Galaxias australes con núcleo doble

NASA Astrophysics Data System (ADS)

Gimeno, G.; Díaz, R.; Carranza, G.

Se estudia una muestra de galaxias australes con núcleo doble a partir de una búsqueda extensiva en la literatura. Se analizan las características morfológicas, fotométricas y espectroscópicas de la muestra. Para algunas galaxias se han realizado observaciones con el espectrógrafo multifunción (EMF) de la Estación Astrofísica de Bosque Alegre a partir de las cuales se determinaron parámetros cinemáticos.

Nasal valve evaluation in the Mexican-Hispanic (mestizo) nose.

PubMed

Jasso-Ramírez, Elizabeth; Sánchez Y Béjar, Fernando; Arcaute Aizpuru, Fernando; Maulen Radován, Irene E; de la Garza Hesles, Héctor

2018-04-01

Our aim in this study was to determine the angle of the internal nasal valve in Mexican patients with the "mestizo nose" feature and without nasal obstructive symptoms. The work was prospective, comparative, and observational in nature and included patients >14 years of age who were seen in the Otolaryngology Department at the Los Angeles Lomas Hospital between April and May 2016. The angle of the internal nasal valve was measured in 30 patients without obstructive symptoms. Endoscopic examination was performed with a 0° endoscope framed with tape at a 13-mm distance from the endoscope's tip, and digital photographs of the internal nasal valve were taken. The measurement of the angle of the internal nasal valve was made in sexagesimal degrees using Golden Ratio v3.1 (2012) software. Statistical analysis was performed using Excel v15.13.3. The angles of the internal nasal valve of the patients were (mean ± standard deviation) 24.07 ± 4.8° for the right nasal cavity and 25.07 ± 5.0° for the left nasal cavity, wider than the angle reported in the normal Caucasian nose established in the literature. According to our results, the Mexican-Hispanic mestizo nose has a wider angle in the internal nasal valve than that considered normal in the literature (10°-15°). We believe it is necessary to undertake a second study and add an airflow resistance measurement with a rhinomanometry procedure so we can compare the results with those in the Caucasian population. © 2018 ARS-AAOA, LLC.

Forensic parameters and admixture in Mestizos from five geographic regions of Mexico based on 20 autosomal STRs (Powerplex 21 system).

PubMed

Aguilar-Velázquez, J A; Martínez-Cortés, G; Inclán-Sánchez, A; Favela-Mendoza, A F; Velarde-Félix, J S; Rangel-Villalobos, H

2018-03-01

We analyzed Mestizo (admixed) population samples from different geographic regions of Mexico (n = 1283) with 20 autosomal STRs (PowerPlex® 21, Promega Corp.). Allele frequencies and forensic parameters from the Northwest, Northeast, West, Center, and Southeast regions are reported, as well as from the pooled Mexican population sample. The combined PD and PE for this 20 STR system were > 0.9999999999 and > 0.99999996593% in all five population samples, respectively. Analysis of molecular variance (AMOVA) of these Mexican population samples, plus Monterrey (Northeast) and Mexico (Center) Cities, showed low but significant differences among Mexican-Mestizos from the seven populations (Fst = 0.20%; p = 0.0000). Structure analysis showed the highest proportion of Native American ancestry in Mexico City, Center, and Southeast regions, respectively, which was in agreement with the estimated genetic distances represented in a MDS plot and a NJ tree. The best fit of population clusters (K = 4) obtained with the Structure software indicates that Mexican-Mestizos are mainly composed by European, African, and two Native American ancestries. The European and Native American ancestries displayed a contrary gradient, increasing toward the North-West and South-Southeast, respectively. These 20 autosomal STR loci improved the admixture estimation regarding previous studies with the 13 CODIS-STRs, as supported by the higher similarity with previous estimates based on genome-wide SNP. In brief, this study validates the confident use of the PowerPlex® 21 system for human identification purposes in Mestizo populations throughout the Mexican territory.

Cultural significance of wild mammals in Mayan and mestizo communities of the Lacandon Rainforest, Chiapas, Mexico.

PubMed

García Del Valle, Yasminda; Naranjo, Eduardo J; Caballero, Javier; Martorell, Carlos; Ruan-Soto, Felipe; Enríquez, Paula L

2015-05-07

Several ethnobiology studies evaluate the cultural significance (CS) of plants and mushrooms. However, this is not the case for mammals. It is important to make studies of CS allowing the comparison of cultural groups because the value given to groups of organisms may be based on different criteria. Such information would be valuable for wildlife preservation plans. In this study, the most culturally significant species of mammals from the Lacandon Rainforest (Chiapas, Mexico) for people from two Mayan-Lacandon and mestizo communities were identified. The reasons behind the CS of the studied species were explored and the existence of differences among the cultural groups was evaluated. One hundred ninety-eight semi-structured and structured interviews were applied to compile socio-demographic information, qualitative data on CS categories, and free listings. Frequency of mention was a relative indicator to evaluate the CS of each species of mammal. Comparison of responses between communities was carried out through multivariate analyses. The non-parametric Mann-Whitney U test was used to compare the number of mentioned species by Lacandons and mestizos as well as different responses in the qualitative categories. A χ2 test was used to compare frequency of categories. 38 wild mammal species were identified. The classification and Principal Components Analyses show an apparent separation between Lacandon and mestizo sites based on the relative importance of species. All four communities mentioned the lowland paca the most, followed by peccary, white-tailed deer, armadillo, and jaguar. No significant difference was found in the number of mentioned species between the two groups. Eight CS categories were identified. The most important category was "harmful mammals", which included 28 species. Other relevant categories were edible, medicinal, and appearing in narratives. The data obtained in this study demonstrates the existence of differential cultural patterns in the

Analysis of Polymorphisms in Interleukin-10, Interleukin-6, and Interleukin-1 Receptor Antagonist in Mexican-Mestizo Women with Pre-eclampsia

PubMed Central

Valencia Villalvazo, Elith Yazmin; Canto-Cetina, Thelma; Romero Arauz, Juan Fernando; Coral-Vázquez, Ramón Mauricio; Canizales-Quinteros, Samuel; Coronel, Agustín; Carlos Falcón, Juan; Hernández Rivera, Jaime; Ibarra, Roberto; Polanco Reyes, Lucila

2012-01-01

Due to the fact that studies seeking associations of polymorphisms in regulatory regions of cytokine genes with pre-eclampsia (PE) have not always been consistent in different population analyses, the aim of this study was to investigate the possible association between rs1800896 of interleukin-10 (IL-10), rs1800795 of interleukin-6 (IL-6), and the variable number of tandem repeats (VNTR) in intron 2 of interleukin-1 receptor antagonist (IL-1Ra), as well as gene–gene interactions between these three polymorphisms with the presence of PE in Mexican-Mestizo women and one Amerindian population from México (Maya). A case–control study was performed where 411 pre-eclamptic cases and 613 controls were genotyped. For the rs1800896 of IL-10 and rs1800795 of IL-6, we used real-time polymerase chain reaction (PCR) allelic discrimination and for the VNTR of IL-1Ra, PCR. Allele frequency differences were assessed by Chi-squared test; logistic regression was used to test for associations; a gene–gene interaction was conducted. Genotypic and allelic distribution of the polymorphisms was similar in our population. The estimated of the gene–gene interaction between the polymorphisms did not differ significantly. However, we observed important differences in the distribution of the alleles and genotypes of the three polymorphisms analyzed between Mestiza-Mexicanas and Maya-Mestizo women. In conclusion, we did not find an association between polymorphisms in IL-10, IL-6, and IL-1Ra and PE in Mexican-Mestizo and Maya-Mestizo women. To our knowledge, this is the first time that these three polymorphisms were analyzed together with gene–gene interaction in women with PE. PMID:23013217

Genetic Obesity Risk and Attenuation Effect of Physical Fitness in Mexican-Mestizo Population: a Case-Control Study.

PubMed

Costa-Urrutia, Paula; Abud, Carolina; Franco-Trecu, Valentina; Colistro, Valentina; Rodríguez-Arellano, Martha Eunice; Vázquez-Pérez, Joel; Granados, Julio; Seelaender, Marilia

2017-05-01

We analyzed commonly reported European and Asian obesity-related gene variants in a Mexican-Mestizo population through each single nucleotide polymorphism (SNP) and a genetic risk score (GRS) based on 23 selected SNPs. Study subjects were physically active Mexican-Mestizo adults (n  =  608) with body mass index (BMI) values from 18 to 55 kg/m 2 . For each SNP and for the GRS, logistic models were performed to test for simple SNP associations with BMI, fat mass percentage (FMP), waist circumference (WC), and the interaction with VO 2max and muscular endurance (ME). To further understand the SNP or GRS*physical fitness components, generalized linear models were performed. Obesity risk was significantly associated to 6 SNPs (ADRB2 rs1042713, APOB rs512535, PPARA rs1800206, TNFA rs361525, TRHR rs7832552 and rs16892496) after adjustment by gender, age, ancestry, VO 2max , and ME. ME attenuated the influence of APOB rs512535 and TNFA rs361525 on obesity risk in FMP. WC was significantly associated to GRS. Both ME and VO 2max attenuated GRS effect on WC. We report associations for 6 out of 23 SNPs and for the GRS, which confer obesity risk, a novel finding for Mexican-Mestizo physically active population. Also, the importance of including physical fitness components variables in obesity genetic risk studies is highlighted, with special regard to intervention purposes. © 2017 John Wiley & Sons Ltd/University College London.

In vitro Antimicrobial Activity of Traditional Plant Used in Mestizo Shamanism from the Peruvian Amazon in Case of Infectious Diseases.

PubMed

Roumy, Vincent; Gutierrez-Choquevilca, Andréa-Luz; Lopez Mesia, Jean Pierre; Ruiz, Lastenia; Ruiz Macedo, Juan Celidonio; Abedini, Amin; Landoulsi, Ameni; Samaillie, Jennifer; Hennebelle, Thierry; Rivière, Céline; Neut, Christel

2015-10-01

Our survey was performed near Iquitos (Peruvian Amazon) and its surroundings and leads us to consider Mestizo ethnomedical practices. The plant species reported here are traditionally used for ailments related to microbial infections. Inhabitants of various ethnic origins were interviewed, and 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi-resistant bacteria or yeast. The study aimed at providing information on antimicrobial plant extract activities and the ethnomedical context of Mestizo riverine populations from Loreto (Peru). The minimum inhibitory concentrations (MICs) of the plant crude extracts were carried out using the agar dilution method and ranged between 0.075 and 5.0 mg/ml. Of the 40 plants analyzed, 9 species showed MIC ≤0.3 mg/ml (Anacardium occidentale, Couroupita guianensis, Croton lechleri, Davilla rugosa, Erythrina amazonica, Jacaranda copaia subsp. Spectabilis, Oenocarpus bataua, Peperomia macrostachya, and Phyllanthus urinaria) for one or several of the 36 microorganisms and only 6 drug extracts were inactive. Among the 40 plants, 13 were evaluated for the first time for an antibacterial activity. This evaluation of the antimicrobial activity of 40 plants using an approved standard methodology allowed comparing those activities against various microbes to establish antimicrobial spectra of standardized plant extracts, and give support to the traditional use of these plants. It may also help discovering new chemical classes of antimicrobial agents that could serve against multi-resistant bacteria. This study leads us to consider Mestizo ethnomedical practices near Iquitos (Peruvian Amazon) and its surroundings. The plant species reported here are traditionally used for ailments related to microbial infections. 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi resistant bacteria or yeast. The study aimed

VDR polymorphisms are associated with bone mineral density in post-menopausal Mayan-Mestizo women.

PubMed

Canto-Cetina, Thelma; Cetina Manzanilla, José Antonio; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia

2015-01-01

Osteoporosis is characterized by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic and environmental factors. To analyse the association between two polymorphisms of VDR as well as their haplotypes with BMD in post-menopausal Maya-Mestizo women. This study comprised 600 post-menopausal Maya-Mestizo women. A structured questionnaire for risk factors was applied and BMD was assessed at the lumbar spine (LS) and total hip (TH) by dual-energy X-ray absorptiometry. DNA was extracted from blood leukocytes. Two single-nucleotide polymorphisms of VDR (rs731236 and rs2228570) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analysed with covariance. Haplotype analysis was conducted. TT genotype of rs731236 of VDR had higher BMD at total hip and femoral neck (FN), and one haplotype formed by the two polymorphisms was associated with only TH-BMD variations. This difference was statistically significant after adjustment for confounders. The genotype of rs2228570 of VDR analysis showed no significant differences with BMD variations. The results showed that the TT genotype of rs731236 of VDR and one haplotype formed by rs731236 and rs2228570 polymorphisms were associated with higher BMD at TH and FN.

In vitro Antimicrobial Activity of Traditional Plant Used in Mestizo Shamanism from the Peruvian Amazon in Case of Infectious Diseases

PubMed Central

Roumy, Vincent; Gutierrez-Choquevilca, Andréa-Luz; Lopez Mesia, Jean Pierre; Ruiz, Lastenia; Ruiz Macedo, Juan Celidonio; Abedini, Amin; Landoulsi, Ameni; Samaillie, Jennifer; Hennebelle, Thierry; Rivière, Céline; Neut, Christel

2015-01-01

Context: Our survey was performed near Iquitos (Peruvian Amazon) and its surroundings and leads us to consider Mestizo ethnomedical practices. The plant species reported here are traditionally used for ailments related to microbial infections. Inhabitants of various ethnic origins were interviewed, and 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi-resistant bacteria or yeast. The study aimed at providing information on antimicrobial plant extract activities and the ethnomedical context of Mestizo riverine populations from Loreto (Peru). Material and Method: The minimum inhibitory concentrations (MICs) of the plant crude extracts were carried out using the agar dilution method and ranged between 0.075 and 5.0 mg/ml. Results: Of the 40 plants analyzed, 9 species showed MIC ≤0.3 mg/ml (Anacardium occidentale, Couroupita guianensis, Croton lechleri, Davilla rugosa, Erythrina amazonica, Jacaranda copaia subsp. Spectabilis, Oenocarpus bataua, Peperomia macrostachya, and Phyllanthus urinaria) for one or several of the 36 microorganisms and only 6 drug extracts were inactive. Among the 40 plants, 13 were evaluated for the first time for an antibacterial activity. Conclusion: This evaluation of the antimicrobial activity of 40 plants using an approved standard methodology allowed comparing those activities against various microbes to establish antimicrobial spectra of standardized plant extracts, and give support to the traditional use of these plants. It may also help discovering new chemical classes of antimicrobial agents that could serve against multi-resistant bacteria. SUMMARY This study leads us to consider Mestizo ethnomedical practices near Iquitos (Peruvian Amazon) and its surroundings. The plant species reported here are traditionally used for ailments related to microbial infections. 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36

Distribution of three SNPs related to low bone mineral density in Amerindian groups and Mestizos from Mexico.

PubMed

Nuño-Arana, Ismael; Sahagún-Núñez, Valeria Del Rocío; Muñoz-Valle, José Francisco; Sandoval, Lucila; Pinto-Escalante, Doris; Páez-Riberos, Luis Antonio; Lazalde, Brissia; Maldonado-González, Montserrat; Rangel-Villalobos, Héctor

2012-01-01

Some Single nucleotide polymorphisms (SNPs) of several candidate genes have been associated with low bone mineral density (BMD) and fracture risk. As the genetic variability of such SNPs in Hispanic and Native American populations is scarce, we analyzed the three SNPs that have been related with bone mass disorders (Sp1, A163G, and BsmI) located in the genes of Type I Collagen (COL1A1), Osteoprotegerin (OPG), and Vitamin D receptor (VDR) in Mexican Mestizos (people resulting from post-Columbian admixture) and five Amerindian populations. We genotyped these three SNPs by Polymerase chain reaction (PCR) and Restriction fragment length polymorphisms (RFLPs) in 523 individuals from five Mexican Amerindian groups (Nahua, Maya, Purépecha, Tarahumara, and Huichol) and 227 western Mestizos (Jalisco state). The modal allele was the same in all the six populations for Sp1-COL1A1 (S > 77%), A163G-OPG (A > 80%), and BsmI-VDR (b > 62%). Genotype distribution was in Hardy-Weinberg equilibrium in all SNPs/populations, excepting Sp1-COL1A1 in the Purépecha group and BsmI-VDR in Mestizo. In terms of the presumably Sp1-COL1A1 risk allele to low BMD (allele "s"), the Purépecha group showed the highest allele (23%) and homozygous (14.5%) frequencies. If the role of this allele as a genetic predisposing factor to low BMD were confirmed, this would mean increased susceptibility of Purépechas with regard to Europeans (14.5 vs. 6.8%). This finding presumably could influence the genetic susceptibility to low BMD in Purépechas. For the SNPs, BsmI-VDR and A163G-OPG, relative homogeneity was observed among the Mexican populations analyzed here. Copyright © 2012 Wiley Periodicals, Inc.

[Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

PubMed

Wielandt, Ana María; Vollrath, Valeska; Chianale, José

2004-09-01

There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p<0.005) but similar to that reported in Asian population (p=0.739), probably due to the Asian origin of the Amerindian populations. In addition, the MDR1*l haplotype fequency hin Mestizos was similar to the frequency reported in Caucasians (p=0.49), in agreement with the origin of our population, with a strong influence of Caucasian genes from the Spanish conquerors. The MDR1*2 haplotype distribution, with the three polymoyphisms and probably lower multidrug transporter expression, was similar in the three Chilean populations studied (p>0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

A Study of Parental Attitudes and Values Towards Education on the Navajo and Hopi Reservations. Part II, Parental Attitudes [Ganado].

ERIC Educational Resources Information Center

Biglin, J. E.; And Others

Objectives of this study were (1) to determine the parental attitudes of those parents who reside in the Chinle, Keams Canyon, Kayenta, Ganado, Window Rock, or Tuba City school district toward public education on the Navajo and Hopi reservations in the areas of teachers, curriculum, social behaviors of children, school services, school policies,…

DD genotype of angiotensin-converting enzyme in type 2 diabetes mellitus with renal disease in Mexican Mestizos.

PubMed

Palomo-Piñón, Silvia; Gutiérrez-Rodríguez, Margarita E; Díaz-Flores, Margarita; Sánchez-Barrera, Reyna; Valladares-Salgado, Adán; Utrera-Barillas, Dolores; Durán-Reyes, Genoveva; Galván-Duarte, Rosa E; Trinidad-Ramos, Pedro; Cruz, Miguel

2009-04-01

The DD genotype of angiotensin-converting enzyme (ACE) has been suggested as a major contributor of diabetic nephropathy in several populations. The purpose of the present study was to determine whether micro/macroalbuminuria is associated with ACE insertion/deletion (I/D) polymorphism in Mexican Mestizos with type 2 diabetes mellitus. A total of 435 patients with type 2 diabetes mellitus, of whom 233 had albuminuria, were characterized for the ACE I/D polymorphism by the polymerase chain reaction method. Clinical and biochemical characteristics and frequencies according to DD, ID and II genotypes in patients with and without albuminuria showed no significant differences. However, only females with micro/macroalbuminuria showed higher frequency of a DD genotype than those without albuminuria (27.9%, 21.2% and 10.5%, respectively; P Mestizo females with type 2 diabetes, indicating a possible DD genotype-associated sex effect in renal disease.

Higher prepregnancy body mass index is a risk factor for developing preeclampsia in Maya-Mestizo women: a cohort study.

PubMed

Canto-Cetina, Thelma; Coral-Vázquez, Ramón Mauricio; Rojano-Mejía, David; Pérez Godoy, Sergio; Coronel, Agustín; Canto, Patricia

2018-08-01

Preeclampsia and obesity are two closely related syndromes. The high maternal prepregnancy body mass index (BMI) is a risk factor for present preeclampsia, independently of the ethnic background of the studied population. The aim of this study was to analyse in a prospective cohort study the relation between prepregnancy BMI and development of preeclampsia in Maya-Mestizo women. This is a prospective cohort study of 642 pregnant women that were included in the first trimester of the pregnancy (gestational age ≤12 weeks at the first antenatal visit) and all of them were of Maya-Mestizo ethnic origin from the state of Yucatán, México. We assessed the potential risk factors for preeclampsia and documented the prepregnancy BMI (kg/m 2 ) that was based on measured height and maternal self-report of prepregnancy weight at the initial visit. Besides, in the antenatal visit we documented if the pregnant women developed preeclampsia. Of the 642 pregnant Maya-Mestizo women, 49 developed preeclampsia, with an incidence of 7.6% (44.9% had severe and 55% mild). The prepregnancy BMI was higher in women with developed preeclampsia than in those with normal pregnancies. Women with overweight or obesity in comparison with normal weight presented a RR = 2.82 (95% CI: 1.32-6.03; P = 0.008) and RR= 4.22 (95% CI: 2.07-8.61; P = 0.001), respectively. Our findings expand the previous studies to show that the higher prepregnancy BMI is a strong, independent risk factor for preeclampsia.

Heterogenous Distribution of MTHFR Gene Variants among Mestizos and Diverse Amerindian Groups from Mexico

PubMed Central

Contreras-Cubas, Cecilia; Sánchez-Hernández, Beatríz E.; García-Ortiz, Humberto; Martínez-Hernández, Angélica; Barajas-Olmos, Francisco; Cid, Miguel; Mendoza-Caamal, Elvia C.; Centeno-Cruz, Federico; Ortiz-Cruz, Gabriela; Jiménez-López, José Concepción; Córdova, Emilio J.; Salas-Bautista, Eva Gabriela; Saldaña-Alvarez, Yolanda; Fernández-López, Juan Carlos; Mutchinick, Osvaldo M.

2016-01-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme in folate metabolism. Folate deficiency has been related to several conditions, including neural tube defects (NTDs) and cardiovascular diseases. Hence, MTHFR genetic variants have been studied worldwide, particularly the C677T and A1298C. We genotyped the C677T and A1298C MTHFR polymorphisms in Mexican Amerindians (MAs), from the largest sample included in a genetic study (n = 2026, from 62 ethnic groups), and in a geographically-matched Mexican Mestizo population (MEZ, n = 638). The 677T allele was most frequent in Mexican individuals, particularly in MAs. The frequency of this allele in both MAs and MEZs was clearly enriched in the South region of the country, followed by the Central East and South East regions. In contrast, the frequency of the 1298C risk allele in Mexicans was one of the lowest in the world. Both in MAs and MEZs the variants 677T and 1298C displayed opposite allele frequency gradients from southern to northern Mexico. Our findings suggest that in Mestizos the 677T allele was derived from Amerindians while the 1298C allele was a European contribution. Some subgroups showed an allele frequency distribution that highlighted their genetic diversity. Notably, the distribution of the frequency of the 677T allele was consistent with that of the high incidence of NTDs reported in MEZ. PMID:27649570

Polymorphisms of APLN-APLNR system are associated with essential hypertension in Mexican-Mestizo individuals.

PubMed

Esteban-Martínez, Rosa Lilia; Pérez-Razo, Juan Carlos; Vargas-Alarcón, Gilberto; Martínez-Rodríguez, Nancy; Cano-Martínez, Luis Javier; López-Hernández, Luz Berenice; Rojano-Mejía, David; Canto, Patricia; Coral-Vazquez, Ramón Mauricio

2016-08-01

The aim of this study was to evaluate if polymorphisms of APLN and APLNR genes may play a role as susceptibility markers for hypertension in a group of Mexican-Mestizo patients. A case-control study was carried out including normotensive and hypertensive individuals. For these, two polymorphisms of APLN (rs3761581 and rs56204867) and two of APLNR () genes were genotyped by 5' exonuclease TaqMan assay in 400 normotensive individuals and 383 patients. The results showed that, under an additive model adjusted by BMI, HDL, triglycerides, glucose and family history of essential hypertension, the rs7119375 and rs10501367 polymorphisms of APLNR gene were associated significantly with a decreased risk of essential hypertension (P=0.039 and P=0.029, respectively). Besides, the haplotypes analysis of these polymorphisms showed that H1 haplotype was associated with an increased risk of essential hypertension (P=0.026), while the H2 haplotype was associated with a decreased risk (P=0.032). Contrary, the rs3761581 and rs56204867 polymorphisms of APLN gene were not associated with essential hypertension (P=0.1707 and P=0.0769, respectively). The data suggest that APLNR rs7119375 and rs10501367 are associated with a decreased risk of essential hypertension in our Mexican-Mestizo studied group, but further studies are warranted. Copyright © 2016 Elsevier Inc. All rights reserved.

Admixture and genetic relationships of Mexican Mestizos regarding Latin American and Caribbean populations based on 13 CODIS-STRs.

PubMed

Salazar-Flores, J; Zuñiga-Chiquette, F; Rubi-Castellanos, R; Álvarez-Miranda, J L; Zetina-Hérnandez, A; Martínez-Sevilla, V M; González-Andrade, F; Corach, D; Vullo, C; Álvarez, J C; Lorente, J A; Sánchez-Diz, P; Herrera, R J; Cerda-Flores, R M; Muñoz-Valle, J F; Rangel-Villalobos, H

2015-02-01

Short tandem repeats (STRs) of the combined DNA index system (CODIS) are probably the most employed markers for human identification purposes. STR databases generated to interpret DNA profiles are also helpful for anthropological purposes. In this work, we report admixture, population structure, and genetic relationships of Mexican Mestizos with respect to Latin American and Caribbean populations based on 13 CODIS-STRs. In addition, new STR population data were included from Tijuana, Baja California (Northwest, Mexico), which represents an interesting case of elevated genetic flow as a bordering city with the USA. Inter-population analyses included CODIS-STR data from 11 Mexican Mestizo, 12 Latin American and four Caribbean populations, in addition to European, Amerindian, and African genetic pools as ancestral references. We report allele frequencies and statistical parameters of forensic interest (PD, PE, Het, PIC, typical PI), for 15 STRs in Tijuana, Baja California. This Mexican border city was peculiar by the increase of African ancestry, and by presenting three STRs in Hardy-Weinberg disequilibrium, probably explained by recurrent gene flow. The Amerindian ancestry in Central and Southeast of Mexico was the greatest in Latin America (50.9-68.6%), only comparable with the North of Central America and Ecuador (48.8-56.4%), whereas the European ancestry was prevalent in South America (66.7-75%). The African ancestry in Mexico was the smallest (2.2-6.3%) in Latin America (≥ 2.6%), particularly regarding Brazil (21%), Honduras (62%), and the Caribbean (43.2-65.2%). CODIS-STRs allowed detecting significant population structure in Latin America based on greater presence of European, Amerindian, and African ancestries in Central/South America, Mexican Mestizos, and the Caribbean, respectively. Copyright © 2014 Elsevier GmbH. All rights reserved.

Forensic efficiency parameters of the Investigator Argus X-12 kit in women from two Mestizo and seven Amerindian populations from Mexico.

PubMed

Cortés-Trujillo, I; Ramos-González, B; Salas-Salas, O; Zuñiga-Chiquette, F; Zetina Hernández, A; Martínez-Cortés, G; Ruiz-Hernández, M; González-Martín, A; Ferragut, J F; Rangel-Villalobos, H

2017-05-01

Allele frequency distribution and statistical parameters of forensic efficiency concerning the Investigator Argus X-12 kit (Qiagen, Hilden, Germany) were determined in a total sample of 641 unrelated Mexican females, including two Mestizo-admixed- populations (n=309) and seven Amerindian groups (n=332) from the main regions of the country. Most of the 12 X-STRs were in agreement with Hardy-Weinberg expectations in all nine Mexican populations. The power of discrimination in females (PD) and Median exclusion chance for trios (MEC T ) and duos (MEC D ) of this genetic system based on X-STRs were >99.99%. Although Mexican populations showed significant pairwise differentiation, a closer relationship was evident between Amerindian groups and nearby Mestizos, in agreement with historical records, previous genetic studies, and X-linked inheritance pattern expectations. Copyright © 2017 Elsevier B.V. All rights reserved.

"El Escalafon y el Doble Turno": An International Perspective on School Director Preparation

ERIC Educational Resources Information Center

Slater, Charles L.; Boone, Mike; Nelson, Sarah; De La Colina, Maria; Garcia, Elizabeth; Grimaldo, Leticia; Rico, Grace; Rodriguez, Sonia; Sirios, Cheryl; Womack, Damaris; Garduno, Jose Maria Garcia; Arriaga, Ruth

2006-01-01

"El Escalafon" is the process for appointing school directors and "el Doble Turno" is the double shift of morning and afternoon session in Mexican schools. These two concepts open the door to examine more general issues in the appointment of school directors and the structure of the school day. Director appointment and school…

Factors affecting ethnobotanical knowledge in a mestizo community of the Sierra de Huautla Biosphere Reserve, Mexico

PubMed Central

2014-01-01

Background Worldwide, mestizo communities’s ethnobotanical knowledge has been poorly studied. Based on a mestizo group in Mexico, this study assesses a) the use value (UV) of the local flora, b) gendered differences in plant species, and c) the association between socio-economic variables and ethnobotanical knowledge. Methods To assess the degree of knowledge of plant resources, we conducted 41 interviews collecting information on knowledge of local plant resources and the socio-economic situation of the informant. We also collected free listings of useful plants by category of use to identify the UV of each species. With the support of key informants, we photographed and collected the plant material recorded during the interviews and free listings on five different habitats. Paired t-tests and a Wilcoxon signed rank test were used to determine differences in the number of species known by men and women. Differences in distribution were analyzed by means of the Shapiro–Wilk’s W normality tests. To determine the association of socio-economic factors and ethnobotanical knowledge, we used a non-metric multidimensional scaling analysis (NMDS). Results Informants listed 185 species. Medicinal plants constituted the most diverse group (90 species). Tropical deciduous forest is the habitat that concentrates the highest proportion of plant resources (80 species). The use-values were classified into three groups: A (4–6 UV; three species), B (0.35-1.37 UV; 39 species) and C (0–0.29 UV; 143 species). High-quality wood species and those associated to religious ceremonies had the highest UV. Women’s and men’s knowledge of plant species showed statistically significant differences at the interspecific and the intracategorical levels (Student’s test, T15 = 4.8, p < 0.001). Occupation, gender and age were statistically significant associated to ethnobotanical knowledge (p < 0.05), whereas income, education level, and place of origin were not. Conclusion This

Factors affecting ethnobotanical knowledge in a mestizo community of the Sierra de Huautla Biosphere Reserve, Mexico.

PubMed

Beltrán-Rodríguez, Leonardo; Ortiz-Sánchez, Amanda; Mariano, Nestor A; Maldonado-Almanza, Belinda; Reyes-García, Victoria

2014-01-27

Worldwide, mestizo communities' ethnobotanical knowledge has been poorly studied. Based on a mestizo group in Mexico, this study assesses a) the use value (UV) of the local flora, b) gendered differences in plant species, and c) the association between socio-economic variables and ethnobotanical knowledge. To assess the degree of knowledge of plant resources, we conducted 41 interviews collecting information on knowledge of local plant resources and the socio-economic situation of the informant. We also collected free listings of useful plants by category of use to identify the UV of each species. With the support of key informants, we photographed and collected the plant material recorded during the interviews and free listings on five different habitats. Paired t-tests and a Wilcoxon signed rank test were used to determine differences in the number of species known by men and women. Differences in distribution were analyzed by means of the Shapiro-Wilk's W normality tests. To determine the association of socio-economic factors and ethnobotanical knowledge, we used a non-metric multidimensional scaling analysis (NMDS). Informants listed 185 species. Medicinal plants constituted the most diverse group (90 species). Tropical deciduous forest is the habitat that concentrates the highest proportion of plant resources (80 species). The use-values were classified into three groups: A (4-6 UV; three species), B (0.35-1.37 UV; 39 species) and C (0-0.29 UV; 143 species). High-quality wood species and those associated to religious ceremonies had the highest UV. Women's and men's knowledge of plant species showed statistically significant differences at the interspecific and the intracategorical levels (Student's test, T15 = 4.8, p < 0.001). Occupation, gender and age were statistically significant associated to ethnobotanical knowledge (p < 0.05), whereas income, education level, and place of origin were not. This research improves our understanding of the socio

Bone mineral density in postmenopausal Mexican-Mestizo women with normal body mass index, overweight, or obesity.

PubMed

Méndez, Juan Pablo; Rojano-Mejía, David; Pedraza, Javier; Coral-Vázquez, Ramón Mauricio; Soriano, Ruth; García-García, Eduardo; Aguirre-García, María Del Carmen; Coronel, Agustín; Canto, Patricia

2013-05-01

Obesity and osteoporosis are two important public health problems that greatly impact mortality and morbidity. Several similarities between these complex diseases have been identified. The aim of this study was to analyze if different body mass indexes (BMIs) are associated with variations in bone mineral density (BMD) among postmenopausal Mexican-Mestizo women with normal weight, overweight, or different degrees of obesity. We studied 813 postmenopausal Mexican-Mestizo women. A structured questionnaire for risk factors was applied. Height and weight were used to calculate BMI, whereas BMD in the lumbar spine (LS) and total hip (TH) was measured by dual-energy x-ray absorptiometry. We used ANCOVA to examine the relationship between BMI and BMDs of the LS, TH, and femoral neck (FN), adjusting for confounding factors. Based on World Health Organization criteria, 15.13% of women had normal BMI, 39.11% were overweight, 25.96% had grade 1 obesity, 11.81% had grade 2 obesity, and 7.99% had grade 3 obesity. The higher the BMI, the higher was the BMD at the LS, TH, and FN. The greatest differences in size variations in BMD at these three sites were observed when comparing women with normal BMI versus women with grade 3 obesity. A higher BMI is associated significantly and positively with a higher BMD at the LS, TH, and FN.

Hb S [β6(A3)Glu→Val, GAG>GTG] in Mexican Mestizos: frequency and analysis of the 5' β-globin haplotype.

PubMed

Guzmán, Luis F; Perea, Francisco J; Magaña, María T; Morales-González, Karina R; Chávez-Velazco, M Luz; Ibarra, Bertha

2010-01-01

Between 1978 and 2009, we studied 1,863 Mexican Mestizo patients with clinical data compatible with a hemoglobinopathy. Of these patients, 382 had some hemoglobin (Hb) abnormality (20.5%), 128 had a sickle cell hemoglobinopathy, representing a general frequency of 6.9%, which is similar to the percentage observed in previous studies on Mexican Mestizos. We analyzed the 5' β-globin haplotype (5'Hp) in 79 unrelated β(S) chromosomes (26 β(S)/β(S), 14 β(S)/β(Thal), nine β(S)/β(A) and four β(S)/β(D)), and four haplotypes were observed: 72.2% CAR 24.1% Benin, 2.5% Senegal and 1.2% Cameroon; the last two are reported for first time in Mexico. In some Latin American populations such as Brazil, the Bantu haplotype predominates, while in others such as Jamaica, the Benin haplotype is the most frequent, showing heterogeneity of African genes as a consequence of different regions involved in the slave trade.

Disease features and outcomes in United States lupus patients of Hispanic origin and their Mestizo counterparts in Latin America: a commentary

PubMed Central

Pons-Estel, Guillermo J.; Molineros, Julio; Wojdyla, Daniel; McGwin, Gerald; Nath, Swapan K.; Pons-Estel, Bernardo A.; Alarcón-Riquelme, Marta; Alarcón, Graciela S.

2016-01-01

Objective. To evaluate disease features and outcomes in two populations with significant Amerindian ancestry. Methods. Hispanic patients (from Texas) from the Lupus in Minorities: Nature versus Nurture (LUMINA) cohort and Mestizo patients from the Grupo Latino Americano De Estudio del Lupus or Latin American Group for the Study of Lupus (GLADEL) cohort were included. Disease features and outcomes were evaluated at baseline and last visit. Admixture informative markers of Mestizo Genoma de Lupus Eritematoso Sistémico Network consortium (GENLES) patients and Hispanic LUMINA patients were compared. Univariable analyses were performed using Chi square or Student’s t test as appropriate. Multivariable analyses adjusting for possible confounders were carried out using Poisson, logistic or Cox regression models as appropriate. Results. A total of 114 LUMINA and 619 GLADEL patients were included. GLADEL patients had accrued more damage at baseline, but the opposite was the case at last visit. Being from LUMINA was a risk factor for damage accrual, even after adjusting for possible confounders [relative risk (RR) 1.33, 95% CI 1.12, 1.58]. Also, LUMINA patients have a higher risk of mortality than GLADEL patients [hazard ratio (HR) 2.37, 95% CI 1.10, 5.15], having 5-year survival of 85.6% and 94.5%, respectively. In addition, 79 LUMINA patients and 744 Mestizo GENLES patients were evaluated in order to compare genetic ancestry between the two groups; GENLES patients had a higher proportion of European ancestry (48.5% vs 43.3%, P = 0.003) and a lower proportion of Asian ancestry (3.7% vs 4.9%, P = 0.048), but the proportions of Amerindian and African ancestry were comparable in both. Conclusion. USA Hispanic patients seemed to have a poorer prognosis than their counterparts from Latin America, despite having a comparable genetic background. Socioeconomic factors may account for these observations. PMID:26412809

Association between the APOE ε4 Allele and Late-Onset Alzheimer's Disease in an Ecuadorian Mestizo Population

PubMed Central

Calero, Cristian; Vinueza, Rodrigo; Correa, Patricio; Carrera-Gonzalez, Andrea; Villegas, Franklin; Moreta, Germania; Paredes, Rosario

2017-01-01

Alzheimer's disease (AD) is the most common neurodegenerative disease. It has two main pathological hallmarks: amyloid plaques and neurofibrillary tangles. The APOE ε4 allele has been recognized as the strongest genetic risk factor for late-onset Alzheimer's disease (LOAD) in several populations worldwide, yet the risk varies by region and ethnicity. The aims of this study were to describe APOE allele and genotype frequencies and examine the relationship between the APOE ε4 allele and LOAD risk in an Ecuadorian Mestizo population. We carried out a case-control study comprising 56 individuals clinically diagnosed with probable AD (≥65 years of age) and 58 unrelated healthy control subjects (≥65 years of age). Genotyping was performed using the real-time PCR method. Our data showed that allelic and genotypic frequencies follow the trends observed in most worldwide populations. We also found a high-risk association between APOE ε4 allele carriers and LOAD (OR = 7.286; 95% CI = 2.824–18.799; p < 0.001). Therefore, we concluded that APOE ε4 must be considered an important genetic risk factor for LOAD in the Ecuadorian Mestizo population. Additionally, we suggest that in mixed populations the effects of admixture and ethnic identity should be differentiated when evaluating genetic contributions to Alzheimer's disease risk. PMID:29348964

Distribution of CYP2D6 and CYP2C19 Polymorphisms Associated with Poor Metabolizer Phenotype in Five Amerindian Groups and Western Mestizos from Mexico

PubMed Central

Salazar-Flores, Joel; Torres-Reyes, Luis A.; Martínez-Cortés, Gabriela; Rubi-Castellanos, Rodrigo; Sosa-Macías, Martha; Muñoz-Valle, José F.; González-González, César; Ramírez, Angélica; Román, Raquel; Méndez, José L.; Barrera, Andrés; Torres, Alfredo; Medina, Rafael

2012-01-01

Background: The distribution of polymorphisms in the CYP2D6 and CYP2C19 genes allows inferring the potential risk for specific adverse drug reactions and lack of therapeutic effects in humans. This variability shows differences among human populations. The aim of this study was to analyze single-nucleotide polymorphisms related to a poor metabolizer (PM) phenotype in nonpreviously studied Amerindian groups and Mestizos (general admixed population) from Mexico. Methods: We detected by SNaPshot® different polymorphisms located in CYP2D6 (*3, *4, *6, *7, and *8) and CYP2C19 (*2, *3, *4 and *5) in western Mestizos (n=145) and five Amerindian groups from Mexico: Tarahumaras from the North (n=88); Purépechas from the Center (n=101); and Tojolabales (n=68), Tzotziles (n=88), and Tzeltales (n=20) from the Southeast. Genotypes were observed by capillary electrophoresis. The genetic relationships among these populations were estimated based on these genes. Results and Discussion: The wild-type allele (*1) of both genes was predominant in the Mexican populations studied. The most widely observed alleles were CYP2C19*2 (range, 0%–31%) and CYP2D6*4 (range, 1.2%–7.3%), whereas CYP2D6*3 was exclusively detected in Mestizos. Conversely, CYP2C19*4 and *5, as well as CYP2D6*3, *6, *7, and *8, were not observed in the majority of the Mexican populations. The Tarahumaras presented a high frequency of the allele CYP2C19*2 (31%) and of homozygotes *2/*2 (10.7%), which represent a high frequency of potentially PM phenotypes in this Amerindian group. The genetic distances showed high differentiation of Tarahumaras (principally for CYP2C19 gene). In general, a relative proximity was observed between most of the Amerindian, Mexican-Mestizo, and Latin-American populations. Conclusion: In general, the wild-type allele (*1) predominates in Mexican populations, outlining a relatively homogeneous distribution for CYP2C19 and CYP2D6. The exception is the Tarahumara group that displays a

Disease features and outcomes in United States lupus patients of Hispanic origin and their Mestizo counterparts in Latin America: a commentary.

PubMed

Ugarte-Gil, Manuel F; Pons-Estel, Guillermo J; Molineros, Julio; Wojdyla, Daniel; McGwin, Gerald; Nath, Swapan K; Pons-Estel, Bernardo A; Alarcón-Riquelme, Marta; Alarcón, Graciela S

2016-03-01

To evaluate disease features and outcomes in two populations with significant Amerindian ancestry. Hispanic patients (from Texas) from the Lupus in Minorities: Nature versus Nurture (LUMINA) cohort and Mestizo patients from the Grupo Latino Americano De Estudio del Lupus or Latin American Group for the Study of Lupus (GLADEL) cohort were included. Disease features and outcomes were evaluated at baseline and last visit. Admixture informative markers of Mestizo Genoma de Lupus Eritematoso Sistémico Network consortium (GENLES) patients and Hispanic LUMINA patients were compared. Univariable analyses were performed using Chi square or Student's t test as appropriate. Multivariable analyses adjusting for possible confounders were carried out using Poisson, logistic or Cox regression models as appropriate. A total of 114 LUMINA and 619 GLADEL patients were included. GLADEL patients had accrued more damage at baseline, but the opposite was the case at last visit. Being from LUMINA was a risk factor for damage accrual, even after adjusting for possible confounders [relative risk (RR) 1.33, 95% CI 1.12, 1.58]. Also, LUMINA patients have a higher risk of mortality than GLADEL patients [hazard ratio (HR) 2.37, 95% CI 1.10, 5.15], having 5-year survival of 85.6% and 94.5%, respectively. In addition, 79 LUMINA patients and 744 Mestizo GENLES patients were evaluated in order to compare genetic ancestry between the two groups; GENLES patients had a higher proportion of European ancestry (48.5% vs 43.3%, P = 0.003) and a lower proportion of Asian ancestry (3.7% vs 4.9%, P = 0.048), but the proportions of Amerindian and African ancestry were comparable in both. USA Hispanic patients seemed to have a poorer prognosis than their counterparts from Latin America, despite having a comparable genetic background. Socioeconomic factors may account for these observations. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights

PPARGC1A and ADIPOQ polymorphisms are associated with aggressive prostate cancer in Mexican-Mestizo men with overweight or obesity.

PubMed

Canto, Patricia; Granados, Jesús Benítez; Feria-Bernal, Guillermo; Coral-Vázquez, Ramón Mauricio; García-García, Eduardo; Tejeda, María Elena; Tapia, André; Rojano-Mejía, David; Méndez, Juan Pablo

2017-07-04

Obesity constitutes a risk factor for the development of aggressive forms of prostate cancer. It has been proposed, that prostate cancer has a genetic predisposition and that PPARGC1A and ADIPOQ polymorphisms play a role in the development of this condition. To analyse the association of two PPARGC1A and ADIPOQ polymorphisms as well as their haplotypes, with the development of aggressive prostate cancer in Mexican-Mestizo men with overweight or obesity. Two hundred fifty seven men with prostate cancer of Mexican-Mestizo origin were included. Body mass index (BMI) was determined and the degree of prostate cancer aggressiveness by the D'Amico classification. DNA was obtained. Rs7665116 and rs2970870 of PPARGC1A, and rs266729 and rs1501299 of ADIPOQ were studied by real-time PCR allelic discrimination. Pairwise linkage disequilibrium, between single nucleotide polymorphisms was calculated and haplotype analysis was performed. A higher-risk (D'Amico classification) was observed in 21.8% of patients. An association of cancer aggressiveness with rs2970870 of PPARGC1A, and rs501299 of ADIPOQ, as well as with one haplotype of ADIPOQ was documented. This is the first study regarding the relationship of PPARGC1A and ADIPOQ polymorphisms, and the aggressiveness of prostate cancer in men with overweight or obesity.

Contribution of Common Genetic Variation to the Risk of Type 2 Diabetes in the Mexican Mestizo Population

PubMed Central

Gamboa-Meléndez, Marco Alberto; Huerta-Chagoya, Alicia; Moreno-Macías, Hortensia; Vázquez-Cárdenas, Paola; Ordóñez-Sánchez, María Luisa; Rodríguez-Guillén, Rosario; Riba, Laura; Rodríguez-Torres, Maribel; Guerra-García, María Teresa; Guillén-Pineda, Luz Elizabeth; Choudhry, Shweta; del Bosque-Plata, Laura; Canizales-Quinteros, Samuel; Pérez-Ortiz, Gustavo; Escobedo-Aguirre, Fernando; Parra, Adalberto; Lerman-Garber, Israel; Aguilar-Salinas, Carlos Alberto; Tusié-Luna, María Teresa

2012-01-01

Several studies have identified nearly 40 different type 2 diabetes susceptibility loci, mainly in European populations, but few of them have been evaluated in the Mexican population. The aim of this study was to examine the extent to which 24 common genetic variants previously associated with type 2 diabetes are associated in Mexican Mestizos. Twenty-four single nucleotide polymorphisms (SNPs) in or near genes (KCNJ11, PPARG, TCF7L2, SLC30A8, HHEX, CDKN2A/2B, CDKAL1, IGF2BP2, ARHGEF11, JAZF1, CDC123/CAMK1D, FTO, TSPAN8/LGR5, KCNQ1, THADA, ADAMTS9, NOTCH2, NXPH1, RORA, UBQLNL, and RALGPS2) were genotyped in Mexican Mestizos. A case-control association study comprising 1,027 type 2 diabetic individuals and 990 control individuals was conducted. To account for population stratification, a panel of 104 ancestry-informative markers was analyzed. Association to type 2 diabetes was found for rs13266634 (SLC30A8), rs7923837 (HHEX), rs10811661 (CDKN2A/2B), rs4402960 (IGF2BP2), rs12779790 (CDC123/CAMK1D), and rs2237892 (KCNQ1). In addition, rs7754840 (CDKAL1) was associated in the nonobese type 2 diabetic subgroup, and for rs7903146 (TCF7L2), association was observed for early-onset type 2 diabetes. Lack of association for the rest of the variants may have resulted from insufficient power to detect smaller allele effects. PMID:22923468

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

PubMed

González-Mercado, A; Sánchez-López, J Y; Regla-Nava, J A; Gámez-Nava, J I; González-López, L; Duran-Gonzalez, J; Celis, A; Perea-Díaz, F J; Salazar-Páramo, M; Ibarra, B

2013-07-30

We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.

Genetic structure of Mexican Mestizo women with breast cancer based on three STR loci.

PubMed

Calderón-Garcidueñas, Ana L; Rivera-Prieto, Roxana A; Ortíz-Lopez, Rocio; Rivas, Fernando; Barrera-Saldaña, Hugo A; Peñaloza-Espinosa, Rosenda I; Cerda-Flores, Ricardo M

2008-01-01

The aim of this population genetics study was to compare the genetic structure of Mexican women with breast cancer (BrCa) with previously reported data of four random populations (Nuevo León, Hispanics, Chihuahua, and Central Region of Mexico). A sample of 115 unrelated women with BrCa and whose four grandparents were born in five zones of Mexico were interviewed at a reference hospital in Northeastern Mexico. Noncodifying STRs D7S820, D13S317, and D16S39 were analyzed; genotype distribution was in agreement with Hardy-Weinberg expectations for all three markers. Similar allele frequencies among four random populations and this selected population were found. According with this and previous studies using molecular and nonmolecular nuclear DNA markers not associated with any disease, Mexican Mestizo population is genetically homogeneous and therefore, genetic causes of BrCa are less heterogeneous, simplifying genetic epidemiologic studies.

A Pilot Genome-Wide Association Study in Postmenopausal Mexican-Mestizo Women Implicates the RMND1/CCDC170 Locus Is Associated with Bone Mineral Density

PubMed Central

Villalobos-Comparán, Marisela; Estrada, Karol; Parra-Torres, Alma Y.; González-Mercado, Anahí; Patiño, Nelly; Castillejos-López, Manuel; Quiterio, Manuel; Fernandez-López, Juan Carlos; Ibarra, Bertha; Romero-Hidalgo, Sandra; Salmerón, Jorge

2017-01-01

To identify genetic variants influencing bone mineral density (BMD) in the Mexican-Mestizo population, we performed a GWAS for femoral neck (FN) and lumbar spine (LS) in Mexican-Mestizo postmenopausal women. In the discovery sample, 300,000 SNPs were genotyped in a cohort of 411 postmenopausal women and seven SNPs were analyzed in the replication cohort (n = 420). The combined results of a meta-analysis from the discovery and replication samples identified two loci, RMND1 (rs6904364, P = 2.77 × 10−4) and CCDC170 (rs17081341, P = 1.62 × 10−5), associated with FN BMD. We also compared our results with those of the Genetic Factors for Osteoporosis (GEFOS) Consortium meta-analysis. The comparison revealed two loci previously reported in the GEFOS meta-analysis: SOX6 (rs7128738) and PKDCC (rs11887431) associated with FN and LS BMD, respectively, in our study population. Interestingly, rs17081341 rare in Caucasians (minor allele frequency < 0.03) was found in high frequency in our population, which suggests that this association could be specific to non-Caucasian populations. In conclusion, the first pilot Mexican GWA study of BMD confirmed previously identified loci and also demonstrated the importance of studying variability in diverse populations and/or specific populations. PMID:28840121

Ultrasound, histopathological, and genetic features of uveal melanoma in a Mexican-Mestizo population.

PubMed

Delgado, S; Rodriguez Reyes, A; Mora Rios, L; Dueñas-González, A; Taja-Chayeb, L; Moragrega Adame, E

2018-01-01

To describe the ultrasound, histopathological and genetic characteristics of uveal melanoma in a Mexican-Mestizo population. A total of 39 enucleated eyes with a histopathological diagnosis of uveal melanoma were assessed by describing the clinical findings, and ultrasound, histopathological and genetic features. A high correlation was observed between tumour height measurement using ultrasound and histopathology. In our cases, tumour size and reflectivity were higher compared with those reported in the literature. The preliminary data on the molecular assessment of the tumours show the presence of an unreported polymorphism (T>C IVS5+34) and one sample with GNAQ mutation (A>C CAA>CCA Gln 209 Pro). Ultrasound is a reliable method to identify the size of the tumour. Furthermore, knowledge of the molecular mechanisms promises new perspectives for the development of new targeted therapeutics. Fortunately this leads to progress in the treatment of patients with metastatic disease or prevents it in those at high risk. Copyright © 2017 Sociedad Española de Oftalmología. Publicado por Elsevier España, S.L.U. All rights reserved.

EBV+ lymphoepithelial carcinoma of the parotid gland in Mexican Mestizo patients with chronic autoimmune diseases.

PubMed

Saqui-Salces, Milena; Martinez-Benitez, Braulio; Gamboa-Dominguez, Armando

2006-01-01

Lymphoepithelial carcinomas of the salivary gland are rare tumors constantly associated with Epstein-Barr virus (EBV) and mainly identified in Asiatic and Greenlander population. Four cases have been described in Caucasians, only two with EBV infection. We describe two cases of parotid gland lymphoepithelial carcinomas in Mexican mestizo women in which chronic latent EBV infection was documented by immunohistochemistry and in situ hybridization. One patient had primary Sjögren's syndrome and the other systemic lupus erythematosus of six and three years of evolution, respectively. Epithelial neoplastic cells showed latency pattern II (LMP1+, EBNA-2-, EBER+) with a dense inflammatory infiltrate composed mainly by CD8+ T lymphocytes. Follow-up excluded nasopharyngeal involvement in both patients. This report expands the ethnic groups in which salivary lymphoepithelial carcinomas associated with chronic latent EBV infection have been described, and illustrates for the first time its association with autoimmune diseases in two women living in a region non-endemic for this unusual neoplasm.

Medicinal use of wild fauna by mestizo communities living near San Guillermo Biosphere Reserve (San Juan, Argentina).

PubMed

Hernandez, Jorge; Campos, Claudia M; Borghi, Carlos E

2015-01-21

Wild and domestic animals and their by-products are important ingredients in the preparation of curative, protective and preventive medicines. Despite the medicinal use of animals worldwide, this topic has received less attention than the use of medicinal plants. This study assessed the medicinal use of animals by mestizo communities living near San Guillermo MaB Reserve by addressing the following questions: What animal species and body parts are used? What ailments or diseases are treated with remedies from these species? To what extent do mestizo people use animals as a source of medicine? Is the use related to people's age? We conducted semi-structured interviews with 171 inhabitants (15-93 years old) of four villages close to the Reserve: Tudcúm, Angualasto, Malimán and Colangüil. We calculated the informant consensus factor and fidelity level to test homogeneity of knowledge and to know the importance of different medicinal uses for a given species. The medicinal use of animals was reported by 57% of the surveyed people. Seven species were mentioned: Rhea pennata, Lama guanicoe, Puma concolor, Pseudalopex sp., Lama vicugna, Lepus europaeus and Conepatus chinga. Several body parts were used: fat, leg, bezoar-stone, stomach, feather, meat, blood, feces, wool, and liver. The fat of R. pennata was the most frequently used animal part, followed by the bezoar stone and the leg of L. guanicoe. Animals were used to treat 22 ailments, with respiratory and nervous system disorders being the most frequently treated diseases with a high degree of consensus. Old people used animals as remedies more frequently than young residents, showing some differences among villages. A low number of animal species was mentioned as used for medicinal purposes, which could be explained by the perception of strong control related the legislation that bans hunting and the erosion of traditional knowledge produced by mestizaje. However, the presence of a traditional medicine is deeply

The 482Ser of PPARGC1A and 12Pro of PPARG2 Alleles Are Associated with Reduction of Metabolic Risk Factors Even Obesity in a Mexican-Mestizo Population.

PubMed

Vázquez-Del Mercado, Mónica; Guzmán-Ornelas, Milton-Omar; Corona Meraz, Fernanda-Isadora; Ríos-Ibarra, Clara-Patricia; Reyes-Serratos, Eduardo-Alejandro; Castro-Albarran, Jorge; Ruíz-Quezada, Sandra-Luz; Navarro-Hernández, Rosa-Elena

2015-01-01

The aim of this study was to investigate the relationship between functional polymorphisms Gly482Ser in PPARGC1A and Pro12Ala in PPARG2 with the presence of obesity and metabolic risk factors. We included 375 individuals characterized as Mexican-Mestizos and classified by the body mass index (BMI). Body dimensions and distribution of body fat were measured. The HOMA-IR and adiposity indexes were calculated. Adipokines and metabolic profile quantification were performed by ELISA and routine methods. Genetic polymorphisms were determined by polymerase chain reaction restriction fragment length polymorphism analysis. A difference between obese and nonobese subjects in polymorphism PPARGC1A distribution was observed. Among obese individuals, carriers of genotype 482Gly/Gly were observed to have decreased body fat, BMI, and body fat ratio versus 482Ser/Ser carriers and increased resistin and leptin levels in carriers Gly+ phenotype versus Gly- phenotype. Subjects with PPARG2 Ala- phenotype (genotype 12Pro/Pro) showed a decreased HOMA-IR index versus individuals with Ala+ phenotype (genotypes 12Pro/Ala plus 12Ala/Ala). We propose that, in obese Mexican-Mestizos, the combination of alleles 482Ser in PPARGC1A and 12Pro in PPARG2 represents a reduced metabolic risk profile, even when the adiposity indexes are increased.

The 482Ser of PPARGC1A and 12Pro of PPARG2 Alleles Are Associated with Reduction of Metabolic Risk Factors Even Obesity in a Mexican-Mestizo Population

PubMed Central

Vázquez-Del Mercado, Mónica; Guzmán-Ornelas, Milton-Omar; Corona Meraz, Fernanda-Isadora; Ríos-Ibarra, Clara-Patricia; Reyes-Serratos, Eduardo-Alejandro; Castro-Albarran, Jorge; Ruíz-Quezada, Sandra-Luz; Navarro-Hernández, Rosa-Elena

2015-01-01

The aim of this study was to investigate the relationship between functional polymorphisms Gly482Ser in PPARGC1A and Pro12Ala in PPARG2 with the presence of obesity and metabolic risk factors. We included 375 individuals characterized as Mexican-Mestizos and classified by the body mass index (BMI). Body dimensions and distribution of body fat were measured. The HOMA-IR and adiposity indexes were calculated. Adipokines and metabolic profile quantification were performed by ELISA and routine methods. Genetic polymorphisms were determined by polymerase chain reaction restriction fragment length polymorphism analysis. A difference between obese and nonobese subjects in polymorphism PPARGC1A distribution was observed. Among obese individuals, carriers of genotype 482Gly/Gly were observed to have decreased body fat, BMI, and body fat ratio versus 482Ser/Ser carriers and increased resistin and leptin levels in carriers Gly+ phenotype versus Gly− phenotype. Subjects with PPARG2 Ala− phenotype (genotype 12Pro/Pro) showed a decreased HOMA-IR index versus individuals with Ala+ phenotype (genotypes 12Pro/Ala plus 12Ala/Ala). We propose that, in obese Mexican-Mestizos, the combination of alleles 482Ser in PPARGC1A and 12Pro in PPARG2 represents a reduced metabolic risk profile, even when the adiposity indexes are increased. PMID:26185753

Polymorphism of LRP5, but not of TNFRSF11B, is associated with a decrease in bone mineral density in postmenopausal Maya-Mestizo women.

PubMed

Canto-Cetina, Thelma; Polanco Reyes, Lucila; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia

2013-01-01

Osteoporosis is a complex disease characterized principally by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic, and environmental factors. The aim of this study was to analyze the possible association among one polymorphism of LRP5 and three polymorphisms of TNFRSF11B as well as their haplotypes with BMD variations in Maya-Mestizo postmenopausal women. We studied 583 postmenopausal women of Maya-Mestizo ethnic origin. A structured questionnaire for risk factors was applied and BMD was measured in lumbar spine (LS), total hip (TH), and femoral neck (FN) by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. One single-nucleotide polymorphism of LRP5 (rs3736228, p.A1330V) and three of TNFRSF11B (rs4355801, rs2073618, and rs6993813) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analyzed with covariance. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis of TNFRSF11B was conducted. The Val genotype of the rs3736228 (p.A1330V) of LRP5 was significantly associated with BMD variations at the LS, TH, and FN. None of the three polymorphisms of TNFRSF11B was associated with BMD variations. Our results show that p.A1330V was significantly associated with BMD variations at all three skeletal sites analyzed; the Val allele and the Val/Val genotype were those most frequently found in our population. Copyright © 2013 Wiley Periodicals, Inc.

Forensic-paternity effectiveness and genetics population analysis of six non-CODIS mini-STR loci (D1S1656, D2S441, D6S1043, D10S1248, D12S391, D22S1045) and SE33 in Mestizo and Amerindian populations from Mexico.

PubMed

Burguete-Argueta, Nelsi; Martínez De la Cruz, Braulio; Camacho-Mejorado, Rafael; Santana, Carla; Noris, Gino; López-Bayghen, Esther; Arellano-Galindo, José; Majluf-Cruz, Abraham; Antonio Meraz-Ríos, Marco; Gómez, Rocío

2016-11-01

STRs are powerful tools intensively used in forensic and kinship studies. In order to assess the effectiveness of non-CODIS genetic markers in forensic and paternity tests, the genetic composition of six mini short tandem repeats-mini-STRs-(D1S1656, D2S441, D6S1043, D10S1248, D12S391, D22S1045) and the microsatellite SE33 in Mestizo and Amerindian populations from Mexico were studied. Using multiplex polymerase chain reactions and capillary electrophoresis, this study genotyped all loci from 870 chromosomes and evaluated the statistical genetic parameters. All mini-STRs studied were in agreement with HW and linkage equilibrium; however, an important HW departure for SE33 was found in the Mestizo population (p ≤ 0.0001). Regarding paternity and forensic statistical parameters, high values of combined power discrimination and mean power of exclusion were found using these seven markers. The principal co-ordinate analysis based on allele frequencies of three mini-STRs showed the complex genetic architecture of the Mestizo population. The results indicate that this set of loci is suitable to genetically identify individuals in the Mexican population, supporting its effectiveness in human identification casework. In addition, these findings add new statistical values and emphasise the importance of the use of non-CODIS markers in complex populations in order to avoid erroneous assumptions.

HLA Alleles are Genetic Markers for Susceptibility and Resistance towards Leprosy in a Mexican Mestizo Population.

PubMed

Aguilar-Medina, Maribel; Escamilla-Tilch, Monica; Frías-Castro, Luis Octavio; Romero-Quintana, Geovanni; Estrada-García, Iris; Estrada-Parra, Sergio; Granados, Julio; Arambula Meraz, Eliakym; Sánchez-Schmitz, Guzman; Khader, Shabaana Abdul; Rangel-Moreno, Javier; Ramos-Payán, Rosalío

2017-01-01

Despite the use of multidrug therapy, leprosy remains endemic in some countries. The association of several human leucocyte antigen (HLA) alleles and gene polymorphisms with leprosy has been demonstrated in many populations, but the major immune contributors associated to the spectrum of leprosy have not been defined yet. In this study, genotyping of HLA-A, -B, -DR, and -DQ alleles was performed in leprosy patients (n = 113) and control subjects (n = 117) from the region with the highest incidence for the disease in México. The odds of developing leprosy and lepromatous subtype were 2.12- and 2.74-fold higher in carriers of HLA-A*28, and 2.48- and 4.14-fold higher for leprosy and dimorphic subtype in carriers of DQB1*06. Interestingly, DQB1*07 was overrepresented in healthy individuals, compared to patients with leprosy (OR = 0.08) and the lepromatous subtype (OR = 0.06). These results suggest that HLA-A*28 is a marker for predisposition to leprosy and the lepromatous subtype and DQB1*06 to leprosy and the dimorphic subtype, while DQB1*07 might be a resistance marker in this Mestizo population. © 2016 John Wiley & Sons Ltd/University College London.

Cardiovascular health status and metabolic syndrome in Ecuadorian natives/Mestizos aged 40 years or more with and without stroke and ischemic heart disease--an atahualpa project case-control nested study.

PubMed

Del Brutto, Oscar H; Mera, Robertino M; Montalván, Martha; Del Brutto, Victor J; Zambrano, Mauricio; Santamaría, Milton; Tettamanti, Daniel

2014-04-01

Knowledge of regional-specific cardiovascular risk factors is mandatory to reduce the growing burden of stroke and ischemic heart disease in Latin American populations. We conducted a population-based case-control study to assess which risk factors are associated with the occurrence of vascular events in natives/mestizos living in rural coastal Ecuador. We assessed the cardiovascular health (CVH) status and the presence of the metabolic syndrome in all Atahualpa residents aged 40 years or more with stroke and ischemic heart disease and in randomly selected healthy persons to evaluate differences in the prevalence of such risk factors between patients and controls. A total of 120 persons (24 with stroke or ischemic heart disease and 96 matched controls) were included. A poor CVH status (according to the American Heart Association) was found in 87.5% case-patients and 81.3% controls (P = .464). The metabolic syndrome was present in the same proportion (58.3%) of case-patients and controls. Likewise, both sets of risk factors (poor CVH status and the metabolic syndrome) were equally prevalent among both groups (58.3% versus 49%, P = .501). This case-control study suggests that none of the measured risk factors is associated with the occurrence of vascular events. It is possible that some yet unmeasured risk factors or an unknown genetic predisposition may account for a sizable proportion of stroke and ischemic heart disease occurring in the native/mestizo population of rural coastal Ecuador. Copyright © 2014 National Stroke Association. Published by Elsevier Inc. All rights reserved.

Intestinal microbiota assessment in cirrhotic patients from a Mexican mestizo population.

PubMed

Pérez-Monter, C; Escalona-Nandez, I; Estanes-Hernández, A; Noriega-López, L G; Torre-Delgadillo, A

2018-06-11

The intestinal microbiota is significantly altered in cirrhotic patients, but the composition of the intestinal microbiota in Mexican patients with the pathology has not been reported. The present study is an attempt to determine the type of intestinal microbiota in healthy subjects and in patients of Mexican mestizo origin that present with cirrhosis of the liver. Biochemical liver function parameters (ALT, AST, GGT, BIL-T, etc.) were determined in 23 cirrhotic patients and 21 control subjects. The intestinal microbiota was established through 16S ribosomal RNA gene sequencing. The cirrhotic patients had elevated levels of ALT, AST, GGT (105.2±77.7 vs. 20.99±8.5UI/L, 110±68.6 vs. 23.39±5.2, and 119.1±79.1 vs. 19.3±15.2UI/L, respectively), IL-6 (1.64±0.38pg/ml, P<.001), or TNFα (1.78±0.3, P<.05). The intestinal microbiota of the cirrhotic patients was less diverse, compared with that of the control subjects. At the level of the phylum, there was a significant increase in Proteobacteria and Bacteroidetes in the patients with cirrhosis, compared with the controls (6.2 vs. 4.9% and 44 vs. 46%, respectively, P<.01). In contrast, there was a decrease in Firmicutes, Actinobacteria, and Fusobacteria in the cirrhotic patients. There was an increase in the Campylobacter and Gemella families in the cirrhotic patients, whereas Streptococcus and Veillonella had a positive association with serum ALT or AST levels. To the best of our knowledge, the present study is the first to demonstrate the type of intestinal microbiota in Mexican patients with cirrhosis of the liver. The extension of the findings in a larger cohort of subjects and the metagenome analysis will enable the creation of data that can have relevant treatment implications for this group of patients in Mexico. Copyright © 2018 Asociación Mexicana de Gastroenterología. Publicado por Masson Doyma México S.A. All rights reserved.

The 3'UTR 1188A/C polymorphism of IL-12p40 is not associated with susceptibility for developing plaque psoriasis in Mestizo population from western Mexico.

PubMed

Sandoval-Talamantes, Ana Karen; Brito-Luna, Myrian Johanna; Fafutis-Morris, Mary; Villanueva-Quintero, Delfina Guadalupe; Graciano-Machuca, Omar; Ramírez-Dueñas, María Guadalupe; Alvarado-Navarro, Anabell

2015-02-01

Psoriasis is a chronic autoimmune inflammatory disease that affects the skin and the joints. Psoriasis is characterized by the keratinocyte proliferation, which is induced by cytokines Th1 and Th17. Patients with plaque psoriasis present a chronic inflammatory response with high levels of interleukin (IL)-12 and IL-23. Various single-nucleotide polymorphisms (SNP) have been identified in the IL12B gene, such as SNP 3' UTR 1188 A/C (SNP rs3212227), which has been associated with susceptibility to developing plaque psoriasis and with the production of IL-12 and IL-23 in individuals of different ethnic groups. In this study, we determined whether there is an association of SNP rs3212227 with the susceptibility of developing plaque psoriasis and with serum levels of IL-12 and IL-23 in Mestizo population in western Mexico. We included 112 patients with psoriasis and 112 clinical healthy individuals in the study. The frequencies of genotypes A/A, A/C, and C/C in patients with plaque psoriasis were 41, 53, and 6%, respectively, while in the control group, these were 37, 53, and 10%, respectively, without finding statistically significant differences between both groups (p>0.05). Although IL-12 and IL-23 serum levels were higher in patients than in controls, we found no significant differences. The group of patients with genotype CC presented the highest levels of IL-23 (p<0.05). These data suggest that the SNP rs3212227 phenotype is not associated with the risk of developing plaque psoriasis or with IL-12 and IL-23 levels in Mestizo population in western Mexico. Copyright © 2014 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

Breast Cancer Risk Associated with Genotype Polymorphisms of the Aurora Kinase a Gene (AURKA): a Case-Control Study in a High Altitude Ecuadorian Mestizo Population.

PubMed

López-Cortés, Andrés; Cabrera-Andrade, Alejandro; Oña-Cisneros, Fabián; Rosales, Felipe; Ortiz, Malena; Tejera, Eduardo; Paz-Y-Miño, César

2018-07-01

Breast cancer (BC) is the leading cause of cancer related death among women in 2014. The AURKA gene that encodes the protein called Aurora kinase A plays an important role in the progression of the cell cycle, by controlling and promoting the entry into the phase of mitosis. The single nucleotide polymorphism AURKA T91A (rs2273535) (Phe21Ile) has been identified as functional alternator of this kinase, the Ile allele is associated with the occurrence of chromosome segregation errors and tumor progression. Therefore, it is essential to know how BC risk is associated with histopathological characteristics, immunohistochemical characteristics, and genotype polymorphism in a high altitude Ecuadorian mestizo population. In this retrospective case-control study 200 individuals were analyzed. DNA was extracted from 100 healthy and 100 affected women. Genotypes were determined by genomic sequencing. We found significant association between the AURKA T91A (rs2273535) (Phe21Ile) genotype and an increased risk of BC development: Phe/Ile (odds ratio [OR] = 2.6; 95% confidence interval [CI] = 1.4-4.9; P = 0.004), Ile/Ile (OR = 3.8; 95% CI = 1.6-9.0; P = 0.002), and Phe/Ile + Ile/Ile (OR = 2.9; 95% CI = 1.6-5.2; P = 0.001). Additionally, the rs2273535 variant was associated with the tumor grade SBR III (OR = 9.6; 95% CI = 1.0-91.9; P = 0.048) and the Ki-67 ≥ 20 (OR = 16.5; 95% CI = 2.7-101.3; P = 0.002). In brief, this study provides the first evidence where the Ile allele of the AURKA gene could act as potentially predictive biomarker of BC in the high altitude Ecuadorian mestizo population that lives at 2800 m above sea level (masl).

