Zeng, Hongqiu; Xie, Yanwei; Liu, Guoyin; Lin, Daozhe; He, Chaozu; Shi, Haitao
2018-06-01
MeGAPCs were identified as negative regulators of plant disease resistance, and the interaction of MeGAPCs and MeATG8s was highlighted in plant defense response. As an important enzyme of glycolysis metabolic pathway, glyceraldehyde-3-P dehydrogenase (GAPDH) plays important roles in plant development, abiotic stress and immune responses. Cassava (Manihot esculenta) is most important tropical crop and one of the major food crops, however, no information is available about GAPDH gene family in cassava. In this study, 14 MeGAPDHs including 6 cytosol GAPDHs (MeGAPCs) were identified from cassava, and the transcripts of 14 MeGAPDHs in response to Xanthomonas axonopodis pv manihotis (Xam) indicated their possible involvement in immune responses. Further investigation showed that MeGAPCs are negative regulators of disease resistance against Xam. Through transient expression in Nicotiana benthamiana, we found that overexpression of MeGAPCs led to decreased disease resistance against Xam. On the contrary, MeGAPCs-silenced cassava plants through virus-induced gene silencing (VIGS) conferred improved disease resistance. Notably, MeGAPCs physically interacted with autophagy-related protein 8b (MeATG8b) and MeATG8e and inhibited autophagic activity. Moreover, MeATG8b and MeATG8e negatively regulated the activities of NAD-dependent MeGAPDHs, and are involved in MeGAPCs-mediated disease resistance. Taken together, this study highlights the involvement of MeGAPCs in plant disease resistance, through interacting with MeATG8b and MeATG8e.
Pseudogene redux with new biological significance.
Salmena, Leonardo
2014-01-01
The study of pseudogenes, originally dismissed as genomic relics of evolutionary selection, has seen a resurgence in scientific literature, in addition to being a peculiar topic of discussion in theological debates. For a long time, pseudogenes have been touted as a beacon of natural selection and a definitive proof of evolution due to the slow mutation rate that differentiated them from their parental genes and ultimately caused their genetic demise as functional genes. It now seems that "creationists" have co-opted some recent reports identifying unheralded biological functions to pseudogens and other noncoding RNAs as evidence to undermine the existence of evolution and supporting intelligent design. This issue of Methods in Molecular Biology focused on pseudogenes will certainly not end, nor enter this debate; however, scientists who are also genomics and pseudogene enthusiasts will certainly appreciate that many scientists are thinking about these particular genetic elements in new and interesting ways. With this new interest in a biological significance and "non-junk" role for pseudogenes and other noncoding RNAs, new methods and approaches are being developed to unlock the mystery of these ancient artifacts we know as pseudogenes. In this brief introductory chapter we highlight the renewed interest in pseudogenes and review a rationale for intensification of pseudogene-related research.
Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH.
Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Alvarez-Domínguez, Carmen
2014-01-01
The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189-201 and LLO91-99 and the GAPDH peptide, GAPDH1-22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1-22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91-99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1-22-specific CD4(+) and CD8(+) immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4(+) and CD8(+) epitopes.
Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH
Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M. Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L.; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Álvarez-Domínguez, Carmen
2014-01-01
The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189−201 and LLO91−99 and the GAPDH peptide, GAPDH1−22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1−22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91−99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1−22-specific CD4+ and CD8+ immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4+ and CD8+ epitopes. PMID:24600592
Differentially-Expressed Pseudogenes in HIV-1 Infection.
Gupta, Aditi; Brown, C Titus; Zheng, Yong-Hui; Adami, Christoph
2015-09-29
Not all pseudogenes are transcriptionally silent as previously thought. Pseudogene transcripts, although not translated, contribute to the non-coding RNA pool of the cell that regulates the expression of other genes. Pseudogene transcripts can also directly compete with the parent gene transcripts for mRNA stability and other cell factors, modulating their expression levels. Tissue-specific and cancer-specific differential expression of these "functional" pseudogenes has been reported. To ascertain potential pseudogene:gene interactions in HIV-1 infection, we analyzed transcriptomes from infected and uninfected T-cells and found that 21 pseudogenes are differentially expressed in HIV-1 infection. This is interesting because parent genes of one-third of these differentially-expressed pseudogenes are implicated in HIV-1 life cycle, and parent genes of half of these pseudogenes are involved in different viral infections. Our bioinformatics analysis identifies candidate pseudogene:gene interactions that may be of significance in HIV-1 infection. Experimental validation of these interactions would establish that retroviruses exploit this newly-discovered layer of host gene expression regulation for their own benefit.
Differentially-Expressed Pseudogenes in HIV-1 Infection
Gupta, Aditi; Brown, C. Titus; Zheng, Yong-Hui; Adami, Christoph
2015-01-01
Not all pseudogenes are transcriptionally silent as previously thought. Pseudogene transcripts, although not translated, contribute to the non-coding RNA pool of the cell that regulates the expression of other genes. Pseudogene transcripts can also directly compete with the parent gene transcripts for mRNA stability and other cell factors, modulating their expression levels. Tissue-specific and cancer-specific differential expression of these “functional” pseudogenes has been reported. To ascertain potential pseudogene:gene interactions in HIV-1 infection, we analyzed transcriptomes from infected and uninfected T-cells and found that 21 pseudogenes are differentially expressed in HIV-1 infection. This is interesting because parent genes of one-third of these differentially-expressed pseudogenes are implicated in HIV-1 life cycle, and parent genes of half of these pseudogenes are involved in different viral infections. Our bioinformatics analysis identifies candidate pseudogene:gene interactions that may be of significance in HIV-1 infection. Experimental validation of these interactions would establish that retroviruses exploit this newly-discovered layer of host gene expression regulation for their own benefit. PMID:26426037
Critical protein GAPDH and its regulatory mechanisms in cancer cells
Zhang, Jin-Ying; Zhang, Fan; Hong, Chao-Qun; Giuliano, Armando E.; Cui, Xiao-Jiang; Zhou, Guang-Ji; Zhang, Guo-Jun; Cui, Yu-Kun
2015-01-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), initially identified as a glycolytic enzyme and considered as a housekeeping gene, is widely used as an internal control in experiments on proteins, mRNA, and DNA. However, emerging evidence indicates that GAPDH is implicated in diverse functions independent of its role in energy metabolism; the expression status of GAPDH is also deregulated in various cancer cells. One of the most common effects of GAPDH is its inconsistent role in the determination of cancer cell fate. Furthermore, studies have described GAPDH as a regulator of cell death; other studies have suggested that GAPDH participates in tumor progression and serves as a new therapeutic target. However, related regulatory mechanisms of its numerous cellular functions and deregulated expression levels remain unclear. GAPDH is tightly regulated at transcriptional and posttranscriptional levels, which are involved in the regulation of diverse GAPDH functions. Several cancer-related factors, such as insulin, hypoxia inducible factor-1 (HIF-1), p53, nitric oxide (NO), and acetylated histone, not only modulate GAPDH gene expression but also affect protein functions via common pathways. Moreover, posttranslational modifications (PTMs) occurring in GAPDH in cancer cells result in new activities unrelated to the original glycolytic function of GAPDH. In this review, recent findings related to GAPDH transcriptional regulation and PTMs are summarized. Mechanisms and pathways involved in GAPDH regulation and its different roles in cancer cells are also described. PMID:25859407
DOE Office of Scientific and Technical Information (OSTI.GOV)
Joo, Hyun-Yoo; Laboratory of Biochemistry, School of Life Sciences and Biotechnology, Korea University, Seoul 136-713; Woo, Seon Rang
2012-08-10
Highlights: Black-Right-Pointing-Pointer SIRT1 serves to retain GAPDH in the cytosol, preventing GAPDH nuclear translocation. Black-Right-Pointing-Pointer When SIRT1 is depleted, GAPDH translocation occurs even in the absence of stress. Black-Right-Pointing-Pointer Upon irradiation, SIRT1 interacts with GAPDH. Black-Right-Pointing-Pointer SIRT1 prevents irradiation-induced nuclear translocation of GAPDH. Black-Right-Pointing-Pointer SIRT1 presence rather than activity is essential for inhibiting GAPDH translocation. -- Abstract: Upon apoptotic stimulation, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a cytosolic enzyme normally active in glycolysis, translocates into the nucleus and activates an apoptotic cascade therein. In the present work, we show that SIRT1 prevents nuclear translocation of GAPDH via interaction with GAPDH. SIRT1 depletion triggeredmore » nuclear translocation of cytosolic GAPDH even in the absence of apoptotic stress. Such translocation was not, however, observed when SIRT1 enzymatic activity was inhibited, indicating that SIRT1 protein per se, rather than the deacetylase activity of the protein, is required to inhibit GAPDH translocation. Upon irradiation, SIRT1 prevented irradiation-induced nuclear translocation of GAPDH, accompanied by interaction of SIRT1 and GAPDH. Thus, SIRT1 functions to retain GAPDH in the cytosol, protecting the enzyme from nuclear translocation via interaction with these two proteins. This serves as a mechanism whereby SIRT1 regulates cell survival upon induction of apoptotic stress by means that include irradiation.« less
AIRE-induced apoptosis is associated with nuclear translocation of stress sensor protein GAPDH
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liiv, Ingrid, E-mail: ingrid.liiv@ut.ee; Haljasorg, Uku; Kisand, Kai
2012-06-22
Highlights: Black-Right-Pointing-Pointer AIRE induces apoptosis in epithelial cells. Black-Right-Pointing-Pointer CARD domain of AIRE is sufficient for apoptosis induction. Black-Right-Pointing-Pointer AIRE induced apoptosis involves GAPDH translocation to the nuclei. Black-Right-Pointing-Pointer Deprenyl inhibits AIRE induced apoptosis. -- Abstract: AIRE (Autoimmune Regulator) has a central role in the transcriptional regulation of self-antigens in medullary thymic epithelial cells, which is necessary for negative selection of autoreactive T cells. Recent data have shown that AIRE can also induce apoptosis, which may be linked to cross-presentation of these self-antigens. Here we studied AIRE-induced apoptosis using AIRE over-expression in a thymic epithelial cell line as well asmore » doxycycline-inducible HEK293 cells. We show that the HSR/CARD domain in AIRE together with a nuclear localization signal is sufficient to induce apoptosis. In the nuclei of AIRE-positive cells, we also found an increased accumulation of a glycolytic enzyme, glyceraldehyde-3-phosphate (GAPDH) reflecting cellular stress and apoptosis. Additionally, AIRE-induced apoptosis was inhibited with an anti-apoptotic agent deprenyl that blocks GAPDH nitrosylation and nuclear translocation. We propose that the AIRE-induced apoptosis pathway is associated with GAPDH nuclear translocation and induction of NO-induced cellular stress in AIRE-expressing cells.« less
Zuriaga, María Angeles; Mas-Coma, Santiago; Bargues, María Dolores
2015-05-01
A pseudogene, designated as "ps(5.8S+ITS-2)", paralogous to the 5.8S gene and internal transcribed spacer (ITS)-2 of the nuclear ribosomal DNA (rDNA), has been recently found in many triatomine species distributed throughout North America, Central America and northern South America. Among characteristics used as criteria for pseudogene verification, secondary structures and free energy are highlighted, showing a lower fit between minimum free energy, partition function and centroid structures, although in given cases the fit only appeared to be slightly lower. The unique characteristics of "ps(5.8S+ITS-2)" as a processed or retrotransposed pseudogenic unit of the ghost type are reviewed, with emphasis on its potential functionality compared to the functionality of genes and spacers of the normal rDNA operon. Besides the technical problem of the risk for erroneous sequence results, the usefulness of "ps(5.8S+ITS-2)" for specimen classification, phylogenetic analyses and systematic/taxonomic studies should be highlighted, based on consistence and retention index values, which in pseudogenic sequence trees were higher than in functional sequence trees. Additionally, intraindividual, interpopulational and interspecific differences in pseudogene amount and the fact that it is a pseudogene in the nuclear rDNA suggests a potential relationships with fitness, behaviour and adaptability of triatomine vectors and consequently its potential utility in Chagas disease epidemiology and control.
Itakura, Masanori; Kubo, Takeya; Kaneshige, Akihiro; Harada, Naoki; Izawa, Takeshi; Azuma, Yasu-Taka; Kuwamura, Mitsuru; Yamaji, Ryouichi; Takeuchi, Tadayoshi
2017-01-01
Glycolytic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a multifunctional protein that also mediates cell death under oxidative stress. We reported previously that the active-site cysteine (Cys-152) of GAPDH plays an essential role in oxidative stress-induced aggregation of GAPDH associated with cell death, and a C152A-GAPDH mutant rescues nitric oxide (NO)-induced cell death by interfering with the aggregation of wild type (WT)-GAPDH. However, the detailed mechanism underlying GAPDH aggregate-induced cell death remains elusive. Here we report that NO-induced GAPDH aggregation specifically causes mitochondrial dysfunction. First, we observed a correlation between NO-induced GAPDH aggregation and mitochondrial dysfunction, when GAPDH aggregation occurred at mitochondria in SH-SY5Y cells. In isolated mitochondria, aggregates of WT-GAPDH directly induced mitochondrial swelling and depolarization, whereas mixtures containing aggregates of C152A-GAPDH reduced mitochondrial dysfunction. Additionally, treatment with cyclosporin A improved WT-GAPDH aggregate-induced swelling and depolarization. In doxycycline-inducible SH-SY5Y cells, overexpression of WT-GAPDH augmented NO-induced mitochondrial dysfunction and increased mitochondrial GAPDH aggregation, whereas induced overexpression of C152A-GAPDH significantly suppressed mitochondrial impairment. Further, NO-induced cytochrome c release into the cytosol and nuclear translocation of apoptosis-inducing factor from mitochondria were both augmented in cells overexpressing WT-GAPDH but ameliorated in C152A-GAPDH-overexpressing cells. Interestingly, GAPDH aggregates induced necrotic cell death via a permeability transition pore (PTP) opening. The expression of either WT- or C152A-GAPDH did not affect other cell death pathways associated with protein aggregation, such as proteasome inhibition, gene expression induced by endoplasmic reticulum stress, or autophagy. Collectively, these results suggest that NO-induced GAPDH
Seabra, Amedea B; Ouellet, Marc; Antonic, Marija; Chrétien, Michelle N; English, Ann M
2013-11-30
Vascular relaxation to nitroglycerin (glyceryl trinitrate; GTN) requires its bioactivation by mechanisms that remain controversial. We report here that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) catalyzes the release of nitrite from GTN. In assays containing dithiothreitol (DTT) and NAD(+), the GTN reductase activity of purified GAPDH produces nitrite and 1,2-GDN as the major products. A vmax of 2.6nmolmin(-)(1)mg(-)(1) was measured for nitrite production by GAPDH from rabbit muscle and a GTN KM of 1.2mM. Reductive denitration of GTN in the absence of DTT results in dose- and time-dependent inhibition of GAPDH dehydrogenase activity. Disulfiram, a thiol-modifying drug, inhibits both the dehydrogenase and GTN reductase activity of GAPDH, while DTT or tris(2-carboxyethyl)phosphine reverse the GTN-induced inhibition. Incubation of intact human erythrocytes or hemolysates with 2mM GTN for 60min results in 50% inhibition of GAPDH's dehydrogenase activity, indicating that GTN is taken up by these cells and that the dehydrogenase is a target of GTN. Thus, erythrocyte GAPDH may contribute to GTN bioactivation. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.
Sulfur mustard induced nuclear translocation of glyceraldehyde-3-phosphate-dehydrogenase (GAPDH).
Steinritz, Dirk; Weber, Jana; Balszuweit, Frank; Thiermann, Horst; Schmidt, Annette
2013-12-05
Sulfur Mustard (SM) is a vesicant chemical warfare agent, which is acutely toxic to a variety of organ systems including skin, eyes, respiratory system and bone marrow. The underlying molecular pathomechanism was mainly attributed to the alkylating properties of SM. However, recent studies have revealed that cellular responses to SM exposure are of more complex nature and include increased protein expression and protein modifications that can be used as biomarkers. In order to confirm already known biomarkers, to detect potential new ones and to further elucidate the pathomechanism of SM, we conducted large-scale proteomic experiments based on a human keratinocyte cell line (HaCaT) exposed to SM. Surprisingly, our analysis identified glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) as one of the up-regulated proteins after exposure of HaCaT cells to SM. In this paper we demonstrate the sulfur mustard induced nuclear translocation of GAPDH in HaCaT cells by 2D gel-electrophoresis (2D GE), immunocytochemistry (ICC), Western Blot (WB) and a combination thereof. 2D GE in combination with MALDI-TOF MS/MS analysis identified GAPDH as an up-regulated protein after SM exposure. Immunocytochemistry revealed a distinct nuclear translocation of GAPDH after exposure to 300μM SM. This finding was confirmed by fractionated WB analysis. 2D GE and subsequent immunoblot staining of GAPDH demonstrated two different spot locations of GAPH (pI 7.0 and pI 8.5) that are related to cytosolic or nuclear GAPDH respectively. After exposure to 300μM SM a significant increase of nuclear GAPDH at pI 8.5 occurred. Nuclear GAPDH has been associated with apoptosis, detection of structural DNA alterations, DNA repair and regulation of genomic integrity and telomere structure. The results of our study add new aspects to the pathophysiology of sulfur mustard toxicity, yet further studies will be necessary to reveal the specific function of nuclear GAPDH in the pathomechanism of sulfur mustard
Lactobacillus plantarum 299v surface-bound GAPDH: a new insight into enzyme cell walls location.
Saad, N; Urdaci, M; Vignoles, C; Chaignepain, S; Tallon, R; Schmitter, J M; Bressollier, P
2009-12-01
The aim of this study was to provide new insight into the mechanism whereby the housekeeping enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) locates to cell walls of Lactobacillus plantarum 299v. After purification, cytosolic and cell wall GAPDH (cw-GAPDH) forms were characterized and shown to be identical homotetrameric active enzymes. GAPDH concentration on cell walls was growth-time dependent. Free GAPDH was not observed on the culture supernatant at any time during growth, and provoked cell lysis was not concomitant with any reassociation of GAPDH onto the cell surface. Hence, with the possibility of cw-GAPDH resulting from autolysis being unlikely, entrapment of intracellular GAPDH on the cell wall after a passive efflux through altered plasma membrane was investigated. Flow cytometry was used to assess L. plantarum 299v membrane permeabilization after labeling with propidium iodide (PI). By combining PI uptake and cw-GAPDH activity measurements, we demonstrate here that the increase in cw-GAPDH concentration from the early exponential phase to the late stationary phase is closely related to an increase in plasma membrane permeability during growth. Moreover, we observed that increases in both plasma membrane permeability and cw-GAPDH activity were delayed when glucose was added during L. plantarum 299v growth. Using a double labeling of L. plantarum 299v cells with anti-GAPDH antibodies and propidium iodide, we established unambiguously that cells with impaired membrane manifest five times more cw-GAPDH than unaltered cells. Our results show that plasma membrane permeability appears to be closely related to the efflux of GAPDH on the bacterial cell surface, offering new insight into the understanding of the cell wall location of this enzyme.
GAPDH: the missing link between glycolysis and mitochondrial oxidative phosphorylation?
Ramzan, Rabia; Weber, Petra; Linne, Uwe; Vogt, Sebastian
2013-10-01
The main function of glycolysis and oxidative phosphorylation is to produce cellular energy in the form of ATP. In the present paper we propose a link between both of these energy-regulatory processes in the form of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and CytOx (cytochrome c oxidase). GAPDH is the sixth enzyme of glycolysis, whereas CytOx is the fourth complex of the mitochondrial oxidative phosphorylation system. In MS analysis, GAPDH was found to be associated with a BN-PAGE (blue native PAGE)-isolated complex of CytOx from bovine heart tissue homogenates. Both GAPDH and CytOx are highly regulated under normal energy metabolic conditions, but both of these enzymes are highly deregulated in the presence of oxidative stress. The interaction of GAPDH with CytOx could be the point of interest as it has already been shown that GAPDH protein damage results in a marked decrease in cellular ATP levels. On the other hand, decreasing the ATP/ADP ratio may ultimately result in switching off the allosteric ATP inhibition of CytOx leading to increased ROS (reactive oxygen species), cytochrome c release and apoptosis. Moreover, we have previously reported that allosteric ATP inhibition of CytOx is responsible for keeping the membrane potential at low healthy values, thus avoiding the production of ROS and this allosteric ATP inhibition is switched on at a high ATP/ADP ratio. So, in the present paper, we propose a scheme that could prove to be a link between these two enzymes and their role in the prevalence of diseases.
Butterfield, D Allan; Hardas, Sarita S; Lange, Miranda L Bader
2010-01-01
Recently, the oxidoreductase, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), has become a subject of interest as more and more studies reveal a surfeit of diverse GAPDH functions, extending beyond traditional aerobic metabolism of glucose. As a result of multiple isoforms and cellular locales, GAPDH is able to come in contact with a variety of small molecules, proteins, membranes, etc., that play important roles in normal and pathologic cell function. Specifically, GAPDH has been shown to interact with neurodegenerative disease-associated proteins, including the amyloid-beta protein precursor (AbetaPP). Studies from our laboratory have shown significant inhibition of GAPDH dehydrogenase activity in Alzheimer's disease (AD) brain due to oxidative modification. Although oxidative stress and damage is a common phenomenon in the AD brain, it would seem that inhibition of glycolytic enzyme activity is merely one avenue in which AD pathology affects neuronal cell development and survival, as oxidative modification can also impart a toxic gain-of-function to many proteins, including GAPDH. In this review, we examine the many functions of GAPDH with respect to AD brain; in particular, the apparent role(s) of GAPDH in AD-related apoptotic cell death is emphasized.
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is inactivated by S-sulfuration in vitro.
Jarosz, Artur P; Wei, Wanlei; Gauld, James W; Auld, Janeen; Özcan, Filiz; Aslan, Mutay; Mutus, Bulent
2015-12-01
Hydrogen sulfide (H2S) is produced enzymatically by cystathionine β-synthase (CBS) and cystathionine γ-lyase (CSE), as well as other enzymes in mammalian tissues. These discoveries have led to the crowning of H2S as yet another toxic gas that serves as a gasotransmitter like NO and CO. H2S is thought to exert its biological effects through its reaction with cysteine thiols in proteins, yielding sulfurated thiol (-SSH) derivatives. One of the first proteins shown to be modified by H2S was glyceraldehyde 3-phosphate dehydrogenase (GAPDH) [1] where the S-sulfuration of the active site cysteine (Cys 152) resulted in ~7-fold increase in the activity of the enzyme. In the present study we have attempted to reproduce this result with no success. GAPDH in its reduced, or hydrogen peroxide, or glutathione disulfide, or nitrosonium oxidized forms was reacted with sulfide or polysulfides. Sulfide had no effect on reduced GAPDH activity, while polysulfides inhibited GAPDH to ~42% of control. S-sulfuration of GAPDH occurred at Cys 247 after sulfide treatment, Cys 156 and Cys 247 after polysulfide treatment. No evidence of S-sulfuration at active site Cys 152 was discovered. Both sulfide and polysulfide was able to restore the activity of glutathione disulfide oxidized GAPDH, but not to control untreated levels. Treatment of glutathione disulfide oxidized GAPDH with polysulfide also produced S-sulfuration of Cys 156. Treatment of a C156S mutant of GAPDH with sulfide and polysulfide resulted in S-sulfuration of Cys 152, which also caused a decrease and not an increase in enzymatic activity. Computational chemistry shows S-sulfuration of Cys 156 may affect the position of catalytic Cys 152, raising its pKa by 0.5, which may affect the nucleophilicity of Cys 152. The current study raises significant questions about the reported ability of H2S to activate GAPDH by the sulfuration of its active site thiol, and indicates that polysulfide is a stronger protein S-sulfurating agent
Tian, Lu; Li, Wenyu; Huang, Xinmei; Tian, Di; Liu, Jianhua; Yang, Xinchao; Liu, Lianrui; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui; Song, Xiaokai
2017-01-01
Coccidiosis is an intestinal disorder of poultry and often caused by simultaneous infections of several Eimeria species. GAPDH is one of the immunogenic common antigens among Eimeria tenella, E. acervulina, and E. maxima identified in our previous study. The present study was performed to further evaluate its immunogenicity and protective efficacy. The genes of GAPDH cloned from E. acervulina and E. maxima were named as EaGAPDH and EmGAPDH, respectively. The immunogenicity of recombinant proteins of EaGAPDH and EmGAPDH were analyzed by Western blot. The transcription and expression of pVAX-EaGAPDH and pVAX-EmGAPDH in the injected muscles were detected by reverse transcription PCR (RT-PCR) and Western blot, respectively. GAPDH-induced changes of T lymphocytes subpopulation, cytokines production, and antibody were determined using flow cytometry, quantitative real-time PCR (qPCR), and ELISA, respectively. Finally, the protective efficacies of pVAX-EaGAPDH and pVAX-EmGAPDH were evaluated by vaccination and challenge experiments. The results revealed that the recombinant GAPDH proteins reacted with the corresponding chicken antisera. The EaGAPDH genes were successfully transcribed and expressed in the injected muscles. Vaccination with pVAX-EaGAPDH and pVAX-EmGAPDH significantly increased the proportion of CD4+ and CD8+ T lymphocytes, the cytokines productions of IFN-γ, IL-2, IL-4 et al., and IgG antibody levels compared to controls. The vaccination increased the weight gains, decreased the oocyst outputs, alleviate the enteric lesions compared to controls, and induced moderate anti-coccidial index (ACI). In conclusion, the coccidial common antigen of GAPDH induced significant humoral and cellular immune response and effective protection against E. tenella, E. acervulina, E. maxima, and mixed infection of the three Eimeria species. PMID:28769877
Cloning, expression and characterization of a mucin-binding GAPDH from Lactobacillus acidophilus.
Patel, Dhaval K; Shah, Kunal R; Pappachan, Anju; Gupta, Sarita; Singh, Desh Deepak
2016-10-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a ubiquitous enzyme involved in glycolysis. It is also referred to as a moonlighting protein as it has many diverse functions like regulation of apoptosis, iron homeostasis, cell-matrix interactions, adherence to human colon etc. apart from its principal role in glycolysis. Lactobacilli are lactic acid bacteria which colonize the human gut and confer various health benefits to humans. In the present study, we have cloned, expressed and purified the GAPDH from Lactobacillus acidophilus to get a recombinant product (r-LaGAPDH) and characterized it. Size exclusion chromatography shows that r-LaGAPDH exists as a tetramer in solution and have a mucin binding and hemagglutination activity indicating carbohydrate like binding adhesion mechanism. Fluorescence spectroscopy studies showed an interaction of r-LaGAPDH with mannose, galactose, N-acetylgalactosamine and N-acetylglucosamine with a Kd of 3.6±0.7×10(-3)M, 4.34±0.09×10(-3)M, 4±0.87×10(-3)M and 3.7±0.28×10(-3)M respectively. We hope that this preliminary data will generate more interest in further elucidation of the roles of GAPDH in the adhesion processes of the bacteria. Copyright © 2016 Elsevier B.V. All rights reserved.
Functional divergences of GAPDH isoforms during early development in two perciform fish species.
Sarropoulou, Elena; Nousdili, Dimitra; Kotoulas, Georgios; Magoulas, Antonios
2011-12-01
Glyceraldehyde-3-phospate dehydrogenase (GAPDH) is involved in basic cell catabolic processes and, as it is thought to be continuously expressed, belongs to the group of housekeeping genes. Thus, it is frequently used as an internal control in quantitative gene expression studies. However, the evidence of different expression patterns in a broad range of organisms and tissues, as well as the occurrence of different isoforms, shows that GAPDH has to be reevaluated as an internal control in qPCR studies, and its annotation has to be enriched. GAPDH has been shown to be involved in the pathway of energy and carbon molecule supply as well as in transcription and apoptosis. In the present study, we isolated the two isoforms, GAPDH-1 and GAPDH-2, of the gilthead sea bream (Sparus aurata) and the European sea bass (Dicentrarchus labrax). We inferred the phylogenetic relationships to ten other fish species and gave the gene structure of both genes. We further investigated gene expression analysis in both species for different developmental stages showing divergent gene expression of the two isoforms and the possible function of GAPDH-1 as a maternal gene.
Human Nanog pseudogene8 promotes the proliferation of gastrointestinal cancer cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Uchino, Keita, E-mail: uchino13@intmed1.med.kyushu-u.ac.jp; Hirano, Gen; Hirahashi, Minako
2012-09-10
There is emerging evidence that human solid tumor cells originate from cancer stem cells (CSCs). In cancer cell lines, tumor-initiating CSCs are mainly found in the side population (SP) that has the capacity to extrude dyes such as Hoechst 33342. We found that Nanog is expressed specifically in SP cells of human gastrointestinal (GI) cancer cells. Nucleotide sequencing revealed that NanogP8 but not Nanog was expressed in GI cancer cells. Transfection of NanogP8 into GI cancer cell lines promoted cell proliferation, while its inhibition by anti-Nanog siRNA suppressed the proliferation. Immunohistochemical staining of primary GI cancer tissues revealed NanogP8 proteinmore » to be strongly expressed in 3 out of 60 cases. In these cases, NanogP8 was found especially in an infiltrative part of the tumor, in proliferating cells with Ki67 expression. These data suggest that NanogP8 is involved in GI cancer development in a fraction of patients, in whom it presumably acts by supporting CSC proliferation. -- Highlights: Black-Right-Pointing-Pointer Nanog maintains pluripotency by regulating embryonic stem cells differentiation. Black-Right-Pointing-Pointer Nanog is expressed in cancer stem cells of human gastrointestinal cancer cells. Black-Right-Pointing-Pointer Nucleotide sequencing revealed that Nanog pseudogene8 but not Nanog was expressed. Black-Right-Pointing-Pointer Nanog pseudogene8 promotes cancer stem cells proliferation. Black-Right-Pointing-Pointer Nanog pseudogene8 is involved in gastrointestinal cancer development.« less
Identification of erythrocyte membrane proteins interacting with Mycoplasma suis GAPDH and OSGEP.
Song, Qiqi; Song, Weijiao; Zhang, Weijing; He, Lan; Fang, Rui; Zhou, Yanqin; Shen, Bang; Hu, Min; Zhao, Junlong
2018-05-05
Mycoplasma suis (M. suis) is an uncultivable haemotrophic mycoplasma that parasitizes the red blood cells of a wide range of domestic and wild animals. Adhesion of M. suis to host erythrocytes is crucial for its unique RBC-dependent lifecycle. MSG1 protein (now named as GAPDH) with homology to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was the first identified adhesion protein of M. suis. In this study, we found that O-sialoglycoprotein endopeptidase (OSGEP) is another M. suis protein capable of binding porcine erythrocytes. Recombinant OSGEP expressed in E. coli demonstrated surface localization similar to GAPDH. Purified rOSGEP bound to erythrocyte membrane preparations in a dose-dependent manner and this adhesion could be specifically inhibited by anti-rOSGEP antibodies. E. coli transformants expressing OSGEP on their surface were able to adhere to porcine erythrocytes. Furthermore, using far-western and pull-down assays, we determined the host membrane proteins that interacted with OSGEP and GAPDH were Band3 and glycophorin A (GPA). In conclusion, our studies indicated that OSGEP and GAPDH could interact with both Band3 and GPA to mediate adhesion of M. suis to porcine erythrocytes. Copyright © 2018 Elsevier Ltd. All rights reserved.
Nitric Oxide-GAPDH Transcriptional Signaling Mediates Behavioral Actions of Cocaine.
Harraz, Maged M; Snyder, Solomon H
2015-01-01
Psychotropic actions of cocaine are generally thought to involve its blockade of monoamine transporters leading to increased synaptic levels of monoamines, especially dopamine. Subsequent intracellular events have been less well characterized. We describe a signaling system wherein lower behavioral stimulant doses of cocaine, as well as higher neurotoxic doses, activate a cascade wherein nitric oxide nitrosylates glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to generate a complex with the ubiquitin-E3-ligase Siah1 which translocates to the nucleus. With lower cocaine doses, nuclear GAPDH augments CREB signaling, while at higher doses p53 signaling is enhanced. The drug CGP3466B very potently blocks GAPDH nitrosylation, hindering both signaling cascades and inhibits both behavioral activating and neurotoxic effects of cocaine. This system affords potentially novel approaches to the therapy of cocaine abuse.
FRET analysis of CP12 structural interplay by GAPDH and PRK.
Moparthi, Satish Babu; Thieulin-Pardo, Gabriel; de Torres, Juan; Ghenuche, Petru; Gontero, Brigitte; Wenger, Jérôme
2015-03-13
CP12 is an intrinsically disordered protein playing a key role in the regulation of the Benson-Calvin cycle. Due to the high intrinsic flexibility of CP12, it is essential to consider its structural modulation induced upon binding to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) enzymes. Here, we report for the first time detailed structural modulation about the wild-type CP12 and its site-specific N-terminal and C-terminal disulfide bridge mutants upon interaction with GAPDH and PRK by Förster resonance energy transfer (FRET). Our results indicate an increase in CP12 compactness when the complex is formed with GAPDH or PRK. In addition, the distributions in FRET histograms show the elasticity and conformational flexibility of CP12 in all supra molecular complexes. Contrarily to previous beliefs, our FRET results importantly reveal that both N-terminal and C-terminal site-specific CP12 mutants are able to form the monomeric (GAPDH-CP12-PRK) complex. Copyright © 2015 Elsevier Inc. All rights reserved.
Human GAPDH Is a Target of Aspirin’s Primary Metabolite Salicylic Acid and Its Derivatives
Manohar, Murli; Harraz, Maged M.; Park, Sang-Wook; Schroeder, Frank C.; Snyder, Solomon H.; Klessig, Daniel F.
2015-01-01
The plant hormone salicylic acid (SA) controls several physiological processes and is a key regulator of multiple levels of plant immunity. To decipher the mechanisms through which SA’s multiple physiological effects are mediated, particularly in immunity, two high-throughput screens were developed to identify SA-binding proteins (SABPs). Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH) from plants (Arabidopsis thaliana) was identified in these screens. Similar screens and subsequent analyses using SA analogs, in conjunction with either a photoaffinity labeling technique or surface plasmon resonance-based technology, established that human GAPDH (HsGAPDH) also binds SA. In addition to its central role in glycolysis, HsGAPDH participates in several pathological processes, including viral replication and neuronal cell death. The anti-Parkinson’s drug deprenyl has been shown to suppress nuclear translocation of HsGAPDH, an early step in cell death and the resulting cell death induced by the DNA alkylating agent N-methyl-N’-nitro-N-nitrosoguanidine. Here, we demonstrate that SA, which is the primary metabolite of aspirin (acetyl SA) and is likely responsible for many of its pharmacological effects, also suppresses nuclear translocation of HsGAPDH and cell death. Analysis of two synthetic SA derivatives and two classes of compounds from the Chinese medicinal herb Glycyrrhiza foetida (licorice), glycyrrhizin and the SA-derivatives amorfrutins, revealed that they not only appear to bind HsGAPDH more tightly than SA, but also exhibit a greater ability to suppress translocation of HsGAPDH to the nucleus and cell death. PMID:26606248
Pavlícek, Adam; Paces, Jan; Elleder, Daniel; Hejnar, Jirí
2002-03-01
We report here the presence of numerous processed pseudogenes derived from the W family of endogenous retroviruses in the human genome. These pseudogenes are structurally colinear with the retroviral mRNA followed by a poly(A) tail. Our analysis of insertion sites of HERV-W processed pseudogenes shows a strong preference for the insertion motif of long interspersed nuclear element (LINE) retrotransposons. The genomic distribution, stability during evolution, and frequent truncations at the 5' end resemble those of the pseudogenes generated by LINEs. We therefore suggest that HERV-W processed pseudogenes arose by multiple and independent LINE-mediated retrotransposition of retroviral mRNA. These data document that the majority of HERV-W copies are actually nontranscribed promoterless pseudogenes. The current search for HERV-Ws associated with several human diseases should concentrate on a small subset of transcriptionally competent elements.
Chang, Chunmei; Su, Hua; Zhang, Danhong; Wang, Yusha; Shen, Qiuhong; Liu, Bo; Huang, Rui; Zhou, Tianhua; Peng, Chao; Wong, Catherine C L; Shen, Han-Ming; Lippincott-Schwartz, Jennifer; Liu, Wei
2015-12-17
Eukaryotes initiate autophagy to cope with the lack of external nutrients, which requires the activation of the nicotinamide adenine dinucleotide (NAD(+))-dependent deacetylase Sirtuin 1 (Sirt1). However, the mechanisms underlying the starvation-induced Sirt1 activation for autophagy initiation remain unclear. Here, we demonstrate that glyceraldehyde 3-phosphate dehydrogenase (GAPDH), a conventional glycolytic enzyme, is a critical mediator of AMP-activated protein kinase (AMPK)-driven Sirt1 activation. Under glucose starvation, but not amino acid starvation, cytoplasmic GAPDH is phosphorylated on Ser122 by activated AMPK. This causes GAPDH to redistribute into the nucleus. Inside the nucleus, GAPDH interacts directly with Sirt1, displacing Sirt1's repressor and causing Sirt1 to become activated. Preventing this shift of GAPDH abolishes Sirt1 activation and autophagy, while enhancing it, through overexpression of nuclear-localized GAPDH, increases Sirt1 activation and autophagy. GAPDH is thus a pivotal and central regulator of autophagy under glucose deficiency, undergoing AMPK-dependent phosphorylation and nuclear translocation to activate Sirt1 deacetylase activity. Copyright © 2015 Elsevier Inc. All rights reserved.
Baker, Bo Y; Shi, Wuxian; Wang, Benlian; Palczewski, Krzysztof
2014-01-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) catalyzes the oxidative phosphorylation of d-glyceraldehyde 3-phosphate (G3P) into 1,3-diphosphoglycerate (BGP) in the presence of the NAD cofactor. GAPDH is an important drug target because of its central role in glycolysis, and nonglycolytic processes such as nuclear RNA transport, DNA replication/repair, membrane fusion and cellular apoptosis. Recent studies found that GAPDH participates in the development of diabetic retinopathy and its progression after the cessation of hyperglycemia. Here, we report two structures for native bovine photoreceptor GAPDH as a homotetramer with differing occupancy by NAD, bGAPDH(NAD)4, and bGAPDH(NAD)3. The bGAPDH(NAD)4 was solved at 1.52 Å, the highest resolution for GAPDH. Structural comparison of the bGAPDH(NAD)4 and bGAPDH(NAD)3 models revealed novel details of conformational changes induced by cofactor binding, including a loop region (residues 54–56). Structure analysis of bGAPDH confirmed the importance of Phe34 in NAD binding, and demonstrated that Phe34 was stabilized in the presence of NAD but displayed greater mobility in its absence. The oxidative state of the active site Cys149 residue is regulated by NAD binding, because this residue was found oxidized in the absence of dinucleotide. The distance between Cys149 and His176 decreased upon NAD binding and Cys149 remained in a reduced state when NAD was bound. These findings provide an important structural step for understanding the mechanism of GAPDH activity in vision and its pathological role in retinopathies. PMID:25176140
Improvement of expression level of polysaccharide lyases with new tag GAPDH in E. coli.
Chen, Zhenya; Li, Ye; Sun, Xinxiao; Yuan, Qipeng
2016-10-20
Escherichia coli (E. coli) is widely used to express a variety of heterologous proteins. Efforts have been made to enhance the expression level of the desired protein. However, problems still exist to regulate the level of protein expression and therefore, new strategies are needed to overcome those issues. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) which is properly expressed in E. coli might play a leading role and increase the expression levels of the target proteins. In this study, GAPDH was fused with a target enzyme, ChSase ABC I, an endoeliminase and polysaceharide lyase. Our results confirmed this hypothesis and indicated that GAPDH boosted the expression level of ChSase ABC I with an increase of 2.25 times, while the enzymatic activity with an increase of 2.99 times. The hypothesis were also supported by RT-PCR study and GAPDH was more effective in enhancing the expression level and enzymatic activity as compared to MBP, which is commonly used as fused tag and can improve the soluble expression of target protein. addition, the expression level and enzymatic activity of other polysaceharide lyases were also improved in the presence of GAPDH. The findings of this study prove that GAPDH has a strong effect on enhancing the expression level and enzymatic activity of the target proteins. Copyright © 2016 Elsevier B.V. All rights reserved.
Energy determinants GAPDH and NDPK act as genetic modifiers for hepatocyte inclusion formation
Weerasinghe, Sujith V.W.; Singla, Amika; Leonard, Jessica M.; Hanada, Shinichiro; Andrews, Philip C.; Lok, Anna S.; Omary, M. Bishr
2011-01-01
Genetic factors impact liver injury susceptibility and disease progression. Prominent histological features of some chronic human liver diseases are hepatocyte ballooning and Mallory-Denk bodies. In mice, these features are induced by 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) in a strain-dependent manner, with the C57BL and C3H strains showing high and low susceptibility, respectively. To identify modifiers of DDC-induced liver injury, we compared C57BL and C3H mice using proteomic, biochemical, and cell biological tools. DDC elevated reactive oxygen species (ROS) and oxidative stress enzymes preferentially in C57BL livers and isolated hepatocytes. C57BL livers and hepatocytes also manifested significant down-regulation, aggregation, and nuclear translocation of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). GAPDH knockdown depleted bioenergetic and antioxidant enzymes and elevated hepatocyte ROS, whereas GAPDH overexpression decreased hepatocyte ROS. On the other hand, C3H livers had higher expression and activity of the energy-generating nucleoside-diphosphate kinase (NDPK), and knockdown of hepatocyte NDPK augmented DDC-induced ROS formation. Consistent with these findings, cirrhotic, but not normal, human livers contained GAPDH aggregates and NDPK complexes. We propose that GAPDH and NDPK are genetic modifiers of murine DDC-induced liver injury and potentially human liver disease. PMID:22006949
On the role of GAPDH isoenzymes during pentose fermentation in engineered Saccharomyces cerevisiae.
Linck, Annabell; Vu, Xuan-Khang; Essl, Christine; Hiesl, Charlotte; Boles, Eckhard; Oreb, Mislav
2014-05-01
In the metabolic network of the cell, many intermediary products are shared between different pathways. d-Glyceraldehyde-3-phosphate, a glycolytic intermediate, is a substrate of GAPDH but is also utilized by transaldolase and transketolase in the scrambling reactions of the nonoxidative pentose phosphate pathway. Recent efforts to engineer baker's yeast strains capable of utilizing pentose sugars present in plant biomass rely on increasing the carbon flux through this pathway. However, the competition between transaldolase and GAPDH for d-glyceraldehyde-3-phosphate produced in the first transketolase reaction compromises the carbon balance of the pathway, thereby limiting the product yield. Guided by the hypothesis that reduction in GAPDH activity would increase the availability of d-glyceraldehyde-3-phosphate for transaldolase and thereby improve ethanol production during fermentation of pentoses, we performed a comprehensive characterization of the three GAPDH isoenzymes in baker's yeast, Tdh1, Tdh2, and Tdh3 and analyzed the effect of their deletion on xylose utilization by engineered strains. Our data suggest that overexpression of transaldolase is a more promising strategy than reduction in GAPDH activity to increase the flux through the nonoxidative pentose phosphate pathway. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
GAPDH rs1136666 SNP indicates a high risk of Parkinson's disease.
