine cells and mice as well as robust protection against the highly pathogenic strain O/Andong/SKR/2010 and increased expression of cytokines in swine following combination treatment. In addition, we showed that combination treatment was effective against all serotypes of FMDV. Therefore, we suggest that the combined treatment with Ad-porcine IFN-αγ and Ad-3siRNA may offer fast-acting antiviral protection and be used with a vaccine during the period that the vaccine does not provide protection against FMD. IMPORTANCE The use of current foot-and-mouth disease (FMD) vaccines to induce rapid protection provides limited effectiveness because the protection does not become effective until a minimum of 4 days after vaccination. Therefore, during outbreaks antiviral agents remain the only available treatment to confer rapid protection and reduce the spread of foot-and-mouth disease virus (FMDV) in livestock until vaccine-induced protective immunity can become effective. Interferons (IFNs) and small interfering RNAs (siRNAs) have been reported to be effective antiviral agents against
de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M
2009-10-01
A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.
Interferon Independent Non-Canonical STAT Activation and Virus Induced Inflammation
Wu, Chunyan
2018-01-01
Interferons (IFNs) are a group of secreted proteins that play critical roles in antiviral immunity, antitumor activity, activation of cytotoxic T cells, and modulation of host immune responses. IFNs are cytokines, and bind receptors on cell surfaces to trigger signal transduction. The major signaling pathway activated by IFNs is the JAK/STAT (Janus kinase/signal transducer and activator of transcription) pathway, a complex pathway involved in both viral and host survival strategies. On the one hand, viruses have evolved strategies to escape from antiviral host defenses evoked by IFN-activated JAK/STAT signaling. On the other hand, viruses have also evolved to exploit the JAK/STAT pathway to evoke activation of certain STATs that somehow promote viral pathogenesis. In this review, recent progress in our understanding of the virus-induced IFN-independent STAT signaling and its potential roles in viral induced inflammation and pathogenesis are summarized in detail, and perspectives are provided. PMID:29662014
Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh
2014-06-01
Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. INFECTED BALB/C MICE WERE DIVIDED INTO FIVE GROUPS AS: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth.
Maroufi, Yahya; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh
2014-01-01
Background: Cutaneous leishmaniasis is a health problem in the world. Lesions should be treated on cosmetically or functionally important sites, such as the face and hands. Cantharidin is a terpenoid compound produced naturally by beetles of Meloidae and Oedemeridae families. Objectives: The current study aimed to investigate the effect of cantharidin on Cutaneous Leishmaniasis (CL) lesions and IFN-γ and IL-4 patterns in infected BALB/c mice. Materials and Methods: Infected BALB/c mice were divided into five groups as: untreated (control group), eucerin-treated and 0.05%, 0.1% and 0.5% cantharidin-treated. Lesions diameter was measured by Vernier caliper every three days for four weeks. Cytokines levels were measured by enzyme-linked immunosorbent assay (ELISA) using U-CyTech kit. Results: The results indicated that treatment with cantharidin exacerbates lesions compared with the controls, except for 0.05% cantharidin dose that restrained lesion growth significantly. Interferon gamma level in cantharidin-treated groups was significantly less than that of the control group. But interlukin-4 level was similar among the groups. Conclusions: The current study results indicated that high doses of cantharidin exacerbates leishmaniasis lesion, but low dose of cantharidin inhibits lesion growth. PMID:25371808
OM-85 is an immunomodulator of interferon-β production and inflammasome activity
Dang, A. T.; Pasquali, C.; Ludigs, K.; Guarda, G.