Genetic structure of Mexican Mestizos with type 2 diabetes mellitus based on three STR loci.

PubMed

Cerda-Flores, Ricardo M; Rivera-Prieto, Roxana A; Pereyra-Alférez, Benito; Calderón-Garcidueñas, Ana L; Barrera-Saldaña, Hugo A; Gallardo-Blanco, Hugo L; Ortiz-López, Rocío; Flores-Peña, Yolanda; Cárdenas-Villarreal, Velia M; Rivas, Fernando; Figueroa, Andrés; Kshatriya, Gautam

2013-08-01

The aims of this population genetics study were: 1) to ascertain whether Mexicans with type 2 diabetes mellitus (DM) were genetically homogeneous and 2) to compare the genetic structure of this selected population with the previously reported data of four random populations (Nuevo León, Hispanics, Chihuahua, and Central Region of Mexico). A sample of 103 unrelated individuals with DM and whose 4 grandparents were born in five zones of Mexico was interviewed in 32 Medical Units in the Mexican Institute of Social Security (IMSS). The non-coding STRs D16S539, D7S820, and D13S317 were analyzed. Genotype distribution was in agreement with Hardy-Weinberg expectations for all three markers. Allele frequencies were found to be similar between the selected population and the four random populations. Gene diversity analysis suggested that more than 99.57% of the total gene diversity could be attributed to variation between individuals within the population and 0.43% between the populations. According to the present and previous studies using molecular and non-molecular nuclear DNA markers not associated with any disease, the Mexican Mestizo population is found to be genetically homogeneous and therefore the genetic causes of DM are less heterogeneous, thereby simplifying genetic epidemiological studies as has been found in a previous study with the same design in Mexican women with breast cancer. Published by Elsevier B.V.

Comparison of statin eligibility according to the Adult Treatment Panel III, ACC/AHA blood cholesterol guideline, and presence of carotid plaque by ultrasound in Mexican mestizo patients with rheumatoid arthritis.

PubMed

Galarza-Delgado, Dionicio A; Azpiri-Lopez, Jose R; Colunga-Pedraza, Iris J; Cardenas-de la Garza, Jesus A; Vera-Pineda, Raymundo; Garcia-Colunga, Judith I; Arvizu-Rivera, Rosa I; Martinez-Moreno, Adrian; Villarreal-Perez, Jesus Z; Elizondo-Riojas, Guillermo; Garza Elizondo, Mario A

2016-11-01

Atherosclerotic cardiovascular disease (ASCVD) is the leading cause of death in rheumatoid arthritis (RA) patients. Guidelines of the American College of Cardiology and the American Heart Association (ACC/AHA) 2013 and the Adult Treatment Panel III (ATP-III) differ in their strategies to recommend initiation of statin therapy. The presence of carotid plaque (CP) by carotid ultrasound is an indication to begin statin therapy. We aimed to compare the recommendation to initiate statin therapy according to the ACC/AHA 2013 guidelines, ATP-III guidelines, and CP by carotid ultrasound. We then carried out an observational, cross-sectional study of 62 statin-naive Mexican mestizo RA patients, aged 40 to 75, who fulfilled the 1987 or 2010 ACR/European League Against Rheumatism (EULAR) classification criteria. CP was evaluated with B-mode ultrasound. Cohen's kappa (k) was used to assess agreement between ACC/AHA 2013 guidelines, ATP-III guidelines, and the presence of CP, considering a p < 0.05 as statistically significant. Agreement was classified as slight (0.01-0.20), fair (0.21-0.40), moderate (0.41-0.60), substantial (0.61-0.80), and an almost perfect agreement (0.81-1.00). Slight agreement (k = 0.096) was found when comparing statin recommendation between CP and ATP-III. Fair agreement (k = 0.242) was revealed between ACC/AHA 2013 and ATP-III. Comparison between ACC/AHA 2013 and CP showed moderate agreement (k = 0.438). ACC/AHA 2013 guidelines could be an adequate and cost-effective tool to evaluate the need of statin therapy in Mexican mestizo RA patients, with moderate agreement with the presence of CP by ultrasound.

Calpain-10 gene polymorphisms and risk of type 2 diabetes mellitus in Mexican mestizos.

PubMed

Picos-Cárdenas, V J; Sáinz-González, E; Miliar-García, A; Romero-Zazueta, A; Quintero-Osuna, R; Leal-Ugarte, E; Peralta-Leal, V; Meza-Espinoza, J P

2015-03-27

The calpain-10 gene is expressed primarily in tissues important in glucose metabolism; thus, some of its polymorphisms have been associated with type 2 diabetes. In this study, we examined the association between the calpain-10 single-nucleotide polymorphism (SNP)-43, SNP-19, and SNP-63 and type 2 diabetes in Mexican mestizos. We included 211 patients and 152 non-diabetic subjects. Polymerase chain reaction was used to identify alleles. We compared allele, genotype, haplotype, and diplotype frequencies between both groups and used the chi-square test to calculate the risk. The allele frequency of SNP-43 allele 1 was 70% in controls and 72% in patients; the GG, GA, and AA genotype frequencies were 48.7, 42.8, and 8.5% in controls and 51.2, 41.7, and 7.1% in patients, respectively. For SNP- 19, the prevalence of allele 1 (2R) was 32% in controls and 39% in patients. In controls, homozygosity (2R/2R) was 10.5%, heterozygosity was 42.8%, and 3R/3R was 46.7%; in cases, these values were 13.3, 50.7, and 36.0%, respectively. For SNP-63, the frequency of allele 1 was 87% in controls and 83% in patients; genotype frequencies in controls were 75.7% (CC), 23% (CT), and 1.3% (TT), and were 69.7, 27.5, and 2.8%, respectively for the cases. Genotype distributions were consistent with Hardy-Weinberg equilibrium. No significant intergroup differences for allele, genotype, haplotype, or diplotype frequencies were observed. We found no association between these polymorphisms and diabetes. However, our sample size was small, so the role of calpain-10 risk alleles should be further examined.

HPV-16 and HLA-DRB1 alleles are associated with cervical carcinoma in Mexican Mestizo women.

PubMed

Alaez-Verson, Carmen; Berumen-Campos, Jaime; Munguía-Saldaña, Andrea; Flores-Aguilar, Hilario; Guardado-Estrada, Mariano; Rodríguez-Gomez, Araceli; Gorodezky-Lauferman, Clara

2011-07-01

The aim of this report was to investigate the contribution of HLA-DRB1/DQB1 alleles to the expression of cervical cancer (CC) and squamous intraepithelial lesion (SIL) in Mexican patients. A total of 257 women were included in the study: 61with low-grade squamous intraepithelial lesions (LSIL), 30 with high-grade (HSIL), 73 with CC and 93 healthy females. All were Mexican Mestizos. For HLA class II typing, PCR-SSOP methodology was used. HPV-16 viral DNA was detected by PCR with specific primers for E6-E7 region. HPV-16 was found in 52% of the patients with CC as well as in 19% of women with HSIL and in 12.5% of females with LSIL. HLA-DRB1∗04:03 (OR = 5.88) was found increased in patients with HSIL as compared with controls, although significance (p = 0.04) was lost after correction (pc =NS). HLA-DRB1∗04:03 seems to influence the risk for developing HSIL, disregarding the presence of HPV-16. HLA-DRB1∗01:01 (OR = 0.12; p = 0.01) may confer protection to the development of CC. An analysis performed stratifying by the presence of HPV-16 infection showed that the frequency of HLA-DRB1∗04:07 (OR = 2.71) was increased in CC patients infected with HPV-16, confirming that the HLA association is HPV dependent. These results shed light on the influence that this virus may have in the expression of CC in the susceptible host. Genetic background is, therefore, a crucial factor in understanding the etiopathogenesis of CC in HPV-positive patients. Copyright © 2011 IMSS. Published by Elsevier Inc. All rights reserved.

Genetic variations in toll-like receptor 4 in Mexican-Mestizo patients with intra-abdominal infection and/or pneumonia.

PubMed

Rodriguez-Osorio, Carlos A; Lima, Guadalupe; Herrera-Caceres, Jaime O; Villegas-Torres, Beatriz E; Zuñiga, Joaquin; Ponce-de-Leon, Sergio; Llorente, Luis; Sifuentes-Osornio, Jose

2013-06-01

Sepsis is a leading cause of death around the world, and 73-83% of all sepsis cases requiring attention in intensive care units are linked to intra-abdominal infection (IAI) or pneumonia. The activation of innate immunity is central to the manifestation of sepsis, and toll-like receptor (TLR) 4 plays an important role in this activation process. The 299G and 399I alleles of TLR4 have been linked with an increased risk of Gram-negative bacteria (GNB) infections and septic shock in some populations. This case-control study evaluated the prevalence of D299G/T399I polymorphisms in Mexican patients with IAI and/or pneumonia and in healthy controls. Genotyping revealed that 1 in 44 patients (2.3%; CI 95%: 0.05-12.0%) and 4 in 126 controls (3.2%; CI 95%: 0.9-7.9%) were heterozygous for both the D299G and T399l polymorphisms (OR: 0.71, CI 95%: 0.01-7.44, p = NS), confirming the co-segregation of these alleles in this population. Furthermore, the patients with a GNB infection and severe sepsis were not carriers of the risk alleles. In summary, this report shows that the frequency of the D299G and T399I polymorphisms in Mexican-Mestizos is lower than anticipated in comparison with other ethnic groups, emphasizing the variable distribution of TLR4 polymorphisms among different populations. Consequently, this study was not able to detect associations between TLR4 polymorphisms and sepsis in this population. Copyright © 2013 Elsevier B.V. All rights reserved.

Association of CYP1A1 and CYP1B1 polymorphisms with bone mineral density variations in postmenopausal Mexican-Mestizo women.

PubMed

Chávez, Bertha; Vilchis, Felipe; Rojano-Mejía, David; Coral Vázquez, Ramón Mauricio; Aguirre-García, María Del Carmen; Canto, Patricia

2017-08-01

Herein, we investigated potential associations between polymorphisms of genes related to estrogen metabolism and bone mineral density (BMD) in postmenopausal women. This was a cross-sectional study, in which two hundred and ninety postmenopausal Mexican-Mestizo women were studied. The BMD of the lumbar spine (LS), total hip (TH), and femoral neck (FN) was measured. The distribution of the genetic polymorphisms, including rs1799814 and rs1048943 at CYP1A1 as well as rs1056836 at CYP1B1, were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), single-stranded conformational polymorphism (SSCP), and DNA sequencing. Deviations from Hardy-Weinberg equilibrium (HWE) were tested, and linkage disequilibrium (LD) was calculated by direct correlation (r 2 ). Moreover, haplotype analysis was performed. All polymorphisms were in HWE. The genotype and allele distributions of the three single nucleotide polymorphisms (SNPs) studied showed no significant differences. However, statistical significance was reached when constructing haplotypes. The CG haplotype in CYP1A1 was associated with variations in LS and FN BMD after adjustment for covariates (p = 0.021 and 0.045, respectively), but the association with TH BMD was not significant. These results suggested that the CG haplotype in CYP1A1 may play an important role in the mechanism of osteoporosis and may be useful as a genetic marker.

Biochemical differences in ethnic groups in Durango, Mexico.

PubMed

Lares-Asseff, Ismael; Lujín-García, Azalia; Sosa-Macías, Martha; Lazalde-Ramos, Blanca; Loera-Castañeda, Veronica; Galaviz-Hernández, Carlos; Villanueva-Fierro, Ignacio

2012-01-01

The aim of this study was to assess biochemical differences between Tepehuano indigenous people, and Mennonite and Mestizo populations of Durango, Mexico. Our study involved 334 volunteers aged 15 to 80 years; 132 Mennonite and 130 Mestizo individuals from Nuevo Ideal Municipality and 72 Tepehuano indigenous people from Mezquital Durango were evaluated. A clinical history and fast determination of aspartate aminotransferase (AST), alanine aminotransferase (ALT), uric acid, urea and creatinine were performed on each studied case. Statistically significant differences between the three studied groups were found for age, weight and height (P < .05), with higher values observed in men. The highest plasma urea levels were found in Mennonite compared to Mestizo people, followed by the Tepehuano indigenous. Higher biochemical parameters were found in men (vs women) in the studied groups. The percentage of individuals with abnormal levels for AST, ALT and uric acid were higher in Tepehuano indigenous people than in Mestizo, whereas the urea and creatinine percentages were higher in Mestizo people. The differences found on biochemical tests, could be explained by differences in lifestyle such as diet and sanitary habits.

Analysis of Polymorphisms in Genes (AGT, MTHFR, GPIIIa, and GSTP1) Associated with Hypertension, Thrombophilia and Oxidative Stress in Mestizo and Amerindian Populations of México

PubMed Central

Juárez-Velázquez, Rocio; Canto, Patricia; Canto-Cetina, Thelma; Rangel-Villalobos, Hector; Rosas-Vargas, Haydee; Rodríguez, Maricela; Canizales-Quinteros, Samuel; Velázquez Wong, Ana Claudia; Ordoñez-Razo, Rosa María; Vilchis-Dorantes, Guadalupe; Coral-Vázquez, Ramón Mauricio

2010-01-01

Several polymorphisms related to hypertension, thrombophilia, and oxidative stress has been associated with the development of cardiovascular disease. We analyzed the frequency of M235T angiotensinogen (AGT), A222V 5,10 methylenete-trahydrofolate reductase (MTHFR), L33P glycoprotein IIIa (GPIIIa), and I105V glutathione S-transferase P1 (GSTP1) polymorphisms in 285 individuals belonging to Mexican-Mestizo and five Amerindian population from México, by real time PCR allelic discrimination. Allele and genotype frequencies were compared using χ2 tests. All populations followed the Hardy Weinberg equilibrium for assay markers with the exception of the Triki, whose were in Hardy Weinberg dysequilibrium for the glutathione S-transferase P1 polymorphism. Interestingly, according to all the analyzed single nucleotide polymorphisms (SNPs), the Triki population was the most differentiated and homogeneous group of the six populations analyzed. A comparison of our data with those previously published for some Caucasian, Asian and Black populations showed quite significant differences. These differences were remarkable with all the Mexican populations having a lower frequency of the 105V allele of the glutathione S-transferase P1 and reduced occurrence of the 222A allele of the 5,10 methylenetetrahydrofolate reductase. Our results show the genetic diversity among different Mexican populations and with other racial groups. PMID:20592457

The Light Infantry Division Regionally Focused for Low Intensity Conflict

DTIC Science & Technology

1990-06-01

The= offical languages are Spanish, Quechua and Aymara. (3) Education: Illiteracy: 20%. (4) Ethnic Composition: Indian 45%; mestizo 37%; Caucasian 15... Quechua , and Aymara are the offical languages. (3) Education: Illiteracy: 37%. (4) Ethnic Composition: Quechua 30%; Aymara 25%; Mestizo 31%; European

IKAROS Gene Deleted B-Cell Acute Lymphoblastic Leukemia in Mexican Mestizos: Observations in Seven Patients and a Short Review of the Literature.

PubMed

Ruiz-Delgado, Guillermo José; Cantero-Fortiz, Yahveth; León-Peña, Andrés Aurelio; León-González, Mónica; Nuñez-Cortés, Ana Karen; Ruiz-Argüelles, Guillermo José

2016-01-01

In B-cell acute lymphoblastic leukemia, one of the most frequent cytogenetic alterations is the presence of the Philadelphia chromosome. Recently, newly identified genetic alterations have been studied, among them the IKZF1 deletion. IKZF1 encodes IKAROS, a zinc finger protein that plays an important role in hematopoiesis involving the regulation process of adhesion, cellular migration, and as a tumor suppressor. We aimed to study the impact of IKAROS deletion in the evolution and prognosis of B-cell acute lymphoblastic leukemia. At a single center we prospectively studied patients diagnosed with B-cell acute lymphoblastic leukemia and screened for IKZF1 deletion using the multiplex ligation-dependent probe amplification method. We did a descriptive analysis of patients positive for the IKZF1 deletion to determine its impact on the evolution of the disease and survival rate. Between 2010 and 2015, 16 Mexican mestizo patients with B-cell acute lymphoblastic leukemia were prospectively screened for IKZF1 deletion; seven (43%) were positive and were included for further analysis. The age range of patients was 13-60 years; six were males and one female. All cases had type B acute lymphoblastic leukemia. Of the seven patients, two died, three were lost to follow-up, and two continue in complete remission with treatment. Results are worse than those in a group of patients with non-mutated IKAROS B-cell acute lymphoblastic leukemia previously studied in our center. Although this is a small sample, the presence of IKAROS deletion in acute lymphoblastic leukemia patients could represent a poor-prognosis marker and was probably related to therapy failure. It is also possible that this variant of leukemia may be more prevalent in Mexico. More studies are needed to define the role of IKZF1 deletion in acute lymphoblastic leukemia and the real prevalence of the disease in different populations.

16 de Septiembre, 1810 Module. Secondary Level. [16 of September, 1810 Module. Secondary Level.

ERIC Educational Resources Information Center

Crystal City Independent School District, TX.

Independence for Mexico took 11 years to achieve. Before its independence Mexico was ruled by Spain and had a basic caste system of indios, mestizos, criollos, and gachupines. The gachupines and criollos ruled the government and exploited the indios and mestizos. When the criollos became dissatisfied with being secondary to the gachupines, they…

Identification of genetic variants in pharmacogenetic genes associated with type 2 diabetes in a Mexican-Mestizo population

PubMed Central

Rodríguez-Rivera, Nidia Samara; Cuautle-Rodríguez, Patricia; Castillo-Nájera, Fernando; Molina-Guarneros, Juan Arcadio

2017-01-01

Type 2 diabetes mellitus (T2DM) is one of the most prevalent chronic pathologies in the world. In developing countries, such as Mexico, its prevalence represents an important public health and research issue. Determining factors triggering T2DM are environmental and genetic. While diet, exercise and proper weight control are the first measures recommended to improve the quality of life and life expectancy of patients, pharmacological treatment is usually the next step. Within every population there are variations in interindividual drug response, which may be due to genetic background. Some of the most frequent first line T2DM treatments in developing countries are sulfonylureas (SU), whose targets are ATP-sensitive potassium channels (KATP). Single nucleotide polymorphisms (SNPs) of the KATP coding genes, potassium voltage-gated channel subfamily J member 11 (KCNJ11) and ATP binding cassette subfamily C member 8 (ABCC8) have been associated with SU response variability. To date, there is little information regarding the mechanism by which these SNPs work within Mexican populations. The present study describes the distribution of three SNPs [KCNJ11 rs5219 (E23K), ABCC8 rs757110 (S1369A) and rs1799854 (−3C/T)] among Mestizo Mexican (MM) T2DM patients, and compares it with published data on various healthy subjects and T2DM populations. Through this comparison, no difference in the KCNJ11 rs5219 and ABCC8 rs757110 allelic and genotypic frequencies in MM were observed compared with the majority of the reported populations of healthy and diabetic individuals among other ethnic groups; except for African and Colombian individuals. By contrast, ABCC8 rs1799854 genomic and allelic frequencies among MM were observed to be significantly different from those reported by the 1000 Genomes Project, and from diabetic patients within other populations reported in the literature, such as the European, Asian and Latin-American individuals [T=0.704, G=0.296; CC=0.506, CT=0.397, TT

Identification of genetic variants in pharmacogenetic genes associated with type 2 diabetes in a Mexican-Mestizo population.

PubMed

Rodríguez-Rivera, Nidia Samara; Cuautle-Rodríguez, Patricia; Castillo-Nájera, Fernando; Molina-Guarneros, Juan Arcadio

2017-07-01

Type 2 diabetes mellitus (T2DM) is one of the most prevalent chronic pathologies in the world. In developing countries, such as Mexico, its prevalence represents an important public health and research issue. Determining factors triggering T2DM are environmental and genetic. While diet, exercise and proper weight control are the first measures recommended to improve the quality of life and life expectancy of patients, pharmacological treatment is usually the next step. Within every population there are variations in interindividual drug response, which may be due to genetic background. Some of the most frequent first line T2DM treatments in developing countries are sulfonylureas (SU), whose targets are ATP-sensitive potassium channels (K ATP ). Single nucleotide polymorphisms (SNPs) of the K ATP coding genes, potassium voltage-gated channel subfamily J member 11 ( KCNJ11 ) and ATP binding cassette subfamily C member 8 ( ABCC8 ) have been associated with SU response variability. To date, there is little information regarding the mechanism by which these SNPs work within Mexican populations. The present study describes the distribution of three SNPs [KCNJ11 rs5219 (E23K), ABCC8 rs757110 (S1369A) and rs1799854 (-3C/T)] among Mestizo Mexican (MM) T2DM patients, and compares it with published data on various healthy subjects and T2DM populations. Through this comparison, no difference in the KCNJ11 rs5219 and ABCC8 rs757110 allelic and genotypic frequencies in MM were observed compared with the majority of the reported populations of healthy and diabetic individuals among other ethnic groups; except for African and Colombian individuals. By contrast, ABCC8 rs1799854 genomic and allelic frequencies among MM were observed to be significantly different from those reported by the 1000 Genomes Project, and from diabetic patients within other populations reported in the literature, such as the European, Asian and Latin-American individuals [T=0.704, G=0.296; CC=0.506, CT=0

Association of ADIPOQ +45T>G polymorphism with body fat mass and blood levels of soluble adiponectin and inflammation markers in a Mexican-Mestizo population

PubMed Central

Guzman-Ornelas, Milton-Omar; Chavarria-Avila, Efrain; Munoz-Valle, Jose-Francisco; Armas-Ramos, Laura-Elizabeth; Castro-Albarran, Jorge; Aldrete, Maria Elena Aguilar; Oregon-Romero, Edith; Mercado, Monica Vazquez-Del; Navarro-Hernandez, Rosa-Elena

2012-01-01

Purpose Obesity is a disease with genetic susceptibility characterized by an increase in storage and irregular distribution of body fat. In obese patients, the decrease in the Adiponectin gene (ADIPOQ) expression has been associated with a systemic low-grade inflammatory state. Our aim was to investigate the relationship between ADIPOQ +45T>G gene simple nucleotide polymorphism (SNP rs2241766) with serum adiponectin (sAdiponectin), distribution of body fat storage, and inflammation markers. Subjects and methods In this cross-sectional study, 242 individuals from Western Mexico characterized as Mexican-Mestizo and classified by body mass index (BMI), were included. Anthropometrics, body composition, body fat distribution, and inflammation markers were measured by routine methods. Genotypes were characterized using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique and sAdiponectin by the ELISA method. A P-value <0.05 was considered the statistically significant threshold. Results sAdiponectin is associated with BMI (P < 0.001) and the genotypes (P < 0.001 to 0.0046) GG (8169 ± 1162 ng/mL), TG (5189 ± 501 ng/mL), and TT (3741 ± 323 ng/mL), but the SNP ADIPOQ +45T>G is not associated with BMI. However, the detailed analysis showed association of this SNP with a pattern of fat distribution and correlations (P < 0.05) with inflammation markers and distribution of body fat storage (Pearson’s r = −0.169 to −0.465) were found. Conclusion In this study, we have suggested that the ADIPOQ +45G allele could be associated with distribution of body fat storage in obesity. On the other hand, as no association was observed between ADIPOQ +45T>G gene polymorphism and obesity, it cannot be concluded that the ADIPOQ +45G allele is responsible for the increase of adiponectin levels. PMID:23118546

Association of ADIPOQ +45T>G polymorphism with body fat mass and blood levels of soluble adiponectin and inflammation markers in a Mexican-Mestizo population.

PubMed

Guzman-Ornelas, Milton-Omar; Chavarria-Avila, Efrain; Munoz-Valle, Jose-Francisco; Armas-Ramos, Laura-Elizabeth; Castro-Albarran, Jorge; Aguilar Aldrete, Maria Elena; Oregon-Romero, Edith; Vazquez-Del Mercado, Monica; Navarro-Hernandez, Rosa-Elena

2012-01-01

Obesity is a disease with genetic susceptibility characterized by an increase in storage and irregular distribution of body fat. In obese patients, the decrease in the Adiponectin gene (ADIPOQ) expression has been associated with a systemic low-grade inflammatory state. Our aim was to investigate the relationship between ADIPOQ +45T>G gene simple nucleotide polymorphism (SNP rs2241766) with serum adiponectin (sAdiponectin), distribution of body fat storage, and inflammation markers. In this cross-sectional study, 242 individuals from Western Mexico characterized as Mexican-Mestizo and classified by body mass index (BMI), were included. Anthropometrics, body composition, body fat distribution, and inflammation markers were measured by routine methods. Genotypes were characterized using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique and sAdiponectin by the ELISA method. A P-value <0.05 was considered the statistically significant threshold. sAdiponectin is associated with BMI (P < 0.001) and the genotypes (P < 0.001 to 0.0046) GG (8169 ± 1162 ng/mL), TG (5189 ± 501 ng/mL), and TT (3741 ± 323 ng/mL), but the SNP ADIPOQ +45T>G is not associated with BMI. However, the detailed analysis showed association of this SNP with a pattern of fat distribution and correlations (P < 0.05) with inflammation markers and distribution of body fat storage (Pearson's r = -0.169 to -0.465) were found. In this study, we have suggested that the ADIPOQ +45G allele could be associated with distribution of body fat storage in obesity. On the other hand, as no association was observed between ADIPOQ +45T>G gene polymorphism and obesity, it cannot be concluded that the ADIPOQ +45G allele is responsible for the increase of adiponectin levels.

Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.

PubMed

López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés

2017-12-01

This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.

Impact of genetic variants of IL-6, IL6R, LRP5, ESR1 and SP7 genes on bone mineral density in postmenopausal Mexican-Mestizo women with obesity.

PubMed

Méndez, Juan Pablo; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Pedraza, Javier; Casas, María José; Soriano, Ruth; García-García, Eduardo; Vilchis, Felipe; Canto, Patricia

2013-10-10

Since obesity and osteoporosis present a high genetic predisposition and polymorphisms of IL-6, IL6R, LRP5, ESR1 and SP7 may influence the risk of both diseases, the aim of this study was to analyze the possible association of polymorphisms in these genes, as well as their haplotypes, with BMD variations in postmenopausal Mexican-Mestizo women with grade 2 or grade 3 obesity. One hundred eighty unrelated postmenopausal women with grade 2 or grade 3 obesity were included. BMD was measured in total hip and lumbar spine by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. Rs1800795 of IL-6, rs2228145 of IL6R, rs3736228 of LRP5, rs9340799 (XbaI) and rs2234693 (PvuII), of ESR1, rs10876432 and rs2016266, of SP7 (and their haplotypes), were studied by real-time PCR allelic discrimination. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis was conducted. Using WHO criteria, 54.5% had grade 2 obesity, and 45.5% had grade 3 obesity. Regarding DXA results, 11.1% women had osteoporosis, 41.7% had osteopenia, and 47.2% had normal BMD. Genotype and haplotype analysis showed no significant differences with BMD variations at the lumbar spine, total hip or femoral neck. We did not find a significant association between the polymorphisms analyzed or their haplotypes and BMD variations in postmenopausal women with obesity. The higher BMD observed in women with obesity could be the result of an adaptive response to the higher loading of the skeleton. © 2013 Elsevier B.V. All rights reserved.

Ethnicity and lipoprotein(a) polymorphism in Native Mexican populations.

PubMed

Cardoso-Saldaña, G; De La Peña-Díaz, A; Zamora-González, J; Gomez-Ortega, R; Posadas-Romero, C; Izaguirre-Avila, R; Malvido-Miranda, E; Morales-Anduaga, M E; Anglés-Cano, E

2006-01-01

Lp(a) is a lipoparticle of unknown function mainly present in primates and humans. It consists of a low-density lipoprotein and apo(a), a polymorphic glycoprotein. Apo(a) shares sequence homology and fibrin binding with plasminogen, inhibiting its fibrinolytic properties. Lp(a) is considered a link between atherosclerosis and thrombosis. Marked inter-ethnic differences in Lp(a) concentration related to the genetic polymorphism of apo(a) have been reported in several populations. The study examined the structural and functional features of Lp(a) in three Native Mexican populations (Mayos, Mazahuas and Mayas) and in Mestizo subjects. We determined the plasma concentration of Lp(a) by immunonephelometry, apo(a) isoforms by Western blot, Lp(a) fibrin binding by immuno-enzymatic assay and short tandem repeat (STR) polymorphic marker genetic analysis by capillary electrophoresis. Mestizos presented the less skewed distribution and the highest median Lp(a) concentration (13.25 mg dL(-1)) relative to Mazahuas (8.2 mg dL(-1)), Mayas (8.25 mg dL(-1)) and Mayos (6.5 mg dL(-1)). Phenotype distribution was different in Mayas and Mazahuas as compared with the Mestizo group. The higher Lp(a) fibrin-binding capacity was found in the Maya population. There was an inverse relationship between the size of apo(a) polymorphs and both Lp(a) levels and Lp(a) fibrin binding. There is evidence of significative differences in Lp(a) plasma concentration and phenotype distribution in the Native Mexican and the Mestizo group.

Genetic structure and forensic parameters of 38 Indels for human identification purposes in eight Mexican populations.

PubMed

Martínez-Cortés, G; Gusmão, L; Pereira, R; Salcido, V H; Favela-Mendoza, A F; Muñoz-Valle, J F; Inclán-Sánchez, A; López-Hernández, L B; Rangel-Villalobos, H

2015-07-01

Insertion-deletions for human identification purposes (HID-Indels) offer advantages to solve particular forensic situations and complex paternity cases. In Mexico, admixed population known as Mestizos is the largest (∼90%), plus a number of Amerindian groups (∼10%), which have not been studied with HID-Indels. For this reason, allele frequencies and forensic parameters for 38 HID-Indels were estimated in 531 unrelated individuals from one Amerindian (Purépecha) and seven Mestizo populations from different regions of the country. Genotype distribution was in agreement with Hardy-Weinberg expectations in almost all loci/populations. The linkage disequilibrium (LD) test did not reveal possible associations between loci pairs in all eight Mexican populations. The combined power of discrimination was high in all populations (PD >99.99999999998%). However, the power of exclusion of the 38 HID-Indel system (PE >99.6863%) was reduced regarding most of autosomal STR kits. The assessment of genetic structure (AMOVA) and relationships between populations (FST) demonstrated significant differences among Mexican populations, mainly of the Purépecha Amerindian group. Among Mexican-Mestizos, three population clusters consistent with geography were defined: (i) North-West region: Chihuahua, Sinaloa, and Jalisco; (ii) Central-Southern region: Mexico City, Veracruz and Yucatan; (iii) South region: Chiapas. In brief, this report validates the inclusion of the 38 HID-Indel system in forensic casework and paternity cases in seven Mexican-Mestizo populations from different regions, and in one Mexican Amerindian group. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Analysis of ancestry informative markers in three main ethnic groups from Ecuador supports a trihybrid origin of Ecuadorians.

PubMed

Santangelo, Roberta; González-Andrade, Fabricio; Børsting, Claus; Torroni, Antonio; Pereira, Vania; Morling, Niels

2017-11-01

Ancestry inference is traditionally done using autosomal SNPs that present great allele frequency differences among populations from different geographic regions. These ancestry informative markers (AIMs) are useful for determining the most likely biogeographic ancestry or population of origin of an individual. Due to the growing interest in AIMs and their applicability in different fields, commercial companies have started to develop AIM multiplexes targeted for Massive Parallel Sequencing platforms. This project focused on the study of three main ethnic groups from Ecuador (Kichwa, Mestizo, and Afro-Ecuadorian) using the Precision ID Ancestry panel (Thermo Fisher Scientific). In total, 162 Ecuadorian individuals were investigated. The Afro-Ecuadorian and Mestizo showed higher average genetic diversities compared to the Kichwa. These results are consistent with the highly admixed nature of the first two groups. The Kichwa showed the highest proportion of Native Amerindian (NAM) ancestry relative to the other two groups. The Mestizo had an admixed ancestry of NAM and European with a larger European component, whereas the Afro-Ecuadorian were highly admixed presenting proportions of African, Native Amerindian, and European ancestries. The comparison of our results with previous studies based on uniparental markers (i.e. Y chromosome and mtDNA) highlighted the sex-biased admixture process in the Ecuadorian Mestizo. Overall, the data generated in this work represent one important step to assess the application of ancestry inference in admixed populations in a forensic context. Copyright © 2017 Elsevier B.V. All rights reserved.

Ethnicity and lipoprotein(a) polymorphism in Native Mexican populations

PubMed Central

Cardoso-Saldaña, Guillermo; De La Peña-Díaz, Aurora; Zamora-González, José; Gomez-Ortega, Rocio; Posadas-Romero, Carlos; Izaguirre-Avila, Raul; Malvido-Miranda, Elsa; Morales-Anduaga, Maria Elena; Angles-Cano, Eduardo

2006-01-01

Background Lp(a) is a lipoparticle of unknown function mainly present in primates and humans. It consists of a low-density lipoprotein and apo(a), a polymorphic glycoprotein. Apo(a) shares sequence homology and fibrin-binding with plasminogen inhibiting its fibrinolytic properties. Lp(a) is considered a link between atherosclerosis and thrombosis. Marked inter-ethnic differences in Lp(a) concentration related to the genetic polymorphism of apo(a), have been reported in several populations. Aim To study the structural and functional features of Lp(a) in three Native Mexican populations (Mayos, Mazahuas and Mayas) and in Mestizo subjects. Methods We determined the plasma concentration of Lp(a) by immunonephelometry, apo(a) isoforms by Western blot, Lp(a) fibrin-binding by immuno-enzymatic assay and STR polymorphic markers genetic analysis by capillary electrophoresis. Results Mestizos presented the less skewed distribution and the highest median Lp(a) concentration (13.25 mg/dL) relative to Mazahuas (8.2 mg/dL), Mayas (8.25 mg/dL) and Mayos (6.5 mg/dL). Phenotype distribution was different in Mayas and Mazahuas as compared to the Mestizo group. The higher Lp(a) fibrin-binding capacity was found in the Maya population. There was an inverse relationship between the size of apo(a) polymorphs and both Lp(a) levels and Lp(a) fibrin binding. Conclusion There is evidence of significative differences in Lp(a) plasma concentration and phenotype distribution in Native Mexican and the Mestizo group. PMID:16684693

Contribution of Common Genetic Variants to Obesity and Obesity-Related Traits in Mexican Children and Adults

PubMed Central

Villalobos-Comparán, Marisela; Villarreal-Molina, Teresa; Romero-Hidalgo, Sandra; López-Contreras, Blanca; Gutiérrez-Vidal, Roxana; Vega-Badillo, Joel; Jacobo-Albavera, Leonor; Posadas-Romeros, Carlos; Canizalez-Román, Adrián; Río-Navarro, Blanca Del; Campos-Pérez, Francisco; Acuña-Alonzo, Victor; Aguilar-Salinas, Carlos; Canizales-Quinteros, Samuel

2013-01-01

Background Several studies have identified multiple obesity-associated loci mainly in European populations. However, their contribution to obesity in other ethnicities such as Mexicans is largely unknown. The aim of this study was to examine 26 obesity-associated single-nucleotide polymorphisms (SNP) in a sample of Mexican mestizos. Methods 9 SNPs in biological candidate genes showing replications (PPARG, ADRB3, ADRB2, LEPR, GNB3, UCP3, ADIPOQ, UCP2, and NR3C1), and 17 SNPs in or near genes associated with obesity in first, second and third wave GWAS (INSIG2, FTO, MC4R, TMEM18, FAIM2/BCDIN3, BDNF, SH2B1, GNPDA2, NEGR1, KCTD15, SEC16B/RASAL2, NPC1, SFRF10/ETV5, MAF, PRL, MTCH2, and PTER) were genotyped in 1,156 unrelated Mexican-Mestizos including 683 cases (441 obese class I/II and 242 obese class III) and 473 normal-weight controls. In a second stage we selected 12 of the SNPs showing nominal associations with obesity, to seek associations with quantitative obesity-related traits in 3 cohorts including 1,218 Mexican Mestizo children, 945 Mexican Mestizo adults, and 543 Indigenous Mexican adults. Results After adjusting for age, sex and admixture, significant associations with obesity were found for 6 genes in the case-control study (ADIPOQ, FTO, TMEM18, INSIG2, FAIM2/BCDIN3 and BDNF). In addition, SH2B1 was associated only with class I/II obesity and MC4R only with class III obesity. SNPs located at or near FAIM2/BCDIN3, TMEM18, INSIG2, GNPDA2 and SEC16B/RASAL2 were significantly associated with BMI and/or WC in the combined analysis of Mexican-mestizo children and adults, and FTO locus was significantly associated with increased BMI in Indigenous Mexican populations. Conclusions Our findings replicate the association of 8 obesity-related SNPs with obesity risk in Mexican adults, and confirm the role of some of these SNPs in BMI in Mexican adults and children. PMID:23950976

Frequency distribution of interleukin-10 haplotypes (-1082 A>G, -819 C>T, and -592 C>A) in a Mexican population.

PubMed

Vázquez-Villamar, M; Palafox-Sánchez, C A; Hernández-Bello, J; Muñoz-Valle, J F; Valle, Y; Cruz, A; Alatorre-Meza, A I; Oregon-Romero, E

2016-11-03

Interleukin 10 (IL-10) is an immunoregulatory cytokine with multiple roles in the immune system. Three single nucleotide polymorphisms at positions -1082 (A>G), -819 (C>T), and -592 (C>A) in the promoter region of the IL10 gene are believed to be associated with different inflammatory, infectious, and autoimmune diseases. These polymorphisms exhibit a strong linkage disequilibrium (LD) and form three principal haplotypes (GCC, ACC, and ATA). The GCC and ATA haplotypes have been associated with high and low levels of IL-10 production, respectively. The aim of this study was to establish the allele and haplotype frequencies of the IL10 polymorphisms in Mestizos from western Mexico. SNPs were analyzed in 340 healthy unrelated Mestizos from western Mexico by polymerase chain reaction-restriction fragment length polymorphism. The studied population presented significant differences, in the distribution of IL10 polymorphisms, from the Asian, African, and European populations. We also observed a strong LD within -1082 A>G, -819 C>T, and -592 C>A (100% pc = 7.735 x 10 -18 ). The haplotypes ACC (45.4%), ATA (22.0%), GTA (14.9%), and GCC (13.9%) were most frequently observed in this population. The haplotype frequencies, however, differed from those reported previously in Mestizos from central Mexico, Asians, Africans, and European Caucasians, suggesting a differential gene flow in the Mexican Mestizo population. This could account for the genetic variability between Mexicans and populations of other ethnicities. The study of these polymorphisms and their haplotypes could help in expanding our knowledge to design future disease-risk studies on the western Mexican population.

High Rate of Infection by Only Oncogenic Human Papillomavirus in Amerindians.

PubMed

Vargas-Robles, Daniela; Magris, Magda; Morales, Natalia; de Koning, Maurits N C; Rodríguez, Iveth; Nieves, Tahidid; Godoy-Vitorino, Filipa; Sánchez, Gloria I; Alcaraz, Luis David; Forney, Larry J; Pérez, María-Eglée; García-Briceño, Luis; van Doorn, Leen-Jan; Domínguez-Bello, María Gloria

2018-06-27

Human papillomavirus (HPV), an etiological agent of cervical cancer (CC), has infected humans since ancient times. Amerindians are the furthest migrants out of Africa, and they reached the Americas more than 14,000 years ago. Some groups still remain isolated, and some migrate to towns, forming a gradient spanning urbanization. We hypothesized that, by virtue of their history, lifestyle, and isolation from the global society, remote Amerindian women have lower HPV diversity than do urban women (Amerindian or mestizo). Here we determined the diversity of the 25 most relevant cervical HPV types in 82 Amerindians spanning urbanization (low, medium, and high, consistent with the exposure to urban lifestyles of the town of Puerto Ayacucho in the Venezuelan Amazonas State), and in 29 urban mestizos from the town. Cervical, anal, oral, and introitus samples were taken, and HPVs were typed using reverse DNA hybridization. A total of 23 HPV types were detected, including 11 oncogenic or high-risk types, most associated with CC. Cervical HPV prevalence was 75%, with no differences by group, but Amerindians from low and medium urbanization level had significantly lower HPV diversity than mestizos did. In Amerindians, but not in mestizos, infections by only high-risk HPVs were higher than coinfections or by exclusively low-risk HPVs. Cervical abnormalities only were observed in Amerindians (9/82), consistent with their high HPV infection. The lower cervical HPV diversity in more isolated Amerindians is consistent with their lower exposure to the global pool, and transculturation to urban lifestyles could have implications on HPV ecology, infection, and virulence. IMPORTANCE The role of HPV type distribution on the disparity of cervical cancer (CC) incidence between human populations remains unknown. The incidence of CC in the Amazonas State of Venezuela is higher than the national average. In this study, we determined the diversity of known HPV types (the viral agent of CC

Prevalence of the metabolic syndrome and its correlation with the cardiovascular health status in stroke- and ischemic heart disease-free Ecuadorian natives/mestizos aged ≥40 years living in Atahualpa: a population-based study.

PubMed

Del Brutto, Oscar H; Zambrano, Mauricio; Peñaherrera, Ernesto; Montalván, Martha; Pow-Chon-Long, Freddy; Tettamanti, Daniel

2013-01-01

Epidemiologic studies assessing cardiovascular risk factors affecting a given population may prove cost-effective to reduce the burden of cardiovascular diseases in the developing world. We evaluated the prevalence of the metabolic syndrome in Atahualpa, a village representative of rural coastal Ecuador. Prevalence of the metabolic syndrome and its correlation with the cardiovascular (CVH) status was assessed in a door-to-door survey performed in stroke- and ischemic heart disease-free Ecuadorian native/mestizos aged ≥40 years. The metabolic syndrome was diagnosed in 288 (55.7%) out of 517 persons. Worst individual components were: increased waist circumference (75%), increased fasting glucose (68.1%) and high blood pressure (56.5%). Prevalence of individual components of this condition varied according to age, gender, education, and alcohol intake. However, no differences were found in the odds for having the metabolic syndrome when persons were stratified according to these parameters. A poor CVH status was found in 80.2% persons with and in 55.9% without the metabolic syndrome (p<0.0001). Prevalence of the metabolic syndrome in Atahualpa is high. Most persons with the metabolic syndrome also have a poor CVH status. However, sizable subsets only have either the metabolic syndrome or a poor CVH status. Stratification of cardiovascular risk according to whether the person has both, one, or none of these two sets of risk factors would be of value to evaluate if the metabolic syndrome, a poor CVH status or the combination of both, better predict the occurrence of vascular outcomes in the long-term follow-up. Copyright © 2013 Diabetes India. Published by Elsevier Ltd. All rights reserved.

[Homocysteinemia and its relationship with the methylentetrahydrofolate reductase polymorphism in various ethnic groups from western Venezuela].

PubMed

Vizcaíno, Gilberto; Diez-Ewald, María; Herrmann, Falko H; Schuster, Gudrun; Torres-Guerra, Enrique; Arteaga-Vizcaíno, Melvis

2005-12-01

The prevalence of hyperhomocysteinemia and C677T MTHFR polymorphism was studied in various ethnic groups from Western Venezuela (60 Wayuu Indians, 42 italian immigrants and 77 Venezuelan mestizos) in relation with the prevalence of hyperhomocysteinemia and the C677T MTHFR polymorphism. Homocysteinemia was determined by polarized fluorescence immunoassay in an IMX system, serum folate was measured by radioimmunoanalysis and the MTHFR genotype was determined by PCR and restriction analysis. Hyperhomocysteinemia was defined as a value over 2 SD above the mean value for normal MTHFR (CC677) in each group. The prevalence of MTHFR variants (C677T and 677TT) was elevated in all ethnic groups (78% among the wayuu, 76% among Italians and 63% among mestizos) with a significant association between the concentrations of homocysteine and the levels of serum folate among the wayuu (p < 0.0001) and the mestizos (p < 0.001) only. Hyperhomocysteinemia was associated with MTHFR variants in 23% of the wayuu (OR: 6.17, CI 95: 0.74-51.36), 9.5% of the Italians (OR: 0.93, CI 95: 0.085-10.10) and 20.7 of the Venezuelans mestizos (OR: 5.2, CI 95: 1.08-24.90, p > 0.03). There was no relationship between hyperhomocysteinemia and folate deficiency in any of the groups studied. In conclusion, despite a high prevalence of C677T MTHFR variants in these ethnic groups of western Venezuela, the lack of no evidence of hyperhomocysteinemia combined with folate deficiency may imply that the nutritional status of these groups plays an important role in the control of hyperhomocysteinemia as a risk factor for cardiovascular disease.

Amylin S20G mutation in Mexican population.

PubMed

Garcia-Gonzalez, Claudia Lorena; Montoya-Fuentes, Hector; Padilla-Rosas, Miguel; Sanchez-Corona, Jose

2007-04-01

Diabetes Mellitus type 2 (DM2) is a group of metabolic disorders characterized by defective insulin action or secretion or both with a 10.6% incidence in Mexican Mestizo population, DM2 is also classified within the localized misfolding diseases due to the amyloid pancreatic deposits found in 90% of the DM2 necropsies. The pancreatic amyloid main component is a protein known as human islet amyloid polypeptide (hIAPP) or amylin, the most common mutation is the S20G in Asian population with a polymorphic frequency in DM2 Asian patients. The aim of this study was to search this mutation in Mexican Mestizo general population (104) and DM2 patients (100). This is the first molecular study of hIAPP gene in Mexican population and in which we developed an alternative more effective antisense primer for the analysis of the NFGAILSS region in hIAPP exon 3 critical for the amyloid beta structure formation. We did not find the mutation in any of the 204 analyzed samples, thus the findings show that S20G is not a common mutation in Mexican Mestizo population.

Cultural and social determinants of health among indigenous Mexican migrants in the United States.

PubMed

Lee, Junghee; Donlan, William; Cardoso, Edgar Ezequiel Orea; Paz, Juan Jesus

2013-01-01

Despite growing numbers, indigenous Mexican migrants are relatively invisible to health practitioners who group them with nonindigenous, mestizo Mexican-origin populations. Associations between indigenous and mestizo cultural identifications with psychosocial characteristics and health indicators among indigenous Mexican migrants were examined. Results revealed gender differences in cultural identifications, perceived discrimination, self-esteem, self-efficacy, and various health indicators including depression severity, culture-bound syndromes, and self-rated health. Multivariate regression and structural equation path modeling demonstrated how indigenous cultural identification and perceived discrimination affects health. Findings suggest that interventions should utilize indigenous community-based activities designed to promote self-esteem and the value of indigenous culture, with a focus on females.

Metabolic effects of the contraceptive skin patch and subdermal contraceptive implant in Mexican women: A prospective study

PubMed Central

2014-01-01

Background The contraceptive skin patch (CSP) accepted by the U.S. FDA in 2001 includes ethinylestradiol and norelgestromine, whereas the subdermal contraceptive implant (SCI) has etonogestrel and is also approved by the FDA. In Mexico, both are now widely used for contraception but their effects on Mexican population are unknown. The objective of the study was to evaluate if these treatments induce metabolic changes in a sample of indigenous and mestizo Mexican women. Methods An observational, prospective, longitudinal, non-randomized study of women between 18 and 35 years of age assigned to CSP or SCI. We performed several laboratory tests: clinical chemistry, lipid profile, and liver and thyroid function tests. Also, serum levels of insulin, C-peptide, IGF-1, leptin, adiponectin, and C reactive protein were assayed. Results Sixty-two women were enrolled, 25 used CSP (0 indigenous; 25 mestizos) and 37 used SCI (18 indigenous; 19 mestizos). Clinical symptoms were relatively more frequent in the SCI group. Thirty-four contraceptive users gained weight without other clinical significant changes. After 4 months of treatment, significant changes were found in some biochemical parameters in both treatment groups. Most were clinically irrelevant. Interestingly, the percentage of users with an abnormal atherogenic index diminished from 75% to 41.6% after follow-up. Conclusions The CSP slightly modified the metabolic variables. Most changes were nonsignificant, whereas for SCI users changes were more evident and perhaps beneficial. Results of this attempt to evaluate the effects of contraceptives in mestizo and native-American populations show that clinical symptoms are frequent in Mexican users of CSP and SCI. Although these medications may affect some metabolic variables, these changes seem clinically irrelevant. Induction of abnormalities in other physiological pathways cannot be ruled out. PMID:24767248

Factors that enable or limit the sustained use of improved firewood cookstoves: Qualitative findings eight years after an intervention in rural Mexico.

PubMed

Catalán-Vázquez, Minerva; Fernández-Plata, Rosario; Martínez-Briseño, David; Pelcastre-Villafuerte, Blanca; Riojas-Rodríguez, Horacio; Suárez-González, Laura; Pérez-Padilla, Rogelio; Schilmann, Astrid

2018-01-01

The aim of this study was to analyze the factors enabling/limiting the use of improved cookstoves among rural fuel wood users from one mestizo and two indigenous communities eight years after an intervention in the state of Michoacan, in Mexico. A qualitative study with an ethnographic perspective was conducted in 2013/2014 based on 62 interviews with women who had participated in an improved firewood cookstove program in 2005. Thematic qualitative content analysis was performed. Very few women from the indigenous communities were using the improved cookstove at the time of the study; the majority had dismantled or had ceased using it; whereas most of those from the mestizo community were using it for all of their cooking activities. In the indigenous communities, characterized by extended families, uptake of new technology was limited by traditional routine practices, rearrangement of rooms in the house, attachment to the traditional stove, a low- or non-risk perception of woodsmoke; gender relations, insufficient training, non-compliance with program recommendations and design-related aspects. Conversely, in the mestizo community, the uptake of the improved cookstove was favored by routine cooking practices in a nuclear family, a previous use of a raised cookstove and social representations on the health-disease-death effects of woodsmoke vs. the health benefits of cooking with improved stoves. The sociocultural dimension of communities and the cookstove design are aspects that either favor or limit the use of improved cookstoves in indigenous and mestizo populations. Effective cookstove programs must take these elements into account from their early planning stages, and blend them into implementation and follow-up. Project communication, training and differentiated follow-up activities ensuring the operation and maintenance of the cookstove, should be designed according to the specific needs and traditions of each community; they should be based on the

FNF Construction, Inc. Coverage under General Air Quality Permit for New or Modified Minor Source Hot Mix Asphalt Plants in Indian Country

EPA Pesticide Factsheets

Documents related to the FNF Construction, Inc. Request for Coverage under the General Air Quality Permit for New or Modified Minor Source Hot Mix Asphalt Plants in Indian Country to be Located near Ganado, Arizona on the Navajo Nation.

Tailoring Nutritional Advice for Mexicans Based on Prevalence Profiles of Diet-Related Adaptive Gene Polymorphisms

PubMed Central

Ojeda-Granados, Claudia; Panduro, Arturo; Gonzalez-Aldaco, Karina; Sepulveda-Villegas, Maricruz; Rivera-Iñiguez, Ingrid

2017-01-01

Diet-related adaptive gene (DRAG) polymorphisms identified in specific populations are associated with chronic disorders in carriers of the adaptive alleles due to changes in dietary and lifestyle patterns in recent times. Mexico’s population is comprised of Amerindians (AM) and Mestizos who have variable AM, European (EUR) and African genetic ancestry and an increased risk of nutrition-related chronic diseases. Nutritional advice based on the Mexican genome and the traditional food culture is needed to develop preventive and therapeutic strategies. Therefore, we aimed to provide a prevalence profile of several DRAG polymorphisms in the Mexican population, including Central West (CW) Mexico subpopulations. Geographic heat maps were built using ArcGIS10 (Esri, Redlands, CA, USA) software, based on the published data of the MTHFR C677T (rs1801133), ABCA1 Arg230Cys (rs9282541), APOE T388C (rs429358)/C526T (rs7412), LCT C-13910T (rs4988235) polymorphisms and AMY1 copy number variation (CNV). Also, new data obtained by allelic discrimination-real-time polymerase chain reaction (RT-PCR) assays for the MTHFR, ABCA1, and APOE polymorphisms as well as the AMY1 CNV in the CW Mexico subpopulations with different proportions of AM and EUR ancestry were included. In the CW region, the highest frequency of the MTHFR 677T, ABCA1 230C and APOE ε4 adaptive alleles was observed in the AM groups, followed by Mestizos with intermediate AM ancestry. The LCT-13910T allele frequency was highest in Mestizos-EUR but extremely low in AM, while the AMY1 diploid copy number was 6.82 ± 3.3 copies. Overall, the heat maps showed a heterogeneous distribution of the DRAG polymorphisms, in which the AM groups revealed the highest frequencies of the adaptive alleles followed by Mestizos. Given these genetic differences, genome-based nutritional advice should be tailored in a regionalized and individualized manner according to the available foods and Mexican traditional food culture that may lead

Factors that enable or limit the sustained use of improved firewood cookstoves: Qualitative findings eight years after an intervention in rural Mexico

PubMed Central

Catalán-Vázquez, Minerva; Fernández-Plata, Rosario; Martínez-Briseño, David; Pelcastre-Villafuerte, Blanca; Riojas-Rodríguez, Horacio; Suárez-González, Laura; Pérez-Padilla, Rogelio

2018-01-01

Objective The aim of this study was to analyze the factors enabling/limiting the use of improved cookstoves among rural fuel wood users from one mestizo and two indigenous communities eight years after an intervention in the state of Michoacan, in Mexico. Methods A qualitative study with an ethnographic perspective was conducted in 2013/2014 based on 62 interviews with women who had participated in an improved firewood cookstove program in 2005. Thematic qualitative content analysis was performed. Results Very few women from the indigenous communities were using the improved cookstove at the time of the study; the majority had dismantled or had ceased using it; whereas most of those from the mestizo community were using it for all of their cooking activities. In the indigenous communities, characterized by extended families, uptake of new technology was limited by traditional routine practices, rearrangement of rooms in the house, attachment to the traditional stove, a low- or non-risk perception of woodsmoke; gender relations, insufficient training, non-compliance with program recommendations and design-related aspects. Conversely, in the mestizo community, the uptake of the improved cookstove was favored by routine cooking practices in a nuclear family, a previous use of a raised cookstove and social representations on the health-disease-death effects of woodsmoke vs. the health benefits of cooking with improved stoves. The sociocultural dimension of communities and the cookstove design are aspects that either favor or limit the use of improved cookstoves in indigenous and mestizo populations. Conclusions Effective cookstove programs must take these elements into account from their early planning stages, and blend them into implementation and follow-up. Project communication, training and differentiated follow-up activities ensuring the operation and maintenance of the cookstove, should be designed according to the specific needs and traditions of each community

The Genetics of Mexico Recapitulates Native American Substructure and Affects Biomedical Traits

PubMed Central

Moreno-Estrada, Andrés; Gignoux, Christopher R.; Fernández-López, Juan Carlos; Zakharia, Fouad; Sikora, Martin; Contreras, Alejandra V.; Acuña-Alonzo, Victor; Sandoval, Karla; Eng, Celeste; Romero-Hidalgo, Sandra; Ortiz-Tello, Patricia; Robles, Victoria; Kenny, Eimear E.; Nuño-Arana, Ismael; Barquera-Lozano, Rodrigo; Macín-Pérez, Gastón; Granados-Arriola, Julio; Huntsman, Scott; Galanter, Joshua M.; Via, Marc; Ford, Jean G.; Chapela, Rocío; Rodriguez-Cintron, William; Rodríguez-Santana, Jose R.; Romieu, Isabelle; Sienra-Monge, Juan José; Navarro, Blanca del Rio; London, Stephanie J.; Ruiz-Linares, Andrés; Garcia-Herrera, Rodrigo; Estrada, Karol; Hidalgo-Miranda, Alfredo; Jimenez-Sanchez, Gerardo; Carnevale, Alessandra; Soberón, Xavier; Canizales-Quinteros, Samuel; Rangel-Villalobos, Héctor; Silva-Zolezzi, Irma; Burchard, Esteban Gonzalez; Bustamante, Carlos D.

2014-01-01

Mexico harbors great cultural and ethnic diversity, yet fine-scale patterns of human genome-wide variation from this region remain largely uncharacterized. We studied genomic variation within Mexico from over 1,000 individuals representing 20 indigenous and 11 mestizo populations. We found striking genetic stratification among indigenous populations within Mexico at varying degrees of geographic isolation. Some groups were as differentiated as Europeans are from East Asians. Pre-Columbian genetic substructure is recapitulated in the indigenous ancestry of admixed mestizo individuals across the country. Furthermore, two independently phenotyped cohorts of Mexicans and Mexican Americans showed a significant association between sub-continental ancestry and lung function. Thus, accounting for fine-scale ancestry patterns is critical for medical and population genetic studies within Mexico, in Mexican-descent populations, and likely in many other populations worldwide. PMID:24926019

Revitalizing Hispanic and Native American Communities: Four Examples.

ERIC Educational Resources Information Center

Robinson, Paul; And Others

1989-01-01

Describes locally controlled economic development strategies used by Native American and Hispanic cooperatives and organizations: Ganados del Valle, Madera Forest Products Association, Seventh Generation Fund, and Ramah Navajo Weavers Association. Discusses the issues of cultural and economic survival in isolated rural communities. (SV)

45. 800 H.P. WATER WHEEL UNIT (LEFT HAND) DIRECT CONNECTED ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

45. 800 H.P. WATER WHEEL UNIT (LEFT HAND) DIRECT CONNECTED TO A 500 K.W. G.E. CO. GENERATOR, SPEED 176 R.P.M., HEAD OF WATER 305 FT EFF., FOR SANTA ANA RIVER NO. 2 PLANT. ABNER DOBLE CO., ENGINEERS, SAN FRANCISCO, AUG. 29, 1904. TRACED FROM DOBLE BLUE PRINT, SEPT. 9, 1911. SCE drawing no. 5698. - Santa Ana River Hydroelectric System, SAR-2 Powerhouse, Redlands, San Bernardino County, CA

Association of Lactase Persistence Genotypes with High Intake of Dairy Saturated Fat and High Prevalence of Lactase Non-Persistence among the Mexican Population.

PubMed

Ojeda-Granados, Claudia; Panduro, Arturo; Rebello Pinho, João Renato; Ramos-Lopez, Omar; Gleyzer, Ketti; Malta, Fernanda de Mello; Gonzalez-Aldaco, Karina; Roman, Sonia

2016-01-01

Lactase (LCT) -13910 C>T and -22018 G>A polymorphisms associated with the lactase non-persistence (LNP)/persistence (LP) phenotypes vary globally. LP has been associated with obesity in Europeans. However, it has not been genetically evaluated in Mexico, a country with admixed population, recent introduction of dairy, and a high prevalence of obesity. Thus, we aimed to determine the distribution of the LCT polymorphisms and their association with the nutritional profile of West Mexico's populations. Genotyping of 1,196 individuals (natives and mestizos) was carried out by a Taqman allelic discrimination assay. Descriptive statistics and interpopulation analyzes were performed by SPSS, Arlequin, and Structure software. Demographic, anthropometric, biochemical and dietary data were analyzed in 212 mestizos. LNP genotypes mainly prevailed (CC 68.7% and GG 68.2%); both predominated in native Huicholes and Nahuas (>97.7%). Among the mestizos, the LP genotypes were associated with a higher intake of saturated fat (9.9 ± 3.9% vs. 8.5 ± 4.0%, p = 0.018; OR = 2.55, 95% CI 1.29-5.03, p = 0.006) and a daily/more frequent consumption of dairy (88.8 vs. 78.0%; p = 0.049) than LNP genotypes. The LNP trait was predominant in Mexicans with a major Amerindian ancestry. A daily consumption of dairy was associated with a higher intake of saturated fat in LP individuals. © 2016 S. Karger AG, Basel.

Absence of the tag polymorphism for the risk haplotype HLA-DR2 for multiple sclerosis in Wixárika subjects from Mexico.

PubMed

González-Enríquez, G V; Torres-Mendoza, B M; Márquez-Pedroza, J; Macías-Islas, M A; Ortiz, G G; Cruz-Ramos, J A

2018-02-03

The HLA-DRB1*15:01 allele has a demonstrated risk for the development of multiple sclerosis (MS) in most populations around the world. The single nucleotide polymorphism (SNP) rs3129934 is found in linkage disequilibrium with the risk haplotype formed by the HLA-DRB1*15:01 and HLA-DQB1*06:02 alleles, and it is considered a reliable marker of the presence of this haplotype. Native Americans have a null or low prevalence of MS. In this study, we sought to identify the frequency of rs3129934 in the Wixárika ethnic group as well as in Mestizo (mixed race) patients with MS and in controls from western Mexico. Through real-time polymerase chain reaction (PCR) using TaqMan probes, we analyzed the allele and genotype frequencies of rs3129934 in Mestizo individuals with and without MS and in 73 Wixárika subjects from the state of Jalisco, Mexico. The Wixárika subjects were homozygote for the C allele of rs3129934. The allele and genotype frequency in Mestizos with MS was similar to that of other MS populations with Caucasian ancestry. The absence of the T risk allele rs3129934 (associated with the haplotype HLA-DRB1*15:01, HLA-DQ1*06:02) in this sample of Wixárika subjects is consistent with the unreported MS in this Amerindian group, related to absence of such paramount genetic risk factor.

A New Strategy for Latin America

DTIC Science & Technology

1992-04-01

resulted in six significant racial groups; Indians, Europeans, Mestizo (Indians & Europeans); Black, Mulattoes (Black & Europeans), and Zambos (Indians...slice of the budget pie , a priority ranking of these countries would establish where the best benefits lie for US national security. As discussed, Latin

Toxoplasmosis gondii and schizophrenia: a case control study in a low Toxoplasma gondii seroprevalence Mexican population

USDA-ARS?s Scientific Manuscript database

There are conflicting reports concerning the association of T. gondii infection and schizophrenia. Therefore, we determined such association in a Mexican population of Mestizo ethnicity. Through a case-control study design, 50 schizophrenic patients and 150 control subjects matched by gender, age, r...

Beta 2 adrenergic receptor polymorphisms, at codons 16 and 27, and bronchodilator responses in adult Venezuelan asthmatic patients.

PubMed

Larocca, Nancy; Moreno, Dolores; Garmendia, Jenny Valentina; Velasquez, Olga; Martin-Rojo, Joana; Talamo, Carlos; Garcia, Alexis; De Sanctis, Juan Bautista

2013-12-01

One of the gene polymorphisms often studied in asthmatic patients is the β2 adrenergic receptor (ADRβ2). Even though in the Venezuelan Mestizo population there is a high incidence of asthma, there are no direct reports of ADRβ2 gene polymorphism, and treatment response. The aim of this study was to assess, in this population, the gene frequency of ADRβ2 polymorphisms at codons 16 Arg/Gly and 27 Gln/Glu, allergen sensitization, and its relationship to bronchodilator response. Purified genomic DNA was obtained form 105 Mestizo asthmatic and 100 Mestizo healthy individuals from Venezuela. The two polymorphisms were assessed by PCR-RFLP. Patient sensitization to aeroallergens and their response to bronchodilatation were correlated. Significant differences between patients and controls were recorded in: 1) the prevalence of Arg/Arg at codon 16 (28.6% in patients vs. 47% in controls, P<0.01), 2) the frequency of heterozygotes Arg/Gly (55% in patients vs. 35% in controls, P<0.01). Conversely, no differences in polymorphism frequencies were found at codon 27. The haplotypes Arg/Gly-Gln/Gln were more common in patients than controls (P <0.01), whereas the Arg/Arg-Gln/Glu combination prevailed in the control group (P<0.01). The Arg/Gly and Gln/Glu genotypes were associated with better responses after salbutamol. The asthmatic homozygotes Arg/Arg have higher sensitivity to aeroallergens. The difference in Arg/Arg frequency between groups suggests that this could be a protective genotype although the asthmatic group had a higher sensitivity to aeroallergens. The asthmatic heterozygotes had better bronchodilator responses than the homozygotes.

Distribution and persistence of sterile screwworms (Diptera: Calliphoridae) released at the Panama-Colombia border

USDA-ARS?s Scientific Manuscript database

The sterile insect technique is currently used by the Comisión Panamá - Estados Unidos para la Erradicación y Prevención del Gusano Barrenador del Ganado (COPEG) to maintain a barrier at the border between Panama and Colombia that prevents screwworms, Cochliomyia hominivorax (Coquerel), from South A...

When You Don't Know What's Important: Revitalizing Decision-Making in the Native American School.

ERIC Educational Resources Information Center

Boloz, Sigmund A.; Brutz, Ronald A.

In the Ganado Public School District (K-12, 1,650 students), in the northeast corner of the Navajo Reservation, an administrative retreat structure has been used for 4 years to promote the team management concept and maintain the District's formal direction. Building from a comprehensive needs assessment by and for the District's Navajo…

Epidemic hecatomb in the New World.

PubMed

Naranjo, P

1992-01-01

The American population developed, during thousands of years, free of epidemics that had been attacking Europe, Asia and Africa. The European and African migrations, after Columbus's first trip, produced an epidemic invasion of influenza, smallpox, measles, yellow fever, malaria, diphtheria, typhus, and other diseases that attacked the immunologically virgin populations and produced a very high mortality, with a diminution of the indigenous population of more than 90% in many places. According to historical evidence, the first epidemic was influenza, produced by swine strain of virus, immediately followed by smallpox. The Spaniards mated freely with the Indians producing a mixed race called the Mestizo, who were immunologically more capable of defending themselves against various viruses, bacteria, and parasites brought over from the Old World. Marriage between the races also was sanctioned by Queen Isabella (1503) and Fernando I (1515). With these new genetic immunologic defenses against infections, the Mestizo eventually made up the majority of the population of Indians in the New World.

Periodontal microbiology in Latin America.

PubMed

Contreras, Adolfo; Moreno, Sandra M; Jaramillo, Adriana; Pelaez, Melissa; Duque, Andres; Botero, Javier E; Slots, Jørgen

2015-02-01

This review article describes the microbiota associated with periodontal disease in Latin America. This vast territory includes 22 nations, which show great ethnic diversity, with large groups of White people, Black people, Mestizo people and Native people. Widespread poverty and limited access to education and health-care services, including periodontal care, are prominent predisposing factors for destructive periodontal disease in Latin America. Black people and Mestizo people seem to have particularly severe periodontal disease and are frequently colonized by the major periodontal pathogens Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans. The 'red complex' bacterial pathogens and A. actinomycetemcomitans predominate in chronic and aggressive periodontitis, but gram-negative enteric rods and herpesviruses can also play important periodontopathic roles in Latin America. The key to minimizing the risk of periodontal disease is control of the pathogens, and new low-cost periodontal treatments deserve serious consideration in Latin America. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

A Study of Parental Attitudes and Values Towards Education on the Navajo and Hopi Reservations. Part II, Parental Attitudes [Window Rock].

ERIC Educational Resources Information Center

Biglin, J. E.; And Others

Objectives of this study were (1) to determine the parental attitudes of those parents who reside in the Chinle, Keams Canyon, Kayenta, Ganado, Window Rock, or Tuba City school district toward public education on the Navajo and Hopi reservations in the areas of teachers, curriculum, social behaviors of children, school services, school policies,…

A Study of Parental Attitudes and Values Towards Education on the Navajo and Hopi Reservations. Part II, Parental Attitudes [Kayenta].

ERIC Educational Resources Information Center

Biglin, J. E.; And Others

Objectives of this study were (1) to determine the parental attitudes of those parents who reside in the Chinle, Keams Canyon, Kayenta, Ganado, Window Rock, or Tuba City school district toward public education on the Navajo and Hopi reservations in the areas of teachers, curriculum, social behaviors of children, school services, school policies,…

A Study of Parental Attitudes and Values Towards Education on the Navajo and Hopi Reservations. Part II, Parental Attitudes [Tuba City].

ERIC Educational Resources Information Center

Biglin, J. E.; And Others

Objectives of this study were (1) to determine the parental attitudes of those parents who reside in the Chinle, Keams Canyon, Kayenta, Ganado, Window Rock, or Tuba City school district toward public education on the Navajo and Hopi reservations in the areas of teachers, curriculum, social behaviors of children, school services, school policies,…

A Study of Parental Attitudes and Values Towards Education on the Navajo and Hopi Reservations. Part II, Parental Attitudes [Keams Canyon].

ERIC Educational Resources Information Center

Biglin, J. E.; And Others

Objectives of this study were (1) to determine the parental attitudes of those parents who reside in the Chinle, Keams Canyon, Kayenta, Ganado, Window Rock, or Tuba City school district toward public education on the Navajo and Hopi reservations in the areas of teachers, curriculum, social behaviors of children, school services, school policies,…

A Study of Parental Attitudes and Values Towards Education on the Navajo and Hopi Reservations. Part II, Parental Attitudes [Chinle].

ERIC Educational Resources Information Center

Biglin, J. E.; And Others

Objectives of this study were (1) to determine the parental attitudes of those parents who reside in the Chinle, Keams Canyon, Kayenta, Ganado, Window Rock, or Tuba City school district toward public education on the Navajo and Hopi reservations in the areas of teachers, curriculum, social behaviors of children, school services, school policies,…

The Hispanicization of the United States.

ERIC Educational Resources Information Center

Nostrand, Richard L.