Ping, Zhang; Xiaomu, Wu; Xufang, Xie; Wenfeng, Cao; Liang, Shao; Tao, Wang
2018-06-07
Development of Parkinson's disease (PD) is attributed to both genetic and environmental factors. Furthermore,GAPDH may play a key role in the development of neurodegenerative disease. Examination of genetic polymorphism in patients with sporadic PD will help uncover the mechanisms of PD pathogenesis and provide new insights into the treatment of PD. The SNaPshot method was applied to determine the gene sequences in 265 patients with idiopathic PD and 269 control cases (sex- and age-matched). The rs1136666 polymorphism of GAPDH was determined to be closely associated with PD. Subsequently, the CC genotype of the rs1136666 fragment was transfected into SH-SY5Y cells via a plasmid. The genetic expression of rs1136666 CC could induce SH-SY5Y cell injury and apoptosis via regulation of the oxidant-antioxidant and apoptosis-antiapoptosis balance. rs1136666 CC of the GAPDH had a pro-apoptotic effect similar to that of rotenone, and combination of the rs1136666 CC genetic variation and the rotenone neurotoxic effect could aggravate oxidative stress, cell injury, and apoptosis better than either single treatment alone. This study confirmed that the rs1136666 CC allele of theGAPDH increased the risk of PD, particularly in older male patients. Copyright © 2018. Published by Elsevier B.V.
Tang, Zhenjie; Yuan, Shuqiang; Hu, Yumin; Zhang, Hui; Wu, Wenjing; Zeng, Zhaolei; Yang, Jing; Yun, Jingping; Xu, Ruihua; Huang, Peng
2012-02-01
It has long been observed that many cancer cells exhibit increased aerobic glycolysis and rely more on this pathway to generate ATP and metabolic intermediates for cell proliferation. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a key enzyme in glycolysis and has been known as a housekeeping molecule. In the present study, we found that GAPDH expression was significantly up-regulated in human colorectal carcinoma tissues compared to the adjacent normal tissues, and also increased in colon cancer cell lines compared to the non-tumor colon mucosa cells in culture. The expression of GAPDH was further elevated in the liver metastatic tissues compared to the original colon cancer tissue of the same patients, suggesting that high expression of GAPDH might play an important role in colon cancer development and metastasis. Importantly, we found that 3-bromopyruvate propyl ester (3-BrOP) preferentially inhibited GAPDH and exhibited potent activity in inducing colon cancer cell death by causing severe depletion of ATP. 3-BrOP at low concentrations (1-10 μM) inhibited GAPDH and a much higher concentration (300 μM) was required to inhibit hexokinase-2. The cytotoxic effect of 3-BrOP was associated with its inhibition of GAPDH, and colon cancer cells with loss of p53 were more sensitive to this compound. Our study suggests that GAPDH may be a potential target for colon cancer therapy.
Mycobacterium leprae: genes, pseudogenes and genetic diversity
Singh, Pushpendra; Cole, Stewart T
2011-01-01
Leprosy, which has afflicted human populations for millenia, results from infection with Mycobacterium leprae, an unculturable pathogen with an exceptionally long generation time. Considerable insight into the biology and drug resistance of the leprosy bacillus has been obtained from genomics. M. leprae has undergone reductive evolution and pseudogenes now occupy half of its genome. Comparative genomics of four different strains revealed remarkable conservation of the genome (99.995% identity) yet uncovered 215 polymorphic sites, mainly single nucleotide polymorphisms, and a handful of new pseudogenes. Mapping these polymorphisms in a large panel of strains defined 16 single nucleotide polymorphism-subtypes that showed strong geographical associations and helped retrace the evolution of M. leprae. PMID:21162636
Tang, Zhenjie; Yuan, Shuqiang; Hu, Yumin; Zhang, Hui; Wu, Wenjing; Zeng, Zhaolei; Yang, Jing; Yun, Jingping
2012-01-01
It has long been observed that many cancer cells exhibit increased aerobic glycolysis and rely more on this pathway to generate ATP and metabolic intermediates for cell proliferation. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a key enzyme in glycolysis and has been known as a housekeeping molecule. In the present study, we found that GAPDH expression was significantly up-regulated in human colorectal carcinoma tissues compared to the adjacent normal tissues, and also increased in colon cancer cell lines compared to the non-tumor colon mucosa cells in culture. The expression of GAPDH was further elevated in the liver meta-static tissues compared to the original colon cancer tissue of the same patients, suggesting that high expression of GAPDH might play an important role in colon cancer development and metastasis. Importantly, we found that 3-bromopyruvate propyl ester (3-BrOP) preferentially inhibited GAPDH and exhibited potent activity in inducing colon cancer cell death by causing severe depletion of ATP. 3-BrOP at low concentrations (1–10 μM) inhibited GAPDH and a much higher concentration (300 μM) was required to inhibit hexokinase-2. The cytotoxic effect of 3-BrOP was associated with its inhibition of GAPDH, and colon cancer cells with loss of p53 were more sensitive to this compound. Our study suggests that GAPDH may be a potential target for colon cancer therapy. PMID:22350014
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tayebi, N.; Cushner, S.; Sidransky, E.
1996-09-01
We describe the use of long-template PCR to differentiate the glucocerebrosidase gene from its pseudogene, which will simplify molecular diagnostic testing and the detection of known and new mutations in patients with Gaucher disease. Gaucher disease results from the inherited deficiency of the lysosomal enzyme, glucocerebrosidase. Sixteen kilobases downstream of the glucocerebrosidase gene is a pseudogene, which is {approximately}2 kb shorter and has >96% identity to the coding regions of the functional gene. Many mutations encountered in Gaucher patients are identical to sequences ordinarily found only in the pseudogene, and some result from recombination between the gene and pseudogene. Thus,more » for diagnostic purposes it is essential to differentiate between sequences from the gene and pseudogene. 9 refs., 1 fig.« less
A mammalian pseudogene lncRNA at the interface of inflammation and anti-inflammatory therapeutics
Rapicavoli, Nicole A; Qu, Kun; Zhang, Jiajing; Mikhail, Megan; Laberge, Remi-Martin; Chang, Howard Y
2013-01-01
Pseudogenes are thought to be inactive gene sequences, but recent evidence of extensive pseudogene transcription raised the question of potential function. Here we discover and characterize the sets of mouse lncRNAs induced by inflammatory signaling via TNFα. TNFα regulates hundreds of lncRNAs, including 54 pseudogene lncRNAs, several of which show exquisitely selective expression in response to specific cytokines and microbial components in a NF-κB-dependent manner. Lethe, a pseudogene lncRNA, is selectively induced by proinflammatory cytokines via NF-κB or glucocorticoid receptor agonist, and functions in negative feedback signaling to NF-κB. Lethe interacts with NF-κB subunit RelA to inhibit RelA DNA binding and target gene activation. Lethe level decreases with organismal age, a physiological state associated with increased NF-κB activity. These findings suggest that expression of pseudogenes lncRNAs are actively regulated and constitute functional regulators of inflammatory signaling. DOI: http://dx.doi.org/10.7554/eLife.00762.001 PMID:23898399
2010-01-01
Background Unitary pseudogenes are a class of unprocessed pseudogenes without functioning counterparts in the genome. They constitute only a small fraction of annotated pseudogenes in the human genome. However, as they represent distinct functional losses over time, they shed light on the unique features of humans in primate evolution. Results We have developed a pipeline to detect human unitary pseudogenes through analyzing the global inventory of orthologs between the human genome and its mammalian relatives. We focus on gene losses along the human lineage after the divergence from rodents about 75 million years ago. In total, we identify 76 unitary pseudogenes, including previously annotated ones, and many novel ones. By comparing each of these to its functioning ortholog in other mammals, we can approximately date the creation of each unitary pseudogene (that is, the gene 'death date') and show that for our group of 76, the functional genes appear to be disabled at a fairly uniform rate throughout primate evolution - not all at once, correlated, for instance, with the 'Alu burst'. Furthermore, we identify 11 unitary pseudogenes that are polymorphic - that is, they have both nonfunctional and functional alleles currently segregating in the human population. Comparing them with their orthologs in other primates, we find that two of them are in fact pseudogenes in non-human primates, suggesting that they represent cases of a gene being resurrected in the human lineage. Conclusions This analysis of unitary pseudogenes provides insights into the evolutionary constraints faced by different organisms and the timescales of functional gene loss in humans. PMID:20210993
Li, Ye; Chen, Zhenya; Zhou, Zhao; Yuan, Qipeng
2016-12-01
Chondroitinases (ChSases) are a family of polysaccharide lyases that can depolymerize high molecular weight chondroitin sulfate (CS) and dermatan sulfate (DS). In this study, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is stably expressed in different cells like normal cells and cancer cells and the expression is relatively insensitive to experimental conditions, was expressed as a fusion protein with ChSase ABC I. Results showed that the expression level and enzyme activity of GAPDH-ChSase ABC I were about 2.2 and 3.0 times higher than those of ChSase ABC I. By optimization of fermentation conditions, higher productivity of ChSase ABC I was achieved as 880 ± 61 IU/g wet cell weight compared with the reported ones. The optimal temperature and pH of GAPDH-ChSase ABC I were 40 °C and 7.5, respectively. GAPDH-ChSase ABC I had a kcat/Km of 131 ± 4.1 L/μmol s and the catalytic efficiency was decreased as compared to ChSase ABC I. The relative activity of GAPDH-ChSase ABC I remained 89% after being incubated at 30 °C for 180 min and the thermostability of ChSase ABC I was enhanced by GAPDH when it was incubated at 30, 35, 40 and 45 °C. Copyright © 2016 Elsevier Inc. All rights reserved.
PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.
Wimmer, Katharina; Wernstedt, Annekatrin
2014-01-01
The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.
Lin, Ya-Ying
2017-01-01
A portion of the mitochondrial cytochrome c oxidase I gene was sequenced using both genomic DNA and complement DNA from three planktonic copepod Neocalanus species (N. cristatus, N. plumchrus, and N. flemingeri). Small but critical sequence differences in CO1 were observed between gDNA and cDNA from N. plumchrus. Furthermore, careful observation revealed the presence of recombination between sequences in gDNA from N. plumchrus. Moreover, a chimera of the N. cristatus and N. plumchrus sequences was obtained from N. plumchrus gDNA. The observed phenomena can be best explained by the preferential amplification of the nuclear mitochondrial pseudogenes from gDNA of N. plumchrus. Two conclusions can be drawn from the observations. First, nuclear mitochondrial pseudogenes are pervasive in N. plumchrus. Second, a mating between a female N. cristatus and a male N. plumchrus produced viable offspring, which further backcrossed to a N. plumchrus individual. These observations not only demonstrate intriguing mating behavior in these species, but also emphasize the importance of careful interpretation of species marker sequences amplified from gDNA. PMID:28231343
Marimon, José María; Freire, Javier; Salcines-Cuevas, David; Carmen Fariñas, M.; onzalez-Rico, Claudia; Marradi, Marco; Garcia, Isabel; Alkorta-Gurrutxaga, Mirian; San Nicolas-Gomez, Aida; Castañeda-Sampedro, Ana; Yañez-Diaz, Sonsoles; Penades, Soledad; Punzon, Carmen; Gomez-Roman, Javier; Rivera, Fernando; Fresno, Manuel; Alvarez-Dominguez, Carmen
2017-01-01
Clinical cases of neonatal listeriosis are associated with brain disease and fetal loss due to complications in early or late pregnancy, which suggests that microglial function is altered. This is believed to be the first study to link microglial apoptosis with neonatal listeriosis and listeriosis-associated brain disease, and to propose a new nanovaccine formulation that reverses all effects of listeriosis and confers Listeria monocytogenes (LM)-specific immunity. We examined clinical cases of neonatal listeriosis in 2013–2015 and defined two useful prognostic immune biomarkers to design listeriosis vaccines: high anti-GAPDH1-22 titres and tumor necrosis factor (TNF)/interleukin (IL)-6 ratios. Therefore, we developed a nanovaccine with gold glyco-nanoparticles conjugated to LM peptide 1-22 of GAPDH (Lmo2459), GNP-GAPDH1-22 nanovaccinesformulated with a pro-inflammatory Toll-like receptor 2/4-targeted adjuvant. Neonates born to non-vaccinated pregnant mice with listeriosis, showed brain and vascular diseases and significant microglial dysfunction by induction of TNF-α-mediated apoptosis. This programmed TNF-mediated suicide explains LM dissemination in brains and livers and blocks production of early pro-inflammatory cytokines such as IL-1β and interferon-α/β. In contrast, neonates born to GNP-GAPDH1–22-vaccinated mothers before LM infection, did not develop listeriosis or brain diseases and had functional microglia. In nanovaccinated mothers, immune responses shifted towards Th1/IL-12 pro-inflammatory cytokine profiles and high production of anti-GAPDH1–22 antibodies, suggesting good induction of LM-specific memory. PMID:28903312
Calderon-Gonzalez, Ricardo; Frande-Cabanes, Elisabet; Teran-Navarro, Hector; Marimon, José María; Freire, Javier; Salcines-Cuevas, David; Carmen Fariñas, M; Onzalez-Rico, Claudia; Marradi, Marco; Garcia, Isabel; Alkorta-Gurrutxaga, Mirian; San Nicolas-Gomez, Aida; Castañeda-Sampedro, Ana; Yañez-Diaz, Sonsoles; Penades, Soledad; Punzon, Carmen; Gomez-Roman, Javier; Rivera, Fernando; Fresno, Manuel; Alvarez-Dominguez, Carmen
2017-08-15
Clinical cases of neonatal listeriosis are associated with brain disease and fetal loss due to complications in early or late pregnancy, which suggests that microglial function is altered. This is believed to be the first study to link microglial apoptosis with neonatal listeriosis and listeriosis-associated brain disease, and to propose a new nanovaccine formulation that reverses all effects of listeriosis and confers Listeria monocytogenes (LM)-specific immunity. We examined clinical cases of neonatal listeriosis in 2013-2015 and defined two useful prognostic immune biomarkers to design listeriosis vaccines: high anti-GAPDH 1-22 titres and tumor necrosis factor (TNF)/interleukin (IL)-6 ratios. Therefore, we developed a nanovaccine with gold glyco-nanoparticles conjugated to LM peptide 1-22 of GAPDH (Lmo2459), GNP-GAPDH 1-22 nanovaccinesformulated with a pro-inflammatory Toll-like receptor 2/4-targeted adjuvant. Neonates born to non-vaccinated pregnant mice with listeriosis, showed brain and vascular diseases and significant microglial dysfunction by induction of TNF-α-mediated apoptosis. This programmed TNF-mediated suicide explains LM dissemination in brains and livers and blocks production of early pro-inflammatory cytokines such as IL-1β and interferon-α/β. In contrast, neonates born to GNP-GAPDH 1-22 -vaccinated mothers before LM infection, did not develop listeriosis or brain diseases and had functional microglia. In nanovaccinated mothers, immune responses shifted towards Th1/IL-12 pro-inflammatory cytokine profiles and high production of anti-GAPDH 1-22 antibodies, suggesting good induction of LM-specific memory.
Noise-induced multistability in the regulation of cancer by genes and pseudogenes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Petrosyan, K. G., E-mail: pkaren@phys.sinica.edu.tw; Hu, Chin-Kun, E-mail: huck@phys.sinica.edu.tw; National Center for Theoretical Sciences, National Tsing Hua University, Hsinchu 30013, Taiwan
2016-07-28
We extend a previously introduced model of stochastic gene regulation of cancer to a nonlinear case having both gene and pseudogene messenger RNAs (mRNAs) self-regulated. The model consists of stochastic Boolean genetic elements and possesses noise-induced multistability (multimodality). We obtain analytical expressions for probabilities for the case of constant but finite number of microRNA molecules which act as a noise source for the competing gene and pseudogene mRNAs. The probability distribution functions display both the global bistability regime as well as even-odd number oscillations for a certain range of model parameters. Statistical characteristics of the mRNA’s level fluctuations are evaluated.more » The obtained results of the extended model advance our understanding of the process of stochastic gene and pseudogene expressions that is crucial in regulation of cancer.« less
Margaryan, Hasmik; Dorosh, Andriy; Capkova, Jana; Manaskova-Postlerova, Pavla; Philimonenko, Anatoly; Hozak, Pavel; Peknicova, Jana
2015-03-08
Sperm proteins are important for the sperm cell function in fertilization. Some of them are involved in the binding of sperm to the egg. We characterized the acrosomal sperm protein detected by a monoclonal antibody (MoAb) (Hs-8) that was prepared in our laboratory by immunization of BALB/c mice with human ejaculated sperms and we tested the possible role of this protein in the binding assay. Indirect immunofluorescence and immunogold labelling, gel electrophoresis, Western blotting and protein sequencing were used for Hs-8 antigen characterization. Functional analysis of GAPDHS from the sperm acrosome was performed in the boar model using sperm/zona pellucida binding assay. Monoclonal antibody Hs-8 is an anti-human sperm antibody that cross-reacts with the Hs-8-related protein in spermatozoa of other mammalian species (boar, mouse). In the immunofluorescence test, Hs-8 antibody recognized the protein localized in the acrosomal part of the sperm head and in the principal piece of the sperm flagellum. In immunoblotting test, MoAb Hs-8 labelled a protein of 45 kDa in the extract of human sperm. Sequence analysis identified protein Hs-8 as GAPDHS (glyceraldehyde 3-phosphate dehydrohenase-spermatogenic). For this reason, commercial mouse anti-GAPDHS MoAb was applied in control tests. Both antibodies showed similar staining patterns in immunofluorescence tests, in electron microscopy and in immunoblot analysis. Moreover, both Hs-8 and anti-GAPDHS antibodies blocked sperm/zona pellucida binding. GAPDHS is a sperm-specific glycolytic enzyme involved in energy production during spermatogenesis and sperm motility; its role in the sperm head is unknown. In this study, we identified the antigen with Hs8 antibody and confirmed its localization in the apical part of the sperm head in addition to the principal piece of the flagellum. In an indirect binding assay, we confirmed the potential role of GAPDHS as a binding protein that is involved in the secondary sperm
Kim, Min-Sik
2016-01-01
Malaria transmission begins when an infected mosquito delivers Plasmodium sporozoites into the skin. The sporozoite subsequently enters the circulation and infects the liver by preferentially traversing Kupffer cells, a macrophage-like component of the liver sinusoidal lining. By screening a phage display library, we previously identified a peptide designated P39 that binds to CD68 on the surface of Kupffer cells and blocks sporozoite traversal. In this study, we show that the P39 peptide is a structural mimic of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) on the sporozoite surface and that GAPDH directly interacts with CD68 on the Kupffer cell surface. Importantly, an anti-P39 antibody significantly inhibits sporozoite liver invasion without cross-reacting with mammalian GAPDH. Therefore, Plasmodium-specific GAPDH epitopes may provide novel antigens for the development of a prehepatic vaccine. PMID:27551151
Cha, Sung-Jae; Kim, Min-Sik; Pandey, Akhilesh; Jacobs-Lorena, Marcelo
2016-09-19
Malaria transmission begins when an infected mosquito delivers Plasmodium sporozoites into the skin. The sporozoite subsequently enters the circulation and infects the liver by preferentially traversing Kupffer cells, a macrophage-like component of the liver sinusoidal lining. By screening a phage display library, we previously identified a peptide designated P39 that binds to CD68 on the surface of Kupffer cells and blocks sporozoite traversal. In this study, we show that the P39 peptide is a structural mimic of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) on the sporozoite surface and that GAPDH directly interacts with CD68 on the Kupffer cell surface. Importantly, an anti-P39 antibody significantly inhibits sporozoite liver invasion without cross-reacting with mammalian GAPDH. Therefore, Plasmodium-specific GAPDH epitopes may provide novel antigens for the development of a prehepatic vaccine. © 2016 Cha et al.
Kaido, Masanori; Abe, Kazutomo; Mine, Akira; Hyodo, Kiwamu; Taniguchi, Takako; Taniguchi, Hisaaki; Mise, Kazuyuki; Okuno, Tetsuro
2014-01-01
The formation of virus movement protein (MP)-containing punctate structures on the cortical endoplasmic reticulum is required for efficient intercellular movement of Red clover necrotic mosaic virus (RCNMV), a bipartite positive-strand RNA plant virus. We found that these cortical punctate structures constitute a viral replication complex (VRC) in addition to the previously reported aggregate structures that formed adjacent to the nucleus. We identified host proteins that interacted with RCNMV MP in virus-infected Nicotiana benthamiana leaves using a tandem affinity purification method followed by mass spectrometry. One of these host proteins was glyceraldehyde 3-phosphate dehydrogenase-A (NbGAPDH-A), which is a component of the Calvin-Benson cycle in chloroplasts. Virus-induced gene silencing of NbGAPDH-A reduced RCNMV multiplication in the inoculated leaves, but not in the single cells, thereby suggesting that GAPDH-A plays a positive role in cell-to-cell movement of RCNMV. The fusion protein of NbGAPDH-A and green fluorescent protein localized exclusively to the chloroplasts. In the presence of RCNMV RNA1, however, the protein localized to the cortical VRC as well as the chloroplasts. Bimolecular fluorescence complementation assay and GST pulldown assay confirmed in vivo and in vitro interactions, respectively, between the MP and NbGAPDH-A. Furthermore, gene silencing of NbGAPDH-A inhibited MP localization to the cortical VRC. We discuss the possible roles of NbGAPDH-A in the RCNMV movement process. PMID:25411849
2013-01-01
Background Pseudogenes are traditionally considered “dead” genes, therefore lacking biological functions. This view has however been challenged during the last decade. This is the case of the Protein phosphatase 1 regulatory subunit 2 (PPP1R2) or inhibitor-2 gene family, for which several incomplete copies exist scattered throughout the genome. Results In this study, the pseudogenization process of PPP1R2 was analyzed. Ten PPP1R2-related pseudogenes (PPP1R2P1-P10), highly similar to PPP1R2, were retrieved from the human genome assembly present in the databases. The phylogenetic analysis of mammalian PPP1R2 and related pseudogenes suggested that PPP1R2P7 and PPP1R2P9 retroposons appeared before the great mammalian radiation, while the remaining pseudogenes are primate-specific and retroposed at different times during Primate evolution. Although considered inactive, four of these pseudogenes seem to be transcribed and possibly possess biological functions. Given the role of PPP1R2 in sperm motility, the presence of these proteins was assessed in human sperm, and two PPP1R2-related proteins were detected, PPP1R2P3 and PPP1R2P9. Signatures of negative and positive selection were also detected in PPP1R2P9, further suggesting a role as a functional protein. Conclusions The results show that contrary to initial observations PPP1R2-related pseudogenes are not simple bystanders of the evolutionary process but may rather be at the origin of genes with novel functions. PMID:24195737
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bozza, M.; Gerard, C.; Kolakowski, L.F. Jr.
1995-06-10
Macrophage migration inhibitory factor, MIF, is a cytokine released by T-lymphocytes, macrophages, and the pituitary gland that serves to integrate peripheral and central inflammatory responses. Ubiquitous expression and developmental regulation suggest that MIF may have additional roles outside of the immune system. Here we report the structure and chromosomal location of the mouse Mif gene and the partial characterization of five Mif pseudogenes. The mouse Mif gene spans less than 0.7 kb of chromosomal DNA and is composed of three exons. A comparison between the mouse and the human genes shows a similar gene structure and common regulatory elements inmore » both promoter regions. The mouse Mif gene maps to the middle region of chromosome 10, between Bcr and S100b, which have been mapped to human chromosomes 22q11 and 21q22.3, respectively. The entire sequence of two pseudogenes demonstrates the absence of introns, the presence of the 5{prime} untranslated region of the cDNA, a 3{prime} poly(A) tail, and the lack of sequence similarity with untranscribed regions of the gene. The five pseudogenes are highly homologous to the cDNA, but contain a variable number of mutations that would produce mutated or truncated MIF-like proteins. Phylogenetic analyses of MIF genes and pseudogenes indicate several independent genetic events that can account for multiple genomic integrations. Three of the Mif pseudogenes were also mapped by interspecific backcross to chromosomes 1, 9, and 17. These results suggest that Mif pseudogenes originated by retrotransposition. 46 refs., 5 figs., 1 tab.« less
Del Giudice, Alessandra; Pavel, Nicolae Viorel; Galantini, Luciano; Falini, Giuseppe; Trost, Paolo; Fermani, Simona; Sparla, Francesca
2015-12-01
Oxygenic photosynthetic organisms produce sugars through the Calvin-Benson cycle, a metabolism that is tightly linked to the light reactions of photosynthesis and is regulated by different mechanisms, including the formation of protein complexes. Two enzymes of the cycle, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK), form a supramolecular complex with the regulatory protein CP12 with the formula (GAPDH-CP122-PRK)2, in which both enzyme activities are transiently inhibited during the night. Small-angle X-ray scattering analysis performed on both the GAPDH-CP12-PRK complex and its components, GAPDH-CP12 and PRK, from Arabidopsis thaliana showed that (i) PRK has an elongated, bent and screwed shape, (ii) the oxidized N-terminal region of CP12 that is not embedded in the GAPDH-CP12 complex prefers a compact conformation and (iii) the interaction of PRK with the N-terminal region of CP12 favours the approach of two GAPDH tetramers. The interaction between the GAPDH tetramers may contribute to the overall stabilization of the GAPDH-CP12-PRK complex, the structure of which is presented here for the first time.
Sexton, Jonathan Z; Danshina, Polina V; Lamson, David R; Hughes, Mark; House, Alan J; Yeh, Li-An; O’Brien, Deborah A; Williams, Kevin P
2011-01-01
Glycolytic isozymes that are restricted to the male germline are potential targets for the development of reversible, non-hormonal male contraceptives. GAPDHS, the sperm-specific isoform of glyceraldehyde-3-phosphate dehydrogenase, is an essential enzyme for glycolysis making it an attractive target for rational drug design. Toward this goal, we have optimized and validated a high-throughput spectrophotometric assay for GAPDHS in 384-well format. The assay was stable over time and tolerant to DMSO. Whole plate validation experiments yielded Z’ values >0.8 indicating a robust assay for HTS. Two compounds were identified and confirmed from a test screen of the Prestwick collection. This assay was used to screen a diverse chemical library and identified fourteen small molecules that modulated the activity of recombinant purified GAPDHS with confirmed IC50 values ranging from 1.8 to 42 µM. These compounds may provide useful scaffolds as molecular tools to probe the role of GAPDHS in sperm motility and long term to develop potent and selective GAPDHS inhibitors leading to novel contraceptive agents. PMID:21760877
Stem cell regulatory function mediated by expression of a novel mouse Oct4 pseudogene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Huey; Shabbir, Arsalan; Molnar, Merced
2007-03-30
Multiple pseudogenes have been proposed for embryonic stem (ES) cell-specific genes, and their abundance suggests that some of these potential pseudogenes may be functional. ES cell-specific expression of Oct4 regulates stem cell pluripotency and self-renewing state. Although Oct4 expression has been reported in adult tissues during gene reprogramming, the detected Oct4 signal might be contributed by Oct4 pseudogenes. Among the multiple Oct4 transcripts characterized here is a {approx}1 kb clone derived from P19 embryonal carcinoma stem cells, which shares a {approx}87% sequence homology with the parent Oct4 gene, and has the potential of encoding an 80-amino acid product (designated asmore » Oct4P1). Adenoviral expression of Oct4P1 in mesenchymal stem cells promotes their proliferation and inhibits their osteochondral differentiation. These dual effects of Oct4P1 are reminiscent of the stem cell regulatory function of the parent Oct4, and suggest that Oct4P1 may be a functional pseudogene or a novel Oct4-related gene with a unique function in stem cells.« less
Ganapathy-Kanniappan, Shanmugasundaram; Geschwind, Jean-Francois H.; Kunjithapatham, Rani; Buijs, Manon; Vossen, Josephina A.; Tchernyshyov, Irina; Cole, Robert N.; Syed, Labiq H.; Rao, Pramod P.; Ota, Shinichi; Vali, Mustafa
2013-01-01
Background The pyruvic acid analog 3-bromopyruvate (3BrPA) is an alkylating agent known to induce cancer cell death by blocking glycolysis. The anti-glycolytic effect of 3BrPA is considered to be the inactivation of glycolytic enzymes. Yet, there is a lack of experimental documentation on the direct interaction of 3BrPA with any of the suggested targets during its anticancer effect. Methods and Results In the current study, using radiolabeled (14C) 3BrPA in multiple cancer cell lines, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was identified as the primary intracellular target of 3BrPA, based on two-dimensional (2D) gel electrophoretic autoradiography, mass spectrometry and immunoprecipitation. Furthermore, in vitro enzyme kinetic studies established that 3BrPA has marked affinity to GAPDH. Finally, Annexin V staining and active caspase-3 immunoblotting demonstrated that apoptosis was induced by 3BrPA. Conclusion GAPDH pyruvylation by 3BrPA affects its enzymatic function and is the primary intracellular target in 3BrPA mediated cancer cell death. PMID:20044597
Avoidance of pseudogene interference in the detection of 3' deletions in PMS2.
Vaughn, Cecily P; Hart, Kimberly J; Samowitz, Wade S; Swensen, Jeffrey J
2011-09-01
Lynch syndrome is characterized by mutations in the mismatch repair genes MLH1, MSH2, MSH6, and PMS2. In PMS2, detection of mutations is confounded by numerous pseudogenes. Detection of 3' deletions is particularly complicated by the pseudogene PMS2CL, which has strong similarity to PMS2 exons 9 and 11-15, due to extensive gene conversion. A newly designed multiplex ligation-dependent probe amplification (MLPA) kit incorporates probes for variants found in both PMS2 and PMS2CL. This provides detection of deletions, but does not allow localization of deletions to the gene or pseudogene. To address this, we have developed a methodology incorporating reference samples with known copy numbers of variants, and paired MLPA results with sequencing of PMS2 and PMS2CL. We tested a subset of clinically indicated samples for which mutations were either unidentified or not fully characterized using existing methods. We identified eight unrelated patients with deletions encompassing exons 9-15, 11-15, 13-15, 14-15, and 15. By incorporating specific, characterized reference samples and sequencing the gene and pseudogene it is possible to identify deletions in this region of PMS2 and provide clinically relevant results. This methodology represents a significant advance in the diagnosis of patients with Lynch syndrome caused by PMS2 mutations. © 2011 Wiley-Liss, Inc.
Marri, Lucia; Zaffagnini, Mirko; Collin, Valérie; Issakidis-Bourguet, Emmanuelle; Lemaire, Stéphane D; Pupillo, Paolo; Sparla, Francesca; Miginiac-Maslow, Myroslawa; Trost, Paolo
2009-03-01
The Calvin cycle enzymes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) can form under oxidizing conditions a supramolecular complex with the regulatory protein CP12. Both GAPDH and PRK activities are inhibited within the complex, but they can be fully restored by reduced thioredoxins (TRXs). We have investigated the interactions of eight different chloroplast thioredoxin isoforms (TRX f1, m1, m2, m3, m4, y1, y2, x) with GAPDH (A(4), B(4), and B(8) isoforms), PRK and CP12 (isoform 2), all from Arabidopsis thaliana. In the complex, both A(4)-GAPDH and PRK were promptly activated by TRX f1, or more slowly by TRXs m1 and m2, but all other TRXs were ineffective. Free PRK was regulated by TRX f1, m1, or m2, while B(4)- and B(8)-GAPDH were absolutely specific for TRX f1. Interestingly, reductive activation of PRK caged in the complex was much faster than reductive activation of free oxidized PRK, and activation of A(4)-GAPDH in the complex was much faster (and less demanding in terms of reducing potential) than activation of free oxidized B(4)- or B(8)-GAPDH. It is proposed that CP12-assembled supramolecular complex may represent a reservoir of inhibited enzymes ready to be released in fully active conformation following reduction and dissociation of the complex by TRXs upon the shift from dark to low light. On the contrary, autonomous redox-modulation of GAPDH (B-containing isoforms) would be more suited to conditions of very active photosynthesis.
Clinical analysis of PMS2: mutation detection and avoidance of pseudogenes.
Vaughn, Cecily P; Robles, Jorge; Swensen, Jeffrey J; Miller, Christine E; Lyon, Elaine; Mao, Rong; Bayrak-Toydemir, Pinar; Samowitz, Wade S
2010-05-01
Germline mutation detection in PMS2, one of four mismatch repair genes associated with Lynch syndrome, is greatly complicated by the presence of numerous pseudogenes. We used a modification of a long-range PCR method to evaluate PMS2 in 145 clinical samples. This modification avoids potential interference from the pseudogene PMS2CL by utilizing a long-range product spanning exons 11-15, with the forward primer anchored in exon 10, an exon not shared by PMS2CL. Large deletions were identified by MLPA. Pathogenic PMS2 mutations were identified in 22 of 59 patients whose tumors showed isolated loss of PMS2 by immunohistochemistry (IHC), the IHC profile most commonly associated with a germline PMS2 mutation. Three additional patients with pathogenic mutations were identified from 53 samples without IHC data. Thirty-seven percent of the identified mutations were large deletions encompassing one or more exons. In 27 patients whose tumors showed absence of either another protein or combination of proteins, no pathogenic mutations were identified. We conclude that modified long-range PCR can be used to preferentially amplify the PMS2 gene and avoid pseudogene interference, thus providing a clinically useful germline analysis of PMS2. Our data also support the use of IHC screening to direct germline testing of PMS2. (c) 2010 Wiley-Liss, Inc.
NASA Astrophysics Data System (ADS)
Carneiro, Agnaldo Silva; Lameira, Jerônimo; Alves, Cláudio Nahum
2011-10-01
The glyceraldehyde-3-phosphate dehydrogenase enzyme (GAPDH) is an important biological target for the development of new chemotherapeutic agents against Chagas disease. In this Letter, the inhibition mechanism of GAPDH involving iodoacetate (IAA) inhibitor was studied using the hybrid quantum mechanical/molecular mechanical (QM/MM) approach and molecular dynamic simulations. Analysis of the potential energy surface and potential of mean force show that the covalent attachment of IAA inhibitor to the active site of the enzyme occurs as a concerted process. In addition, the energy terms decomposition shows that NAD+ plays an important role in stabilization of the reagents and transition state.
2013-01-01
Background Importance of hereditary factors in the etiology of Idiopathic Scoliosis is widely accepted. In clinical practice some of the IS patients present with positive familial history of the deformity and some do not. Traditionally about 90% of patients have been considered as sporadic cases without familial recurrence. However the exact proportion of Familial and Sporadic Idiopathic Scoliosis is still unknown. Housekeeping genes encode proteins that are usually essential for the maintenance of basic cellular functions. ACTB and GAPDH are two housekeeping genes encoding respectively a cytoskeletal protein β-actin, and glyceraldehyde-3-phosphate dehydrogenase, an enzyme of glycolysis. Although their expression levels can fluctuate between different tissues and persons, human housekeeping genes seem to exhibit a preserved tissue-wide expression ranking order. It was hypothesized that expression ranking order of two representative housekeeping genes ACTB and GAPDH might be disturbed in the tissues of patients with Familial Idiopathic Scoliosis (with positive family history of idiopathic scoliosis) opposed to the patients with no family members affected (Sporadic Idiopathic Scoliosis). An artificial neural network (ANN) was developed that could serve to differentiate between familial and sporadic cases of idiopathic scoliosis based on the expression levels of ACTB and GAPDH in different tissues of scoliotic patients. The aim of the study was to investigate whether the expression levels of ACTB and GAPDH in different tissues of idiopathic scoliosis patients could be used as a source of data for specially developed artificial neural network in order to predict the positive family history of index patient. Results The comparison of developed models showed, that the most satisfactory classification accuracy was achieved for ANN model with 18 nodes in the first hidden layer and 16 nodes in the second hidden layer. The classification accuracy for positive Idiopathic
Lin, Guo-Wang; Lu, Ping; Zeng, Tao; Tang, Hui-Ling; Chen, Yong-Hong; Liu, Shu-Jing; Gao, Mei-Mei; Zhao, Qi-Hua; Yi, Yong-Hong; Long, Yue-Sheng
2017-02-01
Abnormal expressions of sodium channel SCN1A and SCN3A genes alter neural excitability that are believed to contribute to the pathogenesis of epilepsy, a long-term risk of recurrent seizures. Ketogenic diet (KD), a high-fat and low-carbohydrate treatment for difficult-to-control (refractory) epilepsy in children, has been suggested to reverse gene expression patterns. Here, we reveal a novel role of GAPDH on the posttranscriptional regulation of mouse Scn1a and Scn3a expressions under seizure and KD conditions. We show that GAPDH binds to a conserved region in the 3' UTRs of human and mouse SCN1A and SCN3A genes, which decreases and increases genes' expressions by affecting mRNA stability through SCN1A 3' UTR and SCN3A 3' UTR, respectively. In seizure mice, the upregulation and phosphorylation of GAPDH enhance its binding to the 3' UTR, which lead to downregulation of Scn1a and upregulation of Scn3a. Furthermore, administration of KD generates β-hydroxybutyric acid which rescues the abnormal expressions of Scn1a and Scn3a by weakening the GAPDH's binding to the element. Taken together, these data suggest that GAPDH-mediated expression regulation of sodium channel genes may be associated with epilepsy and the anticonvulsant action of KD. Copyright © 2016 Elsevier Ltd. All rights reserved.
Crainey, James Lee; Marín, Michel Abanto; Silva, Túllio Romão Ribeiro da; de Medeiros, Jansen Fernandes; Pessoa, Felipe Arley Costa; Santos, Yago Vinícius; Vicente, Ana Carolina Paulo; Luz, Sérgio Luiz Bessa
2018-04-18
Despite the broad distribution of M. ozzardi in Latin America and the Caribbean, there is still very little DNA sequence data available to study this neglected parasite's epidemiology. Mitochondrial DNA (mtDNA) sequences, especially the cytochrome oxidase (CO1) gene's barcoding region, have been targeted successfully for filarial diagnostics and for epidemiological, ecological and evolutionary studies. MtDNA-based studies can, however, be compromised by unrecognised mitochondrial pseudogenes, such as Numts. Here, we have used shot-gun Illumina-HiSeq sequencing to recover the first complete Mansonella genus mitogenome and to identify several mitochondrial-origin pseudogenes. Mitogenome phylogenetic analysis placed M. ozzardi in the Onchocercidae "ONC5" clade and suggested that Mansonella parasites are more closely related to Wuchereria and Brugia genera parasites than they are to Loa genus parasites. DNA sequence alignments, BLAST searches and conceptual translations have been used to compliment phylogenetic analysis showing that M. ozzardi from the Amazon and Caribbean regions are near-identical and that previously reported Peruvian M. ozzardi CO1 reference sequences are probably of pseudogene origin. In addition to adding a much-needed resource to the Mansonella genus's molecular tool-kit and providing evidence that some M. ozzardi CO1 sequence deposits are pseudogenes, our results suggest that all Neotropical M. ozzardi parasites are closely related.
Harpke, Doerte; Peterson, Angela
2008-05-01
The internal transcribed spacer (ITS) region (ITS1, 5.8S rDNA, ITS2) represents the most widely applied nuclear marker in eukaryotic phylogenetics. Although this region has been assumed to evolve in concert, the number of investigations revealing high degrees of intra-individual polymorphism connected with the presence of pseudogenes has risen. The 5.8S rDNA is the most important diagnostic marker for functionality of the ITS region. In Mammillaria, intra-individual 5.8S rDNA polymorphisms of up to 36% and up to nine different types have been found. Twenty-eight of 30 cloned genomic Mammillaria sequences were identified as putative pseudogenes. For the identification of pseudogenic ITS regions, in addition to formal tests based on substitution rates, we attempted to focus on functional features of the 5.8S rDNA (5.8S motif, secondary structure). The importance of functional data for the identification of pseudogenes is outlined and discussed. The identification of pseudogenes is essential, because they may cause erroneous phylogenies and taxonomic problems.
De Martino, Marco; Azzariti, Amalia; Arra, Claudio; Fusco, Alfredo; Esposito, Francesco
2017-01-01
Several studies have established that pseudogene mRNAs can work as competing endogenous RNAs and, when deregulated, play a key role in the onset of human neoplasias. Recently, we have isolated two HMGA1 pseudogenes, HMGA1P6 and HMGA1P7. These pseudogenes have a critical role in cancer progression, acting as micro RNA (miRNA) sponges for HMGA1 and other cancer-related genes. HMGA1 pseudogenes were found overexpressed in several human carcinomas, and their expression levels positively correlate with an advanced cancer stage and a poor prognosis. In order to investigate the molecular alterations following HMGA1 pseudogene 7 overexpression, we carried out miRNA sequencing analysis on HMGA1P7 overexpressing mouse embryonic fibroblasts. Intriguingly, the most upregulated miRNAs were miR-483 and miR-675 that have been described as key regulators in cancer progression. Here, we report that HMGA1P7 upregulates miR-483 and miR-675 through a competing endogenous RNA mechanism with Egr1, a transcriptional factor that positively regulates miR-483 and miR-675 expression. PMID:29149041
Differential expression of Oct4 variants and pseudogenes in normal urothelium and urothelial cancer.