2017-01-01
The inflammasome–IL-1 axis and type I interferons (IFNs) have been shown to exert protective effects upon respiratory tract infections. Conversely, IL-1 has also been implicated in inflammatory airway pathologies such as asthma and chronic obstructive pulmonary disease (COPD). OM-85 is a bacterial extract with proved efficacy against COPD and recurrent respiratory tract infections, a cause of co-morbidity in asthmatic patients. We therefore asked whether OM-85 affects the above-mentioned innate immune pathways. Here we show that OM-85 induced interferon-β through the Toll-like receptor adaptors Trif and MyD88 in bone marrow-derived dendritic cells. Moreover, it exerted a dual role on IL-1 production; on the one hand, it upregulated proIL-1β and proIL-1α levels in a MyD88-dependent manner without activating the inflammasome. On the other hand, it repressed IL-1β secretion induced by alum, a well-known NLRP3 activator. In vivo, OM-85 diminished the recruitment of inflammatory cells in response to peritoneal alum challenge. Our findings therefore suggest that OM-85 favors a protective primed state, while dampening inflammasome activation in specific conditions. Taken together, these data bring new insights into the mechanisms of OM-85 action on innate immune pathways and suggest potential explanations for its efficacy in the treatment of virus-induced airway diseases. PMID:28262817
Development and evaluation of an interferon-γ release assay in Asian elephants (Elephas maximus).
Paudel, Sarad; Villanueva, Marvin A; Mikota, Susan K; Nakajima, Chie; Gairhe, Kamal P; Subedi, Suraj; Rayamajhi, Nabin; Sashika, Mariko; Shimozuru, Michito; Matsuba, Takashi; Suzuki, Yasuhiko; Tsubota, Toshio
2016-08-01
We developed an interferon-γ release assay (IGRA) specific for Asian elephants (Elephas maximus). Whole blood collected from forty captive Asian elephants was stimulated with three different mitogens i.e., phytohemagglutinin (PHA), pokweed mitogen (PWM) and phorbol myristate aceteate/ionomycin (PMA/I). A sandwich ELISA that was able to recognize the recombinant elephant interferon-γ (rEIFN-γ) as well as native interferon-γ from the Asian elephants was performed using anti-elephant IFN-γ rabbit polyclonal antibodies as capture antibodies and biotinylated anti-elephant IFN-γ rabbit polyclonal antibodies as detection antibodies. PMA/I was the best mitogen to use as a positive control for an Asian elephant IGRA. The development of an Asian elephant-specific IGRA that detects native IFN-γ in elephant whole blood provides promising results for its application as a potential diagnostic tool for diseases, such as tuberculosis (TB) in Asian elephants.
Erkens, C G M; Dinmohamed, A G; Kamphorst, M; Toumanian, S; van Nispen-Dobrescu, R; Alink, M; Oudshoorn, N; Mensen, M; van den Hof, S; Borgdorff, M; Verver, S
2014-04-01
Interferon-gamma release assays (IGRAs) are reported to be more specific for the diagnosis of latent tuberculous infection (LTBI) than the tuberculin skin test (TST). The two-step procedure, TST followed by an IGRA, is reported to be cost-effective in high-income countries, but it requires more financial resources. To assess the added value of IGRA compared to TST alone in the Netherlands. Test results and background data on persons tested with an IGRA were recorded by the Public Municipal Health Services in a web-based database. The number of persons diagnosed with LTBI using different screening algorithms was calculated. In those tested with an IGRA, at least 60% of persons who would have been diagnosed with LTBI based on TST alone had a negative IGRA. Among those with a TST reaction below the cut-off for the diagnosis of LTBI, 13% had a positive IGRA. For 41% of persons tested with an IGRA after TST, the IGRA influenced whether or not an LTBI diagnosis would be made. With the IGRA as reference standard, a high proportion of persons in low-prevalence settings are treated unnecessarily for LTBI if tested with TST alone, while a small proportion eligible for preventive treatment are missed. Incremental costs of the two-step strategy seem to be balanced by the improved targeting of preventive treatment.
Chuke, Stella O.; Yen, Nguyen Thi Ngoc; Laserson, Kayla F.; Phuoc, Nguyen Huu; Trinh, Nguyen An; Nhung, Duong Thi Cam; Mai, Vo Thi Chi; Qui, An Dang; Hai, Hoang Hoa; Loan, Le Thien Huong; Jones, Warren G.; Whitworth, William C.; Shah, J. Jina; Painter, John A.; Mazurek, Gerald H.; Maloney, Susan A.