Two strikingly contrasting culture groups, Latin Americans and Anglo Americans, overlap in a Borderlands that straddles the international boundary between the United States and Mexico. This overlap began with the Aztec conquest by Cortes which triggered the intermixing and miscegenation between Spaniards and Indians that produced a mestizo people…

High‐altitude ancestry protects against hypoxia‐associated reductions in fetal growth

PubMed Central

Julian, Colleen Glyde; Vargas, Enrique; Armaza, J Fernando; Wilson, Megan J; Niermeyer, Susan; Moore, Lorna G

2007-01-01

Objective The chronic hypoxia of high‐altitude (⩾2500 m) residence has been shown to decrease birth weight in all populations studied to date. However, multigenerational high‐altitude populations appear protected relative to newcomer groups. This study aimed to determine whether such protection exists independently of other factors known to influence fetal growth and whether admixed populations (ie, people having both high‐ and low‐altitude ancestry) show an intermediate level of protection. Design 3551 medical records from consecutive deliveries to Andean, European or Mestizo (ie, admixed) women at low, intermediate or high altitudes in Bolivia were evaluated for maternal characteristics influencing fetal growth as measured by birth weight and the frequency of small for gestational age births (SGA or ⩽10th percentile birth weight for gestational age and sex). Two‐way analysis of variance and χ2 tests were used to compare maternal and infant characteristics. The effects of ancestry or altitude on SGA and birth weight were assessed using logistic or linear regression models, respectively. Results Altitude decreased birth weight and increased SGA in all ancestry groups. Andean infants weighed more and were less often SGA than Mestizo or European infants at high altitude (13%, 16% and 33% respectively, p<0.01). After accounting for the influences of maternal hypertensive complications of pregnancy, parity, body weight, and number of prenatal visits, European relative to Andean ancestry increased the frequency of SGA at high altitude nearly fivefold. Conclusions Andean relative to European ancestry protects against altitude‐associated reductions in fetal growth. The intermediate protection seen in the admixed (Mestizo) group is consistent with the influence of genetic or other Andean‐specific protective characteristics. PMID:17329275

Effects of ethnic attributes on the quality of family planning services in Lima, Peru: a randomized crossover trial.

PubMed

Planas, Maria-Elena; García, Patricia J; Bustelo, Monserrat; Carcamo, Cesar P; Martinez, Sebastian; Nopo, Hugo; Rodriguez, Julio; Merino, Maria-Fernanda; Morrison, Andrew

2015-01-01

Most studies reporting ethnic disparities in the quality of healthcare come from developed countries and rely on observational methods. We conducted the first experimental study to evaluate whether health providers in Peru provide differential quality of care for family planning services, based on the indigenous or mestizo (mixed ethnoracial ancestry) profile of the patient. In a crossover randomized controlled trial conducted in 2012, a sample of 351 out of the 408 public health establishments in Metropolitan Lima, Peru were randomly assigned to receive unannounced simulated patients enacting indigenous and mestizo profiles (sequence-1) or mestizo and then indigenous profiles (sequence-2), with a five week wash-out period. Both ethnic profiles used the same scripted scenario for seeking contraceptive advice but had distinctive cultural attributes such as clothing, styling of hair, make-up, accessories, posture and patterns of movement and speech. Our primary outcome measure of quality of care is the proportion of technical tasks performed by providers, as established by Peruvian family planning clinical guidelines. Providers and data analysts were kept blinded to the allocation. We found a non-significant mean difference of -0.7% (p = 0.23) between ethnic profiles in the percentage of technical tasks performed by providers. However we report large deficiencies in the compliance with quality standards of care for both profiles. Differential provider behaviour based on the patient's ethnic profiles compared in the study did not contribute to deficiencies in family planning outcomes observed. The study highlights the need to explore other determinants for poor compliance with quality standards, including demand and supply side factors, and calls for interventions to improve the quality of care for family planning services in Metropolitan Lima.

Nicaragua: Educational Policy for Ethnic Minorities.

ERIC Educational Resources Information Center

Rippberger, Susan

Since taking power, the Sandinista government has made a commitment to educating all Nicaraguans. Under its direction, literacy increased from approximately 50 to 88 percent. Thousands of new teachers were hired, and the number of elementary schools doubled. The official language is Spanish, and the dominant culture, Mestizo (mixed Spanish and…

Resist This! Embodying the Contradictory Positions and Collective Possibilities of Transformative Resistance

ERIC Educational Resources Information Center

Quijada Cerecer, David Alberto; Cahill, Caitlin; Bradley, Matt

2011-01-01

Youth participatory action research (YPAR) and arts-informed approaches reflect a source of critical resistance at the intersection of theory and practice (praxis). Our discussion draws upon "Mestizo Arts & Activism" ("MAA"), a participatory action research collective made up of young people who focused their research on the educational rights of…

Let Jorge Do It: An Approach to Rural Nonformal Education.

ERIC Educational Resources Information Center

Hoxeng, James

Operating under the philosophy that people can learn from each other, the Nonformal Education Project trained 24 Ecuadorian campesinos in seven rural mestizo villages to instruct their peers in basic litaracy skills, negotiating techniques, and the development of self-esteem. Within a year of operation some of the original "facilitators"…

Mexico: The Crisis of Identity.

ERIC Educational Resources Information Center

Ewen, Alexander

1994-01-01

Examines the place of Indian people in Mexican society and politics, from the conquest to the 1994 Zapatista uprising in Chiapas (fueled by the threat to rural indigenous communal lands posed by economic reforms). Although Indianness is celebrated as contributing to the idealized mestizo "race," self-identification as Indian threatens…

Amerindian and Translingual Literacies across Time and Space

ERIC Educational Resources Information Center

Coronel-Molina, Serafín M.; Cowan, Peter M.

2017-01-01

Recent studies have examined Indigenous and mestizo communities that engage in social practices of transculturated, Amerindian and translingual literacies, often to resist efforts by powerful groups to oppress them. By drawing on data from studies conducted in Peru and the United States, we trace the trajectories of Amerindian and translingual…

Teaching English Critically to Mexican Children

ERIC Educational Resources Information Center

López-Gopar, Mario E.

2014-01-01

The purpose of this article is to present one significant part of a large-scale critical-ethnographic-action-research project (CEAR Project) carried out in Oaxaca, Mexico. The overall CEAR Project has been conducted since 2007 in different Oaxacan elementary schools serving indigenous and mestizo (mixed-race) children. In the CEAR Project, teacher…

Historical Development of the Concept of the Multicultural Personality: A Mixed Ethnic Heritage Perspective.

ERIC Educational Resources Information Center

Ramirez, Manuel, III

The Mestizo (mixed ethnic heritage) Civil Rights Movement in the United States can be divided into five phases: Pre-Civil Rights, Civil Rights, Bilingual-Multicultural Education, Political Conservatism, and the current period, an Assault on Civil Rights. The paper describes how a personal research career has been influenced by the different stages…

Schooling, Environment and Cognitive Development: A Cross-Cultural Study.

ERIC Educational Resources Information Center

Stevenson, Harold W.; And Others

1978-01-01

Investigated the influence of schooling and environment on young children's memory and cognitive skills. Subjects were five- and six-year-old Mestizo and Quechua Indian children living in jungle villages or city slums in Peru. Samples of upper-middle-class children in Lima and poor children in Detroit were also tested. (JMB)

Doble Research Supplement (Digest of Bilingual Education).

ERIC Educational Resources Information Center

Berney, Tomi D., Ed.; Eisenberg, Anne, Ed.

This bulletin summarizes the arguments for bilingual education in the United States. More than one language is needed as the medium of instruction where the child's mother tongue may not be English. Instruction in a weaker language not only retards reading, but arithmetic and other subjects are not as well learned if the child must cope with…

Features associated with hematologic abnormalities and their impact in patients with systemic lupus erythematosus: Data from a multiethnic Latin American cohort.

PubMed

González-Naranjo, Luis A; Betancur, Octavio Martínez; Alarcón, Graciela S; Ugarte-Gil, Manuel F; Jaramillo-Arroyave, Daniel; Wojdyla, Daniel; Pons-Estel, Guillermo J; Rondón-Herrera, Federico; Vásquez-Duque, Gloria M; Quintana-López, Gerardo; Da Silva, Nilzio A; Tavares Brenol, João C; Reyes-Llerena, Gil; Pascual-Ramos, Virginia; Amigo, Mary C; Massardo, Loreto; Alfaro-Lozano, José; Segami, María I; Esteva-Spinetti, María H; Iglesias-Gamarra, Antonio; Pons-Estel, Bernardo A

2016-06-01

To examine hematological manifestations' correlates and their impact on damage accrual and mortality in SLE patients from the multiethnic, Latin American, GLADEL cohort. In patients with recent SLE diagnosis (≤2 years), the association between follow-up hematological manifestations (per ACR criteria) and socio-demographic and clinical variables was examined by univariable and multivariable logistic regressions; their impact on damage accrual and mortality was examined by Poisson and Cox proportional-hazards regression analyses, respectively. Of 1437 patients, 948 (66.0%) developed ≥1 hematological manifestation [5.5% hemolytic anemia (AHA), 16.3% thrombocytopenia, and 56.4% lymphopenia] over 4.3 (3.3) follow-up years. Younger age, Mestizo ethnicity, hematologic disorder (at/or before SLE diagnosis), and first damage recorded were associated with hematological manifestations while antimalarials were negatively associated. AHA (at/or before SLE diagnosis), anti-Sm, and anti-RNP antibodies were associated with subsequent AHA occurrence while musculoskeletal involvement was negatively associated. Thrombocytopenia (at/or before SLE diagnosis), AHA, anti-phospholipid antibodies (aPLs), anti-SSA/Ro, anti-SSB/La antibodies, and first damage recorded were associated with later thrombocytopenia occurrence. Lymphopenia (at/or before SLE diagnosis), younger age at diagnosis, Mestizo ethnicity, having medical insurance, and first damage recorded were associated with subsequent lymphopenia occurrence while antimalarials and azathioprine treatment were negatively associated. AHA was associated with damage accrual and mortality after adjusting for variables known to affect these outcomes. Mestizo ethnicity and early hematological manifestations are risk factors for their subsequent occurrence while antimalarials have a protective effect. The associations between AHA and aPLs and thrombocytopenia were corroborated. AHA contributes independently to damage accrual and diminished

Association of HMOX1 and NQO1 Polymorphisms with Metabolic Syndrome Components

PubMed Central

Martínez-Hernández, Angélica; Córdova, Emilio J.; Rosillo-Salazar, Oscar; García-Ortíz, Humberto; Contreras-Cubas, Cecilia; Islas-Andrade, Sergio; Revilla-Monsalve, Cristina; Salas-Labadía, Consuelo; Orozco, Lorena

2015-01-01

Metabolic syndrome (MetS) is among the most important public health problems worldwide, and is recognized as a major risk factor for various illnesses, including type 2 diabetes mellitus, obesity, and cardiovascular diseases. Recently, oxidative stress has been suggested as part of MetS aetiology. The heme oxygenase 1 (HMOX1) and NADH:quinone oxidoreductase 1 (NQO1) genes are crucial mediators of cellular defence against oxidative stress. In the present study, we analysed the associations of HMOX1 (GT)n and NQO1 C609T polymorphisms with MetS and its components. Our study population comprised 735 Mexican Mestizos unrelated volunteers recruited from different tertiary health institutions from Mexico City. In order to know the HMOX1 (GT)n and NQO1 C609T allele frequencies in Amerindians, we included a population of 241 Amerindian native speakers. Their clinical and demographic data were recorded. The HMOX1 (GT)n polymorphism was genotyped using PCR and fluorescence technology. NQO1 C609T polymorphism genotyping was performed using TaqMan probes. Short allele (<25 GT repeats) of the HMOX1 polymorphism was associated with high systolic and diastolic blood pressure, and the T allele of the NQO1 C609T polymorphism was associated with increased triglyceride levels and decreased HDL-c levels, but only in individuals with MetS. This is the first study to analyse the association between MetS and genes involved in oxidative stress among Mexican Mestizos. Our data suggest that polymorphisms of HMOX1 and NQO1 genes are associated with a high risk of metabolic disorders, including high systolic and diastolic blood pressure, hypertriglyceridemia, and low HDL-c levels in Mexican Mestizo individuals. PMID:25933176

Association of HMOX1 and NQO1 Polymorphisms with Metabolic Syndrome Components.

PubMed

Martínez-Hernández, Angélica; Córdova, Emilio J; Rosillo-Salazar, Oscar; García-Ortíz, Humberto; Contreras-Cubas, Cecilia; Islas-Andrade, Sergio; Revilla-Monsalve, Cristina; Salas-Labadía, Consuelo; Orozco, Lorena

2015-01-01

Metabolic syndrome (MetS) is among the most important public health problems worldwide, and is recognized as a major risk factor for various illnesses, including type 2 diabetes mellitus, obesity, and cardiovascular diseases. Recently, oxidative stress has been suggested as part of MetS aetiology. The heme oxygenase 1 (HMOX1) and NADH:quinone oxidoreductase 1 (NQO1) genes are crucial mediators of cellular defence against oxidative stress. In the present study, we analysed the associations of HMOX1 (GT)n and NQO1 C609T polymorphisms with MetS and its components. Our study population comprised 735 Mexican Mestizos unrelated volunteers recruited from different tertiary health institutions from Mexico City. In order to know the HMOX1 (GT)n and NQO1 C609T allele frequencies in Amerindians, we included a population of 241 Amerindian native speakers. Their clinical and demographic data were recorded. The HMOX1 (GT)n polymorphism was genotyped using PCR and fluorescence technology. NQO1 C609T polymorphism genotyping was performed using TaqMan probes. Short allele (<25 GT repeats) of the HMOX1 polymorphism was associated with high systolic and diastolic blood pressure, and the T allele of the NQO1 C609T polymorphism was associated with increased triglyceride levels and decreased HDL-c levels, but only in individuals with MetS. This is the first study to analyse the association between MetS and genes involved in oxidative stress among Mexican Mestizos. Our data suggest that polymorphisms of HMOX1 and NQO1 genes are associated with a high risk of metabolic disorders, including high systolic and diastolic blood pressure, hypertriglyceridemia, and low HDL-c levels in Mexican Mestizo individuals.

Effects of Ethnic Attributes on the Quality of Family Planning Services in Lima, Peru: A Randomized Crossover Trial

PubMed Central

Planas, Maria-Elena; García, Patricia J.; Bustelo, Monserrat; Carcamo, Cesar P.; Martinez, Sebastian; Nopo, Hugo; Rodriguez, Julio; Merino, Maria-Fernanda; Morrison, Andrew

2015-01-01

Most studies reporting ethnic disparities in the quality of healthcare come from developed countries and rely on observational methods. We conducted the first experimental study to evaluate whether health providers in Peru provide differential quality of care for family planning services, based on the indigenous or mestizo (mixed ethnoracial ancestry) profile of the patient. In a crossover randomized controlled trial conducted in 2012, a sample of 351 out of the 408 public health establishments in Metropolitan Lima, Peru were randomly assigned to receive unannounced simulated patients enacting indigenous and mestizo profiles (sequence-1) or mestizo and then indigenous profiles (sequence-2), with a five week wash-out period. Both ethnic profiles used the same scripted scenario for seeking contraceptive advice but had distinctive cultural attributes such as clothing, styling of hair, make-up, accessories, posture and patterns of movement and speech. Our primary outcome measure of quality of care is the proportion of technical tasks performed by providers, as established by Peruvian family planning clinical guidelines. Providers and data analysts were kept blinded to the allocation. We found a non-significant mean difference of -0·7% (p = 0·23) between ethnic profiles in the percentage of technical tasks performed by providers. However we report large deficiencies in the compliance with quality standards of care for both profiles. Differential provider behaviour based on the patient's ethnic profiles compared in the study did not contribute to deficiencies in family planning outcomes observed. The study highlights the need to explore other determinants for poor compliance with quality standards, including demand and supply side factors, and calls for interventions to improve the quality of care for family planning services in Metropolitan Lima. PMID:25671664

Influence of School and Environment on Selective Memory.

ERIC Educational Resources Information Center

Wilkinson, Alex; And Others

1979-01-01

Subjects were 943 mestizo and Quechua Indian children aged five and six years who lived in jungle villages near Lanas and in slum settlements in Lima, Peru. Some six year olds attended school and others did not. The children were tested with a task that assessed memory for central and incidental features of drawings. (JMB)

Hepatitis B virus infection in Latin America: A genomic medicine approach

PubMed Central

Roman, Sonia; Jose-Abrego, Alexis; Fierro, Nora Alma; Escobedo-Melendez, Griselda; Ojeda-Granados, Claudia; Martinez-Lopez, Erika; Panduro, Arturo

2014-01-01

Hepatitis B virus (HBV) infection is the leading cause of severe chronic liver disease. This article provides a critical view of the importance of genomic medicine for the study of HBV infection and its clinical outcomes in Latin America. Three levels of evolutionary adaptation may correlate with the clinical outcomes of HBV infection. Infections in Latin America are predominantly of genotype H in Mexico and genotype F in Central and South America; these strains have historically circulated among the indigenous population. Both genotypes appear to be linked to a benign course of disease among the native and mestizo Mexicans and native South Americans. In contrast, genotypes F, A and D are common in acute and chronic infections among mestizos with Caucasian ancestry. Hepatocellular carcinoma is rare in Mexicans, but it has been associated with genotype F1b among Argentineans. This observation illustrates the significance of ascertaining the genetic and environmental factors involved in the development of HBV-related liver disease in Latin America, which contrast with those reported in other regions of the world. PMID:24966588

Epidemiology of diabetes mellitus in Mexico.

PubMed

Bello-Chavolla, Omar Y; Rojas-Martinez, Rosalba; Aguilar-Salinas, Carlos A; Hernández-Avila, Mauricio

2017-01-01

Type 2 diabetes is the main health problem in Mexico. The large and growing number of cases and the remarkable economic impact of the disease support this statement. The condition is expressed at an earlier age and at a lower body mass index in Mexican mestizos compared with the age and body mass index reported in Caucasians. In addition, Mexican mestizos have an increased susceptibility to developing diabetic nephropathy. The Mexican health system needs major adjustments in order to prevent and treat type 2 diabetes. Treatment is not currently based on the needs and expectations of the patient. As a result, it is insufficient, belated, and costly. Close to 20% of the preventable deaths in Mexico are caused by diabetes and related metabolic diseases. Even a small decrease in this rate could result in substantial savings for the Mexican healthcare system. © The Author(s) 2016. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Plants used by native Amazonian groups from the Nanay River (Peru) for the treatment of malaria.

PubMed

Ruiz, Lastenia; Ruiz, Liliana; Maco, Martha; Cobos, Marianela; Gutierrez-Choquevilca, Andréa-Luz; Roumy, Vincent

2011-01-27

In order to evaluate the antimalarial potential of traditional remedies used in Peru, Indigenous and Mestizo populations from the river Nanay in Loreto were interviewed about traditional medication for the treatment of malaria. The survey took place on six villages and led to the collection of 59 plants. 35 hydro-alcoholic extractions were performed on the 21 most cited plants. The extracts were then tested for antiplasmodial activity in vitro on Plasmodium falciparum chloroquine resistant strain (FCR-3), and ferriprotoporphyrin inhibition test was also performed in order to assume pharmacological properties. Extracts from 9 plants on twenty-one tested (Abuta rufescens, Ayapana lanceolata, Capsiandra angustifolia, Citrus limon, Citrus paradise, Minquartia guianensis, Potalia resinífera, Scoparia dulcis, and Physalis angulata) displayed an interesting antiplasmodial activity (IC(50)<10 μg/ml) and 16 remedies were active on the ferriprotoporphyrin inhibition test. The results give scientific validation to the traditional medical knowledge of the Amerindian and Mestizo populations from Loreto and exhibit a source of potentially active plants. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Hernan Cortes; Conquistador and Colonizer. The Tinker Pamphlet Series for the Teaching of Mexican American Heritage.

ERIC Educational Resources Information Center

Miller, Hubert J.

The conquest and colonization of Mexico initiated by Hernan Cortes resulted in the fusion of the Indian and Hispanic cultures. This fusion led to the "mestizo" culture. Cortes was the bearer of the Hispanic heritage just as the Aztecs and other Indians in Mexico and the Southwest were the carriers of the Indian heritage. In studying the…

Linguistic Purism in Cuzco, Peru: A Historical Perspective.

ERIC Educational Resources Information Center

Nino-Murcia, Mercedes

1997-01-01

Notes that a group of mestizo intellectuals in Peru claims that "Qhpaj'simi" is the Quechua used by the ancient Inca nobility and is the purest form of Quechua. Explains that a social hierarchy has arisen with the use of this "imperial language" demarcating its users from the common people and that these purist attitudes play a…

Building the genomic nation: ‘Homo Brasilis’ and the ‘Genoma Mexicano’ in comparative cultural perspective

PubMed Central

Kent, Michael; García-Deister, Vivette; López-Beltrán, Carlos; Santos, Ricardo Ventura; Schwartz-Marín, Ernesto; Wade, Peter

2015-01-01

This article explores the relationship between genetic research, nationalism and the construction of collective social identities in Latin America. It makes a comparative analysis of two research projects – the ‘Genoma Mexicano’ and the ‘Homo Brasilis’ – both of which sought to establish national and genetic profiles. Both have reproduced and strengthened the idea of their respective nations of focus, incorporating biological elements into debates on social identities. Also, both have placed the unifying figure of the mestizo/mestiço at the heart of national identity constructions, and in so doing have displaced alternative identity categories, such as those based on race. However, having been developed in different national contexts, these projects have had distinct scientific and social trajectories: in Mexico, the genomic mestizo is mobilized mainly in relation to health, while in Brazil the key arena is that of race. We show the importance of the nation as a frame for mobilizing genetic data in public policy debates, and demonstrate how race comes in and out of focus in different Latin American national contexts of genomic research, while never completely disappearing. PMID:27479999

5. POWERHOUSE INTERIOR SHOWING EXCITER No. 1. SMALL PELTONDOBLE IMPULSE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

5. POWERHOUSE INTERIOR SHOWING EXCITER No. 1. SMALL PELTON-DOBLE IMPULSE WHEEL IN FOREGROUND. VIEW TO NORTHWEST. - Rush Creek Hydroelectric System, Powerhouse Exciters, Rush Creek, June Lake, Mono County, CA

Aldehyde dehydrogenase polymorphism in North American, South American, and Mexican Indian populations.

PubMed Central

Goedde, H W; Agarwal, D P; Harada, S; Rothhammer, F; Whittaker, J O; Lisker, R

1986-01-01

While about 40% of the South American Indian populations (Atacameños, Mapuche, Shuara) were found to be deficient in aldehyde dehydrogenase isozyme I (ALDH2 or E2), preliminary investigations showed very low incidence of isozyme deficiency among North American natives (Sioux, Navajo) and Mexican Indians (mestizo). Possible implications of such trait differences on cross-cultural behavioral response to alcohol drinking are discussed. PMID:3953578

12. POWERHOUSE INTERIOR SHOWING EXCITER No. 2 SMALL PELTONDOBLE IMPULSE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

12. POWERHOUSE INTERIOR SHOWING EXCITER No. 2 SMALL PELTON-DOBLE IMPULSE WHEEL, HAND-CONTROLLED GATE VALVE, AND NOZZLE. VIEW TO SOUTHWEST. - Rush Creek Hydroelectric System, Powerhouse Exciters, Rush Creek, June Lake, Mono County, CA

6. POWERHOUSE INTERIOR SHOWING EXCITER No. 1. HANDCONTROLLED GATE VALVE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

6. POWERHOUSE INTERIOR SHOWING EXCITER No. 1. HAND-CONTROLLED GATE VALVE SHOWN ON NOZZLE TO PELTON-DOBLE IMPULSE WHEEL. VIEW TO NORTHEAST. - Rush Creek Hydroelectric System, Powerhouse Exciters, Rush Creek, June Lake, Mono County, CA

14. POWERHOUSE INTERIOR, EXCITER No. 2 SHOWING GENERAL ELECTRIC INDUCTION ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

14. POWERHOUSE INTERIOR, EXCITER No. 2 SHOWING GENERAL ELECTRIC INDUCTION MOTOR IN SERIES BETWEEN PELTON-DOBLE IMPULSE WHEEL AND GENERAL ELECTRIC GENERATOR. VIEW TO EAST. - Rush Creek Hydroelectric System, Powerhouse Exciters, Rush Creek, June Lake, Mono County, CA

Venezuela, A Country Study.

DTIC Science & Technology

1982-04-16

NUMBERS US Army War College Carlisle Barracks, PA 17013 11. CONTROLLING OFFICE NAME AND ADDRESS 12. REPORT DATE Same16 Aril 1982Same13. NUMBER OF...to grips with expectations for more and better social welfare programs, education, health facilities and jobs. The pressures are the 2 greatest in the...the mestizos or mulattos - and freed blacks. This group was spreading through the country. They became a significant ethnic culture in Venezuela

Autoimmune vitiligo in rheumatic disease in the mestizo Mexican population.

PubMed

Avalos-Díaz, Esperanza; Pérez-Pérez, Elena; Rodríguez-Rodríguez, Mayra; Pacheco-Tovar, María-Guadalupe; Herrera-Esparza, Rafael

2016-08-01

Vitiligo is a chronic disease characterized by the dysfunction or destruction of melanocytes with secondary depigmentation. The aim of the present study was to determine the prevalence of vitiligo associated with autoimmune rheumatic diseases. The clinical records from a 10-year database of patients with rheumatic diseases and associated vitiligo was analysed, with one group of patients having autoimmune rheumatic disease and another non-autoimmune rheumatic disease. Available serum samples were used to assess the anti-melanocyte antibodies. A total of 5,251 individual clinical files were archived in the last 10 years, and these patients underwent multiple rheumatology consultations, with 0.3% of the group presenting with vitiligo. The prevalence of vitiligo in the autoimmune rheumatic disease group was 0.672%, which was mainly associated with lupus and arthritis. However, patients with more than one autoimmune disease had an increased relative risk to develop vitiligo, and anti-melanocyte antibodies were positive in 92% of these patients. By contrast, the prevalence was 0.082% in the group that lacked autoimmune rheumatic disease and had negative autoantibodies. In conclusion, the association between vitiligo and autoimmune rheumatic diseases was relatively low. However, the relative risk increased when there were other autoimmune comorbidities, such as thyroiditis or celiac disease. Therefore, the presence of multiple autoimmune syndromes should be suspected.

[Polymorphism g.37190613 G>A of the ELMO1 gene in the Mexican population: potential marker for clinical-surgical pathology].

PubMed

Topete-González, Luz Rosalba; Ramirez-Garcia, Sergio Alberto; Charles-Niño, Claudia; Villa-Ruano, Nemesio; Mosso-González, Clemente; Dávalos-Rodríguez, Nory Omayra

2014-01-01

ELMO1 is a gene located at locus 7p14.2-14.1 that codifies a regulatory protein involved in fibrogenesis, cell migration, phagocytosis and apoptosis. This gene presents a single nucleotide polymorphism, which appears to be linked with the development of diabetic nephropathy. Currently, there are no studies in regard to the presence of such polymorphism in the Mexican population. Therefore, the aim of this work was to estimate the frequency rate of alleles and genotypes of polymorphism rs1345365 from ELMO1 in Mexican mestizos who inhabit the west and the southeast regions of Mexico in order to generate reliable data for further association studies. There were 322 individuals who were screened for the identification of polymorphism rs1345365 using genomic DNA from leucocytes as a template for PCR-PASA reactions. Amplicons were separated in 7% PAGE and visualized after staining with silver nitrate. The reference allele (A) was the most frequent in both western and southeastern populations of Mexico. In addition, a different genotype distribution was found with respect to other populations. The results of this study indicate that both populations are in Hardy-Weinberg equilibrium. This study also reveals a low frequency rate of the ancestral genotype for the polymorphism rs1345365 in mestizos from the western and southeastern regions of Mexico.

Helicobacter pylori Infection in Rural and Urban Dyspeptic Patients from Venezuela

PubMed Central

Contreras, Monica; Fernández-Delgado, Milagro; Reyes, Nelson; García-Amado, María Alexandra; Rojas, Héctor; Michelangeli, Fabian

2015-01-01

The goal of this work was to assess the Helicobacter pylori prevalence in a rural mestizo population and compare it to an urban population from Venezuela. The study was performed in gastric juice samples of 71 dyspeptic patients from Caracas (urban) and 39 from Tucupita (rural), in the Orinoco Delta region. Helicobacter pylori was detected by amplification of 16S rRNA, glmM, and ureA genes in 55.0% patients from urban and 87.2% from rural populations. cagA was found positive in 51% and 62% urban and rural patients, respectively. Non-H. pylori Helicobacter species were not detected in the urban population, but was found in 7.7% of patients in the rural study site. Frequency values of the 16S rRNA, glmM, and ureA genes were higher in the rural population. The odds ratio for each gene was 15.18 for 16S rRNA, 2.34 for glmM, 2.89 for ureA, and 1.53 cagA, showing significant differences except for cagA when gene frequency was compared in both populations. These results demonstrate a higher frequency of H. pylori and gastric non-H. pylori Helicobacter infection in a rural mestizo population with low hygienic standards as compared with city dwellers, representing a potential risk for the development of gastroduodenal diseases. PMID:26195456

Mast cells in the human lung at high altitude

NASA Astrophysics Data System (ADS)

Heath, Donald

1992-12-01

Mast cell densities in the lung were measured in five native highlanders of La Paz (3600 m) and in one lowlander dying from high-altitude pulmonary oedema (HAPO) at 3440 m. Two of the highlanders were mestizos with normal pulmonary arteries and the others were Aymara Indians with muscular remodelling of their pulmonary vasculature. The aim of the investigation was to determine if accumulation of mast cells in the lung at high altitude (HA) is related to alveolar hypoxia alone, to a combination of hypoxia and muscularization of the pulmonary arterial tree, or to oedema of the lung. The lungs of four lowlanders were used as normoxic controls. The results showed that the mast cell density of the two Mestizos was in the normal range of lowlanders (0.6-8.8 cells/mm2). In the Aymara Indians the mast cell counts were raised (25.6-26.0 cells/mm2). In the lowlander dying from HAPO the mast cell count was greatly raised to 70.1 cells/mm2 lung tissue. The results show that in native highlanders an accumulation of mast cells in the lung is not related to hypoxia alone but to a combination of hypoxia and muscular remodelling of the pulmonary arteries. However, the most potent cause of increased mast cell density in the lung at high altitude appears to be high-altitude pulmonary oedema.

Differential Item Functioning of the Psychological Domain of the Menopause Rating Scale.

PubMed

Monterrosa-Castro, Alvaro; Portela-Buelvas, Katherin; Oviedo, Heidi C; Herazo, Edwin; Campo-Arias, Adalberto

2016-01-01

Introduction. Quality of life could be quantified with the Menopause Rating Scale (MRS), which evaluates the severity of somatic, psychological, and urogenital symptoms in menopause. However, differential item functioning (DIF) analysis has not been applied previously. Objective . To establish the DIF of the psychological domain of the MRS in Colombian women. Methods . 4,009 women aged between 40 and 59 years, who participated in the CAVIMEC (Calidad de Vida en la Menopausia y Etnias Colombianas) project, were included. Average age was 49.0 ± 5.9 years. Women were classified in mestizo, Afro-Colombian, and indigenous. The results were presented as averages and standard deviation ( X ± SD). A p value <0.001 was considered statistically significant. Results . In mestizo women, the highest X ± SD were obtained in physical and mental exhaustion (PME) (0.86 ± 0.93) and the lowest ones in anxiety (0.44 ± 0.79). In Afro-Colombian women, an average score of 0.99 ± 1.07 for PME and 0.63 ± 0.88 for anxiety was gotten. Indigenous women obtained an increased average score for PME (1.33 ± 0.93). The lowest score was evidenced in depressive mood (0.50 ± 0.81), which is different from other Colombian women ( p < 0.001). Conclusions . The psychological items of the MRS show differential functioning according to the ethnic group, which may induce systematic error in the measurement of the construct.

The −174G/C and −572G/C Interleukin 6 Promoter Gene Polymorphisms in Mexican Patients with Rheumatoid Arthritis: A Case-Control Study

PubMed Central

Zavaleta-Muñiz, S. A.; Martín-Márquez, B. T.; Gonzalez-Lopez, L.; Gonzalez-Montoya, N. G.; Díaz-Toscano, M. L.; Ponce-Guarneros, J. M.; Ruiz-Padilla, A. J.; Mercado, M. Vázquez-Del; Maldonado-González, M.; Fafutis-Morris, M.; Flores-Martínez, S. E.; Martínez-García, E. A.; Gamez-Nava, J. I.

2013-01-01

Objective. There is a lack of information about the genotype frequencies of IL-6 −174G/C and −572G/C polymorphisms in Mexicans with rheumatoid arthritis (RA). Therefore, the aim of this study was to evaluate the association of the IL-6 −174G/C and −572G/C polymorphisms in Mexican mestizo with RA. Methods. We included 137 patients with RA and 102 healthy controls. Patients were assessed for clinical characteristics. IL-6 −174G/C and −572G/C polymorphisms were genotyped using PCR-RFLP analysis. Allele and genotype frequencies and the Hardy-Weinberg equilibrium were computed. Odds ratios (ORs) were computed to identify the risk for RA associated with the presence of GG genotype in comparison with the GC or CC genotypes. Results. The genotype −174GG occurred at a higher frequency in cases and controls (77.4% versus 78.4%, P = 0.845). We found similar results for the genotype −572GG (54% in patients versus 60.8% in controls, P = 0.295). Conclusions. This is the first study to evaluate the association of −174G/C and −572G/C polymorphisms of the IL-6 gene with RA in Mexican mestizo patients. These two polymorphisms were not associated with RA in the studied sample. Additional studies are required to evaluate if these IL-6 polymorphisms have relevance to the development of more severe disease. PMID:24223608

CCL2 Serum Levels and Adiposity Are Associated with the Polymorphic Phenotypes -2518A on CCL2 and 64ILE on CCR2 in a Mexican Population with Insulin Resistance.

PubMed

Guzmán-Ornelas, Milton-Omar; Petri, Marcelo Heron; Vázquez-Del Mercado, Mónica; Chavarría-Ávila, Efraín; Corona-Meraz, Fernanda-Isadora; Ruíz-Quezada, Sandra-Luz; Madrigal-Ruíz, Perla-Monserrat; Castro-Albarrán, Jorge; Sandoval-García, Flavio; Navarro-Hernández, Rosa-Elena

2016-01-01

Genetic susceptibility has been described in insulin resistance (IR). Chemokine (C-C motif) ligand-2 (CCL2) is overexpressed in white adipose tissue and is the ligand of C-C motif receptor-2 (CCR2). The CCL2 G-2518A polymorphism is known to regulate gene expression, whereas the physiological effects of the CCR2Val64Ile polymorphism are unknown. The aim of the study is to investigate the relationship between these polymorphisms with soluble CCL2 levels (sCCL2), metabolic markers, and adiposity. In a cross-sectional study we included 380 Mexican-Mestizo individuals, classified with IR according to Stern criteria. Polymorphism was identified using PCR-RFLP/sequence-specific primers. Anthropometrics and metabolic markers were measured by routine methods and adipokines and sCCL2 by ELISA. The CCL2 polymorphism was associated with IR (polymorphic A+ phenotype frequencies were 70.9%, 82.6%, in individuals with and without IR, resp.). Phenotype carriers CCL2 (A+) displayed lower body mass and fat indexes, insulin and HOMA-IR, and higher adiponectin levels. Individuals with IR presented higher sCCL2 compared to individuals without IR and was associated with CCR2 (Ile+) phenotype. The double-polymorphic phenotype carriers (A+/Ile+) exhibited higher sCCL2 than double-wild-type phenotype carriers (A-/Ile-). The present findings suggest that sCCL2 production possibly will be associated with the adiposity and polymorphic phenotypes of CCL2 and CCR2, in Mexican-Mestizos with IR.

Differential Item Functioning of the Psychological Domain of the Menopause Rating Scale

PubMed Central

Portela-Buelvas, Katherin; Oviedo, Heidi C.; Herazo, Edwin; Campo-Arias, Adalberto

2016-01-01

Introduction. Quality of life could be quantified with the Menopause Rating Scale (MRS), which evaluates the severity of somatic, psychological, and urogenital symptoms in menopause. However, differential item functioning (DIF) analysis has not been applied previously. Objective. To establish the DIF of the psychological domain of the MRS in Colombian women. Methods. 4,009 women aged between 40 and 59 years, who participated in the CAVIMEC (Calidad de Vida en la Menopausia y Etnias Colombianas) project, were included. Average age was 49.0 ± 5.9 years. Women were classified in mestizo, Afro-Colombian, and indigenous. The results were presented as averages and standard deviation (X ± SD). A p value <0.001 was considered statistically significant. Results. In mestizo women, the highest X ± SD were obtained in physical and mental exhaustion (PME) (0.86 ± 0.93) and the lowest ones in anxiety (0.44 ± 0.79). In Afro-Colombian women, an average score of 0.99 ± 1.07 for PME and 0.63 ± 0.88 for anxiety was gotten. Indigenous women obtained an increased average score for PME (1.33 ± 0.93). The lowest score was evidenced in depressive mood (0.50 ± 0.81), which is different from other Colombian women (p < 0.001). Conclusions. The psychological items of the MRS show differential functioning according to the ethnic group, which may induce systematic error in the measurement of the construct. PMID:27847825

A slow life history is related to a negative attitude towards cousin marriages: a study in three ethnic groups in Mexico.

PubMed

Buunk, Abraham P; Hoben, Ashley D

2013-06-24

Little is known about current attitudes towards cousin marriages. Using data from a rural population in the Mexican state of Oaxaca, the present research examined how life history was related to attitudes towards cousin marriages in various ethnic groups. Participants were 205 parents from three ethnic groups. i.e., Mestizos (people of mixed descent, n = 103), indigenous Mixtecs (n = 65), and Blacks (n = 35). Nearly all men in this study were farm workers or fishermen. Participants reported more negative than positive attitudes towards cousin marriage, and women reported more negative attitudes than did men. The main objection against marrying a cousin was that it is wrong for religious reasons, whereas the risk of genetic defects was considered relatively unimportant. Cousin marriage was not considered to contribute to the quality and unity of marriage and the family. The three ethnic groups did not differ in their attitude towards cousin marriages. However, a slower life history was related to a more negative attitude towards cousin marriages, especially among Blacks, less so among Mixtecs, and not at all among Mestizos. In addition, and independent of the effect of life history, with increasing levels of parental control over mate choice, the attitude towards cousin marriage was more positive, but among men the attitude was more negative the more religious they were. The results are discussed in the context of theorizing on life history theory and the benefits and costs of cousin marriages.

Arsenic exposure and risk of preeclampsia in a Mexican mestizo population.

PubMed

Sandoval-Carrillo, Ada; Méndez-Hernández, Edna M; Antuna-Salcido, Elizabeth I; Salas-Pacheco, Sergio M; Vázquez-Alaniz, Fernando; Téllez-Valencia, Alfredo; Aguilar-Durán, Marisela; Barraza-Salas, Marcelo; Castellanos-Juárez, Francisco X; La Llave-León, Osmel; Salas-Pacheco, José M

2016-07-11

Exposure to arsenic in drinking water has been associated with various complications of pregnancy including fetal loss, low birth weight, anemia, gestational diabetes and spontaneous abortion. However, to date, there are no studies evaluating its possible association with preeclampsia. This case-control study involved 104 preeclamptic and 202 healthy pregnant women. The concentrations of arsenic in drinking water and urine were measured using a Microwave Plasma-Atomic Emission Spectrometer. We found relatively low levels of arsenic in household tap water (range of 2.48-76.02 μg/L) and in the urine of the participants (7.1 μg/L vs 6.78 μg/L in cases and controls, respectively). The analysis between groups showed for the first time that at these lower levels of exposure there is no association with preeclampsia.

Biobanking of different body fluids within the frame of IVF-a standard operating procedure to improve reproductive biology research.

PubMed

Schenk, Michael; Huppertz, Berthold; Obermayer-Pietsch, Barbara; Kastelic, Darja; Hörmann-Kröpfl, Martina; Weiss, Gregor

2017-02-01

The aim of the present study was to develop a standard operating procedure (SOP) for the collection, transport, and storage of human cumulus cells, follicular fluid, blood serum, seminal plasma, embryo culture supernatant, and embryo culture supernatant control obtained within the IVF process under approved protocols and written informed consent from participating patients. The SOP was developed at the Kinderwunsch Institut Schenk, Dobl, Austria, together with Biobank Graz of the Medical University of Graz, Austria. The SOP provides comprehensive details of laboratory procedures and sampling of the different fluids within the IVF process. Furthermore, information on sample coding, references of involved laboratory techniques (e.g., oocyte retrieval with a Steiner-TAN needle), ethical approvals, and biobanking procedures are presented. The result of the present study is a standard operating procedure. The SOP ensures a professional way for collection and scientific use of IVF samples by the Kinderwunsch Institut Schenk, Dobl, Austria, and Biobank Graz of the Medical University of Graz, Austria. It can be used as a template for other institutions to unify specimen collection procedures in the field of reproductive health research.

High-resolution HLA allele and haplotype frequencies in majority and minority populations of Costa Rica and Nicaragua: Differential admixture proportions in neighboring countries.

PubMed

Arrieta-Bolaños, E; Madrigal-Sánchez, J J; Stein, J E; Órlich-Pérez, P; Moreira-Espinoza, M J; Paredes-Carias, E; Vanegas-Padilla, Y; Salazar-Sánchez, L; Madrigal, J A; Marsh, S G E; Shaw, B E

2018-06-01

The HLA system shows the most extensive polymorphism in the human genome. Allelic and haplotypic frequencies of HLA genes vary dramatically across human populations. Due to a complex history of migration, populations in Latin America show a broad variety of admixture proportions, usually varying not only between countries, but also within countries. Knowledge of HLA allele and haplotype frequencies is essential for medical fields such as transplantation, but also serves as a means to assess genetic diversity and ancestry in human populations. Here, we have determined high-resolution HLA-A, -B, -C, and -DRB1 allele and haplotype frequencies in a sample of 713 healthy subjects from three Mestizo populations, one population of African descent, and Amerindians of five different groups from Costa Rica and Nicaragua and compared their profiles to a large set of indigenous populations from Iberia, Sub-Saharan Africa, and the Americas. Our results show a great degree of allelic and haplotypic diversity within and across these populations, with most extended haplotypes being private. Mestizo populations show alleles and haplotypes of putative European, Amerindian, and Sub-Saharan African origin, albeit with differential proportions. Despite some degree of gene flow, Amerindians and Afro-descendants show great similarity to other Amerindian and West African populations, respectively. This is the first comprehensive study reporting high-resolution HLA diversity in Central America, and its results will shed light into the genetic history of this region while also supporting the development of medical programs for organ and stem cell transplantation. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The targetable A1 Huntington disease haplotype has distinct Amerindian and European origins in Latin America

PubMed Central

Kay, Chris; Tirado-Hurtado, Indira; Cornejo-Olivas, Mario; Collins, Jennifer A; Wright, Galen; Inca-Martinez, Miguel; Veliz-Otani, Diego; Ketelaar, Maria E; Slama, Ramy A; Ross, Colin J; Mazzetti, Pilar; Hayden, Michael R

2017-01-01

Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin (HTT) gene. HD occurs worldwide, but the causative mutation is found on different HTT haplotypes in distinct ethnic groups. In Latin America, HD is thought to have European origins, but indigenous Amerindian ancestry has not been investigated. Here, we report dense HTT haplotypes in 62 mestizo Peruvian HD families, 17 HD families from across Latin America, and 42 controls of defined Peruvian Amerindian ethnicity to determine the origin of HD in populations of admixed Amerindian and European descent. HD in Peru occurs most frequently on the A1 HTT haplotype (73%), as in Europe, but on an unexpected indigenous variant also found in Amerindian controls. This Amerindian A1 HTT haplotype predominates over the European A1 variant among geographically disparate Latin American controls and in HD families from across Latin America, supporting an indigenous origin of the HD mutation in mestizo American populations. We also show that a proportion of HD mutations in Peru occur on a C1 HTT haplotype of putative Amerindian origin (14%). The majority of HD mutations in Latin America may therefore occur on haplotypes of Amerindian ancestry rather than on haplotypes resulting from European admixture. Despite the distinct ethnic ancestry of Amerindian and European A1 HTT, alleles on the parent A1 HTT haplotype allow for development of identical antisense molecules to selectively silence the HD mutation in the greatest proportion of patients in both Latin American and European populations. PMID:28000697

A Reply? A Response to Penny Thompson

ERIC Educational Resources Information Center

Doble, Peter

2007-01-01

Penny Thompson's "reply" to the author's article (Doble, 2005) briefly tells readers that for an answer to some of the author's queries, readers may turn to her book; for the rest, she proposes to take "the argument" further. One of the problems with her earlier article was that it had no discernible argument, so it is not easy to see how it may…

Antimicrobial properties of Honduran medicinal plants.

PubMed

Lentz, D L; Clark, A M; Hufford, C D; Meurer-Grimes, B; Passreiter, C M; Cordero, J; Ibrahimi, O; Okunade, A L

1998-12-01

Ninety-two plants used in the traditional pharmacopoeia of the Pech and neighboring Mestizo peoples of central Honduras are reported. The results of in vitro antimicrobial screens showed that 19 of the extracts from medicinal plants revealed signs of antifungal activity while 22 demonstrated a measurable inhibitory effect on one or more bacterial cultures. Bioassay-guided fractionation of extracts from Mikania micrantha, Neurolaena lobata and Piper aduncum produced weak to moderately active isolates. The broad spectrum of activity of the extracts helps to explain the widespread use of these plants for wound healing and other applications.

Mujeres Latinas--Santas y Marquesas.

PubMed

Arredondo, Patricia

2002-11-01

This presidential address is a conceptualization and application of psychohistorical and mestizo psychology frameworks to address gender and ethnic identity conflicts for contemporary Latinas. Connections are made between historical and cultural icons and Latina literature of the 21st century with protagonists who give voice to the struggles of acculturated and self-empowered women. Spanish terms are used to communicate and give emphasis to the Latino landscape. The article comes to conclusion with personal reflections about María Morales de Zaldívar, or Mamá, the author's grandmother, who embodies the santa y marquesa life script.

Development of the Flu-PRO: a patient-reported outcome (PRO) instrument to evaluate symptoms of influenza.

PubMed

Powers, John H; Guerrero, M Lourdes; Leidy, Nancy Kline; Fairchok, Mary P; Rosenberg, Alice; Hernández, Andrés; Stringer, Sonja; Schofield, Christina; Rodríguez-Zulueta, Patricia; Kim, Katherine; Danaher, Patrick J; Ortega-Gallegos, Hilda; Bacci, Elizabeth Dansie; Stepp, Nathaniel; Galindo-Fraga, Arturo; St Clair, Kristina; Rajnik, Michael; McDonough, Erin A; Ridoré, Michelande; Arnold, John C; Millar, Eugene V; Ruiz-Palacios, Guillermo M

2016-01-05

To develop content validity of a comprehensive patient-reported outcome (PRO) measure following current best scientific methodology to standardize assessment of influenza (flu) symptoms in clinical research. Stage I (Concept Elicitation): 1:1 telephone interviews with influenza-positive adults (≥18 years) in the US and Mexico within 7 days of diagnosis. Participants described symptom type, character, severity, and duration. Content analysis identified themes and developed the draft Flu-PRO instrument. Stage II (Cognitive Interviewing): The Flu-PRO was administered to a unique set of influenza-positive adults within 14 days of diagnosis; telephone interviews addressed completeness, respondent interpretation of items and ease of use. Samples: Stage I: N = 46 adults (16 US, 30 Mexico); mean (SD) age: 38 (19), 39 (14) years; % female: 56%, 73%; race: 69% White, 97% Mestizo. Stage II: N = 34 adults (12 US, 22 Mexico); age: 37 (14), 39 (11) years; % female: 50%, 50%; race: 58% White, 100% Mestizo. Symptoms identified by >50%: coughing, weak or tired, throat symptoms, congestion, headache, weakness, sweating, chills, general discomfort, runny nose, chest (trouble breathing), difficulty sleeping, and body aches or pains. No new content was uncovered during Stage II; participants easily understood the instrument. Results show the 37-item Flu-PRO is a content valid measure of influenza symptoms in adults with a confirmed diagnosis of influenza. Research is underway to evaluate the suitability of the instrument for children and adolescents. This work can form the basis for future quantitative tests of reliability, validity, and responsiveness to evaluate the measurement properties of Flu-PRO for use in clinical trials and epidemiology studies.

¿Qué es racismo?: awareness of racism and discrimination in Ecuador.

PubMed

Beck, Scott H; Mijeski, Kenneth J; Stark, Meagan M

2011-01-01

In the national consciousness, Ecuador is a mestizo nation. However, it is also an ethnically diverse nation with sizable minorities of indigenous and Afrodescended peoples. In national surveys, there is also a considerable minority who self-identify as blanco (white). Although there is strong evidence of continuing discrimination and prejudice toward both indigenous and Afro-descended peoples, there is little public discussion or political action addressing such issues. The emergence of a powerful and resilient indigenous movement in the late 1980s gained international interest and acclaim in the 1990s, in part because of the peaceful mobilization efforts and effective bargaining tactics of the movement. However, indigenous leaders usually have not engaged in a discourse of racismo and/or discriminación. There has been much less social movement solidarity and activism among Afro-Ecuadorians, but their leaders commonly employ a discourse of racismo and discriminación. In August and September 2004, a survey of more than eight thousand adult Ecuadorians was conducted in regard to racism and related topics. In this research, we use several measures from this survey that focus on awareness of and sensitivity to issues of racism, prejudice, and discrimination. Self-identification of respondents enables us to contrast the responses of whites, mestizos, Indians, and Afro-Ecuadorians to the measures. Other independent variables of interest are level of education, the region in which the respondent resides, and whether the respondent lives in an urban or rural area. Regression results show differences among the ethnic groups in levels of awareness of racism, but more powerful predictors are level of education and rural residence.

Evaluation of depressive symptoms in mid-aged women: report of a multicenter South American study.

PubMed

Salazar-Pousada, Danny; Monterrosa-Castro, Alvaro; Ojeda, Eliana; Sánchez, Sandra C; Morales-Luna, Ingrid F; Pérez-López, Faustino R; Chedraui, Peter

2017-11-01

To evaluate depressive symptoms and related factors among mid-aged women using the 10-item Center for Epidemiologic Studies Depression Scale (CESD-10). This was a cross-sectional multicenter study in which women aged 40 to 65 from various South American countries were surveyed with the CESD-10 and a general questionnaire containing personal and partner data. In all, 864 women were interviewed from Colombia (Afro-Colombian, n = 215), Ecuador (Mestizo, n = 202), Perú (Quechua at high altitude, n = 231), and Paraguay (Mestizo, n = 216). Mean age of the whole sample was 49.1 ± 6.0 years. Although the rate of postmenopausal status was similar among studied sites, differences were observed in relation to age, parity, hormone therapy use, hot flush rate, sedentary lifestyle, chronic medical conditions, habits, and partner aspects. Median total CESD-10 score for all sites was 7.0, with a 36.0% (n = 311) having scores equal to 10 or more (suggestive of depressed mood). Higher scores were observed for Afro-Colombian and Quechua women, and also for postmenopausal and perimenopausal ones. Multivariate linear regression analysis found that depressed mood (higher CESD-10 total scores) was significantly associated with ethnicity (Afro-Colombian), hot flush severity, hormone therapy use, sedentary lifestyle, postmenopause, perceived unhealthy status, and lower education. Higher monthly coital frequency and having a healthy partner without premature ejaculation was related to lower scores, hence less depressed mood. In this mid-aged female South American sample, depressive symptoms correlated to menopausal status and related aspects, ethnicity, and personal and partner issues. All these features require further research.

Whole Genome Sequence and Phylogenetic Analysis Show Helicobacter pylori Strains from Latin America Have Followed a Unique Evolution Pathway

PubMed Central

Muñoz-Ramírez, Zilia Y.; Mendez-Tenorio, Alfonso; Kato, Ikuko; Bravo, Maria M.; Rizzato, Cosmeri; Thorell, Kaisa; Torres, Roberto; Aviles-Jimenez, Francisco; Camorlinga, Margarita; Canzian, Federico; Torres, Javier

2017-01-01

Helicobacter pylori (HP) genetics may determine its clinical outcomes. Despite high prevalence of HP infection in Latin America (LA), there have been no phylogenetic studies in the region. We aimed to understand the structure of HP populations in LA mestizo individuals, where gastric cancer incidence remains high. The genome of 107 HP strains from Mexico, Nicaragua and Colombia were analyzed with 59 publicly available worldwide genomes. To study bacterial relationship on whole genome level we propose a virtual hybridization technique using thousands of high-entropy 13 bp DNA probes to generate fingerprints. Phylogenetic virtual genome fingerprint (VGF) was compared with Multi Locus Sequence Analysis (MLST) and with phylogenetic analyses of cagPAI virulence island sequences. With MLST some Nicaraguan and Mexican strains clustered close to Africa isolates, whereas European isolates were spread without clustering and intermingled with LA isolates. VGF analysis resulted in increased resolution of populations, separating European from LA strains. Furthermore, clusters with exclusively Colombian, Mexican, or Nicaraguan strains were observed, where the Colombian cluster separated from Europe, Asia, and Africa, while Nicaraguan and Mexican clades grouped close to Africa. In addition, a mixed large LA cluster including Mexican, Colombian, Nicaraguan, Peruvian, and Salvadorian strains was observed; all LA clusters separated from the Amerind clade. With cagPAI sequence analyses LA clades clearly separated from Europe, Asia and Amerind, and Colombian strains formed a single cluster. A NeighborNet analyses suggested frequent and recent recombination events particularly among LA strains. Results suggests that in the new world, H. pylori has evolved to fit mestizo LA populations, already 500 years after the Spanish colonization. This co-adaption may account for regional variability in gastric cancer risk. PMID:28293542

Association between -174G/C and -572G/C interleukin 6 gene polymorphisms and severe radiographic damage to the hands of Mexican patients with rheumatoid arthritis: a preliminary report.

PubMed

Zavaleta-Muñiz, S A; Gonzalez-Lopez, L; Murillo-Vazquez, J D; Saldaña-Cruz, A M; Vazquez-Villegas, M L; Martín-Márquez, B T; Vasquez-Jimenez, J C; Sandoval-Garcia, F; Ruiz-Padilla, A J; Fajardo-Robledo, N S; Ponce-Guarneros, J M; Rocha-Muñoz, A D; Alcaraz-Lopez, M F; Cardona-Müller, D; Totsuka-Sutto, S E; Rubio-Arellano, E D; Gamez-Nava, J I

2016-12-19

Several interleukin 6 gene (IL6) polymorphisms are implicated in susceptibility to rheumatoid arthritis (RA). It has not yet been established with certainty if these polymorphisms are associated with the severe radiographic damage observed in some RA patients, particularly those with the development of joint bone ankylosis (JBA). The objective of the present study was to evaluate the association between severe radiographic damage in hands and the -174G/C and -572G/C IL6 polymorphisms in Mexican Mestizo people with RA. Mestizo adults with RA and long disease duration (>5 years) were classified into two groups according to the radiographic damage in their hands: a) severe radiographic damage (JBA and/or joint bone subluxations) and b) mild or moderate radiographic damage. We compared the differences in genotype and allele frequencies of -174G/C and -572G/C IL6 polymorphisms (genotyped using polymerase chain reaction-restriction fragment length polymorphism) between these two groups. Our findings indicated that the -174G/C polymorphism of IL6 is associated with severe joint radiographic damage [maximum likelihood odds ratios (MLE_OR): 8.03; 95%CI 1.22-187.06; P = 0.03], whereas the -572G/C polymorphism of IL6 exhibited no such association (MLE_OR: 1.5; 95%CI 0.52-4.5; P = 0.44). Higher anti-cyclic citrullinated peptide antibody levels were associated with more severe joint radiographic damage (P = 0.04). We conclude that there is a relevant association between the -174G/C IL6 polymorphism and severe radiographic damage. Future studies in other populations are required to confirm our findings.

Tetany caused by chronic diarrhea in a child with celiac disease: A case report

PubMed Central

Hurtado-Valenzuela, Jaime Gabriel; Sotelo-Cruz, Norberto; López-Cervantes, Guillermo; de la Barca, Ana María Calderón

2008-01-01

There is no awareness about celiac disease (CD) in Mexico. A 2.9 year old mestizo boy was admitted to a Mexican hospital with muscle cramps and fine tremors. He suffered chronic diarrhea, abdominal distention, hypotrophic limbs, stunting and wasting, and presented hypocalcemia, anemia and high titers of serological markers. Diagnosis of CD was confirmed by a duodenal biopsy. After replacement of calcium and a gluten-free diet, the symptoms resolved within 6 weeks. After 2-months, serum analyses, anthropometric data as well as antibodies titers were normal after 4 years. CD screening tests are needed in chronic diarrhea for any ethnicity patients. PMID:18811963

[Eugenio Espejo, the Quito physician: pioneer of bacteriology in the Americas].

PubMed

Fierro Benítez, Rodrigo

2003-01-01

Eugenio Espejo (1747-1795). Mestizo. Was born in the Royal Audience of Quito. Today, the Republic of Ecuador. The 18th century was isf illustration and enlightment for the Quiteños. Espejo's extraordinary erudition is explained by the full access he had to yhe libraries created in Quito by the Jesuits. The best in the continent at that time. His work, Reflections on Smallpox, makes or Espejo outstanding in his field. Pioneer in bacteriology and of the biopathological observations in America. The first newspaper in Quito, Primicies of the culture of Quito, was his own work. Furthermore, Espejo is considered the precursor of the independence of Hispanoamerica.

A new medicinal plant from Amazonian Ecuador.

PubMed

van Asdall, W

1983-12-01

Dalbergaria tessmanii, a shrub of the Gesneriaceae locally abundant in the tropical forests of Ecuador, is variously ethnomedicinally employed. For example, none of several Shuar (Jívaro) herbal healers know or use it, but the one Shuar Shaman consulted extols its importance in reducing vaginal bleeding. Although Mestizo native consultants from the provincial capital of Morona-Santiago report its use in alleviating heart problems, those from Pastaza Province employ it to reduce menstrual flow. The Lowland Quechua apparently use it for this purpose as well. This plant has apparently not yet been chemically examined. Its reported use in several different cultural context suggest that it should be phytochemically investigated.

Genetic polymorphisms in CYP2A6 are associated with a risk of cigarette smoking and predispose to smoking at younger ages.

PubMed

Pérez-Rubio, Gloria; López-Flores, Luis Alberto; Ramírez-Venegas, Alejandra; Noé-Díaz, Valeri; García-Gómez, Leonor; Ambrocio-Ortiz, Enrique; Sánchez-Romero, Candelaria; Hernández-Zenteno, Rafael De Jesús; Sansores, Raúl Humberto; Falfán-Valencia, Ramcés

2017-09-10

Nicotine is the main component of cigarettes that causes addiction, which is considered a complex disease, and genetic factors have been proposed to be involved in the development of addiction. The CYP2A6 gene encodes the main enzyme responsible for nicotine metabolism. Depending on the study population, different genetic variants of CYP2A6 associated with cigarette smoking have been described. Therefore, we evaluated the possible association between SNPs in CYP2A6 with cigarette smoking and nicotine addiction-related variables in Mexican mestizo smokers. We performed a genetic association study comparing light smokers (LS, n=349), heavy smokers (HS, n=351) and never-smokers (NS, n=394). SNPs rs1137115, rs4105144, rs1801272 and rs28399433 were genotyped in the CYP2A6 gene. We found that the A allele of rs1137115 (OR=1.41) in exon 1 of CYP2A6 and the T allele of rs4105144 (OR=1.32) in the 5' UTR of the gene are associated with the risk of cigarette smoking (p<0.05); rs1137115 affects the level of alternative splicing, resulting in a CYP2A6 isoform with low enzymatic activity, whereas rs4105144 is likely to be in a binding site for the transcription factor for glucocorticoids receptor (GR) and regulates the expression of CYP2A6. In addition, having a greater number of risk alleles (rs1137115 (A), rs4105144 (T) and rs28399433 (G)) is associated with a younger age at onset. The present study shows that in Mexican mestizos, the analyzed SNPs confer greater risk in terms of consumption and age of onset. Copyright © 2017. Published by Elsevier B.V.

Association of the Shared Epitope, Smoking and the Interaction Between the Two With the Presence of Autoantibodies (Anti-CCP and FR) in Patients With Rheumatoid Arthritis in a Hospital in Seville, Spain.

PubMed

García de Veas Silva, José Luis; González Rodríguez, Concepción; Hernández Cruz, Blanca

2017-11-01

To evaluate the association of shared epitope, smoking and their interaction on the presence of autoantibodies (anti-cyclic citrullinated peptide [CCP] antibodies and rheumatoid factor) in patients with rheumatoid arthritis in our geographical area. A descriptive and cross-sectional study was carried out in a cohort of 106 patients diagnosed with RA. Odds ratios (OR) for antibody development were calculated for shared epitope, tobacco exposure and smoking dose. Statistical analysis was performed with univariate and multivariate statistics using ordinal logistic regression. Odds ratios were calculated with 95% confidence interval (95% CI) and a value of P<.05 was considered significant. In univariate analysis, shared epitope (OR=2.68; 95% CI: 1.11-6.46), tobacco exposure (OR=2.79; 95% CI: 1.12-6.97) and heavy smoker (>20 packs/year) (OR=8.93; 95% CI: 1.95-40.82) were associated with the presence of anti-CCP antibodies. For rheumatoid factor, the association was only significant for tobacco exposure (OR=3.89; 95% CI: 1.06-14.28) and smoking dose (OR=8.33; 95% CI: 1.05-66.22). By ordinal logistic regression analysis, an association with high titers of anti-CCP (>200U/mL) was identified with South American mestizos, patients with homozygous shared epitope, positive FR and heavy smokers. Being a South American mestizo, having a shared epitope, rheumatoid factor positivity and a smoking dose>20 packs/year are independent risk factors for the development of rheumatoid arthritis with a high titer of anti-CCP (>200U/mL). In shared epitope-positive rheumatoid arthritis patients, the intensity of smoking is more strongly associated than tobacco exposure with an increased risk of positive anti-CCP. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

Genetic variants in COL13A1, ADIPOQ and SAMM50, in addition to the PNPLA3 gene, confer susceptibility to elevated transaminase levels in an admixed Mexican population.

PubMed

Larrieta-Carrasco, Elena; Flores, Yvonne N; Macías-Kauffer, Luis R; Ramírez-Palacios, Paula; Quiterio, Manuel; Ramírez-Salazar, Eric G; León-Mimila, Paola; Rivera-Paredez, Berenice; Cabrera-Álvarez, Guillermo; Canizales-Quinteros, Samuel; Zhang, Zuo-Feng; López-Pérez, Tania V; Salmerón, Jorge; Velázquez-Cruz, Rafael

2018-02-01

Non-alcoholic fatty liver disease (NAFLD) is the accumulation of extra fat in liver cells not caused by alcohol. Elevated transaminase levels are common indicators of liver disease, including NAFLD. Previously, we demonstrated that PNPLA3 (rs738409), LYPLAL1 (rs12137855), PPP1R3B (rs4240624), and GCKR (rs780094) are associated with elevated transaminase levels in overweight/obese Mexican adults. We investigated the association between 288 SNPs identified in genome-wide association studies and risk of elevated transaminase levels in an admixed Mexican-Mestizo sample of 178 cases of NAFLD and 454 healthy controls. The rs2896019, rs12483959, and rs3810622 SNPs in PNPLA3 and rs1227756 in COL13A1 were associated with elevated alanine aminotransferase (ALT, ≥40IU/L). A polygenic risk score (PRS) based on six SNPs in the ADIPOQ, COL13A1, PNPLA3, and SAMM50 genes was also associated with elevated ALT. Individuals carrying 9-12 risk alleles had 65.8% and 48.5% higher ALT and aspartate aminotransferase (AST) levels, respectively, than those with 1-4 risk alleles. The PRS showed the greatest risk of elevated ALT levels, with a higher level of significance than the individual variants. Our findings suggest a significant association between variants in COL13A1, ADIPOQ, SAMM50, and PNPLA3, and risk of NAFLD/elevated transaminase levels in Mexican adults with an admixed ancestry. This is the first study to examine high-density single nucleotide screening for genetic variations in a Mexican-Mestizo population. The extent of the effect of these variations on the development and progression of NAFLD in Latino populations requires further analysis. Copyright © 2018 Elsevier Inc. All rights reserved.

Susceptibility background for type 2 diabetes in eleven Mexican Indigenous populations: HNF4A gene analysis.

PubMed

Granados-Silvestre, M A; Ortiz-López, M G; Granados, J; Canizales-Quinteros, S; Peñaloza-Espinosa, Rosenda I; Lechuga, C; Acuña-Alonzo, V; Sánchez-Pozos, K; Menjivar, M

2017-12-01

The genetic risk of developing type 2 diabetes (T2D) increases in parallel with the proportion of Native American ancestry. Mestizo Mexicans have a 70% Native Amerindian genetic background. The T130I polymorphism in the HNF4A gene has been associated with early-onset T2D in mestizo Mexicans. Thus, the aim of the present study was to evaluate the frequency and relationship of the T130I variant in the HNF4A gene with risk factors for developing T2D in eleven indigenous groups from Mexico. In two groups, all exons of the HNF4A gene were directly sequenced; in the remaining the T130I polymorphism was analyzed by restriction fragment length polymorphism. Ancestry informative markers were assessed to confirm the Amerindian component. An additional analysis of EHH was carried out. Interestingly, HNF4A gene screening revealed only the presence of the T130I polymorphism. The range frequency of the risk allele (T) in the indigenous groups was from 2.7 to 16%. Genotypic frequencies (T130I/I130I) were higher and significantly different from those of all of the populations included in the HapMap Project (P < 0.005). EHH scores suggest a positive selection for T130I polymorphism. Metabolic traits indicate a relationship between the T130I/I130I genotypes with high triglyceride concentrations in the indigenous groups (P < 0.005). These results strongly suggest that the high frequency of the T130I polymorphism and its biological relationship with dysfunction in lipid metabolism in Mexican indigenous groups is a risk factor for the developing of T2D in Mexicans.

Work disability in Argentinian patients with systemic lupus erythematosus is prevalent and it is due to ethnic, socioeconomic and disease-related factors.

PubMed

Pisoni, Cecilia N; Muñoz, Sebastián A; Tamborenea, María N; García, Mercedes; Curti, Ana; Cappuccio, Ana; Rillo, Oscar; Imamura, Patricia M; Schneeberger, Emilce; Ballent, Marcela; Cousseau, Mario L; Velasco Zamora, Jorge; Saurit, Verónica; Toloza, Sergio; Danielsen, María C; Bellomio, Verónica I; Graf, Cesar; Paira, Sergio; Cavallasca, Javier; Pons Estel, Bernardo; Moreno, José L C; Díaz, Mónica; Alba, Paula; Verando, Marcela; Tate, Guillermo; Mysler, Eduardo; Sarano, Judith; Civit, Emma E; Risueño, Fabián; Álvarez Sepúlveda, Pablo; Larroude, María S; Méndez, Marcos F; Conforti, Andrea; Sohn, Débora

2018-04-02

To study the prevalence and the associated factors of work disability (WD) in systemic lupus erythematosus (SLE) patients. A sample of 419 SLE patients from an observational cross-sectional multicenter study was included. Sociodemographic features, disease characteristics, comorbidities, quality of life, unhealthy behaviors, and work-related factors were measured in a standardized interview. Work disability was defined by patient self-report of not being able to work because of SLE. To identify variables associated with work disability, two different multivariate regression models using a stepwise backward method were performed. Prevalence of WD due to SLE was 24.3%. Eighty-nine percent were female and 51% were Caucasians. Mean disease duration was 8.9 ± 7.2 years, and median System Lupus International Collaborating Clinics/American College of Rheumatology damage index SLICC-SDI was 1.5 (range 0-17). In stepwise multivariate logistic regression, living below the poverty line (odds ratio [OR] = 4.65), less than 12 years of education (OR = 2.84), Mestizo ethnicity (OR = 1.94) and SLICC-SDI (OR = 1.25) were predictors of WD. A second model was performed including patient-derived measures; in this model sedentary lifestyle (OR = 2.69) and lower emotional health domain score of the Lupus Quality of Life (LupusQoL) questionnaire (OR = 1.03) were found to be associated to WD and a higher score in LupusQoL physical health domain (OR = 0.93) was protective. The prevalence of WD in Argentinian SLE patients was 24.3%. WD was associated with ethnic (Mestizo), socioeconomic (poverty) and disease-related factors. Patient-related outcomes such us sedentary lifestyle and poor emotional quality of life were also associated with WD. © 2018 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

Process and dynamics of traditional selling wild edible mushrooms in tropical Mexico

PubMed Central

Ruán-Soto, Felipe; Garibay-Orijel, Roberto; Cifuentes, Joaquín

2006-01-01

Background More than twelve temperate-inhabitant Mexican ethnic groups are considered to be mycophilic and to have extensive traditional mycological knowledge. In contrast, inhabitants of tropical lands have been studied only superficially and their mycological knowledge is less well known. In this paper, we report the results of an ethnomycological research in markets of a wide area of the Mexican tropics. Our aims were to describe the dynamics related to the traditional selling process of wild mushrooms and to determine the tendencies of informants toward mushrooms (mycophily vs. mycophoby). Methods We visited 25 markets of 12 different settlements in the states of Oaxaca, Tabasco and Veracruz and collected information by participant observation as well as by 291 non-structured and semi-structured interviews. Results Mushroom selling was observed in four towns in Oaxaca and in two in Tabasco. Women represented 81.82% of sellers, while indigenous people (Chinantecos, Chontales, Ch'oles and Zoques) comprised 68.18%. Mushroom commercialization took place in secondary mobile markets and only in peasant stands. Mushroom collectors gather the resource in places with secondary vegetation, farmed areas and cattle fields. Because of land tenure restrictions mushroom sellers did not normally collect mushrooms themselves. In Oaxaca, we observed economic dynamics not based on capitalism, such as exchange, reciprocity and barter. Conclusion The sale of some wild edible mushrooms, the large amounts of commercialization of Schizophyllum commune, the complicated intermediary process, as well as the insertion of mushrooms into different informal economic practices are all evidence of an existent mycophily in a sector of the population of this region of the Mexican tropics. Among our informants, urban mestizo people were mycophobic, rural mestizo people were non-mycophilic and indigenous people were true mycophilic. PMID:16393345

Association of vWA and TPOX Polymorphisms with Venous Thrombosis in Mexican Mestizos

PubMed Central

Meraz-Ríos, Marco Antonio; Majluf-Cruz, Abraham; Santana, Carla; Noris, Gino; Camacho-Mejorado, Rafael; Acosta-Saavedra, Leonor C.; Calderón-Aranda, Emma S.; Hernández-Juárez, Jesús; Magaña, Jonathan J.; Gómez, Rocío

2014-01-01

Objective. Venous thromboembolism (VTE) is a multifactorial disorder and, worldwide, the most important cause of morbidity and mortality. Genetic factors play a critical role in its aetiology. Microsatellites are the most important source of human genetic variation having more phenotypic effect than many single nucleotide polymorphisms. Hence, we evaluate a possible relationship between VTE and the genetic variants in von Willebrand factor, human alpha fibrinogen, and human thyroid peroxidase microsatellites to identify possible diagnostic markers. Methods. Genotypes were obtained from 177 patients with VTE and 531 nonrelated individuals using validated genotyping methods. The allelic frequencies were compared; Bayesian methods were used to correct population stratification to avoid spurious associations. Results. The vWA-18, TPOX-9, and TPOX-12 alleles were significantly associated with VTE. Moreover, subjects bearing the combination vWA-18/TPOX-12 loci exhibited doubled risk for VTE (95% CI = 1.02–3.64), whereas the combination vWA-18/TPOX-9 showed an OR = 10 (95% CI = 4.93–21.49). Conclusions. The vWA and TPOX microsatellites are good candidate biomarkers in venous thromboembolism diseases and could help to elucidate their origins. Additionally, these polymorphisms could become useful markers for genetic studies of VTE in the Mexican population; however, further studies should be done owing that this data only show preliminary evidence. PMID:25250329

Biochemical polymorphisms in Spanish Avileña-Negra Iberica cattle.