Wezel, Felix; Pearson, Joanna; Kirkwood, Lisa A; Southgate, Jennifer
2013-10-01
The transcription factor octamer-binding protein 4 (Oct4; encoded by POU5F1) has a key role in maintaining embryonic stem cell pluripotency during early embryonic development and it is required for generation of induced pluripotent stem cells. Controversy exists concerning Oct4 expression in somatic tissues, with reports that Oct4 is expressed in normal and in neoplastic urothelium carrying implications for a bladder cancer stem cell phenotype. Here, we show that the pluripotency-associated Oct4A transcript was absent from cultures of highly regenerative normal human urothelial cells and from low-grade to high-grade urothelial carcinoma cell lines, whereas alternatively spliced variants and transcribed pseudogenes were expressed in abundance. Immunolabeling and immunoblotting studies confirmed the absence of Oct4A in normal and neoplastic urothelial cells and tissues, but indicated the presence of alternative isoforms or potentially translated pseudogenes. The stable forced expression of Oct4A in normal human urothelial cells in vitro profoundly inhibited growth and affected morphology, but protein expression was rapidly down-regulated. Our findings demonstrate that pluripotency-associated isoform Oct4A is not expressed by normal or malignant human urothelium and therefore is unlikely to play a role in a cancer stem cell phenotype. However, our findings also indicate that urothelium expresses a variety of other Oct4 splice-variant isoforms and transcribed pseudogenes that warrant further study. Copyright © 2013 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Zhang, Hua; Zhao, Yu; Zhou, Dao-Xiu
2017-12-01
Sirtuins, a family of proteins with homology to the yeast silent information regulator 2 (Sir2), are NAD+-dependent histone deacetylases and play crucial roles in energy sensing and regulation in yeast and animal cells. Plants are autotrophic organisms and display distinct features of carbon and energy metabolism. It remains largely unexplored whether and how plant cells sense energy/redox status to control carbon metabolic flux under various growth conditions. In this work, we show that the rice nuclear sirtuin OsSRT1 not only functions as an epigenetic regulator to repress glycolytic genes expression and glycolysis in seedlings, but also inhibits transcriptional activity of glyceraldehyde-3-phosphatedehydrogenase (GAPDH) that is enriched on glycolytic genes promoters and stimulates their expression. We show that OsSRT1 reduces GAPDH lysine acetylation and nuclear accumulation that are enhanced by oxidative stress. Mass spectrometry identified six acetylated lysines regulated by OsSRT1. OsSRT1-dependent lysine deacetylation of OsGAPDH1 represses transcriptional activity of the protein. The results indicate that OsSRT1 represses glycolysis by both regulating epigenetic modification of histone and inhibiting the moonlighting function of GAPDH as a transcriptional activator of glycolytic genes in rice. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Kawada, Manabu; Inoue, Hiroyuki; Ohba, Shun-ichi; Yoshida, Junjiro; Masuda, Tohru; Yamasaki, Manabu; Usami, Ihomi; Sakamoto, Shuichi; Abe, Hikaru; Watanabe, Takumi; Yamori, Takao; Shibasaki, Masakatsu; Nomoto, Akio
2015-01-01
Fibroblast-like stromal cells modulate cancer cells through secreted factors and adhesion, but those factors are not fully understood. Here, we have identified critical stromal factors that modulate cancer growth positively and negatively. Using a cell co-culture system, we found that gastric stromal cells secreted IL-6 as a growth and survival factor for gastric cancer cells. Moreover, gastric cancer cells secreted PGE2 and TNFα that stimulated IL-6 secretion by the stromal cells. Furthermore, we found that stromal cells secreted glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Extracellular GAPDH, or its N-terminal domain, inhibited gastric cancer cell growth, a finding confirmed in other cell systems. GAPDH bound to E-cadherin and downregulated the mTOR-p70S6 kinase pathway. These results demonstrate that stromal cells could regulate cancer cell growth through the balance of these secreted factors. We propose that negative regulation of cancer growth using GAPDH could be a new anti-cancer strategy. PMID:25785838
Seo, Jung-Kil; Lee, Min Jeong; Go, Hye-Jin; Kim, Yeon Jun; Park, Nam Gyu
2014-02-01
A 3.4 kDa of antimicrobial peptide was purified from an acidified skin extract of skipjack tuna, Katsuwonus pelamis, by preparative acid-urea-polyacrylamide gel electrophoresis and C18 reversed-phase HPLC. A comparison of the N-terminal amino acid sequence of the purified peptide with that of other known polypeptides revealed high sequence homology with the YFGAP (Yellowfin tuna Glyceraldehyde-3-phosphate dehydrogenase-related Antimicrobial Peptide); thus, this peptide was identified as the skipjack tuna GAPDH-related antimicrobial peptide (SJGAP). SJGAP showed potent antimicrobial activity against Gram-positive bacteria, such as Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, and Streptococcus iniae (minimal effective concentrations [MECs], 1.2-17.0 μg/mL), Gram-negative bacteria, such as Aeromonas hydrophila, Escherichia coli D31, and Vibrio parahaemolyticus (MECs, 3.1-12.0 μg/mL), and against Candida albicans (MEC, 16.0 μg/mL) without significant hemolytic activity. Antimicrobial activity of this peptide is heat-stable but salt-sensitive. According to the secondary structural prediction and the homology modeling, this peptide consists of three secondary structural motifs, including one α-helix and two parallel β-strands, and forms an amphipathic structure. This peptide showed neither membrane permeabilization ability nor killing ability, but did display a small degree of leakage ability. These results suggest that SJGAP acts through a bacteriostatic process rather than bactericidal one. SJGAP is another GAPDH-related antimicrobial peptide isolated from skipjack tuna and likely plays an important role for GAPDH in the innate immune defense of tuna fish. Copyright © 2014 Elsevier Ltd. All rights reserved.
Pseudogenization of the tooth gene enamelysin (MMP20) in the common ancestor of extant baleen whales
Meredith, Robert W.; Gatesy, John; Cheng, Joyce; Springer, Mark S.
2011-01-01
Whales in the suborder Mysticeti are filter feeders that use baleen to sift zooplankton and small fish from ocean waters. Adult mysticetes lack teeth, although tooth buds are present in foetal stages. Cladistic analyses suggest that functional teeth were lost in the common ancestor of crown-group Mysticeti. DNA sequences for the tooth-specific genes, ameloblastin (AMBN), enamelin (ENAM) and amelogenin (AMEL), have frameshift mutations and/or stop codons in this taxon, but none of these molecular cavities are shared by all extant mysticetes. Here, we provide the first evidence for pseudogenization of a tooth gene, enamelysin (MMP20), in the common ancestor of living baleen whales. Specifically, pseudogenization resulted from the insertion of a CHR-2 SINE retroposon in exon 2 of MMP20. Genomic and palaeontological data now provide congruent support for the loss of enamel-capped teeth on the common ancestral branch of crown-group mysticetes. The new data for MMP20 also document a polymorphic stop codon in exon 2 of the pygmy sperm whale (Kogia breviceps), which has enamel-less teeth. These results, in conjunction with the evidence for pseudogenization of MMP20 in Hoffmann's two-toed sloth (Choloepus hoffmanni), another enamel-less species, support the hypothesis that the only unique, non-overlapping function of the MMP20 gene is in enamel formation. PMID:20861053
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ginns, E.I.; Winfield, S.; Sidransky, E.
1994-09-01
The human GC locus on chromosome 1q21 encompasses a 7 kb functional gene encoding the enzyme deficient in Gaucher disease, and a highly homologous sequence 16 Kb downstream that has the properties of a pseudogene. A novel gene, gene X, spanning the 6 kb region between the pseudogene and TSP3 has been identified and characterized in the mouse, and appears to be critical for normal embryonic development. As in the mouse, the human gene X is located 5{prime} to the TSP3 gene and two genes are transcribed divergently from a bidirectional promoter; the direction of transcription of gene X andmore » GC is convergent. However, in the human, gene X and GC are separated by gene X and GC pseudogenes that are the consequence of a gene duplication. The gene X pseudogene lacks the first exon and part of the second exon of the functional gene and may not be transcribed. Northern blot analyses indicate that gene X is transcribed in both normal individuals and in patients with Gaucher disease, but the function of this gene is still unknown. The possibility that mutations in gene X could account for some of the diversity of symptoms encountered in individuals with the more atypical presentations of Gaucher disease is under investigation.« less
Bargues, M Dolores; Zuriaga, M Angeles; Mas-Coma, Santiago
2014-01-01
A pseudogene, paralogous to rDNA 5.8S and ITS-2, is described in Meccus dimidiata dimidiata, M. d. capitata, M. d. maculippenis, M. d. hegneri, M. sp. aff. dimidiata, M. p. phyllosoma, M. p. longipennis, M. p. pallidipennis, M. p. picturata, M. p. mazzottii, Triatoma mexicana, Triatoma nitida and Triatoma sanguisuga, covering North America, Central America and northern South America. Such a nuclear rDNA pseudogene is very rare. In the 5.8S gene, criteria for pseudogene identification included length variability, lower GC content, mutations regarding the functional uniform sequence, and relatively high base substitutions in evolutionary conserved sites. At ITS-2 level, criteria were the shorter sequence and large proportion of insertions and deletions (indels). Pseudogenic 5.8S and ITS-2 secondary structures were different from the functional foldings, different one another, showing less negative values for minimum free energy (mfe) and centroid predictions, and lower fit between mfe, partition function, and centroid structures. A complete characterization indicated a processed pseudogenic unit of the ghost type, escaping from rDNA concerted evolution and with functionality subject to constraints instead of evolving free by neutral drift. Despite a high indel number, low mutation number and an evolutionary rate similar to the functional ITS-2, that pseudogene distinguishes different taxa and furnishes coherent phylogenetic topologies with resolution similar to the functional ITS-2. The discovery of a pseudogene in many phylogenetically related species is unique in animals and allowed for an estimation of its palaeobiogeographical origin based on molecular clock data, inheritance pathways, evolutionary rate and pattern, and geographical spread. Additional to the technical risk to be considered henceforth, this relict pseudogene, designated as "ps(5.8S+ITS-2)", proves to be a valuable marker for specimen classification, phylogenetic analyses, and systematic
Fu, Shulin; Zhang, Minmin; Ou, Jiwen; Liu, Huazhen; Tan, Chen; Liu, Jinlin; Chen, Huanchun; Bei, Weicheng
2012-11-06
Haemophilus parasuis, the causative agent of swine polyserositis, polyarthritis, and meningitis, is one of the most important bacterial diseases of pigs worldwide. The development of a vaccine against H. parasuis has been impeded due to the lack of induction of reliable cross-serotype protection. In this study the gapA gene that encodes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was shown to be present and highly conserved in various serotypes of H. parasuis and we constructed a novel DNA vaccine encoding GAPDH (pCgap) to evaluate the immune response and protective efficacy against infection with H. parasuis MD0322 serovar 4 or SH0165 serovar 5 in mice. A significant antibody response against GAPDH was generated following pCgap intramuscular immunization; moreover, antibodies to the pCgap DNA vaccine were bactericidal, suggesting that it was expressed in vivo. The gapA transcript was detected in muscle, liver, spleen, and kidney of the mice seven days post-vaccination. The IgG subclass (IgG1 and IgG2a) analysis indicated that the DNA vaccine induced both Th1 and Th2 immune responses, but the IgG1 response was greater than the IgG2a response. Moreover, the groups vaccinated with the pCgap vaccine exhibited 83.3% and 50% protective efficacy against the H. parasuis MD0322 serovar 4 or SH0165 serovar 5 challenges, respectively. The pCgap DNA vaccine provided significantly greater protective efficacy compared to the negative control groups or blank control groups (P<0.05 for both). Taken together, these findings indicate that the pCgap DNA vaccine provides a novel strategy against infection of H. parasuis and offer insight concerning the underlying immune mechanisms of a bacterial DNA vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.
Collery, Mark M; Smyth, Cyril J
2007-02-01
The egc locus of Staphylococus aureus harbours two enterotoxin genes (seg and sei) and three enterotoxin-like genes (selm, seln and selo). Between the sei and seln genes are located two pseudogenes, psient1 and psient2, or the selu or seluv gene. While these two alternative sei-seln intergenic regions can be distinguished by PCR, to date, DNA sequencing has been the only confirmatory option because of the very high degree of sequence similarity between egc loci bearing the pseudogenes and the selu or seluv gene. In silico restriction enzyme digestion of genomic regions encompassing the egc locus from the 3' end of the sei gene through the 5' first quarter of the seln gene allowed pseudogene- and selu- or seluv-bearing egc loci to be distinguished by PCR-RFLP. Experimental application of these findings demonstrated that endonuclease HindIII cleaved PCR amplimers bearing pseudogenes but not those with a selu or seluv gene, while selu- or seluv-bearing amplimers were susceptible to cleavage by endonuclease HphI, but not by endonuclease HindIII. The restriction enzyme BccI cleaved selu- or seluv-harbouring amplimers at a unique restriction site created by their signature 15 bp insertion compared with pseudogene-bearing amplimers, thereby allowing distinction of these egc loci. PCR-RFLP analysis using these restriction enzymes provides a rapid, easy to interpret alternative to DNA sequencing for verification of PCR findings on the nature of an egc locus type, and can also be used for the primary identification of the intergenic sei-seln egc locus type.
Nazari, Fatemeh; Parham, Abbas; Maleki, Adham Fani
2015-01-01
Quantitative real time reverse transcription PCR (qRT-PCR) is one of the most important techniques for gene-expression analysis in molecular based studies. Selecting a proper internal control gene for normalizing data is a crucial step in gene expression analysis via this method. The expression levels of reference genes should be remained constant among cells in different tissues. However, it seems that the location of cells in different tissues might influence their expression. The purpose of this study was to determine whether the source of mesenchymal stem cells (MSCs) has any effect on expression level of three common reference genes (GAPDH, β-actin and β2-microglobulin) in equine marrow- and adipose- derived undifferentiated MSCs and consequently their reliability for comparative qRT-PCR. Adipose tissue (AT) and bone marrow (BM) samples were harvested from 3 mares. MSCs were isolated and cultured until passage 3 (P3). Total RNA of P3 cells was extracted for cDNA synthesis. The generated cDNAs were analyzed by quantitative real-time PCR. The PCR reactions were ended with a melting curve analysis to verify the specificity of amplicon. The expression levels of GAPDH were significantly different between AT- and BM- derived MSCs (p < 0.05). Differences in expression level of β-actin (P < 0.001) and B2M (P < 0.006.) between MSCs derived from AT and BM were substantially higher than GAPDH. In addition, the fold change in expression levels of GAPDH, β-actin and B2M in AT-derived MSCs compared to BM-derived MSCs were 2.38, 6.76 and 7.76, respectively. This study demonstrated that GAPDH and especially β-actin and B2M express in different levels in equine AT- and BM- derived MSCs. Thus they cannot be considered as reliable reference genes for comparative quantitative gene expression analysis in MSCs derived from equine bone marrow and adipose tissue.
HnRNP A3 genes and pseudogenes in the vertebrate genomes.
Makeyev, Aleksandr V; Kim, Chang Bae; Ruddle, Frank H; Enkhmandakh, Badam; Erdenechimeg, Lkhamsuren; Bayarsaihan, Dashzeveg
2005-04-01
The hnRNP A/B type proteins are abundant nuclear factors that bind to Pol II transcripts and are involved in numerous RNA-related activities. To date most data on the hnRNP A/B family have been obtained with recombinant proteins and cell cultures. Further characterization can result from an examination of the impact of various modifications in intact functional loci; however, such characterization is hampered by the presence of numerous and widely dispersed hnRNP A/B-related sequences in the mammalian genome. We have found hnRNP A3, a poorly recognized member of the hnRNP A/B family, among candidate transcription factors that interact with the regulatory region of the Hoxc8 gene and screened the human and mouse genomes for genes that encode hnRNP A3. We demonstrate that the sequence reported previously as the human hnRNP A3 gene (Accession number S63912) and located on 10p11.1 belongs to a processed pseudogene of the functional intron-containing locus HNRPA3, which we have identified on 2q31.2. We have also identified its murine orthologs on mouse chromosome 2D and rat chromosome 3q23. Alternative splices were revealed at the N-terminus and in the middle of hnRNP A3. 14 and 28 additional loci in the human and mouse genome, respectively, were mapped and identified as hnRNP A3 processed pseudogenes. In addition, we have found and compared hnRNP A3 orthologous genes in Gallus gallus, Xenopus tropicalis, and Danio rerio. The present in silico analysis serves as a necessary step toward a further functional characterization of hnRNP A3. (c) 2005 Wiley-Liss, Inc.
Ruggiero, Maria Valeria; Procaccini, Gabriele
2004-01-01
Halophila stipulacea is a dioecious marine angiosperm, widely distributed along the western coasts of the Indian Ocean and the Red Sea. This species is thought to be a Lessepsian immigrant that entered the Mediterranean Sea from the Red Sea after the opening of the Suez Canal (1869). Previous studies have revealed both high phenotypic and genetic variability in Halophila stipulacea populations from the western Mediterranean basin. In order to test the hypothesis of a Lessepsian introduction, we compare genetic polymorphism between putative native (Red Sea) and introduced (Mediterranean) populations through rDNA ITS region (ITS1-5.8S-ITS2) sequence analysis. A high degree of intraindividual variability of ITS sequences was found. Most of the intragenomic polymorphism was due to pseudogenic sequences, present in almost all individuals. Features of ITS functional sequences and pseudogenes are described. Possible causes for the lack of homogenization of ITS paralogues within individuals are discussed.
Branco, Patrícia; Albergaria, Helena; Arneborg, Nils; Prista, Catarina
2018-05-01
Saccharomyces cerevisiae secretes antimicrobial peptides (AMPs) derived from glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which induce the death of several non-Saccharomyces yeasts. Previously, we demonstrated that the naturally secreted GAPDH-derived AMPs (i.e. saccharomycin) caused a loss of culturability and decreased the intracellular pH (pHi) of Hanseniaspora guilliermondii cells. In this study, we show that chemically synthesised analogues of saccharomycin also induce a pHi drop and loss of culturability in H. guilliermondii, although to a lesser extent than saccharomycin. To assess the underlying causes of the pHi drop, we evaluated the membrane permeability to H+ cations of H. guilliermondii cells, after being exposed to saccharomycin or its synthetic analogues. Results showed that the H+-efflux decreased by 75.6% and the H+-influx increased by 66.5% in cells exposed to saccharomycin at pH 3.5. Since H+-efflux via H+-ATPase is energy dependent, reduced glucose consumption would decrease ATP production and consequently H+-ATPase activity. However, glucose uptake rates were not affected, suggesting that the AMPs rather than affecting glucose transporters may affect directly the plasma membrane H+-ATPase or increase ATP leakage due to cell membrane disturbance. Thus, our study revealed that both saccharomycin and its synthetic analogues induced cell death of H. guilliermondii by increasing the proton influx and inhibiting the proton efflux.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shipley, J.M.; Klinkenberg, M.; Wu, B.M.
1993-03-01
PCR of cDNA produced from patient fibroblasts allowed the authors to determine the paternal mutation in the first patient reported with [beta]-glucuronidase-deficiency mucopolysaccharidosis type VII (MPS VII). The G[r arrow]T transversion 1,881 bp downstream of the ATG translation initiation codon destroys an MboII restriction site and converts Trp627 to Cys (W627C). Digestion of genomic DNA PCR fragments with MboII indicated that the patient and the father were heterozygous for this missense mutation in exon 12. Failure to find cDNAs from patient RNA which did not contain this mutation suggested that the maternal mutation leads to greatly reduced synthesis or reducedmore » stability of mRNA from the mutant allele. In order to identify the maternal mutation, it was necessary to analyze genomic sequences. This approach was complicated by the finding of multiple unprocessed pseudogenes and/or closely related genes. Using PCR with a panel of human/rodent hybrid cell lines, the authors found that these pseudogenes were present over chromosomes 5-7, 20, and 22 and the Y chromosome. Conditions were defined which allowed them to amplify and characterize genomic sequences for the true [beta]-glucuronidase gene despite this background of related sequences. The patient proved to be heterozygous for a second mutation, in which a C[r arrow]T transition introduces a termination codon (R356STOP) in exon 7. The mother was also heterozygous for this mutation. Expression of a cDNA containing the maternal mutation produced no enzyme activity, as expected. Expression of the paternal mutation in COS-7 cells produced a surprisingly high (65% of control) level of activity. However, activity was 13% of control in transiently transfected murine MPS VII cells. The level of activity of this mutant allele appears to correlate with the level of overexpression. 39 refs., 5 figs., 1 tab.« less
Ikram, Sobia; Durandet, Monique; Vesa, Simona; Pereira, Serge; Guerche, Philippe; Bonhomme, Sandrine
2014-06-01
F-box protein genes family is one of the largest gene families in plants, with almost 700 predicted genes in the model plant Arabidopsis. F-box proteins are key components of the ubiquitin proteasome system that allows targeted protein degradation. Transcriptome analyses indicate that half of these F-box protein genes are found expressed in microspore and/or pollen, i.e., during male gametogenesis. To assess the role of F-box protein genes during this crucial developmental step, we selected 34 F-box protein genes recorded as highly and specifically expressed in pollen and isolated corresponding insertion mutants. We checked the expression level of each selected gene by RT-PCR and confirmed pollen expression for 25 genes, but specific expression for only 10 of the 34 F-box protein genes. In addition, we tested the expression level of selected F-box protein genes in 24 mutant lines and showed that 11 of them were null mutants. Transmission analysis of the mutations to the progeny showed that none of the single mutations was gametophytic lethal. These unaffected transmission efficiencies suggested leaky mutations or functional redundancy among F-box protein genes. Cytological observation of the gametophytes in the mutants confirmed these results. Combinations of mutations in F-box protein genes from the same subfamily did not lead to transmission defect either, further highlighting functional redundancy and/or a high proportion of pseudogenes among these F-box protein genes.
Chan, Wen-Ling; Yang, Wen-Kuang; Huang, Hsien-Da; Chang, Jan-Gowth
2013-01-01
RNA interference (RNAi) is a gene silencing process within living cells, which is controlled by the RNA-induced silencing complex with a sequence-specific manner. In flies and mice, the pseudogene transcripts can be processed into short interfering RNAs (siRNAs) that regulate protein-coding genes through the RNAi pathway. Following these findings, we construct an innovative and comprehensive database to elucidate siRNA-mediated mechanism in human transcribed pseudogenes (TPGs). To investigate TPG producing siRNAs that regulate protein-coding genes, we mapped the TPGs to small RNAs (sRNAs) that were supported by publicly deep sequencing data from various sRNA libraries and constructed the TPG-derived siRNA-target interactions. In addition, we also presented that TPGs can act as a target for miRNAs that actually regulate the parental gene. To enable the systematic compilation and updating of these results and additional information, we have developed a database, pseudoMap, capturing various types of information, including sequence data, TPG and cognate annotation, deep sequencing data, RNA-folding structure, gene expression profiles, miRNA annotation and target prediction. As our knowledge, pseudoMap is the first database to demonstrate two mechanisms of human TPGs: encoding siRNAs and decoying miRNAs that target the parental gene. pseudoMap is freely accessible at http://pseudomap.mbc.nctu.edu.tw/. Database URL: http://pseudomap.mbc.nctu.edu.tw/
Tay, Wee Tek; Elfekih, Samia; Court, Leon N; Gordon, Karl H J; Delatte, Hélène; De Barro, Paul J
2017-10-01
Molecular species identification using suboptimal PCR primers can over-estimate species diversity due to coamplification of nuclear mitochondrial (NUMT) DNA/pseudogenes. For the agriculturally important whitefly Bemisia tabaci cryptic pest species complex, species identification depends primarily on characterization of the mitochondrial DNA cytochrome oxidase I (mtDNA COI) gene. The lack of robust PCR primers for the mtDNA COI gene can undermine correct species identification which in turn compromises management strategies. This problem is identified in the B. tabaci Africa/Middle East/Asia Minor clade which comprises the globally invasive Mediterranean (MED) and Middle East Asia Minor I (MEAM1) species, Middle East Asia Minor 2 (MEAM2), and the Indian Ocean (IO) species. Initially identified from the Indian Ocean island of Réunion, MEAM2 has since been reported from Japan, Peru, Turkey and Iraq. We identified MEAM2 individuals from a Peruvian population via Sanger sequencing of the mtDNA COI gene. In attempting to characterize the MEAM2 mitogenome, we instead characterized mitogenomes of MEAM1. We also report on the mitogenomes of MED, AUS, and IO thereby increasing genomic resources for members of this complex. Gene synteny (i.e., same gene composition and orientation) was observed with published B. tabaci cryptic species mitogenomes. Pseudogene fragments matching MEAM2 partial mtDNA COI gene exhibited low frequency single nucleotide polymorphisms that matched low copy number DNA fragments (<3%) of MEAM1 genomes, whereas presence of internal stop codons, loss of expected stop codons and poor primer annealing sites, all suggested MEAM2 as a pseudogene artifact and so not a real species. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Groth-Malonek, Milena; Wahrmund, Ute; Polsakiewicz, Monika; Knoop, Volker
2007-04-01
Gene transfer from the mitochondrion into the nucleus is a corollary of the endosymbiont hypothesis. The frequent and independent transfer of genes for mitochondrial ribosomal proteins is well documented with many examples in angiosperms, whereas transfer of genes for components of the respiratory chain is a rarity. A notable exception is the nad7 gene, encoding subunit 7 of complex I, in the liverwort Marchantia polymorpha, which resides as a full-length, intron-carrying and transcribed, but nonspliced pseudogene in the chondriome, whereas its functional counterpart is nuclear encoded. To elucidate the patterns of pseudogene degeneration, we have investigated the mitochondrial nad7 locus in 12 other liverworts of broad phylogenetic distribution. We find that the mitochondrial nad7 gene is nonfunctional in 11 of them. However, the modes of pseudogene degeneration vary: whereas point mutations, accompanied by single-nucleotide indels, predominantly introduce stop codons into the reading frame in marchantiid liverworts, larger indels introduce frameshifts in the simple thalloid and leafy jungermanniid taxa. Most notably, however, the mitochondrial nad7 reading frame appears to be intact in the isolated liverwort genus Haplomitrium. Its functional expression is shown by cDNA analysis identifying typical RNA-editing events to reconstitute conserved codon identities and also confirming functional splicing of the 2 liverwort-specific group II introns. We interpret our results 1) to indicate the presence of a functional mitochondrial nad7 gene in the earliest land plants and strongly supporting a basal placement of Haplomitrium among the liverworts, 2) to indicate different modes of pseudogene degeneration and chondriome evolution in the later branching liverwort clades, 3) to suggest a surprisingly long maintenance of a nonfunctional gene in the presumed oldest group of land plants, and 4) to support the model of a secondary loss of RNA-editing activity in marchantiid
Biomimicry enhances sequential reactions of tethered glycolytic enzymes, TPI and GAPDHS.
Mukai, Chinatsu; Gao, Lizeng; Bergkvist, Magnus; Nelson, Jacquelyn L; Hinchman, Meleana M; Travis, Alexander J
2013-01-01
Maintaining activity of enzymes tethered to solid interfaces remains a major challenge in developing hybrid organic-inorganic devices. In nature, mammalian spermatozoa have overcome this design challenge by having glycolytic enzymes with specialized targeting domains that enable them to function while tethered to a cytoskeletal element. As a step toward designing a hybrid organic-inorganic ATP-generating system, we implemented a biomimetic site-specific immobilization strategy to tether two glycolytic enzymes representing different functional enzyme families: triose phosphoisomerase (TPI; an isomerase) and glyceraldehyde 3-phosphate dehydrogenase (GAPDHS; an oxidoreductase). We then evaluated the activities of these enzymes in comparison to when they were tethered via classical carboxyl-amine crosslinking. Both enzymes show similar surface binding regardless of immobilization method. Remarkably, specific activities for both enzymes were significantly higher when tethered using the biomimetic, site-specific immobilization approach. Using this biomimetic approach, we tethered both enzymes to a single surface and demonstrated their function in series in both forward and reverse directions. Again, the activities in series were significantly higher in both directions when the enzymes were coupled using this biomimetic approach versus carboxyl-amine binding. Our results suggest that biomimetic, site-specific immobilization can provide important functional advantages over chemically specific, but non-oriented attachment, an important strategic insight given the growing interest in recapitulating entire biological pathways on hybrid organic-inorganic devices.
Biomimicry Enhances Sequential Reactions of Tethered Glycolytic Enzymes, TPI and GAPDHS
Mukai, Chinatsu; Gao, Lizeng; Bergkvist, Magnus; Nelson, Jacquelyn L.; Hinchman, Meleana M.; Travis, Alexander J.
2013-01-01
Maintaining activity of enzymes tethered to solid interfaces remains a major challenge in developing hybrid organic-inorganic devices. In nature, mammalian spermatozoa have overcome this design challenge by having glycolytic enzymes with specialized targeting domains that enable them to function while tethered to a cytoskeletal element. As a step toward designing a hybrid organic-inorganic ATP-generating system, we implemented a biomimetic site-specific immobilization strategy to tether two glycolytic enzymes representing different functional enzyme families: triose phosphoisomerase (TPI; an isomerase) and glyceraldehyde 3-phosphate dehydrogenase (GAPDHS; an oxidoreductase). We then evaluated the activities of these enzymes in comparison to when they were tethered via classical carboxyl-amine crosslinking. Both enzymes show similar surface binding regardless of immobilization method. Remarkably, specific activities for both enzymes were significantly higher when tethered using the biomimetic, site-specific immobilization approach. Using this biomimetic approach, we tethered both enzymes to a single surface and demonstrated their function in series in both forward and reverse directions. Again, the activities in series were significantly higher in both directions when the enzymes were coupled using this biomimetic approach versus carboxyl-amine binding. Our results suggest that biomimetic, site-specific immobilization can provide important functional advantages over chemically specific, but non-oriented attachment, an important strategic insight given the growing interest in recapitulating entire biological pathways on hybrid organic-inorganic devices. PMID:23626684
Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.
Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene
2017-02-01
Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Etzler, J; Peyrl, A; Zatkova, A; Schildhaus, H-U; Ficek, A; Merkelbach-Bruse, S; Kratz, C P; Attarbaschi, A; Hainfellner, J A; Yao, S; Messiaen, L; Slavc, I; Wimmer, K
2008-02-01
Heterozygous germline mutations in one of the mismatch repair (MMR) genes MLH1, MSH2, MSH6, and PMS2 cause hereditary nonpolyposis colorectal cancer (HNPCC) or Lynch syndrome, a dominantly inherited cancer susceptibility syndrome. Recent reports provide evidence for a novel recessively inherited cancer syndrome with constitutive MMR deficiency due to biallelic germline mutations in one of the MMR genes. MMR-deficiency (MMR-D) syndrome is characterized by childhood brain tumors, hematological and/or gastrointestinal malignancies, and signs of neurofibromatosis type 1 (NF1). We established an RNA-based mutation detection assay for the four MMR genes, since 1) a number of splicing defects may escape detection by the analysis of genomic DNA, and 2) DNA-based mutation detection in the PMS2 gene is severely hampered by the presence of multiple highly similar pseudogenes, including PMS2CL. Using this assay, which is based on direct cDNA sequencing of RT-PCR products, we investigated two families with children suspected to suffer from MMR-D syndrome. We identified a homozygous complex MSH6 splicing alteration in the index patients of the first family and a novel homozygous PMS2 mutation (c.182delA) in the index patient of the second family. Furthermore, we demonstrate, by the analysis of a PMS2/PMS2CL "hybrid" allele carrier, that RNA-based PMS2 testing effectively avoids the caveats of genomic DNA amplification approaches; i.e., pseudogene coamplification as well as allelic dropout, and will, thus, allow more sensitive mutation analysis in MMR deficiency and in HNPCC patients with PMS2 defects. (c) 2007 Wiley-Liss, Inc.
Deeb, Kristin K; Metcalf, James D; Sesock, Kaitlin M; Shen, Junqing; Wensel, Christine A; Rippel, Larisa I; Smith, Michelle; Chapman, Mark S; Zhang, Shulin
2015-07-01
Cystic fibrosis (CF) is one of the most common recessive conditions among whites, with an estimated carrier frequency of 1 in 25 in the United States. Population-based CF carrier screening was implemented in the United States in 2001. The number of mutations screened by each laboratory may vary; however, the 23 most common CF mutations recommended for screening by the American College of Medical Genetics and American College of Obstetricians and Gynecologists are included in all platforms. The c.1364C>A (p.A455E) mutation located in exon 10 of the CFTR gene is one of the 23 mutations. Because CFTR exon 10 and its flanking intronic regions are duplicated and transposed onto several other chromosomes of the human genome during evolution and function as unprocessed pseudogenes, variations in the CFTR pseudogenes may confound CF screening results for mutations located in exon 10 of the CFTR gene. We report an incorrectly identified carrier status for the c.1364C>A (p.A455E) mutation in a healthy individual using the Hologic InPlex CF assay. Further analysis revealed that the mutation resides in one of the CFTR pseudogenes. Because most commercial kits and laboratory-developed tests for CF carrier screening involve a short amplicon encompassing this mutation, this finding suggests that individuals with the c.1364C>A (p.A455E) mutation may require further investigation to avoid a false assignment of CF carrier status. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
A pseudogene long noncoding RNA network regulates PTEN transcription and translation in human cells
Johnsson, Per; Ackley, Amanda; Vidarsdottir, Linda; Lui, Weng-Onn; Corcoran, Martin; Grandér, Dan; Morris, Kevin V.
2013-01-01
PTEN is a tumor suppressor gene that has been shown to be under the regulatory control of a PTEN pseudogene expressed noncoding RNA, PTENpg1. Here, we characterize a previously unidentified PTENpg1 encoded antisense RNA (asRNA), which regulates PTEN transcription and PTEN mRNA stability. We find two PTENpg1 asRNA isoforms, alpha and beta. The alpha isoform functions in trans, localizes to the PTEN promoter, and epigenetically modulates PTEN transcription by the recruitment of DNMT3a and EZH2. In contrast, the beta isoform interacts with PTENpg1 through an RNA:RNA pairing interaction, which affects PTEN protein output via changes of PTENpg1 stability and microRNA sponge activity. Disruption of this asRNA-regulated network induces cell cycle arrest and sensitizes cells to doxorubicin, suggesting a biological function for the respective PTENpg1 expressed asRNAs. PMID:23435381
A pseudogene long-noncoding-RNA network regulates PTEN transcription and translation in human cells.
Johnsson, Per; Ackley, Amanda; Vidarsdottir, Linda; Lui, Weng-Onn; Corcoran, Martin; Grandér, Dan; Morris, Kevin V
2013-04-01
PTEN is a tumor-suppressor gene that has been shown to be under the regulatory control of a PTEN pseudogene expressed noncoding RNA, PTENpg1. Here, we characterize a previously unidentified PTENpg1-encoded antisense RNA (asRNA), which regulates PTEN transcription and PTEN mRNA stability. We find two PTENpg1 asRNA isoforms, α and β. The α isoform functions in trans, localizes to the PTEN promoter and epigenetically modulates PTEN transcription by the recruitment of DNA methyltransferase 3a and Enhancer of Zeste. In contrast, the β isoform interacts with PTENpg1 through an RNA-RNA pairing interaction, which affects PTEN protein output through changes of PTENpg1 stability and microRNA sponge activity. Disruption of this asRNA-regulated network induces cell-cycle arrest and sensitizes cells to doxorubicin, which suggests a biological function for the respective PTENpg1 expressed asRNAs.
Yang, W; Du, W W; Li, X; Yee, A J; Yang, B B
2016-07-28
It has recently been shown that the upregulation of a pseudogene specific to a protein-coding gene could function as a sponge to bind multiple potential targeting microRNAs (miRNAs), resulting in increased gene expression. Similarly, it was recently demonstrated that circular RNAs can function as sponges for miRNAs, and could upregulate expression of mRNAs containing an identical sequence. Furthermore, some mRNAs are now known to not only translate protein, but also function to sponge miRNA binding, facilitating gene expression. Collectively, these appear to be effective mechanisms to ensure gene expression and protein activity. Here we show that expression of a member of the forkhead family of transcription factors, Foxo3, is regulated by the Foxo3 pseudogene (Foxo3P), and Foxo3 circular RNA, both of which bind to eight miRNAs. We found that the ectopic expression of the Foxo3P, Foxo3 circular RNA and Foxo3 mRNA could all suppress tumor growth and cancer cell proliferation and survival. Our results showed that at least three mechanisms are used to ensure protein translation of Foxo3, which reflects an essential role of Foxo3 and its corresponding non-coding RNAs.
Generation and reactivation of T-cell receptor A joining region pseudogenes in primates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thiel, C.; Lanchbury, J.S.; Otting, N.
1996-06-01
Tandemly duplicated T-cell receptor (Tcr) AJ (J{alpha}) segments contribute significantly to TCRA chain junctional region diversity in mammals. Since only limited data exists on TCRA diversity in nonhuman primates, we examined the TCRAJ regions of 37 chimpanzee and 71 rhesus macaque TCRA cDNA clones derived from inverse polymerase chain reaction on peripheral blood mononuclear cell cDNA of healthy animals. Twenty-five different TCRAJ regions were characterized in the chimpanzee and 36 in the rhesus macaque. Each bears a close structural relationship to an equivalent human TCRAJ region. Conserved amino acid motifs are shared between all three species. There are indications thatmore » differences between nonhuman primates and humans exist in the generation of TCRAJ pseudogenes. The nucleotide and amino acid sequences of the various characterized TCRAJ of each species are reported and we compare our results to the available information on human genomic sequences. Although we provide evidence of dynamic processes modifying TCRAJ segments during primate evolution, their repertoire and primary structure appears to be relatively conserved. 21 refs., 2 figs.« less
Lloyd, Julie C.; Raines, Christine A.
2011-01-01
In darkened leaves the Calvin cycle enzymes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) form a regulatory multi-enzyme complex with the small chloroplast protein CP12. GAPDH also forms a high molecular weight regulatory mono-enzyme complex. Given that there are different reports as to the number and subunit composition of these complexes and that enzyme regulatory mechanisms are known to vary between species, it was reasoned that protein–protein interactions may also vary between species. Here, this variation is investigated. This study shows that two different tetramers of GAPDH (an A2B2 heterotetramer and an A4 homotetramer) have the capacity to form part of the PRK/GAPDH/CP12 complex. The role of the PRK/GAPDH/CP12 complex is not simply to regulate the ‘non-regulatory’ A4 GAPDH tetramer. This study also demonstrates that the abundance and nature of PRK/GAPDH/CP12 interactions are not equal in all species and that whilst NAD enhances complex formation in some species, this is not sufficient for complex formation in others. Furthermore, it is shown that the GAPDH mono-enzyme complex is more abundant as a 2(A2B2) complex, rather than the larger 4(A2B2) complex. This smaller complex is sensitive to cellular metabolites indicating that it is an important regulatory isoform of GAPDH. This comparative study has highlighted considerable heterogeneity in PRK and GAPDH protein interactions between closely related species and the possible underlying physiological basis for this is discussed. PMID:21498632
Howard, Thomas P; Lloyd, Julie C; Raines, Christine A
2011-07-01
In darkened leaves the Calvin cycle enzymes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) form a regulatory multi-enzyme complex with the small chloroplast protein CP12. GAPDH also forms a high molecular weight regulatory mono-enzyme complex. Given that there are different reports as to the number and subunit composition of these complexes and that enzyme regulatory mechanisms are known to vary between species, it was reasoned that protein-protein interactions may also vary between species. Here, this variation is investigated. This study shows that two different tetramers of GAPDH (an A2B2 heterotetramer and an A4 homotetramer) have the capacity to form part of the PRK/GAPDH/CP12 complex. The role of the PRK/GAPDH/CP12 complex is not simply to regulate the 'non-regulatory' A4 GAPDH tetramer. This study also demonstrates that the abundance and nature of PRK/GAPDH/CP12 interactions are not equal in all species and that whilst NAD enhances complex formation in some species, this is not sufficient for complex formation in others. Furthermore, it is shown that the GAPDH mono-enzyme complex is more abundant as a 2(A2B2) complex, rather than the larger 4(A2B2) complex. This smaller complex is sensitive to cellular metabolites indicating that it is an important regulatory isoform of GAPDH. This comparative study has highlighted considerable heterogeneity in PRK and GAPDH protein interactions between closely related species and the possible underlying physiological basis for this is discussed.
The molecular dynamics of long noncoding RNA control of transcription in PTEN and its pseudogene
Lister, Nicholas; Shevchenko, Galina; Walshe, James L.; Groen, Jessica; Johnsson, Per; Vidarsdóttir, Linda; Grander, Dan; Ataide, Sandro F.; Morris, Kevin V.
2017-01-01
RNA has been found to interact with chromatin and modulate gene transcription. In human cells, little is known about how long noncoding RNAs (lncRNAs) interact with target loci in the context of chromatin. We find here, using the phosphatase and tensin homolog (PTEN) pseudogene as a model system, that antisense lncRNAs interact first with a 5′ UTR-containing promoter-spanning transcript, which is then followed by the recruitment of DNA methyltransferase 3a (DNMT3a), ultimately resulting in the transcriptional and epigenetic control of gene expression. Moreover, we find that the lncRNA and promoter-spanning transcript interaction are based on a combination of structural and sequence components of the antisense lncRNA. These observations suggest, on the basis of this one example, that evolutionary pressures may be placed on RNA structure more so than sequence conservation. Collectively, the observations presented here suggest a much more complex and vibrant RNA regulatory world may be operative in the regulation of gene expression. PMID:28847966
Martínez, Irene; Zhu, Jiangfeng; Lin, Henry; Bennett, George N; San, Ka-Yiu
2008-11-01
Reactions requiring reducing equivalents, NAD(P)H, are of enormous importance for the synthesis of industrially valuable compounds such as carotenoids, polymers, antibiotics and chiral alcohols among others. The use of whole-cell biocatalysis can reduce process cost by acting as catalyst and cofactor regenerator at the same time; however, product yields might be limited by cofactor availability within the cell. Thus, our study focussed on the genetic manipulation of a whole-cell system by modifying metabolic pathways and enzymes to improve the overall production process. In the present work, we genetically engineered an Escherichia coli strain to increase NADPH availability to improve the productivity of products that require NADPH in its biosynthesis. The approach involved an alteration of the glycolysis step where glyceraldehyde-3-phosphate (GAP) is oxidized to 1,3 bisphophoglycerate (1,3-BPG). This reaction is catalyzed by NAD-dependent endogenous glyceraldehyde-3-phosphate dehydrogenase (GAPDH) encoded by the gapA gene. We constructed a recombinant E. coli strain by replacing the native NAD-dependent gapA gene with a NADP-dependent GAPDH from Clostridium acetobutylicum, encoded by the gene gapC. The beauty of this approach is that the recombinant E. coli strain produces 2 mol of NADPH, instead of NADH, per mole of glucose consumed. Metabolic flux analysis showed that the flux through the pentose phosphate (PP) pathway, one of the main pathways that produce NADPH, was reduced significantly in the recombinant strain when compared to that of the parent strain. The effectiveness of the NADPH enhancing system was tested using the production of lycopene and epsilon-caprolactone as model systems using two different background strains. The recombinant strains, with increased NADPH availability, consistently showed significant higher productivity than the parent strains.