2014-01-01
Objective. Use of tuberculin skin tests (TSTs) and interferon gamma release assays (IGRAs) as part of tuberculosis (TB) screening among immigrants from high TB-burden countries has not been fully evaluated. Methods. Prevalence of Mycobacterium tuberculosis infection (MTBI) based on TST, or the QuantiFERON-TB Gold test (QFT-G), was determined among immigrant applicants in Vietnam bound for the United States (US); factors associated with test results and discordance were assessed; predictive values of TST and QFT-G for identifying chest radiographs (CXRs) consistent with TB were calculated. Results. Of 1,246 immigrant visa applicants studied, 57.9% were TST positive, 28.3% were QFT-G positive, and test agreement was 59.4%. Increasing age was associated with positive TST results, positive QFT-G results, TST-positive but QFT-G-negative discordance, and abnormal CXRs consistent with TB. Positive predictive values of TST and QFT-G for an abnormal CXR were 25.9% and 25.6%, respectively. Conclusion. The estimated prevalence of MTBI among US-bound visa applicants in Vietnam based on TST was twice that based on QFT-G, and 14 times higher than a TST-based estimate of MTBI prevalence reported for the general US population in 2000. QFT-G was not better than TST at predicting abnormal CXRs consistent with TB. PMID:24738031
Yamaguchi, Mayu; Kitagawa, Yoshinori; Zhou, Min; Itoh, Masae; Gotoh, Bin
2014-01-03
Paramyxovirus C protein targets the host interferon (IFN) system for virus immune evasion. To identify its unknown anti-IFN activity, we examined the effect of Sendai virus C protein on activation of the IFN-α promoter via various signaling pathways. This study uncovers a novel ability of C protein to block Toll-like receptor (TLR) 7- and TLR9-dependent IFN-α induction, which is specific to plasmacytoid dendritic cells. C protein interacts with a serine/threonine kinase IKKα and inhibits phosphorylation of IRF7. This anti-IFN activity of C protein is shared across genera of the Paramyxovirinae, and thus appears to play an important role in paramyxovirus immune evasion. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Faridi, R M; Agrawal, S
2011-02-01
Decidual natural killer (NK) cells play key developmental roles at the feto-maternal interface. Individual differences in NK-cell interactions are dependent on the combinations of variable killer immunoglobulin-like receptor (KIR) and HLA class-I gene products. As different receptor-ligand interactions may result in altered NK-cell-mediated immunity against pathogens, it is proposed that the relationship between these genes may be important in a state such as recurrent miscarriage (RM). We had earlier reported that the predisposition to RM is influenced by the maternal KIR gene content. In the present study, we have attempted to extend our findings in the light of contribution from the paternal antigens on the outcome of pregnancy, since maternal NK cells may potentially encounter non-self-paternal HLA-C alleles on trophoblasts. All HLA-C allotypes fall into two major KIR epitopes--C1 (HLA-C*01/*03/*07/*08/*12/*14/*16) and C2 (HLA-C*02/*04/*05/*06/*15/*17/*18)--on the basis of a dimorphism at position 80 of the α1 domain. PCR-sequence specific primer-based genotyping was used to determine the maternal KIR gene content and HLA-C genotypes down to allele level in couples experiencing RM and controls. KIR2DL1 with both partners homozygous for HLA C2 was significantly higher in control couples when compared with the patients [P = 0.0004, odds ratio (OR) = 0.28, 95% confidence interval (CI) = 0.13-0.58]. The activating KIR2DS2 with both partners homozygous for HLA C1 was significantly higher in patients when compared with the controls (P = 0.002, OR = 2.83, 95% CI = 1.47-5.40). Our results represented the 'top-end' of the activation spectrum of KIR-HLA-C compound genotype for NK cells and this may contribute to the immunological etiology of RM.
METHOD FOR THE STUDY OF THE LIVER BLOOD FLOW USING GAMMA-EMITTING RADIONUCLIDES
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baptista, A.M.; Carvalho, J.S.