PubMed

Arranz, J J; Bayón, Y; Medjugorac, I; Primitivo, F

1994-01-12

Thirteen biochemical blood polymorphisms were analysed in a population of 149 Spanish Avileña-Negra Ibérica cattle. The study revealed variation at the following nine loci: HBB, CA, NP, CP, AMY1, ALB, GC, TF and PTF2. The following systems were monomorphic: CAT, DIA1, MDH1 and ME1. Using polyacrylamide-gel electrophoresis, a slow, migrating pair of bands was found in the GC protein system. This pattern is probably controlled by the GC(C) allele, described in only a few cases in cattle. Furthermore, starch-gel electrophoresis allowed the detection of a variant with intermediate mobility between the ALB(A) and the ALB(B) alleles at the albumin locus. A variant with a similar electrophoretic pattern has occasionally been reported in cattle. However, utilizing IEF under denaturing conditions, such a variant could not be differentiated from the ALB(A) allele and thus its significance is not clear. ZUSAMMENFASSUNG: Biochemischer Polymorphismus in spanischen Avileña-Negra Iberica Rindern Insgesamt 13 biochemische Systeme wurden in einer Population von 149 spanischen Avilena-Negra-Iberika-Rindern hinsichtlich Polymorphismus analysiert. Es zeigten sich Varianten bei folgenden Loci: HBB, CA, NP, CP, AMY1, ANB, GC, TF und BTF2, während CAT, DEA, MDH1 und ME1 monomorph sind. Bei stärke Gel-Elektrophorese wurde im Albumin-Locus eine Variante mit intermediärer Mobilität zwischen ALB(A) und ÄLB(B) Allel entdeckt. Eine solche Variante wurde bisher nur sehr selten bei Rindern beobachtet. Darüber hinaus wurde bei Polyacrylamid-Gel-Elektrophorese ein langsam wanderndes Paar von Bändern im GC-Proteinsystem gefunden. Dieses Muster ist wahrscheinlich von dem selten vorkommenden GC(C) -Allel verursacht. RESUMEN: Se analizaron trece polimorfismos bioquímicos sanguíneos en una población de 149 animales de la raza Avileña-Negra Ibérica de ganado vacuno. El estudio reveló la existencia de variación en los nueve loci siguientes: HBB, CA, NP, CP, AMY1, ALB, GC, TF y PTF2

Proving and Improving Wave Models in the Arctic Ocean and its MIZ

DTIC Science & Technology

2014-09-30

on a giant ice island in Baffin Bay, in which the response to a breakup event was measured and the size of the broken-out iceberg fragment tested...2014), In situ measurements and analysis of ocean waves in the Antarctic marginal ice zone, Geophys. Res. Lett., 41, 5046–5051, doi:10.1002...Symposium on Ice, Singapore, August 11 to 15, 2014. Doble, M. J., and J.-R. Bidlot, 2013. Wave buoy measurements at the Antarctic sea ice edge

Isolation and partial characterization of halotolerant lactic acid bacteria from two Mexican cheeses.

PubMed

Morales, Fredy; Morales, Jesús I; Hernández, César H; Hernández-Sánchez, Humberto

2011-07-01

Isolated strains of halotolerant or halophilic lactic acid bacteria (HALAB) from Cotija and doble crema cheeses were identified and partially characterized by phenotypic and genotypic methods, and their technological abilities were studied in order to test their potential use as dairy starter components. Humidity, a(w), pH, and salt concentration of cheeses were determined. Genotypic diversity was evaluated by randomly amplified polymorphic DNA-polymerase chain reaction. Molecular identification and phylogenetic reconstructions based on 16S rRNA gene sequences were performed. Additional technological abilities such as salt tolerance, acidifying, and proteolytic and lipolytic activities were also investigated. The differences among strains reflected the biodiversity of HALAB in both types of cheeses. Lactobacillus acidipiscis, Tetragenococcus halophilus, Weissella thailandensis, and Lactobacillus pentosus from Cotija cheese, and L. acidipiscis, Enterococcus faecium, Lactobacillus plantarum, Lactobacillus farciminis, and Lactobacillus rhamnosus from doble crema cheese were identified based on 16S rRNA. Quantitative and qualitative assessments showed strains of T. halophilus and L. plantarum to be proteolytic, along with E. faecium, L. farciminis, and L. pentosus to a lesser extent. Lipolytic activity could be demonstrated in strains of E. faecium, L. pentosus, L. plantarum, and T. halophilus. Strains belonging to the species L. pentosus, L. plantarum, and E. faecium were able to acidify the milk media. This study evidences the presence of HALAB that may play a role in the ripening of cheeses.

Prevalence of Escherichia coli O157:H7 From House Flies (Diptera: Muscidae) and Dairy Samples in North Central Florida1.

PubMed

Burrus, Roxanne G; Hogsette, Jerome A; Kaufman, Phillip E; Maruniak, James E; Simonne, Amy H; Mai, Volker

2017-05-01

La detección de Escherichia coli O157:H7 en las lecherías es importante para mejorar la seguridad de los productos lácteos, y se ha llevado a cabo principalmente mediante el aislamiento de las bacterias a partir de las muestras de estiércol. Sin embargo, los componentes biliares presentes en el estiércol complica la identificación genética utilizando la técnica del PCR, y el aislamiento microbiológico se dificulta por la presencia de bacterias competidoras que comparten características microbiológicas similares. El aislamiento de E. coli O157:H7 a partir de la mosca doméstica evita las dificultades asociadas con el estiércol del ganado. El aislamiento de patógenos a partir de las moscas domésticas proporciona información adicional sobre el potencial impacto epidemiológico de la dispersión de la mosca doméstica en la distribución de patógenos, ya que las moscas domésticas se dispersan desde las lecherías donde la E. coli O157:H7 existe en forma endémica en el ganado. En este estudio, se encontró que las moscas domésticas son 2,6 veces más sensibles para la detección de E. coli O157:H7 en las lecherías. Las moscas son más fáciles de capturar y manejar que el estiércol, y deberían ser utilizadas en cualquier ensayo para detectar E. coli O157:H7 en las lecherías y otros establecimientos. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

The geoepidemiology of systemic lupus erythematosus.

PubMed

Borchers, Andrea T; Naguwa, Stanley M; Shoenfeld, Yehuda; Gershwin, M Eric

2010-03-01

Systemic lupus erythematosus (SLE) is a systemic autoimmune disease with manifold clinical manifestations and immunological abnormalities, affecting primarily women. Although accurate current data on its incidence and prevalence are largely lacking, there are numerous indications that SLE is far less common in Europeans and their descendants compared to all other ethnicities. The clinical manifestations of the disease show geographic or ethnic variation, generally being less severe in patients of European ancestry than in African, Asian, certain "Hispanic" or mestizo, and various indigenous populations. In particular, renal involvement is far more common in non-European patients. Genetic as well as environmental, sociodemographic and sociocultural factors are likely to contribute to the differences in the incidence and clinical expression of SLE. 2009 Elsevier B.V. All rights reserved.

Immunological inquiry for the epidemiology of leptospirosis in Canis familiaris in Salvador, Bahia, Brazil.

PubMed

Caldas, E M; Doria, J D; Martins, M A

1977-12-01

A total of 430 dogs were immunologically examined in Salvador, Bahia, Brazil, and 21.6% of them were positive. The animals were selected through an aleatory pattern, according to the division of the City in 18 residential zones a division which had been established by the vaccination campaign against canis hydrophobia. The serotypes icterohemorrhagiae and canicola were the most frequently registered. Between the sexes, the male presented the highest index of positivity, though the difference wasn't statistically significant. The period of age ranging from 12 to 48 months comprised 67.7% of the investigations. Mestizo dogs presented a higher frequency of positivity than any other race and the areas of Nordeste de Amaralina, Liberdade and Quintas showed the greatest percentages of positive dogs.

Geology of 1. 7 GA ( ) Baldwin gneiss in the Baldwin Lake type area, San Bernardino Mountains, southern California

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barth, A.P.; Ehlig, P.L.; Wooden, J.L.

1993-04-01

Precambrian gneisses in the San Bernardino Mountains were first identified and described in the vicinity of Baldwin Lake by Guillou (1953). Five lithologic units mappable at 1:24,000 scale are recognized: biotite [+-] muscovite quartzofeldspathic gneiss, amphibolite, pyroxene metagabbro, augen gneiss, and biotite [+-] muscovite granitic gneiss. Baldwin gneiss with this L < S tectonite fabric is unconformably overlain by latest Proterozoic, upright, greenschist/hornfels facies quartzite (Big Bear Group). North and northeast of Baldwin Lake, the gneissic fabric is rotated toward the northwest, subparallel to the Doble fault. Along this fault, Baldwin gneiss is structurally underlain by overturned Paleozoic quartzite andmore » marble (Zabriskie Quartzite and Carrara Formation). Regional relations suggest that the Doble fault is a northeast-directed basement thrust fault of pre-Late Cretaceous age, and may be contemporaneous with late Paleozoic deformation and metamorphism of Paleozoic rocks further west in the range. Field relations suggest that Baldwin gneiss in its type area largely retains Proterozoic fabrics and mineral assemblages, despite marginal Phanerozoic reworking. Silver (1971) reported a U-Pb zircon age of ca. 1,730 Ma for Baldwin augen ( ) gneiss, from an unknown locality, and Miller and Morton (1980) reported Late Cretaceous mica K-Ar ages from a sample of augen gneiss. Preliminary Pb isotopic ratios in galena, feldspar and whole rock samples of Baldwin gneiss, and feldspars in Mesozoic plutons suggest isotopic affinity to the Mojave crustal province of Wooden and Miller (1990).« less

Polymorphisms in HTR2A and DRD4 Predispose to Smoking and Smoking Quantity.

PubMed

Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Noé Díaz, Valeri; García Gómez, Leonor; Elvira Fabián, Karina; García Carmona, Salvador; López-Flores, Luis A; Ambrocio-Ortiz, Enrique; Contreras Romero, Rocío; Alcantar-Ayala, Noé; Sansores, Raúl H; Falfán-Valencia, Ramcés

2017-01-01

Genes encoding the receptors involved in the dopaminergic and serotonergic pathways are potential candidates in the mechanisms of nicotine addiction. To identify genetic variants in the promoter regions and exons of the DRD4 and HTR2A genes associated with tobacco smoking and the degree of nicotine addiction in Mexican mestizos. The study included 438 non-smokers (NS) and 1,157 current smokers, ranked based on their consumption of cigarettes per day (cpd): 574 heavy smokers (HS, >20 cpd) and 583 light smokers (LS, 1-10 cpd). Genotyping was performed for 4 and 8 single nucleotide polymorphisms (SNPs) in the DRD4 and HTR2A genes, respectively. The C allele of rs1800955 in DRD4 was found to be associated with cigarette smoking in the HS vs. NS and LS vs. NS comparisons (p = 2.34E-03 and p = 1.13E-03, respectively); the association was maintained in the homozygous CC genotype (p = 5.00E-04 and p = 2.00E-04, respectively). The T allele of rs6313 in HTR2A was significantly associated with cigarette smoking and a greater degree of nicotine addiction (p = 4.77E-03, OR = 1.55); the association was maintained in the homozygous genotype (TT) (p = 4.90E-03, OR = 1.96). The A allele of rs6313 was associated with cigarette smoking in the HS vs. NS comparison (p = 1.53E-02, OR = 1.36); the risk was nearly doubled in the homozygous AA genotype (p = 1.30E-03, OR = 1.83) compared with the heterozygous GA genotype (OR = 1.38). Among Mexican mestizos, the C allele of rs1800955 in the DRD4 gene and the A allele of rs6311 in the HTR2A gene are associated with cigarette smoking, whereas the T allele of rs6313 in HTR2A is associated with cigarette smoking and the degree of nicotine addiction.

Polymorphisms in HTR2A and DRD4 Predispose to Smoking and Smoking Quantity

PubMed Central

Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Noé Díaz, Valeri; García Gómez, Leonor; Elvira Fabián, Karina; García Carmona, Salvador; López-Flores, Luis A.; Ambrocio-Ortiz, Enrique; Contreras Romero, Rocío; Alcantar-Ayala, Noé; Sansores, Raúl H.

2017-01-01

Background Genes encoding the receptors involved in the dopaminergic and serotonergic pathways are potential candidates in the mechanisms of nicotine addiction. Aims To identify genetic variants in the promoter regions and exons of the DRD4 and HTR2A genes associated with tobacco smoking and the degree of nicotine addiction in Mexican mestizos. Methods The study included 438 non-smokers (NS) and 1,157 current smokers, ranked based on their consumption of cigarettes per day (cpd): 574 heavy smokers (HS, >20 cpd) and 583 light smokers (LS, 1–10 cpd). Genotyping was performed for 4 and 8 single nucleotide polymorphisms (SNPs) in the DRD4 and HTR2A genes, respectively. Results The C allele of rs1800955 in DRD4 was found to be associated with cigarette smoking in the HS vs. NS and LS vs. NS comparisons (p = 2.34E-03 and p = 1.13E-03, respectively); the association was maintained in the homozygous CC genotype (p = 5.00E-04 and p = 2.00E-04, respectively). The T allele of rs6313 in HTR2A was significantly associated with cigarette smoking and a greater degree of nicotine addiction (p = 4.77E-03, OR = 1.55); the association was maintained in the homozygous genotype (TT) (p = 4.90E-03, OR = 1.96). The A allele of rs6313 was associated with cigarette smoking in the HS vs. NS comparison (p = 1.53E-02, OR = 1.36); the risk was nearly doubled in the homozygous AA genotype (p = 1.30E-03, OR = 1.83) compared with the heterozygous GA genotype (OR = 1.38). Conclusions Among Mexican mestizos, the C allele of rs1800955 in the DRD4 gene and the A allele of rs6311 in the HTR2A gene are associated with cigarette smoking, whereas the T allele of rs6313 in HTR2A is associated with cigarette smoking and the degree of nicotine addiction. PMID:28103253

Inca of the blood, Inca of the soul: embodiment, emotion, and racialization in the Peruvian mystical tourist industry.

PubMed

Hill, Michael

2008-01-01

In the context of the globalizing New Age movement and of the "turismo mistico" (mystical tourism) industry emanating from Peru, white and mestizo New Age practitioners and tourists fashion ideologies emphasizing the spiritual energy which supposedly resides in Quechua bodies, even as they freely appropriate Quechua cosmology and ritual for a hybridized New Age Andean spirituality. This case shows how racialized structural inequalities are expressed and experienced by tourists and New Age movement leaders through particular, essentialist representations of the body and through a common repertoire of emotional responses to inequality, commodification, and privilege. The paper provides an ethnographic account of how racialization may be perpetuated, negotiated, and resisted through religious systems, particularly through the work of constructing ideologies and experiences of the body and of emotional subjectivity.

Indigenous migration dynamics in the Ecuadorian Amazon: a longitudinal and hierarchical analysis.

PubMed

Davis, Jason; Sellers, Samuel; Gray, Clark; Bilsborrow, Richard

2017-01-01

Amazonian indigenous populations are approaching a critical stage in their history in which increasing education and market integration, rapid population growth and degradation of natural resources threaten the survival of their traditions and livelihoods. A topic that has hardly been touched upon in this context is migration and population mobility. We address this by analysing a unique longitudinal dataset from the Ecuadorian Amazon on the spatial mobility of five indigenous groups and mestizo co-residents. Analyses reveal traditional and new forms of population mobility and migrant selectivity, including gendered forms of marriage migration and rural-urban moves driven by education. These results illustrate a dynamic present and an uncertain future for indigenous populations in which rural, natural-resource-based lifeways may well be sustained but with increasing links to urban areas.

Indigenous migration dynamics in the Ecuadorian Amazon: a longitudinal and hierarchical analysis

PubMed Central

Davis, Jason; Sellers, Samuel; Gray, Clark; Bilsborrow, Richard

2017-01-01

Amazonian indigenous populations are approaching a critical stage in their history in which increasing education and market integration, rapid population growth and degradation of natural resources threaten the survival of their traditions and livelihoods. A topic that has hardly been touched upon in this context is migration and population mobility. We address this by analysing a unique longitudinal dataset from the Ecuadorian Amazon on the spatial mobility of five indigenous groups and mestizo co-residents. Analyses reveal traditional and new forms of population mobility and migrant selectivity, including gendered forms of marriage migration and rural-urban moves driven by education. These results illustrate a dynamic present and an uncertain future for indigenous populations in which rural, natural-resource-based lifeways may well be sustained but with increasing links to urban areas. PMID:29129939

Population pharmacogenetics of Ibero-Latinoamerican populations (MESTIFAR 2014).

PubMed

Sosa-Macias, Martha; Moya, Graciela E; LLerena, Adrián; Ramírez, Ronald; Terán, Enrique; Peñas-LLedó, Eva M; Tarazona-Santos, Eduardo; Galaviz-Hernández, Carlos; Céspedes-Garro, Carolina; Acosta, Hildaura

2015-01-01

MESTIFAR 2014 28-30 November 2014, Panama City, Panama The CEIBA consortium was created within the Ibero-American network of Pharmacogenetics (RIBEF) to study population pharmacogenetics. The current status of these initiatives and results of the MESTIFAR project were analyzed in Panama, 28-30 November 2014. The MESTIFAR project focused on studying CYPs genetic polymorphisms in populations of different ethnic origin. So far, more than 6000 healthy volunteers have been evaluated, making this one of the largest population pharmacogenomic studies worldwide. Three symposia were organized, 'Pharmacogenetics of indigenous and mestizos populations and its clinical implications', 'Methodological innovation in pharmacogenetics and its application in health', and 'General discussion and concluding remarks', about mechanisms and proposals for training, diffusion of pharmacogenetics for Spanish- and Portuguese-speaking health professionals, and 'bench to bedside' pilot projects.

Prevalence of myopia in an adult population of two different ethnic groups in the Ecuadorian Amazon.

PubMed

Jiménez, José Ramón; Bermúdez, Javier; Rubiño, Manuel; Gómez, Luis; Anera, Rosario González

2004-01-01

To determine the prevalence of myopia in the adult populations of two different ethnic communities in the Ecuadorian Amazon. Refraction with retinoscopy after cycloplegia was performed for 507 Naporuna (an ethnic group indigenous to the jungles of the Ecuadorian Amazon) and for 776 settlers (white-mestizos from the Andes, now living in the Amazon and working for the petroleum industry). Ages ranged from 18 to 45 years. All subjects had little or no formal education. The prevalence of myopia was 4.7% among the Naporuna and 5.5% among the settlers; the prevalence of hyperopia was higher, at 17.8% and 36.0%, respectively. The prevalence of myopia in the two communities studied agrees with the results of other studies showing a low prevalence of myopia among groups with low levels of formal education or groups living a nonurban lifestyle.

The socioeconomic context of the use of Euterpe precatoria Mart. and E. oleracea Mart. in Bolivia and Peru.

PubMed

Paniagua-Zambrana, Narel; Bussmann, Rainer W; Macía, Manuel J

2017-06-02

Traditional knowledge (TK) has enabled communities to adapt to changes in life conditions over centuries. However, this local context is being dramatically affected by recent changes through globalization and modernization of societies. In this paper we seek to identify socio-economic factors that are related to the knowledge and use of two palm species in mestizo and indigenous communities in the Amazonian of Peru and Bolivia. Both species are known in the region under the main vernacular name of Asaí, and are source of two highly commercialized resources: palm-hearts and fruits. Euterpe precatoria Mart. is native to the region whereas E. oleracea Mart. is being introduced for the use of both resources. We compare TK about the two Euterpe species in both countries in relation to 14 socioeconomic factors in seven use categories. We performed a Multivariate analysis of variance (MANOVA) to elucidate the influence of each socioeconomic factor on the overall palm knowledge or on individual use categories. In the two countries, we found that mestizos, speaking only Spanish, and migrants in the same ecoregion, knew more uses in all use categories for E. precatoria than for E. oleracea, even in use categories such as Medicinal and veterinary and Construction, for which indigenous participants had more uses in case of other species. In Peru, the use of E. precatoria was higher among participants with greater wealth, which could be related to the commercial importance that both the fruits and the palm-hearts have had in the markets of the region. In contrast, in Bolivia, although some income generation from Euterpe sp. was observed, the use of E. precatoria was much more homogeneously distributed. The use of E. oleracea in Bolivia is recent, and although its most important uses are related to the consumption of fruits and palm-hearts (Human food), it is now being slowly used for Medicinal and Construction purposes, similar to E. precatoria. The use of each of the species

Knowledge and use of edible mushrooms in two municipalities of the Sierra Tarahumara, Chihuahua, Mexico.

PubMed

Quiñónez-Martínez, Miroslava; Ruan-Soto, Felipe; Aguilar-Moreno, Ivonne Estela; Garza-Ocañas, Fortunato; Lebgue-Keleng, Toutcha; Lavín-Murcio, Pablo Antonio; Enríquez-Anchondo, Irma Delia

2014-09-17

The Sierra Madre Occidental of Chihuahua in Northern Mexico is inhabited by indigenous Raramuris, mestizos, and other ethnic groups. The territory consists of canyons and ravines with pine, oak and pine-oak forests in the higher plateaus. A great diversity of potentially edible mushrooms is found in forests of the Municipalities of Bocoyna and Urique. Their residents are the only consumers of wild mushrooms in the Northern Mexico; they have a long tradition of collecting and eating these during the "rainy season." However, despite the wide diversity of edible mushrooms that grow in these areas, residents have a selective preference. This paper aims to record evidence of the knowledge and use of wild potentially edible mushroom species by inhabitants of towns in the Sierra Tarahumara of Chihuahua, Mexico. Using a semi-structured technique, we surveyed 197 habitants from seven locations in Urique, Bocoyna, and the Cusarare area from 2010 to 2012. Known fungi, local nomenclature, species consumed, preparation methods, appreciation of taste, forms of preservation, criteria for differentiating toxic and edible fungi, other uses, economic aspects, and traditional teaching were recorded. To identify the recognized species, photographic stimuli of 22 local edible species and two toxic species were used. The respondents reported preference for five species: Amanita rubescens, Agaricus campestris, Ustilago maydis, Hypomyces lactifluorum, and the Amanita caesarea complex. No apparent differences were found between ethnic groups in terms of preference, although mestizos used other species in Bocoyna (Boletus edulis and B. pinophilus). Some different uses of fungi are recognized by respondents, i.e. home decorations, medicine, as food in breeding rams, etc. The studied population shows a great appreciation towards five species, mainly the A. caesarea complex, and an apparent lack of knowledge of nearly 20 species which are used as food in other areas of Mexico. There are no

[Evolution of type 2 diabetes and carbohydrate intolerance following bariatric surgery in a Mexican mestizo population].

PubMed

Ramírez-Avilés, Eva; Espinosa-González, Omar; Amado-Galván, Mónica; Maydón-González, Hernán; Sepúlveda-Guerrero, Elisa; Zerrweck-López, Carlos

Bariatric surgery continues to be the best treatment for weight loss and control of obesity related comorbidities. Gastric bypass and sleeve gastrectomy have demonstrated to be the most effective surgeries, but this has not been established in a Mexican (non-American) population. To analyse the improvement in type 2 diabetes mellitus and carbohydrate intolerance in obese patients after bariatric surgery. A retrospective analysis was performed on the data collected prospectively between 2013 and 2015 on every obese patient with diabetes and carbohydrate intolerance submitted for bariatric surgery. Analysis was performed at baseline, and at 1, 3, 6, 9 and 12 months, and included metabolic, clinical, lipid, and anthropometrical parameters. A peri-operative and morbidity and mortality analysis was also performed. Remission rates for patients with diabetes were also established. The analysis included 73 patients, 46 with diabetes and 27 with carbohydrate intolerance. Sixty-two patients were female with a mean age of 42 years. Baseline glucose and glycosylated haemoglobin were 123±34mg/dl and 6.8±1.6%, and at 12 months they were 90.1±8mg/dl and 5.4±0.3%, respectively. Diabetes remission was observed in 68.7% of patients, including 9.3% with partial remission and 21.8% with an improvement. There was also a significant improvement in all metabolic and non-metabolic parameters. Bariatric surgery safely improves the metabolic status of patients with diabetes mellitus or carbohydrate intolerance during the first year, inducing high rates of complete remission. It has also shown a significant improvement on blood pressure, lipid, and anthropometric parameters during the first year of follow-up. Copyright © 2017 Academia Mexicana de Cirugía A.C. Publicado por Masson Doyma México S.A. All rights reserved.

HLA Class I and II study in a mestizo family with high incidence of autoimmune disease.

PubMed

de Sorrentino, Alicia Habegger; Young, Marcela; Marinic, Karina; Motta, Patricia Fabiana; Baruzzo, Carlos

2013-01-01

There are many factors that influence the pathogenesis of autoimmune disease of which host genetic factors play an important role. The aim of this study was to investigate the HLA Class I and II genes in a family with a high incidence of AID to establish whether they contribute to the development of these disease. Four of them had been diagnosed with SLE and one with AHA. The patients with SLE showed the presence of HLA-A*02 B*40 DRB1*04:07 DQB1*03:02 haplotype with a high statistical significance. This haplotype was not present in the healthy individuals and in the patient with AHA, although the DRB1*04:07 DQB1*03:02 haplotype (carried by both parents) was found in the AHA patients and one of the healthy individuals. We must consider how HLA Class I in linkage disequilibrium with HLA Class II may be involved in susceptibility or in the development of SLE. An extensive study in this population should be conducted to establish the true participation of the HLA Class I region. Copyright © 2012 Elsevier España, S.L. All rights reserved.

[Obesity, body morphology, and blood pressure in urban and rural population groups of Yucatan].

PubMed

Arroyo, Pedro; Fernández, Victoria; Loría, Alvar; Pardío, Jeannette; Laviada, Hugo; Vargas-Ancona, Lizardo; Ward, Ryk

2007-01-01

To characterize body morphology and blood pressure of adults of the Mexican state of Yucatan. Rural-urban differences in weight, height, waist, and hip circumferences, and blood pressure were analyzed in 313 urban and 271 rural subjects. No rural-urban differences in prevalence of obesity and overweight were found. Hypertension was marginally higher in urban subjects. Rural abnormal waist circumference was higher in young men and young women. Comparison with two national surveys and a survey in the aboriginal population (rural mixtecos) showed similar prevalence of obesity as ENSA-2000 and higher than mixtecos and ENEC-1993. Abnormal waist circumference was intermediate between ENSANUT-2006 and mixtecos and hypertension was intermediate between ENEC and mixtecos. The Maya and mestizo population of Yucatan showed a high prevalence of obesity and abnormal waist circumference not accompanied by a comparable higher hypertension frequency. This finding requires further confirmation.

-383 A/C tumor necrosis factor receptor 1 polymorphism and ankylosing spondylitis in Mexicans: a preliminary study.

PubMed

Corona-Sanchez, Esther Guadalupe; Muñoz-Valle, José Francisco; Gonzalez-Lopez, Laura; Sanchez-Hernandez, Julia Dolores; Vazquez-Del Mercado, Monica; Ontiveros-Mercado, Heriberto; Huerta, Miguel; Trujillo, Xochitl; Rocha-Muñoz, Alberto Daniel; Celis, Alfredo; Ortega-Flores, Ricardo; Gamez-Nava, Jorge Ivan

2012-08-01

The objective of this study was to evaluate the differences in allele and genotype frequencies of -383 tumor necrosis factor receptor 1 (TNFR1) polymorphism between ankylosing spondylitis (AS) and controls. Mexican Mestizos with AS were matched by gender, age, and ethnicity with healthy controls and compared in allele and genotype frequencies of the -383 TNFR1 polymorphism. Polymorphisms were genotyped using PCR-RFLP. The AA genotype occurred at a higher frequency in the AS group (92%) compared with controls (79%, P = 0.03). A allele was increased in AS (96% vs. 88%, P = 0.015) and was associated with genetic susceptibility for AS (odds ratio = 3.48, 95% CI = 1.23-10.61). This preliminary study is the first assessing the association of the -383 A/C TNFR1 polymorphism with AS, although it has the limitation of a small sample size. These data are of interest for the genetic epidemiology of AS in the Mexican population, requiring further investigation in other countries.

Ethnicity, Social Support, and Depression Among Elderly Chilean People.

PubMed

Gallardo-Peralta, Lorena P; Sánchez-Moreno, Esteban; López De Roda, Ana Barrón; Arias Astray, Andrés

2015-01-01

Recent evidence regarding the relationship between social support and depression in elderly people shows the important role of ethnicity. This research describes the characteristics of social support in a sample of elderly people aged 60 and above living in northern Chile (n = 493), and analyzes the differences in the relationship between social support and depression between an indigenous group (Aymara population, n = 147) and a nonindigenous group (white, Caucasian, mestizo, n = 346). Various dimensions of social support were considered: structural elements, functional social support according to source, and community participation. The results show the existence of significant differences in the characteristics and dimensions of social support depending on sex, ethnicity, and marital status. Further, the central role of the family group is observed for both Aymara and nonindigenous elderly people. The hierarchical regression models obtained result in notable differences in the role of the structural, functional, and community elements of support in explaining depression for the ethnic groups considered.

Peritoneal dialysis in Mexico.

PubMed

Cueto-Manzano, Alfonso M

2003-02-01

While Mexico has the thirteenth largest economy, a large portion of the population is impoverished. About 90% of the population is Mestizo, the result of the admixture of Mexican Indians and Spaniards, with the Indigenous peoples concentrated in the southeastern region. Treatment for end-stage renal disease (estimated 268 patients per million population) is largely determined by the limited healthcare system and the individual's access to resources such as private insurance ( approximately 15%) and governmental sources ( approximately 85%). With only 5% of the gross national product spent on healthcare and most treatment providers being public health institutions that are often under severe economic restrictions, it is not surprising that many Mexican patients do not receive renal replacement therapy. Mexico uses proportionately more peritoneal dialysis than other countries; 1% of the patients are on automated peritoneal dialysis, 19% on hemodialysis and 80% on CAPD. Malnutrition and diabetes, important risk factors for poor outcome, are prevalent among the patients in CAPD programs.

Medicine, religion and ayahuasca in Catalonia. Considering ayahuasca networks from a medical anthropology perspective.

PubMed

Apud, Ismael; Romaní, Oriol

2017-01-01

Ayahuasca is a psychoactive beverage from the Amazon, traditionally used by indigenous and mestizo populations in the region. Widespread international use of the beverage began in the 1990s in both secular contexts and religious/spiritual networks. This article offers an analysis of these networks as health care systems in general and for the case of Spain and specifically Catalonia, describing the emergence and characteristics of their groups, and the therapeutic itineraries of some participants. The medical anthropology perspective we take enables us to reflect on the relationship between medicine and religion, and problematize the tensions between medicalization and medical pluralism. Closely linked to the process of medicalization, we also analyze prohibitionist drug policies and their tensions and conflicts with the use of ayahuasca in ritual and 'health care' contexts. The paper ends with a reflection on the problem of ayahuasca as 'medicine', since the connection between religion and medicine is a very difficult one to separate. Copyright © 2016 Elsevier B.V. All rights reserved.

Afforestation or intense pasturing improve the ecological and economic value of abandoned tropical farmlands.

PubMed

Knoke, Thomas; Bendix, Jörg; Pohle, Perdita; Hamer, Ute; Hildebrandt, Patrick; Roos, Kristin; Gerique, Andrés; Sandoval, María L; Breuer, Lutz; Tischer, Alexander; Silva, Brenner; Calvas, Baltazar; Aguirre, Nikolay; Castro, Luz M; Windhorst, David; Weber, Michael; Stimm, Bernd; Günter, Sven; Palomeque, Ximena; Mora, Julio; Mosandl, Reinhard; Beck, Erwin

2014-11-26

Increasing demands for livelihood resources in tropical rural areas have led to progressive clearing of biodiverse natural forests. Restoration of abandoned farmlands could counter this process. However, as aims and modes of restoration differ in their ecological and socio-economic value, the assessment of achievable ecosystem functions and benefits requires holistic investigation. Here we combine the results from multidisciplinary research for a unique assessment based on a normalization of 23 ecological, economic and social indicators for four restoration options in the tropical Andes of Ecuador. A comparison of the outcomes among afforestation with native alder or exotic pine, pasture restoration with either low-input or intense management and the abandoned status quo shows that both variants of afforestation and intense pasture use improve the ecological value, but low-input pasture does not. Economic indicators favour either afforestation or intense pasturing. Both Mestizo and indigenous Saraguro settlers are more inclined to opt for afforestation.

Afforestation or intense pasturing improve the ecological and economic value of abandoned tropical farmlands

PubMed Central

Knoke, Thomas; Bendix, Jörg; Pohle, Perdita; Hamer, Ute; Hildebrandt, Patrick; Roos, Kristin; Gerique, Andrés; Sandoval, María L.; Breuer, Lutz; Tischer, Alexander; Silva, Brenner; Calvas, Baltazar; Aguirre, Nikolay; Castro, Luz M.; Windhorst, David; Weber, Michael; Stimm, Bernd; Günter, Sven; Palomeque, Ximena; Mora, Julio; Mosandl, Reinhard; Beck, Erwin

2014-01-01

Increasing demands for livelihood resources in tropical rural areas have led to progressive clearing of biodiverse natural forests. Restoration of abandoned farmlands could counter this process. However, as aims and modes of restoration differ in their ecological and socio-economic value, the assessment of achievable ecosystem functions and benefits requires holistic investigation. Here we combine the results from multidisciplinary research for a unique assessment based on a normalization of 23 ecological, economic and social indicators for four restoration options in the tropical Andes of Ecuador. A comparison of the outcomes among afforestation with native alder or exotic pine, pasture restoration with either low-input or intense management and the abandoned status quo shows that both variants of afforestation and intense pasture use improve the ecological value, but low-input pasture does not. Economic indicators favour either afforestation or intense pasturing. Both Mestizo and indigenous Saraguro settlers are more inclined to opt for afforestation. PMID:25425182

Perceived Institutional Support among Young Indigenous and Mestizo Students from Chiapas (México): A Group Vitality Approach

ERIC Educational Resources Information Center

Esteban-Guitart, Moisès; Viladot, Maria Àngels; Giles, Howard

2015-01-01

Ethnolinguistic Vitality Theory (EVT) asserts that status, demographic and institutional support (IS) factors make up the vitality of ethnolinguistic groups within intergroup relations. Specifically, IS factor refers to the extent to which a language group enjoys representation in the various institutions of a society, in particular, mass media,…

CFH haplotypes and ARMS2, C2, C3, and CFB alleles show association with susceptibility to age-related macular degeneration in Mexicans

PubMed Central

Zenteno, Juan Carlos; Fernández-López, Juan Carlos; Rodríguez-Corona, Ulises; Falfán-Valencia, Ramcés; Sebastian, Leticia; Morales, Fabiola; Ochoa-Contreras, Daniel; Carnevale, Alessandra; Silva-Zolezzi, Irma

2014-01-01

Purpose To evaluate the contribution of genetic variants of complement factor H (CFH), complement component 2 and 3 (C2 and C3), complement factor B (CFB), and age-related maculopathy susceptibility 2 (ARMS2) to age-related macular degeneration (AMD) risk in the Mexican Mestizo population. Methods Analysis included 282 unrelated Mexican patients with advanced AMD, 205 healthy controls, and 280 population controls. Stereoscopic fundus images were graded on the Clinical Age-Related Maculopathy System (CARMS). We designed a resequencing strategy using primers with M13 adaptor for the 23 exons of the CFH gene in a subgroup of 96 individuals clinically evaluated: 48 AMD cases and 48 age- and sex-matched healthy controls. Single nucleotide polymorphisms (SNPs) in C3 (Arg80Gly and Pro292Leu), C2 (rs547154), CFB (Leu9His), and ARMS2 (Ala69Ser) were genotyped in all patients, healthy and population controls using TaqMan assay. Results All evaluated individuals were Mexican Mestizos, and their genetic ancestry was validated using 224 ancestry informative markers and calculating Fst values. The CFH resequencing revealed 19 SNPs and a common variant in the intron 2 splice acceptor site; three CFH haplotypes inferred from individual genotypes, showed significant differences between cases and controls. The risk alleles in C3 (rs1047286, odds ratio [OR]=2.48, 95% confidence interval [CI]=1.64–3.75, p=1.59E-05; rs2230199, OR=2.15, 95% CI=1.48–3.13, p=6.28E-05) and in ARMS2 (rs10490924, OR=3.09, 95% CI=2.48–3.86, p=5.42E-23) were strongly associated with risk of AMD. The protective effect of alleles in C2 (rs547154) and CFB (rs4151667) showed a trend but was not significantly associated after correction for multiple testing. Conclusions Our results show that ARMS2 and C3 are major contributors to advanced AMD in Mexican patients, while the contributions of CFH, C2, and CFB are minor to those of other populations, reveling significant ethnic differences in minor allele

Rare intronic variants of TCF7L2 arising by selective sweeps in an indigenous population from Mexico.

PubMed

Acosta, Jose Luis; Hernández-Mondragón, Alma Cristal; Correa-Acosta, Laura Carolina; Cazañas-Padilla, Sandra Nathaly; Chávez-Florencio, Berenice; Ramírez-Vega, Elvia Yamilet; Monge-Cázares, Tulia; Aguilar-Salinas, Carlos A; Tusié-Luna, Teresa; Del Bosque-Plata, Laura

2016-05-26

Genetic variations of the TCF7L2 gene are associated with the development of Type 2 diabetes (T2D). The associated mutations have demonstrated an adaptive role in some human populations, but no studies have determined the impact of evolutionary forces on genetic diversity in indigenous populations from Mexico. Here, we sequenced and analyzed the variation of the TCF7L2 gene in three Amerindian populations and compared the results with whole-exon-sequencing of Mestizo populations from Sigma and the 1000 Genomes Project to assess the roles of selection and recombination in diversity. The diversity in the indigenous populations was biased to intronic regions. Most of the variation was low frequency. Only mutations rs77961654 and rs61724286 were located on exon 15. We did not observe variation in intronic region 4-6 in any of the three indigenous populations. In addition, we identified peaks of selective sweeps in the mestizo samples from the Sigma Project within this region. By replicating the analysis of association with T2D between case-controls from the Sigma Project, we determined that T2D was most highly associated with the rs7903146 risk allele and to a lesser extent with the other six variants. All associated markers were located in intronic region 4-6, and their r(2) values of linkage disequilibrium were significantly higher in the Mexican population than in Africans from the 1000 Genomes Project. We observed reticulations in both the haplotypes network analysis from seven marker associates and the neighborNet tree based on 6061 markers in the TCF7L2 gene identified from all samples of the 1000 Genomes Project. Finally, we identified two recombination hotspots in the upstream region and 3' end of the TCF7L2 gene. The lack of diversity in intronic region 4-6 in Indigenous populations could be an effect of selective sweeps generated by the selection of neighboring rare variants at T2D-associated mutations. The survivors' variants make the intronic region 4-6 the

Because difficulty is not the same for everyone: the impact of complexity in working memory is associated with cannabinoid 1 receptor genetic variation in young adults.

PubMed

Ruiz-Contreras, Alejandra E; Román-López, Talía V; Caballero-Sánchez, Ulises; Rosas-Escobar, Cintia B; Ortega-Mora, E Ivett; Barrera-Tlapa, Miguel A; Romero-Hidalgo, Sandra; Carrillo-Sánchez, Karol; Hernández-Morales, Salvador; Vadillo-Ortega, Felipe; González-Barrios, Juan Antonio; Méndez-Díaz, Mónica; Prospéro-García, Oscar

2017-03-01

Individual differences in working memory ability are mainly revealed when a demanding challenge is imposed. Here, we have associated cannabinoid 1 (CB1) receptor genetic variation rs2180619 (AA, AG, GG), which is located in a potential CNR1 regulatory sequence, with performance in working memory. Two-hundred and nine Mexican-mestizo healthy young participants (89 women, 120 men, mean age: 23.26 years, SD = 2.85) were challenged to solve a medium (2-back) vs. a high (3-back) difficulty N-back tasks. All subjects responded as expected, performance was better with the medium than the high demand task version, but no differences were found among genotypes while performing each working memory (WM) task. However, the cost of the level of complexity in N-back paradigm was double for GG subjects than for AA subjects. It is noteworthy that an additive-dosage allele relation was found for G allele in terms of cost of level of complexity. These genetic variation results support that the endocannabinoid system, evaluated by rs2180619 polymorphism, is involved in WM ability in humans.

[The potential use of ayahuasca in psychiatry].

PubMed

Frecska, Ede; Bokor, Petra; Andrassy, Gabor; Kovacs, Attila

2016-06-01

Ayahuasca is a decoctum made of admixture plants containing dimethyltryptamine and harmine. For millennia it has been used as a central element of spiritual, religious, initiation, and other - foremost healing - rituals, originally by the indigenous groups of the Amazon basin and later by the mestizo populations of the region. During the last two decades the brew has raised increased scientific and lay interest about its healing potentials within the framework of Western therapeutic settings. The typical ayahuasca effects consist of strong somatic reactions, vivid visions, relived personal memories, cathartic emotions, and insightful, introspective experiences when the emerging mental contents take different context and get deeper perspectives. The ayahuasca-experience can be exhausting necessitating the presence of an experienced leader for helping participants to pass difficult phases and for maximizing therapeutic benefits. No health damaging adverse effect has been confirmed thus far as result of its well-structured, institutionalized use. The scientific investigation of ayahuasca is hindered by legal issues, methodical problems, and sociocultural preconceptions. The present review outlines the therapeutic potentials of ayahuasca use in psychiatry with its psychobiological and spiritual background.

More Evidence for the Genetic Susceptibility of Mexican Population to Nonalcoholic Fatty Liver Disease through PNPLA3.

PubMed

Chinchilla-López, Paulina; Ramírez-Pérez, Oscar; Cruz-Ramón, Vania; Canizales-Quinteros, Samuel; Domínguez-López, Aarón; Ponciano-Rodríguez, Guadalupe; Sánchez-Muñoz, Fausto; Méndez-Sánchez, Nahum

2018-03-01

The gene for patatin-like phospholipase domain containing 3 (PNPLA3) is associated with nonalcoholic fatty liver disease (NAFLD) development. We previously found that Mexican indigenous population had the highest frequency reported of the PNPLA3 148M risk allele. Further, we observed a relationship between M148M genotype with elevated ALT levels in individuals with normal weight, overweight and obese. We sought to investigate whether PNPLA3 polymorphism is associated with NAFLD development in Mexicans. We enrolled 189 Mexican patients with NAFLD and 201 healthy controls. Anthropometric, metabolic, and biochemical variables were measured, and rs738409 (Ile148Met substitution) polymorphism was genotyped by sequencing. Logistic regression analysis, using a recessive model, suggested that PNPLA3 polymorphism in Mexican population is significantly associated (OR = 1.711, 95% CI: 1.014-2.886; P = 0.044) with NAFLD. The PNPLA3 gene is associated with NAFLD in Mexican population. More studies are required to explain the high prevalence of PNPLA3 polymorphism in Mexican-Americans, Mexican-Indians, and Mexican-Mestizos.

"One of the Most Uniform Races of the Entire World": Creole Eugenics and the Myth of Chilean Racial Homogeneity.

PubMed

Walsh, Sarah

2015-11-01

This article illuminates why Nicolás Palacios's 1904 monograph, Raza chilena: Libro escrito por un Chileno i para los Chilenos [Chilean Race: A Book Written by a Chilean for Chileans], is central to the creation of a myth of Chilean racial homogeneity at the turn of the twentieth century. Placing Palacios in the context of Latin American eugenic discourse, it demonstrates how he selected a specific racial origin story in order to accommodate his belief in racial hierarchy while also depicting race mixing in a positive light. Specifically, the article highlights how the myth of Chilean racial homogeneity elided the difference between the term "mestizo," which was applied to people of mixed racial heritage, and "white." I contend that Palacios sought to differentiate Chileans from other Latin Americans by emphasizing their racial distinctiveness. The article therefore highlights that Latin American eugenics was concerned with the creation of national narratives that historicized particular racial mixtures in order to reify and affirm national differences. As such, it connects to literature regarding the history of eugenics, race, nation, and the creation of whiteness.

Indigenous healing practice: ayahuasca. Opening a discussion.

PubMed

Prue, Robert; Voss, Richard W

2014-01-01

This essay frames an invitation to pastoral counselors and pastoral theologians to examine connections and perhaps interactions between themselves and traditional shamanic healers who use ayahuasca in their healing ceremonies. Indigenous people in South America have used ayahuasca for centuries, and the ritual has become common among the mestizo populations in urban areas of the Amazon, particularly as a curing ritual for drug addiction (Dobkin de Rios, 1970; Moir, 1998). Like peyote in the United States (Calabrese, 1997) ayahuasca use amongst the indigenous people of the Amazon is a form of cultural psychiatry. A review of the literature reveals very little commentary or discussion of shamanic practice in Pastoral Counseling (Pastoral Theology). The scant literature identifies an antithetical relationship at best. The current authors wonder about the possibility of to including shamanic practices in the context of pastoral counseling? This essay seeks to provide some basic information about the ritual use of ayahuasca and to offer a rationale for pastoral counselors to engage in a dialogue about its utility.

DETERMINING OSTEOPOROSIS RISK IN OLDER COLONO ADULTS FROM RURAL AMAZONIAN ECUADOR USING CALCANEAL ULTRASONOMETRY

PubMed Central

MADIMENOS, FELICIA C.; LIEBERT, MELISSA A.; CEPON-ROBINS, TARA J.; SNODGRASS, J. JOSH; SUGIYAMA, LAWRENCE S.

2014-01-01

Objective Low bone density and osteoporosis prevalence, while well-documented in wealthy nations, are poorly studied in rural, non-clinical contexts in economically-developing regions such as Latin America. This study contributes preliminary osteoporosis risk data for a rural Colono (mestizo) population from Amazonian Ecuador. Methods Anthropometrics were collected for 119 adult participants (74 females, 45 males [50–90 years old]). Heel bone density and T-scores were recorded using calcaneal ultrasonometry Results Approximately 33.6% of the participants had low bone density and were at high-risk for osteoporosis. Four times as many females as males were considered high-risk. Consistent with epidemiological literature, advancing age was significantly associated with lower bone density values (p=0.001). Conclusions Low bone density and osteoporosis prevalence are expected to increase in this and other economically-transitioning populations, yet infrastructure to monitor this changing epidemiological landscape is almost non-existent. Human biologists are uniquely positioned to contribute data from remote populations, a critical step towards initiating increased resource allocation for diagnosis and prevention. PMID:25242164

Marcos Zapata's "Last Supper": a feast of European religion and Andean culture.

PubMed

Zendt, Christina

2010-01-01

In Marcos Zapata's 1753 painting of the Last Supper in Cuzco, Peru, Christian symbolism is filtered through Andean cultural tradition. Zapata was a late member of the Cuzco School of Painting, a group comprised of few European immigrants and handfuls of mestizo and Indian artists. The painters in Cuzco learned mostly from prints of European paintings, and their style tends to blend local culture into the traditional painting of their conquistadors. Imagery was the most successful tool used by the Spaniards in their quest to Christianize the Andean population. By teaching locals to paint Christian subjects, they were able to infuse Christianity into Andean traditions. Zapata's rendering of the Last Supper utilizes this cultural blending while staying true to the Christian symbolism within the subject. Instead of the traditional lamb, Zapata's Last Supper features a platter of cuy, or guinea pig, an Andean delicacy stocked with protein as well as cultural significance. Cuy was traditionally a sacrificial animal at Inca agricultural festivals and in this way it offers poignant parallel to the lamb, as a traditional Christian sacrificial animal.

NAT2 gene diversity and its evolutionary trajectory in the Americas.

PubMed

Bisso-Machado, R; Ramallo, V; Paixão-Côrtes, V R; Acuña-Alonzo, V; Demarchi, D A; Sandoval, J R S; Granara, A A S; Salzano, F M; Hünemeier, T; Bortolini, M C

2016-11-01

N-acetyltransferase 2 (NAT2) is responsible for metabolizing xenobiotics; NAT2 polymorphisms lead to three phenotypes: rapid, intermediate and slow acetylators. We aimed to investigate NAT2 diversity in Native Americans. NAT2 exon 2 was sequenced for 286 individuals from 21 populations (Native American and American Mestizos). Excluding the basal/rapid haplotype NAT2*4, the most frequent haplotypes are NAT2*5B (35.95%) in hunter-gatherers and NAT2*7B (20.61%) and NAT2*5B (19.08%) in agriculturalists that were related to the slow phenotype. A new haplotype was identified in two Amerindians. Data from the ~44 kb region surrounding NAT2 in 819 individuals from Africa, East-Asia, Europe and America were used in additional analyses. No significant differences in the acetylator NAT2 haplotype and phenotype distributions were found between Native American populations practicing farming and/or herding and those practicing hunting and gathering, probably because of the absence or weakness of selection pressures and presence of demographic and random processes preventing detection of any selection signal.

El Salvador.

PubMed

1987-11-01

The Central American republic of El Salvador lies on the Pacific with a south coast between Guatemala and Honduras. The climate rises from tropical maritime along the coast to subtropical hill and valley strip to a mountainous interior. The population consists of 98% Mestizo and 10% Indian, totaling 5.1 million, growing at 2.4 annually. Literacy varies from 40-60%; the infant mortality rate is 71/1000, and the life expectancy is 63-66 years. The economy is based on agricultural products as coffee, sugar and cotton and light industry such as textiles and petroleum refining, but due to political unrest, the 1986 earthquake, and fluctuating commodity prices, inflation runs about 36% and the per capita income is $700. El Salvador takes pride in its independence since 1821, but its history is marked by revolutions and control of government, military and ecclesiastical power by "the fourteen families." The current democratic government, considered to be the result of a fair election, is undertaking land reform and participates in the Central American peace process.

Binarias en cúmulos abiertos: ?`Qué hay de nuevo?

NASA Astrophysics Data System (ADS)

Levato, H.

Las herramientas modernas para detectar duplicidad han jugado un papel fundamental en el resurgimiento del estudio de la binaridad en cúmulos abiertos. El fracaso de las teorías de bifurcación para explicar la formación de estrellas dobles ha puesto en consideración los encuentros de estrellas en cúmulos para formar binarias. Existen muchas pruebas empíricas que pueden realizarse para verificar las creencias actuales. En esta revisión del tema se hace un breve resumen de la historia del problema y se analiza el conocimiento actual. Se proponen las investigaciones y programas que darían lugar a la comprobación de las predicciones que surgen de considerar que las binarias en cúmulos se forman por encuentros.

Management of medicinally useful plants by European migrants in South America.

PubMed

Kujawska, Monika; Pardo-de-Santayana, Manuel

2015-08-22

the forest, whose exploitation was increased by contact with local mestizos and indigenous groups. This study clearly shows that traditional knowledge can be adaptive and resilient. New species have been selected and incorporated from mestizos, and indigenous people, and at the same time the use of some legacy plants has been preserved. The importance of home gardens as a venue for medicinal plants is another facet of this adaptive process. Traditional knowledge is resilient too, because despite the many changes that have occurred, Polish people have maintained phytotherapy as their preferred form of treating ailments, and managed to retain certain species brought from Europe as the most relevant. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Data Sharing Statements for Clinical Trials: A Requirement of the International Committee of Medical Journal Editors.

PubMed

Taichman, Darren B; Sahni, Peush; Pinborg, Anja; Peiperl, Larry; Laine, Christine; James, Astrid; Hong, Sung-Tae; Haileamlak, Abraham; Gollogly, Laragh; Godlee, Fiona; Frizelle, Franka; Florenzano, Fernando; Drazen, Jeffrey M; Bauchner, Howard; Baethge, Christopher; Backus, Joyce

2017-06-01

El Comité Internacional de Editores de Revista Médicas (ICMJE) ha tomado la posición que el compartir los datos generados por los ensayos clínicos es una obligación ética, por cuanto los participantes en esos estudios se colocaron en riesgo al aceptar su inclusión. En esta editorial el ICMJE expresa que requerirá desde Julio 2018 que los manuscritos enviados a sus revistas deben incluir una declaración sobre compartir datos. A su vez, los ensayos clínicos que comiencen a enrolar pacientes a partir de Enero 2019, deben incluir un plan sobre compartir datos en el registro de tales ensayos. Se dan en esta declaración cuatro ejemplos de declaraciones sobre compartir datos, referidos a qué datos se compartirán, cuándo estarán disponibles y qué criterios de acceso se establecerán. El ICMJE visualiza un futuro cercano en el cual el compartir los datos será la norma, con el fin de maximizar el conocimiento ganado por los esfuerzos y sacrificios de los participantes.

Population data and mutation rate of nine Y-STRs in a mestizo Mexican population from Guadalajara, Jalisco, México.

PubMed

Padilla-Gutiérrez, Jorge Ramón; Valle, Yeminia; Quintero-Ramos, Antonio; Hernández, Guillermo; Rodarte, Katya; Ortiz, Rocío; Olivares, Norma; Rivas, Fernando

2008-11-01

Nine Y-STR (DYS19, DYS390, DYS391, DYS392, DYS446, DYS447, DYS448, DYS456 and DYS458) were analyzed in a male sample of 285 unrelated individuals from Guadalajara, Jalisco, México. The haplotype diversity (0.996) and discrimination capacity (0.986) were calculated. A family study of around 200 father/son pairs and among 1828 meiosis showed five mutational events. All mutations were single step. The overall mutation rate estimated across the nine Y-STRs was 2.7 x 10(-3) (95% CI 1.2-6.4 x 10(-3))/locus/meiosis. The results indicate that these nine loci are useful Y-linked markers for forensic applications.

Climacteric symptoms in Quechua and Mestizo women from the Andean region of Cusco, Peru: effects of altitude and ethnicity.

PubMed

Ojeda, Eliana; Blümel, Juan E; Vallejo, María Soledad; Lavín, Pablo

2014-04-01

Latin-American women present a greater severity of climacteric symptoms than women from other parts of the world. Previous studies suggest that this could be due to either its Amerindian crossbreeding or the altitude in which a huge proportion of the Latin-American population lives. To answer this question, climacteric symptoms between Peruvian women ("Hispanic-Mestizas" and "Quechuas") living in similar altitude (around 3000 MASL) were compared. This is a cross sectional descriptive study of healthy women of 40-59 years of age living in Departamento de El Cusco, Peru. Using the MRS questionnaire climacteric symptoms were assessed in 395 "Hispanic-Mestizas" (Quechua-Spaniard breeding) and 376 pure "Quechuas". The "Quechuas" compared with "Hispanic-Mestizas" have comparable similar age, but less: obesity, schooling years, cigarette smoking, use of hormonal therapy, diabetes and hypertension; and a greater: proportion of postmenopausal women and number of children. "Quechuas" showed a greater prevalence in ten of the eleven symptoms evaluated by the MRS scale, except for insomnia. The total MRS score was 14.54±7.51 vs. 9.87±6.26 (p<0.0001), respectively. As a consequence of this, 46.5% of the "Quechuas" had a deteriorated quality of life due to severe climacteric symptomatology, compared to only 14.2% of "Hispanic-Mestizas" women (p<0.0001). After adjusting for confounding variables menopause was associated with increased risk of severe menopausal symptoms (OR: 5.86, 95% CI: 3.93-8.75), followed by lack of partner (OR: 3.52, 95% CI: 1.91-6.48), arterial hypertension (OR: 2.62, 95% CI: 1.28-5.39) and Quechua being (OR: 2.38, 95% CI: 1.27-4.45). Peruvian "Quechuas" women have severer climacteric symptoms than the Peruvian "Hispanic-Mestizas" who live in a comparable altitude. This could suggest that the ethnicity could be one of the factors that could explain the augmented symptoms in Latin-American climacteric woman. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Genetic polymorphisms of matrix metalloproteinases and protein levels in chronic obstructive pulmonary disease in a Mexican population.

PubMed

Hernández-Montoya, Jazmín; Pérez-Ramos, Julia; Montaño, Martha; Ramírez-Venegas, Alejandra; Sansores, Raúl H; Pérez-Rubio, Gloria; Velázquez-Uncal, Mónica; Camarena, Angel; Ramos, Carlos; Falfán-Valencia, Ramcés

2015-01-01

To evaluate association of single nucleotide polymorphisms (SNPs) in the MMP1, MMP2, MMP9 and MMP12 genes and serum MMP-2 and MMP-9 levels in smoking chronic obstructive pulmonary disease (COPD) patients. Genotyping using real-time PCR in 330 smokers with COPD (COPD), 658 smokers without COPD (SNC) and 150 nonsmokers (NCNS), the analysis of samples used was χ(2) test. Using ELISA, the proteins were evaluated. Multiple comparisons were made by ANOVA. rs243864 (OR: 7.44; 95% CI: 3.62-15.26) and rs11646643 (OR: 1.58; 95% CI: 1.07-2.34) of the MMP-2 gene and rs3918253 (OR: 1.72; 95% CI: 1.08-2.71) of the MMP-9 gene, were associated with the risk of COPD. Serum MMP-2 level in the COPD group was lower compared with SNC (p < 0.05). Serum MMP-9 level was elevated in the COPD group compared with SNC (p < 0.05). Polymorphisms in MMP2 and MMP9 but not in MMP1 and MMP12 are associated with the risk of COPD in the Mexican mestizo population.

Spotlight: Peru.

PubMed

Yacher, L

1985-09-01

This article highlights population statistics from Peru, the 3rd largest country in Latin America. The population in 1985 has been estimated at 19.7 million. In 1982, the birth rate was 35/1000 and the mortality rate was 10/1000. Infant mortality stood at 99/1000 live births and life expectancy at birth was 59 years. 41% of Peru's population is under 15 years of age, and only 4% is 65 years of age or older. The country's total fertility rate is 5.2 births/woman. Only 0.4% of the population is foreign born. Peru is highly urbanized, and 65% of the country's total population growth in 1981 occurred in its cities. 1 in 3 Peruvians resides in the capital city of Lima. The 2 largest racial groups are mestizos and whites (53%) and Indians (46%). 21% of the population is illiterate. 40.7% of the labor force is employed in agriculture; however, only 15% of the national income is derived from agriculture. The GNP per capita was US$1040 in 1983. The country's economy is in serious trouble at present, with an annual inflation rate of 250% and a foreign debt of US$13.5 billion.

Nail haemorrhages in native highlanders of the Peruvian Andes

PubMed Central

Heath, Donald; Harris, Peter; Williams, David; Krüger, Hever

1981-01-01

Nail haemorrhages are of interest to the chest physician and cardiologist. While the common type in the distal part of the nail is produced by the minor trauma of daily life, the rarer form—scattered through the nail substance—appears to be related to hypoxaemia brought about by heart and lung disease. We thought it would be of interest to study a population which was naturally hypoxaemic because of living at high altitude. Accordingly we have studied the frequency and types of nail haemorrhage in Quechua Indians who are permanently exposed to the hypobaric hypoxia of the Andes. We found the haemorrhages to be common both in mestizos living on the coastal plain and in the native highlanders. They appeared to increase in frequency with altitude but were of the distal type and would thus seem to be the result of minor trauma as at sea level. However, just as in cases of cyanotic congenital heart disease at low altitude, those with exaggerated hypoxaemia and pronounced elevation of haematocrit—namely, subjects with Monge's disease (chronic mountain sickness)—had scattered haemorrhages in the nail substance. Images

High Prolactin Excretion in Patients with Diabetes Mellitus and Impaired Renal Function.

PubMed

Triebel, Jakob; Moreno-Vega, Aura Ileana; Vázquez-Membrillo, Miguel; Nava, Gabriel; García-Franco, Renata; López-Star, Ellery; Baldivieso-Hurtado, Olivia; Ochoa, Daniel; Macotela, Yazmín; Bertsch, Thomas; Martinez de la Escalera, Gonzalo; Clapp, Carmen

2015-01-01

The metabolic clearance of prolactin (PRL) is partially executed by the kidney. Here, we investigate the urine excretion of PRL in patients with Diabetes Mellitus and renal impairment. Serum and urine samples were collected from male, mestizo patients in central Mexico employing a cross-sectional study design. Ninety-eight individuals had either no diabetes and normal renal function (control), diabetes and normal renal function, or diabetes with impaired renal function. PRL was determined by a chemiluminescent immunometric assay; protein, albumin, and creatinine were evaluated using quantitative colorimetric assays. The results were analyzed using ANOVA-testing. Patients with Diabetes Mellitus and renal impairment had significantly higher urine PRL levels than patients with Diabetes Mellitus and normal renal function and control patients. Higher urine PRL levels were associated with lower glomerular filtration rates, higher serum creatinine, and higher urinary albumin-to-creatinine ratios (UACR). Urine PRL levels correlated positively with UACR. Serum PRL levels were similar among groups. Patients with Diabetes Mellitus and impaired renal function demonstrate a high urinary PRL excretion. Urinary PRL excretion in the context of proteinuria could contribute to PRL dysregulation in renal impairment.

[Injecting without getting infected: injectors' strategies to prevent HIV and HCV.

PubMed

Mateu-Gelabert, P; Friedman, S; Sandoval, M

2007-10-01

OBJETIVO: Desde principios de los noventa, en la ciudad de Nueva York se han implementado con éxito programas para reducir la incidencia del virus de la inmunodeficiencia humana (VIH) y, en menor medida, del virus de la hepatitis C (VHC). A pesar de ello, aproximadamente el 70% de los usuario de drogas inyectables (UDI) están infectados por el VHC. Queremos investigar cómo el 30% restante se las ha arreglado para no infectarse. El Staying safe (nombre original del estudio) explora los comportamientos y mecanismos que ayudan a evitar la infección por el VHC y el VIH a largo plazo. MATERIAL Y M#ENTITYSTARTX000E9;TODOS: Hemos utilizado el concepto de «desviación positiva» aplicado en otros campos de salud pública. Estudiamos las estrategias, prácticas y tácticas de prevención de aquellos UDI que, viviendo en contextos de alta prevalencia, se mantienen sin infectar por VIH y el VHC, a pesar de haberse inyectado heroína durante años. Los resultados preliminares presentados en este artículo incluyen el análisis de las entrevistas realizadas a 25 UDI (17 doble negativos, 3 doble positivos y 5 con infección por el VHC y sin infección por el VIH). Se usaron entrevistas semiestructuradas que exploraban con detalle la historia de vida de los sujetos, incluyendo su consumo de drogas, redes sociales, contacto con instituciones, relaciones sexuales y estrategias de protección y vigilancia. RESULTADOS: La intencionalidad es importante para no infectarse, especialmente durante períodos de involución (períodos donde hay un deterioro económico y/o social que llevan al que se inyecta a situaciones de mayor riesgo). Presentamos tres dimensiones independientes de intencionalidad que conllevan comportamientos que pueden ayudar a prevenir la infección: a) evitar «el mono» (síntomas de abstención) asegurando el acceso a la droga; b) «llevarlo bien» para no convertirse en un junkie y así evitar la «muerte social» y la falta de acceso a los recursos, y c

Pincharse sin infectarse: estrategias para prevenir la infección por el VIH y el VHC entre usuarios de drogas inyectables

PubMed Central

MATEU-GELABERT, P.; FRIEDMAN, S.; SANDOVAL, M.

2011-01-01

Resumen Objetivo Desde principios de los noventa, en la ciudad de Nueva York se han implementado con éxito programas para reducir la incidencia del virus de la inmunodeficiencia humana (VIH) y, en menor medida, del virus de la hepatitis C (VHC). A pesar de ello, aproximadamente el 70% de los usuario de drogas inyectables (UDI) están infectados por el VHC. Queremos investigar cómo el 30% restante se las ha arreglado para no infectarse. El Staying safe (nombre original del estudio) explora los comportamientos y mecanismos que ayudan a evitar la infección por el VHC y el VIH a largo plazo. Material y métodos Hemos utilizado el concepto de «desviación positiva» aplicado en otros campos de salud pública. Estudiamos las estrategias, prácticas y tácticas de prevención de aquellos UDI que, viviendo en contextos de alta prevalencia, se mantienen sin infectar por VIH y el VHC, a pesar de haberse inyectado heroína durante años. Los resultados preliminares presentados en este artículo incluyen el análisis de las entrevistas realizadas a 25 UDI (17 doble negativos, 3 doble positivos y 5 con infección por el VHC y sin infección por el VIH). Se usaron entrevistas semiestructuradas que exploraban con detalle la historia de vida de los sujetos, incluyendo su consumo de drogas, redes sociales, contacto con instituciones, relaciones sexuales y estrategias de protección y vigilancia. Resultados La intencionalidad es importante para no infectarse, especialmente durante períodos de involución (períodos donde hay un deterioro económico y/o social que llevan al que se inyecta a situaciones de mayor riesgo). Presentamos tres dimensiones independientes de intencionalidad que conllevan comportamientos que pueden ayudar a prevenir la infección: a) evitar «el mono» (síntomas de abstención) asegurando el acceso a la droga; b) «llevarlo bien» para no convertirse en un junkie y así evitar la «muerte social» y la falta de acceso a los recursos, y c) seguir sin

Oral melanoacanthoma and oral melanotic macule: a report of 8 cases, review of the literature, and immunohistochemical analysis.

PubMed

Carlos-Bregni, Román; Contreras, Elisa; Netto, Ana Carolina; Mosqueda-Taylor, Adalberto; Vargas, Pablo Agustin; Jorge, Jacks; León, Jorge Esquiche; de Almeida, Oslei Paes

2007-09-01

Oral melanoacanthoma (MA) is a rare, benign pigmented lesion, similar to cutaneous MA, characterized by hyperplasia of spinous keratinocytes and dendritic melanocytes. The pathogenesis of oral MA remains uncertain, although its clinical behavior is suggestive of a reactive origin. The most common intraoral sites are the buccal mucosa, lip, palate and gingiva. The average age of presentation is 28 years, mainly in blacks, with a strong female predilection. The oral melanotic macule (MM) is a small, well-circumscribed brown-to-black macule that occurs on the lips and mucous membranes. The etiology is not clear and it may represent a physiologic or reactive process. The average age of presentation is 43 years, with a female predilection. A biopsy is recommended to distinguish these lesions from each other and from other oral melanocytic lesions. We depict four cases each of oral MA and MM, affecting Caucasian and Latin American mestizo patients. The clinicopathological features of these cases reflect its ample spectrum, and to the best of our knowledge, it is the first example of oral MA affecting a Caucasian boy reported in the English literature. Therefore oral MA and MM should be considered in the differential diagnosis of pigmented lesions in the oral mucosa in these populations.

Analysis of betaS and betaA genes in a Mexican population with African roots.

PubMed

Magaña, María Teresa; Ongay, Zoyla; Tagle, Juan; Bentura, Gilberto; Cobián, José G; Perea, F Javier; Casas-Castañeda, Maricela; Sánchez-López, Yoaly J; Ibarra, Bertha

2002-01-01

To investigate the origin of the beta(A) and beta(S) genes in a Mexican population with African roots and a high frequency of hemoglobin S, we analyzed 467 individuals (288 unrelated) from different towns in the states of Guerrero and Oaxaca in the Costa Chica region. The frequency of the sickle-cell trait was 12.8%, which may represent a public health problem. The frequencies of the beta-haplotypes were determined from 350 nonrelated chromosomes (313 beta(A) and 37 beta(S)). We observed 15 different beta(A) haplotypes, the most common of which were haplotypes 1 (48.9%), 2 (13.4%), and 3 (13.4%). The calculation of pairwise distributions and Nei's genetic distance analysis using 32 worldwide populations showed that the beta(A) genes are more closely related to those of Mexican Mestizos and North Africans. Bantu and Benin haplotypes and haplotype 9 were related to the beta(S) genes, with frequencies of 78.8, 18.2, and 3.0%, respectively. Comparison of these haplotypes with 17 other populations revealed a high similitude with the population of the Central African Republic. These data suggest distinct origins for the beta(A) and beta(S) genes in Mexican individuals from the Costa Chica region.

Yerba Mate (Ilex paraguariensis) Beverage: Nutraceutical Ingredient or Conveyor for the Intake of Medicinal Plants? Evidence from Paraguayan Folk Medicine

PubMed Central

2018-01-01

The use of medicinal plants mixed with yerba mate (Ilex paraguariensis) has been poorly studied in the ethnopharmacological literature so far. The Paraguayan Mestizo people have the longest tradition of using the yerba mate beverage, apart from the indigenous Guarani people. This study analyses the role of yerba mate and medicinal plants in the treatment of illnesses within Paraguayan folk medicine. The research was conducted among 100 Paraguayan migrants living in Misiones, Argentina, in 2014 and 2015. Yerba mate is not considered to be a medicinal plant by its own virtues but is culturally a very important type of medicinal plant intake. Ninety-seven species are employed in hot and cold versions of the yerba mate beverage. The most important species are as follows: Allophylus edulis (highest number of citations), Aristolochia triangularis (highest relative importance value), and Achyrocline flaccida and Achyrocline tomentosa (highest score by Index of Agreement on Species). The plants are used in the treatment of 18 medicinal categories, which include illnesses traditionally treated with plants: digestive system, humoral medicine, and relatively new health conditions such as diabetes, hypertension, and high levels of cholesterol. Newly incorporated medicinal plants, such as Moringa oleifera, are ingested predominantly or exclusively with the mate beverage. PMID:29725356

Present status and perspective of pharmacogenetics in Mexico.