2012-01-01
Background Recent studies in human have highlighted the importance of the monocyte chemotactic proteins (MCP) in leukocyte trafficking and their effects in inflammatory processes, tumor progression, and HIV-1 infection. In European rabbit (Oryctolagus cuniculus) one of the prime MCP targets, the chemokine receptor CCR5 underwent a unique structural alteration. Until now, no homologue of MCP-2/CCL8a, MCP-3/CCL7 or MCP-4/CCL13 genes have been reported for this species. This is interesting, because at least the first two genes are expressed in most, if not all, mammals studied, and appear to be implicated in a variety of important chemokine ligand-receptor interactions. By assessing the Rabbit Whole Genome Sequence (WGS) data we have searched for orthologs of the mammalian genes of the MCP-Eotaxin cluster. Results We have localized the orthologs of these chemokine genes in the genome of European rabbit and compared them to those of leporid genera which do (i.e. Oryctolagus and Bunolagus) or do not share the CCR5 alteration with European rabbit (i.e. Lepus and Sylvilagus). Of the Rabbit orthologs of the CCL8, CCL7, and CCL13 genes only the last two were potentially functional, although showing some structural anomalies at the protein level. The ortholog of MCP-2/CCL8 appeared to be pseudogenized by deleterious nucleotide substitutions affecting exon1 and exon2. By analyzing both genomic and cDNA products, these studies were extended to wild specimens of four genera of the Leporidae family: Oryctolagus, Bunolagus, Lepus, and Sylvilagus. It appeared that the anomalies of the MCP-3/CCL7 and MCP-4/CCL13 proteins are shared among the different species of leporids. In contrast, whereas MCP-2/CCL8 was pseudogenized in every studied specimen of the Oryctolagus - Bunolagus lineage, this gene was intact in species of the Lepus - Sylvilagus lineage, and was, at least in Lepus, correctly transcribed. Conclusion The biological function of a gene was often revealed in situations of
Schuster, W; Brennicke, A
1991-01-01
An intact gene for the ribosomal protein S19 (rps19) is absent from Oenothera mitochondria. The conserved rps19 reading frame found in the mitochondrial genome is interrupted by a termination codon. This rps19 pseudogene is cotranscribed with the downstream rps3 gene and is edited on both sides of the translational stop. Editing, however, changes the amino acid sequence at positions that were well conserved before editing. Other strange editings create translational stops in open reading frames coding for functional proteins. In coxI and rps3 mRNAs CGA codons are edited to UGA stop codons only five and three codons, respectively, downstream to the initiation codon. These aberrant editings in essential open reading frames and in the rps19 pseudogene appear to have been shifted to these positions from other editing sites. These observations suggest a requirement for a continuous evolutionary constraint on the editing specificities in plant mitochondria. Images PMID:1762921
Feng, Feiyue; Qiu, Bin; Zang, Ruochuan; Song, Peng; Gao, Shugeng
2017-04-25
Natural antisense transcripts (NATs) as one of the most diverse classes of long noncoding RNAs (lncRNAs), have been demonstrated involved in fundamental biological processes in human. Here, we reported that human prohibitin gene pseudogene 1 (PHBP1) was upregulated in ESCC, and increased PHBP1 expression in ESCC was associated with clinical advanced stage. Functional experiments showed that PHBP1 knockdown inhibited ESCC cells proliferation, colony formation and xenograft tumor growth in vitro and in vivo by causing cell-cycle arrest at the G1-G0 phase. Mechanisms analysis revealed that PHBP1 transcript as an antisense transcript of PHB is partially complementary to PHB mRNA and formed an RNA-RNA hybrid with PHB, consequently inducing an increase of PHB expression at both the mRNA and protein levels. Furthermore, PHBP1 expression is strongly correlated with PHB expression in ESCC tissues. Collectively, this study elucidates an important role of PHBP1 in promoting ESCC partly via increasing PHB expression.
Zhao, Huabin; Yang, Jian-Rong; Xu, Huailiang; Zhang, Jianzhi
2010-12-01
Although it belongs to the order Carnivora, the giant panda is a vegetarian with 99% of its diet being bamboo. The draft genome sequence of the giant panda shows that its umami taste receptor gene Tas1r1 is a pseudogene, prompting the proposal that the loss of the umami perception explains why the giant panda is herbivorous. To test this hypothesis, we sequenced all six exons of Tas1r1 in another individual of the giant panda and five other carnivores. We found that the open reading frame (ORF) of Tas1r1 is intact in all these carnivores except the giant panda. The rate ratio (ω) of nonsynonymous to synonymous substitutions in Tas1r1 is significantly higher for the giant panda lineage than for other carnivore lineages. Based on the ω change and the observed number of ORF-disrupting substitutions, we estimated that the functional constraint on the giant panda Tas1r1 was relaxed ∼ 4.2 Ma, with its 95% confidence interval between 1.3 and 10 Ma. Our estimate matches the approximate date of the giant panda's dietary switch inferred from fossil records. It is probable that the giant panda's decreased reliance on meat resulted in the dispensability of the umami taste, leading to Tas1r1 pseudogenization, which in turn reinforced its herbivorous life style because of the diminished attraction of returning to meat eating in the absence of Tas1r1. Nonetheless, additional factors are likely involved because herbivores such as cow and horse still retain an intact Tas1r1.
Zhao, Huabin; Yang, Jian-Rong; Xu, Huailiang; Zhang, Jianzhi
2010-01-01
Although it belongs to the order Carnivora, the giant panda is a vegetarian with 99% of its diet being bamboo. The draft genome sequence of the giant panda shows that its umami taste receptor gene Tas1r1 is a pseudogene, prompting the proposal that the loss of the umami perception explains why the giant panda is herbivorous. To test this hypothesis, we sequenced all six exons of Tas1r1 in another individual of the giant panda and five other carnivores. We found that the open reading frame (ORF) of Tas1r1 is intact in all these carnivores except the giant panda. The rate ratio (ω) of nonsynonymous to synonymous substitutions in Tas1r1 is significantly higher for the giant panda lineage than for other carnivore lineages. Based on the ω change and the observed number of ORF-disrupting substitutions, we estimated that the functional constraint on the giant panda Tas1r1 was relaxed ∼4.2 Ma, with its 95% confidence interval between 1.3 and 10 Ma. Our estimate matches the approximate date of the giant panda's dietary switch inferred from fossil records. It is probable that the giant panda's decreased reliance on meat resulted in the dispensability of the umami taste, leading to Tas1r1 pseudogenization, which in turn reinforced its herbivorous life style because of the diminished attraction of returning to meat eating in the absence of Tas1r1. Nonetheless, additional factors are likely involved because herbivores such as cow and horse still retain an intact Tas1r1. PMID:20573776
DOE Office of Scientific and Technical Information (OSTI.GOV)
Malik, Afshan N., E-mail: afshan.malik@kcl.ac.uk; Shahni, Rojeen; Rodriguez-de-Ledesma, Ana
2011-08-19
Highlights: {yields} Mitochondrial dysfunction is central to many diseases of oxidative stress. {yields} 95% of the mitochondrial genome is duplicated in the nuclear genome. {yields} Dilution of untreated genomic DNA leads to dilution bias. {yields} Unique primers and template pretreatment are needed to accurately measure mitochondrial DNA content. -- Abstract: Circulating mitochondrial DNA (MtDNA) is a potential non-invasive biomarker of cellular mitochondrial dysfunction, the latter known to be central to a wide range of human diseases. Changes in MtDNA are usually determined by quantification of MtDNA relative to nuclear DNA (Mt/N) using real time quantitative PCR. We propose that themore » methodology for measuring Mt/N needs to be improved and we have identified that current methods have at least one of the following three problems: (1) As much of the mitochondrial genome is duplicated in the nuclear genome, many commonly used MtDNA primers co-amplify homologous pseudogenes found in the nuclear genome; (2) use of regions from genes such as {beta}-actin and 18S rRNA which are repetitive and/or highly variable for qPCR of the nuclear genome leads to errors; and (3) the size difference of mitochondrial and nuclear genomes cause a 'dilution bias' when template DNA is diluted. We describe a PCR-based method using unique regions in the human mitochondrial genome not duplicated in the nuclear genome; unique single copy region in the nuclear genome and template treatment to remove dilution bias, to accurately quantify MtDNA from human samples.« less
Viral unmasking of cellular 5S rRNA pseudogene transcripts induces RIG-I-mediated immunity.
Chiang, Jessica J; Sparrer, Konstantin M J; van Gent, Michiel; Lässig, Charlotte; Huang, Teng; Osterrieder, Nikolaus; Hopfner, Karl-Peter; Gack, Michaela U
2018-01-01
The sensor RIG-I detects double-stranded RNA derived from RNA viruses. Although RIG-I is also known to have a role in the antiviral response to DNA viruses, physiological RNA species recognized by RIG-I during infection with a DNA virus are largely unknown. Using next-generation RNA sequencing (RNAseq), we found that host-derived RNAs, most prominently 5S ribosomal RNA pseudogene 141 (RNA5SP141), bound to RIG-I during infection with herpes simplex virus 1 (HSV-1). Infection with HSV-1 induced relocalization of RNA5SP141 from the nucleus to the cytoplasm, and virus-induced shutoff of host protein synthesis downregulated the abundance of RNA5SP141-interacting proteins, which allowed RNA5SP141 to bind RIG-I and induce the expression of type I interferons. Silencing of RNA5SP141 strongly dampened the antiviral response to HSV-1 and the related virus Epstein-Barr virus (EBV), as well as influenza A virus (IAV). Our findings reveal that antiviral immunity can be triggered by host RNAs that are unshielded following depletion of their respective binding proteins by the virus.
A novel polymorphic cytochrome P450 formed by splicing of CYP3A7 and the pseudogene CYP3AP1.
Rodriguez-Antona, Cristina; Axelson, Magnus; Otter, Charlotta; Rane, Anders; Ingelman-Sundberg, Magnus
2005-08-05
The cytochrome P450 3A7 (CYP3A7) is the most abundant CYP in human liver during fetal development and first months of postnatal age, playing an important role in the metabolism of endogenous hormones, drugs, differentiation factors, and potentially toxic and teratogenic substrates. Here we describe and characterize a novel enzyme, CYP3A7.1L, encompassing the CYP3A7.1 protein with the last four carboxyl-terminal amino acids replaced by a unique sequence of 36 amino acids, generated by splicing of CYP3A7 with CYP3AP1 RNA. The corresponding CYP3A7-3AP1 mRNA had a significant expression in liver, kidney, and gastrointestinal tract, and its presence was found to be tissue-specific and dependent on the developmental stage. Heterologous expression in yeast revealed that CYP3A7.1L was a functional enzyme with a specific activity similar to that of CYP3A7.1 and, in some conditions, a different hydroxylation specificity than CYP3A7.1 using dehydroepiandrosterone as a substrate. CYP3A7.1L was found to be polymorphic due to a mutation at position -6 of the first splicing site of CYP3AP1 (CYP3A7_39256T-->A), which abrogates the pseudogene splicing. This polymorphism had pronounced interethnic differences and was in linkage disequilibrium with other functional polymorphisms described in the CYP3A locus: CYP3A7*2 and CYP3A5*1. Therefore, the resulting CYP3A haplotypes express different sets of enzymes within the population. In conclusion, a novel mechanism, consisting of the splicing of the pseudogene CYP3AP1 to CYP3A7, causes the formation of the novel CYP3A7.1L having a different tissue distribution and functional properties than the parent CYP3A7 enzyme, with possible developmental, physiological, and toxicological consequences.
Durand-Dubief, Mickaël; Absalon, Sabrina; Menzer, Linda; Ngwabyt, Sandra; Ersfeld, Klaus; Bastin, Philippe
2007-12-01
The protist Trypanosoma brucei possesses a single Argonaute gene called TbAGO1 that is necessary for RNAi silencing. We previously showed that in strain 427, TbAGO1 knock-out leads to a slow growth phenotype and to chromosome segregation defects. Here we report that the slow growth phenotype is linked to defects in segregation of both large and mini-chromosome populations, with large chromosomes being the most affected. These phenotypes are completely reversed upon inducible re-expression of TbAGO1 fused to GFP, demonstrating their link with TbAGO1. Trypanosomes that do not express TbAGO1 show a general increase in the abundance of transcripts derived from the short retroposon RIME (Ribosomal Interspersed Mobile Element). Supplementary large RIME transcripts emerge in the absence of RNAi, a phenomenon coupled to the disappearance of short transcripts. These fluctuations are reversed by inducible expression of GFP::TbAGO1. Furthermore, we use a combination of Northern blots, RT-PCR and sequencing to reveal that RNAi controls expression of transcripts derived from RHS (Retrotransposon Hot Spot) pseudogenes (RHS genes with retro-element(s) integrated within their coding sequence). Absence of RNAi also leads to an increase of steady-state transcripts from regular RHS genes (those without retro-element), indicating a role for pseudogene in control of gene expression. However, analysis of retroposon abundance and arrangement in the genome of multiple clonal cell lines of TbAGO1-/- failed to reveal movement of mobile elements despite the increased amounts of retroposon transcripts.
Danshina, Polina V.; Qu, Weidong; Temple, Brenda R.; Rojas, Rafael J.; Miley, Michael J.; Machius, Mischa; Betts, Laurie; O'Brien, Deborah A.
2016-01-01
structural features of this sperm isozyme. In dose–response assays T0501_7749 inhibited human GAPDHS with an IC50 of 1.2 μM compared with an IC50 of 38.5 μM for the somatic isozyme. This compound caused significant reductions in mouse sperm lactate production (P= 0.017 for 100 μM T0501_7749 versus control) and in the percentage of motile mouse and human sperm (P values from <0.05 to <0.0001, depending on incubation conditions). LIMITATIONS, REASONS FOR CAUTION The chemical properties of T0501_7749, including limited solubility and nonspecific protein binding, are not optimal for drug development. WIDER IMPLICATIONS OF THE FINDINGS This study provides proof-of-principle evidence that GAPDHS can be selectively inhibited, causing significant reductions in sperm glycolysis and motility. These results highlight the utility of structure-based drug design and support further exploration of GAPDHS, and perhaps other sperm-specific isozymes in the glycolytic pathway, as contraceptive targets. LARGE SCALE DATA None. Coordinates and data files for three GAPDHS crystal structures were deposited in the RCSB Protein Data Bank (http://www.rcsb.org). STUDY FUNDING AND COMPETING INTEREST(S) This work was supported by grants from the National Institutes of Health (NIH), USA, including U01 HD060481 and cooperative agreement U54 HD35041 as part of the Specialized Cooperative Centers Program in Reproduction and Infertility Research from the Eunice Kennedy Shriver National Institute of Child Health and Human Development, and TW/HD00627 from the NIH Fogarty International Center. Additional support was provided by subproject CIG-05-109 from CICCR, a program of CONRAD, Eastern Virginia Medical School, USA. There are no conflicts of interest. PMID:26921398
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.
The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing ofmore » an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.« less
Bommareddy, Rajesh Reddy; Chen, Zhen; Rappert, Sugima; Zeng, An-Ping
2014-09-01
Engineering the cofactor availability is a common strategy of metabolic engineering to improve the production of many industrially important compounds. In this work, a de novo NADPH generation pathway is proposed by altering the coenzyme specificity of a native NAD-dependent glyceraldehyde 3-phosphate dehydrogenase (GAPDH) to NADP, which consequently has the potential to produce additional NADPH in the glycolytic pathway. Specifically, the coenzyme specificity of GAPDH of Corynebacterium glutamicum is systematically manipulated by rational protein design and the effect of the manipulation for cellular metabolism and lysine production is evaluated. By a combinatorial modification of four key residues within the coenzyme binding sites, different GAPDH mutants with varied coenzyme specificity were constructed. While increasing the catalytic efficiency of GAPDH towards NADP enhanced lysine production in all of the tested mutants, the most significant improvement of lysine production (~60%) was achieved with the mutant showing similar preference towards both NAD and NADP. Metabolic flux analysis with (13)C isotope studies confirmed that there was no significant change of flux towards the pentose phosphate pathway and the increased lysine yield was mainly attributed to the NADPH generated by the mutated GAPDH. The present study highlights the importance of protein engineering as a key strategy in de novo pathway design and overproduction of desired products. Copyright © 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Display format, highlight validity, and highlight method: Their effects on search performance
NASA Technical Reports Server (NTRS)
Donner, Kimberly A.; Mckay, Tim D.; Obrien, Kevin M.; Rudisill, Marianne
1991-01-01
Display format and highlight validity were shown to affect visual display search performance; however, these studies were conducted on small, artificial displays of alphanumeric stimuli. A study manipulating these variables was conducted using realistic, complex Space Shuttle information displays. A 2x2x3 within-subjects analysis of variance found that search times were faster for items in reformatted displays than for current displays. Responses to valid applications of highlight were significantly faster than responses to non or invalidly highlighted applications. The significant format by highlight validity interaction showed that there was little difference in response time to both current and reformatted displays when the highlight validity was applied; however, under the non or invalid highlight conditions, search times were faster with reformatted displays. A separate within-subject analysis of variance of display format, highlight validity, and several highlight methods did not reveal a main effect of highlight method. In addition, observed display search times were compared to search time predicted by Tullis' Display Analysis Program. Benefits of highlighting and reformatting displays to enhance search and the necessity to consider highlight validity and format characteristics in tandem for predicting search performance are discussed.
NASA Astrophysics Data System (ADS)
Menezes, Irwin R. A.; Lopes, Julio C. D.; Montanari, Carlos A.; Oliva, Glaucius; Pavão, Fernando; Castilho, Marcelo S.; Vieira, Paulo C.; Pupo, M.^onica T.
2003-05-01
Drug design strategies based on Comparative Molecular Field Analysis (CoMFA) have been used to predict the activity of new compounds. The major advantage of this approach is that it permits the analysis of a large number of quantitative descriptors and uses chemometric methods such as partial least squares (PLS) to correlate changes in bioactivity with changes in chemical structure. Because it is often difficult to rationalize all variables affecting the binding affinity of compounds using CoMFA solely, the program GRID was used to describe ligands in terms of their molecular interaction fields, MIFs. The program VolSurf that is able to compress the relevant information present in 3D maps into a few descriptors can treat these GRID fields. The binding affinities of a new set of compounds consisting of 13 coumarins, for one of which the three-dimensional ligand-enzyme bound structure is known, were studied. A final model based on the mentioned programs was independently validated by synthesizing and testing new coumarin derivatives. By relying on our knowledge of the real physical data (i.e., combining crystallographic and binding affinity results), it is also shown that ligand-based design agrees with structure-based design. The compound with the highest binding affinity was the coumarin chalepin, isolated from Rutaceae species, with an IC50 value of 55.5 μM towards the enzyme glyceraldehyde-3-phosphate dehydrogenase (gGAPDH) from glycosomes of the parasite Trypanosoma cruzi, the causative agent of Chagas' disease. The proposed models from GRID MIFs have revealed the importance of lipophilic interactions in modulating the inhibition, but without excluding the dependence on stereo-electronic properties as found from CoMFA fields.
Zeng, Lingfeng; Deng, Rong; Guo, Ziping; Yang, Shushen; Deng, Xiping
2016-03-16
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a central enzyme in glycolysi, we performed genome-wide identification of GAPDH genes in wheat and analyzed their structural characteristics and expression patterns under abiotic stress in wheat. A total of 22 GAPDH genes were identified in wheat cv. Chinese spring; the phylogenetic and structure analysis showed that these GAPDH genes could be divided into four distinct subfamilies. The expression profiles of GAPDH genes showed tissue specificity all over plant development stages. The qRT-PCR results revealed that wheat GAPDHs were involved in several abiotic stress response. Wheat carried 22 GAPDH genes, representing four types of plant GAPDHs (gapA/B, gapC, gapCp and gapN). Whole genome duplication and segmental duplication might account for the expansion of wheat GAPDHs. Expression analysis implied that GAPDHs play roles in plants abiotic stress tolerance.
Kunjithapatham, Rani; Geschwind, Jean-Francois; Devine, Lauren; Boronina, Tatiana N; O'Meally, Robert N; Cole, Robert N; Torbenson, Michael S; Ganapathy-Kanniappan, Shanmugasundaram
2015-04-03
Cellular glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a phylogenetically conserved, ubiquitous enzyme that plays an indispensable role in energy metabolism. Although a wealth of information is available on cellular GAPDH, there is a clear paucity of data on its extracellular counterpart (i.e., the secreted or extracellular GAPDH). Here, we show that the extracellular GAPDH in human serum is a multimeric, high-molecular-weight, yet glycolytically active enzyme. The high-molecular-weight multimers of serum GAPDH were identified by immunodetection on one- and two-dimensional gel electrophoresis using multiple antibodies specific for various epitopes of GAPDH. Partial purification of serum GAPDH by DEAE Affigel affinity/ion exchange chromatography further established the multimeric composition of serum GAPDH. In vitro data demonstrated that human cell lines secrete a multimeric, high-molecular-weight enzyme similar to that of serum GAPDH. Furthermore, LC-MS/MS analysis of extracellular GAPDH from human cell lines confirmed the presence of unique peptides of GAPDH in the high-molecular-weight subunits. Furthermore, data from pulse-chase experiments established the presence of high-molecular-weight subunits in the secreted, extracellular GAPDH. Taken together, our findings demonstrate the presence of a high-molecular-weight, enzymatically active secretory GAPDH in human serum that may have a hitherto unknown function in humans.
Fu, Lili; Han, Bingying; Tan, Deguan; Wang, Meng; Ding, Mei; Zhang, Jiaming
2016-02-22
Myrosinases are β-thioglucoside glucohydrolases and serve as defense mechanisms against insect pests and pathogens by producing toxic compounds. AtTGG6 in Arabidopsis thaliana was previously reported to be a myrosinase pseudogene but specifically expressed in pollen. However, we found that AlTGG6, an ortholog to AtTGG6 in A. lyrata (an outcrossing relative of A. thaliana) was functional, suggesting that functional AtTGG6 alleles may still exist in A. thaliana. AtTGG6 alleles in 29 A. thaliana ecotypes were cloned and sequenced. Results indicate that ten alleles were functional and encoded Myr II type myrosinase of 512 amino acids, and myrosinase activity was confirmed by overexpressing AtTGG6 in Pichia pastoris. However, the 19 other ecotypes had disabled alleles with highly polymorphic frame-shift mutations and diversified sequences. Thirteen frame-shift mutation types were identified, which occurred independently many times in the evolutionary history within a few thousand years. The functional allele was expressed specifically in pollen similar to the disabled alleles but at a higher expression level, suggesting its role in defense of pollen against insect pests such as pollen beetles. However, the defense function may have become less critical after A. thaliana evolved to self-fertilization, and thus resulted in loss of function in most ecotypes.
Pseudogenization of a Sweet-Receptor Gene Accounts for Cats' Indifference toward Sugar
Li, Xia; Li, Weihua; Wang, Hong; Cao, Jie; Maehashi, Kenji; Huang, Liquan; Bachmanov, Alexander A; Reed, Danielle R; Legrand-Defretin, Véronique; Beauchamp, Gary K; Brand, Joseph G
2005-01-01
Although domestic cats (Felis silvestris catus) possess an otherwise functional sense of taste, they, unlike most mammals, do not prefer and may be unable to detect the sweetness of sugars. One possible explanation for this behavior is that cats lack the sensory system to taste sugars and therefore are indifferent to them. Drawing on work in mice, demonstrating that alleles of sweet-receptor genes predict low sugar intake, we examined the possibility that genes involved in the initial transduction of sweet perception might account for the indifference to sweet-tasting foods by cats. We characterized the sweet-receptor genes of domestic cats as well as those of other members of the Felidae family of obligate carnivores, tiger and cheetah. Because the mammalian sweet-taste receptor is formed by the dimerization of two proteins (T1R2 and T1R3; gene symbols Tas1r2 and Tas1r3), we identified and sequenced both genes in the cat by screening a feline genomic BAC library and by performing PCR with degenerate primers on cat genomic DNA. Gene expression was assessed by RT-PCR of taste tissue, in situ hybridization, and immunohistochemistry. The cat Tas1r3 gene shows high sequence similarity with functional Tas1r3 genes of other species. Message from Tas1r3 was detected by RT-PCR of taste tissue. In situ hybridization and immunohistochemical studies demonstrate that Tas1r3 is expressed, as expected, in taste buds. However, the cat Tas1r2 gene shows a 247-base pair microdeletion in exon 3 and stop codons in exons 4 and 6. There was no evidence of detectable mRNA from cat Tas1r2 by RT-PCR or in situ hybridization, and no evidence of protein expression by immunohistochemistry. Tas1r2 in tiger and cheetah and in six healthy adult domestic cats all show the similar deletion and stop codons. We conclude that cat Tas1r3 is an apparently functional and expressed receptor but that cat Tas1r2 is an unexpressed pseudogene. A functional sweet-taste receptor heteromer cannot form, and
ERIC Educational Resources Information Center
Gier, Vicki; Kreiner, David; Hudnell, Jason; Montoya, Jodi; Herring, Daniel
2011-01-01
The purpose of the present experiment was to determine whether using an active learning technique, electronic highlighting, can eliminate the negative effects of pre-existing, poor highlighting on reading comprehension. Participants read passages containing no highlighting, appropriate highlighting, or inappropriate highlighting. We hypothesized…
Fitz-Gibbon, Sorel; Tomida, Shuta; Li, Huiying
2013-01-01
The human skin harbors a diverse community of bacteria, including the Gram-positive, anaerobic bacterium Propionibacterium acnes. P. acnes has historically been linked to the pathogenesis of acne vulgaris, a common skin disease affecting over 80% of all adolescents in the US. To gain insight into potential P. acnes pathogenic mechanisms, we previously sequenced the complete genome of a P. acnes strain HL096PA1 that is highly associated with acne. In this study, we compared its genome to the first published complete genome KPA171202. HL096PA1 harbors a linear plasmid, pIMPLE-HL096PA1. This is the first described P. acnes plasmid. We also observed a five-fold increase of pseudogenes in HL096PA1, several of which encode proteins in carbohydrate transport and metabolism. In addition, our analysis revealed a few island-like genomic regions that are unique to HL096PA1 and a large genomic inversion spanning the ribosomal operons. Together, these findings offer a basis for understanding P. acnes virulent properties, host adaptation mechanisms, and its potential role in acne pathogenesis at the strain level. Furthermore, the plasmid identified in HL096PA1 may potentially provide a new opportunity for P. acnes genetic manipulation and targeted therapy against specific disease-associated strains. PMID:23762865
Itakura, Masanori; Nakajima, Hidemitsu; Semi, Yuko; Higashida, Shusaku; Azuma, Yasu-Taka; Takeuchi, Tadayoshi
2015-11-13
The glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has multiple functions, including mediating oxidative stress-induced neuronal cell death. This process is associated with disulfide-bonded GAPDH aggregation. Some reports suggest a link between GAPDH and the pathogenesis of several oxidative stress-related diseases. However, the pathological significance of GAPDH aggregation in disease pathogenesis remains unclear due to the lack of an effective GAPDH aggregation inhibitor. In this study, we identified a GAPDH aggregation inhibitor (GAI) peptide and evaluated its biological profile. The decapeptide GAI specifically inhibited GAPDH aggregation in a concentration-dependent manner. Additionally, the GAI peptide did not affect GAPDH glycolytic activity or cell viability. The GAI peptide also exerted a protective effect against oxidative stress-induced cell death in SH-SY5Y cells. This peptide could potentially serve as a tool to investigate GAPDH aggregation-related neurodegenerative and neuropsychiatric disorders and as a possible therapy for diseases associated with oxidative stress-induced cell death. Copyright © 2015 Elsevier Inc. All rights reserved.
Pariona-Llanos, Ricardo; Pavani, Raphael Souza; Reis, Marcelo; Noël, Vincent; Silber, Ariel Mariano; Armelin, Hugo Aguirre; Cano, Maria Isabel Nogueira; Elias, Maria Carolina
2015-01-01
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is a classical metabolic enzyme involved in energy production and plays a role in additional nuclear functions, including transcriptional control, recognition of misincorporated nucleotides in DNA and maintenance of telomere structure. Here, we show that the recombinant protein T. cruzi GAPDH (rTcGAPDH) binds single-stranded telomeric DNA. We demonstrate that the binding of GAPDH to telomeric DNA correlates with the balance between oxidized and reduced forms of nicotinamide adenine dinucleotides (NAD+/NADH). We observed that GAPDH-telomere association and NAD+/NADH balance changed throughout the T. cruzi life cycle. For example, in replicative epimastigote forms of T. cruzi, which show similar intracellular concentrations of NAD+ and NADH, GAPDH binds to telomeric DNA in vivo and this binding activity is inhibited by exogenous NAD+. In contrast, in the T. cruzi non-proliferative trypomastigote forms, which show higher NAD+ concentration, GAPDH was absent from telomeres. In addition, NAD+ abolishes physical interaction between recombinant GAPDH and synthetic telomere oligonucleotide in a cell free system, mimicking exogenous NAD+ that reduces GAPDH-telomere interaction in vivo. We propose that the balance in the NAD+/NADH ratio during T. cruzi life cycle homeostatically regulates GAPDH telomere association, suggesting that in trypanosomes redox status locally modulates GAPDH association with telomeric DNA.
Pariona-Llanos, Ricardo; Pavani, Raphael Souza; Reis, Marcelo; Noël, Vincent; Silber, Ariel Mariano; Armelin, Hugo Aguirre; Cano, Maria Isabel Nogueira; Elias, Maria Carolina
2015-01-01
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is a classical metabolic enzyme involved in energy production and plays a role in additional nuclear functions, including transcriptional control, recognition of misincorporated nucleotides in DNA and maintenance of telomere structure. Here, we show that the recombinant protein T. cruzi GAPDH (rTcGAPDH) binds single-stranded telomeric DNA. We demonstrate that the binding of GAPDH to telomeric DNA correlates with the balance between oxidized and reduced forms of nicotinamide adenine dinucleotides (NAD+/NADH). We observed that GAPDH-telomere association and NAD+/NADH balance changed throughout the T. cruzi life cycle. For example, in replicative epimastigote forms of T. cruzi, which show similar intracellular concentrations of NAD+ and NADH, GAPDH binds to telomeric DNA in vivo and this binding activity is inhibited by exogenous NAD+. In contrast, in the T. cruzi non-proliferative trypomastigote forms, which show higher NAD+ concentration, GAPDH was absent from telomeres. In addition, NAD+ abolishes physical interaction between recombinant GAPDH and synthetic telomere oligonucleotide in a cell free system, mimicking exogenous NAD+ that reduces GAPDH-telomere interaction in vivo. We propose that the balance in the NAD+/NADH ratio during T. cruzi life cycle homeostatically regulates GAPDH telomere association, suggesting that in trypanosomes redox status locally modulates GAPDH association with telomeric DNA. PMID:25775131
Samson, Andre L.; Knaupp, Anja S.; Kass, Itamar; Kleifeld, Oded; Marijanovic, Emilia M.; Hughes, Victoria A.; Lupton, Chris J.; Buckle, Ashley M.; Bottomley, Stephen P.; Medcalf, Robert L.
2014-01-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a ubiquitous and abundant protein that participates in cellular energy production. GAPDH normally exists in a soluble form; however, following necrosis, GAPDH and numerous other intracellular proteins convert into an insoluble disulfide-cross-linked state via the process of “nucleocytoplasmic coagulation.” Here, free radical-induced aggregation of GAPDH was studied as an in vitro model of nucleocytoplasmic coagulation. Despite the fact that disulfide cross-linking is a prominent feature of GAPDH aggregation, our data show that it is not a primary rate-determining step. To identify the true instigating event of GAPDH misfolding, we mapped the post-translational modifications that arise during its aggregation. Solvent accessibility and energy calculations of the mapped modifications within the context of the high resolution native GAPDH structure suggested that oxidation of methionine 46 may instigate aggregation. We confirmed this by mutating methionine 46 to leucine, which rendered GAPDH highly resistant to free radical-induced aggregation. Molecular dynamics simulations suggest that oxidation of methionine 46 triggers a local increase in the conformational plasticity of GAPDH that likely promotes further oxidation and eventual aggregation. Hence, methionine 46 represents a “linchpin” whereby its oxidation is a primary event permissive for the subsequent misfolding, aggregation, and disulfide cross-linking of GAPDH. A critical role for linchpin residues in nucleocytoplasmic coagulation and other forms of free radical-induced protein misfolding should now be investigated. Furthermore, because disulfide-cross-linked aggregates of GAPDH arise in many disorders and because methionine 46 is irrelevant to native GAPDH function, mutation of methionine 46 in models of disease should allow the unequivocal assessment of whether GAPDH aggregation influences disease progression. PMID:25086035
Hu, Yue; Zhang, Erhong; Huang, Lisi; Li, Wenfang; Liang, Pei; Wang, Xiaoyun; Xu, Jin; Huang, Yan; Yu, Xinbing
2014-12-01
Globally, 15-20 million people are infected with Clonorchis sinensis (C. sinensis) which results in clonorchiasis. In China, clonorchiasis is considered to be one of the fastest-growing food-borne parasitic diseases. That more key molecules of C. sinensis are characterized will be helpful to understand biology and pathogenesis of the carcinogenic liver fluke. Glyceraldehyde-3-phosphate dehydrogenases (GAPDHs) from many species have functions other than their catalytic role in glycolysis. In the present study, we analyzed the sequence and structure of GAPDH from C. sinensis (CsGAPDH) by using bioinformatics tools and obtained its recombinant protein by prokaryotic expression system, to learn its expression profiles and molecular property. CsGAPDH could bind to human intrahepatic biliary epithelial cell in vivo and in vitro by the method of immunofluorescence assays. CsGAPDH also disturbed in lumen of biliary tract near to the parasite in the liver of infected rat. Western blotting analysis together with immunofluorescence assay indicated that CsGAPDH was a component of excretory/secretory proteins (CsESPs) and a surface-localized protein of C. sinensis. Quantitative real-time PCR (Q-PCR) and Western blotting demonstrated that CsGAPDHs are expressed at the life stages of adult worm, metacercaria, and egg, but the expression levels were different from each other. Recombinant CsGAPDH (rCsGAPDH) was confirmed to have the capacity to catalyze the conversion of glyceraldehyde 3-phosphate to D-glycerate 1,3-bisphosphate which was inhibited by AMP in a dose-dependent manner. In addition, rCsGAPDH was able to interact with human plasminogen in a dose-dependent manner by ELISA. The interaction could be inhibited by lysine. The plasminogen binding capacity of rCsGAPDH along with the distribution of CsGAPDH in vivo and in the liver of C. sinensis-infected rat hinted that surface-localized CsGAPDH might play an important role in host invasion of the worm besides its glycolytic
Anticancer efficacy of the metabolic blocker 3-bromopyruvate: specific molecular targeting.
Ganapathy-Kanniappan, Shanmugasundaram; Kunjithapatham, Rani; Geschwind, Jean-Francois
2013-01-01
The anticancer efficacy of the pyruvate analog 3-bromopyruvate has been demonstrated in multiple tumor models. The chief principle underlying the antitumor effects of 3-bromopyruvate is its ability to effectively target the energy metabolism of cancer cells. Biochemically, the glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has been identified as the primary target of 3-bromopyruvate. Its inhibition results in the depletion of intracellular ATP, causing cell death. Several reports have also demonstrated that in addition to GAPDH inhibition, the induction of cellular stress also contributes to 3-bromopyruvate treatment-dependent apoptosis. Furthermore, recent evidence shows that 3-bromopyruvate is taken up selectively by tumor cells via the monocarboxylate transporters (MCTs) that are frequently overexpressed in cancer cells (for the export of lactate produced during aerobic glycolysis). The preferential uptake of 3-bromopyruvate via MCTs facilitates selective targeting of tumor cells while leaving healthy and non-malignant tissue untouched. Taken together, the specificity of molecular (GAPDH) targeting and selective uptake by tumor cells, underscore the potential of 3-bromopyruvate as a potent and promising anticancer agent. In this review, we highlight the mechanistic characteristics of 3-bromopyruvate and discuss its potential for translation into the clinic.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Steinkasserer, A.; Koettnitz, K.; Hauber, J.
1995-02-10
The eukaryotic initiation factor 5A (eIF-5A) has been identified as an essential cofactor for the HIV-1 transactivator protein Rev. Rev plays a key role in the complex regulation of HIV-1 gene expression and thereby in the generation of infectious virus particles. Expression of eIF-5A is vital for Rev function, and inhibition of this interaction leads to a block of the viral replication cycle. In humans, four different eIF-5A genes have been identified. One codes for the eIF-5A protein and the other three are pseudogenes. Using a panel of somatic rodent-human cell hybrids in combination with fluorescence in situ hybridization analysis,more » we show that the four genes map to three different chromosomes. The coding eIF-5A gene (EIF5A) maps to 17p12-p13, and the three pseudogenes EIF5AP1, EIF5AP2, and EIF5AP3 map to 10q23.3, 17q25, and 19q13.2, respectively. This is the first localization report for a eukaryotic cofactor for a regulatory HIV-1 protein. 16 refs., 1 fig.« less
Barinova, K V; Serebryakova, M V; Muronetz, V I; Schmalhausen, E V
2017-12-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a glycolytic protein involved in numerous non-glycolytic functions. S-glutathionylated GAPDH was revealed in plant and animal tissues. The role of GAPDH S-glutathionylation is not fully understood. Rabbit muscle GAPDH was S-glutathionylated in the presence of H 2 O 2 and reduced glutathione (GSH). The modified protein was assayed by MALDI-MS analysis, differential scanning calorimetry, dynamic light scattering, and ultracentrifugation. Incubation of GAPDH in the presence of H 2 O 2 together with GSH resulted in the complete inactivation of the enzyme. In contrast to irreversible oxidation of GAPDH by H 2 O 2 , this modification could be reversed in the excess of GSH or dithiothreitol. By data of MALDI-MS analysis, the modified protein contained both mixed disulfide between Cys150 and GSH and the intrasubunit disulfide bond between Cys150 and Cys154 (different subunits of tetrameric GAPDH may contain different products). S-glutathionylation results in loosening of the tertiary structure of GAPDH, decreases its affinity to NAD + and thermal stability. The mixed disulfide between Cys150 and GSH is an intermediate product of S-glutathionylation: its subsequent reaction with Cys154 results in the intrasubunit disulfide bond in the active site of GAPDH. The mixed disulfide and the C150-C154 disulfide bond protect GAPDH from irreversible oxidation and can be reduced in the excess of thiols. Conformational changes that were observed in S-glutathionylated GAPDH may affect interactions between GAPDH and other proteins (ligands), suggesting the role of S-glutathionylation in the redox signaling. The manuscript considers one of the possible mechanisms of redox regulation of cell functions. Copyright © 2017 Elsevier B.V. All rights reserved.
Fokina, K V; Dainyak, M B; Nagradova, N K; Muronetz, V I
1997-09-15
The ability of D-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) catalyzing the reaction of 1,3-diphosphoglycerate synthesis in human erythrocytes to form complexes with enzymes which use this metabolite as substrate (3-phosphoglycerate kinase (3-PGK) or 2,3-diphosphoglycerate mutase (2,3-DPGM)) was studied. It was found that highly active 2,3-DPGM can be extracted from human erythrocyte hemolysates in a complex with GAPDH adsorbed on Sepharose-bound anti-GAPDH antibodies at pH 6.5, the molar ratio being one 2,3-GPGM subunit per subunit of GAPDH. No complexation was, however, detected at pH 8.0. The opposite was true for the interaction between GAPDH and 3-PGK, which could be observed at pH 8.0. In experiments carried out at pH 7.4, both GAPDH x 2,3-DPGM and GAPGH x 3-PGK complexes were detected. The Kd values of the complexes determined with purified enzyme preparations were in the range 2.40-2.48 microM for both the GAPDH x 2,3-DPGM and GAPGH x 3-PGK enzyme pairs, when titrations of GAPDH covalently bound to CNBr-activated Sepharose were performed by the soluble 2,3-DPGM or 3-PGK. If, however, GAPDH adsorbed on the specific antibodies covalently bound to Sepharose was used in the titration experiments, the Kd for the GAPDH x 2,3-DPGM complex was found to be 0.54 microM, and the Kd for the GAPDH x 3-PGK complex was 0.49 microM. The concentration of 2,3-diphosphoglycerate determined after 1 h of incubation of erythrocytes in the presence of glucose was found to increase 1.5-fold if the incubation was carried out at pH 6.5, but did not change upon incubation at pH 8.0. On the other hand, the concentration of 3-phosphoglycerate after incubation at pH 8.0 was twice as large as that found after incubation at pH 6.5. The results are interpreted on the hypothesis that specific protein-protein interactions between GAPDH and 2,3-DPGM or between GAPDH and 3-PGK may play a role in determining the fate of 1,3-diphosphoglycerate produced in the GAPDH-catalyzed reaction.
2012-01-01
Background Host proteins are incorporated inside human immunodeficiency virus type 1 (HIV-1) virions during assembly and can either positively or negatively regulate HIV-1 infection. Although the identification efficiency of host proteins is improved by mass spectrometry, how those host proteins affect HIV-1 replication has not yet been fully clarified. Results In this study, we show that virion-associated glyceraldehyde 3-phosphate dehydrogenase (GAPDH) does not allosterically inactivate HIV-1 reverse transcriptase (RT) but decreases the efficiency of reverse transcription reactions by decreasing the packaging efficiency of lysyl-tRNA synthetase (LysRS) and tRNALys3 into HIV-1 virions. Two-dimensional (2D) gel electrophoresis demonstrated that some isozymes of GAPDH with different isoelectric points were expressed in HIV-1-producing CEM/LAV-1 cells, and a proportion of GAPDH was selectively incorporated into the virions. Suppression of GAPDH expression by RNA interference in CEM/LAV-1 cells resulted in decreased GAPDH packaging inside the virions, and the GAPDH-packaging-defective virus maintained at least control levels of viral production but increased the infectivity. Quantitative analysis of reverse transcription products indicated that the levels of early cDNA products of the GAPDH-packaging-defective virus were higher than those of the control virus owing to the higher packaging efficiencies of LysRS and tRNALys3 into the virions rather than the GAPDH-dependent negative allosteric modulation for RT. Furthermore, immunoprecipitation assay using an anti-GAPDH antibody showed that GAPDH directly interacted with Pr55gag and p160gag-pol and the overexpression of LysRS in HIV-1-producing cells resulted in a decrease in the efficiency of GAPDH packaging in HIV particles. In contrast, the viruses produced from cells expressing a high level of GAPDH showed decreased infectivity in TZM-bl cells and reverse transcription efficiency in TZM-bl cells and peripheral blood
Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.
Schuetz, J D; Guzelian, P S
1995-03-14
We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.