1959-10-31
A method is described for the evaluation of liver blood flow values by radioactivity measurements of gamma-emitting radionuclides, in colloid form, using a scintillation detector positioned over the liver region. It is shown that the disappearance rate constant of the nuclide from the blood can be calculated from the curves obtained. Advantages of the method, including the use of small amounts of radioactive materials, are discussed. (auth)
Estes, D M; Tuo, W; Brown, W C; Goin, J
1998-12-01
In this report, we sought to determine the role of selected type I interferons [interferon-alpha (IFN-alpha) and interferon-tau (IFN-tau)], IFN-gamma and transforming growth factor-beta (TGF-beta) in the regulation of bovine antibody responses. B cells were stimulated via CD40 in the presence or absence of B-cell receptor (BCR) cross-linking. IFN-alpha enhanced IgM, IgG2 and IgA responses but did not enhance IgG1 responses. BCR signalling alone was more effective at inducing IgG2 responses with IFN-alpha than dual cross-linking with CD40. Recombinant ovine IFN-tau was less effective at inducing IgG2 responses when compared with IFN-alpha, though IgA responses were similar in magnitude following BCR cross-linking. At higher concentrations, IFN-tau enhanced IgA responses greater than twofold over the levels observed with IFN-alpha. Previous studies have shown that addition of IFN-gamma to BCR or pokeweed mitogen-activated bovine B cells stimulates IgG2 production. However, following CD40 stimulation alone, IFN-gamma was relatively ineffective at stimulating high-rate synthesis of any non-IgM isotype. Dual cross-linking via CD40 and the BCR resulted in decreased synthesis of IgM with a concomitant increase in IgA and similar levels of IgG2 production to those obtained via the BCR alone. We also assessed the effects of endogenous and exogenous TGF-beta on immunoglobulin synthesis by bovine B cells. Exogenous TGF-beta stimulates both IgG2 and IgA production following CD40 and BCR cross-linking in the presence of IL-2. Blocking endogenous TGF-beta did not inhibit the up-regulation of IgG2 or IgA by interferons.
Ebihara, Y; Manabe, A; Tanaka, R; Yoshimasu, T; Ishikawa, K; Iseki, T; Hayakawa, J; Maeda, M; Asano, S; Tsuji, K
2003-06-01
The optimal treatment for natural killer (NK) cell leukemia after chronic active Epstein-Barr virus (CAEBV) infection has not been determined. A 15-year-old boy presented with NK cell leukemia following CAEBV infection for 5 years. The peripheral blood and BM had an increased number of CD3(-)CD56(+) large granular lymphocytes and a monoclonal integration of the EBV genome was detected. Chemotherapy was not sufficiently effective to control the disease. Allogeneic BMT from an HLA-identical sister was performed using a conditioning regimen consisting of total body irradiation, cyclophosphamide and thiotepa. The patient is disease-free with a perfect performance status 24 months after BMT. This is the first report to show that allogeneic BMT is potentially able to cure NK cell leukemia after CAEBV infection.
Tubby, Carolyn; Negm, Ola H; Harrison, Timothy; Tighe, Patrick J; Todd, Ian; Fairclough, Lucy C
2017-06-01
The three main types of killer cells - CD8 + T cells, NK cells and NKT cells - have been linked to asthma and chronic obstructive pulmonary disease (COPD). However, their role in a small subset of asthma patients displaying fixed airway obstruction (FAO), similar to that seen in COPD, has not been explored. The objective of the present study was to investigate killer cell numbers, phenotype and function in peripheral blood from asthma patients with FAO, asthma patients without FAO, and healthy individuals. Peripheral CD8 + T cells (CD8 + CD3 + CD56 - ), NK cells (CD56 + CD3 - ) and NKT-like cells (CD56 + CD3 + ) of 14 asthma patients with FAO (post-bronchodilator FEV/FVC <0.7, despite clinician-optimised treatment), 7 asthma patients without FAO (post-bronchodilator FEV/FVC ≥ 0.7), and 9 healthy individuals were studied. No significant differences were seen between the number, receptor expression, MAPK signalling molecule expression, cytotoxic mediator expression, and functional cytotoxicity of peripheral killer cells from asthma patients with FAO, asthma patients without FAO and healthy individuals. Peripheral killer cell numbers or functions do not differentiate between asthma patients with or without fixed airway obstruction.