PubMed

Cuautle-Rodríguez, Patricia; Llerena, Adrián; Molina-Guarneros, Juan

2014-01-01

Drug costs account for up to 24% of the country's health expenditure and there are 13,000 registered drugs being prescribed. Diabetes is the main cause of death in the country, with over 85% of diabetic patients currently under drug treatment. The importance of knowing interindividual variability in drug metabolism on Mexican populations is thus evident. The purpose of this article is to provide an overlook of the current situation of pharmacogenetic research in Mexico, focusing on drug-metabolizing enzymes, and the possibility of developing a phenotyping cocktail for Mexican populations. So far, 21 pharmacogenetic studies on Mexican population samples (Mestizos and Amerindian) have been published. These have reported interindividual variability through phenotyping and/or genotyping cytochromes: CYP2D6, 2C19, 2C9, 2E1, and phase II enzymes UGT and NAT2. Some cytochromes with important clinical implications have not yet been phenotyped in Mexican populations. The development of a cocktail adapted to them could be a significant contribution to a larger knowledge on drug response variability at a lower price and shorter time. There are validated phenotyping cocktails that present several practical advantages, being valuable, safe, and inexpensive tools in drug metabolism characterization, which require only a single experiment to provide information on several cytochrome activities.

Genetic structure of the populations migrating from San Luis Potosi and Zacatecas to Nuevo León in Mexico.

PubMed

Cerda-Flores, R M; Kshatriya, G K; Barton, S A; Leal-Garza, C H; Garza-Chapa, R; Schull, W J; Chakraborty, R

1991-06-01

The Mexicans residing in the Monterrey metropolitan area in Nuevo León, Mexico, were grouped by generation and birthplace [Monterrey Metropolitan Area (MMA), San Luis Potosi (SLP), and Zacatecas (ZAC)] of the four grandparents to determine the extent of genetic variation within this population and the genetic differences, if any, between the natives living in the MMA and the immigrant populations from SLP and ZAC. Nine genetic marker systems were analyzed. The genetic distance analysis indicates that SLP and ZAC are similar to the MMA, irrespective of birthplace and generation. Gene diversity analysis (GST) suggests that more than 96% of the total gene diversity (HT) can be attributed to individual variation within the population. The genetic admixture analysis suggests that the Mexicans of the MMA, SLP, and ZAC, stratified by birthplace and generation, have received a predominantly Spanish contribution (78.5%), followed by a Mexican Indian contribution (21.5%). Similarly, admixture analysis, conducted on the population of Nuevo León and stratified by generation, indicates a substantial contribution from the MMA (64.6%), followed by ZAC (22.1%) and SLP (13.3%). Finally, we demonstrate that there is no nonrandom association of alleles among the genetic marker systems (i.e., no evidence of gametic disequilibrium) despite the Mestizo origin of this population.

Ayahuasca, psychedelic studies and health sciences: the politics of knowledge and inquiry into an Amazonian plant brew.

PubMed

Tupper, Kenneth W; Labate, Beatriz C

2014-01-01

This article offers critical sociological and philosophical reflections on ayahuasca and other psychedelics as objects of research in medicine, health and human sciences. It situates 21st century scientific inquiry on ayahuasca in the broader context of how early modern European social trends and intellectual pursuits translated into new forms of empiricism and experimental philosophy, but later evolved into a form of dogmatism that convenienced the political suppression of academic inquiry into psychedelics. Applying ideas from the field of science and technology studies, we consider how ayahuasca's myriad ontological representations in the 21st century--for example, plant teacher, traditional medicine, religious sacrament, material commodity, cognitive tool, illicit drug--influence our understanding of it as an object of inquiry. We then explore epistemological issues related to ayahuasca studies, including how the indigenous and mestizo concept of "plant teacher" or the more instrumental notion of psychedelics as "cognitive tools" may impact understanding of knowledge. This leads to questions about whether scientists engaged in ayahuasca research should be expected to have personal experiences with the brew, and how these may be perceived to help or hinder the objectivity of their pursuits. We conclude with some brief reflections on the politics of psychedelic research and impediments to academic knowledge production in the field of psychedelic studies.

[Acute abdominal pain due to splenic infarction in a patient with heterozygous sickle cell disease exposed to high altitude].

PubMed

Ruiz Semba, Edgar; Garavito Rentería, Jorge; Jiménez Bustamante, Jorge; Arteaga Caro, Ronal; García Del Aguila, José Luis; Chávez Gil, Vannya

2006-01-01

Hemoglobinopathy S, Depranocytosis or Sickle Cell Disease is the most common hemoglobinopathy in the world. In its heterozygous form (Sickle Cell Trait), it affects 8% of the black population in the U.S. and 25% of the black population in Africa, and is found less frequently in the Mediterranean area, India, Middle East and Latin America. The basic alteration is a substitution of glutamic acid by valin in the sixth position of the beta globin chain, which causes polymerization at low oxygen tension thereby distorting the structure of erythrocytes and increasing blood viscosity, which, in turn, generates obstructions of the capillary arterial blood flow to different areas of the body thus causing microinfarctions. Although Splenic Infarction is rare, it is recognized as a serious complication of Heterozygous Sickle Cell Disease (Sickle Cell Trait). We present the case of a 21 year-old mestizo male patient who came in with an acute case of abdominal pain after arriving to work in the Casapalca mining city (located in the Peruvian Andes at 4200 m.a.s.l.) and was referred to our Hospital in Lima for exams. We present the case because it is an unusual cause of acute abdominal pain, and because this condition is rare in Peru and there are few publications about it.

Colonia Tovar: the history of a semi-isolated Venezuelan population of German ancestry described by HLA class I genes.

PubMed

Gendzekhadze, K; Montagnani, S; Ogando, V; Balbas, O; Mendez-Castellano, H; Layrisse, Z

2003-11-01

The history of Colonia Tovar is very complex, being the home of descendants of only a small fraction of immigrants arriving to the South American continent from a specific region of Germany, with a restricted number of founders, small population size and consanguineous mating, experiencing isolation for 100 years, with later migrations, a low rate of population growth and a high mean number of children per couple. How complex is its genetic structure? Do the highly polymorphic HLA genes reflect its history and confirm the story of this population described by other genes? Several studies have been made in this population, but we describe for the first time the HLA Class I variability in the population of Colonia Tovar using PCR-SSOP. Random genetic drift, founder effect and gene flow could explain the HLA allele and haplotype frequencies observed in this population but alleles at the class I loci were insufficient to identify the German origin of the community established through history. This agrees with findings obtained testing other genetic systems (ACP, AK, ESD, G6PD, GLO, PGM, PGD, ALB, CP, HP, TF), but the HLA-typing results indicate that the original gene pool has been diluted due to gene flow from the surrounding Mestizo population.

Genetic admixture of eight Mexican indigenous populations: based on five polymarker, HLA-DQA1, ABO, and RH loci.

PubMed

Buentello-Malo, Leonora; Peñaloza-Espinosa, Rosenda I; Salamanca-Gómez, Fabio; Cerda-Flores, Ricardo M

2008-01-01

This study explores the genetic admixture of eight Mexican indigenous populations (Otomi-Ixmiquilpan, Otomi-Actopan, Tzeltales, Nahua-Milpa-Alta, Nahua-Xochimilco, Nahua-Zitlala, Nahua-Ixhuatlancillo, and Nahua-Coyolillo) on the basis of five PCR-based polymorphic DNA loci (LDLR, GYPA, HBGG, D7S8, GC), HLA_DQA1, and the blood groups ABO and Rh (CcDEe). Among the indigenous populations, the highest gene frequencies for O and D were 0.9703 and 1.000 for Zitlala (State of Guerrero) and 0.9955 and 0.9414 for Tzeltales (State of Chiapas), respectively. Maximum likelihood estimates of admixture components yield a trihybrid model with Amerindian (assuming that Nahua-Zitlala is the most representative indigenous population), Spanish, and African ancestry with the admixture proportions: 93.03, 6.03, and 0.94 for Tzeltales, and 28.99, 44.03, and 26.98 for Coyolillo. A contribution of the ancestral populations of Ixhuatlancillo, Actopan, Ixmiquilpan, Milpa-Alta, and Xochimilco were found with the following average of admixture proportions: 75.84, 22.50, and 1.66. The findings herein demonstrate that the genetic admixture of the Mexican indigenous populations who at present speak the same Amer-Indian language can be differentiated and that the majority of them have less ancestral indigenous contribution than those considered as Mestizo populations.

HLA-A, -B, -C, -DQB1, and -DRB1,3,4,5 allele and haplotype frequencies in the Costa Rica Central Valley Population and its relationship to worldwide populations.

PubMed

Arrieta-Bolaños, Esteban; Maldonado-Torres, Hazael; Dimitriu, Oana; Hoddinott, Michael A; Fowles, Finnuala; Shah, Anila; Orlich-Pérez, Priscilla; McWhinnie, Alasdair J; Alfaro-Bourrouet, Wilbert; Buján-Boza, Willem; Little, Ann-Margaret; Salazar-Sánchez, Lizbeth; Madrigal, J Alejandro

2011-01-01

The human leukocyte antigen (HLA) system is the most polymorphic in humans. Its allele, genotype, and haplotype frequencies vary significantly among different populations. Molecular typing data on HLA are necessary for the development of stem cell donor registries, cord blood banks, HLA-disease association studies, and anthropology studies. The Costa Rica Central Valley Population (CCVP) is the major population in this country. No previous study has characterized HLA frequencies in this population. Allele group and haplotype frequencies of HLA genes in the CCVP were determined by means of molecular typing in a sample of 130 unrelated blood donors from one of the country's major hospitals. A comparison between these frequencies and those of 126 populations worldwide was also carried out. A minimum variance dendrogram based on squared Euclidean distances was constructed to assess the relationship between the CCVP sample and populations from all over the world. Allele group and haplotype frequencies observed in this study are consistent with a profile of a dynamic and diverse population, with a hybrid ethnic origin, predominantly Caucasian-Amerindian. Results showed that populations genetically closest to the CCVP are a Mestizo urban population from Venezuela, and another one from Guadalajara, Mexico. Copyright © 2011 American Society for Histocompatibility and Immunogenetics. All rights reserved.

Developmental pathways inferred from modularity, morphological integration and fluctuating asymmetry patterns in the human face.

PubMed

Quinto-Sánchez, Mirsha; Muñoz-Muñoz, Francesc; Gomez-Valdes, Jorge; Cintas, Celia; Navarro, Pablo; Cerqueira, Caio Cesar Silva de; Paschetta, Carolina; de Azevedo, Soledad; Ramallo, Virginia; Acuña-Alonzo, Victor; Adhikari, Kaustubh; Fuentes-Guajardo, Macarena; Hünemeier, Tábita; Everardo, Paola; de Avila, Francisco; Jaramillo, Claudia; Arias, Williams; Gallo, Carla; Poletti, Giovani; Bedoya, Gabriel; Bortolini, Maria Cátira; Canizales-Quinteros, Samuel; Rothhammer, Francisco; Rosique, Javier; Ruiz-Linares, Andres; Gonzalez-Jose, Rolando

2018-01-17

Facial asymmetries are usually measured and interpreted as proxies to developmental noise. However, analyses focused on its developmental and genetic architecture are scarce. To advance on this topic, studies based on a comprehensive and simultaneous analysis of modularity, morphological integration and facial asymmetries including both phenotypic and genomic information are needed. Here we explore several modularity hypotheses on a sample of Latin American mestizos, in order to test if modularity and integration patterns differ across several genomic ancestry backgrounds. To do so, 4104 individuals were analyzed using 3D photogrammetry reconstructions and a set of 34 facial landmarks placed on each individual. We found a pattern of modularity and integration that is conserved across sub-samples differing in their genomic ancestry background. Specifically, a signal of modularity based on functional demands and organization of the face is regularly observed across the whole sample. Our results shed more light on previous evidence obtained from Genome Wide Association Studies performed on the same samples, indicating the action of different genomic regions contributing to the expression of the nose and mouth facial phenotypes. Our results also indicate that large samples including phenotypic and genomic metadata enable a better understanding of the developmental and genetic architecture of craniofacial phenotypes.

The panorama of familial hypercholesterolemia in Latin America: a systematic review.

PubMed

Mehta, Roopa; Zubirán, Rafael; Martagón, Alexandro J; Vazquez-Cárdenas, Alejandra; Segura-Kato, Yayoi; Tusié-Luna, María Teresa; Aguilar-Salinas, Carlos A

2016-12-01

The burden caused by familial hypercholesterolemia (FH) varies among countries and ethnic groups. The prevalence and characteristics of FH in Latin American (LA) countries is largely unknown. We present a systematic review (following the PRISMA statement) of FH in LA countries. The epidemiology, genetics, screening, management, and unique challenges encountered in these countries are discussed. Published reports discussing FH in Hispanic or LA groups was considered for analysis. Thirty studies were included representing 10 countries. The bulk of the data was generated in Brazil and Mexico. Few countries have registries and there was little commonality in FH mutations between LA countries. LDL receptor mutations predominate; APOB and PCSK9 mutations are rare. No mutation was found in an FH gene in nearly 50% of cases. In addition, some country-specific mutations have been reported. Scant information exists regarding models of care, cascade screening, cost, treatment effectiveness, morbidity, and mortality. In conclusion, FH is largely underdiagnosed and undertreated in the LA region. The genetic admixture with indigenous populations, producing mestizo's groups, may influence the mutational findings in Latin America. Potential opportunities to close gaps in knowledge and health care are identified. Copyright © 2016 by the American Society for Biochemistry and Molecular Biology, Inc.

-592 and -1082 interleukin-10 polymorphisms in pulmonary tuberculosis with type 2 diabetes.

PubMed

García-Elorriaga, Guadalupe; Vera-Ramírez, Leila; del Rey-Pineda, Guillermo; González-Bonilla, César

2013-07-01

To determine the polymorphisms of Interleukin-10 (IL-10) (-592, -1082) in pulmonary tuberculosis (PTB) with and without type 2 diabetes (T2D). We studied a Mexican mestizo population of 37 patients with TB in remission (TBr) and 40 with active pulmonary TB (PTB), 21 patients with TB + T2D, 47 blood donors accepted, and 13 healthy health-care workers with tuberculin skin test positive. Determination of IL-10 polymorphisms was performed by real-time Polymerase chain reaction. IL-10-592C/A presented in a greater proportion in healthy individuals than in patients with type 2 diabetes and TB in a not quite significant statistically manner. IL-10-1082A/A presented more frequently in the group of patients with both diseases, not being statistically significant in comparison with the group of healthy subjects. This study describes two important new findings. First, it reveals that the IL-10 (-592 A/A and -592 C/C) polymorphisms were found in a greater proportion in a group of patients with T2D and TB than in healthy subjects. Second, the study provides evidence that the (-1082 G/G) polymorphism presented with greater frequency in healthy individuals than in patients with both of these diseases. Copyright © 2013 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

[High frequency of ancestral allele of the TJP1 polymorphism rs2291166 in Mexican population, conformational effect and applications in surgery and medicine].

PubMed

Ramirez-Garcia, Sergio Alberto; Flores-Alvarado, Luis Javier; Topete-González, Luz Rosalba; Charles-Niño, Claudia; Mazariegos-Rubi, Manuel; Dávalos-Rodríguez, Nory Omayra

2016-01-01

TJP1 gene encodes a ZO-1 protein that is required for the recruitment of occludins and claudins in tight junction, and is involved in cell polarisation. It has different variations, the frequency of which has been studied in different populations. In Mexico there are no studies of this gene. These are required because their polymorphisms can be used in studies associated with medicine and surgery. Therefore, the aim of this study was to estimate the frequency of alleles and genotypes of rs2291166 gene polymorphism TJP1 in Mexico Mestizos population, and to estimate the conformational effect of an amino acid change. A total of 473 individuals were included. The rs2291166 polymorphism was identified PASA PCR-7% PAGE, and stained with silver nitrate. The conformational effect of amino acid change was performed in silico, and was carried out with servers ProtPraram Tool and Search Database with Fasta. The most frequent allele in the two populations is the ancestral allele (T). A genotype distribution similar to other populations was found. The polymorphism is in Hardy-Weinberg, p>0.05. Changing aspartate to alanine produced a conformational change. The study reveals a high frequency of the ancestral allele at rs2291166 polymorphism in the Mexican population. Copyright © 2015 Academia Mexicana de Cirugía A.C. Published by Masson Doyma México S.A. All rights reserved.

PTPN22 -1123G>C polymorphism and anti-cyclic citrullinated protein antibodies in rheumatoid arthritis.

PubMed

Muñoz-Valle, José Francisco; Padilla-Gutiérrez, Jorge Ramón; Hernández-Bello, Jorge; Ruiz-Noa, Yeniley; Valle, Yeminia; Palafox-Sánchez, Claudia Azucena; Parra-Rojas, Isela; Gutiérrez-Ureña, Sergio Ramón; Rangel-Villalobos, Hector

2017-08-10

The protein tyrosine phosphatase non-receptor type 22 (PTPN22) gene encodes an important negative regulator of T-cell activation, lymphoid-specific phosphatase -Lyp- and has been associated with different autoimmune disorders. The PTPN22 -1123G>C polymorphism appears to affect the transcriptional control of this gene, but to date, the biological significance of this polymorphisms on rheumatoid arthritis (RA) risk remains unknown. We evaluate the association of PTPN22 -1123G>C polymorphism with anti-cyclic citrullinated protein antibodies (anti-CCP) and risk for RA in population from Western Mexico. A transversal analytic study, which enrolled 300 RA patients classified according to ACR-EULAR criteria and 300 control subjects (CS) was conducted. The -1123 G>C polymorphism was genotyped by PCR-RFLP. The anti-CCP antibodies levels were quantified by ELISA kit. We found a higher prevalence of homozygous PTPN22 -1123CC genotype in CS than in RA patients (OR 0.41; 95% confidence interval 0.24-0.71; P=.001), suggesting a potential protective effect against RA. Concerning anti-CCP levels, the CC genotype carriers showed the lowest median levels in RA (P<.05). The PTPN22 -1123CC genotype is a protector factor to RA in a Mexican-mestizo population and is associated with low anti-CCP antibodies. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

Two worlds apart: Determinants of height in late 18th century central Mexico.

PubMed

Dobado-González, Rafael; Garcia-Hiernaux, Alfredo

2017-02-01

Anthropometric literature on the American territories of the Hispanic monarchy before their independence is still scarce. We attempt to expand the field with a case study that includes some important novelties. Albeit our main source, the military records of the Censo de Revillagigedo (conducted in the early 1790s), has already been used, the sample size and the geographical scope are unprecedented: 19,390 males of four ethnicities (castizos, españoles, mestizos, and mulatos) aged from 16 to 39 from 24 localities, including towns and villages scattered across central regions of the Viceroyalty of New Spain. We build a database that, complemented with information on resource endowments obtained from other sources, permits to analyze the determinants of height. Our results show the importance of spatial differences as well as the significance of ethnicity, occupation, rurality, age and resource endowments as determinants of height. Unprivileged mulatos are only 0.5cm shorter than, assumedly privileged, españoles in the "first world" (El Bajío) and 1.3cm taller in the "second world" (Eastern Central Highlands). In turn, living in the "first world" implies being between nearly 1.5cm and 5cm taller than the inhabitants of the "second world". Our estimates of physical statures are placed within an international comparative context and offer a relatively "optimistic" picture. Copyright © 2016 Elsevier B.V. All rights reserved.

A new mutation of the PCNT gene in a Colombian patient with microcephalic osteodysplastic primordial dwarfism type II: a case report.

PubMed

Pachajoa, Harry; Ruiz-Botero, Felipe; Isaza, Carolina

2014-06-13

Microcephalic osteodysplastic primordial dwarfism is a syndrome characterized by the presence of intrauterine growth restriction, post-natal growth deficiency and microcephaly. Microcephalic osteodysplastic primordial dwarfism type II is the most distinctive syndrome in this group of entities. Individuals affected by this disease present at an adult height of less than 100 cm, a post-pubertal head circumference of 40 cm or less, mild mental retardation, an outgoing personality and bone dysplasia. We report the first case of a five-year-old Colombian boy of mixed race ancestry (mestizo), with clinical features of microcephaly, prominent and narrow nose, arched palate, amelogenesis imperfecta, short stature, tall and narrow pelvis, disproportionate shortening of fore-arms and legs, and mild coxa vara. Analysis of the PCNT gene by sequencing showed the presence of a nucleotide change in exon 10, c. 1468C>T, evidencing a new mutation not reported in the literature for microcephalic osteodysplastic primordial dwarfism. The new mutation identified in this case could be associated with the severity of the phenotypic expression of the disease, resulting in the extreme short stature of the patient. Further studies are required to reach an explanation that can justify such findings, and it is vital to emphasize the importance of detection and follow-up by the epidemiological surveillance groups in birth defects and rare diseases.

Lack of Association of the Polymorphisms IL-17A (−197G/A) and IL-17F (+7488A/G) with Multibacillary Leprosy in Mexican Patients

PubMed Central

Escamilla-Tilch, Mónica; Estrada-García, Iris; Granados, Julio; Arenas-Guzmán, Roberto; Ramos-Payan, Rosalio; Pérez-Suárez, Thalía Gabriela; Salazar, Ma. Isabel; Pérez-Lucas, Riky Luis; Estrada-Parra, Sergio; Torres-Carrillo, Nora Magdalena

2014-01-01

Background. Leprosy is a chronic infectious disease caused by the intracellular acid-fast bacilli Mycobacterium leprae; it has been determined that genetic factors of the host play an important role in the disease susceptibility. Thus, in this case-control study, we evaluated the possible association between the IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780) gene SNPs and susceptibility to leprosy disease in Mexican population. Methods. Seventy-five leprosy patients and sixty-nine control subjects were included. Both SNPs were genotyped with the polymerase chain reaction-restriction fragment length polymorphism technique. Results. We found nonsignificant differences in genotype and allele frequencies related to IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780) gene SNPs in MB as well as subclinical forms of leprosy disease versus healthy individuals. Conclusions. Since the sample size is not large enough, it is difficult to sustain an association of susceptibility to leprosy with genotypes or allele frequencies of IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780), suggesting that IL-17 polymorphisms have no significant role in the genetic susceptibility to development of this disease in the Mexican Mestizo population. PMID:25431761

Growth patterns in early childhood: Better trajectories in Afro-Ecuadorians independent of sex and socioeconomic factors.

PubMed

Matos, Sheila Maria Alvim; Amorim, Leila D; Campos, Ana Clara P; Barreto, Mauricio L; Rodrigues, Laura C; Morejón, Yadira A; Chico, Martha E; Cooper, Philip J

2017-08-01

The first years of life are the most dynamic period for childhood growth. There are limited data available on growth patterns of infants and children living in rural Latin America. The aim of this study was to describe the growth patterns from birth to 5years in children living in a rural District of tropical coastal Ecuador using data from a birth cohort of 2404 neonates. We hypothesize that there would be growth differences according to ethnicity and sex. Evaluations were conducted at birth or until 2weeks of age and at 7, 13, 24, 36 and 60months during clinic and home visits. Individual growth trajectories for weight-for-age, height-for-age and weight/height-for-age Z-scores were estimated using multilevel models. Girls were lighter and shorter than boys at birth. However, Afro-Ecuadorian children (versus mestizo or indigenous) were longer/taller and heavier throughout the first 5years of life and had greater mean trajectories for HAZ and WAZ independent of sex and socioeconomic factors. Our data indicate that ethnicity is a determinant of growth trajectories during the first 5years of life independent of socioeconomic factors in a birth cohort conducted in a rural region of Latin America. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Pharmacogenetic Variation in Over 100 Genes in Patients Receiving Acenocumarol

PubMed Central

Gonzalez-Covarrubias, Vanessa; Urena-Carrion, Javier; Villegas-Torres, Beatriz; Cossío-Aranda, J. Eduardo; Trevethan-Cravioto, Sergio; Izaguirre-Avila, Raul; Fiscal-López, O. Javier; Soberon, Xavier

2017-01-01

Coumarins are widely prescribed worldwide, and in Mexico acenocumarol is the preferred form. It is well known that despite its efficacy, coumarins show a high variability for dose requirements. We investigated the pharmacogenetic variation of 110 genes in patients receiving acenocumarol using a targeted NGS approach. We report relevant population differentiation for variants on CYP2C8, CYP2C19, CYP4F11, CYP4F2, PROS, and GGCX, VKORC1, CYP2C18, NQO1. A higher proportion of novel-to-known variants for 10 genes was identified on 41 core pharmacogenomics genes related to the PK (29), PD (3), of coumarins, and coagulation proteins (9) including, CYP1A1, CYP3A4, CYP3A5, and F8, and a low proportion of novel-to-known variants on CYP2E1, VKORC1, and SULT1A1/2. Using a Bayesian approach, we identified variants influencing acenocumarol dosing on, VKORC1 (2), SULT1A1 (1), and CYP2D8P (1) explaining 40–55% of dose variability. A collection of pharmacogenetic variation on 110 genes related to the PK/PD of coumarins is also presented. Our results offer an initial insight into the use of a targeted NGS approach in the pharmacogenomics of coumarins in Mexican Mestizos. PMID:29218011

Prevalence and correlates of burnout in health professionals in Ecuador.

PubMed

Ramírez, Marina R; Otero, Patricia; Blanco, Vanessa; Ontaneda, Mercy P; Díaz, Olga; Vázquez, Fernando L

2018-04-01

Although burnout is a widespread phenomenon among healthcare professionals, there are no studies about its prevalence in Ecuador. This study assesses the prevalence of burnout syndrome among Ecuadorian healthcare professionals and examine the relationship with their personal and organizational characteristics. A total of 2404 healthcare professionals (average age 40.0years; 68.4% women) from the capitals of all 24 provinces in Ecuador participated in this study. Trained psychologists assessed the presence of burnout by applying the Maslach Burnout Inventory. Sociodemographic variables, emotional distress, social support and coping styles as well as organizational variables were also collected. Of all healthcare professionals surveyed, 2.6% presented burnout syndrome. By dimensions, 17.2% of the participants presented a high level of emotional exhaustion, 13.5% of depersonalization, and 18.2% had reduced personal accomplishment. Being non-mestizo, being classified as a probable case of mental disorder and using more passive coping were associated with a greater probability of presenting burnout; having >10years of experience was associated with a lower probability of burnout. A significant number of active health professionals suffer from burnout. It is necessary to develop effective psychotherapeutic interventions for those who have the syndrome and to evaluate potential prevention strategies in those who have not yet developed it. Copyright © 2017 Elsevier Inc. All rights reserved.

Reemergence of Measles in the Americas: The Genotype B3 2011-2012 Outbreak in Ecuador.

PubMed

Le, Nicole K; Mhaskar, Rahul; Hoare, Ismael; Espinel, Mauricio; Fernanda Rivadeneira, María; Malavade, Sharad; Izurieta, Ricardo

2017-06-02

This study characterizes a measles outbreak which occurred in Ecuador in 2011-2012, analyzing data from 3700 suspected cases of measles reported to Ecuador's Ministry of Public Health. The study population had a large age range and included 333 confirmed cases of measles. The greatest number of cases were found in the <1 year (32.43%, n = 108) and 1-4 year (30.03%, n = 100) age-groups. Compared to Mestizos, indigenous people had the highest number of cases (68.2%, n = 227), as well as a higher risk of infection (OR 7.278 (CI 5.251-10.087)). The greatest protection from measles was observed in individuals who received two doses of the measles vaccine. Residents of Pastaza (OR 6.645 CI (3.183-13.873)) and Tungurahua (OR 8.346 CI (5.570-12.507)) had a higher risk of infection than the other provinces. Of the 17 laboratory confirmed cases, all were identified as genotype B3. Age-group, ethnicity, measles vaccinations, and residence in Tungurahua and Pastaza were correlated with rates of measles infection in the outbreak. Tungurahua and Pastaza, where the outbreak originated, have large indigenous populations. Indigenous children <1 year of age showed the highest incidence. It is likely that indigenous women do not have immunity to the virus, and so are unable to confer measles resistance to their newborns.

Genetic and environmental determinants of the susceptibility of Amerindian derived populations for having hypertriglyceridemia

PubMed Central

Aguilar-Salinas, Carlos A.; Tusie-Luna, Teresa; Pajukanta, Päivi

2014-01-01

Here, we discuss potential explanations for the higher prevalence of hypertriglyceridemia in populations with an Amerindian background. Although environmental factors are the triggers, the search for the ethnic related factors that explains the increased susceptibility of the Amerindians is a promising area for research. The study of the genetics of hypertriglyceridemia in Hispanic populations faces several challenges. Ethnicity could be a major confounding variable to prove genetic associations. Despite that, the study of hypertriglyceridemia in Hispanics has resulted in significant contributions. Two GWAS reports have exclusively included Mexican mestizos. Fifty percent of the associations reported in Caucasians could be generalized to the Mexicans, but in many cases the Mexican lead SNP was different than that reported in Europeans. Both reports included new associations with apo B or triglycerides concentrations. The frequency of susceptibility alleles in Mexicans is higher than that found in Europeans for several of the genes with the greatest effect on triglycerides levels. An example is the SNP rs964184 in APOA5. The same trend was observed for ANGPTL3 and TIMD4 variants. In summary, we postulate that the study of the genetic determinants of hypertriglyceridemia in Amerindian populations which have major changes in their lifestyle, may prove to be a great resource to identify new genes and pathways associated with hypertriglyceridemia. PMID:24768220

Plasma triglyceride/HDL-cholesterol ratio, insulin resistance, and cardiometabolic risk in young adults

PubMed Central

Murguía-Romero, Miguel; Jiménez-Flores, J. Rafael; Sigrist-Flores, Santiago C.; Espinoza-Camacho, Miguel A.; Jiménez-Morales, Mayra; Piña, Enrique; Méndez-Cruz, A. René; Villalobos-Molina, Rafael; Reaven, Gerald M.

2013-01-01

Studies in mature adults suggest that the plasma concentration ratio of triglyceride (TG)/HDL-cholesterol (HDL-C) provides a simple way to identify apparently healthy individuals who are insulin resistant (IR) and at increased cardiometabolic risk. This study extends these observations by examining the clinical utility of the TG/HDL-C ratio and the metabolic syndrome (MetS) in 2,244 healthy college students (17–24 years old) of Mexican Mestizo ancestry. The TG/HDL-C ratio separating the 25% with the highest value was used to identify IR and increased cardiometabolic risk. Cardiometabolic risk factors were more adverse in men and women whose TG/HDL-C ratios exceeded 3.5 and 2.5, respectively, and approximately one third were identified as being IR. The MetS identified fewer individuals as being IR, but their risk profile was accentuated. In conclusion, both a higher TG/HDL-C ratio and a diagnosis of the MetS identify young IR individuals with an increased cardiometabolic risk profile. The TG/HDL-C ratio identified a somewhat greater number of “high risk” subjects, whereas the MetS found a group whose risk profile was somewhat magnified. These findings suggest that the TG/HDL-C ratio may serve as a simple and clinically useful approach to identify apparently healthy, young individuals who are IR and at increased cardiometabolic risk. PMID:23863983

Triglyceride/high-density lipoprotein cholesterol (TG/HDL-C) index as a reference criterion of risk for metabolic syndrome (MetS) and low insulin sensitivity in apparently healthy subjects.

PubMed

Baez-Duarte, Blanca Guadalupe; Zamora-Gínez, Irma; González-Duarte, Ramiro; Torres-Rasgado, Enrique; Ruiz-Vivanco, Guadalupe; Pérez-Fuentes, Ricardo; Celis, The Multidisciplinary Research Group Of Diabetes

To evaluate if the TG/HDL-C index can be considered as a reference criterion of MetS and low insulin sensitivity in apparently healthy subjects. The subjects were Mexican mestizos who resided in Puebla City, Mexico, who were anthropometrically, biochemically, and clinically characterized. The TG/HDL-C index was calculated by dividing triglyceride (TG) levels by HDL-C levels. MetS was diagnosed by the Third Report from the Adult Treatment Panel-National Cholesterol Education Program (ATP-III NCEP) criteria, while insulin sensitivity was evaluated by the Quantitative Insulin sensitivity Check Index (QUICKI). The study included 813 subjects, with an average age of 38.6 ± 12.1 years, of which 564 were women and 249 men. An association was found between high TG/HDL-C index and low insulin sensitivity (Odds ratio [OR]: 4.09; p < 0.01) and with MetS (OR: 15.29; p < 0.01). A correlation was found between the TG/HDL-C index and QUICKI (rho: -0.4989; p < 0.01) and with MetS (rho: 0.6581; p < 0.01). The results indicate that the TG/HDL-C index is associated with low insulin sensitivity and MetS in apparently healthy subjects, suggesting this index as a reference criterion of risk for low insulin sensitivity and MetS.

A new mutation of the PCNT gene in a Colombian patient with microcephalic osteodysplastic primordial dwarfism type II: a case report

PubMed Central

2014-01-01

Introduction Microcephalic osteodysplastic primordial dwarfism is a syndrome characterized by the presence of intrauterine growth restriction, post-natal growth deficiency and microcephaly. Microcephalic osteodysplastic primordial dwarfism type II is the most distinctive syndrome in this group of entities. Individuals affected by this disease present at an adult height of less than 100cm, a post-pubertal head circumference of 40cm or less, mild mental retardation, an outgoing personality and bone dysplasia. Case presentation We report the first case of a five-year-old Colombian boy of mixed race ancestry (mestizo), with clinical features of microcephaly, prominent and narrow nose, arched palate, amelogenesis imperfecta, short stature, tall and narrow pelvis, disproportionate shortening of fore-arms and legs, and mild coxa vara. Analysis of the PCNT gene by sequencing showed the presence of a nucleotide change in exon 10, c. 1468C>T, evidencing a new mutation not reported in the literature for microcephalic osteodysplastic primordial dwarfism. Conclusion The new mutation identified in this case could be associated with the severity of the phenotypic expression of the disease, resulting in the extreme short stature of the patient. Further studies are required to reach an explanation that can justify such findings, and it is vital to emphasize the importance of detection and follow-up by the epidemiological surveillance groups in birth defects and rare diseases. PMID:24928221

Understanding the facilitators and barriers of antiretroviral adherence in Peru: A qualitative study

PubMed Central

2010-01-01

Background Antiretroviral scale-up is increasing in resource-constrained settings. To date, few studies have explored the barriers and facilitators of adherence to ART in these settings. Facilitators and barriers of antiretroviral adherence in Peru are not completely understood. Methods At two clinics that serve a large number of HIV-positive individuals in Lima, Peru, 31 in-depth interviews were carried out in 2006 with adult HIV-positive individuals receiving ART. Purposive sampling was used to recruit the participants. Interviews were transcribed and coded using two Spanish-speaking researchers and a content analysis approach to identify themes in the data. Results Among the participants, 28/31 (90%) were male, 25/31 (81%) were self-identified as mestizo, and 19/31 (61%) had an education above high school. The most frequently discussed barriers to adherence included side effects, simply forgetting, inconvenience, dietary requirements, being away from home, and fear of disclosure/stigma. The most frequently discussed facilitators to adherence included having a fixed routine, understanding the need for compliance, seeing positive results, treatment knowledge, and faith in treatment. Conclusions Overall, these findings were similar to the facilitators and challenges experienced by individuals on ART in other resource constrained settings. Further treatment support tools and networks should be developed to decrease the challenges of ART adherence for HIV-positive individuals in Lima, Peru. PMID:20070889

Análisis fotométrico-espectroscópico de un par de binarias en NGC 3532

NASA Astrophysics Data System (ADS)

Gramajo, L.; González, J. F.

Presentamos el informe de avance de un proyecto que apunta a la determinación de masas y radios de precisión en estrellas tempranas de cúmulos abiertos mediante el análisis fotométrico-espectroscópico de sistemas binarios detached con baja rotación. Con ello se pretende determinar el estado evolutivo de estas estrellas y confrontar su estructura con modelos estelares teóricos con distinto grado de ``overshooting". Los primeros objetos seleccionados son dos sistemas binarios de espectros dobles (BDA27 y BDA363) detectados en el cúmulo NGC 3532. Presentamos la órbita espectroscópica obtenida para la binaria eclipsante BDA27, para la cual obtuvimos un período de 4.29 días y una razón de masas q=0.62. Derivamos sus parámetros absolutos preliminares usando nuestra curva de velocidad y datos fotométricos existentes en la literatura, y presentamos estimas del alcance de nuestros resultados una vez que hayamos completado nuestras observaciones con nuevas curvas de luz.

Simultaneous correction of large low-order and high-order aberrations with a new deformable mirror technology

NASA Astrophysics Data System (ADS)

Rooms, F.; Camet, S.; Curis, J. F.

2010-02-01

A new technology of deformable mirror will be presented. Based on magnetic actuators, these deformable mirrors feature record strokes (more than +/- 45μm of astigmatism and focus correction) with an optimized temporal behavior. Furthermore, the development has been made in order to have a large density of actuators within a small clear aperture (typically 52 actuators within a diameter of 9.0mm). We will present the key benefits of this technology for vision science: simultaneous correction of low and high order aberrations, AO-SLO image without artifacts due to the membrane vibration, optimized control, etc. Using recent papers published by Doble, Thibos and Miller, we show the performances that can be achieved by various configurations using statistical approach. The typical distribution of wavefront aberrations (both the low order aberration (LOA) and high order aberration (HOA)) have been computed and the correction applied by the mirror. We compare two configurations of deformable mirrors (52 and 97 actuators) and highlight the influence of the number of actuators on the fitting error, the photon noise error and the effective bandwidth of correction.

Short communication: Characterization of methicillin-resistant Staphylococcus aureus isolated from raw milk fresh cheese in Colombia.

PubMed

Herrera, Fanny C; García-López, María-Luisa; Santos, Jesús A

2016-10-01

The aim of this study was the characterization of a collection of 8 methicillin-resistant Staphylococcus aureus (MRSA) isolates, obtained from samples of fresh cheese (Doble Crema) produced from raw cow milk in small dairies in Colombia. All the isolates harbored the mecA and Panton-Valentine leukocidin (PVL) genes, presented with SCCmec type IV, and belonged to multilocus sequence type 8 and spa type 024. Seven isolates presented 3 closely related pulsed-field gel electrophoresis profiles. Three of them carried the staphylococcal enterotoxin B gene. The isolates were resistant to cefoxitin, oxacillin, penicillin, and ampicillin and susceptible to all non-β-lactams antibiotics tested, with minimum inhibitory concentration values for oxacillin of 4 to 8mg/L. The isolates belonged to the community-acquired MRSA group, suggesting a human source of contamination. The risk of human infection by MRSA via contaminated foods is considered low, but contaminated food commodities can contribute to the worldwide dissemination of clones of community-acquired MRSA. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

"Una mujer trabaja doble aqui": Vignette-based focus groups on stress and work for Latina blue-collar women in eastern North Carolina.

PubMed

Easter, Michele M; Linnan, Laura A; Bentley, Margaret E; DeVellis, Brenda M; Meier, Andrea; Frasier, Pamela Y; Kelsey, Kristine S; Campbell, Marci K

2007-01-01

Latina women are a growing percentage of the working population, and very little is known about their health needs and interests. The purpose of this article is to share qualitative research results gathered from Latina women with a particular focus on exploring stress and health. This project was a substudy of Health Works in the Community, a 5-year CDC-funded multiple risk-factor reduction trial using participatory action research approaches to address smoking, healthy eating, stress, and physical activity among blue-collar women from 12 manufacturing work sites in rural, eastern North Carolina. Five focus groups were conducted with trained, bilingual facilitators using a vignette-based moderator guide that appeared particularly effective with this population. Results from the focus groups are used to make recommendations for future research with Latinas and for developing effective work-site-based interventions to address issues of stress and health within this population.

Spotlight: Costa Rica.

PubMed

1998-03-01

3.5 million people lived in Costa Rica as of mid-1997. There were 24 births and 4 deaths per 1000 population, respectively, contributing to the annual natural increase rate of 2.0%. Each woman in Costa Rica bears an average of 2.8 children during her reproductive lifespan and men and women were expected to live for 73 and 78 years, respectively. Costa Rica's low infant mortality rate and high literacy and life expectancy rates set it apart from the rest of Central America. Costa Rica is also the only country in the region which maintains no standing army. About 96% of the population is White or Mestizo, 3% is Black, and 1% is indigenous Indian. More than half of the country lives in San Jose and its metropolitan area, 6% of the country's total land area. Unemployment has run near 5% over the past 2 years, but much of the labor force is underemployed. Costa Rica's economy depends upon tourism and agricultural exports such as coffee, beef, and bananas. A large Intel factory opened in 1997. The government and Costa Rican environmentalists are planning a joint campaign to reconvert 80% of Costa Rica's pasture back to forest and tree crops. About 20% of the government's budget is spent upon education and the 93% literacy rate is the highest in the region. Government health services provide low-cost contraceptives to more than 75% of users and 75% of women use some form of family planning.

Distribution of genetic variants of oxidative stress metabolism genes: Paraoxonase 1 (PON1) and Glutathione S-transferase (GSTM1/GSTT1) in a population from Southeastern Mexico.

PubMed

García-González, I; Mendoza-Alcocer, R; Pérez-Mendoza, G J; Rubí-Castellanos, R; González-Herrera, L

2016-11-01

Paraoxonase 1 (PON1) and glutathione S-transferases (GSTs) are involved in the biotransformation of xenobiotics. Variation in the enzyme concentration and activity suggests individual differences for the degree of protection against oxidative stress. This study analysed the distribution of SNPs Q192R, L55M (PON1) and variants in GSTM1 and GSTT1 genes in a population from Southeastern Mexico. One hundred and fifty-one Mexican Mestizo healthy volunteers were included. PON1 polymorphisms were determined by Taqman allele discrimination real time-PCR, whereas GSTM1 and GSTT1 genes were determined with a multiplex PCR-based method. All genotypes were in Hardy-Weinberg equilibrium, except for GSTM1. The genotypic distributions of Q192R and L55M were 22% QQ, 48% QR, 30% RR, 62% LL, 34% LM and 4% MM, respectively, whereas the allele frequencies were 0.46 (Q), 0.54 (R), 0.79 (L) and 0.21 (M). The most frequent haplotype was R/L (46.7%). It was found that 31% and 9% of the individuals had the GSTM1 and GSTT1 null genotype, respectively. The frequency of the combined null genotype GSTM1*0/GSTT1*0 was 4.64%. The results showed that the frequencies of polymorphisms of PON1, GSTM1 and GSTT1 in the Yucatán population differ to those observed in other ethnic groups and provide useful data for epidemiological studies.

Reemergence of Measles in the Americas: The Genotype B3 2011–2012 Outbreak in Ecuador

PubMed Central

Le, Nicole K.; Mhaskar, Rahul; Hoare, Ismael; Espinel, Mauricio; Fernanda Rivadeneira, María; Malavade, Sharad; Izurieta, Ricardo

2017-01-01

This study characterizes a measles outbreak which occurred in Ecuador in 2011–2012, analyzing data from 3700 suspected cases of measles reported to Ecuador’s Ministry of Public Health. The study population had a large age range and included 333 confirmed cases of measles. The greatest number of cases were found in the <1 year (32.43%, n = 108) and 1–4 year (30.03%, n = 100) age-groups. Compared to Mestizos, indigenous people had the highest number of cases (68.2%, n = 227), as well as a higher risk of infection (OR 7.278 (CI 5.251–10.087)). The greatest protection from measles was observed in individuals who received two doses of the measles vaccine. Residents of Pastaza (OR 6.645 CI (3.183–13.873)) and Tungurahua (OR 8.346 CI (5.570–12.507)) had a higher risk of infection than the other provinces. Of the 17 laboratory confirmed cases, all were identified as genotype B3. Age-group, ethnicity, measles vaccinations, and residence in Tungurahua and Pastaza were correlated with rates of measles infection in the outbreak. Tungurahua and Pastaza, where the outbreak originated, have large indigenous populations. Indigenous children <1 year of age showed the highest incidence. It is likely that indigenous women do not have immunity to the virus, and so are unable to confer measles resistance to their newborns. PMID:28574449

Association of Nuclear Factor-Erythroid 2-Related Factor 2, Thioredoxin Interacting Protein, and Heme Oxygenase-1 Gene Polymorphisms with Diabetes and Obesity in Mexican Patients.

PubMed

Jiménez-Osorio, Angélica Saraí; González-Reyes, Susana; García-Niño, Wylly Ramsés; Moreno-Macías, Hortensia; Rodríguez-Arellano, Martha Eunice; Vargas-Alarcón, Gilberto; Zúñiga, Joaquín; Barquera, Rodrigo; Pedraza-Chaverri, José

2016-01-01

The nuclear factor-erythroid 2- (NF-E2-) related factor 2 (Nrf2) is abated and its ability to reduce oxidative stress is impaired in type 2 diabetes and obesity. Thus, the aim of this study was to explore if polymorphisms in Nrf2 and target genes are associated with diabetes and obesity in Mexican mestizo subjects. The rs1800566 of quinone oxidoreductase 1 (NQO1) gene, rs7211 of thioredoxin interacting protein (TXNIP) gene, rs2071749 of heme oxygenase-1 (HMOX1) gene, and the rs6721961 and the rs2364723 from Nrf2 gene were genotyped in 627 diabetic subjects and 1020 controls. The results showed that the rs7211 polymorphism is a protective factor against obesity in nondiabetic subjects (CC + CT versus TT, OR = 0.40, P = 0.005) and in women (CC versus CT + TT, OR = 0.7, P = 0.016). TT carriers had lower high-density lipoprotein cholesterol levels and lower body mass index. The rs2071749 was positively associated with obesity (AA versus AG + GG, OR = 1.25, P = 0.026). Finally, the rs6721961 was negatively associated with diabetes in men (CC versus CA + AA, OR = 0.62, P = 0.003). AA carriers showed lower glucose concentrations. No association was found for rs1800566 and rs2364723 polymorphisms. In conclusion, the presence of Nrf2 and related genes polymorphisms are associated with diabetes and obesity in Mexican patients.

HLA-A, HLA-B, and HLA-DRB1 Allele and Haplotype Frequencies in Renal Transplant Candidates in a Population in Southern Brazil.

PubMed

Saito, Patrícia Keiko; Yamakawa, Roger Haruki; Noguti, Erika Noda; Bedendo, Gustavo Borelli; Júnior, Waldir Veríssimo da Silva; Yamada, Sérgio Seiji; Borelli, Sueli Donizete

2016-05-01

Very few studies have examined the diversity of human leukocyte antigens (HLA) in the Brazilian renal transplant candidates. The frequencies of the HLA-A, HLA-B, and HLA-DRB1 alleles, haplotypes and phenotypes were studied in 522 patients with chronic renal failure, renal transplant candidates, registered at the Transplant Centers in north/northwestern Paraná State, southern Brazil. Patients were classified according to the ethnic group (319 whites [Caucasians], 134 mestizos [mixed race descendants of Europeans, Africans, and Amerindians; browns or "pardos"] and 69 blacks). The HLA typing was performed by the polymerase chain reaction sequence-specific oligonucleotide method (PCR-SSO), combined with Luminex technology. In the analysis of the total samples, 20 HLA-A, 32 HLA-B, and 13 HLA-DRB1 allele groups were identified. The most frequent allele groups for each HLA locus were HLA-A*02 (25.4%), HLA-B*44 (10.9%), and HLA-DRB1*13 (13.9%). The most frequent haplotypes were HLA-A*01-B*08-DRB1*03 (2.3%), A*02-B*44-DRB1*07 (1.2%), and A*03-B*07-DRB1*11 (1.0%). Significant differences (P < 0.05) were observed in the HLA-A*68, B*08, and B*58 allele frequencies among ethnic groups. This study provides the first data on the HLA-A, HLA-B, and HLA-DRB1 allele, phenotype and haplotype frequencies of renal transplant candidates in a population in southern Brazil. © 2015 Wiley Periodicals, Inc.

[Reference values for the blood coagulation tests in Mexico: usefulness of the pooled plasma from blood donors].

PubMed

Calzada-Contreras, Adriana; Moreno-Hernández, Manuel; Castillo-Torres, Noemi Patricia; Souto-Rosillo, Guadalupe; Hernández-Juárez, Jesús; Ricardo-Moreno, María Tania; Sánchez-Fernández, Maria Guadalupe de Jesús; García-González, América; Majluf-Cruz, Abraham

2012-01-01

The blood coagulation system maintains the blood in a liquid state and bleeding and thrombosis are the manifestations of its malfunction. Blood coagulation laboratory evaluates the physiology of this system. To establish both, the reference values for several tests performed at the blood coagulation laboratory as well as the utility of the pooled plasma to perform these assays. MATERIAL AND: In this descriptive, cross-sectional, randomized study, we collected plasma from Mexican Mestizos. Each pooled plasma was prepared with the plasma from at least 20 blood donors. We performed screening and special tests and the Levey-Jennings graphs were built and interpreted after each pass. Results of the tests were analyzed and their distribution was established using the Kolmogorov-Smirnov test. To establish the reference values we used 95% confidence intervals. We collected 72 pooled plasmas. The distribution for PT, APTT, and TT tests was abnormal. Although the PT test showed a bimodal distribution it was normal for factor VII. The reference values for the hemostatic, anticoagulant, and fibrinolytic factors were different from those suggested by the manufacturers. We established the reference values for the blood coagulation tests in the adult Mexican population. We have shown that the pooled plasma must be used for the screening tests. We suggest that each clinical laboratory should establish its own reference values (at least for the screening tests). To reach this objective, we encourage the use of the pooled plasma.

The mutation profile of JAK2, MPL and CALR in Mexican patients with Philadelphia chromosome-negative myeloproliferative neoplasms.

PubMed

Labastida-Mercado, Nancy; Galindo-Becerra, Samantha; Garcés-Eisele, Javier; Colunga-Pedraza, Perla; Guzman-Olvera, Valeria; Reyes-Nuñez, Virginia; Ruiz-Delgado, Guillermo J; Ruiz-Argüelles, Guillermo J

2015-03-01

By using molecular markers, it is possible to gain information on both the classification and etiopathogenesis of chronic myeloproliferative neoplasias (MPN). In a group of 27 Mexican mestizo patients with MPNs, we studied seven molecular markers: the BCR/ABL1 fusion gene, the JAK2 V617F mutation, the JAK2 exon 12 mutations, the MPL W515L mutation, the MPL W515K mutation, and the calreticulin (CALR) exon 9 deletion or insertion. Patients with the BCR/ABL1 fusion gene were excluded. We studied 14 patients with essential thrombocythemia (ET), eight with polycythemia vera (PV), four with primary myelofibrosis (MF), and one with undifferentiated MPN. We found twelve individuals with the JAK2 V617F mutation; five of them had been clinically classified as PV, five as ET, and one as MF. One patient with the MPL W515L was identified with a clinical picture of ET. Five patients with the CALR mutation were identified, four ET and one MF. No individuals with either the MPL W515K mutation or the JAK2 exon 12 mutations were identified. The most consistent relationship was that between PV and the JAK2 V617F mutation (p=.01). Despite its small size, the study shows much less prevalence of JAK2 mutation in PV, ET and MF, which does not match international data. Copyright © 2015 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

Nonlinear Analysis of Time Series in Genome-Wide Linkage Disequilibrium Data

NASA Astrophysics Data System (ADS)

Hernández-Lemus, Enrique; Estrada-Gil, Jesús K.; Silva-Zolezzi, Irma; Fernández-López, J. Carlos; Hidalgo-Miranda, Alfredo; Jiménez-Sánchez, Gerardo

2008-02-01

The statistical study of large scale genomic data has turned out to be a very important tool in population genetics. Quantitative methods are essential to understand and implement association studies in the biomedical and health sciences. Nevertheless, the characterization of recently admixed populations has been an elusive problem due to the presence of a number of complex phenomena. For example, linkage disequilibrium structures are thought to be more complex than their non-recently admixed population counterparts, presenting the so-called ancestry blocks, admixed regions that are not yet smoothed by the effect of genetic recombination. In order to distinguish characteristic features for various populations we have implemented several methods, some of them borrowed or adapted from the analysis of nonlinear time series in statistical physics and quantitative physiology. We calculate the main fractal dimensions (Kolmogorov's capacity, information dimension and correlation dimension, usually named, D0, D1 and D2). We also have made detrended fluctuation analysis and information based similarity index calculations for the probability distribution of correlations of linkage disequilibrium coefficient of six recently admixed (mestizo) populations within the Mexican Genome Diversity Project [1] and for the non-recently admixed populations in the International HapMap Project [2]. Nonlinear correlations showed up as a consequence of internal structure within the haplotype distributions. The analysis of these correlations as well as the scope and limitations of these procedures within the biomedical sciences are discussed.

Variation in hemoglobin concentration among samples of high-altitude natives in the Andes and the Himalayas.

PubMed

Beall, Cynthia M; Brittenham, Gary M; Macuaga, Francisco; Barragan, Mario

1990-01-01

This paper presents data on hemoglobin concentration in a rural Andean sample at 3,800-3,900 m and incorporates them into a review intended to evaluate possible sources of the range of variation in mean hemoglobin concentration among samples obtained at high altitude. Between 3,400 and 4,000 m, rural Himalayan highlanders average 1.4 gm/dl lower mean hemoglobin concentration than rural Andean highlanders. With respect to potential causes of anemia, it is concluded that the relatively low values of rural Himalyan populations are not explicable by lower hypoxic stress or different techniques of obtaining and analyzing blood samples and are probably not explicable by nutritional deficiency and disease. With respect to potential causes of polycythemia within Andean populations, it is concluded that the somewhat higher values of some mining and urban samples of Andean higlanders may not be due to the mining occupation per se but may be due partly to the inclusion of European and mestizo (with at most 500 years of high-altitude ancestry) along with Amerindian highlanders (with millenia of high-altitude ancestry) as well as to the inclusion of highlanders living well above their own habitual altitudes of residence. The Andean polycythemia is probably not due to obesity, high androgen levels, or frequent intermittent hypoxemia during sleep. The effect of heavy smoking cannot be evaluated. Further work on hematological adaptation to high altitude must pay special attention to sample characteristics. Copyright © 1990 Wiley-Liss, Inc., A Wiley Company.

Can data science inform environmental justice and community risk screening for type 2 diabetes?

PubMed

Davis, J Allen; Burgoon, Lyle D

2015-01-01

Having the ability to scan the entire country for potential "hotspots" with increased risk of developing chronic diseases due to various environmental, demographic, and genetic susceptibility factors may inform risk management decisions and enable better environmental public health policies. Develop an approach for community-level risk screening focused on identifying potential genetic susceptibility hotpots. Our approach combines analyses of phenotype-genotype data, genetic prevalence of single nucleotide polymorphisms, and census/geographic information to estimate census tract-level population attributable risks among various ethnicities and total population for the state of California. We estimate that the rs13266634 single nucleotide polymorphism, a type 2 diabetes susceptibility genotype, has a genetic prevalence of 56.3%, 47.4% and 37.0% in Mexican Mestizo, Caucasian, and Asian populations. Looking at the top quintile for total population attributable risk, 16 California counties have greater than 25% of their population living in hotspots of genetic susceptibility for developing type 2 diabetes due to this single genotypic susceptibility factor. This study identified counties in California where large portions of the population may bear additional type 2 diabetes risk due to increased genetic prevalence of a susceptibility genotype. This type of screening can easily be extended to include information on environmental contaminants of interest and other related diseases, and potentially enables the rapid identification of potential environmental justice communities. Other potential uses of this approach include problem formulation in support of risk assessments, land use planning, and prioritization of site cleanup and remediation actions.

Prevalence of metabolic syndrome, obesity and diabetes type 2 in cryptogenic cirrhosis.

PubMed

Tellez-Avila, Felix I; Sanchez-Avila, Francisco; García-Saenz-de-Sicilia, Mauricio; Chavez-Tapia, Norberto C; Franco-Guzman, Ada M; Lopez-Arce, Gustavo; Cerda-Contreras, Eduardo; Uribe, Misael

2008-08-14

To evaluate the prevalence of metabolic syndrome (MS), obesity and type 2 diabetes mellitus (T2DM) in a group of Mexican Mestizo patients with cryptogenic cirrhosis (CC) and to compare this group with patients with cirrhosis secondary to other causes (disease controls). Patients with CC, diagnosed between January, 1990 and April, 2005, were included in a retrospective study. Patients with cirrhosis caused by chronic hepatitis C, alcohol abuse or autoimmune hepatitis (AIH) served as disease controls. A total of 134 patients with CC were analyzed. Disease controls consisted of 81 patients with chronic hepatitis C, 33 with alcohol abuse and 20 with AIH. The median age of patients with CC was 57 years (range, 16-87); 83 (61.9%) patients were female; 53 (39.6%) were Child A, 65 (48.5%) Child B, and 16 (11.9%) were Child C cirrhosis. The prevalence of MS (29.1% vs 6%; P<0.001), obesity (16.4% vs 8.2%; P=0.04) and T2DM (40% vs 22.4%; P=0.013) was higher in CC patients than in disease controls. There were no differences in sex, age or liver function tests between the two groups. The prevalence of MS, obesity and T2DM were higher in patients with CC than in patients with cirrhosis secondary to others causes. Our findings support the hypothesis that non-alcoholic steatohepatitis (NASH) plays an under-recognized role in CC.

[C677T-SNP of methylenetetrahydrofolate reductase gene and breast cancer in Mexican women].

PubMed

Calderón-Garcidueñas, Ana Laura; Cerda-Flores, Ricardo Martín; Castruita-Ávila, Ana Lilia; González-Guerrero, Juan Francisco; Barrera-Saldaña, Hugo Alberto

2017-01-01

Low-penetrance susceptibility genes such as 5,10-methylenetetrahydrofolate reductase gene (MTHFR) have been considered in the progression of breast cancer (BC). Cancer is a result of genetic, environmental and epigenetic interactions; therefore, these genes should be studied in environmental context, because the results can vary between populations and even within the same country. The objective was to analyze the allelic and genotypic frequencies of the MTHFR C667T SNP in Mexican Mestizo patients with BC and controls from Northeastern Mexico. 243 patients and 118 healthy women were studied. The analysis of the polymorphism was performed with a DNA microarray. Once the frequency of the polymorphism was obtained, Hardy-Weinberg equilibrium test was carried out for the genotypes. Chi square test was used to compare the distribution of frequencies. The allele frequency in patients was: C = 0.5406; T = 0.4594 and in controls C = 0.5678, T = 0.4322. Genotype in BC patients was: C / C = 29.9%, C / T = 48.3% and T / T = 21.8. The distribution in controls was: C / C = 31.4%, C / T = 50.8%, T / T = 17.8% (chi squared 0.77, p = 0.6801). Northeastern Mexican women in this study showed no association between MTFHR C667T SNP and the risk of BC. It seems that the contribution of this polymorphism to BC in Mexico varies depending on various factors, both genetic and environmental.

Analysis of PTPN22, ZFAT and MYO9B polymorphisms in Turner Syndrome and risk of autoimmune disease.

PubMed

Villanueva-Ortega, E; Ahedo, B; Fonseca-Sánchez, M A; Pérez-Durán, J; Garibay-Nieto, N; Macías-Galavíz, M T; Trujillo-Cabrera, Y; García-Latorre, E; Queipo, G

2017-08-01

Turner syndrome (TS) is one of the most common sexual chromosome abnormalities and is clearly associated with an increased risk of autoimmune diseases, particularly thyroid disease and coeliac disease (CD). Single-nucleotide polymorphism analyses have been shown to provide correlative evidence that specific genes are associated with autoimmune disease. Our aim was to study the functional polymorphic variants of PTPN22 and ZFAT in relation to thyroid disease and those of MYO9B in relation to CD. A cross-sectional comparative analysis was performed on Mexican mestizo patients with TS and age-matched healthy females. Our data showed that PTPN22 C1858T (considered a risk variant) is not associated with TS (X 2  = 3.50, p = .61, and OR = 0.33 [95% CI = 0.10-1.10]). Also, ZFAT was not associated with TS (X 2  = 1.2, p = .28, and OR = 1.22 [95% CI = 0.84-1.79]). However, for the first time, rs2305767 MYO9B was revealed to have a strong association with TS (X 2  = 58.6, p = .0001, and OR = 10.44 [95% C = 5.51-19.80]), supporting a high level of predisposition to CD among TS patients. This report addresses additional data regarding the polymorphic variants associated with autoimmune disease, one of the most common complications in TS. © 2017 John Wiley & Sons Ltd.

Ethnic and demographic incidence of amyotrophic lateral sclerosis (ALS) in Brazil: A population based study.

PubMed

Moura, Mirian Conceicao; Casulari, Luiz Augusto; Carvalho Garbi Novaes, Maria Rita

2016-01-01

Our objectives were to examine demographic and ethnic factors associated with amyotrophic lateral sclerosis in Brazil. The method used was a retrospective study of death certificates performed in June 2015, identifying the incidence of amyotrophic lateral sclerosis over 10 years, from January 2004 to December 2013, related to gender, age and race. Results revealed 8942 death certificates with 8152 as the underlying cause and 790 as a secondary cause. The average age was 62.7 ± 13.2 years, with a predominance of males (1·3:1). The adjusted mortality rate over 20 years was 0.61 to 0.89/100,000 person-years, and over 45 years was 1.77 to 2.3/100,000 person-years. There was a predominance of amyotrophic lateral sclerosis in Caucasians compared to the general population above 20 years (2010 Census), with an odds ratio (OR) of 2.92 (95% CI 2.78-3.07). The OR in blacks was 0.04 (95% CI: 0.03-0.04), in mestizos was 0.05 (0.04-0.07), and in Indians was 0.02 (0.01-0.04). The mean age was lower than in European populations (48.5 ± 12.3 years) (p < 0.0001). In conclusion, the incidence of amyotrophic lateral sclerosis in Brazil is close to other Latin American populations, with a lower age at death and clear predominance in Caucasians.

Hypocholesterolemia is an independent risk factor for depression disorder and suicide attempt in Northern Mexican population.

PubMed

Segoviano-Mendoza, Marcela; Cárdenas-de la Cruz, Manuel; Salas-Pacheco, José; Vázquez-Alaniz, Fernando; La Llave-León, Osmel; Castellanos-Juárez, Francisco; Méndez-Hernández, Jazmín; Barraza-Salas, Marcelo; Miranda-Morales, Ernesto; Arias-Carrión, Oscar; Méndez-Hernández, Edna

2018-01-15

Cholesterol has been associated as a risk factor for cardiovascular disease. Recently, however, there is growing evidence about crucial requirement of neuron membrane cholesterol in the organization and function of the 5-HT 1A serotonin receptor. For this, low cholesterol level has been reported to be associated with depression and suicidality. However there have been inconsistent reports about this finding and the exact relationship between these factors remains controversial. Therefore, we investigated the link between serum cholesterol and its fractions with depression disorder and suicide attempt in 467 adult subjects in Mexican mestizo population. Plasma levels of total cholesterol, triglycerides, and high-density lipoprotein cholesterol (HDL-c) and low density lipoprotein cholesterol (LDL-c) were determined in 261 MDD patients meeting the DSM-5 criteria for major depressive disorder (MDD), 59 of whom had undergone an episode of suicide attempt, and 206 healthy controls. A significant decrease in total cholesterol, LDL-cholesterol, VLDL-cholesterol and triglyceride serum levels was observed in the groups of MDD patients and suicide attempt compared to those without suicidal behavior (p < 0.05). After adjusting for covariates, lower cholesterol levels were significantly associated with MDD (OR 4.229 CI 95% 2.555 - 7.000, p<.001) and suicide attempt (OR 5.540 CI 95% 2.825 - 10.866, p<.001) CONCLUSIONS: These results support the hypothesis that lower levels of cholesterol are associated with mood disorders like MDD and suicidal behavior. More mechanistic studies are needed to further explain this association.

Bedrock and surficial geologic map of the Satan Butte and Greasewood 7.5’ quadrangles, Navajo and Apache Counties, northern Arizona

USGS Publications Warehouse

Amoroso, Lee; Priest, Susan S.; Hiza-Redsteer, Margaret

2013-01-01

The geologic map of the Satan Butte and Greasewood 7.5’ quadrangles is the result of a cooperative effort of the U.S. Geological Survey (USGS) and the Navajo Nation to provide regional geologic information for management and planning officials. This map provides geologic information useful for range management, plant and animal studies, flood control, water resource investigations, and natural hazards associated with sand-dune mobility. The map provides connectivity to the regional geologic framework of the Grand Canyon area of northern Arizona. The map area encompasses approximately 314 km2 (123 mi2) within Navajo and Apache Counties of northern Arizona and is bounded by lat 35°37'30" to 35°30' N., long 109°45' to 110° W. The quadrangles lie within the southern Colorado Plateau geologic province and within the northeastern portion of the Hopi Buttes (Tsézhin Bií). Large ephemeral drainages, Pueblo Colorado Wash and Steamboat Wash, originate north of the map area on the Defiance Plateau and Balakai Mesa respectively. Elevations range from 1,930 m (6,330 ft) at the top of Satan Butte to about 1,787 m (5,860 ft) at Pueblo Colorado Wash where it exits the southwest corner of the Greasewood quadrangle. The only settlement within the map area is Greasewood, Arizona, on the north side of Pueblo Colorado Wash. Navajo Highway 15 crosses both quadrangles and joins State Highway 264 northwest of Ganado. Unimproved dirt roads provide access to remote parts of the Navajo Reservation.

Central Nervous System Idiopathic Inflammatory Demyelinating Disorders in South Americans: A Descriptive, Multicenter, Cross-Sectional Study.

PubMed

Papais-Alvarenga, Regina Maria; Vasconcelos, Claudia Cristina Ferreira; Carra, Adriana; de Castillo, Ibis Soto; Florentin, Sara; Diaz de Bedoya, Fernando Hamuy; Mandler, Raul; de Siervi, Luiza Campanella; Pimentel, Maria Lúcia Vellutini; Alvarenga, Marina Papais; Alvarenga, Marcos Papais; Grzesiuk, Anderson Kuntz; Gama Pereira, Ana Beatriz Calmon; Gomes Neto, Antonio Pereira; Velasquez, Carolina; Soublette, Carlos; Fleitas, Cynthia Veronica; Diniz, Denise Sisteroli; Armas, Elizabeth; Batista, Elizabeth; Hernandez, Freda; Pereira, Fernanda Ferreira Chaves da Costa; Siqueira, Heloise Helena; Cabeça, Hideraldo; Sanchez, Jose; Brooks, Joseph Bruno Bidin; Gonçalves, Marcus Vinicius; Barroso, Maria Cristina Del Negro; Ravelo, Maria Elena; Castillo, Maria Carlota; Ferreira, Maria Lúcia Brito; Rocha, Maria Sheila Guimarães; Parolin, Monica Koncke Fiuza; Molina, Omaira; Marinho, Patricia Beatriz Christino; Christo, Paulo Pereira; Brant de Souza, Renata; Pessanha Neto, Silvio; Camargo, Solange Maria das Graças; Machado, Suzana Costa; Neri, Vanderson Carvalho; Fragoso, Yara Dadalti; Alvarenga, Helcio; Thuler, Luiz Claudio Santos

2015-01-01

The idiopathic inflammatory demyelinating disease (IIDD) spectrum has been investigated among different populations, and the results have indicated a low relative frequency of neuromyelitis optica (NMO) among multiple sclerosis (MS) cases in whites (1.2%-1.5%), increasing in Mestizos (8%) and Africans (15.4%-27.5%) living in areas of low MS prevalence. South America (SA) was colonized by Europeans from the Iberian Peninsula, and their miscegenation with natives and Africans slaves resulted in significant racial mixing. The current study analyzed the IIDD spectrum in SA after accounting for the ethnic heterogeneity of its population. A cross-sectional multicenter study was performed. Only individuals followed in 2011 with a confirmed diagnosis of IIDD using new diagnostic criteria were considered eligible. Patients' demographic, clinical and laboratory data were collected. In all, 1,917 individuals from 22 MS centers were included (73.7% female, 63.0% white, 28.0% African, 7.0% Mestizo, and 0.2% Asian). The main disease categories and their associated frequencies were MS (76.9%), NMO (11.8%), other NMO syndromes (6.5%), CIS (3.5%), ADEM (1.0%), and acute encephalopathy (0.4%). Females predominated in all main categories. The white ethnicity also predominated, except in NMO. Except in ADEM, the disease onset occurred between 20 and 39 years old, early onset in 8.2% of all cases, and late onset occurred in 8.9%. The long-term morbidity after a mean disease time of 9.28±7.7 years was characterized by mild disability in all categories except in NMO, which was scored as moderate. Disease time among those with MS was positively correlated with the expanded disability status scale (EDSS) score (r=0.374; p=<0.001). This correlation was not observed in people with NMO or those with other NMO spectrum disorders (NMOSDs). Among patients with NMO, 83.2% showed a relapsing-remitting course, and 16.8% showed a monophasic course. The NMO-IgG antibody tested using indirect

Central Nervous System Idiopathic Inflammatory Demyelinating Disorders in South Americans: A Descriptive, Multicenter, Cross-Sectional Study

PubMed Central

Papais-Alvarenga, Regina Maria; Vasconcelos, Claudia Cristina Ferreira; Carra, Adriana; de Castillo, Ibis Soto; Florentin, Sara; Diaz de Bedoya, Fernando Hamuy; Mandler, Raul; de Siervi, Luiza Campanella; Pimentel, Maria Lúcia Vellutini; Alvarenga, Marina Papais; Papais Alvarenga, Marcos; Grzesiuk, Anderson Kuntz; Gama Pereira, Ana Beatriz Calmon; Gomes Neto, Antonio Pereira; Velasquez, Carolina; Soublette, Carlos; Fleitas, Cynthia Veronica; Diniz, Denise Sisteroli; Armas, Elizabeth; Batista, Elizabeth; Hernandez, Freda; Pereira, Fernanda Ferreira Chaves da Costa; Siqueira, Heloise Helena; Cabeça, Hideraldo; Sanchez, Jose; Brooks, Joseph Bruno Bidin; Gonçalves, Marcus Vinicius; Barroso, Maria Cristina Del Negro; Ravelo, Maria Elena; Castillo, Maria Carlota; Ferreira, Maria Lúcia Brito; Rocha, Maria Sheila Guimarães; Parolin, Monica Koncke Fiuza; Molina, Omaira; Marinho, Patricia Beatriz Christino; Christo, Paulo Pereira; Brant de Souza, Renata; Pessanha Neto, Silvio; Camargo, Solange Maria das Graças; Machado, Suzana Costa; Neri, Vanderson Carvalho; Fragoso, Yara Dadalti; Alvarenga, Helcio; Thuler, Luiz Claudio Santos

2015-01-01

The idiopathic inflammatory demyelinating disease (IIDD) spectrum has been investigated among different populations, and the results have indicated a low relative frequency of neuromyelitis optica (NMO) among multiple sclerosis (MS) cases in whites (1.2%-1.5%), increasing in Mestizos (8%) and Africans (15.4%-27.5%) living in areas of low MS prevalence. South America (SA) was colonized by Europeans from the Iberian Peninsula, and their miscegenation with natives and Africans slaves resulted in significant racial mixing. The current study analyzed the IIDD spectrum in SA after accounting for the ethnic heterogeneity of its population. A cross-sectional multicenter study was performed. Only individuals followed in 2011 with a confirmed diagnosis of IIDD using new diagnostic criteria were considered eligible. Patients’ demographic, clinical and laboratory data were collected. In all, 1,917 individuals from 22 MS centers were included (73.7% female, 63.0% white, 28.0% African, 7.0% Mestizo, and 0.2% Asian). The main disease categories and their associated frequencies were MS (76.9%), NMO (11.8%), other NMO syndromes (6.5%), CIS (3.5%), ADEM (1.0%), and acute encephalopathy (0.4%). Females predominated in all main categories. The white ethnicity also predominated, except in NMO. Except in ADEM, the disease onset occurred between 20 and 39 years old, early onset in 8.2% of all cases, and late onset occurred in 8.9%. The long-term morbidity after a mean disease time of 9.28±7.7 years was characterized by mild disability in all categories except in NMO, which was scored as moderate. Disease time among those with MS was positively correlated with the expanded disability status scale (EDSS) score (r=0.374; p=<0.001). This correlation was not observed in people with NMO or those with other NMO spectrum disorders (NMOSDs). Among patients with NMO, 83.2% showed a relapsing-remitting course, and 16.8% showed a monophasic course. The NMO-IgG antibody tested using indirect

Molecular epidemiology of cryptosporidiosis in cattle and other food animals [Spanish][Epidemiología molecular de cryptosporidiosis en el ganado vacuno y en otros animales de abasto

USDA-ARS?s Scientific Manuscript database

Molecular epidemiology of cryptosporidiosis in cattle and other food animals Cryptosporidium is an enteric protozoan parasite that infects a wide range of vertebrate hosts. Cryptosporidial infection is known now as one of the most common causes of diarrhea in humans and livestock. Worldwide prevale...