Ávila, César L; Torres-Bugeau, Clarisa M; Barbosa, Leandro R S; Sales, Elisa Morandé; Ouidja, Mohand O; Socías, Sergio B; Celej, M Soledad; Raisman-Vozari, Rita; Papy-Garcia, Dulce; Itri, Rosangela; Chehín, Rosana N
2014-05-16
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a multifunctional enzyme that has been associated with neurodegenerative diseases. GAPDH colocalizes with α-synuclein in amyloid aggregates in post-mortem tissue of patients with sporadic Parkinson disease and promotes the formation of Lewy body-like inclusions in cell culture. In a previous work, we showed that glycosaminoglycan-induced GAPDH prefibrillar species accelerate the conversion of α-synuclein to fibrils. However, it remains to be determined whether the interplay among glycosaminoglycans, GAPDH, and α-synuclein has a role in pathological states. Here, we demonstrate that the toxic effect exerted by α-synuclein oligomers in dopaminergic cell culture is abolished in the presence of GAPDH prefibrillar species. Structural analysis of prefibrillar GAPDH performed by small angle x-ray scattering showed a particle compatible with a protofibril. This protofibril is shaped as a cylinder 22 nm long and a cross-section diameter of 12 nm. Using biocomputational techniques, we obtained the first all-atom model of the GAPDH protofibril, which was validated by cross-linking coupled to mass spectrometry experiments. Because GAPDH can be secreted outside the cell where glycosaminoglycans are present, it seems plausible that GAPDH protofibrils could be assembled in the extracellular space kidnapping α-synuclein toxic oligomers. Thus, the role of GAPDH protofibrils in neuronal proteostasis must be considered. The data reported here could open alternative ways in the development of therapeutic strategies against synucleinopathies like Parkinson disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Ganster, Christina; Wernstedt, Annekatrin; Kehrer-Sawatzki, Hildegard; Messiaen, Ludwine; Schmidt, Konrad; Rahner, Nils; Heinimann, Karl; Fonatsch, Christa; Zschocke, Johannes; Wimmer, Katharina
2010-05-01
Sequence exchange between PMS2 and its pseudogene PMS2CL, embedded in an inverted duplication on chromosome 7p22, has been reported to be an ongoing process that leads to functional PMS2 hybrid alleles containing PMS2- and PMS2CL-specific sequence variants at the 5'-and the 3'-end, respectively. The frequency of PMS2 hybrid alleles, their biological significance, and the mechanisms underlying their formation are largely unknown. Here we show that overall hybrid alleles account for one-third of 384 PMS2 alleles analyzed in individuals of different ethnic backgrounds. Depending on the population, 14-60% of hybrid alleles carry PMS2CL-specific sequences in exons 13-15, the remainder only in exon 15. We show that exons 13-15 hybrid alleles, named H1 hybrid alleles, constitute different haplotypes but trace back to a single ancient intrachromosomal recombination event with crossover. Taking advantage of an ancestral sequence variant specific for all H1 alleles we developed a simple gDNA-based polymerase chain reaction (PCR) assay that can be used to identify H1-allele carriers with high sensitivity and specificity (100 and 99%, respectively). Because H1 hybrid alleles harbor missense variant p.N775S of so far unknown functional significance, we assessed the H1-carrier frequency in 164 colorectal cancer patients. So far, we found no indication that the variant plays a major role with regard to cancer susceptibility. (c) 2010 Wiley-Liss, Inc.
Wu, Yonghong; Wu, Min; He, Guowei; Zhang, Xiao; Li, Weiguang; Gao, Yan; Li, Zhihui; Wang, Zhaoyan; Zhang, Chenggang
2012-04-01
In the current study, we examined the expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein in a number of organisms and the stability of GAPDH under various conditions. Our results revealed that GAPDH is present in multiple Escherichia coli strains, the yeast strain GS115, Caenorhabditis elegans, rat PC12 cells, and both mouse and rat brain. Furthermore, GAPDH was stably expressed under different concentrations of inducer and at different times of induction in E. coli (BL21) cells and yeast GS115 cells. Stable expression of GAPDH protein was also observed in C.elegans and PC12 cells that were treated with different concentrations of paraquat or sodium sulfite, respectively. In addition, we were able to detect and identify the endogenous gapA protein in E.coli via immunoprecipitation and MALDI-TOF-MS analysis. Endogenous gapA protein and exogenously expressed (subcloned) GAPDH proteins were detected in E. coli BL21 but not for gapC. With the exception of gapC in E. coli, the various isoforms of GAPDH possessed enzymatic activity. Finally, sequence analysis revealed that the GAPDH proteins were 76% identical, with the exception of E. coli gapC. Taken together, our results indicate that GAPDH could be universally used as an internal control for the Western blot analysis of prokaryotic and eukaryotic samples. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.
APPA 2011 Conference Highlights
ERIC Educational Resources Information Center
Facilities Manager, 2011
2011-01-01
This article presents highlights of APPA conference that was held on July 16-18, 2011. The highlights feature photos of 2011-2012 board of directors, outgoing senior regional representatives to the board, meritorious service award, APPA fellow, president's recognition and gavel exchange, and diamond business partner award.
THE HEME BINDING PROPERTIES OF GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE
Hannibal, Luciana; Collins, Daniel; Brassard, Julie; Chakravarti, Ritu; Vempati, Rajesh; Dorlet, Pierre; Santolini, Jérôme; Dawson, John H.; Stuehr, Dennis J.
2012-01-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a glycolytic enzyme that also functions in transcriptional regulation, oxidative stress, vesicular trafficking, and apoptosis. Because GAPDH is required for cellular heme insertion into inducible nitric oxide synthase (Chakravarti et al, PNAS 2010, 107(42):18004-9), we extensively characterized the heme binding properties of GAPDH. Substoichiometric amounts of ferric heme bound to GAPDH (1 heme per GAPDH tetramer) to form a low-spin complex with UV-visible maxima at 362, 418 and 537 nm, and when reduced to ferrous gave maxima at 424, 527 and 559 nm. Ferric heme association and dissociation rate constants at 10 °C were kon =17,800 M−1s−1 and koff1 = 7.0 × 10−3 s−1; koff2 = 3.3 × 10−4 s−1 respectively, giving approximate affinities of 19–390 nM. Ferrous heme bound more poorly to GAPDH and dissociated with a koff = 4.2 × 10−3 s−1. Magnetic circular dichroism (MCD), resonance Raman (rR) and EPR spectroscopic data on the ferric, ferrous, and ferrous-CO complexes of GAPDH showed that the heme is bis-ligated with His as the proximal ligand. The distal ligand in ferric complex was not displaced by CN− or N3− but in ferrous complex was displaceable by CO at a rate of 1.75 s−1 (for [CO]>0.2 mM). Studies with heme analogs revealed selectivity toward the coordinating metal and porphyrin ring structure. GAPDH-heme was isolated from bacteria induced to express rabbit GAPDH in the presence of δ-amino levulinic acid. Our finding of heme binding to GAPDH expands the protein’s potential roles. The strength, selectivity, reversibility, and redox sensitivity of heme binding to GAPDH is consistent with it performing heme sensing or heme chaperone-like functions in cells. PMID:22957700
Kishimoto, Naoki; Onitsuka-Kishimoto, Ayano; Iga, Nozomi; Takamune, Nobutoki; Shoji, Shozo; Misumi, Shogo
2016-12-01
Human immunodeficiency virus type-1 (HIV-1) requires the packaging of human tRNA Lys3 as a primer for effective viral reverse transcription. Previously, we reported that glyceraldehyde 3-phosphate dehydrogenase (GAPDH) suppresses the packaging efficiency of tRNA Lys3 . Although the binding of GAPDH to Pr55 gag is important for the suppression mechanism, it remains unclear which domain of GAPDH is responsible for the interaction with Pr55 gag . In this study, we show that Asp 256 , Lys 260 , Lys 263 and Glu 267 of GAPDH are important for the suppression of tRNA Lys3 packaging. Yeast two-hybrid analysis demonstrated that the C -terminal domain of GAPDH (151-335) interacts with both the matrix region (MA; 1-132) and capsid N -terminal domain (CA-NTD; 133-282). The D256R, K263E or E267R mutation of GAPDH led to the loss of the ability to bind to wild-type (WT) MA, and the D256R/K260E double mutation of GAPDH resulted in the loss of detectable binding activity to WT CA-NTD. In contrast, R58E, Q59A or Q63A of MA, and E76R or R82E of CA-NTD abrogated the interaction with the C -terminal domain of GAPDH. Multiple-substituted GAPDH mutant (D256R/K260E/K263E/E267R) retained the oligomeric formation with WT GAPDH in HIV-1 producing cells, but the incorporation level of the hetero-oligomer was decreased in viral particles. Furthermore, the viruses produced from cells expressing the D256R/K260E/K263E/E267R mutant restored tRNA Lys3 packaging efficiency because the mutant exerted a dominant negative effect by preventing WT GAPDH from binding to MA and CA-NTD and improved the reverse transcription. These findings indicate that the amino acids Asp 256 , Lys 260 , Lys 263 and Glu 267 of GAPDH is essential for the mechanism of tRNA Lys3 -packaging suppression and the D256R/K260E/K263E/E267R mutant of GAPDH acts in a dominant negative manner to suppress tRNA Lys3 packaging.
Facilitating pictorial comprehension with color highlighting.
McDougald, Brannan R; Wogalter, Michael S
2014-09-01
Pictorials can aid in communicating warning information, but viewers may not always correctly comprehend them. Two experiments focused on whether the use of relevant highlighting could benefit pictorial comprehension. A set of warning-related pictorials were manipulated according to three-color highlighting conditions: highlighting areas more relevant to correct comprehension, highlighting areas less relevant to comprehension, and no highlighting. Participants were asked to describe the purpose and meaning of each pictorial presented to them. The findings from both experiments indicate that comprehension of warning pictorials is higher for the relevant highlighting condition than the other two conditions. The highlighting of less relevant areas reduced comprehension compared to no highlighting. Use of appropriately placed highlighting could benefit the design of a complex symbol by pointing out pertinent areas to aid in determining its intended conceptual meaning. Copyright © 2013 Elsevier Ltd and The Ergonomics Society. All rights reserved.
Emerling, Christopher A
2018-01-01
Carotenoids have important roles in bird behavior, including pigmentation for sexual signaling and improving color vision via retinal oil droplets. Yellow carotenoids are diet-derived, but red carotenoids (ketocarotenoids) are typically synthesized from yellow precursors via a carotenoid ketolase. Recent research on passerines has provided evidence that a cytochrome p450 enzyme, CYP2J19, is responsible for this reaction, though it is unclear if this function is phylogenetically restricted. Here I provide evidence that CYP2J19 is the carotenoid ketolase common to Aves using the genomes of 65 birds and the retinal transcriptomes of 15 avian taxa. CYP2J19 is functionally intact and robustly transcribed in all taxa except for several species adapted to foraging in dim light conditions. Two penguins, an owl and a kiwi show evidence of genetic lesions and relaxed selection in their genomic copy of CYP2J19, and six owls show evidence of marked reduction in CYP2J19 retinal transcription compared to nine diurnal avian taxa. Furthermore, one of the owls appears to transcribe a CYP2J19 pseudogene. Notably, none of these taxa are known to use red carotenoids for sexual signaling and several species of owls and penguins represent the only birds known to completely lack red retinal oil droplets. The remaining avian taxa belong to groups known to possess red oil droplets, are known or expected to deposit red carotenoids in skin and/or plumage, and/or frequently forage in bright light. The loss and reduced expression of CYP2J19 is likely an adaptation to maximize retinal sensitivity, given that oil droplets reduce the amount of light available to the retina. Copyright © 2017 Elsevier Inc. All rights reserved.
Wang, Dunrui; Moothart, Daniel R.; Lowy, Douglas R.; Qian, Xiaolan
2013-01-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is often used as a stable housekeeping marker for constant gene expression. However, the transcriptional levels of GAPDH may be highly up-regulated in some cancers, including non-small cell lung cancers (NSCLC). Using a publically available microarray database, we identified a group of genes whose expression levels in some cancers are highly correlated with GAPDH up-regulation. The majority of the identified genes are cell cycle-dependent (GAPDH Associated Cell Cycle, or GACC). The up-regulation pattern of GAPDH positively associated genes in NSCLC is similar to that observed in cultured fibroblasts grown under conditions that induce anti-senescence. Data analysis demonstrated that up-regulated GAPDH levels are correlated with aberrant gene expression related to both glycolysis and gluconeogenesis pathways. Down-regulation of fructose-1,6-bisphosphatase (FBP1) in gluconeogenesis in conjunction with up-regulation of most glycolytic genes is closely related to high expression of GAPDH in the tumors. The data presented demonstrate that up-regulation of GAPDH positively associated genes is proportional to the malignant stage of various tumors and is associated with an unfavourable prognosis. Thus, this work suggests that GACC genes represent a potential new signature for cancer stage identification and disease prognosis. PMID:23620736
Ganster, Christina; Wernstedt, Annekatrin; Kehrer-Sawatzki, Hildegard; Messiaen, Ludwine; Schmidt, Konrad; Rahner, Nils; Heinimann, Karl; Fonatsch, Christa; Zschocke, Johannes; Wimmer, Katharina
2012-01-01
Sequence exchange between PMS2 and its pseudogene PMS2CL, embedded in an inverted duplication on chromosome 7p22, has been reported to be an ongoing process that leads to functional PMS2 hybrid alleles containing PMS2- and PMS2CL-specific sequence variants at the 5′-and the 3′-end, respectively. The frequency of PMS2 hybrid alleles, their biological significance, and the mechanisms underlying their formation are largely unknown. Here we show that overall hybrid alleles account for one-third of 384 PMS2 alleles analyzed in individuals of different ethnic backgrounds. Depending on the population, 14–60% of hybrid alleles carry PMS2CL-specific sequences in exons 13–15, the remainder only in exon 15. We show that exons 13–15 hybrid alleles, named H1 hybrid alleles, constitute different haplotypes but trace back to a single ancient intrachromosomal recombination event with crossover. Taking advantage of an ancestral sequence variant specific for all H1 alleles we developed a simple gDNA-based polymerase chain reaction (PCR) assay that can be used to identify H1-allele carriers with high sensitivity and specificity (100 and 99%, respectively). Because H1 hybrid alleles harbor missense variant p.N775S of so far unknown functional significance, we assessed the H1-carrier frequency in 164 colorectal cancer patients. So far, we found no indication that the variant plays a major role with regard to cancer susceptibility. PMID:20186689
Yan, Bin; Wubuli, Aikepaer; Liu, Yidong; Wang, Xin
2018-06-01
Osteosarcoma is a common type of human carcinoma, which exhibits a high metastasis and recurrence rate. Previous studies have indicated that long non-coding RNA phosphatase and tensin homolog pseudogene 1 (lnPTENP1) has tumor suppressive action by modulating PTEN expression in different types of tumor cells. However, the potential mechanism by which lnPTENP1 has an effect in osteosarcoma cells remains elusive. In the present study, the role of lnPTENP1 in osteosarcoma cells was investigated and the possible mechanisms by which it functions were explored. It was revealed that lnPTENP1 transfection significantly inhibited osteosarcoma cell growth, proliferation, migration and invasion. LnPTENP1 transfection also significantly promoted apoptosis in Mg63 cells treated with tunicamycin. Further analysis revealed that lnPTENP1 transfection regulated osteosarcoma cell growth via the PI3K/AKT signaling pathway. In vivo assays revealed that lnPTENP1 transfection significantly inhibited osteosarcoma tumor growth and significantly increased the protein expression and phosphorylation levels of PI3K and AKT. In conclusion, the results of the present study indicated that lnPTENP1 may inhibit osteosarcoma cell growth via the PI3K/AKT signaling pathway, which may be a potential novel target for human osteosarcoma therapy.
NASA Technical Reports Server (NTRS)
1978-01-01
General highlights of NASA's activities for 1978 are presented. The highlights are categorized into topics such as space science, space transportation systems, space and terrestrial applications, environment, technology utilization, aeronautics, space research and technology, energy programs, and international. A list of the 1978 launches including: (1) launch date; (2) payload designation; (3) launch vehicle; (4) launch site and (5) mission remarks is also presented.
Heme binding properties of glyceraldehyde-3-phosphate dehydrogenase.
Hannibal, Luciana; Collins, Daniel; Brassard, Julie; Chakravarti, Ritu; Vempati, Rajesh; Dorlet, Pierre; Santolini, Jérôme; Dawson, John H; Stuehr, Dennis J
2012-10-30
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a glycolytic enzyme that also functions in transcriptional regulation, oxidative stress, vesicular trafficking, and apoptosis. Because GAPDH is required for the insertion of cellular heme into inducible nitric oxide synthase [Chakravarti, R., et al. (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 18004-18009], we extensively characterized the heme binding properties of GAPDH. Substoichiometric amounts of ferric heme bound to GAPDH (one heme per GAPDH tetramer) to form a low-spin complex with UV-visible maxima at 362, 418, and 537 nm and when reduced to ferrous gave maxima at 424, 527, and 559 nm. Ferric heme association and dissociation rate constants at 10 °C were as follows: k(on) = 17800 M(-1) s(-1), k(off1) = 7.0 × 10(-3) s(-1), and k(off2) = 3.3 × 10(-4) s(-1) (giving approximate affinities of 19-390 nM). Ferrous heme bound more poorly to GAPDH and dissociated with a k(off) of 4.2 × 10(-3) s(-1). Magnetic circular dichroism, resonance Raman, and electron paramagnetic resonance spectroscopic data on the ferric, ferrous, and ferrous-CO complexes of GAPDH showed that the heme is bis-ligated with His as the proximal ligand. The distal ligand in the ferric complex was not displaced by CN(-) or N(3)(-) but in the ferrous complex could be displaced by CO at a rate of 1.75 s(-1) (for >0.2 mM CO). Studies with heme analogues revealed selectivity toward the coordinating metal and porphyrin ring structure. The GAPDH-heme complex was isolated from bacteria induced to express rabbit GAPDH in the presence of δ-aminolevulinic acid. Our finding of heme binding to GAPDH expands the protein's potential roles. The strength, selectivity, reversibility, and redox sensitivity of heme binding to GAPDH are consistent with it performing heme sensing or heme chaperone-like functions in cells.
Validity of Highlighting on Text Comprehension
NASA Astrophysics Data System (ADS)
So, Joey C. Y.; Chan, Alan H. S.
2009-10-01
In this study, 38 university students were tested with a Chinese reading task on an LED display under different task conditions for determining the effects of the highlighting and its validity on comprehension performance on light-emitting diodes (LED) display for Chinese reading. Four levels of validity (0%, 33%, 67% and 100%) and a control condition with no highlighting were tested. Each subject was required to perform the five experimental conditions in which different passages were read and comprehended. The results showed that the condition with 100% validity of highlighting was found to have better comprehension performance than other validity levels and conditions with no highlighting. The comprehension score of the condition without highlighting effect was comparatively lower than those highlighting conditions with distracters, though not significant.
Chong, Isaac K W; Ho, Wing S
2013-09-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is known to interact with different biomolecules and was implicated in many novel cellular activities including programmed cell death, nuclear RNA transport unrelated to the commonly known carbohydrate metabolism. We reported here the purification of GAPDH from Chironomidae larvae (Insecta, Diptera) that showed different biologic activity towards heavy metals. It was inhibited by copper, cobalt nickel, iron and lead but was activated by zinc. The GAPDH was purified by ammonium sulphate fractionation and Chelating Sepharose CL-6B chromatography followed by Blue Sepharose CL-6B chromatography. The 150-kDa tetrameric GAPDH showed optimal activity at pH 8.5 and 37°C. The multiple alignment of sequence of the Chironomidae GAPDH with other known species showed 78 - 88% identity to the conserved regions of the GADPH. Bioinformatic analysis unveils substantial N-terminal sequence similarity of GAPDH of Chironomidae larvae to mammalian GADPHs. However, the GADPH of Chironomidae larvae showed different biologic activities and cytotoxicity towards heavy metals. The GAPDH enzyme would undergo adaptive molecular changes through binding at the active site leading to higher tolerance to heavy metals.
Research and Development Highlights 1997
DOT National Transportation Integrated Search
1997-01-01
This report contains highlights of the major accomplishments and applications that have been made by Airport and Aircraft Safety researchers and by our university, industry, and government colleagues during the past year. The highlights illustrate bo...
NASA Astrophysics Data System (ADS)
Oddone, P. J.
2010-12-01
DISCUSSION by CHAIRMAN: P.J. ODDONE, Scientific Secretaries: W. Fisher, A. Holzner Note from Publisher: The Slides of the Lecture: "Highlights from Fermilab" can be found at http://www.ccsem.infn.it/issp2007/
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gersuk, V.H.; Rose, T.M.; Todaro, G.J.
The acyl-CoA binding protein (ACBP) and the diazepam binding inhibitor (DBI) or endozepine are independent isolates of a single 86-amino-acid, 10-kDa protein. ACBP/DBI is highly conserved between species and has been identified in several diverse organisms, including human, cow, rat, frog, duck, insects, plants, and yeast. Although the genomic locus has not yet been cloned in humans, complementary DNA clones with different 5{prime} ends have been isolated and characterized. These cDNA clones appear to be encoded by a single gene. However, Southern blot analyses, in situ hybridizations, and somatic cell hybrid chromosomal mapping all suggest that there are multiple ACBP/DBI-relatedmore » sequences in the genome. To identify potential members of this gene family, degenerate oligonucleotides corresponding to highly conserved regions of ACBP/DBI were used to screen a human genomic DNA library using the polymerase chain reaction. A novel gene, DBIP1, that is closely related to ACBP/DBI but is clearly distinct was identified. DBIP1 bears extensive sequence homology to ACBP/DBI but lacks the introns predicted by rat and duck genomic sequence studies. A 1-base deletion in the coding region results in a frameshift and, along with the absence of introns and the lack of a detectable transcript, suggests that DBIP1 is a pseudogene. ACBP/DBI has previously been mapped to chromosome 2, although this was recently disputed, and a chromosome 6 location was suggested. We show that ACBP/DBI is correctly placed on chromosome 2 and that the gene identified on chromosome 6 is DBIP1. 33 refs., 3 figs., 1 tab.« less
Atmospheric Research 2011 Technical Highlights
NASA Technical Reports Server (NTRS)
2012-01-01
The 2011 Technical Highlights describes the efforts of all members of Atmospheric Research. Their dedication to advancing Earth Science through conducting research, developing and running models, designing instruments, managing projects, running field campaigns, and numerous other activities, is highlighted in this report.
Fluorescence Spectra of Highlighter Inks
NASA Astrophysics Data System (ADS)
Birriel, Jennifer J.; King, Damon
2018-01-01
Fluorescence spectra excited by laser pointers have been the subject of several papers in TPT. These papers all describe a fluorescence phenomenon in which the reflected laser light undergoes a change in color: this color change results from the combination of some partially reflected laser light and additional colors generated by fluorescent emission. Here we examine the fluorescence spectra of highlighter inks using green and violet laser pointers. We use an RSpec Explorer spectrometer to obtain spectra and compare the emission spectra of blue, green, yellow, orange, pink, and purple highlighters. The website Compound Interest details the chemical composition of highlighter inks; in addition, the site discusses how some base dye colors can be combined to produce the variety commercially available colors. Spectra obtained in this study were qualitatively consistent with the Compound Interest site. We discuss similarities and differences between various highlighter colors and conclude with the relevance of such studies to physics students.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stern, S. Alan; Ennico, Kimberly; Gladstone, G. Randall
This collection contains two articles, "NASA's New Horizons Mission to Pluto" and the "Diversity of Chemistry and Geologic Processes Observed by the MSL/Chem Cam Laser Instrument in Gale Crater, Mars". These highlights describe how New Horizons came to be, how the spacecraft got to Pluto, and how the findings are challenging our understanding of ice worlds in the outer solar system; and the ChemCam, one of ten instrument packages on board the rover.
Stern, S. Alan; Ennico, Kimberly; Gladstone, G. Randall; ...
2016-04-01
This collection contains two articles, "NASA's New Horizons Mission to Pluto" and the "Diversity of Chemistry and Geologic Processes Observed by the MSL/Chem Cam Laser Instrument in Gale Crater, Mars". These highlights describe how New Horizons came to be, how the spacecraft got to Pluto, and how the findings are challenging our understanding of ice worlds in the outer solar system; and the ChemCam, one of ten instrument packages on board the rover.
Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher
2009-01-01
GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890
Collegiate Athletics Highlights.
ERIC Educational Resources Information Center
St. John, Eric
1999-01-01
Highlights 15 trends/events in black college athletics, including championship coaches, Black Coaches Association, eligibility issues, disclosure of athlete graduation rates, athletics resource allocation, early adoption of professional athlete status, success of the Women's National Basketball Association, lack of black access to certain sports,…
Tsuchiya, Yukihiro; Yamaguchi, Mitsune; Chikuma, Toshiyuki; Hojo, Hiroshi
2005-06-15
Lipid peroxidation products such as 4-hydroxy-2-nonenal (HNE) may be responsible for various pathophysiological events under oxidative stress, since they injure cellular components such as proteins and DNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is a key enzyme of glycolysis and has been reported to be a multifunctional enzyme, is one of the enzymes inhibited by HNE. Previous studies showed that GAPDH is degraded when incubated with acetylleucine chloromethyl ketone (ALCK), resulting in the liberation of a 23-kDa fragment. In this study, we examined whether GAPDH incubated with HNE or other aldehydes of lipid peroxidation products are degraded similarly to that with ALCK. The U937 cell extract was incubated with these aldehydes at 37 degrees C and analyzed by Western blotting using anti-GAPDH antibodies. Incubation with HNE or 4-hydroxy-2-hexenal (HHE) decreased GAPDH activity and GAPDH protein level, and increased the 23-kDa fragment, in time- and dose-dependent manners, but that with other aldehydes did not. Gel filtration using the Superose 6 showed that the GAPDH-degrading activity was eluted in higher molecular fractions than proteasome activity. The enzyme activity was detected at the basic range of pH and inhibited by serine protease inhibitors, diisopropyl fluorophosphate and phenylmethylsulfonyl fluoride, but not by other protease inhibitors including a proteasome inhibitor, MG-132, and a tripeptidyl peptidase II (TPP II) inhibitor, AAF-CMK. These results suggest that GAPDH modified by HNE and HHE is degraded by a giant serine protease, releasing the 23-kDa fragment, not by proteasome or TPP II.
Editorial highlighting and highly cited papers
NASA Astrophysics Data System (ADS)
Antonoyiannakis, Manolis
Editorial highlighting-the process whereby journal editors select, at the time of publication, a small subset of papers that are ostensibly of higher quality, importance or interest-is by now a widespread practice among major scientific journal publishers. Depending on the venue, and the extent to which editorial resources are invested in the process, highlighted papers appear as News & Views, Research Highlights, Perspectives, Editors' Choice, IOP Select, Editors' Summary, Spotlight on Optics, Editors' Picks, Viewpoints, Synopses, Editors' Suggestions, etc. Here, we look at the relation between highlighted papers and highly influential papers, which we define at two levels: having received enough citations to be among the (i) top few percent of their journal, and (ii) top 1% of all physics papers. Using multiple linear regression and multilevel regression modeling we examine the parameters associated with highly influential papers. We briefly comment on cause and effect relationships between citedness and highlighting of papers.
Wang, Kaicheng; Lu, Chengping
2007-01-01
A total of 36 streptococcal strains, including seven S. equi ssp.zooepidemicus, two S. suis type 1 (SS1), 24 SS2, two SS9, and one SS7, were tested for glyceraldehyde-3-phosphate dehydrogenase gene (gapdh). Except from non-virulent SS2 strain T1 5, all strains harboured gapdh. The gapdh of Chinese Sichuan SS2 isolate ZY05719 and Jiangsu SS2 isolate HA9801 were sequenced and then compared with published sequences in the GenBank. The comparison revealed a 99.9 % and 99.8 % similarity of ZY05719 and HA9801, respectively, with the published sequence. Adherence assay data demonstrated a significant ((p<0.05)) reduction in adhesion of SS2 in HEp-2 cells pre-incubated with purified GAPDH compared to non pre-incubated controls, suggesting the GAPDH mediates SS2 bacterial adhesion to host cells.
Using Highlighting to Train Attentional Expertise
Roads, Brett; Mozer, Michael C.; Busey, Thomas A.
2016-01-01
Acquiring expertise in complex visual tasks is time consuming. To facilitate the efficient training of novices on where to look in these tasks, we propose an attentional highlighting paradigm. Highlighting involves dynamically modulating the saliency of a visual image to guide attention along the fixation path of a domain expert who had previously viewed the same image. In Experiment 1, we trained naive subjects via attentional highlighting on a fingerprint-matching task. Before and after training, we asked subjects to freely inspect images containing pairs of prints and determine whether the prints matched. Fixation sequences were automatically scored for the degree of expertise exhibited using a Bayesian discriminative model of novice and expert gaze behavior. Highlighted training causes gaze behavior to become more expert-like not only on the trained images but also on transfer images, indicating generalization of learning. In Experiment 2, to control for the possibility that the increase in expertise is due to mere exposure, we trained subjects via highlighting of fixation sequences from novices, not experts, and observed no transition toward expertise. In Experiment 3, to determine the specificity of the training effect, we trained subjects with expert fixation sequences from images other than the one being viewed, which preserves coarse-scale statistics of expert gaze but provides no information about fine-grain features. Observing at least a partial transition toward expertise, we obtain only weak evidence that the highlighting procedure facilitates the learning of critical local features. We discuss possible improvements to the highlighting procedure. PMID:26744839
Using Highlighting to Train Attentional Expertise.
Roads, Brett; Mozer, Michael C; Busey, Thomas A
2016-01-01
Acquiring expertise in complex visual tasks is time consuming. To facilitate the efficient training of novices on where to look in these tasks, we propose an attentional highlighting paradigm. Highlighting involves dynamically modulating the saliency of a visual image to guide attention along the fixation path of a domain expert who had previously viewed the same image. In Experiment 1, we trained naive subjects via attentional highlighting on a fingerprint-matching task. Before and after training, we asked subjects to freely inspect images containing pairs of prints and determine whether the prints matched. Fixation sequences were automatically scored for the degree of expertise exhibited using a Bayesian discriminative model of novice and expert gaze behavior. Highlighted training causes gaze behavior to become more expert-like not only on the trained images but also on transfer images, indicating generalization of learning. In Experiment 2, to control for the possibility that the increase in expertise is due to mere exposure, we trained subjects via highlighting of fixation sequences from novices, not experts, and observed no transition toward expertise. In Experiment 3, to determine the specificity of the training effect, we trained subjects with expert fixation sequences from images other than the one being viewed, which preserves coarse-scale statistics of expert gaze but provides no information about fine-grain features. Observing at least a partial transition toward expertise, we obtain only weak evidence that the highlighting procedure facilitates the learning of critical local features. We discuss possible improvements to the highlighting procedure.
NASA Technical Reports Server (NTRS)
1998-01-01
Langley's mission is accomplished by performing innovative research relevant to national needs and Agency goals, transferring technology to users in a timely manner, and providing development support to other United States Government Agencies, industry, other NASA Centers, the educational community, and the local community. This report contains highlights of some of the major accomplishments and applications that have been made by Langley researchers and by our university and industry colleagues during the past year. The highlights illustrate the broad range of research and technology activities carried out by NASA Langley Research Center and the contributions of this work toward maintaining United States' leadership in aeronautics and space research.
NASA Technical Reports Server (NTRS)
1999-01-01
Langley's mission is accomplished by performing innovative research relevant to national needs and Agency goals, transferring technology to users in a timely manner, and providing development support to other United States Government Agencies, industry, other NASA Centers, the educational community, and the local community. This report contains highlights of some of the major accomplishments and applications that have been made by Langley researchers and by our university and industry colleagues during the past year. The highlights illustrate the broad range of research and technology activities carried out by NASA Langley Research Center and the contributions of this work toward maintaining United States' leadership in aeronautics and space research. A color electronic version of this report is available at URL http://larcpubs.larc.nasa.gov/randt/1998/.
Research and technology highlights, 1993
NASA Technical Reports Server (NTRS)
1994-01-01
This report contains highlights of the major accomplishments and applications that have been made by Langley researchers and by our university and industry colleagues during the past year. The highlights illustrate both the broad range of the research and technology activities supported by NASA Langley Research Center and the contributions of this work toward maintaining United States leadership in aeronautics and space research. This report also describes some of the Center's most important research and testing facilities.
Difference between highlight and object colors enhances glossiness.
Hanada, Mitsuhiko
2012-06-01
The effect of highlight and object colors on perception of glossiness was examined. Ten participants rated glossiness of object images. The color coordinates of objects and highlights were varied while luminance of each pixel was unchanged. Four colors were used for objects and highlights. Objects were perceived as glossier when the highlight color was different from the object color than when they were the same. Objects with some unnatural combinations of highlight and object colors were perceived to be as glossy as those with natural color combinations. The results suggested that differences between highlight and object colors enhance perceived glossiness and that perceived glossiness does not depend on naturalness of color combination for highlights and objects.
None
2018-01-16
Highlights the research NETL is doing in the following fields: Clean Coal, Gasification, Carbon Sequestration, and Hydrogen. This video was featured in the lobby of the Forrestal building in Washington, D.C.
Laboratory for Atmospheres: 2006 Technical Highlights
NASA Technical Reports Server (NTRS)
Stewart, Richard W.
2007-01-01
The 2006 Technical Highlights describes the efforts of all members of the Laboratory for Atmospheres. Their dedication to advancing Earth science through conducting research, developing and running models, designing instruments, managing projects, running field campaigns, and numerous other activities, are highlighted in this report.
Laboratory for Atmospheres 2009 Technical Highlights
NASA Technical Reports Server (NTRS)
Cote, Charles E.
2010-01-01
The 2009 Technical Highlights describes the efforts of all members of the Laboratory for Atmospheres. Their dedication to advancing Earth Science through conducting research, developing and running models, designing instruments, managing projects, running field campaigns, and numerous other activities, is highlighted in this report.
Laboratory for Atmospheres 2005 Technical Highlights
NASA Technical Reports Server (NTRS)
2006-01-01
The 2005 Technical highlights describes the efforts of all members of the Laboratory for Atmospheres. Their dedication to advancing Earth Science through conducting research, developing and running models, designing instruments, managing projects, running field campaigns, and numerous other activities, is highlighted in this report.
Laboratory for Atmospheres 2010 Technical Highlights
NASA Technical Reports Server (NTRS)
2011-01-01
The 2010 Technical Highlights describes the efforts of all members of the Laboratory for Atmospheres. Their dedication to advancing Earth Science through conducting research, developing and running models, designing instruments, managing projects, running field campaigns, and numerous other activities, is highlighted in this report.
Laboratory for Atmospheres 2007 Technical Highlights
NASA Technical Reports Server (NTRS)
Stewart, Richard W.
2008-01-01
The 2007 Technical Highlights describes the efforts of all members of the Laboratory for Atmospheres. Their dedication to advancing Earth Science through conducting research, developing and running models, designing instruments, managing projects, running field campaigns, and numerous other activities, is highlighted in this report.
Long, Chandler A.; Boloum, Valy; Albadawi, Hassan; Tsai, Shirling; Yoo, Hyung-Jin; Oklu, Rahmi; Goldman, Mitchell H.; Watkins, Michael T.
2013-01-01
Introduction Diabetes is known to increase poly-ADP-ribose-polymerase (PARP) activity and posttranslational poly-ADP-ribosylation of several regulatory proteins involved in inflammation and energy metabolism. These experiments test the hypothesis that PARP inhibition will modulate hind limb ischemia reperfusion (IR) in a mouse model of type-II diabetes; ameliorate the ribosylation and the activity/transnuclear localization of the key glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Methods db/db mice underwent 1.5hrs of hind limb ischemia followed by 1, 7, or 24hrs reperfusion. The treatment group received the PARP inhibitor PJ34 (PJ34) over a 24hrs period; the untreated group received Lactated ringer’s (LR) at the same time points. IR muscles were analyzed for indices of PARP activity, fiber injury, metabolic activity, inflammation, GAPDH activity /intracellular localization and poly-ADP-ribosylation of GAPDH. Results PARP activity was significantly lower in the PJ34 treated groups compared to the LR group at 7 and 24 hours reperfusion. There was significantly less muscle fiber injury in the PJ34 treated group compared to LR treated mice at 24 hrs reperfusion. PJ34 lowered levels of select proinflammatory molecules at 7hrs and 24hrs IR. There were significant increases in metabolic activity only at 24 hours IR in the PJ34 group, which temporally correlated with increase in GAPDH activity, decreased GAPDH poly ADP-ribosylation and nuclear translocation of GAPDH. Conclusions PJ34 reduced PARP activity, GAPDH ribosylation, GAPDH translocation, ameliorated muscle fiber injury, and increased metabolic activity following hind limb IR injury in a murine model of type-II diabetes. PARP inhibition might be a therapeutic strategy following IR in diabetic humans. PMID:23549425
NASA Technical Reports Server (NTRS)
1982-01-01
Significant aircraft tests which were performed are highlighted. The broad range of the research and technology activities. The conributions of this work toward maintaining United States leadership in aeronautics and space research are illustrated.
Liu, Tengfei; Fang, Hui; Liu, Jun; Reid, Stephen; Hou, Juan; Zhou, Tingting; Tian, Zhendong; Song, Botao; Xie, Conghua
2017-12-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is an important enzyme that functions in producing energy and supplying intermediates for cellular metabolism. Recent researches indicate that GAPDHs have multiple functions beside glycolysis. However, little information is available for functions of GAPDHs in potato. Here, we identified 4 putative cytosolic GAPDH genes in potato genome and demonstrated that the StGAPC1, StGAPC2, and StGAPC3, which are constitutively expressed in potato tissues and cold inducible in tubers, encode active cytosolic GAPDHs. Cosuppression of these 3 GAPC genes resulted in low tuber GAPDH activity, consequently the accumulation of reducing sugars in cold stored tubers by altering the tuber metabolite pool sizes favoring the sucrose pathway. Furthermore, GAPCs-silenced tubers exhibited a loss of apical dominance dependent on cell death of tuber apical bud meristem (TAB-meristem). It was also confirmed that StGAPC1, StGAPC2, and StGAPC3 interacted with the autophagy-related protein 3 (ATG3), implying that the occurrence of cell death in TAB-meristem could be induced by ATG3 associated events. Collectively, the present research evidences first that the GAPC genes play crucial roles in diverse physiological and developmental processes in potato tubers. © 2017 John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nagao, Yoshiro; Sly, W.S.; Batanian, J.R.
1995-08-10
Carbonic anhydrase V (CA V) is expressed in mitochondrial matrix in liver and several other tissues. It is of interest for its putative roles in providing bicarbonate to carbamoyl phosphate synthetase for ureagenesis and to pyruvate carboxylase for gluconeogenesis and its possible importance in explaining certain inherited metabolic disorders with hyperammonemia and hypoglycemia. Following the recent characterization of the cDNA for human CA V, we report the isolation of the human gene from two {lambda} genomic libraries and its characterization. The CA V gene (CA5) is approximately 50 kb long and contains 7 exons and 6 introns. The exon-intron boundariesmore » are found in positions identical to those determined for the previously described CA II, CA III, and CA VII genes. Like the CA VII gene, CA5 does not contain typical TATA and CAAT promoter elements in the 5{prime} flanking region but does contain a TTTAA sequence 147 nucleotides upstream of the initiation codon. CA5 also contains a 12-bp GT-rich segment beginning 13 bp downstream of the polyadenylation signal in the 3{prime} untranslated region of exon 7. FISH analysis allowed CA5 to be assigned to chromosome 16q24.3. An unprocessed pseudogene containing sequence homologous to exons 3-7 and introns 3-6 was also isolated and was assigned by FISH analysis to chromosome 16p11.2-p12. 22 refs., 4 figs., 1 tab.« less
Highlighting our Tiniest Neighbors
2012-06-08
This image shows our own back yard, astronomically speaking, from a vantage point about 30 light-years away from the sun. It highlights the population of tiny brown dwarfs recently discovered by NASA WISE. The image simulates actual positions of stars.
NASA Technical Reports Server (NTRS)
Fitzpatrick, M.
1976-01-01
Highlights of NASA's 1976 activities are summarized. Sixteen successful launches were made. Two landings of Viking spacecraft on Mars and rollout of the space shuttle orbiter are reviewed. Applications of aerospace science to education, health care, and community services are also discussed.
2016-01-01
CYTIDINE DEAMINASE (CDA) catalyzes the deamination of cytidine to uridine and ammonia in the catabolic route of C nucleotides. The Arabidopsis (Arabidopsis thaliana) CDA gene family comprises nine members, one of which (AtCDA) was shown previously in vitro to encode an active CDA. A possible role in C-to-U RNA editing or in antiviral defense has been discussed for other members. A comprehensive bioinformatic analysis of plant CDA sequences, combined with biochemical functionality tests, strongly suggests that all Arabidopsis CDA family members except AtCDA are pseudogenes and that most plants only require a single CDA gene. Soybean (Glycine max) possesses three CDA genes, but only two encode functional enzymes and just one has very high catalytic efficiency. AtCDA and soybean CDAs are located in the cytosol. The functionality of AtCDA in vivo was demonstrated with loss-of-function mutants accumulating high amounts of cytidine but also CMP, cytosine, and some uridine in seeds. Cytidine hydrolysis in cda mutants is likely caused by NUCLEOSIDE HYDROLASE1 (NSH1) because cytosine accumulation is strongly reduced in a cda nsh1 double mutant. Altered responses of the cda mutants to fluorocytidine and fluorouridine indicate that a dual specific nucleoside kinase is involved in cytidine as well as uridine salvage. CDA mutants display a reduction in rosette size and have fewer leaves compared with the wild type, which is probably not caused by defective pyrimidine catabolism but by the accumulation of pyrimidine catabolism intermediates reaching toxic concentrations. PMID:27208239
DOE Office of Scientific and Technical Information (OSTI.GOV)
Monaco, L.; Murtagh, J.J.; Newman, K.B.