Gupta, Kanupriya; Ogendi, Brian M. O.; Bakshi, Rakesh K.; Kapil, Richa; Press, Christen G.; Sabbaj, Steffanie; Lee, Jeannette Y.
2017-01-01
ABSTRACT Chlamydia trachomatis infection is the most prevalent bacterial sexually transmitted infection and can cause significant reproductive morbidity in women. There is insufficient knowledge of C. trachomatis-specific immune responses in humans, which could be important in guiding vaccine development efforts. In contrast, murine models have clearly demonstrated the essential role of T helper type 1 (Th1) cells, especially interferon gamma (IFN-γ)-producing CD4+ T cells, in protective immunity to chlamydia. To determine the frequency and magnitude of Th1 cytokine responses elicited to C. trachomatis infection in humans, we stimulated peripheral blood mononuclear cells from 90 chlamydia-infected women with C. trachomatis elementary bodies, Pgp3, and major outer membrane protein and measured IFN-γ-, tumor necrosis factor alpha (TNF-α)-, and interleukin-2 (IL-2)-producing CD4+ and CD8+ T-cell responses using intracellular cytokine staining. The majority of chlamydia-infected women elicited CD4+ TNF-α responses, with frequency and magnitude varying significantly depending on the C. trachomatis antigen used. CD4+ IFN-γ and IL-2 responses occurred infrequently, as did production of any of the three cytokines by CD8+ T cells. About one-third of TNF-α-producing CD4+ T cells coproduced IFN-γ or IL-2. In summary, the predominant Th1 cytokine response elicited to C. trachomatis infection in women was a CD4+ TNF-α response, not CD4+ IFN-γ, and a subset of the CD4+ TNF-α-positive cells produced a second Th1 cytokine. PMID:28100498
Inactivation of human interferon by body fluids
NASA Technical Reports Server (NTRS)
Cesario, T. C.; Mandell, A.; Tilles, J. G.
1973-01-01
Description of the effects of human feces, bile, saliva, serum, and cerebrospinal fluid on interferon activity. It is shown that crude interferon is inactivated by at least 50% more than with the control medium used, when incubated for 4 hr in vitro in the presence of serum, saliva, or cerebrospinal liquid, and by close to 100% when incubated with stool extract or bile.
Nitric oxide inhibits exocytosis of cytolytic granules from lymphokine-activated killer cells
Ferlito, Marcella; Irani, Kaikobad; Faraday, Nauder; Lowenstein, Charles J.
2006-01-01
NO inhibits cytotoxic T lymphocyte killing of target cells, although the precise mechanism is unknown. We hypothesized that NO decreases exocytosis of cytotoxic granules from activated lymphocytes. We now show that NO inhibits lymphokine-activated killer cell killing of K562 target cells. Exogenous and endogenous NO decreases the release of granzyme B, granzyme A, and perforin: all contents of cytotoxic granules. NO inhibits the signal transduction cascade initiated by cross-linking of the T cell receptor that leads to granule exocytosis. In particular, we found that NO decreases the expression of Ras, a critical signaling component within the exocytic pathway. Ectopic expression of Ras prevents NO inhibition of exocytosis. Our data suggest that Ras mediates NO inhibition of lymphocyte cytotoxicity and emphasize that alterations in the cellular redox state may regulate the exocytic signaling pathway. PMID:16857739
1990-12-20
and infectious mononucleosis , as well as outbreaks of herpes simplex (Ishigami, 1919; Hinkle and Plummer, 1952; McClelland, Alexander, and Marks, 1982...Evans, A., and Neiderman, J., (1979). Psychosocial risk factors in the development of infectious mononucleosis . Psychosomatic Medicine, 41, 445-466...34Stress, Coping, and Infectious Illness: Persistently Low Natural Killer Cell Activity as a Host Ri-k Fa.ctor" 2. PERSONAL AUTHOR(S) Sandra M. Lev