Population data of 24 STRs in Mexican-Mestizo population from Monterrey, Nuevo Leon (Northeast, Mexico) based on Powerplex(®) Fusion and GlobalFiler(®) kits.

PubMed

Ramos-González, Benito; Aguilar-Velázquez, José Alonso; Chávez-Briones, María de Lourdes; Delgado-Chavarría, Juan Ramón; Alfaro-Lopez, Elizabeth; Rangel-Villalobos, Héctor

2016-03-01

The STR loci included into new commercial human identification kits compels geneticists estimating forensic parameters for interpretation purposes in forensic casework. Therefore, we studied for the first time in Mexico the GlobalFiler(®) and Powerplex(®) Fusion systems in 326 and 682 unrelated individuals, respectively. These individuals are resident of the Monterrey City of the Nuevo Leon state (Northeast, Mexico). Population data from 23 autosomal STRs and the Y-STR locus DYS391 are reported and compared against available STR data from American ethnic groups and the unique Mexican population studied with Powerplex(®) Fusion. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Vitamin D (25(OH)D) in patients with chronic kidney disease stages 2-5.

PubMed

Restrepo Valencia, César Augusto; Aguirre Arango, José Vicente

2016-09-30

To establish the impact the chronic kidney disease stage has in the native vitamin D levels in patients not undergoing dialysis treatment. A study performed in Manizales, Colombia, a city located 2,200 meters above sea level, without important stational variations. Patients with 18 years of age or more, with chronic kidney disease stages 2 to 5 and not undergoing dialysis treatment were recruited for this study. Demographic and anthropometric variations were evaluated as well as solar exposure, CKD etiology and laboratory variables related to bone and mineral diseases. For each CKD clinical stage, correlations were evaluated for vitamin D levels, laboratory results for bone and mineral diseases, solar exposure and ethnicity. Three hundred thirty-three patients were evaluated with a median age of 71 years, most of them mestizo (71%), 173 were women. The main CKD etiology was hypertensive nephropathy (32.2%). 21.1% of patients had normal vitamin D levels, 70.1% were within insufficient range and 8.8% were in deficit. A negative correlation was found between the levels of vitamin 25 (OH) D and the values for: creatinine, phosphorous, calcium x phosphorous product, PTH, 24 hours urine protein and BMI. A positive relationship was found for calcium and albumin. Positive significant statistical correlation was found for vitamin 25(OH) D levels and solar exposure for stages 3b and 4 of CKD. It is common to find low levels of vitamin 25(OH) D in patients with CKD; these can contribute to the appearance of secondary hyperparathyroidism.

MIF functional polymorphisms (-794 CATT5-8 and -173 G>C) are associated with MIF serum levels, severity and progression in male multiple sclerosis from western Mexican population.

PubMed

Castañeda-Moreno, V A; De la Cruz-Mosso, U; Torres-Carrillo, N; Macías-Islas, M A; Padilla-De la Torre, O; Mireles-Ramírez, M A; González-Pérez, O; Ruiz-Sandoval, J L; Huerta, M; Trujillo, X; Ortuño-Sahagún, D; Muñoz-Valle, J F

2018-07-15

Macrophage migration inhibitory factor (MIF) is a cytokine associated with tissue damage in multiple autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis and psoriatic arthritis. The role of MIF in multiple sclerosis (MS) and the contribution of its polymorphisms are unknown in our population. Therefore, we decided to investigate the genetic association of -794 CATT 5-8 (rs5844572) and -173 G>C (rs755622) MIF polymorphisms with MS, clinical variables and MIF serum levels in the population of western Mexico. 230 MS patients diagnosed according to McDonald criteria and 248 control subjects (CS) were recruited for this study, both polymorphisms were genotyped by PCR and PCR-RFLP and MIF serum levels were measured by ELISA kit. Severity and progression of MS were evaluated by EDSS and MSSS scores, respectively. Genotypes carrying the 5 repeats alleles of -794 CATT 5-8 MIF polymorphism present higher MIF serum levels in comparison with no carriers, and the presence of 5,7 heterozygous genotype contribute to the increase of disease severity and damage progression in MS patients. Notably when we stratified by sex, an effect of risk alleles (7 repeats and -173*C) of both MIF polymorphisms on EDSS and MSSS scores on males was found (p < 0.01). This study suggests that polymorphic alleles of MIF polymorphisms could act as sex-specific disease modifiers that increase the severity and progression of MS in male Mexican-Mestizo western population. Copyright © 2018 Elsevier B.V. All rights reserved.

Cognition, culture and utility: plant classification by Paraguayan immigrant farmers in Misiones, Argentina.

PubMed

Kujawska, Monika; Jiménez-Escobar, N David; Nolan, Justin M; Arias-Mutis, Daniel

2017-07-25

This study was conducted in three rural communities of small farmers of Paraguayan origin living in the province of Misiones, Argentina. These Criollos (Mestizos) hail chiefly from departments located in the east of Paraguay, where the climate and flora have similar characteristics as those in Misiones. These ecological features contribute to the continuation and maintenance of knowledge and practices related to the use of plants. Fieldwork was conducted between September 2014 and August 2015. Forty five informants from three rural localities situated along the Parana River participated in an ethno-classification task. For the classification event, photographs of 30 medicinal and edible plants were chosen, specifically those yielding the highest frequency of mention among the members of that community (based on data obtained in the first stage of research in 2014). Variation in local plant classifications was examined and compared using principal component analysis and cluster analysis. We found that people classify plants according to application or use (primarily medicinal, to a lesser extent as edible). Morphology is rarely taken into account, even for very similar and closely-related species such as varieties of palms. In light of our findings, we highlight a dominant functionality model at work in the process of plant cognition and classification among farmers of Paraguayan origin. Salient cultural beliefs and practices associated with rural Paraguayan plant-based medicine are described. Additionally, the manner by which residents' concepts of plants articulate with local folk epistemology is discussed. Culturally constructed use patterns ultimately override morphological variables in rural Paraguayans' ethnobotanical classification.

The -174G/C Interleukin-6 Gene Promoter Polymorphism as a Genetic Marker of Differences in Therapeutic Response to Methotrexate and Leflunomide in Rheumatoid Arthritis.

PubMed

Ruiz-Padilla, A J; Gamez-Nava, J I; Saldaña-Cruz, A M; Murillo-Vazquez, J D; Vazquez-Villegas, M L; Zavaleta-Muñiz, S A; Martín-Márquez, B T; Ponce-Guarneros, J M; Rodriguez Jimenez, N A; Flores-Chavez, A; Sandoval-Garcia, F; Vasquez-Jimenez, J C; Cardona-Muñoz, E G; Totsuka-Sutto, S E; Gonzalez-Lopez, L

2016-01-01

Objective . To evaluate the association of -174G/C IL-6 polymorphism with failure in therapeutic response to methotrexate (MTX) or leflunomide (LEF). This prospective, observational cohort included 96 Mexican-Mestizo patients with moderate or severe rheumatoid arthritis (RA), initiating MTX or LEF, genotyped for IL-6 -174G/C polymorphism by PCR-RFLP. Therapeutic response was strictly defined: only if patients achieved remission or low disease activity (DAS-28 < 3.2). Results . Patients with MTX or LEF had significant decrement in DAS-28 ( p < 0.001); nevertheless, only 14% and 12.5% achieved DAS-28 < 3.2 at 3 and 6 months. After 6 months with any of these drugs the -174G/G genotype carriers (56%) had higher risk of therapeutic failure compared with GC (RR: 1.19, 95% CI: 1.07-1.56). By analyzing each drug separately, after 6 months with LEF, GG genotype confers higher risk of therapeutic failure than GC (RR = 1.56; 95% CI = 1.05-2.3; p = 0.003), or CC (RR = 1.83; 95% CI = 1.07-3.14; p = 0.001). This risk was also observed in the dominant model (RR = 1.33; 95% CI = 1.03-1.72; p = 0.02). Instead, in patients receiving MTX no genotype was predictor of therapeutic failure. We concluded that IL-6 -174G/G genotype confers higher risk of failure in therapeutic response to LEF in Mexicans and if confirmed in other populations this can be used as promissory genetic marker to differentiate risk of therapeutic failure to LEF.

Genetic, metabolic and environmental factors involved in the development of liver cirrhosis in Mexico

PubMed Central

Ramos-Lopez, Omar; Martinez-Lopez, Erika; Roman, Sonia; Fierro, Nora A; Panduro, Arturo

2015-01-01

Liver cirrhosis (LC) is a chronic illness caused by inflammatory responses and progressive fibrosis. Globally, the most common causes of chronic liver disease include persistent alcohol abuse, followed by viral hepatitis infections and nonalcoholic fatty liver disease. However, regardless of the etiological factors, the susceptibility and degree of liver damage may be influenced by genetic polymorphisms that are associated with distinct ethnic and cultural backgrounds. Consequently, metabolic genes are influenced by variable environmental lifestyle factors, such as diet, physical inactivity, and emotional stress, which are associated with regional differences among populations. This Topic Highlight will focus on the genetic and environmental factors that may influence the metabolism of alcohol and nutrients in the setting of distinct etiologies of liver disease. The interaction between genes and environment in the current-day admixed population, Mestizo and Native Mexican, will be described. Additionally, genes involved in immune regulation, insulin sensitivity, oxidative stress and extracellular matrix deposition may modulate the degree of severity. In conclusion, LC is a complex disease. The onset, progression, and clinical outcome of LC among the Mexican population are influenced by specific genetic and environmental factors. Among these are an admixed genome with a heterogenic distribution of European, Amerindian and African ancestry; a high score of alcohol consumption; viral infections; a hepatopathogenic diet; and a high prevalence of obesity. The variance in risk factors among populations suggests that intervention strategies directed towards the prevention and management of LC should be tailored according to such population-based features. PMID:26556986

Socioeconomic and Nutritional Factors Account for the Association of Gastric Cancer with Amerindian Ancestry in a Latin American Admixed Population

PubMed Central

Pereira, Latife; Zamudio, Roxana; Soares-Souza, Giordano; Herrera, Phabiola; Cabrera, Lilia; Hooper, Catherine C.; Cok, Jaime; Combe, Juan M.; Vargas, Gloria; Prado, William A.; Schneider, Silvana; Kehdy, Fernanda; Rodrigues, Maira R.; Chanock, Stephen J.; Berg, Douglas E.; Gilman, Robert H.; Tarazona-Santos, Eduardo

2012-01-01

Gastric cancer is one of the most lethal types of cancer and its incidence varies worldwide, with the Andean region of South America showing high incidence rates. We evaluated the genetic structure of the population from Lima (Peru) and performed a case-control genetic association study to test the contribution of African, European, or Native American ancestry to risk for gastric cancer, controlling for the effect of non-genetic factors. A wide set of socioeconomic, dietary, and clinic information was collected for each participant in the study and ancestry was estimated based on 103 ancestry informative markers. Although the urban population from Lima is usually considered as mestizo (i.e., admixed from Africans, Europeans, and Native Americans), we observed a high fraction of Native American ancestry (78.4% for the cases and 74.6% for the controls) and a very low African ancestry (<5%). We determined that higher Native American individual ancestry is associated with gastric cancer, but socioeconomic factors associated both with gastric cancer and Native American ethnicity account for this association. Therefore, the high incidence of gastric cancer in Peru does not seem to be related to susceptibility alleles common in this population. Instead, our result suggests a predominant role for ethnic-associated socioeconomic factors and disparities in access to health services. Since Native Americans are a neglected group in genomic studies, we suggest that the population from Lima and other large cities from Western South America with high Native American ancestry background may be convenient targets for epidemiological studies focused on this ethnic group. PMID:22870209

Vitamin D (25(OH)D) in patients with chronic kidney disease stages 2-5

PubMed Central

Aguirre Arango, José Vicente

2016-01-01

Objective: To establish the impact the chronic kidney disease stage has in the native vitamin D levels in patients not undergoing dialysis treatment. Methods: A study performed in Manizales, Colombia, a city located 2,200 meters above sea level, without important stational variations. Patients with 18 years of age or more, with chronic kidney disease stages 2 to 5 and not undergoing dialysis treatment were recruited for this study. Demographic and anthropometric variations were evaluated as well as solar exposure, CKD etiology and laboratory variables related to bone and mineral diseases. For each CKD clinical stage, correlations were evaluated for vitamin D levels, laboratory results for bone and mineral diseases, solar exposure and ethnicity. Results: Three hundred thirty-three patients were evaluated with a median age of 71 years, most of them mestizo (71%), 173 were women. The main CKD etiology was hypertensive nephropathy (32.2%). 21.1% of patients had normal vitamin D levels, 70.1% were within insufficient range and 8.8% were in deficit. A negative correlation was found between the levels of vitamin 25 (OH) D and the values for: creatinine, phosphorous, calcium x phosphorous product, PTH, 24 hours urine protein and BMI. A positive relationship was found for calcium and albumin. Positive significant statistical correlation was found for vitamin 25(OH) D levels and solar exposure for stages 3b and 4 of CKD. Conclusions: It is common to find low levels of vitamin 25(OH) D in patients with CKD; these can contribute to the appearance of secondary hyperparathyroidism. PMID:27821896

Characterisation of genetic structure of the Mayan population in Guatemala by autosomal STR analysis.

PubMed

Martinez-Gonzalez, L J; Alvarez-Cubero, M J; Saiz, M; Alvarez, J C; Martinez-Labarga, C; Lorente, J A

2016-09-01

Currently, the Guatemalan population comprises genetically isolated groups due to geographic, linguistic and cultural factors. For example, Mayan groups within the Guatemala population have preserved their own language, culture and religion. These practices have limited genetic admixture and have maintained the genetic identity of Mayan populations. This study is designed to define the genetic structure of the Mayan-Guatemalan groups Kaqchiquel, K'iche', Mam and Q'eqchi' through autosomal short tandem repeat (STR) polymorphisms and to analyse the genetic relationships between them and with other Mayan groups. Fifteen STR polymorphisms were analysed in 200 unrelated donors belonging to the Kaqchiquel (n = 50), K'iche' (n = 50), Mam (n = 50) and Q'eqchi' (n = 50) groups living in Guatemala. Genetic distance, non-metric MDS and AMOVA were used to analyse the genetic relationships between population groups. Within the Mayan population, the STRs D18S51 and FGA were the most informative markers and TH01 was the least informative. AMOVA and genetic distance analyses showed that the Guatemalan-Native American populations are highly similar to Mayan populations living in Mexico. The Mayan populations from Guatemala and other Native American groups display high genetic homogeneity. Genetic relationships between these groups are more affected by cultural and linguistic factors than geographical and local flow. This study represents one of the first steps in understanding Mayan-Guatemalan populations, the associations between their sub-populations and differences in gene diversity with other populations. This article also demonstrates that the Mestizo population shares most of its ancestral genetic components with the Guatemala Mayan populations.

Socio-demographic transformations and living conditions among two indigenous and black populations in Northern Cauca during the period of 1993-2005.

PubMed

Urrea Giraldo, Fernando; Rodríguez Sánchez, Diego Alejandro

2012-04-01

To describe the changes that occurred in some patterns of socio-demographic variables and in living conditions among the Nasa, Guambiana and Afrocolombian populations in the northern region of the Department of Cauca, and those occurring in two residential communities, one white-mestizo and one black, in Cali during the 1993-2005 period. This paper presents a descriptive study that analyzes several socio-demographic indicators from the census of 1993 and 2005, the specific data include: rate of juvenile dependency; total masculinity index; average size of the household; specific global and local birth rates, and infant mortality rates; life expectancy at birth; average years of schooling; health cover age status; and percentage of the population with unmet basic needs (UBN). In this way, it is possible to note differences in the course of socio-demographic evolution and in the standard of living trends in the differing populations under study. The Guambiana Indian population in the municipality of Silvia presents lower birth rates than the Nasa population, characterized by their seasonal birth rates. Differing from the pattern of the indigenous people of Northern Cauca, the Afro-Colombian population both from this region and from the population residing in the urban zones of Cali's tend to show similar socio-demographic patterns. Although there have been profound changes recorded during this period among these populations under study, the ethnic-racial inequalities and those of social class seem to persist. From this first diagnosis, attention is called to the need for a more adequate reproductive health policy to attend the specific needs presented by the indigenous population.

Honduras.

PubMed

1989-09-01

Honduras is a country with an area of 68,000 square miles, with considerable mountainous terrain, and a subtropical but variable climate. It has a population of 4.4 million people and an annual growth rate of 3.1%. The ethnic make up is 90% mestizo, a mixture of Indian and European, with others consisting of Arab, African, oriental, and Indians. The main religion is Catholic with a fast growing Protestant minority, and the language is Spanish. Infant mortality is 60/1000 and life expectancy is 63 years. The work force is mainly agricultural 63%, services 20%, manufacturing 9%, and construction 3%. The government is a democratic constitutional republic established in 1821. The budget is $1,334 million with 7% used for defense, and the gross national product is $4.4 billion with an annual growth rate of 4.5%. Despite being poor and underdeveloped, natural resources include arable land, hydro- electric power, and considerable forest, marine, and mineral resources. Agriculture products include coffee, bananas, citrus fruit, corn, beans, and livestock. The major industries are textiles, cement, wood products, cigars and foodstuffs. Unemployment is over 15% and underemployment is estimated over 40% with the literacy rate at only 60%. In the last few years with US aid the economy has grown 3.8% a year assisted by mining, construction and the service sectors. Honduras must undertake major economic reforms to gain longterm growth and stability since it has large fiscal and trade deficits, a large public bureaucracy, poorly run state enterprises and overvalued exchange rate.

Ethnobotanical Knowledge Is Vastly Under-Documented in Northwestern South America

PubMed Central

Cámara-Leret, Rodrigo; Paniagua-Zambrana, Narel; Balslev, Henrik; Macía, Manuel J.

2014-01-01

A main objective of ethnobotany is to document traditional knowledge about plants before it disappears. However, little is known about the coverage of past ethnobotanical studies and thus about how well the existing literature covers the overall traditional knowledge of different human groups. To bridge this gap, we investigated ethnobotanical data-collecting efforts across four countries (Colombia, Ecuador, Peru, Bolivia), three ecoregions (Amazon, Andes, Chocó), and several human groups (including Amerindians, mestizos, and Afro-Americans). We used palms (Arecaceae) as our model group because of their usefulness and pervasiveness in the ethnobotanical literature. We carried out a large number of field interviews (n = 2201) to determine the coverage and quality of palm ethnobotanical data in the existing ethnobotanical literature (n = 255) published over the past 60 years. In our fieldwork in 68 communities, we collected 87,886 use reports and documented 2262 different palm uses and 140 useful palm species. We demonstrate that traditional knowledge on palm uses is vastly under-documented across ecoregions, countries, and human groups. We suggest that the use of standardized data-collecting protocols in wide-ranging ethnobotanical fieldwork is a promising approach for filling critical information gaps. Our work contributes to the Aichi Biodiversity Targets and emphasizes the need for signatory nations to the Convention on Biological Diversity to respond to these information gaps. Given our findings, we hope to stimulate the formulation of clear plans to systematically document ethnobotanical knowledge in northwestern South America and elsewhere before it vanishes. PMID:24416449

Factors associated with health-related quality of life in Peruvian patients with systemic lupus erythematosus.

PubMed

Elera-Fitzcarrald, Claudia; Alva, Magaly; Gamboa-Cardenas, Rocío; Mora-Trujillo, Claudia S; Zevallos, Francisco; García-Poma, Augusto; Medina, Mariela; Rodriguez-Bellido, Zoila; Perich-Campos, Risto A; Pastor-Asurza, César A; Segami, María I; Ugarte-Gil, Manuel F

2018-05-01

Objective In this paper, we aim to define factors associated with health-related quality of life (HRQoL) in Mestizo patients with systemic lupus erythematosus (SLE). Methods We evaluated patients with SLE from Peru's two largest hospitals between October 2012 and July 2015 to ascertain HRQoL. Using a standard protocol, we incorporated demographic characteristics, clinical manifestations and treatment in our analysis. HRQoL was measured with the LupusQoL, disease activity was ascertained with the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI), and damage was appraised with the Systemic Lupus International Collaborating Clinics (SLICC)/American College of Rheumatology (ACR) damage index (SDI). The associations between the LupusQoL and these variables were examined using linear regression models. Model selection was based on backward elimination. Results A total of 277 patients fit the inclusion criterion. Of these, 254 (91.7%) were female, the median (interquartile range, IQR) age at diagnosis was 41.5 (33.8-51.8) years, disease duration was 6.5 (2.7-11.3) years. The HRQoL domains most affected were the following: burden to others, fatigue, and intimate relationships. Through multivariate analysis, we determined that older age at diagnosis, higher disease activity, damage, and immunosuppressive drug use were negatively associated with HRQoL. Further, we found that higher socioeconomic status, disease duration, and antimalarial use were positively associated with HRQoL. Conclusion Age at diagnosis, disease activity, damage, and use of immunosuppressive drugs were negatively associated with HRQoL; high socioeconomic status, disease duration, and use of antimalarials were positively associated with HRQoL.

Lessons Learned from Twelve Years of Partnered Tobacco Cessation Research in the Dominican Republic

PubMed Central

Ossip, Deborah J.; Diaz, Sergio; Quiñones, Zahira; McIntosh, Scott; Dozier, Ann; Chin, Nancy; Weber, Emily; Holderness, Heather; Torres, Essie; Bautista, Arisleyda; Sanchez, Jose Javier; Avendaño, Esteban; De Ver Dye, Timothy; McDonald, Paul; Bianco, Eduardo

2017-01-01

Engaging partners for tobacco control within low and middle income countries (LMICs) at early stages of tobacco control presents both challenges and opportunities in the global effort to avert the one billion premature tobacco caused deaths projected for this century. The Dominican Republic (DR) is one such early stage country. The current paper reports on lessons learned from 12 years of partnered United States (US)-DR tobacco cessation research conducted through two NIH trials (Proyecto Doble T, PDT1 and 2). The projects began with a grassroots approach of working with interested communities to develop and test interventions for cessation and secondhand smoke reduction that could benefit the communities, while concurrently building local capacity and providing resources, data, and models of implementation that could be used to ripple upward to expand partnerships and tobacco intervention efforts nationally. Lessons learned are discussed in four key areas: partnering for research, logistical issues in setting up the research project, disseminating and national networking, and mentoring. Effectively addressing the global tobacco epidemic will require sustained focus on supporting LMIC infrastructures for tobacco control, drawing on lessons learned across partnered trials such as those reported here, to provide feasible and innovative approaches for addressing this modifiable public health crisis. PMID:29104673

Lessons Learned from Twelve Years of Partnered Tobacco Cessation Research in the Dominican Republic.

PubMed

Ossip, Deborah J; Diaz, Sergio; Quiñones, Zahira; McIntosh, Scott; Dozier, Ann; Chin, Nancy; Weber, Emily; Holderness, Heather; Torres, Essie; Bautista, Arisleyda; Sanchez, Jose Javier; Avendaño, Esteban; De Ver Dye, Timothy; McDonald, Paul; Bianco, Eduardo

2016-06-01

Engaging partners for tobacco control within low and middle income countries (LMICs) at early stages of tobacco control presents both challenges and opportunities in the global effort to avert the one billion premature tobacco caused deaths projected for this century. The Dominican Republic (DR) is one such early stage country. The current paper reports on lessons learned from 12 years of partnered United States (US)-DR tobacco cessation research conducted through two NIH trials (Proyecto Doble T, PDT1 and 2). The projects began with a grassroots approach of working with interested communities to develop and test interventions for cessation and secondhand smoke reduction that could benefit the communities, while concurrently building local capacity and providing resources, data, and models of implementation that could be used to ripple upward to expand partnerships and tobacco intervention efforts nationally. Lessons learned are discussed in four key areas: partnering for research, logistical issues in setting up the research project, disseminating and national networking, and mentoring. Effectively addressing the global tobacco epidemic will require sustained focus on supporting LMIC infrastructures for tobacco control, drawing on lessons learned across partnered trials such as those reported here, to provide feasible and innovative approaches for addressing this modifiable public health crisis.

[Not Available].

PubMed

San Mauro Martín, Ismael; Garicano Vilar, Elena; León Fernández, Joana; Ciudad Cabañas, María José; Collado Yurrita, Luis

2016-07-19

Introducción: recientemente ha surgido el interés por el posible papel de la microbiota intestinal como agente potenciador del rápido aumento que se está observando en el aumento de la prevalencia de obesidad en todo el mundo.Objetivos: relacionar las modificaciones que puede ocasionar el consumo de antibióticos en la microflora intestinal con la obesidad.Métodos: se extrajeron, de las Encuestas Nacionales de Salud de España, entre los años 2001 y 2011, las cifras de ingesta de antibióticos y la prevalencia (%) de obesidad en el mismo rango de edad, género y año. La media total de encuestados fue de 29.904 participantes.Resultados: se encontraron correlaciones significativas (p=0,09) en la asociación de la prevalencia de obesidad y la ingesta de antibióticos. Además, se objetivó que en el sexo masculino esta influencia es el doble que en el femenino.Conclusiones: los descubrimientos recientes en el campo de la microbiota intestinal y su relación con el huésped abren nuevos caminos en la comprensión de ciertas enfermedades inflamatorias y metabólicas, como la obesidad.

La binaria LSS 3074 y su entorno: ?`una nueva asociación OB?

NASA Astrophysics Data System (ADS)

Niemela, V.; Morrell, N.; Corti, M.

En este trabajo presentamos un nuevo análisis orbital de LSS~3074, junto con tipos espectrales y velocidades radiales de estrellas que podrían constituir con ella una nueva asociación OB. La estrella O4f LSS3074 fue descubierta como binaria espectroscópica de corto período y líneas dobles por Morrell & Niemela (1990, ASP Conf. Ser. 7, 57). Posteriormente, Haefner et~al.(1994, IBVS 3969) encontraron variaciones fotométricas, estimando una inclinación orbital entre 50o y 55o. Teniendo en cuenta la importancia de obtener valores empíricos para las masas de estrellas O tempranas, y considerando la gran dispersión existente entre los valores observados y su discrepancia con los predichos por los modelos teóricos, hemos obtenido nuevas observaciones espectroscópicas de este sistema, con el propósito de mejorar los elementos orbitales derivados en la solución preliminar. Además, como las estrellas O tempranas suelen formar parte de cúmulos y asociaciones OB, hemos llevado a cabo una investigación espectroscópica de varias estrellas tempranas que podrían estar físicamente relacionadas con LSS~3074.

Gabapentina a dosis de 300 vs. 450 mg como premedicación anestésica para hipertensión reactiva, ansiedad y analgesia.

PubMed

Rascón-Martínez, Dulce María; Guzmán-Sánchez, Joaquín Antonio; Corral-Urdapilleta, Nora Paulina; Arguelles-Uribe, Gema Damaris; Velázquez-Loeza, Jazmín; Soto-Palma, Gustavo; Carrillo-Torres, Orlando

Observar el comportamiento de la gabapentina para aminorar la hipertensión reactiva secundaria a ansiedad y dolor en pacientes sometidos a cirugía oftálmica, así como el consumo de opiáceos entre los grupos. Ensayo clínico controlado aleatorizado y doble ciego que analizó a 125 pacientes divididos en tres grupos: grupo A, gabapentina 300 mg; grupo B, gabapentina 450 mg; grupo C, amaranto en grageas como control 2 horas antes del procedimiento quirúrgico. Se utilizó la prueba de ji al cuadrado para variables sociodemográficas y ANOVA de un factor para variables numéricas continuas. Se consideró como significativo un valor de p < 0.05 para un estudio de dos colas con un poder beta del 80%. La ansiedad y la analgesia transoperatoria y posoperatoria tuvieron diferencias significativas entre los grupos. Se encontró menor consumo de opiáceos en los grupos que usaron gabapentina. La gabapentina por vía oral, 300 o 450 mg, 2 horas antes de la cirugía, reduce el dolor, la ansiedad y el consumo de opiáceos durante el posoperatorio en pacientes sometidos a cirugía oftalmológica. Copyright: © 2018 SecretarÍa de Salud

Association between STR -794 CATT5-8 and SNP -173 G/C polymorphisms in the MIF gene and Lepromatous Leprosy in Mestizo patients of western Mexico.

PubMed

Martinez-Guzman, M A; Alvarado-Navarro, A; Pereira-Suarez, A L; Muñoz-Valle, J F; Fafutis-Morris, M

2016-10-01

Lepromatous Leprosy (LL) is the most common presentation of leprosy in Mexico. LL patients are unable to activate an effective inflammatory response against Mycobacterium leprae probably due to the genetics of the host. Macrophage Migration Inhibitory Factor (MIF) is important to trigger inflammation processes. Two polymorphisms have been reported for human MIF: STR -794 CATT5-8 and SNP -173 G/C. 7-8 CATT repeats at -794 and the C allele at -173 increase the expression of MIF. We aim to determine the association between the polymorphisms in MIF gene and LL. We carried a case and controls study with 100 Mexican LL patients and 100 healthy subjects (HS). PCR was used for genotyping of STR -794 CATT5-8 polymorphism and PCR-RFLP for -173 G/C. We found that LL patients possess high -794 CATT repeats (47.1%) more often than HS (32.7%). In conclusion, a MIF polymorphism is associated with susceptibility to LL in Western Mexican population. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

The Impact of LEP G-2548A and LEPR Gln223Arg Polymorphisms on Adiposity, Leptin, and Leptin-Receptor Serum Levels in a Mexican Mestizo Population.

PubMed

Chavarria-Avila, Efraín; Vázquez-Del Mercado, Mónica; Gomez-Bañuelos, Eduardo; Ruiz-Quezada, Sandra-Luz; Castro-Albarran, Jorge; Sánchez-López, Lizeth; Martín-Marquez, Beatriz Teresita; Navarro-Hernández, Rosa-Elena

2015-01-01

The polymorphisms in leptin (LEP G-2548A) and leptin-receptor (LEPR Gln223Arg) seem to influence obesity and lipid metabolism among others. The aim of this study was to investigate the effect of these polymorphisms on adiposity, leptin (sLeptin), and leptin-receptor (sLeptin-receptor) serum concentrations as well as inflammation markers. We included 382 adults originally from Western Mexico. They were genotyped by PCR-RFLP. Obese individuals showed higher sLeptin (58.2 ± 31.35 ng/mL) but lower sLeptin-receptor (12.6 ± 3.74 ng/mL) levels than normal weight ones (17.6 ± 14.62 ng/mL, 17.4 ± 4.62 ng/mL, resp.), P < 0.001. Obese subjects carriers of Arg/Arg genotype had more (P = 0.016) sLeptin-receptor (14.7 ± 4.96 ng/mL) and less (P = 0.004) sLeptin (44.0 ± 28.12 ng/mL) levels than Gln/Gln genotype (11.0 ± 2.92 ng/mL, 80.3 ± 33.24 ng/mL, resp.). Body fat mass was lower (P from 0.003 to 0.045) for A/A (36.5% ± 6.80) or Arg/Arg (36.8% ± 6.82) genotypes with respect to G/G (41.3% ± 5.52) and G/A (41.6% ± 5.61) or Gln/Gln (43.7% ± 4.74) and Gln/Arg (41.0% ± 5.52) genotypes carriers. Our results suggest that LEP -2548A and LEPR 223Arg could be genetic markers of less body fat mass accumulation in obese subjects from Western Mexico.

SNPs in NRXN1 and CHRNA5 are associated to smoking and regulation of GABAergic and glutamatergic pathways.

PubMed

Pérez-Rubio, Gloria; Pérez-Rodríguez, Martha E; Fernández-López, Juan Carlos; Ramírez-Venegas, Alejandra; García-Colunga, Jesús; Ávila-Moreno, Federico; Camarena, Angel; Sansores, Raúl H; Falfán-Valencia, Ramcés

2016-07-01

To identify genetic variants associated with greater tobacco consumption in a Mexican population. Daily smokers were classified as light smokers (LS; n = 742), heavy smokers (HS; n = 601) and nonsmokers (NS; n = 606). In the first stage, a genotyping microarray that included 347 SNPs in CHRNA2-CHRNA7/CHRNA10, CHRNB2-CHRNB4 and NRXN1 genes and 37 ancestry-informative markers was used to analyze 707 samples (187 HS, 328 LS and 192 NS). In the second stage, 14 SNPs from stage 1 were validated in the remaining samples (HS, LS and NS; n = 414 in each group) using real-time PCR. To predict the role of the associated SNPs, an in silico analysis was performed. Two SNPs in NRXN1 and two in CHRNA5 were associated with cigarette consumption, while rs10865246/C (NRXN1) was associated with high nicotine addiction. The in silico analysis revealed that rs1882296/T had a high level of homology with Hsa-miR-6740-5p, which encodes a putative miRNA that targets glutamate receptor subunits (GRIA2, GRID2) and GABA receptor subunits (GABRG1, GABRA4, GABRB2), while rs1882296/C had a high level of homology with Hsa-miR-6866-5p, which encodes a different miRNA that targets GRID2 and GABRB2. In a Mexican Mestizo population, greater consumption of cigarettes was influenced by polymorphisms in the NRXN1 and CHRNA5 genes. We proposed new hypotheses regarding the putative roles of miRNAs that influence the GABAergic and glutamatergic pathways in smoking addiction.

The Therapeutic Potentials of Ayahuasca: Possible Effects against Various Diseases of Civilization.

PubMed

Frecska, Ede; Bokor, Petra; Winkelman, Michael

2016-01-01

Ayahuasca is an Amazonian psychoactive brew of two main components. Its active agents are β-carboline and tryptamine derivatives. As a sacrament, ayahuasca is still a central element of many healing ceremonies in the Amazon Basin and its ritual consumption has become common among the mestizo populations of South America. Ayahuasca use amongst the indigenous people of the Amazon is a form of traditional medicine and cultural psychiatry. During the last two decades, the substance has become increasingly known among both scientists and laymen, and currently its use is spreading all over in the Western world. In the present paper we describe the chief characteristics of ayahuasca, discuss important questions raised about its use, and provide an overview of the scientific research supporting its potential therapeutic benefits. A growing number of studies indicate that the psychotherapeutic potential of ayahuasca is based mostly on the strong serotonergic effects, whereas the sigma-1 receptor (Sig-1R) agonist effect of its active ingredient dimethyltryptamine raises the possibility that the ethnomedical observations on the diversity of treated conditions can be scientifically verified. Moreover, in the right therapeutic or ritual setting with proper preparation and mindset of the user, followed by subsequent integration of the experience, ayahuasca has proven effective in the treatment of substance dependence. This article has two important take-home messages: (1) the therapeutic effects of ayahuasca are best understood from a bio-psycho-socio-spiritual model, and (2) on the biological level ayahuasca may act against chronic low grade inflammation and oxidative stress via the Sig-1R which can explain its widespread therapeutic indications.

Disparities in stroke type and vascular risk factors between 2 Hispanic populations in Miami and Mexico city.

PubMed

Romano, Jose G; Arauz, Antonio; Koch, Sebastian; Dong, Chuanhui; Marquez, Juan M; Artigas, Carol; Merlos, Marlon; Hernandez, Bernardo; Roa, Luis F; Rundek, Tatjana; Sacco, Ralph L

2013-08-01

The heterogeneous nature and determinants of stroke among different Hispanic groups was examined by comparing hospitalized Hispanic stroke patients in Miami, where the Hispanic population is largely of Caribbean origin, to a Mestizo population in Mexico City. Consecutive Hispanic patients who were admitted with stroke or transient ischemic attack (TIA) and included in the prospective stroke registries of 2 tertiary care teaching hospitals were studied. Demographic factors, stroke subtypes, vascular risk factors, stroke severity, and outcomes were compared. Vascular risk factor definitions were standardized. A total of 928 patients (520 Mexicans and 408 Miami Hispanics) were analyzed. Mexicans were younger, with a greater proportion of women. More cerebral venous thromboses (CVTs) were admitted in Mexico, while TIA and stroke mimics were more commonly admitted in Miami; cardioembolic strokes were more commonly ascertained in Miami, and more cryptogenic strokes in Mexico. Stroke severity was similar for intracerebral hemorrhages, but more severe ischemic strokes and CVTs were included in the Mexican registry. Outcome at 1 and 3 months was similar in both registries after adjusting for age and baseline stroke severity. After adjusting for age and sex, hypertension, dyslipidemia, and atrial fibrillation were more frequent, and diabetes mellitus was less frequent, among Miami Hispanics compared to Mexicans. We found significant differences in the frequency of hypertension, diabetes, dyslipidemia, and atrial fibrillation in Miami Hispanics and Mexican stroke patients, highlighting the heterogeneity of the Hispanic ethnic group. Future studies are needed to clarify the relative contribution of genetic and environmental disparities amongst Mexican and Caribbean Hispanic stroke patients. Copyright © 2013 National Stroke Association. Published by Elsevier Inc. All rights reserved.

The Therapeutic Potentials of Ayahuasca: Possible Effects against Various Diseases of Civilization

PubMed Central

Frecska, Ede; Bokor, Petra; Winkelman, Michael

2016-01-01

Ayahuasca is an Amazonian psychoactive brew of two main components. Its active agents are β-carboline and tryptamine derivatives. As a sacrament, ayahuasca is still a central element of many healing ceremonies in the Amazon Basin and its ritual consumption has become common among the mestizo populations of South America. Ayahuasca use amongst the indigenous people of the Amazon is a form of traditional medicine and cultural psychiatry. During the last two decades, the substance has become increasingly known among both scientists and laymen, and currently its use is spreading all over in the Western world. In the present paper we describe the chief characteristics of ayahuasca, discuss important questions raised about its use, and provide an overview of the scientific research supporting its potential therapeutic benefits. A growing number of studies indicate that the psychotherapeutic potential of ayahuasca is based mostly on the strong serotonergic effects, whereas the sigma-1 receptor (Sig-1R) agonist effect of its active ingredient dimethyltryptamine raises the possibility that the ethnomedical observations on the diversity of treated conditions can be scientifically verified. Moreover, in the right therapeutic or ritual setting with proper preparation and mindset of the user, followed by subsequent integration of the experience, ayahuasca has proven effective in the treatment of substance dependence. This article has two important take-home messages: (1) the therapeutic effects of ayahuasca are best understood from a bio-psycho-socio-spiritual model, and (2) on the biological level ayahuasca may act against chronic low grade inflammation and oxidative stress via the Sig-1R which can explain its widespread therapeutic indications. PMID:26973523

Socio-demographic transformations and living conditions among two indigenous and black populations in Northern Cauca during the period of 1993-2005

PubMed Central

Rodríguez Sánchez, Diego Alejandro

2012-01-01

Objectives: To describe the changes that occurred in some patterns of socio-demographic variables and in living conditions among the Nasa, Guambiana and Afrocolombian populations in the northern region of the Department of Cauca, and those occurring in two residential communities, one white-mestizo and one black, in Cali during the 1993-2005 period. Methods: This paper presents a descriptive study that analyzes several socio-demographic indicators from the census of 1993 and 2005, the specific data include: rate of juvenile dependency; total masculinity index; average size of the household; specific global and local birth rates, and infant mortality rates; life expectancy at birth; average years of schooling; health cover age status; and percentage of the population with unmet basic needs (UBN). In this way, it is possible to note differences in the course of socio-demographic evolution and in the standard of living trends in the differing populations under study. Results: The Guambiana Indian population in the municipality of Silvia presents lower birth rates than the Nasa population, characterized by their seasonal birth rates. Differing from the pattern of the indigenous people of Northern Cauca, the Afro-Colombian population both from this region and from the population residing in the urban zones of Cali's tend to show similar socio-demographic patterns. Conclusions: Although there have been profound changes recorded during this period among these populations under study, the ethnic-racial inequalities and those of social class seem to persist. From this first diagnosis, attention is called to the need for a more adequate reproductive health policy to attend the specific needs presented by the indigenous population. PMID:24893053

Novel HLA class I associations with HIV-1 control in a unique genetically admixed population.

PubMed

Valenzuela-Ponce, Humberto; Alva-Hernández, Selma; Garrido-Rodríguez, Daniela; Soto-Nava, Maribel; García-Téllez, Thalía; Escamilla-Gómez, Tania; García-Morales, Claudia; Quiroz-Morales, Verónica Sonia; Tapia-Trejo, Daniela; Del Arenal-Sánchez, Silvia; Prado-Galbarro, Francisco-Javier; Hernández-Juan, Ramón; Rodríguez-Aguirre, Edna; Murakami-Ogasawara, Akio; Mejía-Villatoro, Carlos; Escobar-Urias, Ingrid Y; Pinzón-Meza, Rodolfo; Pascale, Juan Miguel; Zaldivar, Yamitzel; Porras-Cortés, Guillermo; Quant-Durán, Carlos; Lorenzana, Ivette; Meza, Rita I; Palou, Elsa Y; Manzanero, Marvin; Cedillos, Rolando A; Aláez, Carmen; Brockman, Mark A; Harrigan, P Richard; Brumme, Chanson J; Brumme, Zabrina L; Ávila-Ríos, Santiago; Reyes-Terán, Gustavo

2018-04-17

Associations between HLA class I alleles and HIV progression in populations exhibiting Amerindian and Caucasian genetic admixture remain understudied. Using univariable and multivariable analyses we evaluated HLA associations with five HIV clinical parameters in 3,213 HIV clade B-infected, ART-naïve individuals from Mexico and Central America (MEX/CAM cohort). A Canadian cohort (HOMER, n = 1622) was used for comparison. As expected, HLA allele frequencies in MEX/CAM and HOMER differed markedly. In MEX/CAM, 13 HLA-A, 24 HLA-B, and 14 HLA-C alleles were significantly associated with at least one clinical parameter. These included previously described protective (e.g. B*27:05, B*57:01/02/03 and B*58:01) and risk (e.g. B*35:02) alleles, as well as novel ones (e.g. A*03:01, B*15:39 and B*39:02 identified as protective, and A*68:03/05, B*15:30, B*35:12/14, B*39:01/06, B*39:05~C*07:02, and B*40:01~C*03:04 identified as risk). Interestingly, both protective (e.g. B*39:02) and risk (e.g. B*39:01/05/06) subtypes were identified within the common and genetically diverse HLA-B*39 allele group, characteristic to Amerindian populations. While HLA-HIV associations identified in MEX and CAM separately were similar overall (Spearman's rho = 0.33, p = 0.03), region-specific associations were also noted. The identification of both canonical and novel HLA/HIV associations provides a first step towards improved understanding of HIV immune control among unique and understudied Mestizo populations.

Panama.

PubMed

1992-03-01

Panama's territory is 77,381 square km or 29,762 square miles with a population of 2.4 million of whom 70% are mestizos or mixed Spanish and Indian. Literacy is 87%, infant mortality is 22/1000, and life expectancy is 72 years. Panama was part of the Spanish empire from 1538 to 1821. In 1903 Panama declared its independence from Colombia, and afterwards signed a treaty with the US to build a canal 10 miles wide. The existing 52-mile lock canal was completed in 1914. From the 1960s pressure mounted to renegotiate the treaty that was eventually accomplished in 1977. In 1989 the Noriega regime called elections and lost, but it did not accept the results, and continued repression until it was ousted by a 1989 US military action. Noriega surrendered and was indicted for drug trafficking. The economy was in disrepair after mismanagement and US sanctions. During 1990-91 the economy started to recover with the return of capital to banks, increase of exports and construction, and the decrease of government deficit and unemployment. The gross domestic product grew 3.45 in 1990 and 9.3% in 1991 with a low level of inflation. Government policies were proposed to stimulate foreign private investment, improve market conditions, and reduce tariffs and price controls. In 1992 the Endara government signed agreements with international financial institutions on credit that entailed tax, social security, and public investment reforms. The unemployment rate decreased from 35% in 1989 to 16% by 1992. The revenues from the canal have to be sustained, therefore the Panama Canal Commission approved a $200-million project to widen it over the next 20 years.

Cultural factors affecting urban Mexican male homosexual behavior.

PubMed

Carrier, J M

1976-03-01

Some aspects of the mestizoized urban culture in Mexico are linked to male homosexuality in support of the theory that cultural factors play an important role in the kind of life styles and sex practices of males involved in homosexual behavior. The following factors are considered relevant: the sharp dichotomization of gender roles, dual categorization of females as good or bad, separate social networks maintained by males before and after marriage, proportion of unmarried males, and distribution of income. One result of the sharp dichotomization of male and female gender roles is the widely held belief that effeminate males generally prefer to play the female role rather than the male. Effeminacy and homosexuality are also linked by the belief that as a result of this role preference effeminate males are sexually interested only in masculine males with whom they play the passive sex role. The participation of masculine males in homosexual encounters is related in part to a relatively high level of sexual awareness in combination with the lack of stigmatization of the insertor sex role and in part to the restraints placed on alternative sexual outlets by available income and/or marital status. Males involved in homosexual behavior in Mexico operate in a sociocultural environment which gives rise to expectations that they should play either the insertee or insertor sex role but not both and that they should obtain ultimate sexual satisfaction with anal intercourse rather than fellatio. In spite of cultural imperatives, however, individual preferences stemming from other variables such as personality needs, sexual gratification, desires of wanted partners, and amount of involvement may override the imperatives with resulting variations in sexual behavior patterns.

Association of Systemic Lupus Erythematosus With Decreased Immunosuppressive Potential of the IgG Glycome

PubMed Central

Vučković, Frano; Krištić, Jasminka; Gudelj, Ivan; Teruel, Maria; Keser, Toma; Pezer, Marija; Pučić‐Baković, Maja; Štambuk, Jerko; Trbojević‐Akmačić, Irena; Barrios, Clara; Pavić, Tamara; Menni, Cristina; Wang, Youxin; Zhou, Yong; Cui, Liufu; Song, Haicheng; Zeng, Qiang; Guo, Xiuhua; Pons‐Estel, Bernardo A.; McKeigue, Paul; Leslie Patrick, Alan; Gornik, Olga; Spector, Tim D.; Harjaček, Miroslav; Molokhia, Mariam; Wang, Wei; Lauc, Gordan

2015-01-01

Objective Glycans attached to the Fc portion of IgG are important modulators of IgG effector functions. Interindividual differences in IgG glycome composition are large and they associate strongly with different inflammatory and autoimmune diseases. IKZF1, HLA–DQ2A/B, and BACH2 genetic loci that affect IgG glycome composition show pleiotropy with systemic lupus erythematosus (SLE), indicating a potentially causative role of aberrant IgG glycosylation in SLE. We undertook this large multicenter case–control study to determine whether SLE is associated with altered IgG glycosylation. Methods Using ultra‐performance liquid chromatography analysis of released glycans, we analyzed the composition of the IgG glycome in 261 SLE patients and 247 matched controls of Latin American Mestizo origin (the discovery cohort) and in 2 independent replication cohorts of different ethnicity (108 SLE patients and 193 controls from Trinidad, and 106 SLE patients and 105 controls from China). Results Multiple statistically significant differences in IgG glycome composition were observed between patients and controls. The most significant changes included decreased galactosylation and sialylation of IgG (which regulate proinflammatory and antiinflammatory actions of IgG) as well as decreased core fucose and increased bisecting N‐acetylglucosamine (which affect antibody‐dependent cell‐mediated cytotoxicity). Conclusion The IgG glycome in SLE patients is significantly altered in a way that decreases immunosuppressive action of circulating immunoglobulins. The magnitude of observed changes is associated with the intensity of the disease, indicating that aberrant IgG glycome composition or changes in IgG glycosylation may be an important molecular mechanism in SLE. PMID:26200652

Honduras.

PubMed

1992-05-01

Honduras has an area of 112,088 square km or 43,277 square miles with a population of 4.8 million in 1991 of whom 90% are mestizos. Literacy is 68%, the infant mortality rate is 60/1000, and life expectancy is 63 years. After independence from Spain in 1821 the Central American Federation collapsed in 1938. There have been 300 internal rebellions since independence. With an inadequate economic infrastructure, sociopolitical integration has been fragile. In 1982 the Suazo government relied on US support to face the economic recession, the threat posed by the Marxist government in Nicaragua, and civil war in El Salvador. USAID sponsored ambitious social and economic projects. A peaceful transfer of power between civilian presidents occurred in 1986 despite an electoral quirk. In 1990 President Callejas introduced reforms to reduce the deficit, and to stimulate investments and exports. After initial higher inflation and low growth in 1990 and 1991, modest progress is forecast for 1992 and 1993. The powerful military has been kept in check, and human rights have been better protected. The country is among the poorest in Latin America with underemployment of 30-40% and a mostly agricultural economy. The 1990 reforms of deregulation of prices, liberalization of trade, less protectionism, and export orientation is expected to produce longterm benefits not only in agriculture but also in manufacturing. The US is the primary trading partner, and the main direct foreign investor (fruits, refining, and mining). The slash-and-burn agricultural cultivation has created environmental destruction, and as a sign of public awareness the armed forces have engaged in reforestation and fighting forest fires.

Moléculas orgánicas no-rígidas

NASA Astrophysics Data System (ADS)

Senent Díez, M. L.

Se destaca la importancia del estudio espectroscópico ab initio de una serie de moléculas no-rígidas detectadas en el medio interestelar (acetona, dimetil-eter, etanol, metanol, metilamina, ldots), así como los últimos avances del desarrollo de la metodología para el tratamiento teórico de estas especies. Se describe, a modo de ejemplo, el análisis del espectro roto-torsional de la molécula de glicoaldehido que ha sido recientemente detectada en el centro Galáctico Sagitario B2 (N) [1]. Esta especie presenta dos movimientos de gran amplitud que interaccionan, descansan en el Infrarrojo Lejano y le confiere propiedades no-rígidas. La molécula puede existir en posiciones cis y trans y presenta cinco confórmeros estables, tres de simetría Cs (I, II y IV) y un doble mínimo trans de simetría C1 (III) . La conformación favorita, I, presenta simetría Cs y se estabiliza por la formación de un puente de hidrógeno entre los grupos OH y C=O. Los mínimos secundarios II, III, y IV se han determinado a 1278.2 cm-1 (trans, Cs), 1298.8 cm-1 (trans, C1) y 1865.2 cm-1 (cis, Cs) con cálculos MP4/cc-pVQZ que incluyen sustituciones triples. Para determinar que vibraciones interaccionan con las torsiones, se ha realizado un análisis armónico en los mínimos. Las frecuencias fundamentales armónicas correspondientes al mínimo I se han calculado en 213.4 cm-1 (torsión C-C) y 425.7 cm-1 (torsión OH). Es de esperar que tan sólo dos vibraciones, la flexión del grupo C-C-O y el aleteo del hidrógeno del grupo aldehídico puedan desplazar el espectro torsional de la molécula aislada. Para determinar el espectro torsional, se ha determinado la superficie de potencial en dos dimensiones mediante el cálculo ab initio de las geometrías y energías de 74 conformaciones seleccionadas. Estas últimas se han ajustado a un doble serie de Fourier. A partir de la PES y de los parámetros cinéticos del Hamiltoniano vibracional se han obtenido frecuencias e intensidades

PFI-ZEKE (Pulsed Field Ionization-Zero Electron Kinetic Energy) para el estudio de iones

NASA Astrophysics Data System (ADS)

Castaño, F.; Fernández, J. A.; Basterretxea, A. Longarte. F.; Sánchez Rayo, M. N.; Martínez, R.

Entre las áreas hacia donde ha evolucionado la Química en los últimos años están los estudios de sistemas con especies reactivas de alta energía y los dominados por fuerzas intermoleculares débiles, con energías de unas pocas kcal/mol. En efecto, el estudio de las propiedades de los iones, comenzando por su relación con la molécula neutra de la que procede, la energía de ionización, los estados vibracionales y rotacionales, energías de enlace de Van der Waals entre el ión y una amplia variedad de otras moléculas, sus confórmeros o isómeros y sus reacciones o semi-reacciones químicas están en la raíz de la necesidad de la espectroscopía conocida como PFI-ZEKE, Pulsed Field Ionization-Zero Electron Kinetic Energy. Entre las aplicaciones que requieren estos conocimientos se encuentran la generación de plasmas para la fabricación de semiconductores, memorias magnéticas, etc, así como los sistemas astrofísicos, la ionosfera terrestre, etc. La espectroscopía ZEKE es una evolución de las de fluorescencia inducida por láser, LIF, ionización multifotónica acrecentada por resonancia, REMPI, con uno y dos colores y acoplada a un sistema de tiempo de vuelo, REMPI-TOF-MS, y las espectroscopías de doble resonancia IR-UV y UV-UV. Sus espectros y la ayuda de cálculos ab inicio permite determinar las energías de enlace de complejos de van der Waals en estados fundamental y excitados, identificar confórmeros e isómeros, obtener energías de ionización experimentales aproximadas (100 cm-1) y otras variables de interés. Al igual que con LIF, REMPI y dobles resonancias, es posible utilizar muestras gaseosas, pero los espectros están muy saturados de bandas y su interpretación es difícil o imposible. Se evitan estas dificultades estudiando las moléculas o complejos en expansiones supersónicas, donde la T de los grados de libertad solo alcanzan unos pocos K. Para realizar experimentos de ZEKE hay que utilizar una propiedad recientemente

Evaluation of the contribution of D9S1120 to anthropological studies in Native American populations.

PubMed

Aguilar-Velázquez, J A; Martínez-Sevilla, V Manuel; Sosa-Macías, M; González-Martin, A; Muñoz-Valle, J F; Rangel-Villalobos, H

2017-12-01

The D9S1120 locus exhibits a population-specific allele of 9 repeats (9RA) in all Native American and two Siberian populations currently studied, but it is absent in other worldwide populations. Although this feature has been used in anthropological genetic studies, its impact on the evaluation of the structure and genetic relations among Native American populations has been scarcely assessed. Consequently, the aim of this study was to evaluate the anthropological impact of D9S1120 when it was added to STR population datasets in Mexican Native American groups. We analyzed D9S1120 by PCR and capillary electrophoresis (CE) in 1117 unrelated individuals from 13 native groups from the north and west of Mexico. Additional worldwide populations previously studied with D9S1120 and/or 15 autosomal STRs (Identifier kit) were included for interpopulation analyses. We report statistical results of forensic importance for D9S1120. On average, the modal alleles were the Native American-specific allele 9RA (0.3254) and 16 (0.3362). Genetic distances between Native American and worldwide populations were estimated. When D9S1120 was included in the 15 STR population dataset, we observed improvements for admixture estimation in Mestizo populations and for representing congruent genetic relationships in dendrograms. Analysis of molecular variance (AMOVA) based on D9S1120 confirms that most of the genetic variability in the Mexican population is attributable to their Native American backgrounds, and allows the detection of significant intercontinental differentiation attributed to the exclusive presence of 9RA in America. Our findings demonstrate the contribution of D9S1120 to a better understanding of the genetic relationships and structure among Mexican Native groups. Copyright © 2017 Elsevier GmbH. All rights reserved.

Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

PubMed

Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

2006-01-01

The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

Clinical investigations of the therapeutic potential of ayahuasca: rationale and regulatory challenges.

PubMed

McKenna, Dennis J

2004-05-01

Ayahuasca is a hallucinogenic beverage that is prominent in the ethnomedicine and shamanism of indigenous Amazonian tribes. Its unique pharmacology depends on the oral activity of the hallucinogen, N,N-dimethyltryptamine (DMT), which results from inhibition of monoamine oxidase (MAO) by beta-carboline alkaloids. MAO is the enzyme that normally degrades DMT in the liver and gut. Ayahuasca has long been integrated into mestizo folk medicine in the northwest Amazon. In Brazil, it is used as a sacrament by several syncretic churches. Some of these organizations have incorporated in the United States. The recreational and religious use of ayahuasca in the United States, as well as "ayahuasca tourism" in the Amazon, is increasing. The current legal status of ayahuasca or its source plants in the United States is unclear, although DMT is a Schedule I controlled substance. One ayahuasca church has received favorable rulings in 2 federal courts in response to its petition to the Department of Justice for the right to use ayahuasca under the Religious Freedom Restoration Act. A biomedical study of one of the churches, the Uñiao do Vegetal (UDV), indicated that ayahuasca may have therapeutic applications for the treatment of alcoholism, substance abuse, and possibly other disorders. Clinical studies conducted in Spain have demonstrated that ayahuasca can be used safely in normal healthy adults, but have done little to clarify its potential therapeutic uses. Because of ayahuasca's ill-defined legal status and variable botanical and chemical composition, clinical investigations in the United States, ideally under an approved Investigational New Drug (IND) protocol, are complicated by both regulatory and methodological issues. This article provides an overview of ayahuasca and discusses some of the challenges that must be overcome before it can be clinically investigated in the United States.

[Splenic infarction at high altitude, Huaraz-Peru (3,100 masl)].

PubMed

López de Guimaraes, Douglas; Menacho López, Julio; Villanueva Palacios, Jovita; Mosquera Vásquez, Vitaliano

2009-01-01

We report three cases of splenic infarction in healthy men for the first time that amounted to high altitudes, observed in the hospital "Victor Ramos Guardia" Huaraz (3100 m). Case 1 (1995) of 55 years, born in Cuba, from Lima, caucasian suddenly presented acute abdominal pain in epigastrium, distension, nausea and vomiting, was laparotomized for acute abdomen and surgical pathology revealed thrombosis with splenic infarction splenic artery and vein. During follow-up in Lima, hemoglobin electrophoresis showed that it was heterozygous carrier of the sickle trait (Hb A: 57% Hb S: 38.5%). Case 2 (1998) of 23 years, born in Cuba, from Lima, Black said acute abdominal pain in left hypochondrium, shortness of breath and chest pain, clinical examination and radiography of the abdomen showed the spleen volume increased. Case 3 (2006) of 17 years, natural and from Lima, mestizo, who came on tour promotion, acute abdominal pain referred onset in the epigastrium and left hypochondrium, headache, increase heat, nausea and vomiting, pharyngitis was found acute and painful, and spleen increased in size by clinical and x-ray of abdomen simple stand. None had no history of hemoglobinopathy and anemia. In general, medical management was supportive and cases 2 and 3 are recommended hemoglobin electrophoresis. We conclude that we must think of splenic infarction associated with height in any healthy person who is first at high altitude (> 3000m) and having a sudden acute abdominal pain in epigastrium and / or left hypochondrium, pain and palpable spleen and radiological study compatible with image. In this case is indicated by hemoglobin electrophoresis to determine whether there is an individual heterozygous carrier of the sickle trait. splenic infarction, high altitude, sickle trait, Huaraz.

Peru.

PubMed

1987-12-01

This publication provides a brief account of Peru's geographic, history, government, and political and economic conditions. With an area of 1.28 million sq. km., Peru is the third largest country in South American and is home to 20.2 million inhabitants (6 million live in the capital city of Lima). The population is 45% Indian, 37% mestizo, 15% white, and 3% black, Asian, and other. The 2 official languages are Spanish and Quechua. Its literacy rate stands at 79%, and its infant mortality rate and life expectancy measure 91/1000 and 60.8 years respectively. Peru's pre-Colombian period notes the impressive achievements of the Inca civilization, which was conquered by Spain in 1531. The country gained its independence from Spanish rule in 1821. The article also mentions Peru's turbulent contemporary history, with territorial disputes, a strong military presence, and a series of coups that have interrupted civilian constitutional governments. As recently as 1985, Peru had its first exchange of power from 1 democratically elected leader to another in 40 years, when 36 year-old Alan Garcia Perez became president. Leader of the American Popular Revolutionary Alliance (APRA), GArcia espouses leftist but not non-communist politics, and is well-known for his message of anti-imperialism and Latin American integration. Peru's has seen terrorist activity from 2 marxist organizations, the Maoist Sendero Luminoso (The Shining Path) and the MRTA-MIR (Tupac Amaru Revolutionary Movement-Movement of the Revolutionary Left. In 1986, Peru's economy had a $17 billion Gross Domestic Product (GDP), a per capital GDP of $839, and an inflation rate of 62.9. The article also provides information concerning US economic assistance to Peru, as well as an assessment of US-Peruvian relations.

Single nucleotide polymorphisms of the angiotensin-converting enzyme (ACE) gene are associated with essential hypertension and increased ACE enzyme levels in Mexican individuals.

PubMed

Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

2013-01-01

To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Nine ACE gene polymorphisms were genotyped by 5' exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). The results suggest that single nucleotide polymorphisms and the "GGATG" haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels.

E-cadherin expression in sporadic gastric cancer from Mexico: exon 8 and 9 deletions are infrequent events associated with poor survival.

PubMed

Gamboa-Dominguez, Armando; Dominguez-Fonseca, Claudia; Chavarri-Guerra, Yanin; Vargas, Roberto; Reyes-Gutierrez, Edgardo; Green, Dan; Quintanilla-Martinez, Leticia; Luber, Birgit; Busch, Raymonde; Becker, Karl-Friedrich; Becker, Ingrid; Höfler, Heinz; Fend, Falko

2005-01-01

Aberrant expression and mutation of E-cadherin is frequent in gastric carcinoma (GC) especially of the diffuse type. The frequency of CDH1 (gene encoding E-cadherin) mutation in populations with high incidence of diffuse GC and its prognostic significance is unknown. One hundred seventy-seven gastrectomies from Mexican mestizo patients with intestinal (53), mixed (55), or diffuse (69) GC were included. In addition, 101 endoscopic biopsies from patients with GC not subjected to surgery were analyzed. Immunohistochemistry against wild-type E-cadherin (clone 36) and against 2 mutation-specific antibodies (MSA) recognizing mutant CDH1 lacking exon-8 (del 8) or exon-9 (del 9) were performed. Staining was correlated with histotype, tumor node metastasis stage, and follow-up. Abnormal or absent E-cadherin expression (clone 36) was identified in 84% GC, predominantly in diffuse or mixed tumors (P = 0.004) in advanced stages (P = 0.003). No survival differences at 1 and 2 years were observed among patients showing normal, abnormal, or absent wild type E-cadherin expression. Overall reactivity with the MSA was observed in 10 (5.6%) patients who were treated with surgery. In 140 patients, dead from the disease or alive with the disease, the survival at 1 and 2 years was 37% versus 17% and 14% versus 0 for patients without and with del 8/9 positivity, respectively (log rank P = 0.01). Biopsies from patients with inoperable-GC (101) rendered 5 (4.95%) with del 8 or 9 immunoreactivity. Abnormal E-cadherin expression is frequent in GC. However, exon 8 or 9 deletions were observed in only 5.3% tumors in this series from Mexico, at a lower rate than previously published, but associated with a worse prognosis.

Prevalence of metilentetrahidrofolate reductase C677T polymorphism, consumption of vitamins B6, B9, B12 and determination of lipidic hydroperoxides in obese and normal weight Mexican population.

PubMed

Hernández-Guerrero, César; Romo-Palafox, Inés; Díaz-Gutiérrez, Mary Carmen; Iturbe-García, Mariana; Texcahua-Salazar, Alejandra; Pérez-Lizaur, Ana Bertha

2013-11-01

Oxidative stress is a key factor in the development of the principal comorbidities of obesity. Methylenetetrahydrofolate reductase enzyme (MTHFR) participates in the metabolism of folate with the action of vitamins B6 and B12. The gene of MTHFR may present a single nucleotide polymorphism (SNP) at position 677 (C677T), which can promote homocysteinemia associated to the production of free radicals. To determine the frequency of SNP C677T of the MTHFR, evaluate the consumption of vitamins B6, B9, B12 and determine the concentration of plasma lipid hydroperoxides (LOOH) in obese and control groups. 128 Mexican mestizo according to their body mass index were classified as normal weight (Nw; n=75) and obesity (ObeI-III; n=53). Identification of SNP C677T of MTHFR was performed by PCR-RFLP technic. The consumption of vitamins B6, B9 and B12 was assessed by a validate survey. LOOH was determined as an indicator of peripheral oxidative stress. There was no statistical difference in the frequency of the C677T polymorphism between the TT homozygous genotype in Nw (0.19) and ObeI-III (0.25). The frequency of T allele in Nw was 0.45 and 0.51 in ObI-III group. There were no statistical differences in the consumption of vitamins B6, B9 and B12 between Nw and ObI-III groups. The LOOH showed statistical difference (p < 0.05) between Nw and ObI–III group. Oxidative stress is present in all grades of obesity although there were no differences in the vitamin consumption and the SNP C677T between Nw and ObeI–III groups. Copyright AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.

Serum uric acid levels contribute to new renal damage in systemic lupus erythematosus patients.

PubMed

Reátegui-Sokolova, C; Ugarte-Gil, Manuel F; Gamboa-Cárdenas, Rocío V; Zevallos, Francisco; Cucho-Venegas, Jorge M; Alfaro-Lozano, José L; Medina, Mariela; Rodriguez-Bellido, Zoila; Pastor-Asurza, Cesar A; Alarcón, Graciela S; Perich-Campos, Risto A

2017-04-01

This study aims to determine whether uric acid levels contribute to new renal damage in systemic lupus erythematosus (SLE) patients. This prospective study was conducted in consecutive patients seen since 2012. Patients had a baseline visit and follow-up visits every 6 months. Patients with ≥2 visits were included; those with end-stage renal disease (regardless of dialysis or transplantation) were excluded. Renal damage was ascertained using the SLICC/ACR damage index (SDI). Univariable and multivariable Cox-regression models were performed to determine the risk of new renal damage. Uric acid was included as a continuous and dichotomous (per receiving operating characteristic curve) variable. Multivariable models were adjusted for age at diagnosis, disease duration, socioeconomic status, SLEDAI, SDI, serum creatinine, baseline use of prednisone, antimalarials, and immunosuppressive drugs. One hundred and eighty-six patients were evaluated; their mean (SD) age at diagnosis was 36.8 (13.7) years; nearly all patients were mestizo. Disease duration was 7.7 (6.8) years. Follow-up time was 2.3 (1.1) years. The SLEDAI was 5.2 (4.3) and the SDI 0.8 (1.1). Uric acid levels were 4.5 (1.3) mg/dl. During follow-up, 16 (8.6%) patients developed at least one new point in the renal domain of the SDI. In multivariable analyses, uric acid levels (continuous and dichotomous) at baseline predicted the development of new renal damage (HR 3.21 (1.39-7.42), p 0.006; HR 18.28 (2.80-119.48), p 0.002; respectively). Higher uric acid levels contribute to the development of new renal damage in SLE patients independent of other well-known risk factors for such occurrence.

Mexico.