1990-03-01
ADP-ribosylation factors (ARFs) are {approx}20-kDa proteins that act as GTP-dependent allosteric activators of cholera toxin. With deoxyinosine-containing degenerate oligonucleotide primers corresponding to conserved GTP-binding domains in ARFs, the polymerase chain reaction (PCR) was used to amplify simultaneously from human DNA portions of three ARF genes that include codons for 102 amino acids, with intervening sequences. Amplification products that differed in size because of differences in intron sizes were separated by agarose gel electrophoresis. One amplified DNA contained no introns and had a sequence different from those of known AFRs. Based on this sequence, selective oligonucleotide probes were prepared and usedmore » to isolate clone {Psi}ARF 4, a putative ARF pseudogene, from a human genomic library in {lambda} phage EMBL3. Reverse transcription-PCR was then used to clone from human poly(A){sup +} RNA the cDNA corresponding to the expressed homolog of {Psi}ARF 4, referred to as human ARF 4. It appears that {Psi}ARF 4 arose during human evolution by integration of processed ARF 4 mRNA into the genome. Human ARF 4 differs from previously identified mammalian ARFs 1, 2, and 3. Hybridization of ARF 4-specific oligonucleotide probes with human, bovine, and rat RNA revealed a single 1.8-kilobase mRNA, which was clearly distinguished from the 1.9-kilobase mRNA for ARF 1 in these tissues. The PCR provides a powerful tool for investigating diversity in this and other multigene families, especially with primers targeted at domains believed to have functional significance.« less
Rhinn, Hervé; Marchand-Leroux, Catherine; Croci, Nicole; Plotkine, Michel; Scherman, Daniel; Escriou, Virginie
2008-01-01
Background Traumatic brain injury models are widely studied, especially through gene expression, either to further understand implied biological mechanisms or to assess the efficiency of potential therapies. A large number of biological pathways are affected in brain trauma models, whose elucidation might greatly benefit from transcriptomic studies. However the suitability of reference genes needed for quantitative RT-PCR experiments is missing for these models. Results We have compared five potential reference genes as well as total cDNA level monitored using Oligreen reagent in order to determine the best normalizing factors for quantitative RT-PCR expression studies in the early phase (0–48 h post-trauma (PT)) of a murine model of diffuse brain injury. The levels of 18S rRNA, and of transcripts of β-actin, glyceraldehyde-3P-dehydrogenase (GAPDH), β-microtubulin and S100β were determined in the injured brain region of traumatized mice sacrificed at 30 min, 3 h, 6 h, 12 h, 24 h and 48 h post-trauma. The stability of the reference genes candidates and of total cDNA was evaluated by three different methods, leading to the following rankings as normalization factors, from the most suitable to the less: by using geNorm VBA applet, we obtained the following sequence: cDNA(Oligreen); GAPDH > 18S rRNA > S100β > β-microtubulin > β-actin; by using NormFinder Excel Spreadsheet, we obtained the following sequence: GAPDH > cDNA(Oligreen) > S100β > 18S rRNA > β-actin > β-microtubulin; by using a Confidence-Interval calculation, we obtained the following sequence: cDNA(Oligreen) > 18S rRNA; GAPDH > S100β > β-microtubulin > β-actin. Conclusion This work suggests that Oligreen cDNA measurements, 18S rRNA and GAPDH or a combination of them may be used to efficiently normalize qRT-PCR gene expression in mouse brain trauma injury, and that β-actin and β-microtubulin should be avoided. The potential of total cDNA as measured by Oligreen as a first
Manipulation and Biological Applications of Gold Nanorods
NASA Astrophysics Data System (ADS)
Rostro-Kohanloo, Betty Catalina
This thesis compared anionic polyelectrolyte wrapping stabilization with poly(sodium 4-stryene-sulfonate), (PSS), polyelectrolyte and methoxy (polyethylene glycol)-thiol (mPEG(5000)-SH) strategies. From this data the critical gold nanorod (GNR) and cetyl-trimethylammonium bromide (CTAB) concentration ratio needed for GNR stabilization was determined using optical and chemical extraction methods. This was followed by functionalization with a heterobifunctional Polyethylene glycol (PEG) linker, such as a-thio-w-carboxy poly(ethylene glycol) termed t-PEG-c and carbodiimide chemistries for antibody linkage with Immunoglobulin G (IgG), and epidermal growth factor receptor (EGFR) based Human Epidermal growth factor Receptor 2 (Her2), and Cetuximab (C225) antibodies, for in vitro cancer cell targeting. Confocal, two-photon luminescence (TPL), and dark scattering microscopy, and fluorescence, zeta potential, and Nanoparticle Enzyme-linked immunosorbent assay (ELISA) were used to monitor changes to the GNR surface. An untreatable form of bladder cancer was then studied using the t-GNR-PEG-c-Ab bioconjugates with C225 antibody, which housed a glyceraldehyde-3-phosphate (GAPDH), Fluorescein isothiocyanate (FITC) labeled siRNA, termed GAPDH-siRNA-FITC, which was included within a Luciferase based plasmid. A salt based electrostatic heating method was used to trap the GAPDH-siRNA-FITC from the PEG layer by activating the PEG polymer pour point, while a laser based heating system was used for in vitro release inside cancer cells. The down regulation of the GAPDH gene was targeted by the siRNA. as GAPDH has been shown to be up-regulated in many cancers and down-regulated by chemotherapeutic drugs. Cell culture, and subsequent imaging by transmission electron microscopy (TEM), TPL and confocal microscopy were used to view the internalized conjugates, and reverse transcriptase polymerase chain reaction (RT-PCR) were used to determine if the release of the GAPDH-siRNA caused a
Research and Technology Highlights 1995
NASA Technical Reports Server (NTRS)
1996-01-01
The mission of the NASA Langley Research Center is to increase the knowledge and capability of the United States in a full range of aeronautics disciplines and in selected space disciplines. This mission is accomplished by performing innovative research relevant to national needs and Agency goals, transferring technology to users in a timely manner, and providing development support to other United States Government agencies, industry, other NASA Centers, the educational community, and the local community. This report contains highlights of the major accomplishments and applications that have been made by Langley researchers and by our university and industry colleagues during the past year. The highlights illustrate both the broad range of research and technology (R&T) activities carried out by NASA Langley Research Center and the contributions of this work toward maintaining United States leadership in aeronautics and space research. An electronic version of the report is available at URL http://techreports.larc.nasa.gov/RandT95. This color version allows viewing, retrieving, and printing of the highlights, searching and browsing through the sections, and access to an on-line directory of Langley researchers.
Fokina, K V; Yazykova, M Y; Danshina, P V; Schmalhausen, E V; Muronetz, V I
2000-04-01
Data are presented concerning the possible participation of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in regulation of the glycolytic pathway and the level of 2,3-diphosphoglycerate in erythrocytes. Experimental support has been obtained for the hypothesis according to which a mild oxidation of GAPDH must result in acceleration of glycolysis and in decrease in the level of 2, 3-diphosphoglycerate due to the acyl phosphatase activity of the mildly oxidized enzyme. Incubation of erythrocytes in the presence of 1 mM hydrogen peroxide decreases 2,3-diphosphoglycerate concentration and causes accumulation of 3-phosphoglycerate. It is assumed that the acceleration of glycolysis in the presence of oxidative agents described previously by a number of authors could be attributed to the acyl phosphatase activity of GAPDH. A pH-dependent complexing of GAPDH and 3-phosphoglycerate kinase or 2, 3-diphosphoglycerate mutase is found to determine the fate of 1,3-diphosphoglycerate that serves as a substrate for the synthesis of 2,3-diphosphoglycerate as well as for the 3-phosphoglycerate kinase reaction in glycolysis. A withdrawal of the two-enzyme complexes from the erythrocyte lysates using Sepharose-bound anti-GAPDH antibodies prevents the pH-dependent accumulation of the metabolites. The role of GAPDH in the regulation of glycolysis and the level of 2,3-diphosphoglycerate in erythrocytes is discussed.
Molecular analysis of the glucocerebrosidase gene locus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Winfield, S.L.; Martin, B.M.; Fandino, A.
1994-09-01
Gaucher disease is due to a deficiency in the activity of the lysosomal enzyme glucocerebrosidase. Both the functional gene for this enzyme and a pseudogene are located in close proximity on chromosome 1q21. Analysis of the mutations present in patient samples has suggested interaction between the functional gene and the pseudogene in the origin of mutant genotypes. To investigate the involvement of regions flanking the functional gene and pseudogene in the origin of mutations found in Gaucher disease, a YAC clone containing DNA from this locus has been subcloned and characterized. The original YAC containing {approximately}360 kb was truncated withmore » the use of fragmentation plasmids to about 85 kb. A lambda library derived from this YAC was screened to obtain clones containing glucocerebrosidase sequences. PCR amplification was used to identify subclones containing 5{prime}, central, or 3{prime} sequences of the functional gene or of the pseudogene. Clones spanning the entire distance from the last exon of the functional gene to intron 1 of the pseudogene, the 5{prime} end of the functional gene and 16 kb of 5{prime} flanking region and approximately 15 kb of 3{prime} flanking region of the pseudogene were sequenced. Sequence data from 48 kb of intergenic and flanking regions of the glucocerebrosidase gene and its pseudogene has been generated. A large number of Alu sequences and several simple repeats have been found. Two of these repeats exhibit fragment length polymorphism. There is almost 100% homology between the 3{prime} flanking regions of the functional gene and the pseudogene, extending to about 4 kb past the termination codons. A much lower degree of homology is observed in the 5{prime} flanking region. Patient samples are currently being screened for polymorphisms in these flanking regions.« less
NASA Technical Reports Server (NTRS)
1981-01-01
The highlights of NASA's 1981 activities are presented, including the results of the two flights of the space shuttle Columbia and the Voyager 2 encounter with Saturn. Accomplishments in the areas of space transportation operations; space science; aeronautical, energy, and space research and development; as well as space tracking, international activities, and 1981 launch activities are discussed.
Langley aerospace test highlights, 1985
NASA Technical Reports Server (NTRS)
1986-01-01
The role of the Langley Research Center is to perform basic and applied research necessary for the advancement of aeronautics and space flight, to generate new and advanced concepts for the accomplishment of related national goals, and to provide research advice, technological support, and assistance to other NASA installations, other government agencies, and industry. Significant tests which were performed during calendar year 1985 in Langley test facilities, are highlighted. Both the broad range of the research and technology activities at the Langley Research Center and the contributions of this work toward maintaining United States leadership in aeronautics and space research, are illustrated. Other highlights of Langley research and technology for 1985 are described in Research and Technology-1985 Annual Report of the Langley Research Center.
McKenzie, S; Doe, W; Buffinton, G
1999-01-01
Background—Reactive oxygen and nitrogen derived species produced by activated neutrophils have been implicated in the damage of mucosal proteins including the inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the active inflammatory lesion in patients with inflammatory bowel disease (IBD). This study investigated the efficacy of currently used IBD therapeutics to prevent injury mediated by reactive oxygen and nitrogen derived species. Methods—GAPDH activity of human colon epithelial cells was used as a sensitive indicator of injury produced by reactive oxygen and nitrogen derived species. HCT116 cells (106/ml phosphate buffered saline; 37°C) were incubated in the presence of 5-aminosalicylic acid (5-ASA), 6-mercaptopurine, methylprednisolone, or metronidazole before exposure to H2O2, HOCl, or NO in vitro. HCT116 cell GAPDH enzyme activity was determined by standard procedures. Cell free reactions between 5-ASA and HOCl were analysed by spectrophotometry and fluorimetry to characterise the mechanism of oxidant scavenging. Results—GAPDH activity of HCT116 cells was inhibited by the oxidants tested: the concentration that produced 50% inhibition (IC50) was 44.5 (2.1) µM for HOCl, 379.8 (21.3) µM for H2O2, and 685.8 (103.8) µM for NO (means (SEM)). 5-ASA was the only therapeutic compound tested to show efficacy (p<0.05) against HOCl mediated inhibition of enzyme activity; however, it was ineffective against H2O2 and NO mediated inhibition of GAPDH. Methylprednisolone, metronidazole, and the thiol-containing 6-mercaptopurine were ineffective against all oxidants. Studies at ratios of HOCl:5-ASA achievable in the mucosa showed direct scavenging to be the mechanism of protection of GAPDH activity. Mixing 5-ASA and HOCl before addition to the cells resulted in significantly greater protection of GAPDH activity than when HOCl was added to cells preincubated with 5-ASA. The addition of 5-ASA after HOCl exposure did not restore GAPDH activity
NASA Technical Reports Server (NTRS)
1990-01-01
Highlights of NASA research from 1986 to 1988 are discussed. Topics covered include Space Shuttle flights, understanding the Universe and its origins, understanding the Earth and its environment, air and space transportation, using space to make America more competitive, using space technology an Earth, strengthening America's education in science and technology, the space station, and human exploration of the solar system.
Role of SRC-3delta4 in the Progression and Metastasis of Castration-Resistant Prostate Cancer
2013-10-01
Expression of SRC-3∆4, GAPDH, and AR target genes including PSA, KLK2, IGFBP5, Cyclin A2, and UBE2C was determined by RT-qPCR analysis . Data are...Expression of AR (B), GAPDH, and TMPRSS2- ERG (C) was determined by RT-qPCR analysis . Data are presented using the comparative Ct method, in which GAPDH...input. An irrelevant region (1800 bp downstream of transcription start site) was served as a negative control. (E) and (F). ChIP analysis of SRC-3∆4’s
Langley aerospace test highlights, 1989
NASA Technical Reports Server (NTRS)
1990-01-01
The role of the NASA Langley Research Center is to perform basic and applied research necessary for the advancement of aeronautics and spaceflight, to generate new and advanced concepts for the accomplishment of related national goals, and to provide research advice, technological support, and assistance to other NASA installations, other government agencies, and industry. Some of the significant tests that were performed during calendar year 1989 in the NASA Langley Research Center test facilities are highlighted. Both the broad range of the research and technology activities at the NASA Langley Research Center are illustrated along with the contributions of this work toward maintaining United States leadership in aeronautics and space research. Other highlights of Langley research and technology for 1989 are described in Research and Technology 1989 - Langley Research Center.
Langley aerospace test highlights, 1990
NASA Technical Reports Server (NTRS)
1991-01-01
The role of NASA-Langley is to perform basic and applied research necessary for the advancement of aeronautics and spaceflight, to generate new and advanced concepts for the accomplishment of related national goals, and to provide research advice, technological support, and assistance to other NASA installations, other government agencies, and industry. Some of the significant tests are highlighted which were performed during 1990 in the NASA-Langley test facilities, a number of which are unique in the world. Both the broad range of the research and technology activities at NASA-Langley and the contributions of this work toward maintaining U.S. leadership in aeronautics and space research are illustrated. Other highlights of Langley research and technology for 1990 are described in Research and Technology 1990 Langley Research Center.
Active Reading Procedures for Moderating the Effects of Poor Highlighting
ERIC Educational Resources Information Center
Gier, Vicki S.; Herring, Daniel; Hudnell, Jason; Montoya, Jodi; Kreiner, David S.
2010-01-01
We investigated two active reading techniques intended to eliminate the negative effect on reading comprehension of preexisting, inappropriate highlighting. College students read passages in three highlighting conditions: no highlighting, appropriate highlighting, and inappropriate highlighting. In Experiment 1, 30 students read the passages while…
2000 Digital Avionics Highlights
NASA Technical Reports Server (NTRS)
Polites, Michael E.
2000-01-01
This article summarizes the highlights of recent events and developments in digital avionics in commercial aviation, military systems, and space. This article is about 1,200 words long. Information for the article was collected from other NASA centers, DoD, and industry. All information was previously cleared by the originating organizations. Information for the article was also gathered from Aviation Week and Space Technology and similar sources.
Children's Environmental Health 2008 Highlights
This report, eighth in an annual series from the Office of Children's Health Protection and Environmental Education, highlights the Agency's recent work on protecting the health of children by addressing the environments where they live, learn and play.
LAMA Preconference and Program Highlights.
ERIC Educational Resources Information Center
Library Administration & Management, 1988
1988-01-01
Highlights events of the Library Administration and Management Association 1988 conference, including presentation of awards and programs on: (1) transfer of training; (2) hiring; (3) mentoring; (4) acquisitions automation; (5) library building consultation; and (6) managing shared systems. (MES)
Highlighting impact: Do editors' selections identify influential papers?
NASA Astrophysics Data System (ADS)
Antonoyiannakis, Manolis
A recent trend in scientific publishing is that journal editors highlight each week a select set among the papers published (usually) in their respective journals. The highlighted papers are deemed of higher quality, importance, or interest than the 'average' paper and feature prominently in the publishers' websites. We perform a citation analysis of the highlighted papers for a number of journals from various publishers in physics. By comparing the performance of highlighted papers relative to (a) typical papers and (b) highly cited papers in their source journals and in other journals in the field, we explore whether, and to what extent, the selection process at the time of publication identifies papers that will turn out to be influential. We discuss the broader implications for research assessment.
Research highlights: printing the future of microfabrication.
Tseng, Peter; Murray, Coleman; Kim, Donghyuk; Di Carlo, Dino
2014-05-07
In this issue we highlight emerging microfabrication approaches suitable for microfluidic systems with a focus on "additive manufacturing" processes (i.e. printing). In parallel with the now-wider availability of low cost consumer-grade 3D printers (as evidenced by at least three brands of 3D printers for sale in a recent visit to an electronics store in Akihabara, Tokyo), commercial-grade 3D printers are ramping to higher and higher resolution with new capabilities, such as printing of multiple materials of different transparency, and with different mechanical and electrical properties. We highlight new work showing that 3D printing (stereolithography approaches in particular) has now risen as a viable technology to print whole microfluidic devices. Printing on 2D surfaces such as paper is an everyday experience, and has been used widely in analytical chemistry for printing conductive materials on paper strips for glucose and other electrochemical sensors. We highlight recent work using electrodes printed on paper for digital microfluidic droplet actuation. Finally, we highlight recent work in which printing of membrane-bound droplets that interconnect through bilayer membranes may open up an entirely new approach to microfluidic manufacturing of soft devices that mimic physiological systems.
A script to highlight hydrophobicity and charge on protein surfaces
Hagemans, Dominique; van Belzen, Ianthe A. E. M.; Morán Luengo, Tania; Rüdiger, Stefan G. D.
2015-01-01
The composition of protein surfaces determines both affinity and specificity of protein-protein interactions. Matching of hydrophobic contacts and charged groups on both sites of the interface are crucial to ensure specificity. Here, we propose a highlighting scheme, YRB, which highlights both hydrophobicity and charge in protein structures. YRB highlighting visualizes hydrophobicity by highlighting all carbon atoms that are not bound to nitrogen and oxygen atoms. The charged oxygens of glutamate and aspartate are highlighted red and the charged nitrogens of arginine and lysine are highlighted blue. For a set of representative examples, we demonstrate that YRB highlighting intuitively visualizes segments on protein surfaces that contribute to specificity in protein-protein interfaces, including Hsp90/co-chaperone complexes, the SNARE complex and a transmembrane domain. We provide YRB highlighting in form of a script that runs using the software PyMOL. PMID:26528483
Research and technology highlights, 1992
NASA Technical Reports Server (NTRS)
1993-01-01
The mission of the NASA Langley Research Center is to increase the knowledge and capability of the United States in a full range of aeronautics disciplines and in selected space disciplines. This mission will be accomplished by performing innovative research relevant to national needs and Agency goals, transferring technology to users in a timely manner, and providing development support to other United States Government agencies, industry, and other NASA centers. Highlights of the major accomplishments and applications that have been made by Langley researchers and by our university and industry colleagues during the past year are presented. The highlights illustrate both the broad range of research and technology (R&T) activities supported by NASA Langley Research Center and the contributions of this work toward maintaining United States leadership in aeronautics and space research. Some of the Center's most important research and testing facilities are also described.
Cai, Jing; Li, Tao; Huang, Bangxing; Cheng, Henghui; Ding, Hui; Dong, Weihong; Xiao, Man; Liu, Ling; Wang, Zehua
2014-01-01
Quantitative real-time PCR (qPCR) is a powerful and reproducible method of gene expression analysis in which expression levels are quantified by normalization against reference genes. Therefore, to investigate the potential biomarkers and therapeutic targets for epithelial ovarian cancer by qPCR, it is critical to identify stable reference genes. In this study, twelve housekeeping genes (ACTB, GAPDH, 18S rRNA, GUSB, PPIA, PBGD, PUM1, TBP, HRPT1, RPLP0, RPL13A, and B2M) were analyzed in 50 ovarian samples from normal, benign, borderline, and malignant tissues. For reliable results, laser microdissection (LMD), an effective technique used to prepare homogeneous starting material, was utilized to precisely excise target tissues or cells. One-way analysis of variance (ANOVA) and nonparametric (Kruskal-Wallis) tests were used to compare the expression differences. NormFinder and geNorm software were employed to further validate the suitability and stability of the candidate genes. Results showed that epithelial cells occupied a small percentage of the normal ovary indeed. The expression of ACTB, PPIA, RPL13A, RPLP0, and TBP were stable independent of the disease progression. In addition, NormFinder and geNorm identified the most stable combination (ACTB, PPIA, RPLP0, and TBP) and the relatively unstable reference gene GAPDH from the twelve commonly used housekeeping genes. Our results highlight the use of homogeneous ovarian tissues and multiple-reference normalization strategy, e.g. the combination of ACTB, PPIA, RPLP0, and TBP, for qPCR in epithelial ovarian tissues, whereas GAPDH, the most commonly used reference gene, is not recommended, especially as a single reference gene.
Liu, Guangjian; Walter, Lutz; Tang, Suni; Tan, Xinxin; Shi, Fanglei; Pan, Huijuan; Roos, Christian; Liu, Zhijin; Li, Ming
2014-01-01
Umami and sweet tastes are two important basic taste perceptions that allow animals to recognize diets with nutritious carbohydrates and proteins, respectively. Until recently, analyses of umami and sweet taste were performed on various domestic and wild animals. While most of these studies focused on the pseudogenization of taste genes, which occur mostly in carnivores and species with absolute feeding specialization, omnivores and herbivores were more or less neglected. Catarrhine primates are a group of herbivorous animals (feeding mostly on plants) with significant divergence in dietary preference, especially the specialized folivorous Colobinae. Here, we conducted the most comprehensive investigation to date of selection pressure on sweet and umami taste genes (TAS1Rs) in catarrhine primates to test whether specific adaptive evolution occurred during their diversification, in association with particular plant diets. We documented significant relaxation of selective constraints on sweet taste gene TAS1R2 in the ancestral branch of Colobinae, which might correlate with their unique ingestion and digestion of leaves. Additionally, we identified positive selection acting on Cercopithecidae lineages for the umami taste gene TAS1R1, on the Cercopithecinae and extant Colobinae and Hylobatidae lineages for TAS1R2, and on Macaca lineages for TAS1R3. Our research further identified several site mutations in Cercopithecidae, Colobinae and Pygathrix, which were detected by previous studies altering the sensitivity of receptors. The positively selected sites were located mostly on the extra-cellular region of TAS1Rs. Among these positively selected sites, two vital sites for TAS1R1 and four vital sites for TAS1R2 in extra-cellular region were identified as being responsible for the binding of certain sweet and umami taste molecules through molecular modelling and docking. Our results suggest that episodic and differentiated adaptive evolution of TAS1Rs pervasively occurred
Engel, Pablo; Angulo, Ana
2016-01-01
Since the discovery of the high abundance of Alu elements in the human genome, the interest for the functional significance of these retrotransposons has been increasing. Primate Alu and rodent Alu-like elements are retrotransposed by a mechanism driven by the LINE1 (L1) encoded proteins, the same machinery that generates the L1 repeats, the processed pseudogenes (PPs), and other retroelements. Apart from free Alu RNAs, Alus are also transcribed and retrotranscribed as part of cellular gene transcripts, generally embedded inside 3’ untranslated regions (UTRs). Despite different proposed hypotheses, the functional implication of the presence of Alus inside 3’UTRs remains elusive. In this study we hypothesized that Alu elements in 3’UTRs could be involved in the genesis of PPs. By analyzing human genome data we discovered that the existence of 3’UTR-embedded Alu elements is overrepresented in genes source of PPs. In contrast, the presence of other retrotransposable elements in 3’UTRs does not show this PP linked overrepresentation. This research was extended to mouse and rat genomes and the results accordingly reveal overrepresentation of 3’UTR-embedded B1 (Alu-like) elements in PP parent genes. Interestingly, we also demonstrated that the overrepresentation of 3’UTR-embedded Alus is particularly significant in PP parent genes with low germline gene expression level. Finally, we provide data that support the hypothesis that the L1 machinery is also the system that herpesviruses, and possibly other large DNA viruses, use to capture host genes expressed in germline or somatic cells. Altogether our results suggest a novel role for Alu or Alu-like elements inside 3’UTRs as facilitators of the genesis of PPs, particularly in lowly expressed genes. Moreover, we propose that this L1-driven mechanism, aided by the presence of 3’UTR-embedded Alus, may also be exploited by DNA viruses to incorporate host genes to their viral genomes. PMID:28033411
DOE Office of Scientific and Technical Information (OSTI.GOV)
This fact sheet summarizes the research highlights for the Clean Energy Manufacturing Analysis Center (CEMAC) for Fiscal Year 2106. Topics covered include additive manufacturing for the wind industry, biomass-based chemicals substitutions, carbon fiber manufacturing facility siting, geothermal power plant turbines, hydrogen refueling stations, hydropower turbines, LEDs and lighting, light-duty automotive lithium-ion cells, magnetocaloric refrigeration, silicon carbide power electronics for variable frequency motor drives, solar photovoltaics, and wide bandgap semiconductor opportunities in power electronics.
NASA Astrophysics Data System (ADS)
Zha, Wangmei
2018-02-01
The Solenoidal Tracker at RHIC (STAR) experiment takes advantage of its excellent tracking and particle identification capabilities at mid-rapidity to explore the properties of strongly interacting QCD matter created in heavy-ion collisions at RHIC. The STAR collaboration presented 7 parallel and 2 plenary talks at Strangeness in Quark Matter 2017 and covered various topics including heavy flavor measurements, bulk observables, electro-magnetic probes and the upgrade program. This paper highlights some of the selected results.
Small Drinking Water Systems Communication and Outreach Highlights
As part of our small drinking water systems efforts, this poster highlights several communications and outreach highlights that EPA's Office of Research and Development and Office of Water have been undertaking in collaboration with states and the Association of State Drinking Wa...
STS-109 Mission Highlights Resource Tape
NASA Astrophysics Data System (ADS)
2002-05-01
This video, Part 3 of 4, shows the activities of the STS-109 crew (Scott Altman, Commander; Duane Carey, Pilot; John Grunsfeld, Payload Commander; Nancy Currie, James Newman, Richard Linnehan, Michael Massimino, Mission Specialists) during flight days 6 and 7. The activities from other flight days can be seen on 'STS-109 Mission Highlights Resource Tape' Part 1 of 4 (internal ID 2002139471), 'STS-109 Mission Highlights Resource Tape' Part 2 of 4 (internal ID 2002137664), and 'STS-109 Mission Highlights Resource Tape' Part 4 of 4 (internal ID 2002137577). Flight day 6 features a very complicated EVA (extravehicular activity) to service the HST (Hubble Space Telescope). Astronauts Grunsfeld and Linnehan replace the HST's power control unit, disconnecting and reconnecting 36 tiny connectors. The procedure includes the HST's first ever power down. The cleanup of spilled water from the coollant system in Grunsfeld's suit is shown. The pistol grip tool, and two other space tools are also shown. On flight day 7, Newman and Massimino conduct an EVA. They replace the HST's FOC (Faint Object Camera) with the ACS (Advanced Camera for Surveys). The video ends with crew members playing in the shuttle's cabin with a model of the HST.
Highlights of the Exposure Factors Handbook (Final Report)
EPA announced the availability of the final report, Highlights of the Exposure Factors Handbook (EPA/600/R-10/030).This Highlights document presents an overview of the information provided in the Exposure Factors Handbook (U.S. EPA, 2011). Excerpts of each chapter of the ...
Deprenyl Enhances the Teratogenicity of Hydroxyurea in Organogenesis Stage Mouse Embryos
Schlisser, Ava E.; Hales, Barbara F.
2013-01-01
Hydroxyurea, an antineoplastic drug, is a model teratogen. The administration of hydroxyurea to CD1 mice on gestation day 9 induces oxidative stress, increasing the formation of 4-hydroxy-2-nonenal adducts to redox-sensitive proteins such as glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the caudal region of the embryo. GAPDH catalytic activity is reduced, and its translocation into the nucleus is increased. Because the nuclear translocation of GAPDH is associated with oxidative stress–induced cell death, we hypothesized that this translocation plays a role in mediating the teratogenicity of hydroxyurea. Deprenyl (also known as selegiline), a drug used as a neuroprotectant in Parkinson’s disease, inhibits the nuclear translocation of GAPDH. Hence, timed pregnant CD1 mice were treated with deprenyl (10mg/kg) on gestation day 9 followed by the administration of hydroxyurea (400 or 600mg/kg). Deprenyl treatment significantly decreased the hydroxyurea-induced nuclear translocation of GAPDH in the caudal lumbosacral somites. Deprenyl enhanced hydroxyurea-mediated caudal malformations, inducing specifically limb reduction, digit anomalies, tail defects, and lumbosacral vertebral abnormalities. Deprenyl did not augment the hydroxyurea-induced inhibition of glycolysis or alter the ratio of oxidized to reduced glutathione. However, it did dramatically increase cleaved caspase-3 in embryos. These data suggest that nuclear GAPDH plays an important, region-specific, role in teratogen-exposed embryos. Deprenyl exacerbated the developmental outcome of hydroxyurea exposure by a mechanism that is independent of oxidative stress. Although the administration of deprenyl alone did not affect pregnancy outcome, this drug may have adverse consequences when combined with exposures that increase the risk of malformations. PMID:23696560
Southeast Alaska forests: inventory highlights.
Sally Campbell; Willem W.S. van Hees; Bert. Mead
2004-01-01
This publication presents highlights of a recent southeast Alaska inventory and analysis conducted by the Pacific Northwest Research Station Forest Inventory and Analysis Program (USDA Forest Service). Southeast Alaska has about 22.9 million acres, of which two-thirds are vegetated. Almost 11 million acres are forest land and about 4 million acres have nonforest...
Automatic Online Lecture Highlighting Based on Multimedia Analysis
ERIC Educational Resources Information Center
Che, Xiaoyin; Yang, Haojin; Meinel, Christoph
2018-01-01
Textbook highlighting is widely considered to be beneficial for students. In this paper, we propose a comprehensive solution to highlight the online lecture videos in both sentence- and segment-level, just as is done with paper books. The solution is based on automatic analysis of multimedia lecture materials, such as speeches, transcripts, and…
MUCHFUSS: Status and Highlights
NASA Astrophysics Data System (ADS)
Geier, S.; Kupfer, T.; Barlow, B.; Schaffenroth, V.; Fürst, F.; Heuser, C.; Ziegerer, E.; Heber, U.; Marsh, T.; Maxted, P.; Östensen, R.; O'Toole, S.; Gänsicke, B.; Napiwotzki, R.
2014-04-01
The MUCHFUSS project aims at finding sdBs with massive compact companions. Here we report on the current status of our spectroscopic and photometric follow-up campaigns and present some highlight results. We derive orbital solutions of seven new sdB binaries and estimate the fraction of close substellar companions to sdBs. Finally, we present an ultracompact sdB+WD binary as possible progenitor of a thermonuclear supernova and connect it to the only known hypervelocity subdwarf star, which might be the donor remnant of such an event.
Highlights in emergency medicine medical education research: 2008.
Farrell, Susan E; Coates, Wendy C; Khun, Gloria J; Fisher, Jonathan; Shayne, Philip; Lin, Michelle
2009-12-01
The purpose of this article is to highlight medical education research studies published in 2008 that were methodologically superior and whose outcomes were pertinent to teaching and education in emergency medicine. Through a PubMed search of the English language literature in 2008, 30 medical education research studies were independently identified as hypothesis-testing investigations and measurements of educational interventions. Six reviewers independently rated and scored all articles based on eight anchors, four of which related to methodologic criteria. Articles were ranked according to their total rating score. A ranking agreement among the reviewers of 83% was established a priori as a minimum for highlighting articles in this review. Five medical education research studies met the a priori criteria for inclusion and are reviewed and summarized here. Four of these employed experimental or quasi-experimental methodology. Although technology was not a component of the structured literature search employed to identify the candidate articles for this review, 14 of the articles identified, including four of the five highlighted articles, employed or studied technology as a focus of the educational research. Overall, 36% of the reviewed studies were supported by funding; three of the highlighted articles were funded studies. This review highlights quality medical education research studies published in 2008, with outcomes of relevance to teaching and education in emergency medicine. It focuses on research methodology, notes current trends in the use of technology for learning in emergency medicine, and suggests future avenues for continued rigorous study in education.
Is Domain Highlighting Actually Helpful in Identifying Phishing Web Pages?
Xiong, Aiping; Proctor, Robert W; Yang, Weining; Li, Ninghui
2017-06-01
To evaluate the effectiveness of domain highlighting in helping users identify whether Web pages are legitimate or spurious. As a component of the URL, a domain name can be overlooked. Consequently, browsers highlight the domain name to help users identify which Web site they are visiting. Nevertheless, few studies have assessed the effectiveness of domain highlighting, and the only formal study confounded highlighting with instructions to look at the address bar. We conducted two phishing detection experiments. Experiment 1 was run online: Participants judged the legitimacy of Web pages in two phases. In Phase 1, participants were to judge the legitimacy based on any information on the Web page, whereas in Phase 2, they were to focus on the address bar. Whether the domain was highlighted was also varied. Experiment 2 was conducted similarly but with participants in a laboratory setting, which allowed tracking of fixations. Participants differentiated the legitimate and fraudulent Web pages better than chance. There was some benefit of attending to the address bar, but domain highlighting did not provide effective protection against phishing attacks. Analysis of eye-gaze fixation measures was in agreement with the task performance, but heat-map results revealed that participants' visual attention was attracted by the highlighted domains. Failure to detect many fraudulent Web pages even when the domain was highlighted implies that users lacked knowledge of Web page security cues or how to use those cues. Potential applications include development of phishing prevention training incorporating domain highlighting with other methods to help users identify phishing Web pages.
Highlights of the Child-Specific Exposure Factors Handbook (Final Report)
EPA announced the release of the final report, Highlights of the Child-Specific Exposure Factors Handbook. As a "highlights" document, this is a companion report to the Child-Specific Exposure Factors Handbook (Final Report) EPA released in 2008. This highlights doc...
Highlighting in Early Childhood: Learning Biases Through Attentional Shifting.
Burling, Joseph M; Yoshida, Hanako
2017-02-01
The literature on human and animal learning suggests that individuals attend to and act on cues differently based on the order in which they were learned. Recent studies have proposed that one specific type of learning outcome, the highlighting effect, can serve as a framework for understanding a number of early cognitive milestones. However, little is known how this learning effect itself emerges among children, whose memory and attention are much more limited compared to adults. Two experiments were conducted using different versions of the general highlighting paradigm: Experiment 1 tested 3 to 6 year olds with a newly developed image-based version of the paradigm, which was designed specifically to test young children. Experiment 2 tested the validity of an image-based implementation of the highlighting paradigm with adult participants. The results from Experiment 1 provide evidence for the highlighting effect among children 3-6 years old, and they suggest age-related differences in dividing attention among multiple cues during learning. Experiment 2 replicated results from previous studies by showing robust biases for both image-based and text-based versions of the highlighting task. This study suggests that sensitivity to learning order emerges early through the process of cued attention, and the role of the highlighting effect in early language learning is discussed. Copyright © 2016 Cognitive Science Society, Inc.
Wood machining highlights, 1972 and 1973
Charles W. Mcmillin
1975-01-01
Important wood machining research published during 1972 and 1973 is highlighted to provide the reader with a concise summary of activity in 17 fields of endeavor. The review is based on 427 references and contains 154 citations.
Wood Machining Highlights, 1972 and 1973
C.W. McMillin
1975-01-01
Important wood machining research published during 1972 and 1973 is highlighted to provide the reader with a concise summary of activity in 17 fields of endeavor. The review is based on 427 references and contains 154 citations.
Dad, Azra; Jeong, Clara H; Wagner, Elizabeth D; Plewa, Michael J
2018-02-06
The disinfection of drinking water has been a major public health achievement. However, haloacetic acids (HAAs), generated as byproducts of water disinfection, are cytotoxic, genotoxic, mutagenic, carcinogenic, and teratogenic. Previous studies of monoHAA-induced genotoxicity and cell stress demonstrated that the toxicity was due to inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), leading to disruption of cellular metabolism and energy homeostasis. DiHAAs and triHAAs are also produced during water disinfection, and whether they share mechanisms of action with monoHAAs is unknown. In this study, we evaluated the effects of mono-, di-, and tri-HAAs on cellular GAPDH enzyme kinetics, cellular ATP levels, and pyruvate dehydrogenase complex (PDC) activity. Here, treatments conducted in Chinese hamster ovary (CHO) cells revealed differences among mono-, di-, and triHAAs in their molecular targets. The monoHAAs, iodoacetic acid and bromoacetic acid, were the strongest inhibitors of GAPDH and greatly reduced cellular ATP levels. Chloroacetic acid, diHAAs, and triHAAs were weaker inhibitors of GAPDH and some increased the levels of cellular ATP. HAAs also affected PDC activity, with most HAAs activating PDC. The primary finding of this work is that mono- versus multi-HAAs address different molecular targets, and the results are generally consistent with a model in which monoHAAs activate the PDC through GAPDH inhibition-mediated disruption in cellular metabolites, including altering ATP-to-ADP and NADH-to-NAD ratios. The monoHAA-mediated reduction in cellular metabolites results in accelerated PDC activity by way of metabolite-ratio-dependent PDC regulation. DiHAAs and triHAAs are weaker inhibitors of GAPDH, but many also increase cellular ATP levels, and we suggest that they increase PDC activity by inhibiting pyruvate dehydrogenase kinase.
Research highlights: increasing paper possibilities.
Wu, Chueh-Yu; Adeyiga, Oladunni; Lin, Jonathan; Di Carlo, Dino
2014-09-07
In this issue we highlight three recent papers that demonstrate new strategies to extend the capabilities of paper microfluidics. Paper (a mesh of porous fibers) has a long history as a substrate to perform biomolecular assays. Traditional lateral flow immunoassays (LFAs) are widely used for rapid diagnostic tests, and perform well when a yes or no answer is required and the analyte of interest is at relatively high concentrations. High concentrations are required because usually only a small volume of analyte-containing fluid flows past the detection region, leading to a limited signal. Further, the small pores within paper matrices prevent the use of paper to control the flow of larger particles and cells, limiting the use of paper microfluidics for cell-based diagnostics. The work we highlight addresses these important unmet challenges in paper microfluidics: enriching low concentration analytes to a higher concentration in a smaller volume that can be processed effectively, and using paper to pump flows in larger channels amenable to cells. Applying these new approaches may allow diagnosis of disease states currently technically unachievable using current LFA systems, while maintaining many of the "un-instrumented" advantages of an assay on self-wicking paper.
Wu, Keke; Liu, Wenwen; Mar, Thithi; Liu, Yan; Wu, Yunfeng; Wang, Xifeng
2014-01-01
The bird cherry-oat aphid (Rhopalosiphum padi), an important pest of cereal crops, not only directly sucks sap from plants, but also transmits a number of plant viruses, collectively the yellow dwarf viruses (YDVs). For quantifying changes in gene expression in vector aphids, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is a touchstone method, but the selection and validation of housekeeping genes (HKGs) as reference genes to normalize the expression level of endogenous genes of the vector and for exogenous genes of the virus in the aphids is critical to obtaining valid results. Such an assessment has not been done, however, for R. padi and YDVs. Here, we tested three algorithms (GeNorm, NormFinder and BestKeeper) to assess the suitability of candidate reference genes (EF-1α, ACT1, GAPDH, 18S rRNA) in 6 combinations of YDV and vector aphid morph. EF-1α and ACT1 together or in combination with GAPDH or with GAPDH and 18S rRNA could confidently be used to normalize virus titre and expression levels of endogenous genes in winged or wingless R. padi infected with Barley yellow dwarf virus isolates (BYDV)-PAV and BYDV-GAV. The use of only one reference gene, whether the most stably expressed (EF-1α) or the least stably expressed (18S rRNA), was not adequate for obtaining valid relative expression data from the RT-qPCR. Because of discrepancies among values for changes in relative expression obtained using 3 regions of the same gene, different regions of an endogenous aphid gene, including each terminus and the middle, should be analyzed at the same time with RT-qPCR. Our results highlight the necessity of choosing the best reference genes to obtain valid experimental data and provide several HKGs for relative quantification of virus titre in YDV-viruliferous aphids. PMID:24810421
2016 NIH Research Highlights | NIH MedlinePlus the Magazine
... Research Highlights Follow us Breaking New Ground: NIH Research Highlights With NIH support, scientists across the U.S. ... confirming the long-term benefits of the therapy. Research to treat obesity in new ways Adults have ...
Highlight summarization in golf videos using audio signals
NASA Astrophysics Data System (ADS)
Kim, Hyoung-Gook; Kim, Jin Young
2008-01-01
In this paper, we present an automatic summarization of highlights in golf videos based on audio information alone without video information. The proposed highlight summarization system is carried out based on semantic audio segmentation and detection on action units from audio signals. Studio speech, field speech, music, and applause are segmented by means of sound classification. Swing is detected by the methods of impulse onset detection. Sounds like swing and applause form a complete action unit, while studio speech and music parts are used to anchor the program structure. With the advantage of highly precise detection of applause, highlights are extracted effectively. Our experimental results obtain high classification precision on 18 golf games. It proves that the proposed system is very effective and computationally efficient to apply the technology to embedded consumer electronic devices.
Yan, Hong; Lou, Marjorie F; Fernando, M Rohan; Harding, John J
2006-10-02
To investigate whether mammalian thioredoxin (Trx) and thioredoxin reductase (TrxR), with or without alpha-crystallin can revive inactivated glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in both the cortex and nucleus of human aged clear and cataract lenses. The lens cortex (including capsule-epithelium) and the nucleus were separated from human aged clear and cataract lenses (grade II and grade IV) with similar average age. The activity of GAPDH in the water-soluble fraction after incubation with or without Trx or/and TrxR for 60 min at 30 degrees C was measured spectrophotometrically. In addition, the effect of a combination of Trx/TrxR and bovine lens alpha-crystallin was investigated. GAPDH activity was lower in the nucleus of clear lenses than in the cortex, and considerably diminished in the cataractous lenses, particularly in the nucleus of cataract lenses grade IV. Trx and TrxR were able to revive the activity of GAPDH markedly in both the cortex and nucleus of the clear and cataract lenses. The percentage increase of activity in the cortex of the clear lenses was less than that of the nucleus in the presence of Trx and TrxR, whereas it was opposite in the cataract lenses. The revival of activity in both the cortex and nucleus from the cataract lenses grade II was higher than that of the grade IV. Moreover, Trx alone, but not TrxR, efficiently enhanced GAPDH activity. The combination of Trx and TrxR had greater effect than that of either alone. In addition, alpha(L)-crystallin enhanced the activity in the cortex of cataract grade II with Trx and TrxR present. However, it failed to provide a statistically significant increase of activity in the nucleus. This is the first evidence to show that mammalian Trx and TrxR are able to revive inactivated GAPDH in human aged clear and cataract lenses, and alpha-crystallin helped this effect. The inactivation of GAPDH during aging and cataract development must be caused in part by disulphide formation and in part by
Brookhaven highlights, October 1979-September 1980
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1980-01-01
Highlights are given for the research areas of the Brookhaven National Laboratory. These areas include high energy physics, physics and chemistry, life sciences, applied energy science (energy and environment, and nuclear energy), and support activities (including mathematics, instrumentation, reactors, and safety). (GHT)
STS-109 Mission Highlights Resource Tape
NASA Astrophysics Data System (ADS)
2002-05-01
This video, Part 1 of 4, shows the activities of the STS-109 crew (Scott Altman, Commander; Duane Carey, Pilot; John Grunsfeld, Payload Commander; Nancy Currie, James Newman, Richard Linnehan, Michael Massimino, Mission Specialists) during flight days 1 through 3. The activities from other flight days can be seen on 'STS 109 Mission Highlights Resource Tape' Part 2 of 4 (internal ID 2002137664), 'STS 109 Mission Highlights Resource Tape' Part 3 of 4 (internal ID 2002139471), and 'STS-109 Mission Highlights Resource Tape' Part 4 of 4 (internal ID 2002137577). The main activity recorded during flight day 1 is the liftoff of Columbia. Attention is given to suit-up, boarding, and pre-flight procedures. The pre-launch crew meal has no sound. The crew members often wave to the camera before liftoff. The jettisoning of the solid rocket boosters is shown, and the External Tank is seen as it falls to Earth, moving over African dunes in the background. There are liftoff replays, including one from inside the cockpit. The opening of the payload bay doors is seen from the rear of the shuttle's cockpit. The footage from flight day 2 shows the Flight Support System for bearthing the HST (Hubble Space Telescope). Crew preparations for the bearthing are shown. Flight day 3 shows the tracking of and approach to the HST by Columbia, including orbital maneuvers, the capture of the HST, and its lowering onto the Flight Support System. Many views of the HST are shown, including one which reveals an ocean and cloud background as the HST retracts a solar array.