PubMed

1993-01-01

The background notes on Mexico provide text and recent statistical information on the geography, population, government, economy, and foreign relations, specifically the North American Free Trade Agreement with US. The 1992 population is estimated at 89 million of which 60% are mestizo (Indian-Spanish), 30% are American Indian, 9% are Caucasian, and 1% are other. 90% are Roman Catholic. There are 8 years of compulsory education. Infant mortality is 30/1000 live births. Life expectancy for males is 68 years and 76 years for females. The labor force is comprised of 30% in services, 24% in agriculture and fishing, 19% in manufacturing, 13% in commerce, 7% in construction, 4% in transportation and communication, and .4% in mining. There are 31 states and a federal district. Gross domestic product (GDP) per capita was $3200 in 1991. Military expenditures were .5% of GDP in 1991. The average inflation rate is 19%. Mexico City with 20 million is the largest urban center in the world. In recent years, the economy has been restructured with market oriented reforms; the result has been a growth of GDP of 3.6% in 1991 from 2% in 1987. Dependence on oil exports has decreased. There has been privatization and deregulation of state-owned companies. Subsidies to inefficient companies have been stopped. Tariff rates were reduced. The financial debt has been reduced and turned into a surplus of .8% in 1992. Mexico's foreign debt has been reduced from its high in 1987 of $107 billion. Agricultural reforms have been ongoing for 50 years. Land was redistributed, but standards of living and productivity have improved only slightly. Rural land tenure regulations have been changed, and other economic reforms are expected. Mexico engages in ad hoc international groups and is selective about membership in international organizations.

Actinic Prurigo Cheilitis: A Clinicopathologic Review of 75 Cases.

PubMed

Plaza, Jose A; Toussaint, Sonia; Prieto, Victor G; Mercadillo, Patricia; Diez de Medina, Juan C; Lourenco, Silvia; Batdorf, Bjorn; Sangueza, Martin

2016-06-01

Actinic prurigo (AP) is a chronic idiopathic photodermatosis that primarily affects American Indians in the United States and Mestizos in Latin American countries. Clinically, the onset of the disease is usually in the first decade of life but may appear initially in adult life, and it is characterized by symmetric involvement of sun-exposed areas of the skin, particularly areas of the face, resulting in polymorphic erythematous papules, macules, and plaques in different stages of evolution. Lower lip involvement includes swelling, scaling, fissures, hyperpigmentation, and ulcerations of the vermilion border. and in some cases could represent the only manifestation of the disease. The histopathologic features of AP have been studied; however, there is a controversy regarding whether AP cheilitis has distinct histopathologic features that could allow accurate separation from other specific and nonspecific forms of cheilitis. The diagnosis can be challenging, mainly when lip lesions are the only manifestation of the disease. In this study, the authors investigate the clinicopathologic features of 75 cases of AP cheilitis to provide further criteria for its diagnosis and classification. All 75 patients presented with lip lesions. Thirty-three cases were diagnosed as AP cheilitis with cutaneous lesions and 42 cases were diagnosed as AP cheilitis without cutaneous lesions (only lip lesions). Histologically, of the 33 cases with AP cheilitis with cutaneous lesions, 17 (52%) cases showed follicular cheilitis, and of the 42 cases that had only lip lesions, 18 (43%) cases showed follicular cheilitis. Histologically, AP cheilitis can present as follicular cheilitis; thus, supporting the diagnosis. Also, our findings confirm that lip lesions can present as the only manifestation of the disease, showing typical histological and clinical features. This form of cheilitis has not being well described in the dermatologic and dermatopathologic literature.

The cultural significance of wild mushrooms in San Mateo Huexoyucan, Tlaxcala, Mexico.

PubMed

Alonso-Aguilar, Luis Enrique; Montoya, Adriana; Kong, Alejandro; Estrada-Torres, Arturo; Garibay-Orijel, Roberto

2014-03-05

We performed an ethnomycological study in a community in Tlaxcala, Central Mexico to identify the most important species of wild mushrooms growing in an oak forest, their significance criteria, and to validate the Cultural Significance Index (CSI). Thirty-three mestizo individuals were randomly selected in San Mateo Huexoyucan and were asked seven questions based on criteria established by the CSI. Among the 49 mushroom species collected in the oak forest and open areas, 20 species were mentioned most often and were analyzed in more detail. Ordination and grouping techniques were used to determine the relationship between the cultural significance of the mushroom species, according to a perceived abundance index, frequency of use index, taste score appreciation index, multifunctional food index, knowledge transmission index, and health index. The mushrooms with highest CSI values were Agaricus campestris, Ramaria spp., Amanita aff. basii, Russula spp., Ustilago maydis, and Boletus variipes. These species were characterized by their good taste and were considered very nutritional. The species with the lowest cultural significance included Russula mexicana, Lycoperdon perlatum, and Strobylomyces strobilaceus. The ordination and grouping analyses identified four groups of mushrooms by their significance to the people of Huexoyucan. The most important variables that explained the grouping were the taste score appreciation index, health index, the knowledge transmission index, and the frequency of use index. A. aff. basii and A. campestris were the most significant wild mushrooms to the people of San Mateo. The diversity of the Russula species and the variety of Amanita and Ramaria species used by these people was outstanding. Environments outside the forest also produced useful resources. The CSI used in Oaxaca was useful for determining the cultural significance of mushrooms in SMH, Tlaxcala. This list of mushrooms can be used in conservation proposals for the Quercus

The cultural significance of wild mushrooms in San Mateo Huexoyucan, Tlaxcala, Mexico

PubMed Central

2014-01-01

Background We performed an ethnomycological study in a community in Tlaxcala, Central Mexico to identify the most important species of wild mushrooms growing in an oak forest, their significance criteria, and to validate the Cultural Significance Index (CSI). Methods Thirty-three mestizo individuals were randomly selected in San Mateo Huexoyucan and were asked seven questions based on criteria established by the CSI. Among the 49 mushroom species collected in the oak forest and open areas, 20 species were mentioned most often and were analyzed in more detail. Ordination and grouping techniques were used to determine the relationship between the cultural significance of the mushroom species, according to a perceived abundance index, frequency of use index, taste score appreciation index, multifunctional food index, knowledge transmission index, and health index. Results The mushrooms with highest CSI values were Agaricus campestris, Ramaria spp., Amanita aff. basii, Russula spp., Ustilago maydis, and Boletus variipes. These species were characterized by their good taste and were considered very nutritional. The species with the lowest cultural significance included Russula mexicana, Lycoperdon perlatum, and Strobylomyces strobilaceus. The ordination and grouping analyses identified four groups of mushrooms by their significance to the people of Huexoyucan. The most important variables that explained the grouping were the taste score appreciation index, health index, the knowledge transmission index, and the frequency of use index. Conclusions A. aff. basii and A. campestris were the most significant wild mushrooms to the people of San Mateo. The diversity of the Russula species and the variety of Amanita and Ramaria species used by these people was outstanding. Environments outside the forest also produced useful resources. The CSI used in Oaxaca was useful for determining the cultural significance of mushrooms in SMH, Tlaxcala. This list of mushrooms can be used in

Interleukin 1 β (IL-1B) and IL-1 antagonist receptor (IL-1RN) gene polymorphisms are associated with the genetic susceptibility and steroid dependence in patients with ulcerative colitis.

PubMed

Yamamoto-Furusho, Jesús K; Santiago-Hernández, Jean J; Pérez-Hernández, Nonanzit; Ramírez-Fuentes, Silvestre; Fragoso, José Manuel; Vargas-Alarcón, Gilberto

2011-07-01

Ulcerative colitis (UC) is an inflammatory bowel disease of unknown etiology. Among cytokines induced in UC, interleukin 1 antagonist (IL-1ra) and interleukin 1 β (IL-1β) seems to have a central role because of its immunoregulatory and proinflammatory activities. To determine the association between IL-1RA and IL-1B gene polymorphisms and the clinical features of UC in the Mexican Mestizo population. Five polymorphisms in the IL-1 gene cluster members IL-1B (rs16944), IL1F10 (rs3811058), and IL-1RN (rs419598, rs315952, and rs315951) were genotyped by 5' exonuclease TaqMan genotyping assays in a group of 200 Mexican patients with UC and 248 ethnically matched unrelated healthy controls. We found a significant increased frequencies of IL-1RN6/1 TC (rs315952) and RN6/2 CC (rs315951) and decreased frequency of IL-1B-511 TC (rs16944) genotypes in UC patients as compared with healthy controls. In the subgroup analysis, we found a significant association between the RN6/2 GG (rs315951) and IL-1B-511 CC (rs16944) genotypes and the presence of steroid-dependence in UC patients (pC=00001, OR=15.6 and pC=0.008, OR=4.09, respectively). Patients with UC showed increased frequencies of IL-1RN "CTC" and "TCG" haplotypes when compared with healthy controls (P=0.019, OR=1.43 and P<10(-7), OR=2.63, respectively). Two haplotypes (TTG and CTG) showed decreased frequency in patients when compared with healthy controls (P=9×10(-7), OR=0.11 and P=8×10(-6), OR=0.11, respectively). IL-1 RN and IL-1B polymorphisms were associated with the genetic susceptibility to develop UC and might be associated with the presence of steroid-dependence in UC patients.

A functional ABCA1 gene variant is associated with low HDL-cholesterol levels and shows evidence of positive selection in Native Americans

PubMed Central

Acuña-Alonzo, Víctor; Flores-Dorantes, Teresa; Kruit, Janine K.; Villarreal-Molina, Teresa; Arellano-Campos, Olimpia; Hünemeier, Tábita; Moreno-Estrada, Andrés; Ortiz-López, Ma Guadalupe; Villamil-Ramírez, Hugo; León-Mimila, Paola; Villalobos-Comparan, Marisela; Jacobo-Albavera, Leonor; Ramírez-Jiménez, Salvador; Sikora, Martin; Zhang, Lin-Hua; Pape, Terry D.; de Ángeles Granados-Silvestre, Ma; Montufar-Robles, Isela; Tito-Alvarez, Ana M.; Zurita-Salinas, Camilo; Bustos-Arriaga, José; Cedillo-Barrón, Leticia; Gómez-Trejo, Celta; Barquera-Lozano, Rodrigo; Vieira-Filho, Joao P.; Granados, Julio; Romero-Hidalgo, Sandra; Huertas-Vázquez, Adriana; González-Martín, Antonio; Gorostiza, Amaya; Bonatto, Sandro L.; Rodríguez-Cruz, Maricela; Wang, Li; Tusié-Luna, Teresa; Aguilar-Salinas, Carlos A.; Lisker, Ruben; Moises, Regina S.; Menjivar, Marta; Salzano, Francisco M.; Knowler, William C.; Bortolini, M. Cátira; Hayden, Michael R.; Baier, Leslie J.; Canizales-Quinteros, Samuel

2010-01-01

It has been suggested that the higher susceptibility of Hispanics to metabolic disease is related to their Native American heritage. A frequent cholesterol transporter ABCA1 (ATP-binding cassette transporter A1) gene variant (R230C, rs9282541) apparently exclusive to Native American individuals was associated with low high-density lipoprotein cholesterol (HDL-C) levels, obesity and type 2 diabetes in Mexican Mestizos. We performed a more extensive analysis of this variant in 4405 Native Americans and 863 individuals from other ethnic groups to investigate genetic evidence of positive selection, to assess its functional effect in vitro and to explore associations with HDL-C levels and other metabolic traits. The C230 allele was found in 29 of 36 Native American groups, but not in European, Asian or African individuals. C230 was observed on a single haplotype, and C230-bearing chromosomes showed longer relative haplotype extension compared with other haplotypes in the Americas. Additionally, single-nucleotide polymorphism data from the Human Genome Diversity Panel Native American populations were enriched in significant integrated haplotype score values in the region upstream of the ABCA1 gene. Cells expressing the C230 allele showed a 27% cholesterol efflux reduction (P< 0.001), confirming this variant has a functional effect in vitro. Moreover, the C230 allele was associated with lower HDL-C levels (P = 1.77 × 10−11) and with higher body mass index (P = 0.0001) in the combined analysis of Native American populations. This is the first report of a common functional variant exclusive to Native American and descent populations, which is a major determinant of HDL-C levels and may have contributed to the adaptive evolution of Native American populations. PMID:20418488

Effect of knee osteoarthritis on the perception of quality of life in Venezuelan patients.

PubMed

Chacón, José G; González, Nancy E; Véliz, Aleida; Losada, Benito R; Paul, Hernando; Santiago, Luís G; Antúnez, Ana; Finol, Yelitza; González, María E; Granados, Isabel; Maldonado, Irama; Maldonado, Teolinda; Marín, Francisco; Zambrano, Gisela; Rodríguez, Martín A

2004-06-15

To measure the perception of quality of life in Venezuelan patients with knee osteoarthritis and to identify those variables that may influence it. A multicenter, cross-sectional study of 126 mestizo patients with knee osteoarthritis recruited from 8 rheumatology centers in Venezuela. We used a Spanish-translated version of the Arthritis Impact Measurement Scales (AIMS), as adapted in Venezuela. One-way analysis of variance was used to compare the AIMS mean total score among subgroups of knee pain, anatomic stage, and socioeconomic status (SES); a post-hoc test was performed to identify significant intragroup differences. Pearson's correlation coefficient was used to examine correlations between age, body mass index (BMI), disease duration, knee pain, and AIMS score. Associations between radiologic stage, SES, and AIMS scores were examined using Spearman's rank correlation. Multiple regression analysis was used to estimate predictor factors of AIMS scores. A significant correlation was found between total AIMS scores and knee pain, age, and socioeconomic status, but not with BMI, disease duration, or anatomic stage. Patients with severe knee pain differed from those with mild and moderate pain, and the highest AIMS mean total score was seen in patients within the severe knee pain subset. Patients in the highest socioeconomic levels differed from those within lowest categories. Patients classified as being at the levels of relative and critical poverty showed the highest AIMS scores. Multiple regression analysis showed that knee pain was the only variable that exerted an independent effect on the quality of life in our patients. The perception of quality of life is negatively affected by increasing levels of joint pain, old age, and low socioeconomic status in Venezuelan patients with knee osteoarthritis. Our study supports the need for an early and vigorous approach to treat pain in this group of patients.

Prevalence of musculoskeletal diseases in Guatemala, Central America: the COPCORD study of 2 populations.

PubMed

Obregón-Ponce, Ariel; Iraheta, Isa; García-Ferrer, Helga; Mejia, Bayardo; García-Kutzbach, Abraham

2012-06-01

Guatemala is a multiethnic, multilingual, and multicultural country. We have evaluated 2 different ethnic groups from (1) San Juan Sacatepéquez County (SJSC), a rural population (30% illiterate), with 65% from Kaqchiquel ethnic group; and (2) Zone 5 of Guatemala City (Z5GC), an urban population (6.6% illiterate), with 95.5% mestizos. This study aimed to measure simultaneously the prevalence of rheumatic diseases in these 2 Guatemalan populations, both located in the State of Guatemala. A convenience sample of 4000 inhabitants 15 years and older was selected in each group. The Core Community Oriented Program for Control of Rheumatic Diseases Questionnaire was used in this survey. Phase 1 was for screening (identification of study subjects), phase 2 was for obtaining information from subjects with musculoskeletal complaints, and phase 3 was for rheumatologic diagnostic purposes. Phases 1 and 2 were performed by 6 interviewers. Phase 3 was completed by 4 rheumatologists. In phase I, 8000 subjects were identified in both groups. In phase II, 949 subjects reported musculoskeletal complaints: 371 (39%) in Z5GC and 578 (61%) in SJSC. In phase III, 419 patients were clinically evaluated: 141 (34%) in Z5GC and 278 (66%) in SJSC. The most prevalent musculoskeletal diseases were (1) osteoarthritis, (2) soft tissue rheumatism, (3) rheumatoid arthritis, (4) low back pain, and (5) arthralgias of unknown etiology. Osteoarthritis and soft tissue rheumatism were significantly more common in the rural population. The most prevalent musculoskeletal diseases in Guatemala seem to be similar to those in most previous Community Oriented Program for Control of Rheumatic Diseases studies. Most subjects were still working. Further studies examining medical care received and impact on function can now be of interest.

Declining blood lead and zinc protoporphyrin levels in Ecuadorian Andean children.

PubMed

Ortega, Fernando; Counter, S Allen; Buchanan, Leo H; Coronel Parra, Angelica M; Collaguaso, Maria Angela; Jacobs, Anthony B; Rifai, Nader; Hoover, Patricia Nolan

2013-09-01

To investigate current lead (Pb) exposure in children living in Andean Ecuadorian communities. Blood Pb (PbB) and zinc protoporphyrin (ZPP) levels were used respectively as biomarkers of acute and chronic Pb poisoning. The current PbB-ZPP levels were compared with previous pediatric PbB-ZPP levels recorded over years in the study area. Samples of whole blood were collected from 22 Andean children of Quechua and Mestizo backgrounds and measured for PbB concentrations by graphite furnace atomic absorption spectroscopy. ZPP/heme ratio and ZPP whole blood (ZPP WB) levels were measured with a hematofluorometer. The mean PbB level for children in the current study group was 14.5 μg/dL, which was significantly lower than the mean PbB level of 41.1 μg/dL found in the same study area in the 1996-2000 test period, and lower than the 22.2 μg/dL mean level found in the 2003-2007 period. The current mean ZPP/heme ratio was 102.1 μmol/mol, and the mean ZPP WB level was 46.3 μg/dL, both lower than values previously found in children in the study area. While the current pediatric PbB-ZPP levels in the study area remain elevated in some children, the overall levels indicate a decline relative to levels observed in the same Pb-contaminated area in the period between 1996 and 2007. The elevated ZPP levels suggest a history of chronic Pb exposure, and potential iron deficiency in some children. The overall reduction in PbB-ZPP levels suggests a positive outcome of a Pb-exposure education and prevention program, and the therapeutic intervention of succimer chelation therapy. Copyright © 2013 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Differences in body mass index according to fat mass- and obesity-associated (FTO) genotype in Mexican patients with bipolar disorder.

PubMed

Díaz-Anzaldúa, Adriana; Ocampo-Mendoza, Yolanda; Hernández-Lagunas, José Octavio; Díaz-Madrid, Federico Alejandro; Romo-Nava, Francisco; Juárez-García, Francisco; Ortega-Ortiz, Hiram; Díaz-Anzaldúa, Alejandro; Gutiérrez-Mora, Doris; Becerra-Palars, Claudia; Berlanga-Cisneros, Carlos

2015-09-01

The prevalence of obesity has dramatically increased in many countries and it is particularly high in patients with bipolar disorder (BD). A region in the first intron of the fat mass- and obesity-associated (FTO) gene, encompassing markers rs9939973, rs8050136, and rs9939609, has been consistently associated with obesity and body mass index (BMI) in different populations. We sought to determine whether FTO is associated with BMI and/or obesity in patients with BD. The sample included 129 Mexican Mestizo patients with bipolar I or bipolar II disorder. After obtaining informed consent, participants were evaluated with the Structured Clinical Interview for DSM-IV Axis I Disorders and weight, height, and body measurements were recorded. DNA was extracted from a 5-mL blood sample and real-time polymerase chain reaction was performed. The results were analyzed with Haploview v4.2 and SPSS v21. Differences in mean BMI were explained by rs8050136 and rs9939609 genotypes, especially by comparing non-carriers and carriers of two copies of the risk allele (Tukey's p ≤ 0.019), with a mean difference in BMI as high as 7.81 kg/m(2) . Differences in BMI were also explained by the interaction of the genotype (rs8050136 and/or rs9939609), the use of second-generation antipsychotics, and the use of mood stabilizers (p ≤ 0.41). Obesity was also associated with these two markers when patients with and without obesity were compared. In patients with BD, differences in BMI may be affected by the presence of FTO risk alleles, especially in homozygous individuals for these variants. Besides evaluating the possible metabolic effects of certain antipsychotics or mood stabilizers, it is important to evaluate the role of other factors such as FTO risk alleles. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Performance in working memory and attentional control is associated with the rs2180619 SNP in the CNR1 gene.

PubMed

Ruiz-Contreras, A E; Carrillo-Sánchez, K; Ortega-Mora, I; Barrera-Tlapa, M A; Román-López, T V; Rosas-Escobar, C B; Flores-Barrera, L; Caballero-Sánchez, U; Muñoz-Torres, Z; Romero-Hidalgo, S; Hernández-Morales, S; González-Barrios, J A; Vadillo-Ortega, F; Méndez-Díaz, M; Aguilar-Roblero, R; Prospéro-García, O

2014-02-01

Individual differences in cognitive performance are partly dependent, on genetic polymporhisms. One of the single-nucleotide polymorphisms (SNP) of the CNR1 gene, which codes for cannabinoid receptor 1 (CB1R), is the rs2180619, located in a regulatory region of this gene (6q14-q15). The alleles of the rs2180619 are A > G; the G allele has been associated with addiction and high levels of anxiety (when the G allele interacts with the SS genotype of the 5-HTTLPR gene). However, GG genotype is observed also in healthy subjects. Considering G allele as risk for 'psychopathological conditions', it is possible that GG healthy subjects do not be addicted or anxious, but would have reduced performance, compared to AA subjects, in attentional control and working memory processing. One hundred and sixty-four healthy young Mexican-Mestizo subjects (100 women and 64, men; mean age: 22.86 years, SD=2.72) participated in this study, solving a task where attentional control and working memory were required. GG subjects, compared to AA subjects showed: (1) a general lower performance in the task (P = 0.02); (2) lower performance only when a high load of information was held in working memory (P = 0.02); and (3) a higher vulnerability to distractors (P = 0.03). Our results suggest that, although the performance of GG subjects was at normal levels, a lower efficiency of the endocannabinoid system, probably due to a lowered expression of CB1R, produced a reduction in the performance of these subjects when attentional control and working memory processing is challenged. © 2013 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Exploring the Distribution of Genetic Markers of Pharmacogenomics Relevance in Brazilian and Mexican Populations

PubMed Central

Bonifaz-Peña, Vania; Contreras, Alejandra V.; Struchiner, Claudio Jose; Roela, Rosimeire A.; Furuya-Mazzotti, Tatiane K.; Chammas, Roger; Rangel-Escareño, Claudia; Uribe-Figueroa, Laura; Gómez-Vázquez, María José; McLeod, Howard L.; Hidalgo-Miranda, Alfredo

2014-01-01

Studies of pharmacogenomics-related traits are increasingly being performed to identify loci that affect either drug response or susceptibility to adverse drug reactions. However, the effect of the polymorphisms can differ in magnitude or be absent depending on the population being assessed. We used the Affymetrix Drug Metabolizing Enzymes and Transporters (DMET) Plus array to characterize the distribution of polymorphisms of pharmacogenetics and pharmacogenomics (PGx) relevance in two samples from the most populous Latin American countries, Brazil and Mexico. The sample from Brazil included 268 individuals from the southeastern state of Rio de Janeiro, and was stratified into census categories. The sample from Mexico comprised 45 Native American Zapotecas and 224 self-identified Mestizo individuals from 5 states located in geographically distant regions in Mexico. We evaluated the admixture proportions in the Brazilian and Mexican samples using a panel of Ancestry Informative Markers extracted from the DMET array, which was validated with genome-wide data. A substantial variation in ancestral proportions across census categories in Brazil, and geographic regions in Mexico was identified. We evaluated the extent of genetic differentiation (measured as FST values) of the genetic markers of the DMET Plus array between the relevant parental populations. Although the average levels of genetic differentiation are low, there is a long tail of markers showing large frequency differences, including markers located in genes belonging to the Cytochrome P450, Solute Carrier (SLC) and UDP-glucuronyltransferase (UGT) families as well as other genes of PGx relevance such as ABCC8, ADH1A, CHST3, PON1, PPARD, PPARG, and VKORC1. We show how differences in admixture history may have an important impact in the distribution of allele and genotype frequencies at the population level. PMID:25419701

Common gene variants interactions related to uric acid transport are associated with knee osteoarthritis susceptibility.

PubMed

Fernández-Torres, Javier; Martínez-Nava, Gabriela Angélica; Oliviero, Francesca; López-Reyes, Alberto Gabriel; Martínez-Flores, Karina; Garrido-Rodríguez, Daniela; Francisco-Balderas, Adriana; Zamudio-Cuevas, Yessica

2018-06-01

Background The presence of genetic variants in the uric acid (UA) transporters can be associated with hyperuricemia, and therefore with an increased risk of monosodium urate (MSU) crystal precipitation. The inflammatory process triggered by these crystals lead to cartilage damage which, in turn, could promote knee osteoarthritis (KOA). Objective To determine whether genetic polymorphisms of the UA transporters and its interactions are associated with KOA. Materials and Methods Two hundred forty-three unrelated Mexican-mestizo individuals were recruited for this case control-study. Ninety-three of them were KOA patients but without gout, and one hundred and fifty healthy individuals with no symptoms or signs of KOA were recruited as controls. Forty-one single nucleotide polymorphisms (SNPs) involved in the UA transporters were genotyped with OpenArray technology in a QuantStudio 12K flex-System both cases and controls. Results After adjusting by age, gender, BMI and ancestry, significant associations were found for 8 SNPs: rs1260326 (GCKR), rs780093 (GCKR), rs17050272 (INHBB), rs1471633 (PDZK1), rs12129861 (PDZK1), rs7193778 (IGF1R), rs17786744 (STC1) and rs1106766 (R3HDM2). With respect to gene-gene interactions, the pairwise interactions of rs112129861 (PDZK1) and rs7193778 (IGF1R); rs17050272 (INHBB) and rs1106766 (R3HDM2); rs1106766 (R3HDM2) and rs780093 (GCKR); rs1260326 (GCKR) and rs17786744 (STC1); and rs17786744 (STC1) and rs1106766 (R3HDM2), make it possible to visualize the synergistic or antagonistic effect of their genotypes or alleles on KOA development. Conclusions Our preliminary results show that the common gene variants related with the UA transport are associated with KOA in the Mexican population. Further studies must be done to corroborate it.

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

PubMed

de-la-Cruz-Salcedo, E I; Ibarra, B; Rizo-de-la-Torre, L C; Sánchez-López, J Y; González-Mercado, A; Harteveld, C L; Perea-Díaz, F J

2016-10-01

Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (β-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and β-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. β-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δβ-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a β-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a β-thal mutation Cd39, IVS1:110, and Spanish δβ-thal. α-thal is relatively common in Mexican patients, the combination with β-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and β-genes defects in patients showing microcytic hypochromic anemia. © 2016 John Wiley & Sons Ltd.

Medicinal Plant Diversity and Inter-Cultural Interactions between Indigenous Guarani, Criollos and Polish Migrants in the Subtropics of Argentina.

PubMed

Kujawska, Monika; Hilgert, Norma I; Keller, Héctor A; Gil, Guillermo

2017-01-01

Numerous studies highlight the importance of phytotherapy for indigenous and non-indigenous people in different parts of the world. In this work we analyze the richness (number of species), diversity (plant identity and the number of illnesses for which it is used) and similarity of plant species and illnesses treated with them, in order to contribute new data and insight into the importance of plant medicines to the local medical systems of people living in Misiones province, in the subtropics of Argentina. Three sympatric groups were compared: Guarani Indians, Criollos (mestizos) and Polish migrants. Quantitative scrutiny was focused on both primary and secondary sources. The similarity and diversity of medicinal plants and uses between groups was calculated by applying the Sørensen quantitative coefficient and the Shannon-Wiener index, respectively. In order to identify the characteristic plant species used by each group, the Cultural Importance and Prevalence Value (CIPV) was calculated based on the species Indicator Value (IndVal), which combines a species relative abundance with its relative frequency of occurrence in the various groups, and modified according to the type of the analyzed data. The important finding is a great variation in the number of species used by the study groups. Altogether, 509 botanical species were registered: Guarani (397), Criollos (243) and Polish migrants (137). For all groups, the use of native medicinal plants prevailed. The Guarani appear to be the local experts in use of medicinal plants. There is the significant difference in the number of treated illnesses by each taxon among three groups. Criollos and Polish migrants exhibit the greatest similarity in illnesses treated with medicinal plants. These groups share a corpus of knowledge related to illness nosology, and have a symptomatic approach to illness treatment. The Guarani have an etiological approach to illness diagnosis and healing, which may be viewed as a barrier to

Medicinal Plant Diversity and Inter-Cultural Interactions between Indigenous Guarani, Criollos and Polish Migrants in the Subtropics of Argentina

PubMed Central

Kujawska, Monika; Hilgert, Norma I.; Keller, Héctor A.; Gil, Guillermo

2017-01-01

Numerous studies highlight the importance of phytotherapy for indigenous and non-indigenous people in different parts of the world. In this work we analyze the richness (number of species), diversity (plant identity and the number of illnesses for which it is used) and similarity of plant species and illnesses treated with them, in order to contribute new data and insight into the importance of plant medicines to the local medical systems of people living in Misiones province, in the subtropics of Argentina. Three sympatric groups were compared: Guarani Indians, Criollos (mestizos) and Polish migrants. Quantitative scrutiny was focused on both primary and secondary sources. The similarity and diversity of medicinal plants and uses between groups was calculated by applying the Sørensen quantitative coefficient and the Shannon-Wiener index, respectively. In order to identify the characteristic plant species used by each group, the Cultural Importance and Prevalence Value (CIPV) was calculated based on the species Indicator Value (IndVal), which combines a species relative abundance with its relative frequency of occurrence in the various groups, and modified according to the type of the analyzed data. The important finding is a great variation in the number of species used by the study groups. Altogether, 509 botanical species were registered: Guarani (397), Criollos (243) and Polish migrants (137). For all groups, the use of native medicinal plants prevailed. The Guarani appear to be the local experts in use of medicinal plants. There is the significant difference in the number of treated illnesses by each taxon among three groups. Criollos and Polish migrants exhibit the greatest similarity in illnesses treated with medicinal plants. These groups share a corpus of knowledge related to illness nosology, and have a symptomatic approach to illness treatment. The Guarani have an etiological approach to illness diagnosis and healing, which may be viewed as a barrier to

Antiprotozoal activity of medicinal plants used by Iquitos-Nauta road communities in Loreto (Peru).

PubMed

Vásquez-Ocmín, Pedro; Cojean, Sandrine; Rengifo, Elsa; Suyyagh-Albouz, Soulaf; Amasifuen Guerra, Carlos A; Pomel, Sébastien; Cabanillas, Billy; Mejía, Kember; Loiseau, Philippe M; Figadère, Bruno; Maciuk, Alexandre

2018-01-10

In the Peruvian Amazon, the use of medicinal plants is a common practice. However, there is few documented information about the practical aspects of their use and few scientific validation. The starting point for this work was a set of interviews of people living in rural communities from the Peruvian Amazon about their uses of plants. Protozoan diseases are a public health issue in the Amazonian communities, who partly cope with it by using traditional remedies. Validation of these traditional practices contributes to public health care efficiency and may help identify new antiprotozoal compounds. to inventory and validate the use of medicinal plants by rural people of Loreto region. Rural mestizos were interviewed about traditional medication of parasite infections with medicinal plants. Ethnopharmacological surveys were undertaken in two villages along Iquitos-Nauta road (Loreto region, Peru), namely 13 de Febrero and El Dorado communities. Forty-six plants were collected according to their traditional use for the treatment of parasitic diseases, 50 ethanolic extracts (different parts for some of the plants) were tested in vitro on Plasmodium falciparum (3D7 sensitive strain and W2 chloroquine resistant strain), Leishmania donovani LV9 strain and Trypanosoma brucei gambiense. Cytotoxic assessment (HUVEC cells) of the active extracts was performed. Two of the most active plants were submitted to preliminary bioguided fractionation to ascertain and explore their activities. From the initial plants list, 10 were found to be active on P. falciparum, 15 on L. donovani and 2 on the three parasites. The ethanolic extract from Costus curvibracteatus (Costaceae) leaves and Grias neuberthii (Lecythidaceae) bark showed strong in vitro activity on P. falciparum (sensitive and resistant strain) and L. donovani and moderate activity on T. brucei gambiense. The Amazonian forest communities in Peru represents a source of knowledge on the use of medicinal plants. In this work

Association of interleukin-10 promoter haplotypes with disease susceptibility and IL-10 levels in Mexican patients with systemic lupus erythematosus.

PubMed

Palafox-Sánchez, Claudia Azucena; Oregon-Romero, Edith; Salazar-Camarena, Diana Celeste; Valle, Yeminia Maribel; Machado-Contreras, Jesús René; Cruz, Alvaro; Orozco-López, Mariana; Orozco-Barocio, Gerardo; Vázquez-Del Mercado, Mónica; Muñoz-Valle, José Francisco

2015-11-01

Systemic lupus erythematosus (SLE) is the prototype autoimmune rheumatic disease. The etiology of this disease is incompletely understood; however, environmental factors and genetic predisposition are involved. Cytokine-mediated immunity plays a crucial role in the pathogenesis of SLE. We investigate the association of interleukin-10 (IL-10) promoter polymorphisms and their haplotypes in SLE patients from the western Mexico. One hundred and twenty-five SLE patients fulfilling the 1997 ACR criteria and 260 unrelated healthy subjects (HS), both Mexican mestizos, were genotyped for IL-10 -1082A>G, -819C>T, and -592C>A polymorphisms. Haplotypes were inferred using the expectation-maximization algorithm, then allele and haplotype distributions were compared between patients and HS, as well as patients with different clinical variables. We identified at -1082, -819, and -592 four predominant haplotypes ACC (43.70 % in patients vs 46.55 % in HS), ATA (21.45 vs 22.97 %), GCC (16.28 vs 14.21 %), and GTA (14.12 vs 14.12 %). The ATC haplotype was more frequent in SLE respect to HS, suggesting a risk effect (3.23 vs 1.05 %; OR 3.55, CI 1.14-11.11; p = 0.0293). SLE patient carriers of -592 CC genotype as well as the dominant model of inheritance showed higher sIL-10 respect to AA genotype, suggesting that -592 C allele is associated with increased production of the cytokine (p < 0.05). The ACC haplotype had higher IL-10 serum levels and higher values of Mexican version of the Systemic Lupus Erythematosus Disease Activity Index compared with the other haplotype carriers; however, no association was found regarding autoantibodies. Our data suggest that the IL-10 promoter haplotypes play an important role in the risk of developing SLE and influence the production of IL-10 in Mexican population. Nevertheless, further studies are required to analyze the expression of mRNA as well as to investigate the interacting epigenetic factors that could help to define the true contribution of

Differences in lipid profiles in two Hispanic ischemic stroke populations.

PubMed

Arauz, A; Romano, J G; Ruiz-Franco, A; Shang, T; Dong, C; Rundek, T; Koch, S; Hernández-Curiel, B; Pacheco, J; Rojas, P; Ruiz-Navarro, F; Katsnelson, M; Sacco, R L

2014-06-01

The study aims to compare lipid profiles among ischemic stroke patients in a predominantly Caribbean-Hispanic population in Miami and a Mestizo Hispanic population in Mexico City. We analyzed ischemic stroke Hispanic patients with complete baseline fasting lipid profile enrolled contemporaneously in the prospective registries of two tertiary care teaching hospitals in Mexico City and Miami. Demographic characteristics, risk factors, medications, ischemic stroke subtype, and first fasting lipid profile were compared. Vascular risk factor definitions were standardized. Multiple linear regression analysis was performed to compare lipid fractions. A total of 324 patients from Mexico and 236 from Miami were analyzed. Mexicans were significantly younger (58 · 1 vs. 67 · 4 years), had a lower frequency of hypertension (53 · 4% vs. 79 · 7%), and lower body mass index (27 vs. 28 · 5). There was a trend toward greater prevalence of diabetes in Mexicans (31 · 5 vs. 24 · 6%, P = 0 · 07). Statin use at the time of ischemic stroke was more common in Miami Hispanics (18 · 6 vs. 9 · 4%). Mexicans had lower total cholesterol levels (169 · 9 ± 46 · 1 vs. 179 · 9 ± 48 · 4 mg/dl), lower low-density lipoprotein (92 · 3 ± 37 · 1 vs. 108 · 2 ± 40 · 8 mg/dl), and higher triglyceride levels (166 · 9 ± 123 · 9 vs. 149 · 2 ± 115 · 2 mg/dl). These differences remained significant after adjusting for age, gender, hypertension, diabetes, body mass index, smoking, ischemic stroke subtype, and statin use. We found significant differences in lipid fractions in Hispanic ischemic stroke patients, with lower total cholesterol and low-density lipoprotein, and higher triglyceride levels in Mexicans. These findings highlight the heterogeneity of dyslipidemia among the Hispanic race-ethnic group and may lead to different secondary prevention strategies. © 2013 The Authors. International Journal of Stroke © 2013 World Stroke Organization.

Single Nucleotide Polymorphisms of the Angiotensin-Converting Enzyme (ACE) Gene Are Associated with Essential Hypertension and Increased ACE Enzyme Levels in Mexican Individuals

PubMed Central

Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

2013-01-01

Aim To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Methods Nine ACE gene polymorphisms were genotyped by 5′ exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Results Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). Conclusion The results suggest that single nucleotide polymorphisms and the “GGATG” haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels. PMID:23741507

Panama.

PubMed

1989-06-01

Panama has an area of 29,762 square miles, with a population of 2,274 million. The terrain is mountainous and the climate is tropical. The ethnic groups consist of mestizo 79% West Indian 14%, white 10%, and Indian 6%. The religions are Roman Catholic 93% and Protestant 6% and the official language is Spanish with 14% using English. There is 6 years of mandatory primary schooling and the literacy rate is 87.1%. The infant mortality rate is 25.6/1000 and life expectancy is 72.1 years. The work force of 770,000 has 26.6% in agriculture, 27.9% in government, 16% in commerce, 10.5% manufacturing, 5.3% in finance, canal 2.4% and utilities 1.4%. The government was a military dictatorship established in 1903 and a constitution was created in 1972 and revised in 1983. A president and 2 vice presidents, a legislative assembly with 67 members and a supreme court now make up the government. There are 9 provinces and 1 Indian territory and the major political parties are the Panamenista, Democratic Revolutionary, Christian Democratic, Labor, Republican, Nationalist Republican Liberal Movement and many other small parties. The economy has a gross national product of over 5 billion dollars and has a growth rate of .47% in 1987, with an inflation rate of 1.1% in 1985. National resources consist of timber, seafood, and copper ore. Agriculture products are bananas, corn, sugar, rice, coffee, shrimp, timber, vegetables, and cattle. There is 24% agricultural land, 20% forest land and industries include food and drink processing, metal working, petroleum products, chemicals, paper, printing, mining, sugar refining, clothing, furniture, and construction. Exports consist of bananas 21%, shrimp 21%, coffee 9%, sugar 6%, clothing 4%, and other 39%. During the colonial period Panama was ruled by Spain and won independence in 1821 and joined Columbia. In 1903 Panama proclaimed independence and made a treaty with the US to build the canal.

Chile.

PubMed

1992-05-01

The background notes on Chile provide a statistical summary of the population, geography, government, and the economy, and more descriptive text on the history, population, government, economy, defense, and foreign relations. In brief, Chile has 13.3 million Spanish Indian (Mestizos), European, and Indian inhabitants and an annual growth rate of 1.6%. 96% are literate. Infant mortality is 18/1000. 34% of the population are involved in industry and commerce, 30% in services, 19% in agriculture and forestry and fishing, 7% in construction, and 2% in mining. The major city is Santiago. The government, which gained independence in 1810, is a republic with executive, legislative, and judicial branches. There are 12 regions. There are 6 major political parties. Suffrage is universal at 18 years. Gross domestic product (GDP) is $29.2 billion. The annual growth rate is 5% and inflation is 19%. Copper, timber, fish, iron ore, nitrates, precious metals, and molybdenum are its natural resources. Agricultural products are 9% of GDP and include wheat, potatoes, corn, sugar beets, onions, beans, fruits, and livestock. Industry is 21% of GDP and includes mineral refining, metal manufacturing, food and fish processing, paper and wood products, and finished textiles. $8.3 billion is the value of exports and $7 billion of imports. Export markets are in Japan, the US, Germany, Brazil, and the United Kingdom. Chile received $3.5 billion in economic aid between 1949-85, but little in recent years. 83% live in urban centers, principally around Santiago. Congressional representation is made on the basis of elections by a unique binomial majority system. Principal government officials are identified. Chile has a diversified free market economy and is almost self-sufficient in food production. The US is a primary trading partner. 49% of Chile's exports are minerals. Chile maintains diplomatic relations with 70 countries, however, relations are strained with Argentina and Bolivia. Relations

Disease Severity in Patients Infected with Leishmania mexicana Relates to IL-1β

PubMed Central

Fernández-Figueroa, Edith A.; Rangel-Escareño, Claudia; Espinosa-Mateos, Valeria; Carrillo-Sánchez, Karol; Salaiza-Suazo, Norma; Carrada-Figueroa, Georgina; March-Mifsut, Santiago; Becker, Ingeborg

2012-01-01

Leishmania mexicana can cause both localized (LCL) and diffuse (DCL) cutaneous leishmaniasis, yet little is known about factors regulating disease severity in these patients. We analyzed if the disease was associated with single nucleotide polymorphisms (SNPs) in IL-1β (−511), CXCL8 (−251) and/or the inhibitor IL-1RA (+2018) in 58 Mexican mestizo patients with LCL, 6 with DCL and 123 control cases. Additionally, we analyzed the in vitro production of IL-1β by monocytes, the expression of this cytokine in sera of these patients, as well as the tissue distribution of IL-1β and the number of parasites in lesions of LCL and DCL patients. Our results show a significant difference in the distribution of IL-1β (−511 C/T) genotypes between patients and controls (heterozygous OR), with respect to the reference group CC, which was estimated with a value of 3.23, 95% CI = (1.2, 8.7) and p-value = 0.0167), indicating that IL-1β (−511 C/T) represents a variable influencing the risk to develop the disease in patients infected with Leishmania mexicana. Additionally, an increased in vitro production of IL-1β by monocytes and an increased serum expression of the cytokine correlated with the severity of the disease, since it was significantly higher in DCL patients heavily infected with Leishmania mexicana. The distribution of IL-1β in lesions also varied according to the number of parasites harbored in the tissues: in heavily infected LCL patients and in all DCL patients, the cytokine was scattered diffusely throughout the lesion. In contrast, in LCL patients with lower numbers of parasites in the lesions, IL-1β was confined to the cells. These data suggest that IL-1β possibly is a key player determining the severity of the disease in DCL patients. The analysis of polymorphisms in CXCL8 and IL-1RA showed no differences between patients with different disease severities or between patients and controls. PMID:22629474

Lactobacillus species isolated from vaginal secretions of healthy and bacterial vaginosis-intermediate Mexican women: a prospective study

PubMed Central

2013-01-01

Background Lactobacillus jensenii, L. iners, L. crispatus and L. gasseri are the most frequently occurring lactobacilli in the vagina. However, the native species vary widely according to the studied population. The present study was performed to genetically determine the identity of Lactobacillus strains present in the vaginal discharge of healthy and bacterial vaginosis (BV) intermediate Mexican women. Methods In a prospective study, 31 strains preliminarily identified as Lactobacillus species were isolated from 21 samples collected from 105 non-pregnant Mexican women. The samples were classified into groups according to the Nugent score criteria proposed for detection of BV: normal (N), intermediate (I) and bacterial vaginosis (BV). We examined the isolates using culture-based methods as well as molecular analysis of the V1–V3 regions of the 16S rRNA gene. Enterobacterial repetitive intergenic consensus (ERIC) sequence analysis was performed to reject clones. Results Clinical isolates (25/31) were classified into four groups based on sequencing and analysis of the 16S rRNA gene: L. acidophilus (14/25), L. reuteri (6/25), L. casei (4/25) and L. buchneri (1/25). The remaining six isolates were presumptively identified as Enterococcus species. Within the L. acidophilus group, L. gasseri was the most frequently isolated species, followed by L. jensenii and L. crispatus. L. fermentum, L. rhamnosus and L. brevis were also isolated, and were placed in the L. reuteri, L. casei and L. buchneri groups, respectively. ERIC profile analysis showed intraspecific variability amongst the L. gasseri and L. fermentum species. Conclusions These findings agree with previous studies showing that L. crispatus, L. gasseri and L. jensenii are consistently present in the healthy vaginal ecosystem. Additional species or phylotypes were detected in the vaginal microbiota of the non-pregnant Mexican (Hispanic-mestizo) population, and thus, these results further our understanding of

African genetic ancestry is associated with a protective effect on Dengue severity in colombian populations.

PubMed

Chacón-Duque, Juan Camilo; Adhikari, Kaustubh; Avendaño, Efren; Campo, Omer; Ramirez, Ruth; Rojas, Winston; Ruiz-Linares, Andrés; Restrepo, Berta Nelly; Bedoya, Gabriel

2014-10-01

The wide variation in severity displayed during Dengue Virus (DENV) infection may be influenced by host susceptibility. In several epidemiological approaches, differences in disease outcomes have been found between some ethnic groups, suggesting that human genetic background has an important role in disease severity. In the Caribbean, It has been reported that populations of African descent present considerable less frequency of severe forms compared with Mestizo and White self-reported groups. Admixed populations offer advantages for genetic epidemiology studies due to variation and distribution of alleles, such as those involved in disease susceptibility, as well to provide explanations of individual variability in clinical outcomes. The current study analysed three Colombian populations, which like most of Latin American populations, are made up of the product of complex admixture processes between European, Native American and African ancestors; having as a main goal to assess the effect of genetic ancestry, estimated with 30 Ancestry Informative Markers (AIMs), on DENV infection severity. We found that African ancestry has a protective effect against severe outcomes under several systems of clinical classification: Severe Dengue (OR: 0.963 for every 1% increase in African ancestry, 95% confidence interval (0.934-0.993), p-value: 0.016), Dengue Haemorrhagic Fever (OR: 0.969, 95% CI (0.947-0.991), p-value: 0.006), and occurrence of haemorrhages (OR: 0.971, 95% CI (0.952-0.989), p-value: 0.002). Conversely, decrease from 100% to 0% African ancestry significantly increases the chance of severe outcomes: OR is 44-fold for Severe Dengue, 24-fold for Dengue Haemorrhagic Fever, and 20-fold for occurrence of haemorrhages. Furthermore, several warning signs also showed statistically significant association given more evidences in specific stages of DENV infection. These results provide consistent evidence in order to infer statistical models providing a framework for

[Not Available].

PubMed

San Mauro-Martín, Ismael; Collado-Yurrita, Luis; Blumenfeld-Olivares, Javier Andrés; Cuadrado-Cenzual, María Ángeles; Calle-Purón, María Elisa; Hernández-Cabria, Marta; Garicano-Vilar, Elena; Pérez-Arruche, Eva; Arce-Delgado, Esperanza; CiudadCabañas, María José

2016-06-30

Introducción: la hipercolesterolemia es uno de los principales factores de riesgo en la enfermedad cardiovascular. Los esteroles vegetales se han postulado como agentes reguladores y beneficiosos para el control de esta.Objetivo: analizar el efecto de los esteroles vegetales añadidos en una leche en la reducción del colesterol plasmático en adultos jóvenes.Métodos: ensayo clínico, controlado, aleatorizado, doble ciego y cruzado. Los esteroles (2,24 g diarios) fueron administrados en dos tomas de 350 ml de una leche comercial desnatada, durante dos periodos de 3 semanas, separados por una "fase de lavado" de 2 semanas, en el grupo experimental. Al grupo control se le administró la misma cantidad de leche desnatada, sin esteroles. Tanto al inicio como al final de cadaperiodo de intervención se extrajeron muestras sanguíneas. Se analizaron la composición corporal, hábitos de salud y los siguientes marcadores sanguíneos: perfil lipídico, hematológico, inflamación, etc.Resultados: se incluyeron 54 personas en el estudio con una edad media de 38,8 ± 7,3 años. La diferencia porcentual entre los marcadores basales y finales para el colesterol total, colesterol-LDL, colesterol-HDL, triglicéridos y colesterol no-HDL fueron del 9,73%, 12,5%, 1,9%, 3,15% y 13,2%, respectivamente. Se obtuvieron diferencias estadísticamente significativas entre el grupo experimental y el grupo control, para todos los marcadores analizados excepto para los triglicéridos.Conclusión: los esteroles vegetales suministrados en un alimento de consumo habitual, como la leche, pueden ser una estrategia terapéutica no farmacológica para el control de la hipercolesterolemia de alto interés sanitario.

La salud en personas con discapacidad intelectual en España: estudio europeo POMONA-II

PubMed Central

Martínez-Leal, Rafael; Salvador-Carulla, Luis; Gutiérrez-Colosía, Mencía Ruiz; Nadal, Margarida; Novell-Alsina, Ramón; Martorell, Almudena; González-Gordón, Rodrigo G.; Mérida-Gutiérrez, M. Reyes; Ángel, Silvia; Milagrosa-Tejonero, Luisa; Rodríguez, Alicia; García-Gutiérrez, Juan C.; Pérez-Vicente, Amado; García-Ibáñez, José; Aguilera-Inés, Francisco

2011-01-01

Introducción Estudios internacionales demuestran que existe un patrón diferenciado de salud y una disparidad en la atención sanitaria entre personas con discapacidad intelectual (DI) y población general. Objetivo Obtener datos sobre el estado de salud de las personas con DI y compararlos con datos de población general. Pacientes y métodos Se utilizó el conjunto de indicadores de salud P15 en una muestra de 111 sujetos con DI. Los datos de salud encontrados se compararon según el tipo de residencia de los sujetos y se utilizó la Encuesta Nacional de Salud 2006 para comparar estos datos con los de la población general. Resultados La muestra con DI presentó 25 veces más casos de epilepsia y el doble de obesidad. Un 20% presentó dolor bucal, y existió una alta presencia de problemas sensoriales, de movilidad y psicosis. Sin embargo, encontramos una baja presencia de patologías como la diabetes, la hipertensión, la osteoartritis y la osteoporosis. También presentaron una menor participación en programas de prevención y promoción de la salud, un mayor número de ingresos hospitalarios y un uso menor de los servicios de urgencia. Conclusiones El patrón de salud de las personas con DI difiere del de la población general, y éstas realizan un uso distinto de los servicios sanitarios. Es importante el desarrollo de programas de promoción de salud y de formación profesional específicamente diseñados para la atención de personas con DI, así como la implementación de encuestas de salud que incluyan datos sobre esta población. PMID:21948011

PubMed

López, Ana Cristina; Cecchetto, Eugenio; Aguirre, Ana Noemí; Ontiveros, Marina Celeste; Roitter, Claudia Valentina; Garcia, Adelaida Judith; Bernet, Jorgelina; Aguirre, Jorge Alberto

2018-03-23

El objetivo del estudio fue describir características clínicas, sociodemográficas y hábitos en adultos con diabetes mellitus y estudiar su asociación con la calidad de vida relacionada con la salud. Se seleccionó una muestra de 311 pacientes del Programa de Diabetes de una obra social universitaria, de la provincia de Córdoba. Se analizaron los datos a como proporciones y los componentes físico y mental del cuestionario SF-36® . El 57,4% alcanzó un nivel de instrucción terciario o universitario. La hipertensión arterial fue el factor de riesgo cardiovascular más prevalente (86,8%), seguida por dislipemia (50,6%) y obesidad (46,5%). El 24,8% tenía complicación macrovascular y el 29% microvascular. En el componente físico (CF) de calidad de vida las mujeres tuvieron una chance 4,2 veces mayor de reportar un valor inferior en relación a los varones. Entre los 50 y los 70 años se triplicó y los mayores de  70 años tuvieron 4 veces peor una puntuación en el CF respecto a los más jóvenes. Las complicaciones macro y microvasculares y los que reportaron menos de 2 hábitos de vida saludables tuvieron el doble de chances de puntuar por debajo del promedio general en el CF. La asociación entre complicaciones y peor calidad de vida es un motivo más para alcanzar un buen control metabólico, optimizar el manejo de factores de riesgo, evitando o retrasando la aparición de complicaciones.

Utility of urinary transferrin and ceruloplasmin in patients with systemic lupus erythematosus for differentiating patients with lupus nephritis.

PubMed

Urrego, Tomás; Ortiz-Reyes, Blanca; Vanegas-García, Adriana L; Muñoz, Carlos H; González, Luis A; Vásquez, Gloria; Gómez-Puerta, José A

2018-03-09

Diagnosis of lupus nephritis (LN) is usually based on renal biopsy, which is an invasive technique that involves multiple risks. Therefore, different biomarkers have emerged as alternatives for the diagnosis of LN. Nonetheless, studies regarding urinary biomarkers in Latin American patients are limited. The objective of this study was to assess the diagnostic value of urinary transferrin and ceruloplasmin to differentiate patients who have renal involvement from those who do not. Systemic lupus erythematosus (SLE) patients that met the revised American College of Rheumatology (ACR) classification criteria were recruited. Patients with another autoimmune disease, active infection (urinary tract or systemic infection), renal replacement therapy, human immunodeficiency virus infection or pregnancy were excluded. A urine sample was collected from each patient. LN was diagnosed according to ACR criteria. The activity and chronicity of LN were measured using the Austin indices. Urinary transferrin and ceruloplasmin levels were measured using commercial enzyme-linked immunosorbent assay (ELISA) kits. Mann-Whitney U test and Student's t-test were used to compare data. Spearman's rank correlation was used to determine associations. Lastly, receiver operating characteristic (ROC) curves were created. The study involved 120 SLE patients. In all, 85% were female, 76% mestizo, the mean age was 32.8±12.1years and mean systemic lupus erythematosus disease activity index (SLEDAI) was 8.4±8.9; 64% had renal involvement. Urinary levels of the two biomarkers were significantly higher in patients with LN compared to those without LN. Similarly, urinary levels of both biomarkers were significantly higher in patients with active LN compared to those with inactive LN. Furthermore, urinary transferrin levels were significantly higher in Afro-Latin American patients. On the other hand, urinary transferrin levels correlated with SLEDAI and proteinuria, and transferrin and ceruloplasmin

Wildlife uses and hunting patterns in rural communities of the Yucatan Peninsula, Mexico

PubMed Central

2012-01-01

Background Subsistence hunting is a traditional practice providing food and many other goods for households in the Yucatan Peninsula, southeast Mexico. Economic, demographic, and cultural change in this region drive wildlife habitat loss and local extinctions. Improving our understanding about current practices of wildlife use may support better management strategies for conserving game species and their habitat. We aimed to evaluate if wildlife use remained relevant for the subsistence of rural residents of the Yucatan Peninsula, as well as if local hunting practices were related to environmental, geographical, and cultural factors. Methods Fieldwork was done between March 2010 and March 2011. Information was obtained through conversations, interviews, and participant observation. Record forms allowed recording animals hunted, biomass extracted, distance intervals to hunting sites, habitat types and seasonality of wildlife harvests. Data were analyzed using one-way Analysis of Variance, and Generalized Linear Models. Results Forty-six terrestrial vertebrate species were used for obtaining food, medicine, tools, adornments, pets, ritual objects, and for sale and mitigating damage. We recorded 968 animals taken in 664 successful hunting events. The Great Curassow, Ocellated Turkey, paca, white-tailed deer, and collared peccary were the top harvested species, providing 80.7% of biomass (10,190 kg). The numbers of animals hunted and biomass extracted declined as hunting distances increased from villages. Average per capita consumption was 4.65 ± 2.7 kg/person/year. Hunting frequencies were similar in forested and agricultural areas. Discussion Wildlife use, hunting patterns, and technologies observed in our study sites were similar to those recorded in previous studies for rural Mayan and mestizo communities in the Yucatan Peninsula and other Neotropical sites. The most heavily hunted species were those providing more products and by-products for residents. Large

Disseminated Tuberculosis and Chronic Mucocutaneous Candidiasis in a Patient with a Gain-of-Function Mutation in Signal Transduction and Activator of Transcription 1.

PubMed

Pedraza-Sánchez, Sigifredo; Lezana-Fernández, Jose Luis; Gonzalez, Yolanda; Martínez-Robles, Luis; Ventura-Ayala, María Laura; Sadowinski-Pine, Stanislaw; Nava-Frías, Margarita; Moreno-Espinosa, Sarbelio; Casanova, Jean-Laurent; Puel, Anne; Boisson-Dupuis, Stephanie; Torres, Martha

2017-01-01

In humans, recessive loss-of-function mutations in STAT1 are associated with mycobacterial and viral infections, whereas gain-of-function (GOF) mutations in STAT1 are associated with a type of primary immunodeficiency related mainly, but not exclusively, to chronic mucocutaneous candidiasis (CMC). We studied and established a molecular diagnosis in a pediatric patient with mycobacterial infections, associated with CMC. The patient, daughter of a non-consanguineous mestizo Mexican family, had axillary adenitis secondary to BCG vaccination and was cured with resection of the abscess at 1-year old. At the age of 4 years, she had a supraclavicular abscess with acid-fast-staining bacilli identified in the soft tissue and bone, with clinical signs of disseminated infection and a positive Gene-X-pert test, which responded to anti-mycobacterial drugs. Laboratory tests of the IL-12/interferon gamma (IFN-γ) circuit showed a higher production of IL-12p70 in the whole blood from the patient compared to healthy controls, when stimulated with BCG and BCG + IFN-γ. The whole blood of the patient produced 35% less IFN-γ compared to controls assessed by ELISA and flow cytometry, but IL-17 producing T cells from patient were almost absent in PBMC stimulated with PMA plus ionomycin. Signal transduction and activator of transcription 1 (STAT1) was hyperphosphorylated at tyrosine 701 in response to IFN-γ and -α, as demonstrated by flow cytometry and Western blotting in fresh blood mononuclear cells and in Epstein-Barr virus lymphoblastoid cell lines (EBV-LCLs); phosphorylation of STAT1 in EBV-LCLs from the patient was resistant to inhibition by staurosporine but sensitive to ruxolitinib, a Jak phosphorylation inhibitor. Genomic DNA sequencing showed a de novo mutation in STAT1 in cells from the patient, absent in her parents and brother; a known T385M missense mutation in the DNA-binding domain of the transcription factor was identified, and it is a GOF mutation. Therefore

Gender-Dependent Association of FTO Polymorphisms with Body Mass Index in Mexicans

PubMed Central

Saldaña-Alvarez, Yolanda; Salas-Martínez, María Guadalupe; García-Ortiz, Humberto; Luckie-Duque, Angélica; García-Cárdenas, Gustavo; Vicenteño-Ayala, Hermenegildo; Cordova, Emilio J.; Esparza-Aguilar, Marcelino; Contreras-Cubas, Cecilia; Carnevale, Alessandra; Chávez-Saldaña, Margarita; Orozco, Lorena

2016-01-01

To evaluate the associations between six single-nucleotide polymorphisms (SNPs) in intron 1 of FTO and body mass index (BMI), a case-control association study of 2314 unrelated Mexican-Mestizo adult subjects was performed. The association between each SNP and BMI was tested using logistic and linear regression adjusted for age, gender, and ancestry and assuming additive, recessive, and dominant effects of the minor allele. Association analysis after BMI stratification showed that all five FTO SNPs (rs1121980, rs17817449, rs3751812, rs9930506, and rs17817449), were significantly associated with obesity class II/III under an additive model (P<0.05). Interestingly, we also documented a genetic model-dependent influence of gender on the effect of FTO variants on increased BMI. Two SNPs were specifically associated in males under a dominant model, while the remainder were associated with females under additive and recessive models (P<0.05). The SNP rs9930506 showed the highest increased in obesity risk in females (odds ratio = 4.4). Linear regression using BMI as a continuous trait also revealed differential FTO SNP contributions. Homozygous individuals for the risk alleles of rs17817449, rs3751812, and rs9930506 were on average 2.18 kg/m2 heavier than homozygous for the wild-type alleles; rs1121980 and rs8044769 showed significant but less-strong effects on BMI (1.54 kg/m2 and 0.9 kg/m2, respectively). Remarkably, rs9930506 also exhibited positive interactions with age and BMI in a gender-dependent manner. Women carrying the minor allele of this variant have a significant increase in BMI by year (0.42 kg/m2, P = 1.17 x 10−10). Linear regression haplotype analysis under an additive model, confirmed that the TGTGC haplotype harboring all five minor alleles, increased the BMI of carriers by 2.36 kg/m2 (P = 1.15 x 10−5). Our data suggest that FTO SNPs make differential contributions to obesity risk and support the hypothesis that gender differences in the mechanisms

Disseminated Tuberculosis and Chronic Mucocutaneous Candidiasis in a Patient with a Gain-of-Function Mutation in Signal Transduction and Activator of Transcription 1

PubMed Central

Pedraza-Sánchez, Sigifredo; Lezana-Fernández, Jose Luis; Gonzalez, Yolanda; Martínez-Robles, Luis; Ventura-Ayala, María Laura; Sadowinski-Pine, Stanislaw; Nava-Frías, Margarita; Moreno-Espinosa, Sarbelio; Casanova, Jean-Laurent; Puel, Anne; Boisson-Dupuis, Stephanie; Torres, Martha

2017-01-01

In humans, recessive loss-of-function mutations in STAT1 are associated with mycobacterial and viral infections, whereas gain-of-function (GOF) mutations in STAT1 are associated with a type of primary immunodeficiency related mainly, but not exclusively, to chronic mucocutaneous candidiasis (CMC). We studied and established a molecular diagnosis in a pediatric patient with mycobacterial infections, associated with CMC. The patient, daughter of a non-consanguineous mestizo Mexican family, had axillary adenitis secondary to BCG vaccination and was cured with resection of the abscess at 1-year old. At the age of 4 years, she had a supraclavicular abscess with acid-fast-staining bacilli identified in the soft tissue and bone, with clinical signs of disseminated infection and a positive Gene-X-pert test, which responded to anti-mycobacterial drugs. Laboratory tests of the IL-12/interferon gamma (IFN-γ) circuit showed a higher production of IL-12p70 in the whole blood from the patient compared to healthy controls, when stimulated with BCG and BCG + IFN-γ. The whole blood of the patient produced 35% less IFN-γ compared to controls assessed by ELISA and flow cytometry, but IL-17 producing T cells from patient were almost absent in PBMC stimulated with PMA plus ionomycin. Signal transduction and activator of transcription 1 (STAT1) was hyperphosphorylated at tyrosine 701 in response to IFN-γ and -α, as demonstrated by flow cytometry and Western blotting in fresh blood mononuclear cells and in Epstein-Barr virus lymphoblastoid cell lines (EBV-LCLs); phosphorylation of STAT1 in EBV-LCLs from the patient was resistant to inhibition by staurosporine but sensitive to ruxolitinib, a Jak phosphorylation inhibitor. Genomic DNA sequencing showed a de novo mutation in STAT1 in cells from the patient, absent in her parents and brother; a known T385M missense mutation in the DNA-binding domain of the transcription factor was identified, and it is a GOF mutation. Therefore

[Mangrove dynamics in the Cispata lagoon system (Colombian Caribbean) during last 900 years].

PubMed

Castaño, Ana; Urrego, Ligia; Bernal, Gladys

2010-12-01

The lagoon complex of Cispatá (old Sinú river delta) located at the Northwestern coast of the Colombian Caribbean, encloses one of the biggest mangrove areas in this region. This area has changed during the last 330 years because of several environmental and climatic causes, mainly changes in the position of the delta (Sinú River), which is the main freshwater source in this area, and sea level rise. We hypothesized that the climatic and geomorphologic dynamics has caused changes in the extension and composition of mangrove vegetation, especially during last 150 years. The dynamics of mangroves during the last 900 years was reconstructed based on the changes in the stratigraphy, pollen record, calcite concentrations (CaCO3) and C/N ratio, along two sediment cores from La Flotante and Navio lagoons, located in Cispatá complex. The age model was built based on lineal interpolation of 210Pb ages and changes in granulometry. Establishment and expansion of mangrove forests during the last 900 years were related to fluviomarine dynamics in the area and the lagoon formation. During the period encompassed between 1064 and 1762 A.D., the Mestizos spit was formed when marine conditions predominated in the surroundings of La Flotante Lagoon. At the site of Navío, a river dominated lagoon, terrigenous conditions dominated since 1830. Although the colonization of herbaceous pioneer vegetation started between 1142 and 1331 A.D., mangrove colonization only took place since 1717 A.D. Mangrove colonization was a result of the delta progradation. In 1849 A.D. the Sinú river delta migrated to the Cispatá bay. The eustatic sea level rise, the increase in river discharges and sedimentation rates produced the establishment of mangrove forests dominated by Rhizophora since 1849. Since 1900 a marine intrusion was recorded in both lagoons. In 1938, the migration of the delta toward its actual location in Tinajones gave place to the formation of the present lagoon system and to the

Relationship of metabolic syndrome and its components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children.

PubMed

De la Cruz-Mosso, Ulises; Muñoz-Valle, José F; Salgado-Goytia, Lorenzo; García-Carreón, Adrián; Illades-Aguiar, Berenice; Castañeda-Saucedo, Eduardo; Parra-Rojas, Isela

2012-03-29

Several association studies have shown that -844 G/A and HindIII C/G PAI-1 polymorphisms are related with increase of PAI-1 levels, obesity, insulin resistance, glucose intolerance, hypertension and dyslipidemia, which are components of metabolic syndrome. The aim of this study was to analyze the allele and genotype frequencies of these polymorphisms in PAI-1 gene and its association with metabolic syndrome and its components in a sample of Mexican mestizo children. This study included 100 children with an age range between 6-11 years divided in two groups: a) 48 children diagnosed with metabolic syndrome and b) 52 children metabolically healthy without any clinical and biochemical alteration. Metabolic syndrome was defined as the presence of three or more of the following criteria: fasting glucose levels ≥ 100 mg/dL, triglycerides ≥ 150 mg/dL, HDL-cholesterol < 40 mg/dL, obesity BMI ≥ 95th percentile, systolic blood pressure (SBP) and diastolic blood pressure (DBP) ≥ 95th percentile and insulin resistance HOMA-IR ≥ 2.4. The -844 G/A and HindIII C/G PAI-1 polymorphisms were analyzed by PCR-RFLP. For the -844 G/A polymorphism, the G/A genotype (OR = 2.79; 95% CI, 1.11-7.08; p = 0.015) and the A allele (OR = 2.2; 95% CI, 1.10-4.43; p = 0.015) were associated with metabolic syndrome. The -844 G/A and A/A genotypes were associated with increase in plasma triglycerides levels (OR = 2.6; 95% CI, 1.16 to 6.04; p = 0.02), decrease in plasma HDL-cholesterol levels (OR = 2.4; 95% CI, 1.06 to 5.42; p = 0.03) and obesity (OR = 2.6; 95% CI, 1.17-5.92; p = 0.01). The C/G and G/G genotypes of the HindIII C/G polymorphism contributed to a significant increase in plasma total cholesterol levels (179 vs. 165 mg/dL; p = 0.02) in comparison with C/C genotype. The -844 G/A PAI-1 polymorphism is related with the risk of developing metabolic syndrome, obesity and atherogenic dyslipidemia, and the HindIII C/G PAI-1 polymorphism was associated with the increase of total

Wildlife uses and hunting patterns in rural communities of the Yucatan Peninsula, Mexico.

PubMed

Santos-Fita, Dídac; Naranjo, Eduardo J; Rangel-Salazar, José Luis

2012-10-02

Subsistence hunting is a traditional practice providing food and many other goods for households in the Yucatan Peninsula, southeast Mexico. Economic, demographic, and cultural change in this region drive wildlife habitat loss and local extinctions. Improving our understanding about current practices of wildlife use may support better management strategies for conserving game species and their habitat. We aimed to evaluate if wildlife use remained relevant for the subsistence of rural residents of the Yucatan Peninsula, as well as if local hunting practices were related to environmental, geographical, and cultural factors. Fieldwork was done between March 2010 and March 2011. Information was obtained through conversations, interviews, and participant observation. Record forms allowed recording animals hunted, biomass extracted, distance intervals to hunting sites, habitat types and seasonality of wildlife harvests. Data were analyzed using one-way Analysis of Variance, and Generalized Linear Models. Forty-six terrestrial vertebrate species were used for obtaining food, medicine, tools, adornments, pets, ritual objects, and for sale and mitigating damage. We recorded 968 animals taken in 664 successful hunting events. The Great Curassow, Ocellated Turkey, paca, white-tailed deer, and collared peccary were the top harvested species, providing 80.7% of biomass (10,190 kg). The numbers of animals hunted and biomass extracted declined as hunting distances increased from villages. Average per capita consumption was 4.65 ± 2.7 kg/person/year. Hunting frequencies were similar in forested and agricultural areas. Wildlife use, hunting patterns, and technologies observed in our study sites were similar to those recorded in previous studies for rural Mayan and mestizo communities in the Yucatan Peninsula and other Neotropical sites. The most heavily hunted species were those providing more products and by-products for residents. Large birds such as the Great Curassow and

Haplotypic Background of a Private Allele at High Frequency in the Americas

PubMed Central

Schroeder, Kari B.; Jakobsson, Mattias; Crawford, Michael H.; Schurr, Theodore G.; Boca, Simina M.; Conrad, Donald F.; Tito, Raul Y.; Osipova, Ludmilla P.; Tarskaia, Larissa A.; Zhadanov, Sergey I.; Wall, Jeffrey D.; Pritchard, Jonathan K.; Malhi, Ripan S.; Smith, David G.; Rosenberg, Noah A.

2009-01-01

Recently, the observation of a high-frequency private allele, the 9-repeat allele at microsatellite D9S1120, in all sampled Native American and Western Beringian populations has been interpreted as evidence that all modern Native Americans descend primarily from a single founding population. However, this inference assumed that all copies of the 9-repeat allele were identical by descent and that the geographic distribution of this allele had not been influenced by natural selection. To investigate whether these assumptions are satisfied, we genotyped 34 single nucleotide polymorphisms across ∼500 kilobases (kb) around D9S1120 in 21 Native American and Western Beringian populations and 54 other worldwide populations. All chromosomes with the 9-repeat allele share the same haplotypic background in the vicinity of D9S1120, suggesting that all sampled copies of the 9-repeat allele are identical by descent. Ninety-one percent of these chromosomes share the same 76.26 kb haplotype, which we call the “American Modal Haplotype” (AMH). Three observations lead us to conclude that the high frequency and widespread distribution of the 9-repeat allele are unlikely to be the result of positive selection: 1) aside from its association with the 9-repeat allele, the AMH does not have a high frequency in the Americas, 2) the AMH is not unusually long for its frequency compared with other haplotypes in the Americas, and 3) in Latin American mestizo populations, the proportion of Native American ancestry at D9S1120 is not unusual compared with that observed at other genomewide microsatellites. Using a new method for estimating the time to the most recent common ancestor (MRCA) of all sampled copies of an allele on the basis of an estimate of the length of the genealogy descended from the MRCA, we calculate the mean time to the MRCA of the 9-repeat allele to be between 7,325 and 39,900 years, depending on the demographic model used. The results support the hypothesis that all

Use of dietary supplements by pregnant women in Colombia.