Li, Mengmeng; Rao, Man; Chen, Kai; Zhou, Jianye; Song, Jiangping
2017-07-15
Real-time quantitative reverse transcriptase-PCR (qRT-PCR) is a feasible tool for determining gene expression profiles, but the accuracy and reliability of the results depends on the stable expression of selected housekeeping genes in different samples. By far, researches on stable housekeeping genes in human heart failure samples are rare. Moreover the effect of heart failure on the expression of housekeeping genes in right and left ventricles is yet to be studied. Therefore we aim to provide stable housekeeping genes for both ventricles in heart failure and normal heart samples. In this study, we selected seven commonly used housekeeping genes as candidates. By using the qRT-PCR, the expression levels of ACTB, RAB7A, GAPDH, REEP5, RPL5, PSMB4 and VCP in eight heart failure and four normal heart samples were assessed. The stability of candidate housekeeping genes was evaluated by geNorm and Normfinder softwares. GAPDH showed the least variation in all heart samples. Results also indicated the difference of gene expression existed in heart failure left and right ventricles. GAPDH had the highest expression stability in both heart failure and normal heart samples. We also propose using different sets of housekeeping genes for left and right ventricles respectively. The combination of RPL5, GAPDH and PSMB4 is suitable for the right ventricle and the combination of GAPDH, REEP5 and RAB7A is suitable for the left ventricle. Copyright © 2017 Elsevier B.V. All rights reserved.
Ho, L-P; Chang, C-J; Liu, H-C; Yang, H-L; Lin, J H-Y
2014-01-01
Cobia, Rachycentron canadum L., is a very important aquatic fish that faces the risk of infection with the bacterial pathogen Photobacterium damselae ssp. piscicida, and there are few protective approaches available that use multiple antigens. In the present study, potent bivalent antigens from P. damselae ssp. piscicida showed more efficient protection than did single antigens used in isolation. In preparations of three antigens that included recombinant heat shock protein 60 (rHSP60), recombinant α-enolase (rENOLASE) and recombinant glyceraldehyde-3-phosphate dehydrogenase (rGAPDH), we analysed the doses that elicited the best immune responses and found that this occurred at a total of 30 μg of antigen per fish. Subsequently, vaccination of fish with rHSP60, rENOLASE and rGAPDH achieved 46.9, 52 and 25% relative per cent survival (RPS), respectively. In addition, bivalent subunit vaccines--combination I (rHSP60 + rENOLASE), combination II (rENOLASE + rGAPDH) and combination III (rHSP60 + rGAPDH)--were administered and the RPS in these groups (65.6, 64.0 and 48.4%, respectively), was higher than that achieved with single-antigen administration. Finally, in combination IV, the trivalent vaccine rHSP60 + rENOLASE + rGAPDH, the RPS was 1.6%. Taken together, our results suggest that combinations of two antigens may achieve a better efficiency than monovalent or trivalent antigens, and this may provide new insights into pathogen prevention strategies. © 2013 John Wiley & Sons Ltd.
Mohr, S; Stamler, J S; Brüne, B
1994-07-18
Previous studies have suggested that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) undergoes covalent modification of an active site thiol by a NO.-induced [32P]NAD(+)-dependent mechanism. However, the efficacy of GAPDH modification induced by various NO donors was found to be independent of spontaneous rates of NO. release. To further test the validity of this mechanism, we studied the effects of nitrosonium tertrafluoroborate (BF4NO), a strong NO+ donor. BF4NO potently induces GAPDH labeling by the radioactive nucleotide. In this case, the addition of thiol significantly attenuates enzyme modification by competing for the NO moiety in the formation of RS-NO. Peroxynitrite (ONOO-) also induces GAPDH modification in the presence of thiol, consistent with the notion that this species can transfer NO+ (or NO2+) through the intermediacy of RS-NO. However, the efficiency of this reaction is limited by ONOO- -induced oxidation of protein SH groups at the active site. ONOO- generation appears to account for the modification of GAPDH by SIN-1. Thus, S-nitrosylation of the active site thiol is a prequisite for subsequent post-translational modification with NAD+, and emphasizes the role of NO+ transfer in the initial step of this pathway. Our findings thus provide a uniform mechanism by which nitric oxide and related NO donors initiate non-enzymatic ADP-ribosylation (like) reactions. In biological systems, endogenous RS-NO are likely to support the NO group transfer to thiol-containing proteins.
Allonso, Diego; Andrade, Iamara S.; Conde, Jonas N.; Coelho, Diego R.; Rocha, Daniele C. P.; da Silva, Manuela L.; Ventura, Gustavo T.
2015-01-01
ABSTRACT Dengue is one of the main public health concerns worldwide. Recent estimates indicate that over 390 million people are infected annually with the dengue virus (DENV), resulting in thousands of deaths. Among the DENV nonstructural proteins, the NS1 protein is the only one whose function during replication is still unknown. NS1 is a 46- to 55-kDa glycoprotein commonly found as both a membrane-associated homodimer and a soluble hexameric barrel-shaped lipoprotein. Despite its role in the pathogenic process, NS1 is essential for proper RNA accumulation and virus production. In the present study, we identified that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) interacts with intracellular NS1. Molecular docking revealed that this interaction occurs through the hydrophobic protrusion of NS1 and the hydrophobic residues located at the opposite side of the catalytic site. Moreover, addition of purified recombinant NS1 enhanced the glycolytic activity of GAPDH in vitro. Interestingly, we observed that DENV infection promoted the relocalization of GAPDH to the perinuclear region, where NS1 is commonly found. Both DENV infection and expression of NS1 itself resulted in increased GAPDH activity. Our findings indicate that the NS1 protein acts to increase glycolytic flux and, consequently, energy production, which is consistent with the recent finding that DENV induces and requires glycolysis for proper replication. This is the first report to propose that NS1 is an important modulator of cellular energy metabolism. The data presented here provide new insights that may be useful for further drug design and the development of alternative antiviral therapies against DENV. IMPORTANCE Dengue represents a serious public health problem worldwide and is caused by infection with dengue virus (DENV). Estimates indicate that half of the global population is at risk of infection, with almost 400 million cases occurring per year. The NS1 glycoprotein is found in both the
Allonso, Diego; Andrade, Iamara S; Conde, Jonas N; Coelho, Diego R; Rocha, Daniele C P; da Silva, Manuela L; Ventura, Gustavo T; Silva, Emiliana M; Mohana-Borges, Ronaldo
2015-12-01
Dengue is one of the main public health concerns worldwide. Recent estimates indicate that over 390 million people are infected annually with the dengue virus (DENV), resulting in thousands of deaths. Among the DENV nonstructural proteins, the NS1 protein is the only one whose function during replication is still unknown. NS1 is a 46- to 55-kDa glycoprotein commonly found as both a membrane-associated homodimer and a soluble hexameric barrel-shaped lipoprotein. Despite its role in the pathogenic process, NS1 is essential for proper RNA accumulation and virus production. In the present study, we identified that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) interacts with intracellular NS1. Molecular docking revealed that this interaction occurs through the hydrophobic protrusion of NS1 and the hydrophobic residues located at the opposite side of the catalytic site. Moreover, addition of purified recombinant NS1 enhanced the glycolytic activity of GAPDH in vitro. Interestingly, we observed that DENV infection promoted the relocalization of GAPDH to the perinuclear region, where NS1 is commonly found. Both DENV infection and expression of NS1 itself resulted in increased GAPDH activity. Our findings indicate that the NS1 protein acts to increase glycolytic flux and, consequently, energy production, which is consistent with the recent finding that DENV induces and requires glycolysis for proper replication. This is the first report to propose that NS1 is an important modulator of cellular energy metabolism. The data presented here provide new insights that may be useful for further drug design and the development of alternative antiviral therapies against DENV. Dengue represents a serious public health problem worldwide and is caused by infection with dengue virus (DENV). Estimates indicate that half of the global population is at risk of infection, with almost 400 million cases occurring per year. The NS1 glycoprotein is found in both the intracellular and the
2017-08-11
NASA's Cassini spacecraft looks toward the night side of Saturn's moon Titan in a view that highlights the extended, hazy nature of the moon's atmosphere. During its long mission at Saturn, Cassini has frequently observed Titan at viewing angles like this, where the atmosphere is backlit by the Sun, in order to make visible the structure of the hazes. Titan's high-altitude haze layer appears blue here, whereas the main atmospheric haze is orange. The difference in color could be due to particle sizes in the haze. The blue haze likely consists of smaller particles than the orange haze. Images taken using red, green and blue spectral filters were combined to create this natural-color view. The image was taken with the Cassini spacecraft narrow-angle camera on May 29, 2017. The view was acquired at a distance of approximately 1.2 million miles (2 million kilometers) from Titan. Image scale is 5 miles (9 kilometers) per pixel. https://photojournal.jpl.nasa.gov/catalog/PIA21625
Detection of two distinct forms of apoC-I in great apes.
Puppione, Donald L; Ryan, Christopher M; Bassilian, Sara; Souda, Puneet; Xiao, Xinshu; Ryder, Oliver A; Whitelegge, Julian P
2010-03-01
ApoC-I, the smallest of the soluble apolipoproteins, associates with both TG-rich lipoproteins and HDL. Mass spectral analyses of human apoC-I previously had demonstrated that in the circulation there are two forms, either a 57 amino acid protein or a 55 amino acid protein, due to the loss of two amino acids from the N-terminus. In our analyses of the apolipoproteins of the other great apes by mass spectrometry, four forms of apoC-I were detected. Two of these showed a high degree of identity to the mature and truncated forms of human apoC-I. The other two were homologous to the virtual protein and its truncated form that are encoded by a human pseudogene. In humans, the genes for apoC-I and its pseudogene are located on chromosome 19, the pseudogene being 2.5 kb downstream from the apoC-I gene. Based on the similarity between the apoC-I gene and the pseudogene, it has been concluded that the latter arose from the former as a result of gene duplication approximately 35 million years ago. Interestingly, the virtual protein encoded by the pseudogene is acidic, not basic like apoC-I. In the chimpanzee, there also are two genes for apoC-I, the one upstream encodes a basic protein and the downstream gene, rather than being a pseudogene, encodes an acidic protein (P86336). In addition to reporting on the molecular masses of great ape apoC-I, we were able to clearly demonstrate by "Top-down" sequencing that the acidic form arose from a separate gene. In our analyses, we have measured the molecular masses of apoC-I associated with the HDL of the following great apes: bonobo (Pan paniscus), chimpanzee (Pan troglodytes), and the Sumatran orangutan (Pongo abelii). Genomic variations in chromosome 19 among great apes, baboons and macaques as they relate to both genes for apoC-I and the pseudogene are compared and discussed.
Barrett, Tessa J.; Pattison, David I.; Leonard, Stephen E.; Carroll, Kate S.; Davies, Michael J.; Hawkins, Clare L.
2012-01-01
Myeloperoxidase (MPO) forms reactive oxidants including hypochlorous and hypothiocyanous acids (HOCl and HOSCN) under inflammatory conditions. HOCl causes extensive tissue damage and plays a role in the progression of many inflammatory-based diseases. Although HOSCN is a major MPO oxidant, particularly in smokers, who have elevated plasma thiocyanate, the role of this oxidant in disease is poorly characterized. HOSCN induces cellular damage by targeting thiols. However, the specific targets and mechanisms involved in this process are not well defined. We show that exposure of macrophages to HOSCN results in the inactivation of intracellular enzymes, including creatine kinase (CK) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). In each case, the active-site thiol residue is particularly sensitive to oxidation, with evidence for reversible inactivation and the formation of sulfenyl thiocyanate and sulfenic acid intermediates, on treatment with HOSCN (less than fivefold molar excess). Experiments with DAz-2, a cell-permeable chemical trap for sulfenic acids, demonstrate that these intermediates are formed on many cellular proteins, including GAPDH and CK, in macrophages exposed to HOSCN. This is the first direct evidence for the formation of protein sulfenic acids in HOSCN-treated cells and highlights the potential of this oxidant to perturb redox signaling processes. PMID:22248862
Education at a Glance 2011: Highlights
ERIC Educational Resources Information Center
OECD Publishing (NJ1), 2011
2011-01-01
"Education at a Glance 2011: Highlights" offers a reader-friendly introduction to the Organisation for Economic Cooperation and Development's (OECD's) collection of internationally comparable data on education. As the name suggests, it is derived from "Education at a Glance 2011", the OECD's flagship compendium of education…
Education at a Glance 2012: Highlights
ERIC Educational Resources Information Center
OECD Publishing (NJ3), 2012
2012-01-01
"Education at a Glance 2012: Highlights" offers a reader-friendly introduction to the Organisation for Economic Cooperation and Development's (OECD's) collection of internationally comparable data on education. As the name suggests, it is derived from "Education at a Glance 2012", the OECD's flagship compendium of education statistics. However, it…
Nishimura, Ikuko; Shinohara, Yasutomo; Oguma, Tetsuya; Koyama, Yasuji
2018-04-08
In soy sauce brewing, the results of the fermentation of lactic acid greatly affect the quality of soy sauce. The soy sauce moromi produced with Aspergillus oryzae RIB40 allows the growth of Tetragenococcus halophilus NBRC 12172 but not T. halophilus D10. We isolated and identified heptelidic acid (HA), an inhibitor of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), produced by A. oryzae RIB40 as the growth inhibitor of the salt-tolerant lactic acid bacteria. The growth inhibition of T. halophilus D10 by HA was suggested to be associated with the direct inhibition of GAPDH activity under high salt environment. The difference in the susceptibility to HA among various strains of T. halophilus was caused by the mutations in the gene encoding GAPDH.
1977-08-03
AD—A OQ 15 CALIFORNIA UN I V SANTA CRUZ INFORMATION SCIENCES FIG 9.’2 HIGHLIGHTS OF LO11.(U) ~~~ LASS ~~~~~ TR— 77—8—OO5 H MCKEEMAN EN D...EA & WORK UNIT NUMBERS Board of Studies in Information Sciences - . University of Californiav ~~~~~~~~ • I Santa Cruz, Ca1ifnrn(~ 9S~ f LL - II. C O...Office of Naval Research contract NOOO1~ —76 C O682.* .~~~~ .. 3. The Board of Studies in InforMation Sciences, UCSCe~~~~ ~~~~~ 00 ~~ ~~~~~ ifl ,’jIIfl
LibTech Highlights from ALA Midwinter
ERIC Educational Resources Information Center
Hane, Paula J.
2009-01-01
Despite lower attendance than in the past and blustery, cold weather, the American Library Association's Midwinter Meeting in Denver in January offered lots of news from industry vendors and lots of opportunities to discuss important issues and trends. In this report, the author highlights some of the most important product announcements with a…
STS-109 Mission Highlights Resource Tape
NASA Astrophysics Data System (ADS)
2002-05-01
This video, Part 4 of 4, shows footage of crew activities from flight days 8 through 12 of STS-109. The crew included: Scott Altman, Commander; Duane Carey, Pilot; John Grunsfeld, Payload Commander; Nancy Currie, Richard Linnehan, James Newman, Michael Massimino, Mission Speicalists. The activities from other flights days can be seen on 'STS-109 Mission Highlights Resource Tape' Part 1 of 4 (internal ID 2002139471), 'STS-109 Mission Highlights Resource Tape' Part 2 of 4 (internal ID 2002137664), and 'STS-109 Mission Highlights Resource Tape' Part 3 of 4 (internal ID 2002139476). The primary activity on flight day 8 was an EVA (extravehicular activity) by Grunsfeld and Linnehan to install a cryocooler and radiator for the NICMOS (Near Infrared Camera and Multi-Object Spectrometer) on the HST (Hubble Space Telescope). Before returning to Columbia's airlock, the astronauts, with a cloudy background, hold onto the orbiter and offer their thoughts on the significance of their mission, the HST, and spaceflight. Footage from flight day 9 includes the grappling, unbearthing, and deployment of the HST from Columbia, and the crew coordinating and videotaping Columbia's departure. Flight day 10 was a relatively inactive day, and flight day 11 includes a checkout of Columbia's aerodynamic surfaces. Columbia landed on flight day 12, which is covered by footage of the crew members speaking during reentry, and their night landing, primarily shown through the orbiter's head-up display. The video includes numerous views of the HST, as well as views of the the Galapagos Islands, Madagascar, and Southern Africa with parts of the Atlantic, Indian, and Pacific Oceans, and part of the coast of Chile. The pistol grip space tool is shown in use, and the crew answers two messages from the public, including a message to Massimino from the Fire Department of New York.
STS-109 Mission Highlights Resource Tape
NASA Astrophysics Data System (ADS)
2002-05-01
This video, Part 2 of 4, shows the activities of the STS-109 crew (Scott Altman, Commander; Duane Carey, Pilot; John Grunsfeld, Payload Commander; Nancy Currie, James Newman, Richard Linnehan, Michael Massimino, Mission Specialists) during flight days 4 and 5. The activities from other flights days can be seen on 'STS-109 Mission Highlights Resource Tape' Part 1 of 4 (internal ID 2002139471), 'STS-109 Mission Highlights Resource Tape' Part 3 of 4 (internal ID 2002139476), and 'STS-109 Mission Highlights Resource Tape' Part 4 of 4 (internal ID 2002137577). The primary activities during these days were EVAs (extravehicular activities) to replace two solar arrays on the HST (Hubble Space Telescope). Footage from flight day 4 records an EVA by Grunsfeld and Linnehan, including their exit from Columbia's payload bay airlock, their stowing of the old HST starboard rigid array on the rigid array carrier in Columbia's payload bay, their attachment of the new array on HST, the installation of a new starboard diode box, and the unfolding of the new array. The pistol grip space tool used to fasten the old array in its new location is shown in use. The video also includes several shots of the HST with Earth in the background. On flight day 5 Newman and Massimino conduct an EVA to change the port side array and diode box on HST. This EVA is very similar to the one on flight day 4, and is covered similarly in the video. A hand operated ratchet is shown in use. In addition to a repeat of the previous tasks, the astronauts change HST's reaction wheel assembly, and because they are ahead of schedule, install installation and lubricate an instrument door on the telescope. The Earth views include a view of Egypt and Israel, with the Nile River, Red Sea, and Mediterranean Sea.
Highlights: 1985 Recent College Graduates Survey.
ERIC Educational Resources Information Center
Porter, Joanell T.
Highlights of a survey of 1983 and 1984 college graduates at the bachelor's or master's degree level are presented. Information is provided on types of jobs and starting salaries of degree recipients, with comparisons by sex, along with data on newly qualified and beginning teachers. The survey, which was conducted by the Center for Education…
Highlights on DESD Progress to Date
ERIC Educational Resources Information Center
United Nations Educational, Scientific and Cultural Organization (UNESCO), 2007
2007-01-01
This brief report, delivered after the completion of the 1st year of the United Nations (UN) Decade of Education for Sustainable Development (DESD) (2005-2014), highlights the recent developments regarding the Decade (2005). It reports on the documents prepared, the regional and national launches of the Decade held so far and presents relevant…
Glenting, Jacob; Beck, Hans Christian; Vrang, Astrid; Riemann, Holger; Ravn, Peter; Hansen, Anne Maria; Antonsson, Martin; Ahrné, Siv; Israelsen, Hans; Madsen, Søren
2013-06-12
An important criterion for the selection of a probiotic bacterial strain is its ability to adhere to the mucosal surface. Adhesion is usually mediated by proteins or other components located on the outer cell surface of the bacterium. In the present study we characterized the adhesive properties of two classical intracellular enzymes glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and enolase (ENO) isolated from the outer cell surface of the probiotic bacterium Lactobacillus plantarum 299v. None of the genes encoded signal peptides or cell surface anchoring motifs that could explain their extracellular location on the bacterial surface. The presence of the glycolytic enzymes on the outer surface was verified by western blotting using polyclonal antibodies raised against the specific enzymes. GAPDH and ENO showed a highly specific binding to plasminogen and fibronectin whereas GAPDH but not ENO showed weak binding to mucin. Furthermore, a pH dependent and specific binding of GAPDH and ENO to intestinal epithelial Caco-2 cells at pH 5 but not at pH 7 was demonstrated. The results showed that these glycolytic enzymes could play a role in the adhesion of the probiotic bacterium L. plantarum 299v to the gastrointestinal tract of the host. Finally, a number of probiotic as well non-probiotic Lactobacillus strains were analyzed for the presence of GAPDH and ENO on the outer surface, but no correlation between the extracellular location of these enzymes and the probiotic status of the applied strains was demonstrated. Copyright © 2013 Elsevier GmbH. All rights reserved.
MONTHLY HIGHLIGHTS (SUBSURFACE PROTECTION AND REMEDIATION DIVISION)
The Subsurface Protection and Remediation Division (SPRD) produces monthly highlights describing research accomplishments, involvement in current technical assistance activities, and staff participation in scientific meetings and conferences. Announcements of the release and avai...
South-central Alaska forests: inventory highlights.
Sally Campbell; Willem W.S. van Hees; Bert. Mead
2005-01-01
This publication presents highlights of a recent south-central Alaska inventory conducted by the Pacific Northwest Research Station Forest Inventory and Analysis Program (USDA Forest Service). South-central Alaska has about 18.5 million acres, of which one-fifth (4 million acres) is forested. Species diversity is greatest in closed and open Sitka spruce forests, spruce...
Filby, Amy L; Tyler, Charles R
2007-01-01
Background Attempts to develop a mechanistic understanding of the effects of environmental estrogens on fish are increasingly conducted at the level of gene expression. Appropriate application of real-time PCR in such studies requires the use of a stably expressed 'housekeeping' gene as an internal control to normalize for differences in the amount of starting template between samples. Results We sought to identify appropriate genes for use as internal controls in experimental treatments with estrogen by analyzing the expression of eight functionally distinct 'housekeeping' genes (18S ribosomal RNA [18S rRNA], ribosomal protein l8 [rpl8], elongation factor 1 alpha [ef1a], glucose-6-phosphate dehydrogenase [g6pd], beta actin [bactin], glyceraldehyde-3-phosphate dehydrogenase [gapdh], hypoxanthine phosphoribosyltransferase 1 [hprt1], and tata box binding protein [tbp]) following exposure to the environmental estrogen, 17α-ethinylestradiol (EE2), in the fathead minnow (Pimephales promelas). Exposure to 10 ng/L EE2 for 21 days down-regulated the expression of ef1a, g6pd, bactin and gapdh in the liver, and bactin and gapdh in the gonad. Some of these effects were gender-specific, with bactin in the liver and gapdh in the gonad down-regulated by EE2 in males only. Furthermore, when ef1a, g6pd, bactin or gapdh were used for normalization, the hepatic expression of two genes of interest, vitellogenin (vtg) and cytochrome P450 1A (cyp1a) following exposure to EE2 was overestimated. Conclusion Based on the data presented, we recommend 18S rRNA, rpl8, hprt1 and/or tbp, but not ef1a, g6pd, bactin and/or gapdh, as likely appropriate internal controls in real-time PCR studies of estrogens effects in fish. Our studies show that pre-validation of control genes considering the scope and nature of the experiments to be performed, including both gender and tissue type, is critical for accurate assessments of the effects of environmental estrogens on gene expression in fish. PMID
2013-01-01
Carbon nanotubes are capable of penetrating the cell membrane and are widely considered as potential carriers for gene or drug delivery. Because the C-C and C=C bonds in carbon nanotubes are nonpolar, functionalization is required for carbon nanotubes to interact with genes or drugs as well as to improve their biocompatibility. In this study, polyethylenimine (PEI)-functionalized single-wall (PEI-NH-SWNTs) and multiwall carbon nanotubes (PEI-NH-MWNTs) were produced by direct amination method. PEI functionalization increased the positive charge on the surface of SWNTs and MWNTs, allowing carbon nanotubes to interact electrostatically with the negatively charged small interfering RNAs (siRNAs) and to serve as nonviral gene delivery reagents. PEI-NH-MWNTs and PEI-NH-SWNTs had a better solubility in water than pristine carbon nanotubes, and further removal of large aggregates by centrifugation produced a stable suspension of reduced particle size and improved homogeneity and dispersity. The amount of grafted PEI estimated by thermogravimetric analysis was 5.08% (w/w) and 5.28% (w/w) for PEI-NH-SWNTs and PEI-NH-MWNTs, respectively. For the assessment of cytotoxicity, various concentrations of PEI-NH-SWNTs and PEI-NH-MWNTs were incubated with human cervical cancer cells, HeLa-S3, for 48 h. PEI-NH-SWNTs and PEI-NH-MWNTs induced cell deaths in a dose-dependent manner but were less cytotoxic compared to pure PEI. As determined by electrophoretic mobility shift assay, siRNAs directed against glyceraldehyde-3-phosphate dehydrogenase (siGAPDH) were completely associated with PEI-NH-SWNTs or PEI-NH-MWNTs at a PEI-NH-SWNT/siGAPDH or PEI-NH-MWNT/siGAPDH mass ratio of 80:1 or 160:1, respectively. Furthermore, PEI-NH-SWNTs and PEI-NH-MWNTs successfully delivered siGAPDH into HeLa-S3 cells at PEI-NH-SWNT/siGAPDH and PEI-NH-MWNT/siGAPDH mass ratios of 1:1 to 20:1, resulting in suppression of the mRNA level of GAPDH to an extent similar to that of DharmaFECT, a common transfection
Han, Xiang Y; Sizer, Kurt C; Thompson, Erika J; Kabanja, Juma; Li, Jun; Hu, Peter; Gómez-Valero, Laura; Silva, Francisco J
2009-10-01
Mycobacterium lepromatosis is a newly discovered leprosy-causing organism. Preliminary phylogenetic analysis of its 16S rRNA gene and a few other gene segments revealed significant divergence from Mycobacterium leprae, a well-known cause of leprosy, that justifies the status of M. lepromatosis as a new species. In this study we analyzed the sequences of 20 genes and pseudogenes (22,814 nucleotides). Overall, the level of matching of these sequences with M. leprae sequences was 90.9%, which substantiated the species-level difference; the levels of matching for the 16S rRNA genes and 14 protein-encoding genes were 98.0% and 93.1%, respectively, but the level of matching for five pseudogenes was only 79.1%. Five conserved protein-encoding genes were selected to construct phylogenetic trees and to calculate the numbers of synonymous substitutions (dS values) and nonsynonymous substitutions (dN values) in the two species. Robust phylogenetic trees constructed using concatenated alignment of these genes placed M. lepromatosis and M. leprae in a tight cluster with long terminal branches, implying that the divergence occurred long ago. The dS and dN values were also much higher than those for other closest pairs of mycobacteria. The dS values were 14 to 28% of the dS values for M. leprae and Mycobacterium tuberculosis, a more divergent pair of species. These results thus indicate that M. lepromatosis and M. leprae diverged approximately 10 million years ago. The M. lepromatosis pseudogenes analyzed that were also pseudogenes in M. leprae showed nearly neutral evolution, and their relative ages were similar to those of M. leprae pseudogenes, suggesting that they were pseudogenes before divergence. Taken together, the results described above indicate that M. lepromatosis and M. leprae diverged from a common ancestor after the massive gene inactivation event described previously for M. leprae.
Shipitsyna, E; Zolotoverkhaya, E; Hjelmevoll, S O; Maximova, A; Savicheva, A; Sokolovsky, E; Skogen, V; Domeika, M; Unemo, M
2009-11-01
In Russia, laboratory diagnosis of gonorrhoea has been mainly based on microscopy only and, in some settings, relatively rare suboptimal culturing. In recent years, Russian developed and manufactured nucleic acid amplification tests (NAAT) have been implemented for routine diagnosis of Neisseria gonorrhoeae. However, these NAATs have never been validated to any international well-recognized diagnostic NAAT. This study aims to evaluate the performance characteristics of six Russian NAATs for N. gonorrhoeae diagnostics. In total, 496 symptomatic patients were included. Five polymerase chain reaction (PCR) assays and one real-time nucleic acid sequence based amplification (NASBA) assay, developed by three Russian companies, were evaluated on urogenital samples, i.e. cervical and first voided urine (FVU) samples from females (n = 319), urethral and FVU samples from males (n = 127), and extragenital samples, i.e. rectal and pharyngeal samples, from 50 additional female patients with suspicion of gonorrhoea. As reference method, an international strictly validated real-time porA pseudogene PCR was applied. The prevalence of N. gonorrhoeae was 2.7% and 16% among the patients providing urogenital and extragenital samples, respectively. The Russian NAATs and the reference method displayed high level of concordance (99.4-100%). The sensitivities, specificities, positive predictive values and negative predictive values of the Russian tests in different specimens were 66.7-100%, 100%, 100%, and 99.4-100%, respectively. Russian N. gonorrhoeae diagnostic NAATs comprise relatively good performance characteristics. However, larger studies are crucial and, beneficially, the Russian assays should also be evaluated to other international highly sensitive and specific, and ideally Food and Drug Administration approved, NAATs such as Aptima Combo 2 (Gen-Probe).
Antigenic variation of Anaplasma marginale msp2 occurs by combinatorial gene conversion.
Brayton, Kelly A; Palmer, Guy H; Lundgren, Anna; Yi, Jooyoung; Barbet, Anthony F
2002-03-01
The rickettsial pathogen Anaplasma marginale establishes lifelong persistent infection in the mammalian reservoir host, during which time immune escape variants continually arise in part because of variation in the expressed copy of the immunodominant outer membrane protein MSP2. A key question is how the small 1.2 Mb A. marginale genome generates sufficient variants to allow long-term persistence in an immunocompetent reservoir host. The recombination of whole pseudogenes into the single msp2 expression site has been previously identified as one method of generating variants, but is inadequate to generate the number of variants required for persistent infection. In the present study, we demonstrate that recombination of a whole pseudogene is followed by a second level of variation in which small segments of pseudogenes recombine into the expression site by gene conversion. Evidence for four short sequential changes in the hypervariable region of msp2 coupled with the identification of nine pseudogenes from a single strain of A. marginale provides for a combinatorial number of possible expressed MSP2 variants sufficient for lifelong persistence.
Modeling sports highlights using a time-series clustering framework and model interpretation
NASA Astrophysics Data System (ADS)
Radhakrishnan, Regunathan; Otsuka, Isao; Xiong, Ziyou; Divakaran, Ajay
2005-01-01
In our past work on sports highlights extraction, we have shown the utility of detecting audience reaction using an audio classification framework. The audio classes in the framework were chosen based on intuition. In this paper, we present a systematic way of identifying the key audio classes for sports highlights extraction using a time series clustering framework. We treat the low-level audio features as a time series and model the highlight segments as "unusual" events in a background of an "usual" process. The set of audio classes to characterize the sports domain is then identified by analyzing the consistent patterns in each of the clusters output from the time series clustering framework. The distribution of features from the training data so obtained for each of the key audio classes, is parameterized by a Minimum Description Length Gaussian Mixture Model (MDL-GMM). We also interpret the meaning of each of the mixture components of the MDL-GMM for the key audio class (the "highlight" class) that is correlated with highlight moments. Our results show that the "highlight" class is a mixture of audience cheering and commentator's excited speech. Furthermore, we show that the precision-recall performance for highlights extraction based on this "highlight" class is better than that of our previous approach which uses only audience cheering as the key highlight class.
2016 Summer Series Highlights - Inspire the Imagination
2017-01-20
Highlights of the 2016 Summer Series of lectures at NASA's Ames Research Center in Silicon Valley. Sponsored by the Ames Office of the Chief Scientist, the talks are designed to generate innovative discussion, as well as inspire and catalyze scientific progress.
Highlights from AQMEII Phase 2 & Next Steps
We present highlights of the results obtained in the second phase of the Air Quality Model Evaluation International Initiative (AQMEII) that was completed in May 2014. Activities in this phase were focused on the application and evaluation of coupled meteorology-chemistry models ...
Evidence for Loss of a Partial Flagellar Glycolytic Pathway during Trypanosomatid Evolution
Brown, Robert W. B.; Collingridge, Peter W.; Gull, Keith; Rigden, Daniel J.; Ginger, Michael L.
2014-01-01
Classically viewed as a cytosolic pathway, glycolysis is increasingly recognized as a metabolic pathway exhibiting surprisingly wide-ranging variations in compartmentalization within eukaryotic cells. Trypanosomatid parasites provide an extreme view of glycolytic enzyme compartmentalization as several glycolytic enzymes are found exclusively in peroxisomes. Here, we characterize Trypanosoma brucei flagellar proteins resembling glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoglycerate kinase (PGK): we show the latter associates with the axoneme and the former is a novel paraflagellar rod component. The paraflagellar rod is an essential extra-axonemal structure in trypanosomes and related protists, providing a platform into which metabolic activities can be built. Yet, bioinformatics interrogation and structural modelling indicate neither the trypanosome PGK-like nor the GAPDH-like protein is catalytically active. Orthologs are present in a free-living ancestor of the trypanosomatids, Bodo saltans: the PGK-like protein from B. saltans also lacks key catalytic residues, but its GAPDH-like protein is predicted to be catalytically competent. We discuss the likelihood that the trypanosome GAPDH-like and PGK-like proteins constitute molecular evidence for evolutionary loss of a flagellar glycolytic pathway, either as a consequence of niche adaptation or the re-localization of glycolytic enzymes to peroxisomes and the extensive changes to glycolytic flux regulation that accompanied this re-localization. Evidence indicating loss of localized ATP provision via glycolytic enzymes therefore provides a novel contribution to an emerging theme of hidden diversity with respect to compartmentalization of the ubiquitous glycolytic pathway in eukaryotes. A possibility that trypanosome GAPDH-like protein additionally represents a degenerate example of a moonlighting protein is also discussed. PMID:25050549
Baibai, Tarik; Oukhattar, Laila; Mountassif, Driss; Assobhei, Omar; Serrano, Aurelio; Soukri, Abdelaziz
2010-12-01
The NAD(+)-dependent cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPDH, EC 1.2.1.12), which is recognized as a key to central carbon metabolism in glycolysis and gluconeogenesis and as an important allozymic polymorphic biomarker, was purified from muscles of two marine species: the skeletal muscle of Sardina pilchardus Walbaum (Teleost, Clupeida) and the incompressible arm muscle of Octopus vulgaris (Mollusca, Cephalopoda). Comparative biochemical studies have revealed that they differ in their subunit molecular masses and in pI values. Partial cDNA sequences corresponding to an internal region of the GapC genes from Sardina and Octopus were obtained by polymerase chain reaction using degenerate primers designed from highly conserved protein motifs. Alignments of the deduced amino acid sequences were used to establish the 3D structures of the active site of two enzymes as well as the phylogenetic relationships of the sardine and octopus enzymes. These two enzymes are the first two GAPDHs characterized so far from teleost fish and cephalopod, respectively. Interestingly, phylogenetic analyses indicated that the sardina GAPDH is in a cluster with the archetypical enzymes from other vertebrates, while the octopus GAPDH comes together with other molluscan sequences in a distant basal assembly closer to bacterial and fungal orthologs, thus suggesting their different evolutionary scenarios.
Plasmodium glyceraldehyde-3-phosphate dehydrogenase: A potential malaria diagnostic target.
Krause, Robert G E; Hurdayal, Ramona; Choveaux, David; Przyborski, Jude M; Coetzer, Theresa H T; Goldring, J P Dean
2017-08-01
Malaria rapid diagnostic tests (RDTs) are immunochromatographic tests detecting Plasmodial histidine-rich protein 2 (HRP2), lactate dehydrogenase (LDH) and aldolase. HRP2 is only expressed by Plasmodium falciparum parasites and the protein is not expressed in several geographic isolates. LDH-based tests lack sensitivity compared to HRP2 tests. This study explored the potential of the Plasmodial glycolytic enzyme, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), as a new malaria diagnostic biomarker. The P. falciparum and P. yoelii proteins were recombinantly expressed in BL21(DE3) Escherischia coli host cells and affinity purified. Two epitopes (CADGFLLIGEKKVSVFA and CAEKDPSQIPWGKCQV) specific to P. falciparum GAPDH and one common to all mammalian malaria species (CKDDTPIYVMGINH) were identified. Antibodies were raised in chickens against the two recombinant proteins and the three epitopes and affinity purified. The antibodies detected the native protein in parasite lysates as a 38 kDa protein and immunofluorescence verified a parasite cytosolic localization for the native protein. The antibodies suggested a 4-6 fold higher concentration of native PfGAPDH compared to PfLDH in immunoprecipitation and ELISA formats, consistent with published proteomic data. PfGAPDH shows interesting potential as a malaria diagnostic biomarker. Copyright © 2017 Elsevier Inc. All rights reserved.
Hair highlights and severe acute irritant dermatitis ("burn") of the scalp.
Chan, Heidi P; Maibach, Howard I
2010-12-01
These days, most celebrities--young and old--have their hair highlighted. That is why it is not surprising that even the youth have their hair highlighted as they emulate their favorite actors, unaware of the harmful consequences of this unsafe procedure. Hair highlighting involves decolorizing melanin pigments of select hair strands through an oxidation reaction under alkaline conditions by the active ingredients of the highlighting mixture--hydrogen peroxide, persulfates, and metasilicate. Hydrogen peroxide and the persulfates are flammable, necessitating that regulatory bodies (namely, the U.S. Food and Drug Administration [FDA] and the Cosmetic Ingredient Review [CIR] Expert Panel, the European Union's (EU), European Economic Community [EEC] directives, the Australian government's National Industrial Chemicals Notification and Assessment Scheme [NICNAS], and the Association of Southeast Asian Nations [ASEAN]) to regulate the permissible amounts of these chemicals in hair highlighting products. To review published case reports of resulting in severe acute irritant dermatitis ("burns") of the scalp caused by hair highlighting, to explain why these scalp burns happen, to identify preventive measures to avoid such occurrences, and to discuss the implications for society. We searched medical and scientific search engines and used keywords such as hair highlights, scalp burn, and other related terms.. Six articles were obtained, yielding 8 reported cases (2 of the 6 articles had 2 cases each) of hair highlighting resulting in scalp burns; these 8 cases were reviewed and analyzed. Five of the 8 patients belonged to the pediatric age group. The causes of scalp burn were classified into 2 categories: chemical (caustic nature of the highlighting mixture, spillage of the hot mixture, toxic reaction to the dyes) and thermal (by contact of the scalp with overheated aluminum foil and by the blow dryer). The 5 pediatric patients in the group unnecessarily suffered pain and
NASA Technical Reports Server (NTRS)
Bennett, Jerome (Technical Monitor)
2002-01-01
The NASA Center for Computational Sciences (NCCS) is a high-performance scientific computing facility operated, maintained and managed by the Earth and Space Data Computing Division (ESDCD) of NASA Goddard Space Flight Center's (GSFC) Earth Sciences Directorate. The mission of the NCCS is to advance leading-edge science by providing the best people, computers, and data storage systems to NASA's Earth and space sciences programs and those of other U.S. Government agencies, universities, and private institutions. Among the many computationally demanding Earth science research efforts supported by the NCCS in Fiscal Year 1999 (FY99) are the NASA Seasonal-to-Interannual Prediction Project, the NASA Search and Rescue Mission, Earth gravitational model development efforts, the National Weather Service's North American Observing System program, Data Assimilation Office studies, a NASA-sponsored project at the Center for Ocean-Land-Atmosphere Studies, a NASA-sponsored microgravity project conducted by researchers at the City University of New York and the University of Pennsylvania, the completion of a satellite-derived global climate data set, simulations of a new geodynamo model, and studies of Earth's torque. This document presents highlights of these research efforts and an overview of the NCCS, its facilities, and its people.
Highlighting relatedness promotes prosocial motives and behavior.
Pavey, Louisa; Greitemeyer, Tobias; Sparks, Paul
2011-07-01
According to self-determination theory, people have three basic psychological needs: relatedness, competence, and autonomy. Of these, the authors reasoned that relatedness need satisfaction is particularly important for promoting prosocial behavior because of the increased sense of connectedness to others that this engenders. In Experiment 1, the authors manipulated relatedness, autonomy, competence, or gave participants a neutral task, and found that highlighting relatedness led to higher interest in volunteering and intentions to volunteer relative to the other conditions. Experiment 2 found that writing about relatedness experiences promoted feelings of connectedness to others, which in turn predicted greater prosocial intentions. Experiment 3 found that relatedness manipulation participants donated significantly more money to charity than did participants given a neutral task. The results suggest that highlighting relatedness increases engagement in prosocial activities and are discussed in relation to the conflict and compatibility between individual and social outcomes. © 2011 by the Society for Personality and Social Psychology, Inc
Medicaid Highlights: Dually Eligible Enrollees: 2002
Lied, Terry R.