PubMed

Ramírez-Vélez, Robinson; Correa-Bautista, Jorge Enrique; Triana-Reina, Héctor Reynaldo; González-Jiménez, Emilio; Schmidt-RioValle, Jacqueline; González-Ruíz, Katherine

2018-05-02

During pregnancy, the need for certain nutrients increases. This study assessed the prevalence and socio-demographic factors associated with dietary supplement use in a representative sample of pregnant women in Colombia. Data for this study were obtained from a cross-sectional, nationally representative survey (ENSIN, 2010). A total of 1856 pregnant women, 13-49 years of age, were recruited. The use of prenatal dietary supplements (Vitamins A, C or E) was treated as a binary outcome (used at some time or never sued during pregnancy when prescribed by a doctor) in multinomial analyses. Sociodemographic data and associated factors were assessed by computer-assisted personal interview technology. Of the sample, 1123 women (68.6%) reported taking prenatal dietary supplements at some stage during their pregnancy. Most users had a high socioeconomic level (79.5%), were in their third trimester of pregnancy (79.5%), were 30-49 years of age (74.0%), and lived in the central region of Colombia (73.8%). The multivariate logistic regression showed that third trimester of pregnancy (OR 6.2;95% CI 4.0 to 9.3), high educational level (OR 2.3; 95% CI 1.5 to 3.4), high socioeconomic level -SISBEN IV or more- (OR 2.0; 95% CI 1.4 to 2.8), residence in the Atlantic region (north) (OR 2.6; 95% CI 1.7 to 3.6), Eastern region (OR 2.0; 95% CI 1.3 to 3.1), central region (OR 2.6; 95% CI 1.7 to 3.9), Pacific region (west) (OR 1.5; 95% CI 1.0 to 2.3), and belonging to the mestizo (others) ethnic group (OR 1.2; 95% CI 1.0 to 2.6), were all associated with a higher probability of dietary supplement intake. The prevalence of prenatal dietary supplements in pregnant women in Colombia was found to be substantial. The variables significantly associated with their use were educational level, socioeconomic level, trimester of pregnancy, geographic level and ethnic group. These results indicate the necessity of implementing new health policies that guarantee uniform access to nutritional

Polymorphisms of alcohol metabolizing enzymes in indigenous Mexican population: unusual high frequency of CYP2E1*c2 allele.

PubMed

Gordillo-Bastidas, Elizabeth; Panduro, Arturo; Gordillo-Bastidas, Daniela; Zepeda-Carrillo, Eloy A; García-Bañuelos, Jesús J; Muñoz-Valle, José F; Bastidas-Ramírez, Blanca E

2010-01-01

Alcohol abuse represents the major identified etiological factor of cirrhosis in México. ADH1B, ALDH2, and CYP2E1 have been considered candidate genes in alcohol-related diseases. Controversial results probably due to ethnic differences, among other factors, have been reported. Mexican Mestizos (MES) derive from the combination of indigenous, Spaniard, and African genes. Huichols (HUI) constitute an indigenous group from western Mexico with no racial admixture. We determined ADH1B*2, ALDH2*2, and CYP2E1*c2 allele frequencies in healthy HUI and MES from western Mexico. Lipid and hepatic profile were also carried out. One hundred and one HUI and 331 MES subjects were studied. Genotype and allele frequency were assessed through polymerase chain reaction-restriction fragment length polymorphism after DNA isolation from peripheral leukocytes. Commercial kits for lipid and hepatic determinations were used. Polymorphic allele distribution in HUI was: 0%ADH1B*2, 0.5%ALDH2*2, 51.5%CYP2E1*c2; in MES: 3.4%ADH1B*2, 0%ALDH2*2, 16.1%CYP2E1*c2. Frequency of ADH1B*2 was statistically (p < 0.001) lower in HUI than MES. CYP2E1*c2 polymorphic allele was significantly higher (p < 0.0001) in HUI than MES. Hepatic profile was normal in both groups. HUI showed a better lipid profile than MES independently of genotype. Huichols exhibited the highest CYP2E1*c2 allele frequency of the world documented up to this date; meanwhile, ADH1B*2 and ALDH2*2 were practically absent. This feature could be useful in the understanding of Mexican population gene composition, alcohol metabolism, and alcoholic liver disease development. However, further association studies are necessary. The heterogeneity of Mexican population was evidenced by the significantly different distribution of CYP2E1*c2 allele observed among different regions of the country. Lipid and hepatic values were not associated to genotype. This report constitutes the first study dealing with gene polymorphisms of alcohol metabolizing

El Salvador.

PubMed

1993-02-01

Background notes on El Salvador capsulizes specific statistical and descriptive information on geography, demography, government. and economic conditions. The man text describes the people, their history and the nature of the peace process, principal government officials, political conditions, human rights, the state of the economy, foreign relations, and relations with the US. In 1992, the estimated population was about 5 million of which 89% are mestizo (Spanish-Indian), 10% Indian, and 1% Caucasian. 58% live in rural areas. It is largely Roman Catholic. Literacy is about 65% among adults. 6 years of education are compulsory. 40% are engaged in agriculture, 27% in services, and 16% in industry. The gross domestic product was $5.1 billion; per capita income was $1160. El Salvador's history has been marked by frequent revolutions. Almost every present since 1932 has been a military officer. In the more recent past (1969-80), Honduras and El Salvador fought over borders; a peace treaty was signed in 1980, but it was not until 1992 that the land in dispute was awarded by the International Court of Justice to Honduras. During the 1970, efforts by Duarte were made toward democratic reform, but fraud and corruption contributed to the rise of armed guerrilla warfare as a means to bring about change. There were rightist and leftists groups accelerating violence; event he Salvadoran armed forces engaged in lawlessness. The judicial system failed. Nicaragua after 1979 supplied arms and munitions to 5 guerrilla groups. Duarte returned to power and his junta initiated land reform and nationalized banks and marketing of coffee and sugar. The elections in 1982 led to the transfer of power to Alvaro Magana. The new constitution in 1983 appeased some, but land reforms still did not satisfy guerrillas. Duarte was elected again in 1984 and Alfredo Christiani in 1989 in a peaceful transfer of power. In 1991 and 1992 peace accords were signed with the guerrillas. During this 12-year

Multicenter study to assess presenteeism in systemic lupus erythematosus and its relationship with clinical and sociodemographic features.

PubMed

Cosatti, M A; Muñoz, S; Alba, P; Helling, C A; Roverano, S; Sarano, J; Malm-Green, S; Danielsen, M; Medina Bornachera, D; Alvarez, A; Eimon, A; Pendón, G; Mayer, M; Marin, J; Catoggio, C; Pisoni, C N

2018-01-01

Objective The aim of this study was to measure presenteeism (productivity impairment while the patient is at work) and the related risk factors in patients with systemic lupus erythematosus (SLE) from Argentina. Methods A total of 130 consecutive (1997 American College of Rheumatology (ACR) criteria) working patients with SLE were assessed using a standardized data collection form. Sociodemographic, disease and work-related variables were collected. The Work Productivity and Activity Impairment (WPAI) questionnaire was performed. Results Overall, 130 patients were included in the analysis; 91% were women, and the mean age was 39 years (range 19-77). A total of 43% were White, 43% Mestizo and 13% Amerindian. Overall, 38% were single and 38% were married. A total of 75% had more than 12 years of formal education. The median disease duration was 7 years (interquartile range 25-75 (IQR) 4-13). Median Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) score was 0 (IQR 0-2), and median Systemic Lupus International Collaborating Clinics/ACR Damage Index (SLICC-SDI) score was 0 (IQR 0-1). Lupus quality of life (LupusQoL) domains scores were: physical health 87 (IQR 70-96), emotional health 78 (IQR 54-91), burden to others 75 (IQR 50-92), intimate relationships 87 (IQR 50-100), and body image 85 (IQR 70-100). Absenteeism was 8%, presenteeism was 19%, and overall work impairment (absenteeism + presenteeism) was 26%. In the multiple regression analysis, considering presenteeism as dependent variable, (adjusting by age, disease duration, >12 years of education, Non-white race, Visual Analogue Scale (VAS) pain, VAS fatigue, SLICC-SDI, LupusQoL, physical and emotional domains), we found that SLICC-SDI (odds ratio (OR) 1.68, confidence interval (CI) 1-2.7) and Non-white race (OR 3.27, CI 1.04-10) were related to presenteeism and >12 years of education (OR 0.30, CI 0.09-0.98) and higher scores of LupusQoL emotional health domain (OR 0.95, CI 0.92-0.98) were protective

Circulating CD4+CD28null and extra-thymic CD4+CD8+ double positive T cells are independently associated with disease damage in systemic lupus erythematosus patients.

PubMed

Ugarte-Gil, M F; Sánchez-Zúñiga, C; Gamboa-Cárdenas, R V; Aliaga-Zamudio, M; Zevallos, F; Tineo-Pozo, G; Cucho-Venegas, J M; Mosqueira-Riveros, A; Medina, M; Perich-Campos, R A; Alfaro-Lozano, J L; Rodriguez-Bellido, Z; Alarcón, G S; Pastor-Asurza, C A

2016-03-01

To determine whether circulating CD4+CD28null and extra-thymic CD4+CD8+ double positive (DP) T cells are independently associated with damage accrual in systemic lupus erythematosus (SLE) patients. This cross-sectional study was conducted between September 2013 and April 2014 in consecutive SLE patients from our Rheumatology Department. CD4+CD28null and CD4+CD8+ DP T-cell frequencies were analyzed by flow-cytometry. The association of damage (SLICC/ACR Damage Index, SDI) and CD4+CD28null and CD4+CD8+ DP T cells was examined by univariable and multivariable Poisson regression models, adjusting for possible confounders. All analyses were performed using SPSS 21.0. Patients' (n = 133) mean (SD) age at diagnosis was 35.5 (16.8) years, 124 (93.2%) were female; all were mestizo (mixed Caucasian and Amerindian ancestry). Disease duration was 7.4 (6.8) years. The SLE Disease Activity Index was 5.5 (4.2), and the SDI 0.9 (1.2). The percentages of CD4+CD28null and CD4+CD8+ DP T cells were 17.1 (14.4) and 0.4 (1.4), respectively. The percentage of CD4+CD28null and CD4+CD8+ DP T cells were positively associated with a higher SDI in both univariable (rate ratio (RR) 1.02, 95% confidence interval (CI): 1.01-1.03 and 1.17, 95% CI: 1.07-1.27, respectively; p < 0.001 for both) and multivariable analyses RR 1.02, 95% CI: 1.01-1.03, p = 0.001 for CD4+CD28null T cells and 1.28, 95% CI: 1.13-1.44, p < 0.001 for CD4+CD8+ DP T cells). Only the renal domain remained associated with CD4+CD28null in multivariable analyses (RR 1.023 (1.002-1.045); p = 0.034). In SLE patients, CD4+CD28null and CD4+CD8+ DP T cells are independently associated with disease damage. Longitudinal studies are warranted to determine the predictive value of these associations. © The Author(s) 2015.

Nasal base, maxillary, and infraorbital implants--alloplastic.

PubMed

Hinderer, U T

1991-01-01

The aesthetic surgery of the facial skeletal contour requires either the performance of ostectomies of excessively prominent segments or the augmentation of retruded segments with organic or synthetic material, in order to achieve balanced tridimensional relations of each segment with regard to the total facial unit. Craniomaxillofacial surgeries are necessary in major malformations or in those combined with malocclusion. In the nasal dorsum or tip, the author prefers the use of cartilage, because synthetic materials need adequate soft-tissue bulk for cover to be inserted without tension and absence of passive mobility of the reception site. For malar augmentation, first proposed by the author and independently by Spadafora in 1971, for chin augmentation up to 8 mm, and for augmentation of the mandibular angle, the author prefers silicone implants because they do not change in shape or volume, may be premanufactured or custom-made, have a similar consistency to that of bone, and do not support bacterial growth. On the other hand, autologous bone grafts adapt less to curved bony surfaces, have an erratic rate of resorption, and need an additional surgical step for removal with the corresponding morbidity and scar. Subperiosteal insertion is preferred because it confers greater stability and the cavity is easier to dissect without soft-tissue damage. Although bone erosion may occur, with over 1200 implants clinically no major change in the soft-tissue contour has been observed, nor has the author been consulted for late complication. In the malar region this may be due to the large surface of the implant and absence of muscular pressure. In the chin, an insertion over the site of the dental roots is avoided. For midface augmentation the following implants are used: (1) The premaxillary lower nasal base implant, proposed in 1971, is indicated to correct a concave midfacial profile, frequent in Asian, black, and Mestizo patients from Latin America and in Caucasian

Relationship of metabolic syndrome and its components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children

PubMed Central

2012-01-01

Background Several association studies have shown that -844 G/A and HindIII C/G PAI-1 polymorphisms are related with increase of PAI-1 levels, obesity, insulin resistance, glucose intolerance, hypertension and dyslipidemia, which are components of metabolic syndrome. The aim of this study was to analyze the allele and genotype frequencies of these polymorphisms in PAI-1 gene and its association with metabolic syndrome and its components in a sample of Mexican mestizo children. Methods This study included 100 children with an age range between 6-11 years divided in two groups: a) 48 children diagnosed with metabolic syndrome and b) 52 children metabolically healthy without any clinical and biochemical alteration. Metabolic syndrome was defined as the presence of three or more of the following criteria: fasting glucose levels ≥ 100 mg/dL, triglycerides ≥ 150 mg/dL, HDL-cholesterol < 40 mg/dL, obesity BMI ≥ 95th percentile, systolic blood pressure (SBP) and diastolic blood pressure (DBP) ≥ 95th percentile and insulin resistance HOMA-IR ≥ 2.4. The -844 G/A and HindIII C/G PAI-1 polymorphisms were analyzed by PCR-RFLP. Results For the -844 G/A polymorphism, the G/A genotype (OR = 2.79; 95% CI, 1.11-7.08; p = 0.015) and the A allele (OR = 2.2; 95% CI, 1.10-4.43; p = 0.015) were associated with metabolic syndrome. The -844 G/A and A/A genotypes were associated with increase in plasma triglycerides levels (OR = 2.6; 95% CI, 1.16 to 6.04; p = 0.02), decrease in plasma HDL-cholesterol levels (OR = 2.4; 95% CI, 1.06 to 5.42; p = 0.03) and obesity (OR = 2.6; 95% CI, 1.17-5.92; p = 0.01). The C/G and G/G genotypes of the HindIII C/G polymorphism contributed to a significant increase in plasma total cholesterol levels (179 vs. 165 mg/dL; p = 0.02) in comparison with C/C genotype. Conclusions The -844 G/A PAI-1 polymorphism is related with the risk of developing metabolic syndrome, obesity and atherogenic dyslipidemia, and the HindIII C/G PAI-1 polymorphism was

Papiloma invertido sinunasal con invasión intracraneal: Reporte de caso y revisión bibliográfica

PubMed Central

Di Pietrantonio, Andrés; Asmus, Humberto; Ingratta, Christian; Brennan, Walter; Schulz, Javier; Carballo, Leandro

2018-01-01

Resumen IntroducciÓn: El papiloma invertido es una neoplasia benigna de los senos paranasales localmente agresiva con alto potencial de recurrencia y de malignización. La extensión intracraneal es infrecuente y más aún, la penetración dural, asociándose a menudo a la recurrencia de la enfermedad o a su degeneración en carcinoma de células escamosas. Caso clínico: Presentamos el caso de una paciente de 32 años que consultó por lesión exofítica en fosa nasal derecha y exoftalmos, asociada a cefalea, anosmia y disgeusia. Se estudió con TC cerebro, macizo facial y RM de encéfalo que evidencian lesión en fosa nasal derecha con ocupación de senos aéreos, osteólisis de pared medial orbitaria y base de cráneo anterior e invasión intracraneal frontal derecha, con efecto de masa y compresión del parénquima encefálico adyacente. Intervención: Se realizó una nasofibroscopía en primer tiempo con diagnóstico anatomopatológico de papiloma invertido y posteriormente resección de la lesión mediante doble abordaje más reconstrucción de la fosa craneal anterior. Se obtuvo diagnóstico definitivo de papiloma invertido de tipo Schneideriano con áreas de transformación atípica in situ. La paciente evolucionó de forma favorable y sin complicaciones, con permeabilidad de vía aérea superior, sin signos de recidiva lesional luego de 4 años de seguimiento. Conclusión: La invasión intracraneal de esta patología es sumamente infrecuente. Cuando existe, es indicador de agresividad y potencial recidiva, por lo que la exéresis completa de la misma define el pronóstico de la enfermedad. PMID:29430328

DIABETES MELLITUS COMO FACTOR DE RIESGO DE DEMENCIA EN LA POBLACIÓN ADULTA MAYOR MEXICANA

PubMed Central

Silvia, Mejía-Arango; Clemente, y Zúñiga-Gil

2012-01-01

Introduccion La diabetes mellitus y las demencias constituyen dos problemas crecientes de salud entre la población adulta mayor del mundo y en particular de los paises en desarrollo. Hacen falta estudios longitudinales sobre el papel de la diabetes como factor de riesgo para demencia. Objetivo Determinar el riesgo de demencia en sujetos Mexicanos con diabetes mellitus tipo 2. Materiales y Metodos Los sujetos diabéticos libres de demencia pertenecientes al Estudio Nacional de Salud y Envejecimiento en México fueron evaluados a los dos años de la línea de base. Se estudió el papel de los factores sociodemográficos, de otras comorbilidades y del tipo de tratamiento en la conversión a demencia. Resultados Durante la línea de base 749 sujetos (13.8%) tuvieron diabetes. El riesgo de desarrollar demencia en estos individuos fue el doble (RR, 2.08 IC 95%, 1.59–2.73). Se encontró un riesgo mayor en individuos de 80 años y más (RR 2.44 IC 95%, 1.46–4.08), en los hombres (RR, 2.25 IC 95%, 1.46–3.49) y en sujetos con nivel educativo menor de 7 años. El estar bajo tratamiento con insulina incrementó el riesgo de demencia (RR, 2.83, IC 95%, 1.58–5.06). Las otras comorbilidades que aumentaron el riesgo de demencia en los pacientes diabéticos fueron la hipertensión (RR, 2.75, IC 95%, 1.86–4.06) y la depresión (RR, 3.78, 95% IC 2.37–6.04). Conclusión Los sujetos con diabetes mellitus tienen un riesgo mayor de desarrollar demencia, La baja escolaridad y otras comorbilidades altamente prevalentes en la población Mexicana contribuyen a la asociación diabetes-demencia. PMID:21948010

[Not Available].

PubMed

Burgos Peláez, Rosa; Cuerda Compes, María Cristina; García-Luna, Pedro P; Martínez Faedo, Ceferino; Mauri Roca, Sílvia; Moreno Villares, José Manuel; Virgili Casas, M Nuria; Wanden-Berghe, Carmina

2016-07-19

Introducción:la nutrición parenteral (NP) a largo plazo puede asociarse a complicaciones graves, con un deterioro importante de la calidad de vida de los pacientes con síndrome de intestino corto (SIC). Teduglutida, un análogo del péptido-2 similar al glucagón, pertenece a una nueva familia terapéutica y representa el primer abordaje no sintomático del SIC. Objetivos: revisar los datos preclínicos y clínicos en cuanto a eficacia y seguridad de teduglutida. Resultados: la aprobación de teduglutida se basó en los resultados de un estudio en fase III de 24 semanas, doble ciego, controlado con placebo (STEPS). Pacientes con fallo intestinal por SIC dependientes de NP ≥ 3 veces/semana durante ≥ 12 meses recibieron 0,05 mg/kg de teduglutida (n = 43) o placebo (n = 43) 1 vez/día. En la semana 24 hubo significativamente más respondedores en el grupo de teduglutida que en el de placebo (63 vs.30%; p = 0,002). La reducción absoluta media del volumen de NP frente al valor basal en la semana 24 fue significativamente mayor con teduglutida (4,4 vs.2,3 l/semana; p < 0,001). La necesidad de NP se redujo ≥ 1 día en la semana 24 en el 54% de pacientes tratados con teduglutida vs.23% con placebo. Del total de pacientes que recibieron teduglutida en los ensayos en fase III (n = 134), el 12% consiguió una autonomía completa de la NP. Por lo general, la administración subcutánea de teduglutida se toleró bien. Conclusiones: se ha demostrado que teduglutida recupera la absorción intestinal y reduce significativamente la dependencia de la NP, consiguiendo incluso la independencia en algunos pacientes.

Long-Term Intermittent Hypoxia Elevates Cobalt Levels in the Brain and Injures White Matter in Adult Mice

PubMed Central

Veasey, Sigrid C.; Lear, Jessica; Zhu, Yan; Grinspan, Judith B.; Hare, Dominic J.; Wang, SiHe; Bunch, Dustin; Doble, Philip A.; Robinson, Stephen R.

2013-01-01

Study Objectives: Exposure to the variable oxygenation patterns in obstructive sleep apnea (OSA) causes oxidative stress within the brain. We hypothesized that this stress is associated with increased levels of redox-active metals and white matter injury. Design: Participants were randomly allocated to a control or experimental group (single independent variable). Setting: University animal house. Participants: Adult male C57BL/6J mice. Interventions: To model OSA, mice were exposed to long-term intermittent hypoxia (LTIH) for 10 hours/day for 8 weeks or sham intermittent hypoxia (SIH). Measurements and Results: Laser ablation-inductively coupled plasma-mass spectrometry was used to quantitatively map the distribution of the trace elements cobalt, copper, iron, and zinc in forebrain sections. Control mice contained 62 ± 7 ng cobalt/g wet weight, whereas LTIH mice contained 5600 ± 600 ng cobalt/g wet weight (P < 0.0001). Other elements were unchanged between conditions. Cobalt was concentrated within white matter regions of the brain, including the corpus callosum. Compared to that of control mice, the corpus callosum of LTIH mice had significantly more endoplasmic reticulum stress, fewer myelin-associated proteins, disorganized myelin sheaths, and more degenerated axon profiles. Because cobalt is an essential component of vitamin B12, serum methylmalonic acid (MMA) levels were measured. LTIH mice had low MMA levels (P < 0.0001), indicative of increased B12 activity. Conclusions: Long-term intermittent hypoxia increases brain cobalt, predominantly in the white matter. The increased cobalt is associated with endoplasmic reticulum stress, myelin loss, and axonal injury. Low plasma methylmalonic acid levels are associated with white matter injury in long-term intermittent hypoxia and possibly in obstructive sleep apnea. Citation: Veasey SC; Lear J; Zhu Y; Grinspan JB; Hare DJ; Wang S; Bunch D; Doble PA; Robinson SR. Long-term intermittent hypoxia elevates cobalt

[In the America of mountain ranges, the brief summer of Indian agrarian movements (1970-1991)].

PubMed

Le Bot, Y

1991-01-01

Important rural Indian movements appeared almost simultaneously in the early 1970s in 3 countries, Ecuador, Bolivia, and Guatemala, which had the distinction of remaining the most rural and the most Indian countries of Latin America. A similar movement with similar characteristics arose in a rural and Indian region of Colombia, a largely urban and mestizo country. Each movement constituted a particular response to the same problems in different contexts. This work provides a comparative analysis of the historical context, development, constitution, and functioning of Bolivian katarisme, the Ecuarrunari movement in Ecuador, the Regional Committee of the Indigenous of Cauca (CRIC) in Colombia, and the Committee of Peasant Unity (CUC) in Guatemala. The indigenous peasant movements were defined in relation to national-populist models of development and integration: limitations and failures of national-populism in Bolivia and to some extent also in Ecuador, marginalization of the Indian populations vis a vis modernization processes in Ecuador and Colombia, or a crisis caused by blockage of participation in the sociopolitical system in Guatemala. The movements appeared in the context of strong peasant communities left at the margin of processes of integration, but also in contexts where the social dynamics were reinforced by reforms and modernization during a long period of precarious reconstitution of communities sometimes dating back to the 1930s. Another contributing factor in some cases was the dissolution of peonage and other forms of servitude on the great estates. An Indian elite whose emergence was related to modernization of the communities is present in all the movements. It is composed of educated and partially urbanized young people who have maintained ties to the communities, of leaders trained in cooperative or union activity, of promoters of new religious currents, and others affected by change. The leaders belong to modern organizations that wish to make

"Plantas con madre": plants that teach and guide in the shamanic initiation process in the East-Central Peruvian Amazon.

PubMed

Jauregui, X; Clavo, Z M; Jovel, E M; Pardo-de-Santayana, M

2011-04-12

We present and discuss a particular group of plants used by a diversity of healers in the initiation process and apprenticeship of traditional medicine, as practiced by Amazonian societies in East-Central Peru. Often, these plants are locally called plantas con madre (plants with a mother), and are thought to guide initiates in the process of seeking sacred knowledge, learning about plant usage, and understanding traditional medicine practices. We illustrate the diversity of plants used in the apprenticeship and practice of traditional medicine, and nurture the discussion to better understand the terminology used by Indigenous healers to describe plant uses and their practices. The study was conducted between 2003 and 2008 with the participation of 29 curanderos (healers; 23 men, 6 women), 3 apprentices and 4 herbalists. The participants belonged to four ethnic groups: 17 Mestizos, 15 Shipibo-Konibo, 1 Ashaninka, and 1 Matsiguenga; a Spanish apprentice and an Italian herbalist were also included in the study. The field data were collected using semi-structured interviews, participant observation, and the witnessing of numerous healing sessions. Oral informed consent was obtained from each participant. We identified 55 plant species belonging to 26 botanical families, which are used in initiation processes and apprenticeships of traditional medicine. This group of plants is administered under strict conditions during training and healing sessions called dietas (shamanic diets), with the supervision of one or more maestros curanderos (master healers). We observed that during the shamanic diets, maestros curanderos administered plants depending on the teachings or tools he/she was passing on, and were based on a particular sequence during the initiation process: (I) purification and cleansing species; (II) sensitivity and intuition; (III) strengthening; and (IV) protection and defence. Traditional healers continue to be a primary source of health care for the majority

Nicaragua.

PubMed

1983-01-01

Focus in this discussion of Nicaragua is on the following: geography; the people and history; government and polictical conditions; the economy; foreign relations; defense; and relations between the US and Nicaragua. Nicaragua's population is 2.9 million with an annual growth rate of 3.3% (1981). The infant mortality rate is 37/1000; life expectancy is 56 years. Most Nicaraguans are mestizo, a mix of European and Indian. Smaller ethnic groups also are recognizable. A large black minority of Jamaican origin is concentrated on the Caribbean coast, although migration to Managua is on the rise. Nicaragua borders Costa Rica to the south and El Salvador--across the Gulf of Fonseca--and Honduras to the north. The climate is tropical. About 40% of the population are urban; most live in the Pacific lowlands and the adjacent interior highlands region. On July 19, 1979 the Government of National Reconstruction formed in exile as a coalition of the Sandinista Front for National Liberation (FSLN) and civic leaders, stepped into the power vacuum left by the Somoza government's collapse. The GRN was organized into a 5-member junta, the 19 member Council of Ministers, and the 33 member quasi legislative National Council. The GRN's July 19 Declaration of San Jose, promising a democratically elected government and an equitable pluralistic society, met with strong popular support. Freedom of speech, press, religion, and assembly are guaranteed by the declaration, yet the GRN's efforts at promoting political freedom have been less successful than its efforts at economic equity. At different times, the GRN has restricted operation of opposition newspapers on national security grounds, banned individual foreign films on political grounds, attempted to reduce the role of the Roman Catholic Church and tried to reduce the traditional autonomy of the national university. The country's resources are primarily agricultural. Some estimates indicate that 70% of Nicaragua's territory is usable

Mexico.

PubMed

1988-02-01

Focus in this discussion of Mexico is on the following: geography; the people; history; political conditions; the economy; foreign relations; and relations between the US and Mexico. As of July 1987, the population of Mexico numbered 81.9 million with an estimated annual growth rate of 2.09%. 60% of the population is Indian-Spanish (mestizo), 30% American Indian, 9% white, and 1% other. Mexico is the most populous Spanish-speaking country in the world and the 2nd most populous country in Latin America. Education is decentralized and expanded. Mexico's topography ranges from low desert plains and jungle-like coastal strips to high plateaus and rugged mountains. Hernan Cortes conquered Mexico in 1919-21 and founded a Spanish colony that lasted for almost 300 years. Independence from Spain was proclaimed by Father Miguel Hidalgo on September 16, 1810; the republic was established on December 6, 1822. Mexico's constitution of 1917 provides for a federal republic with a separation of powers into independent executive, legislative, and judicial branches of government. Significant political themes of the administration of President Miguel de la Madrid Hurtado, who began his 6-year term in 1982, have been restructuring the economy, liberalizing trade practices, decentralizing government services, and eliminating corruption among public servants. In 1987, estimates put the real growth of the Mexican economy at 1.5%; the gross domestic product (GDP) had shrunk by 3.5% in 1986. Yet, on the positive side, Mexico's international reserves increased to record levels in 1987 (to about $15 billion), and its current account surplus reached more than $3 billion. Mexico has made considerable progress in moving to restructure its economy. It has substantially reduced impediments to international trade and has moved to reduce the number of parastatal firms. 1987 was the 2nd consecutive year in which Mexico recorded triple-digit inflation; inflation reached 158.8%. Other problems include

A Comparative Analysis of Genetic Ancestry and Admixture in the Colombian Populations of Chocó and Medellín.

PubMed

Conley, Andrew B; Rishishwar, Lavanya; Norris, Emily T; Valderrama-Aguirre, Augusto; Mariño-Ramírez, Leonardo; Medina-Rivas, Miguel A; Jordan, I King

2017-10-05

At least 20% of Colombians identify as having African ancestry, yielding the second largest population of Afro-descendants in Latin America. To date, there have been relatively few studies focused on the genetic ancestry of Afro-Latino populations. We report a comparative analysis of the genetic ancestry of Chocó, a state located on Colombia's Pacific coast with a population that is >80% Afro-Colombian. We compared genome-wide patterns of genetic ancestry and admixture for Chocó to six other admixed American populations, with an emphasis on a Mestizo population from the nearby Colombian city of Medellín. One hundred sample donors from Chocó were genotyped across 610,545 genomic sites and compared with 94 publicly available whole genome sequences from Medellín. At the continental level, Chocó shows mostly African genetic ancestry (76%) with a nearly even split between European (13%) and Native American (11%) fractions, whereas Medellín has primarily European ancestry (75%), followed by Native American (18%) and African (7%). Sample donors from Chocó self-identify as having more African ancestry, and conversely less European and Native American ancestry, than can be genetically inferred, as opposed to what we previously found for Medellín, where individuals tend to overestimate levels of European ancestry. We developed a novel approach for subcontinental ancestry assignment, which allowed us to characterize subcontinental source populations for each of the three distinct continental ancestry fractions separately. Despite the clear differences between Chocó and Medellín at the level of continental ancestry, the two populations show overall patterns of subcontinental ancestry that are highly similar. Their African subcontinental ancestries are only slightly different, with Chocó showing more exclusive shared ancestry with the modern Yoruba (Nigerian) population, and Medellín having relatively more shared ancestry with West African populations in Sierra

A Comparative Analysis of Genetic Ancestry and Admixture in the Colombian Populations of Chocó and Medellín

PubMed Central

Conley, Andrew B.; Rishishwar, Lavanya; Norris, Emily T.; Valderrama-Aguirre, Augusto; Mariño-Ramírez, Leonardo; Medina-Rivas, Miguel A.; Jordan, I. King

2017-01-01

At least 20% of Colombians identify as having African ancestry, yielding the second largest population of Afro-descendants in Latin America. To date, there have been relatively few studies focused on the genetic ancestry of Afro-Latino populations. We report a comparative analysis of the genetic ancestry of Chocó, a state located on Colombia’s Pacific coast with a population that is >80% Afro-Colombian. We compared genome-wide patterns of genetic ancestry and admixture for Chocó to six other admixed American populations, with an emphasis on a Mestizo population from the nearby Colombian city of Medellín. One hundred sample donors from Chocó were genotyped across 610,545 genomic sites and compared with 94 publicly available whole genome sequences from Medellín. At the continental level, Chocó shows mostly African genetic ancestry (76%) with a nearly even split between European (13%) and Native American (11%) fractions, whereas Medellín has primarily European ancestry (75%), followed by Native American (18%) and African (7%). Sample donors from Chocó self-identify as having more African ancestry, and conversely less European and Native American ancestry, than can be genetically inferred, as opposed to what we previously found for Medellín, where individuals tend to overestimate levels of European ancestry. We developed a novel approach for subcontinental ancestry assignment, which allowed us to characterize subcontinental source populations for each of the three distinct continental ancestry fractions separately. Despite the clear differences between Chocó and Medellín at the level of continental ancestry, the two populations show overall patterns of subcontinental ancestry that are highly similar. Their African subcontinental ancestries are only slightly different, with Chocó showing more exclusive shared ancestry with the modern Yoruba (Nigerian) population, and Medellín having relatively more shared ancestry with West African populations in Sierra

Keywords to Recruit Spanish- and English-Speaking Participants: Evidence From an Online Postpartum Depression Randomized Controlled Trial

PubMed Central

Kelman, Alex R; Muñoz, Ricardo F

2014-01-01

Background One of the advantages of Internet-based research is the ability to efficiently recruit large, diverse samples of international participants. Currently, there is a dearth of information on the behind-the-scenes process to setting up successful online recruitment tools. Objective The objective of the study was to examine the comparative impact of Spanish- and English-language keywords for a Google AdWords campaign to recruit pregnant women to an Internet intervention and to describe the characteristics of those who enrolled in the trial. Methods Spanish- and English-language Google AdWords campaigns were created to advertise and recruit pregnant women to a Web-based randomized controlled trial for the prevention of postpartum depression, the Mothers and Babies/Mamás y Bebés Internet Project. Search engine users who clicked on the ads in response to keyword queries (eg, pregnancy, depression and pregnancy) were directed to the fully automated study website. Data on the performance of keywords associated with each Google ad reflect Web user queries from February 2009 to June 2012. Demographic information, self-reported depression symptom scores, major depressive episode status, and Internet use data were collected from enrolled participants before randomization in the intervention study. Results The Google ads received high exposure (12,983,196 impressions) and interest (176,295 clicks) from a global sample of Web users; 6745 pregnant women consented to participate and 2575 completed enrollment in the intervention study. Keywords that were descriptive of pregnancy and distress or pregnancy and health resulted in higher consent and enrollment rates (ie, high-performing ads). In both languages, broad keywords (eg, pregnancy) had the highest exposure, more consented participants, and greatest cost per consent (up to US $25.77 per consent). The online ads recruited a predominantly Spanish-speaking sample from Latin America of Mestizo racial identity. The

Women and development in Latin America and the Caribbean. Lessons from the seventies and hopes for the future.

PubMed

Arizpe, L

1982-01-01

The early implicit assumptions that industrialization or, generally, modernization should automatically improve the condition of women have been challenged more and more by research and statistical data. In Latin America and the Caribbean, the theory which held that the cultural assimilation of ethnic groups of Indian and African descent into the national Hispanic or Portuguese cultures implied an improvement in the condition of women has been challenged through ethnographic and historical research. Women in closed corporate communities may have higher status, greater participation in authority, and more support from their children than those in open mestizo communities, where excessive alcohol consumption and abusive sexual relations form an integral part of the psychosocial complex of "machismo." New research has dealt with the forced integration of black women and Indian women, as concubines of the dominant white men, as a mechanism of "mestizaje," i.e., mixing of the population, against which women had no legal or "de facto" defense. Such abuse of women, masked by racial and cultural prejudice, continues in many backward rural areas in Latin America. In discussions of the peasantry and of rural development in Latin America and the Caribbean, women had been largely ignored because agriculture was conceptualized as an exclusively male activity. This androcentric view is reflected in census categories that make the component of women's labor in agriculture invisible or unimportant. Consequently, the statistical percentages have always been unrealistically low in most countries. Detailed observations and surveys conducted during the last decade have shown, to the contrary, that peasant women work longer hours than men and are more liable to increase their time and work load to offset pauperization. The research of Deere and Leon (Colombia) as well as that of other women in different countries of the region confirms that women's subordination precedes capitalism and

Reacciones de intercambio de carga

NASA Astrophysics Data System (ADS)

Errea, L. F.

Se discute la validez de diversas metodologías y su aplicación al estudio de procesos de intercambio de carga electrónico entre iones y blancos atómicos y moleculares. Para energías de impacto entre 0.05 y 5 eV / amu se emplea el método cuántico de la Coordenada de Reacción Común (CRC). A mayores energías, se utiliza el método semiclásico iconal con un desarrollo de la función de onda dinámica en estados moleculares adiabáticos, modificados con un factor de traslación común (FTC). Estos estados pueden obtenerse con cálculos ab initio o empleando potenciales modelo. Cuando la ionización compite con la transferencia de carga, la inclusión de pseudoestados en estos desarrollos permite calcular simultáneamente las secciones eficaces de ambos procesos. Otra técnica utilizada es el método estadístico CTMC. En el tratamiento de colisiones ión-molécula (diatómica) contrastamos la aplicabilidad de distintos métodos, desde la llamada aproximación Franck-Condon hasta un desarrollo en estados vibrónicos, pasando por la aproximación súbita vibro-rotacional, obteniéndose secciones eficaces de captura electrónica total y a estados individuales, así como secciones de excitación vibracional a estados ligados y del continuo (disociación). En todos los casos es necesario calcular superficies de energía y los correspondientes acoplamientos dinámicos entre los estados. La aplicación de estos métodos permite determinar el grado de contaminación de los haces por estados metaestables en un experimento dado, el cambio en los resultados con diferentes isótopos, la importancia de procesos de doble captura, seguida de explosión culombiana, todo ello con precisión comparable a la de medidas experimentales, para sistemas de interés en distintos tipos de plasmas.

Application example: Preliminary Results of ISOLA use to find moment tensor solutions and centroid depth applied to aftershocks of Mw=8.8 February 27 2010, Maule Earthquake

NASA Astrophysics Data System (ADS)

Nacif, S. V.; Sanchez, M. A.

2013-05-01

. Figure 1. Doble-Couple focal mechanisms solutions from Moment Tensor Inversion using ISOLA. Triangles show broad band stations used in this work from IRIS-PASSCAL.

Arizona TeleMedicine Network: Segment Specifications--Tuba City via Mt. Elden, Phoenix; Keams Canyon, Second Mesa, Low Mountain; Phoenix, San Carlos, Bylas; Keams Canyon via Ganado Mesa, Ft. Defiance; Tuba City via Black Mesa, Ft. Defiance; and Budgetary Cost Information--Pinal Peak via San Xavier, Tucson.

ERIC Educational Resources Information Center

Atlantic Research Corp., Alexandria, VA.

The communication links of five different segments of the Arizona TeleMedicine Network (a telecommunication system designed to provide health services for American Indians in rurally isolated areas) and budgetary cost information for Pinal Peak via San Xavier and Tucson are described in this document. The five communication links are identified…

Distribution of stable isotopes in arid storms . II. A double-component model of kinematic wave flow and transport

NASA Astrophysics Data System (ADS)

Yakirevich, Alexander; Dody, Avraham; Adar, Eilon M.; Borisov, Viacheslav; Geyh, Mebus

édible par rapport aux observations a été obtenu après un ajustement des paramètres par une méthode d'essais et d'erreurs. L'analyse de sensibilité et l'application du modèle ont ensuite été réalisés. Le modèle est plutôt sensible aux changements des paramètres caractérisant les zones de stockage dans les dépressions. Le modèle rend compte de l'effet de mémoire isotopique dans l'eau dans le stockage des dépressions entre les événements séquentiels de pluie. L'utilisation d'un modèle à double composante d'écoulement et de transport par onde cinématique permet un ajustement qualitatif et quantitatif adapté entre les distributions des δ18O calculées et observées dans l'écoulement de surface. Resumen Un nuevo método matemático basado en un modelo de doble componente de onda cinemática de flujo y transporte permite caracterizar la distribución isotópica dinámica de las tormentas en zonas áridas y la escorrentía. Este modelo describe el transporte y la evolución del δ18O en la lluvia, flujo superficial y escorrentía en una cuenca rocosa de clima árido con detención superficial distribuida uniformemente. El modelo se calibró numéricamente utilizando un conjunto de datos de descarga temporal y de distribución de δ18O para lluvia y escorrentía recogida en una pequeña cuenca rocosa en el Centro de Experimentación de Sede Boker, Israel. Se obtuvo un buen ajuste a los datos tras un ajuste de parámetros mediante prueba y error. Se realizó un análisis de sensibilidad que indicó que el modelo resulta ser bastante sensible a cambios en los parámetros que caracterizan las zonas de baja detención superficial. El modelo también refleja el efecto de la memoria isotópica en el agua de estas zonas de detención entre los distintos periodos de lluvias. El uso de un modelo de doble componente de onda cinemática de flujo y transporte proporciona un buen ajuste cualitativo y cuantitativo entre los datos medidos y calculados de δ18O en la

Secondary Syphilis in Cali, Colombia: New Concepts in Disease Pathogenesis

PubMed Central

Cruz, Adriana R.; Pillay, Allan; Zuluaga, Ana V.; Ramirez, Lady G.; Duque, Jorge E.; Aristizabal, Gloria E.; Fiel-Gan, Mary D.; Jaramillo, Roberto; Trujillo, Rodolfo; Valencia, Carlos; Jagodzinski, Linda; Cox, David L.; Radolf, Justin D.; Salazar, Juan C.

2010-01-01

Venereal syphilis is a multi-stage, sexually transmitted disease caused by the spirochetal bacterium Treponema pallidum (Tp). Herein we describe a cohort of 57 patients (age 18–68 years) with secondary syphilis (SS) identified through a network of public sector primary health care providers in Cali, Colombia. To be eligible for participation, study subjects were required to have cutaneous lesions consistent with SS, a reactive Rapid Plasma Reagin test (RPR-titer ≥1∶4), and a confirmatory treponemal test (Fluorescent Treponemal Antibody Absorption test- FTA-ABS). Most subjects enrolled were women (64.9%), predominantly Afro-Colombian (38.6%) or mestizo (56.1%), and all were of low socio-economic status. Three (5.3%) subjects were newly diagnosed with HIV infection at study entry. The duration of signs and symptoms in most patients (53.6%) was less than 30 days; however, some patients reported being symptomatic for several months (range 5–240 days). The typical palmar and plantar exanthem of SS was the most common dermal manifestation (63%), followed by diffuse hypo- or hyperpigmented macules and papules on the trunk, abdomen and extremities. Three patients had patchy alopecia. Whole blood (WB) samples and punch biopsy material from a subset of SS patients were assayed for the presence of Tp DNA polymerase I gene (polA) target by real-time qualitative and quantitative PCR methods. Twelve (46%) of the 26 WB samples studied had quantifiable Tp DNA (ranging between 194.9 and 1954.2 Tp polA copies/ml blood) and seven (64%) were positive when WB DNA was extracted within 24 hours of collection. Tp DNA was also present in 8/12 (66%) skin biopsies available for testing. Strain typing analysis was attempted in all skin and WB samples with detectable Tp DNA. Using arp repeat size analysis and tpr RFLP patterns four different strain types were identified (14d, 16d, 13d and 22a). None of the WB samples had sufficient DNA for typing. The clinical and microbiologic

Weaker HLA Footprints on HIV in the Unique and Highly Genetically Admixed Host Population of Mexico

PubMed Central

2017-01-01

ABSTRACT HIV circumvents HLA class I-restricted CD8+ T-cell responses through selection of escape mutations that leave characteristic mutational “footprints,” also known as HLA-associated polymorphisms (HAPs), on HIV sequences at the population level. While many HLA footprints are universal across HIV subtypes and human populations, others can be region specific as a result of the unique immunogenetic background of each host population. Using a published probabilistic phylogenetically informed model, we compared HAPs in HIV Gag and Pol (PR-RT) in 1,612 subtype B-infected, antiretroviral treatment-naive individuals from Mexico and 1,641 individuals from Canada/United States. A total of 252 HLA class I allele subtypes were represented, including 140 observed in both cohorts, 67 unique to Mexico, and 45 unique to Canada/United States. At the predefined statistical threshold of a q value of <0.2, 358 HAPs (201 in Gag, 157 in PR-RT) were identified in Mexico, while 905 (534 in Gag and 371 in PR-RT) were identified in Canada/United States. HAPs identified in Mexico included both canonical HLA-associated escape pathways and novel associations, in particular with HLA alleles enriched in Amerindian and mestizo populations. Remarkably, HLA footprints on HIV in Mexico were not only fewer but also, on average, significantly weaker than those in Canada/United States, although some exceptions were noted. Moreover, exploratory analyses suggested that the weaker HLA footprint on HIV in Mexico may be due, at least in part, to weaker and/or less reproducible HLA-mediated immune pressures on HIV in this population. The implications of these differences for natural and vaccine-induced anti-HIV immunity merit further investigation. IMPORTANCE HLA footprints on HIV identify viral regions under intense and consistent pressure by HLA-restricted immune responses and the common mutational pathways that HIV uses to evade them. In particular, HLA footprints can identify novel immunogenic

Weaker HLA Footprints on HIV in the Unique and Highly Genetically Admixed Host Population of Mexico.

PubMed

Soto-Nava, Maribel; Avila-Ríos, Santiago; Valenzuela-Ponce, Humberto; García-Morales, Claudia; Carlson, Jonathan M; Tapia-Trejo, Daniela; Garrido-Rodriguez, Daniela; Alva-Hernández, Selma N; García-Tellez, Thalía A; Murakami-Ogasawara, Akio; Mallal, Simon A; John, Mina; Brockman, Mark A; Brumme, Chanson J; Brumme, Zabrina L; Reyes-Teran, Gustavo

2018-01-15

HIV circumvents HLA class I-restricted CD8 + T-cell responses through selection of escape mutations that leave characteristic mutational "footprints," also known as HLA-associated polymorphisms (HAPs), on HIV sequences at the population level. While many HLA footprints are universal across HIV subtypes and human populations, others can be region specific as a result of the unique immunogenetic background of each host population. Using a published probabilistic phylogenetically informed model, we compared HAPs in HIV Gag and Pol (PR-RT) in 1,612 subtype B-infected, antiretroviral treatment-naive individuals from Mexico and 1,641 individuals from Canada/United States. A total of 252 HLA class I allele subtypes were represented, including 140 observed in both cohorts, 67 unique to Mexico, and 45 unique to Canada/United States. At the predefined statistical threshold of a q value of <0.2, 358 HAPs (201 in Gag, 157 in PR-RT) were identified in Mexico, while 905 (534 in Gag and 371 in PR-RT) were identified in Canada/United States. HAPs identified in Mexico included both canonical HLA-associated escape pathways and novel associations, in particular with HLA alleles enriched in Amerindian and mestizo populations. Remarkably, HLA footprints on HIV in Mexico were not only fewer but also, on average, significantly weaker than those in Canada/United States, although some exceptions were noted. Moreover, exploratory analyses suggested that the weaker HLA footprint on HIV in Mexico may be due, at least in part, to weaker and/or less reproducible HLA-mediated immune pressures on HIV in this population. The implications of these differences for natural and vaccine-induced anti-HIV immunity merit further investigation. IMPORTANCE HLA footprints on HIV identify viral regions under intense and consistent pressure by HLA-restricted immune responses and the common mutational pathways that HIV uses to evade them. In particular, HLA footprints can identify novel immunogenic regions and

Improving Eleventh Graders' Reading Comprehension through Text Coding and Double Entry Organizer Reading Strategies (Mejoramiento de la comprensión lectora de estudiantes de grado once mediante las estrategias de lectura de codificación de texto y organizador de doble entrada)

ERIC Educational Resources Information Center

Mahecha, Rocío; Urrego, Stella; Lozano, Erika

2011-01-01

In this article we report on an innovation project developed with a group of eleventh graders at a public school in Bogotá. Its aim was to encourage students to improve reading comprehension of texts in English. It was conducted taking into account students' needs, interests and level of English. To do it, we implemented two reading strategies:…

Two new ways of mapping sea ice thickness using ocean waves

NASA Astrophysics Data System (ADS)

Wadhams, P.

2010-12-01

TWO NEW METHODS OF MAPPING SEA ICE THICKNESS USING OCEAN WAVES. P. Wadhams (1,2), Martin Doble (1,2) and F. Parmiggiani (3) (1) Dept. of Applied Mathematics and Theoretical Physics, University of Cambridge, Cambridge CB3 0WA, UK. (2) Laboratoire d’Océanographie de Villefranche, Université Pierre et Marie Curie, 06234 Villefranche-sur-Mer, France (2) ISAC-CNR, Bologna, Italy Two new methods of mapping ice thickness have been recently developed and tested, both making use of the dispersion relation of ocean waves in ice of radically different types. In frazil-pancake ice, a young ice type in which cakes less than 5 m across float in a suspension of individual ice crystals, the propagation of waves has been successfully modelled by treating the ice layer as a highly viscous fluid. The model predicts a shortening of wavelengths within the ice. Two-dimensional Fourier analysis of successive SAR subscenes to track the directional spectrum of a wave field as it enters an ice edge shows that waves do indeed shorten within the ice, and the change has been successfully used to predict the thickness of the frazil-pancake layer. Concurrent shipborne sampling in the Antarctic has shown that the method is accurate, and we now propose its use throughout the important frazil-pancake regimes in the world ocean (Antarctic circumpolar ice edge zone, Greenland Sea, Bering Sea and others). A radically different type of dispersion occurs when ocean waves enter the continuous icefields of the central Arctic, when they couple with the elastic ice cover to propagate as a flexural-gravity wave. A two-axis tiltmeter array has been used to measure the resulting change in the dispersion relation for long ocean swell (15-30 s) originating from storms in the Greenland Sea. The dispersion relation is slightly different from swell in the open ocean, so if two such arrays are placed a substantial distance (100s of km) apart and used to observe the changing wave period of arrivals from a given

Nonthermal Radiation Processes in Interplanetary Plasmas

NASA Astrophysics Data System (ADS)

Chian, A. C. L.

1990-11-01

RESUMEN. En la interacci6n de haces de electrones energeticos con plasmas interplanetarios, se excitan ondas intensas de Langmuir debido a inestabilidad del haz de plasma. Las ondas Langmuir a su vez interaccio nan con fluctuaciones de densidad de baja frecuencia para producir radiaciones. Si la longitud de las ondas de Langmujr exceden las condicio nes del umbral, se puede efectuar la conversi5n de modo no lineal a on- das electromagneticas a traves de inestabilidades parametricas. As se puede excitar en un plasma inestabilidades parametricas electromagneticas impulsadas por ondas intensas de Langmuir: (1) inestabilidades de decaimiento/fusi5n electromagnetica impulsadas por una bomba de Lang- muir que viaja; (2) inestabilidades dobles electromagneticas de decai- miento/fusi5n impulsadas por dos bombas de Langrnuir directamente opues- tas; y (3) inestabilidades de dos corrientes oscilatorias electromagne- ticas impulsadas por dos bombas de Langmuir de corrientes contrarias. Se concluye que las inestabilidades parametricas electromagneticas in- ducidas por las ondas de Langmuir son las fuentes posibles de radiacio- nes no termicas en plasmas interplanetarios. ABSTRACT: Nonthermal radio emissions near the local electron plasma frequency have been detected in various regions of interplanetary plasmas: solar wind, upstream of planetary bow shock, and heliopause. Energetic electron beams accelerated by solar flares, planetary bow shocks, and the terminal shock of heliosphere provide the energy source for these radio emissions. Thus, it is expected that similar nonthermal radiation processes may be responsible for the generation of these radio emissions. As energetic electron beams interact with interplanetary plasmas, intense Langmuir waves are excited due to a beam-plasma instability. The Langmuir waves then interact with low-frequency density fluctuations to produce radiations near the local electron plasma frequency. If Langmuir waves are of sufficiently large

Chile.

PubMed

1988-09-01

Chile is a long (2650 miles), narrow (250 miles at widest point) country sandwiched between the Andes mountains and the Pacific. The northern desert is rich in copper and nitrates; the temperate middle region is agricultural and supports the major cities, including Santiago, the capital, and the port of Valparaiso; and the southern region is a cold and damp area of forests, grasslands, lakes, and fjords. The country is divided into 12 administrative regions. Chile's population of 12.5 million are mainly of Spanish or Indian descent or mestizos. Literacy is 92.3%, and the national language is Spanish. Infant mortality is 18.1/1000, and life expectancy is 68.2 years. 82% of the people are urban, and most are Roman Catholics. Chile was settled by the Spanish in 1541 and attached to the Viceroyalty of Peru. Independence was won in 1818 under the leadership of Bernardo O'Higgins. In the 1880s Chile extended its sovereignty over the Strait of Magellan in the south and areas of southern Peru and Bolivia in the north. An officially parliamentary government, elected by universal suffrage, drifted into oligarchy and finally into a military dictatorship under Carlos Ibanez in 1924. Constitutional government was restored in 1932. The Christian Democratic government of Eduardo Frei (1964-70) inaugurated major reforms, including land redistribution, education, and far-reaching social and economic policies. A Marxist government under Salvador Allende lasted from 1970 to 1973 when the present military government of General Pinochet Ugarte took power, overthrew Allende, abolished the Congress, and banned political parties. It has moved the country in the direction of a free market economy but at the cost of systematic violations of human rights. A new constitution was promulgated in 1981, and congressional elections have been scheduled for October, 1989. A "National Accord for Transition to Full Democracy" was mediated by the Catholic Church in 1985. The social reforms of the

Moving towards South-South International Health: debts and challenges in the regional health agenda.

PubMed

Herrero, María Belén

2017-07-01

The aim of this paper is twofold. First, it aims to investigate the increased interest in health as an important dimension of the foreign policy and diplomatic concerns together with the emergence of a new framework for regional health integration and regional health diplomacy. Second, it seeks to understand the role and practices of new regional blocs in the field of health and whether they are conducting to the emergence of new strategies for addressing health regional policies in South America. The regional policy process relates to health as a right. Thus, some practices and processes in social policy are setting new standards for political and social cohesion in the construction of new regionalism. Health crosses national, regional, and global agendas in a multi-directional fashion, rather than via one-way, top-down policy transfer. A special feature of Unasur is upholding regional health sovereignty despite the unique fact that member countries retain national autonomy. Unasur has projected foreign policy that promotes social values in ways that seem innovative. Experience as Unasur shows that regional organisms can become a game changer in global diplomacy and an influential actor in the international agenda. Resumen El objetivo de este artículo es doble. En primer lugar,investigar el creciente interés en la salud como una dimensión importante de la política exterior, en sintonía con el surgimiento de un nuevo marcopara la integración regional y la diplomacia en salud. En segundo lugar, comprender el papel y las prácticas de los nuevos bloques regionales en el campo de la salud y si estasconducena la emergencia de nuevas estrategias para abordar las políticas sanitarias regionales en América del Sur. Los nuevos procesos de integración regional se refieren a la salud como un derecho. Así, algunas prácticas y procesos de la política regional están estableciendo nuevos patrones de cohesión política y social en el avancede un nuevo regionalismo

Effects of Wind Energy Development on Nesting Ecology of Greater Prairie-Chickens in Fragmented Grasslands

PubMed Central

McNew, Lance B; Hunt, Lyla M; Gregory, Andrew J; Wisely, Samantha M; Sandercock, Brett K

2014-01-01

ólica sobre la ecología reproductiva de las gallinas en un estudio de 5 años. Ubicamos 59 y 185 nidos antes y después del desarrollo, respectivamente, de una instalación de energía eólica de 201 MW en el hábitat de anidación de las gallinas y estudiamos la selección de sitio de anidación y la supervivencia de nidos en relación con la proximidad a la infraestructura y las condiciones de hábitat. La proximidad con las turbinas no afectó negativamente a la selección de sitios de anidación (β = -0.3, 95% CI = -0.6–0.1). En su lugar, la selección de sitios de anidación y la supervivencia estuvieron fuertemente relacionadas con la cobertura vegetal y otras condiciones locales determinadas por el manejo de la producción de ganado. La integración de los resultados de nuestro proyecto con reportes previos de la evitación conductual de instalaciones de petróleo y gas por otras especies de pastizales sugiere nuevas vías para que la investigación mitigue los impactos del desarrollo energético. PMID:24628394

Republic of Venezuela. Country profile.

PubMed

Hakkert, R

1985-06-01

countries in the region. In 1981, 1 million of the countrys, residents were foreign born. The oil industry attracted many immigrants, and illegal immigration is a serious problem. 41% of the population is under 15 years of age, the birth rate is 33-37, the death rate is 5, the infant mortality rate is 39, and life expectancy is 69 years. Average household size is 5.28. Family life is highly unstable. 32% of the couples are in informal unions, and these couples account for 52% of all births. 20% of the households are headed by low income women. The total fertility rate was 6.7 in 1961 and is currently 4.3. There are 3.2 million housing units, and 800,000 of these are classified as inadequate. 65% of the population is mestizo, 20% is European, and the remaining 15% are from various other countries or members of indigenous groups. The population is predominantly Catholic. The literacy rate is 83%; however, 71% of the males and 84% of the females in rural areas are illiterate. 31.5% of the population is in the labor force, and 27.5% of the labor force is female. 20% of the labor force is in the service sector and many of these work in the overgrown government bureaucracy. Only 15% of the labor force is engaged in the primary sector. 37% of the residents of Caracas and 80% of the country's rural residents live below the poverty level.

Panama.

PubMed

1985-05-01

Panama's population characteristics, geographical features, communication system, history, government, economy, current political situation, and foreign relations are briefly described. Ethnically, Panama's population of 2,001,000 (1984) is 70% mestizo, 14% West Indian, 10% white, and 6% Indian. 93% of the population is Roman Catholic, and the official language is Spanish. The school enrollment rate is close to 100% at the primary level and 65% at the secondary level. The literacy rate is 93.7% for urban residents and 61.8% for rural residents. The infant mortality rate is 20.1, and life expectancy is 71 years. Panama is a hilly and mountainous country, and the eastern region is covered by tropical forests. In 1519, the Spanish established the old city of Panama near the isthmus, i.e., the narrowest section (52 miles) of the country separating the Pacific Ocean and the Caribbean Sea, and between then and 1670s, the isthmus played a vital role in the movement of gold and silver from the New World to Spain. Ships from the western side of South American sailed to the western side of the isthmus. Their contents were unloaded, hauled across the isthmus, and reloaded on ships bound for Spain. In 1982 Panama won its independence from Spain and the following year voluntarily became a part of the Republic of Greater Colombia. Since the early 1860s, the idea of building a canal through the isthmus was entertained by various groups, and in the late 1800s a Frenchman unsuccessfully attempted the task. In 1903 Panama declared its independence from Colombia after Colombia refused to sign a treaty to allow the US to construct a canal. Panama, as an independent nation, then signed the Hay/Bunau-Varilla Treaty with the US. The treaty gave the US the right to build a canal. Panama retained sovereignty over the canal zone, i.e., a 5 mile area on each side of the canal, but the US was given all the rights in the area normally exercised by a sovereign power. The treaty was resented by

‘Everybody knows’, but the rest of the world: the case of a caterpillar-borne reproductive loss syndrome in dromedary camels observed by Sahrawi pastoralists of Western Sahara

PubMed Central

2013-01-01

destaca la importancia de estudios de las enfermedades del ganado en pueblos de pastores nómadas porque pueden revelar fenómenos biológicos aún desconocidos y merecen ser investigados. PMID:23305273

Trends, prospects and challenges in quantifying flow and transport through fractured rocks

NASA Astrophysics Data System (ADS)

Neuman, Shlomo P.

2005-03-01

en una roca consistentemente fracturada si la considera como una unidad continua isotrópica uniforme o poco uniforme. En vez de adoptar este enfoque, uno tiene generalmente que explicar la heterogeneidad altamente errática, dependencia direccional, naturaleza doble o multicomponente y comportamiento multiescalar de las rocas fracturadas. Una manera de lograr esto consiste en considerar que la roca contiene una redde fracturas discretas (con bloques de matriz permeable o impermeable) y otro modo en considerar la roca como una unidad continua no uniforme (sola, doble o múltiple). Un tercer procedimiento consiste en combinar las dos maneras anteriores en un modelo híbrido el cual consiste de un continuo no uniforme conteniendo un número relativamente pequeño de fracturas principalmente discretas. En ambos casos la descripción puede ser determinística o estocástica. El artículo contiene una evaluación breve de estas tendencias en base a descubrimientos recientes teóricos y experimentales, terminando con una lista corta de prospectos y desafíos para el futuro.

Constraining performance assessment models with tracer test results: a comparison between two conceptual models

NASA Astrophysics Data System (ADS)

McKenna, Sean A.; Selroos, Jan-Olof

infini sur une période de temps spécifiée explique les différences entre les modèles et le ! fait que le test de traçage seul ne permet pas de déterminer les paramètres de transport à l'échelle du PA. Les résultats des simulations Monte Carlo du modèle de transport avec des temps et des distances de transport variables montrent des résultats concordances entre les différents modèles et suggère que la variation que la variation entre surface mouillée et le rapport de la différence de débits entre les lignes d'écoulement est insignifiante, en regard de la variabilité du montant de la capacité diffusive qui peut être accessible le long de la ligne de transport. Delimitando la eficacia de modelos de evaluación con resultados de pruebas de trazadores: una comparación entre dos modelos conceptuales. Se llevaron a cabo pruebas de trazadores para evaluar los parámetros de transporte de solutos en un rasgo rocoso a lo largo de una trayectoria de transporte de 5 m. Dos diferentes conceptualizaciones del transporte de solutos de porosidad doble aportan estimados de las curvas de avance de trazadores. Una de las conceptualizaciones (ritmo único) utiliza un coeficiente de difusión efectiva único en una matriz con profundidad de penetración infinita. Sin embargo, la retención del trazador entre diferentes trayectorias de flujo puede variar debido a que la relación entre la superficie mojada de flujo y el ritmo de flujo difiere entre las líneas de trayectoria. La otra conceptualización (multi-ritmo) utiliza una distribución continua de coeficientes de ritmos de difusión múltiple en una matriz con capacidad variable pero finita. La aplicación de los dos modelos con los parámetros estimados en base a las curvas de avance de trazadores producen resultados de transporte que difieren en varios órdenes de magnitud, tanto en concentración pico como en el tiempo en que se alcanza la concentración pico, en las escalas de evaluación de eficacia (PA) de

Migration of recharge waters downgradient from the Santa Catalina Mountains into the Tucson basin aquifer, Arizona, USA

NASA Astrophysics Data System (ADS)

Cunningham, Erin E. B.; Long, Austin; Eastoe, Chris; Bassett, R. L.

'origine thermonucléaire permettent de caractériser qualitativement les cheminements de l'eau et leurs vitesses. Les isotopes stables ne mettent pas en évidence un effet d'altitude. Les teneurs en tritium indiquent que quelques sources et certains puits fournissent une eau ancienne, alors que l'eau de la plupart des sources date des années soixante ou est plus récente. Resumen Los acuíferos en las cuencas aluviales áridas del sudoeste de los Estados Unidos de América se recargan principalmente por la infiltración procedentes de los arroyos y playas de las propias cuencas y por entradas a lo largo de los límites de las mismas. La cuenca de Tucson, en el sudeste de Arizona es una de ellas. Las Montañas de Santa Catalina forman el contorno septentrional de esta cuenca y reciben una precipitación de más del doble (700mm/año) que la media de la propia cuenca (unos 300mm/año). En este estudio, se utilizaron isótopos ambientales para investigar la infiltración a través de fracturas y juntas superficiales. Se obtuvieron muestras de manantiales y de la escorrentía en las Montañas de Santa Catalina, así como de pozos ubicados al pie de las mismas. Los isótopos estables (Deuterio y Oxígeno-18) y el Tritio procedente de las bombas termonucleares permitieron la caracterización cualitativa de las líneas de flujo y de las velocidades. Los datos procedentes de la medida de isótopos estables no parecen presentar un efecto de altitud. Los valores de Tritio indican que aunque algunos pozos y manantiales descargan agua previa a los ensayos termonucleares, la mayoría descargan aguas de fecha posterior a 1960.

Dual-porosity modeling of groundwater recharge: testing a quick calibration using in situ moisture measurements, Areuse River Delta, Switzerland

NASA Astrophysics Data System (ADS)

Alaoui, Abdallah; Eugster, Werner

sensitivité ont montré que l'investigation de la couverture du sol est suffisante pour l'estimation locale de la RN du fait que l'eau traversant le plan du flux nul se trouverait sous la zone des racines et échapperait à l'évapotranspiration. La RN simulée sur les 0.70 m du sol sous les conditions d'équilibre était de 364 mm, ce qui est comparable aux mesures. Se propone un método sencillo para calibrar el modelo de doble porosidad "MACRO" mediante medidas in-situ obtenidas por TDR durante un breve ensayo de infiltración (2,8 horas), con el objetivo de estimar la recarga local al acuífero. Ésta ha sido modelada de dos formas: considerando los 3 m de suelo no saturado y empleando sólo desde la capa superior hasta el plano de flujo nulo (de 0 a 0,70 m). Se compara la recarga modelada con la recarga local medida en campo, la cual fue de 313 mm durante un ciclo anual (del 15 de octubre de 1990 al 15 de octubre de 1991). Las mejores simulaciones corresponden a la hipótesis de columna entera no saturada en condiciones de equilibrio, excluyendo el efecto de macroporos (valor de 330 mm), mientras que el resultado obtenido para condiciones de no equilibrio en la recarga local está sobreestimado (378 mm). Los análisis de sensibilidad muestran que la investigación del horizonte superior del suelo es suficiente para estimar la recarga local en este caso, ya que el agua almacenada por debajo de esta profundidad parece estar fuera del alcance típico de las raíces de la vegetación y no puede ser evapotranspirada. La recarga modelada en condiciones de equilibrio para la capa superior de 0,70 m de espesor es de 364 mm, valor aceptable respecto a las medidas.

A participatory approach to integrated aquifer management: The case of Guanajuato State, Mexico

NASA Astrophysics Data System (ADS)

Sandoval, Ricardo

de l'État s'est appliqué à développer une stratégie sur deux plans. Tout d'abord, des études hydrogéologiques de base et des modèles mathématiques d'écoulement et de transport de nappe ont été réalisés à partir d'un suivi d'ensemble des puits existants et d'une révision générale du contexte géologique de l'État. Ensuite, on a soutenu une structure de participation des usagers de l'eau aux actions de gestion de l'eau, à partir de la dissémination de l'information pour la mise en place de projets pilotes efficaces d'utilisation de l'eau, avec des aides financières, techniques et politiques de l'État. Simultanément, un effort coordonné en vue de l'achèvement de l'enregistrement des usagers de l'eau a été fait avec l'autorité fédérale, en même temps que d'autres mesures de soutien, telles que des programmes de formation et des campagnes de surveillance. Cet article présente une vue d'ensemble des réalisations de projets et des défis. Resumen El Estado de Guanajuato, situado en el centro de México, ocupa menos del 2% de la superficie del país. Tiene casi 17.000 pozos profundos, de los cuales se extrae cerca de 4.000 hm3/a, lo que supone un exceso de 1.000 hm3/a respecto a la recarga anual. Puesto que el agua es administrada a nivel federal en México, el gobierno del Estado afronta el reto de asegurar el desarrollo de la población sin disponer de medios formales de intervención. Dadas las limitaciones para aplicar políticas y medidas reguladoras, el programa del agua en el Estado tiene como objetivo principal la implantación de una doble estrategia. Por un lado, desarrollar estudios hidrogeológicos básicos y modelos matemáticos de flujo y transporte de los acuíferos, basándose en una campaña exhaustiva de pozos existentes y en una revisión del marco geológico del Estado. Por otro lado, promover-con soporte financiero, técnico y político-una estructura de participación de los usuarios en las acciones de gesti

Seguridad del paciente en Radioterapia Intraoperatoria: Impacto de los elementos controlados por el Radiofisico

NASA Astrophysics Data System (ADS)

Tarjuelo, Juan Lopez

tambien se uso para estudiar la estabilidad de las camaras de ionizacion mencionadas. Se realizo la dosimetria in vivo en 45 pacientes con MOSFET reforzados mobile TN-502RDM-H, pelicula radiocromica Gafchromic MD-55-2, y se elaboro un modelo teorico para explicar los datos. Por ultimo, al precisarse el uso en RIO de la simulacion virtual y del calculo de la dosis absorbida en el paciente virtual, se ha ilustrado este apartado con la aceptacion y el estado de referencia inicial del planificador de tratamientos modulados con calculo de Monte Carlo Elekta Monaco. Para ello se utilizaron la camara de ionizacion TW31016-0104 y la matriz seven29 de PTW-Freiburg, pelicula radiocromica Gafchromic EBT-2, y diferentes maniquies. Resultados: El FMEA identifico 57 modos de fallo y efectos potenciales. No se experimentaron sucesos relativos a una administracion inadecuada de la dosis absorbida. Se identificaron las revisiones dobles y por un par como claves para reducir los riesgos asociados al equipo de profesionales involucrado en la RIO. Se identificaron tambien oportunidades de mejora con el uso de la automatizacion y el enclavamiento. En cuanto al SPC, los indices de capacidad del proceso abarcaron de 1,6 a 9,3 para un nivel de especificaciones del +/-2%. Las intervenciones simuladas alcanzaron del 2% al 34% de las sesiones de medida. Las camaras de ionizacion Farmer derivaron en direcciones opuestas en un periodo de 6 anos; aunque ello no se aprecio en los informes de calibracion del laboratorio acreditado. No derivo la camara PPC-40. En la dosimetria in vivo, las medidas de los MOSFET no se desviaron significativamente de las medidas con pelicula. Los valores centrales de las dosis absorbidas quedaron entre la dosis absorbida prescrita y la maxima, con lo que indicaron un tratamiento correcto del lecho tumoral. Las anchuras de los intervalos de confianza de las dosis absorbidas esperadas segun el modelo teorico al nivel del 95% abarcaron del 8,6% al 14,7%. Las verificaciones de