2006-01-01
Individuals eligible in both Medicaid and Medicare, the dually eligible enrollees, account for a disproportionate share of Medicaid utilization and payments. While comprising 14.7 percent of the Medicaid population, they accounted for 40.5 percent of Medicaid payments in 2002. Mean reimbursement for the dually eligible enrollees was nearly four times that of non-dually eligible Medicaid enrollees. This highlight examines utilization and payment data for the dually eligible enrollees in 2002. PMID:17290663
Chapman, Joanne R; Waldenström, Jonas
2015-01-01
The choice of reference genes that are stably expressed amongst treatment groups is a crucial step in real-time quantitative PCR gene expression studies. Recent guidelines have specified that a minimum of two validated reference genes should be used for normalisation. However, a quantitative review of the literature showed that the average number of reference genes used across all studies was 1.2. Thus, the vast majority of studies continue to use a single gene, with β-actin (ACTB) and/or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) being commonly selected in studies of vertebrate gene expression. Few studies (15%) tested a panel of potential reference genes for stability of expression before using them to normalise data. Amongst studies specifically testing reference gene stability, few found ACTB or GAPDH to be optimal, whereby these genes were significantly less likely to be chosen when larger panels of potential reference genes were screened. Fewer reference genes were tested for stability in non-model organisms, presumably owing to a dearth of available primers in less well characterised species. Furthermore, the experimental conditions under which real-time quantitative PCR analyses were conducted had a large influence on the choice of reference genes, whereby different studies of rat brain tissue showed different reference genes to be the most stable. These results highlight the importance of validating the choice of normalising reference genes before conducting gene expression studies.
Gentile, Adriana-Mariel; Lhamyani, Said; Coín-Aragüez, Leticia; Oliva-Olivera, Wilfredo; Zayed, Hatem; Vega-Rioja, Antonio; Monteseirin, Javier; Romero-Zerbo, Silvana-Yanina; Tinahones, Francisco-José; Bermúdez-Silva, Francisco-Javier; El Bekay, Rajaa
2016-01-01
Real-time or quantitative PCR (qPCR) is a useful technique that requires reliable reference genes for data normalization in gene expression analysis. Adipogenesis is among the biological processes suitable for this technique. The selection of adequate reference genes is essential for qPCR gene expression analysis of human Vascular Stromal Cells (hVSCs) during their differentiation into adipocytes. To the best of our knowledge, there are no studies validating reference genes for the analyses of visceral and subcutaneous adipose tissue hVSCs from subjects with different Body Mass Index (BMI) and Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) index. The present study was undertaken to analyze this question. We first analyzed the stability of expression of five potential reference genes: CYC, GAPDH, RPL13A, EEF1A1, and 18S ribosomal RNA, during in vitro adipogenic differentiation, in samples from these types of patients. The expression of RPL13A and EEF1A1 was not affected by differentiation, thus being these genes the most stable candidates, while CYC, GAPDH, and 18S were not suitable for this sort of analysis. This work highlights that RPL13A and EEF1A1 are good candidates as reference genes for qPCR analysis of hVSCs differentiation into adipocytes from subjects with different BMI and HOMA-IR.
Gentile, Adriana-Mariel; Lhamyani, Said; Coín-Aragüez, Leticia; Oliva-Olivera, Wilfredo; Zayed, Hatem; Vega-Rioja, Antonio; Monteseirin, Javier; Romero-Zerbo, Silvana-Yanina; Tinahones, Francisco-José; Bermúdez-Silva, Francisco-Javier; El Bekay, Rajaa
2016-01-01
Real-time or quantitative PCR (qPCR) is a useful technique that requires reliable reference genes for data normalization in gene expression analysis. Adipogenesis is among the biological processes suitable for this technique. The selection of adequate reference genes is essential for qPCR gene expression analysis of human Vascular Stromal Cells (hVSCs) during their differentiation into adipocytes. To the best of our knowledge, there are no studies validating reference genes for the analyses of visceral and subcutaneous adipose tissue hVSCs from subjects with different Body Mass Index (BMI) and Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) index. The present study was undertaken to analyze this question. We first analyzed the stability of expression of five potential reference genes: CYC, GAPDH, RPL13A, EEF1A1, and 18S ribosomal RNA, during in vitro adipogenic differentiation, in samples from these types of patients. The expression of RPL13A and EEF1A1 was not affected by differentiation, thus being these genes the most stable candidates, while CYC, GAPDH, and 18S were not suitable for this sort of analysis. This work highlights that RPL13A and EEF1A1 are good candidates as reference genes for qPCR analysis of hVSCs differentiation into adipocytes from subjects with different BMI and HOMA-IR. PMID:27304673
Chlorophyll b degradation by chlorophyll b reductase under high-light conditions.
Sato, Rei; Ito, Hisashi; Tanaka, Ayumi
2015-12-01
The light-harvesting chlorophyll a/b binding protein complex of photosystem II (LHCII) is the main antenna complex of photosystem II (PSII). Plants change their LHCII content depending on the light environment. Under high-light conditions, the content of LHCII should decrease because over-excitation damages the photosystem. Chlorophyll b is indispensable for accumulating LHCII, and chlorophyll b degradation induces LHCII degradation. Chlorophyll b degradation is initiated by chlorophyll b reductase (CBR). In land plants, NON-YELLOW COLORING 1 (NYC1) and NYC1-Like (NOL) are isozymes of CBR. We analyzed these mutants to determine their functions under high-light conditions. During high-light treatment, the chlorophyll a/b ratio was stable in the wild-type (WT) and nol plants, and the LHCII content decreased in WT plants. The chlorophyll a/b ratio decreased in the nyc1 and nyc1/nol plants, and a substantial degree of LHCII was retained in nyc1/nol plants after the high-light treatment. These results demonstrate that NYC1 degrades the chlorophyll b on LHCII under high-light conditions, thus decreasing the LHCII content. After the high-light treatment, the maximum quantum efficiency of the PSII photochemistry was lower in nyc1 and nyc1/nol plants than in WT and nol plants. A larger light-harvesting system would damage PSII in nyc1 and nyc1/nol plants. The fluorescence spectroscopy of the leaves indicated that photosystem I was also damaged by the excess LHCII in nyc1/nol plants. These observations suggest that chlorophyll b degradation by NYC1 is the initial reaction for the optimization of the light-harvesting capacity under high-light conditions.
Highlights from Education at a Glance 2010
ERIC Educational Resources Information Center
OECD Publishing (NJ3), 2010
2010-01-01
"Highlights from Education at a Glance 2010" is a companion publication to the OECD's flagship compendium of education statistics, Education at a Glance. It provides easily accessible data on key topics in education today, including: education levels and student numbers, economic and social benefits of education, education spending, the school…
Are Synonymous Substitutions in Flowering Plant Mitochondria Neutral?
Wynn, Emily L; Christensen, Alan C
2015-10-01
Angiosperm mitochondrial genes appear to have very low mutation rates, while non-gene regions expand, diverge, and rearrange quickly. One possible explanation for this disparity is that synonymous substitutions in plant mitochondrial genes are not truly neutral and selection keeps their occurrence low. If this were true, the explanation for the disparity in mutation rates in genes and non-genes needs to consider selection as well as mechanisms of DNA repair. Rps14 is co-transcribed with cob and rpl5 in most plant mitochondrial genomes, but in some genomes, rps14 has been duplicated to the nucleus leaving a pseudogene in the mitochondria. This provides an opportunity to compare neutral substitution rates in pseudogenes with synonymous substitution rates in the orthologs. Genes and pseudogenes of rps14 have been aligned among different species and the mutation rates have been calculated. Neutral substitution rates in pseudogenes and synonymous substitution rates in genes are significantly different, providing evidence that synonymous substitutions in plant mitochondrial genes are not completely neutral. The non-neutrality is not sufficient to completely explain the exceptionally low mutation rates in land plant mitochondrial genomes, but selective forces appear to play a small role.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish
2009-06-08
The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate
Highlight shapes and perception of gloss for real and photographed objects.
van Assen, Jan Jaap R; Wijntjes, Maarten W A; Pont, Sylvia C
2016-01-01
Gloss perception strongly depends on the three-dimensional shape and the illumination of the object under consideration. In this study we investigated the influence of the spatial structure of the illumination on gloss perception. A diffuse light box in combination with differently shaped masks was used to produce a set of six simple and complex highlight shapes. The geometry of the simple highlight shapes was inspired by conventional artistic practice (e.g., ring flash for photography, window shape for painting and disk or square for cartoons). In the box we placed spherical stimuli that were painted in six degrees of glossiness. This resulted in a stimulus set of six highlight shapes and six gloss levels, a total of 36 stimuli. We performed three experiments of which two took place using digital photographs on a computer monitor and one with the real spheres in the light box. The observers had to perform a comparison task in which they chose which of two stimuli was glossiest and a rating task in which they rated the glossiness. The results show that, perhaps surprisingly, more complex highlight shapes were perceived to produce a less glossy appearance than simple highlight shapes such as a disk or square. These findings were confirmed for both viewing conditions, on a computer display and in a real setting. The results show that variations in the spatial structure of "rather simple" illumination of the "extended source" type highlight influences perceived glossiness.
Langley aerospace test highlights - 1986
NASA Technical Reports Server (NTRS)
1987-01-01
The role of the Langley Research Center is to perform basic and applied research necessary for the advancement of aeronautics and space flight, to generate new and advanced concepts for the accomplishment of related national goals, and to provide research advice, technological support, and assistance to other NASA installations, other government agencies, and industry. This report highlights some of the significant tests which were performed during calendar year 1986 in Langley test facilities, a number of which are unique in the world. The report illustrates both the broad range of the research and technology activities at the Langley Research Center and the contributions of this work toward maintaining United States leadership in aeronautics and space research.
Langley aerospace test highlights, 1988
NASA Technical Reports Server (NTRS)
1989-01-01
The role of the Langley Research Center is to perform basic and applied research necessary for the advancement of aeronautics and space flight, to generate new and advanced concepts for the accomplishment of related national goals, and to provide research advice, technological support, and assistance to other NASA installations, other government agencies, and industry. Some of the significant tests which were performed during calendar year 1988 in Langley test facilities, a number of which are unique in the world are highlighted. Both the broad range of the research and technology activities at the Langley Research Center and the contributions of this work toward maintaining United States leadership in aeronautics and space research are illustrated.
ISPAE Research Highlights 1995-1997
NASA Technical Reports Server (NTRS)
Harwell, Ken
1997-01-01
This paper presents ISPAE (Institute for Space Physics, Astrophysics and Education) research highlights from 1995-1997. The topics include: 1) High-Energy Astrophysics (Finding the smoking gun in gamma-ray bursts, Playing peekaboo with gamma ray bursts, and Spectral pulses muddle burst source study, Einstein was right: Black holes do spin, Astronomers find "one-man X-ray band", and Cosmic rays from the supernova next door?); 2) Solar Physics (Bright burst confirms solar storm model, Model predicts speed of solar wind in space, and Angry sunspots snap under the strain); 3) Gravitational Physics; 4) Tether Dynamics; and 5) Space Physics (Plasma winds blow form polar regions, De-SCIFERing thermal electrons, and UVI lets scientists see daytime aurora).
Aeroacoustics research in Europe: The CEAS-ASC report on 2012 highlights
NASA Astrophysics Data System (ADS)
Bodén, H.; Efraimsson, G.
2013-12-01
The Council of European Aerospace Societies (CEAS) Aeroacoustics Specialists Committee (ASC) supports and promotes the interests of the scientific and industrial aeroacoustics community on an European scale and European aeronautics activities internationally. In this context, "aeroacoustics" encompasses all aerospace acoustics and related areas. Each year the committee highlights some of the research and development projects in Europe. This paper is a report on highlights of aeroacoustics research in Europe in 2012, compiled from information provided to the ASC of the CEAS. During 2012, a number of research programmes involving aeroacoustics were funded by the European Commission. Some of the highlights from these programmes are summarized in this paper, as well as highlights from other programmes funded by national programmes or by industry. Enquiries concerning all contributions should be addressed to the authors who are given at the end of each subsection.
The repertoire of bitter taste receptor genes in canids.
Shang, Shuai; Wu, Xiaoyang; Chen, Jun; Zhang, Huanxin; Zhong, Huaming; Wei, Qinguo; Yan, Jiakuo; Li, Haotian; Liu, Guangshuai; Sha, Weilai; Zhang, Honghai
2017-07-01
Bitter taste receptors (Tas2rs) play important roles in mammalian defense mechanisms by helping animals detect and avoid toxins in food. Although Tas2r genes have been widely studied in several mammals, minimal research has been performed in canids. To analyze the genetic basis of Tas2r genes in canids, we first identified Tas2r genes in the wolf, maned wolf, red fox, corsac fox, Tibetan fox, fennec fox, dhole and African hunting dog. A total of 183 Tas2r genes, consisting of 118 intact genes, 6 partial genes and 59 pseudogenes, were detected. Differences in the pseudogenes were observed among nine canid species. For example, Tas2r4 was a pseudogene in the dog but might play a functional role in other canid species. The Tas2r42 and Tas2r10 genes were pseudogenes in the maned wolf and dhole, respectively, and the Tas2r5 and Tas2r34 genes were pseudogenes in the African hunting dog; however, these genes were intact genes in other canid species. The differences in Tas2r pseudogenes among canids might suggest that the loss of intact Tas2r genes in canid species is species-dependent. We further compared the 183 Tas2r genes identified in this study with Tas2r genes from ten additional carnivorous species to evaluate the potential influence of diet on the evolution of the Tas2r gene repertoire. Phylogenetic analysis revealed that most of the Tas2r genes from the 18 species intermingled across the tree, suggesting that Tas2r genes are conserved among carnivores. Within canids, we found that some Tas2r genes corresponded to the traditional taxonomic groupings, while some did not. PIC analysis showed that the number of Tas2r genes in carnivores exhibited no positive correlation with diet composition, which might be due to the limited number of carnivores included in our study.
Highlights of the 2011 National Youth Gang Survey
... Administrator Highlights of the 2011 National Youth Gang Survey Arlen Egley, Jr., and James C. Howell This ... 2010 to 1,824 in 2011. About the Survey Since 1996, the National Gang Center, through the ...
NASA Technical Reports Server (NTRS)
Evans, G. L.; Morey-Holton, E.; Turner, R. T.
1998-01-01
In the present study, we evaluated the possibility that the abnormal bone matrix produced during spaceflight may be associated with reduced expression of bone matrix protein genes. To test this possibility, we investigated the effects of a 14-day spaceflight (SLS-2 experiment) on steady-state mRNA levels for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), osteocalcin, osteonectin, and prepro-alpha(1) subunit of type I collagen in the major bone compartments of rat femur. There were pronounced site-specific differences in the steady-state levels of expression of the mRNAs for the three bone matrix proteins and GAPDH in normal weight-bearing rats, and these relationships were altered after spaceflight. Specifically, spaceflight resulted in decreases in mRNA levels for GAPDH (decreased in proximal metaphysis), osteocalcin (decreased in proximal metaphysis), osteonectin (decreased in proximal and distal metaphysis), and collagen (decreased in proximal and distal metaphysis) compared with ground controls. There were no changes in mRNA levels for matrix proteins or GAPDH in the shaft and distal epiphysis. These results demonstrate that spaceflight leads to site- and gene-specific decreases in mRNA levels for bone matrix proteins. These findings are consistent with the hypothesis that spaceflight-induced decreases in bone formation are caused by concomitant decreases in expression of genes for bone matrix proteins.
Gong, Zu-Kang; Wang, Shuang-Jie; Huang, Yong-Qi; Zhao, Rui-Qiang; Zhu, Qi-Fang; Lin, Wen-Zhen
2014-12-01
RT-qPCR is a commonly used method for evaluating gene expression; however, its accuracy and reliability are dependent upon the choice of appropriate reference gene(s), and there is limited information available on suitable reference gene(s) that can be used in mouse testis at different stages. In this study, using the RT-qPCR method, we investigated the expression variations of six reference genes representing different functional classes (Actb, Gapdh, Ppia, Tbp, Rps29, Hprt1) in mice testis during embryonic and postnatal development. The expression stabilities of putative reference genes were evaluated using five algorithms: geNorm, NormFinder, Bestkeeper, the comparative delta C(t) method and integrated tool RefFinder. Analysis of the results showed that Ppia, Gapdh and Actb were identified as the most stable genes and the geometric mean of Ppia, Gapdh and Actb constitutes an appropriate normalization factor for gene expression studies. The mRNA expression of AT1 as a test gene of interest varied depending upon which of the reference gene(s) was used as an internal control(s). This study suggested that Ppia, Gapdh and Actb are suitable reference genes among the six genes used for RT-qPCR normalization and provide crucial information for transcriptional analyses in future studies of gene expression in the developing mouse testis.
NASA Astrophysics Data System (ADS)
1989-11-01
Voyager encounter data are presented in computer animation (CA) and real (R) animation. The highlights include a view of 2 full rotations of Neptune. It shows spacecraft trajectory 'diving' over Neptune and intercepting Triton's orbit, depicting radiation and occulation zones. Also shown are a renegade orbit of Triton and Voyager's encounter with Neptune's Magnetopause. A model of the spacecraft's complex maneuvers during close encounters of Neptune and Triton is presented. A view from Earth of Neptune's occulation experiment is is shown as well as a recreation of Voyager's final pass. There is detail of Voyager's Image Compensation technique which produces Voyager images. Eighteen images were produced on June 22 - 23, 1989, from 57 million miles away. A 68 day sequence which provides a stroboscopic view - colorization approximates what is seen by the human eye. Real time images recorded live from Voyager on 8/24/89 are presented. Photoclinometry produced the topography of Triton. Three images are used to create a sequence of Neptune's rings. The globe of Neptune and 2 views of the south pole are shown as well as Neptune rotating. The rotation of a scooter is frozen in images showing differential motion. There is a view of rotation of the Great Dark Spot about its own axis. Photoclinometry provides a 3-dimensional perspective using a color mosaic of Triton images. The globe is used to indicate the orientation of Neptune's crescent. The east and west plumes on Triton are shown.
PARTICULATE CONTROL HIGHLIGHTS: RESEARCH ON ELECTROSTATIC PRECIPITATOR TECHNOLOGY
The report gives highlights of a major EPA research program on electrostatic precipitator (ESP) technology, directed toward improving the performance of ESPs in controlling industrial particulate emissions, notably fly ash from coal combustion in electric power plants. Relationsh...
NASA Astrophysics Data System (ADS)
Bernabei, R.; Belli, P.; d'Angelo, A.; d'Angelo, S.; Di Marco, A.; Montecchia, F.; Incicchitti, A.; Cappella, F.; Caracciolo, V.; Cerulli, R.; Dai, C. J.; He, H. L.; Kuang, H. H.; Ma, X. H.; Sheng, X. D.; Wang, R. G.; Ye, Z. P.
2016-11-01
The DAMA project develops and uses new/improved low background scintillation detectors to investigate the Dark Matter (DM) particle component(s) in the galactic halo and rare processes deep underground at the Gran Sasso National Laboratory (LNGS) of the I.N.F.N.. Here some highlights of DAMA/LIBRA (Large sodium Iodide Bulk for Rare processes) as a unique apparatus in direct DM investigation for its full sensitive mass, target material, intrinsic radio-purity, methodological approach and all the controls performed on the experimental parameters are outlined. The DAMA/LIBRA-phase1 and the former DAMA/NaI data (cumulative exposure 1.33 ton × yr, corresponding to 14 annual cycles) have reached a model-independent evidence at 9.3 σ C.L. for the presence of DM particles in the galactic halo exploiting the DM annual modulation signature with highly radio-pure NaI(Tl) target. Some of the perspectives of the presently running DAMA/LIBRA-phase2 are summarised and the powerful tools offered by a model independent strategy of DM investigation are pointed out.
NCI intramural research highlighted at 2014 AACR meeting
This year’s American Association for Cancer Research meeting featured plenary talks by two NCI scientists, Steven Rosenberg, M.D., and Louis Staudt, M.D., Ph.D., that highlighted the challenges in developing varied and potentially synergistic treatments f
Mohr, S; Hallak, H; de Boitte, A; Lapetina, E G; Brüne, B
1999-04-02
S-Nitrosylation of protein thiol groups by nitric oxide (NO) is a widely recognized protein modification. In this study we show that nitrosonium tetrafluoroborate (BF4NO), a NO+ donor, modified the thiol groups of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) by S-nitrosylation and caused enzyme inhibition. The resultant protein-S-nitrosothiol was found to be unstable and to decompose spontaneously, thereby restoring enzyme activity. In contrast, the NO-releasing compound S-nitrosoglutathione (GSNO) promoted S-glutathionylation of a thiol group of GAPDH both in vitro and under cellular conditions. The GSH-mixed protein disulfide formed led to a permanent enzyme inhibition, but upon dithiothreitol addition a functional active GAPDH was recovered. This S-glutathionylation is specific for GSNO because GSH itself was unable to produce protein-mixed disulfides. During cellular nitrosative stress, the production of intracellular GSNO might channel signaling responses to form protein-mixed disulfide that can regulate intracellular function.
Atmospheric Research 2012 Technical Highlights
NASA Technical Reports Server (NTRS)
Lau, William K -M.
2013-01-01
This annual report, as before, is intended for a broad audience. Our readers include colleagues within NASA, scientists outside the Agency, science graduate students, and members of the general public. Inside are descriptions of atmospheric research science highlights and summaries of our education and outreach accomplishments for calendar year 2012.The report covers research activities from the Mesoscale Atmospheric Processes Laboratory, the Climate and Radiation Laboratory, the Atmospheric Chemistry and Dynamics Laboratory, and the Wallops Field Support Office under the Office of Deputy Director for Atmospheres, Earth Sciences Division in the Sciences and Exploration Directorate of NASAs Goddard Space Flight Center. The overall mission of the office is advancing knowledge and understanding of the Earths atmosphere. Satellite missions, field campaigns, peer-reviewed publications, and successful proposals are essential to our continuing research.
Immunoglobulin genomics in the guinea pig (Cavia porcellus).
Guo, Yongchen; Bao, Yonghua; Meng, Qingwen; Hu, Xiaoxiang; Meng, Qingyong; Ren, Liming; Li, Ning; Zhao, Yaofeng
2012-01-01
In science, the guinea pig is known as one of the gold standards for modeling human disease. It is especially important as a molecular and cellular biology model for studying the human immune system, as its immunological genes are more similar to human genes than are those of mice. The utility of the guinea pig as a model organism can be further enhanced by further characterization of the genes encoding components of the immune system. Here, we report the genomic organization of the guinea pig immunoglobulin (Ig) heavy and light chain genes. The guinea pig IgH locus is located in genomic scaffolds 54 and 75, and spans approximately 6,480 kb. 507 V(H) segments (94 potentially functional genes and 413 pseudogenes), 41 D(H) segments, six J(H) segments, four constant region genes (μ, γ, ε, and α), and one reverse δ remnant fragment were identified within the two scaffolds. Many V(H) pseudogenes were found within the guinea pig, and likely constituted a potential donor pool for gene conversion during evolution. The Igκ locus mapped to a 4,029 kb region of scaffold 37 and 24 is composed of 349 V(κ) (111 potentially functional genes and 238 pseudogenes), three J(κ) and one C(κ) genes. The Igλ locus spans 1,642 kb in scaffold 4 and consists of 142 V(λ) (58 potentially functional genes and 84 pseudogenes) and 11 J(λ) -C(λ) clusters. Phylogenetic analysis suggested the guinea pig's large germline V(H) gene segments appear to form limited gene families. Therefore, this species may generate antibody diversity via a gene conversion-like mechanism associated with its pseudogene reserves.
Immunoglobulin Genomics in the Guinea Pig (Cavia porcellus)
Guo, Yongchen; Bao, Yonghua; Meng, Qingwen; Hu, Xiaoxiang; Meng, Qingyong; Ren, Liming; Li, Ning; Zhao, Yaofeng
2012-01-01
In science, the guinea pig is known as one of the gold standards for modeling human disease. It is especially important as a molecular and cellular biology model for studying the human immune system, as its immunological genes are more similar to human genes than are those of mice. The utility of the guinea pig as a model organism can be further enhanced by further characterization of the genes encoding components of the immune system. Here, we report the genomic organization of the guinea pig immunoglobulin (Ig) heavy and light chain genes. The guinea pig IgH locus is located in genomic scaffolds 54 and 75, and spans approximately 6,480 kb. 507 VH segments (94 potentially functional genes and 413 pseudogenes), 41 DH segments, six JH segments, four constant region genes (μ, γ, ε, and α), and one reverse δ remnant fragment were identified within the two scaffolds. Many VH pseudogenes were found within the guinea pig, and likely constituted a potential donor pool for gene conversion during evolution. The Igκ locus mapped to a 4,029 kb region of scaffold 37 and 24 is composed of 349 Vκ (111 potentially functional genes and 238 pseudogenes), three Jκ and one Cκ genes. The Igλ locus spans 1,642 kb in scaffold 4 and consists of 142 Vλ (58 potentially functional genes and 84 pseudogenes) and 11 Jλ -Cλ clusters. Phylogenetic analysis suggested the guinea pig’s large germline VH gene segments appear to form limited gene families. Therefore, this species may generate antibody diversity via a gene conversion-like mechanism associated with its pseudogene reserves. PMID:22761756
Straub, Shannon C K; Cronn, Richard C; Edwards, Christopher; Fishbein, Mark; Liston, Aaron
2013-01-01
Horizontal gene transfer (HGT) of DNA from the plastid to the nuclear and mitochondrial genomes of higher plants is a common phenomenon; however, plastid genomes (plastomes) are highly conserved and have generally been regarded as impervious to HGT. We sequenced the 158 kb plastome and the 690 kb mitochondrial genome of common milkweed (Asclepias syriaca [Apocynaceae]) and found evidence of intracellular HGT for a 2.4-kb segment of mitochondrial DNA to the rps2-rpoC2 intergenic spacer of the plastome. The transferred region contains an rpl2 pseudogene and is flanked by plastid sequence in the mitochondrial genome, including an rpoC2 pseudogene, which likely provided the mechanism for HGT back to the plastome through double-strand break repair involving homologous recombination. The plastome insertion is restricted to tribe Asclepiadeae of subfamily Asclepiadoideae, whereas the mitochondrial rpoC2 pseudogene is present throughout the subfamily, which confirms that the plastid to mitochondrial HGT event preceded the HGT to the plastome. Although the plastome insertion has been maintained in all lineages of Asclepiadoideae, it shows minimal evidence of transcription in A. syriaca and is likely nonfunctional. Furthermore, we found recent gene conversion of the mitochondrial rpoC2 pseudogene in Asclepias by the plastid gene, which reflects continued interaction of these genomes.
Role of TMS1 Silencing in the Resistance of Breast Cancer Cells to Apoptosis
2006-08-01
USA 93: Kelliher MA, Grimm S, Ishida Y, Kuo F , Stanger BZ, Leder 14486-14491. P. (1998). Immunity 8: 297-303. Stehlik C , Fiorentino L , Dorfleutner A ...Caspase-8 - TMS1.. -. - GAPDH - . B. CuX+ siRNA: CHX TRAIL Lamin A / C + - + - TMS1 + - + Procaspase-8 f t Cleaved Caspase-8 - - 3 TMS1 . 03-tubulin...analysis for caspase-8, TMS 1 and either GAPDH or P3-tubulin as indicated. siRNA: Lamin A / C TMS1 TNFa+CHX - +- - + TRAIL -+ - + PARP -m l PARP p85
Aeroacoustics research in Europe: The CEAS-ASC report on 2013 highlights
NASA Astrophysics Data System (ADS)
Bennett, G. J.; Kennedy, J.; Meskell, C.; Carley, M.; Jordan, P.; Rice, H.
2015-03-01
The Council of European Aerospace Societies (CEAS) Aeroacoustics Specialists Committee (ASC) supports and promotes the interests of the scientific and industrial aeroacoustics community on an European scale and European aeronautics activities internationally. In this context, "aeroacoustics" encompasses all aerospace acoustics and related areas. Each year the committee highlights some of the research and development projects in Europe. This paper is a report on highlights of aeroacoustics research in Europe in 2013, compiled from information provided to the ASC of the CEAS. During 2013, a number of research programmes involving aeroacoustics were funded by the European Commission. Some of the highlights from these programmes are summarised in this paper, as well as highlights from other programmes funded by national programmes or by industry. Furthermore, a concise summary of the CEAS-ASC workshop "Atmospheric and Ground Effects on Aircraft Noise" held in Seville, Spain in September 2013 is included in this report. Enquiries concerning all contributions should be addressed to the authors who are given at the end of each subsection. This issue of the "highlights" paper is dedicated to the memory of Prof. John A. Fitzpatrick, Professor of Mechanical Engineering, Trinity College Dublin, and a valued member of the Aeroacoustics Specialists Committee. John passed away in September 2012 and is fondly missed across the globe by the friends he made in the Aeroacoustics Community. This paper is edited by PhD graduates and colleagues of John's who conduct research in aeroacoustics, inspired by his thirst for knowledge.
Tobacco Use. Adolescent Health Highlight. Publication #2012-33
ERIC Educational Resources Information Center
Murphey, David; Barry, Megan; Vaughn, Brigitte; Terzian, Mary
2012-01-01
Cigarette smoking has steadily declined among adolescents during the last fifteen years, although use of some tobacco products, like cigars, has seen recent increases. However, large numbers of teens continue to use tobacco products. This "Adolescent Health Highlight" presents key research findings; describes prevalence and trends; illustrates…
Geothermal Today: 2003 Geothermal Technologies Program Highlights (Revised)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
2004-05-01
This outreach publication highlights milestones and accomplishments of the DOE Geothermal Technologies Program for 2003. Included in this publication are discussions of geothermal fundamentals, enhanced geothermal systems, direct-use applications, geothermal potential in Idaho, coating technology, energy conversion R&D, and the GeoPowering the West initiative.
NASA Astrophysics Data System (ADS)
Yan, Lulu; Su, Jiaqi; Wang, Zhaoping; Yan, Xiwu; Yu, Ruihai
2017-12-01
Quantitative real-time polymerase chain reaction (qRT-PCR) is a rapid and reliable technique which has been widely used to quantifying gene transcripts (expression analysis). It is also employed for studying heterosis, hybridization breeding and hybrid tolerability of oysters, an ecologically and economically important taxonomic group. For these studies, selection of a suitable set of housekeeping genes as references is crucial for correct interpretation of qRT-PCR data. To identify suitable reference genes for oysters during low temperature and low salinity stresses, we analyzed twelve genes from the gill tissue of Crassostrea sikamea (SS), Crassostrea angulata (AA) and their hybrid (SA), which included three ribosomal genes, 28S ribosomal protein S5 ( RPS5), ribosomal protein L35 ( RPL35), and 60S ribosomal protein L29 ( RPL29); three structural genes, tubulin gamma ( TUBγ), annexin A6 and A7 ( AA6 and AA7); three metabolic pathway genes, ornithine decarboxylase ( OD), glyceraldehyde-3-phosphate dehydrogenase ( GAPDH) and glutathione S-transferase P1 ( GSP); two transcription factors, elongation factor 1 alpha and beta ( EF1α and EF1β); and one protein synthesis gene (ubiquitin ( UBQ). Primers specific for these genes were successfully developed for the three groups of oysters. Three different algorithms, geNorm, NormFinder and BestKeeper, were used to evaluate the expression stability of these candidate genes. BestKeeper program was found to be the most reliable. Based on our analysis, we found that the expression of RPL35 and EF1α was stable under low salinity stress, and the expression of OD, GAPDH and EF1α was stable under low temperature stress in hybrid (SA) oyster; the expression of RPS5 and GAPDH was stable under low salinity stress, and the expression of RPS5, UBQ, GAPDH was stable under low temperature stress in SS oyster; the expression of RPS5, GAPDH, EF1β and AA7 was stable under low salinity stress, and the expression of RPL35, EF1α, GAPDH
Meeting highlights applications of Nek5000 simulation code | Argonne
Photos Videos Fact Sheets, Brochures and Reports Summer Science Writing Internship Careers Education Photos Videos Fact Sheets, Brochures and Reports Summer Science Writing Internship Meeting highlights
Sood, Tanushri Jerath; Lagah, Swati Viviyan; Sharma, Ankita; Singla, Suresh Kumar; Mukesh, Manishi; Chauhan, Manmohan Singh; Manik, Radheysham; Palta, Prabhat
2017-10-01
We evaluated the suitability of 10 candidate internal control genes (ICGs), belonging to different functional classes, namely ACTB, EEF1A1, GAPDH, HPRT1, HMBS, RPS15, RPS18, RPS23, SDHA, and UBC for normalizing the real-time quantitative polymerase chain reaction (qPCR) data of blastocyst-stage buffalo embryos produced by hand-made cloning and in vitro fertilization (IVF). Total RNA was isolated from three pools, each of cloned and IVF blastocysts (n = 50/pool) for cDNA synthesis. Two different statistical algorithms geNorm and NormFinder were used for evaluating the stability of these genes. Based on gene stability measure (M value) and pairwise variation (V value), calculated by geNorm analysis, the most stable ICGs were RPS15, HPRT1, and ACTB for cloned blastocysts, HMBS, UBC, and HPRT1 for IVF blastocysts and RPS15, GAPDH, and HPRT1 for both the embryo types analyzed together. RPS18 was the least stable gene for both cloned and IVF blastocysts. Following NormFinder analysis, the order of stability was RPS15 = HPRT1>GAPDH for cloned blastocysts, HMBS = UBC>RPS23 for IVF blastocysts, and HPRT1>GAPDH>RPS15 for cloned and IVF blastocysts together. These results suggest that despite overlapping of the three most stable ICGs between cloned and IVF blastocysts, the panel of ICGs selected for normalization of qPCR data of cloned and IVF blastocyst-stage embryos should be different.
Glycolysis determines dichotomous regulation of T cell subsets in hypoxia
Xu, Yang; Zhang, Ming; Savoldo, Barbara; Metelitsa, Leonid S.; Rodgers, John; Yustein, Jason T.; Neilson, Joel R.
2016-01-01
Hypoxia occurs in many pathological conditions, including chronic inflammation and tumors, and is considered to be an inhibitor of T cell function. However, robust T cell responses occur at many hypoxic inflammatory sites, suggesting that functions of some subsets are stimulated under low oxygen conditions. Here, we investigated how hypoxic conditions influence human T cell functions and found that, in contrast to naive and central memory T cells (TN and TCM), hypoxia enhances the proliferation, viability, and cytotoxic action of effector memory T cells (TEM). Enhanced TEM expansion in hypoxia corresponded to high hypoxia-inducible factor 1α (HIF1α) expression and glycolytic activity compared with that observed in TN and TCM. We determined that the glycolytic enzyme GAPDH negatively regulates HIF1A expression by binding to adenylate-uridylate–rich elements in the 3′-UTR region of HIF1A mRNA in glycolytically inactive TN and TCM. Conversely, active glycolysis with decreased GAPDH availability in TEM resulted in elevated HIF1α expression. Furthermore, GAPDH overexpression reduced HIF1α expression and impaired proliferation and survival of T cells in hypoxia, indicating that high glycolytic metabolism drives increases in HIF1α to enhance TEM function during hypoxia. This work demonstrates that glycolytic metabolism regulates the translation of HIF1A to determine T cell responses to hypoxia and implicates GAPDH as a potential mechanism for controlling T cell function in peripheral tissue. PMID:27294526
Approaches to Fungal Genome Annotation
Haas, Brian J.; Zeng, Qiandong; Pearson, Matthew D.; Cuomo, Christina A.; Wortman, Jennifer R.
2011-01-01
Fungal genome annotation is the starting point for analysis of genome content. This generally involves the application of diverse methods to identify features on a genome assembly such as protein-coding and non-coding genes, repeats and transposable elements, and pseudogenes. Here we describe tools and methods leveraged for eukaryotic genome annotation with a focus on the annotation of fungal nuclear and mitochondrial genomes. We highlight the application of the latest technologies and tools to improve the quality of predicted gene sets. The Broad Institute eukaryotic genome annotation pipeline is described as one example of how such methods and tools are integrated into a sequencing center’s production genome annotation environment. PMID:22059117
2010-01-01
Background Genome reduction is a common evolutionary process in symbiotic and pathogenic bacteria. This process has been extensively characterized in bacterial endosymbionts of insects, where primary mutualistic bacteria represent the most extreme cases of genome reduction consequence of a massive process of gene inactivation and loss during their evolution from free-living ancestors. Sodalis glossinidius, the secondary endosymbiont of tsetse flies, contains one of the few complete genomes of bacteria at the very beginning of the symbiotic association, allowing to evaluate the relative impact of mobile genetic element proliferation and gene inactivation over the structure and functional capabilities of this bacterial endosymbiont during the transition to a host dependent lifestyle. Results A detailed characterization of mobile genetic elements and pseudogenes reveals a massive presence of different types of prophage elements together with five different families of IS elements that have proliferated across the genome of Sodalis glossinidius at different levels. In addition, a detailed survey of intergenic regions allowed the characterization of 1501 pseudogenes, a much higher number than the 972 pseudogenes described in the original annotation. Pseudogene structure reveals a minor impact of mobile genetic element proliferation in the process of gene inactivation, with most of pseudogenes originated by multiple frameshift mutations and premature stop codons. The comparison of metabolic profiles of Sodalis glossinidius and tsetse fly primary endosymbiont Wiglesworthia glossinidia based on their whole gene and pseudogene repertoires revealed a novel case of pathway inactivation, the arginine biosynthesis, in Sodalis glossinidius together with a possible case of metabolic complementation with Wigglesworthia glossinidia for thiamine biosynthesis. Conclusions The complete re-analysis of the genome sequence of Sodalis glossinidius reveals novel insights in the
Highlighting inconsistencies regarding metal biosorption.
Robalds, Artis; Naja, Ghinwa Melodie; Klavins, Maris
2016-03-05
Thousands of articles have been devoted to examine different types of biosorbents and their use in cleaning polluted waters. An important objective of some studies has been the identification of the biosorption mechanisms. This type of investigation is not always performed, as it can only be done if scientists are aware of all mechanisms that, at least theoretically, control the removal of the target substances. Mistakes are often made, even in highly cited review articles, where biosorption mechanisms are named and/or grouped. The aim of this article is to highlight errors and inaccuracies as well as to discuss different classification systems of the biosorption mechanisms. This article serves as a guide, as well as a platform for discussion among researchers involved in the investigation of biosorbents, in an effort to avoid reproducing errors in subsequent articles. Copyright © 2015 Elsevier B.V. All rights reserved.
Analysis of Connected and Automated Vehicle Technologies Highlights
Uncertainty in Potential Effects on Fuel Use, Miles Traveled | News | NREL Analysis of Connected and Automated Vehicle Technologies Highlights Uncertainty in Potential Effects on Fuel Use, Miles Potential Effects on Fuel Use, Miles Traveled December 13, 2016 A joint study from the U.S. Department of
2012-01-01
Background Francisella is a genus of gram-negative bacterium highly virulent in fishes and human where F. tularensis is causing the serious disease tularaemia in human. Recently Francisella species have been reported to cause mortality in aquaculture species like Atlantic cod and tilapia. We have completed the sequencing and draft assembly of the Francisella noatunensis subsp. orientalisToba04 strain isolated from farmed Tilapia. Compared to other available Francisella genomes, it is most similar to the genome of Francisella philomiragia subsp. philomiragia, a free-living bacterium not virulent to human. Results The genome is rearranged compared to the available Francisella genomes even though we found no IS-elements in the genome. Nearly 16% percent of the predicted ORFs are pseudogenes. Computational pathway analysis indicates that a number of the metabolic pathways are disrupted due to pseudogenes. Comparing the novel genome with other available Francisella genomes, we found around 2.5% of unique genes present in Francisella noatunensis subsp. orientalis Toba04 and a list of genes uniquely present in the human-pathogenic Francisella subspecies. Most of these genes might have transferred from bacterial species through horizontal gene transfer. Comparative analysis between human and fish pathogen also provide insights into genes responsible for pathogenecity. Our analysis of pseudogenes indicates that the evolution of Francisella subspecies’s pseudogenes from Tilapia is old with large number of pseudogenes having more than one inactivating mutation. Conclusions The fish pathogen has lost non-essential genes some time ago. Evolutionary analysis of the Francisella genomes, strongly suggests that human and fish pathogenic Francisella species have evolved independently from free-living metabolically competent Francisella species. These findings will contribute to understanding the evolution of Francisella species and pathogenesis. PMID:23131096
Genomic gigantism: DNA loss is slow in mountain grasshoppers.
Bensasson, D; Petrov, D A; Zhang, D X; Hartl, D L; Hewitt, G M
2001-02-01
Several studies have shown DNA loss to be inversely correlated with genome size in animals. These studies include a comparison between Drosophila and the cricket, Laupala, but there has been no assessment of DNA loss in insects with very large genomes. Podisma pedestris, the brown mountain grasshopper, has a genome over 100 times as large as that of Drosophila and 10 times as large as that of Laupala. We used 58 paralogous nuclear pseudogenes of mitochondrial origin to study the characteristics of insertion, deletion, and point substitution in P. pedestris and Italopodisma. In animals, these pseudogenes are "dead on arrival"; they are abundant in many different eukaryotes, and their mitochondrial origin simplifies the identification of point substitutions accumulated in nuclear pseudogene lineages. There appears to be a mononucleotide repeat within the 643-bp pseudogene sequence studied that acts as a strong hot spot for insertions or deletions (indels). Because the data for other insect species did not contain such an unusual region, hot spots were excluded from species comparisons. The rate of DNA loss relative to point substitution appears to be considerably and significantly lower in the grasshoppers studied than in Drosophila or Laupala. This suggests that the inverse correlation between genome size and the rate of DNA loss can be extended to comparisons between insects with large or gigantic genomes (i.e., Laupala and Podisma). The low rate of DNA loss implies that in grasshoppers, the accumulation of point mutations is a more potent force for obscuring ancient pseudogenes than their loss through indel accumulation, whereas the reverse is true for Drosophila. The main factor contributing to the difference in the rates of DNA loss estimated for grasshoppers, crickets, and Drosophila appears to be deletion size. Large deletions are relatively rare in Podisma and Italopodisma.
2016 Highlights of Ferry Operations in the United States
DOT National Transportation Integrated Search
2017-10-01
This publication highlights data collected by the 2016 NCFO. The Bureau of Transportation Statistics (BTS) conducted the NCFO from April through November 2016, collecting the operational characteristics of the 2015 calendar year ferry operations.
Highlights of Commission 37 Science Results
NASA Astrophysics Data System (ADS)
Carraro, Giovanni; de Grijs, Richard; Elmegreen, Bruce; Stetson, Peter; Anthony-Twarog, Barbara; Goodwin, Simon; Geisler, Douglas; Minniti, Dante
2016-04-01
It is widely accepted that stars do not form in isolation but result from the fragmentation of molecular clouds, which in turn leads to star cluster formation. Over time, clusters dissolve or are destroyed by interactions with molecular clouds or tidal stripping, and their members become part of the general field population. Star clusters are thus among the basic building blocks of galaxies. In turn, star cluster populations, from young associations and open clusters to old globulars, are powerful tracers of the formation, assembly, and evolutionary history of their parent galaxies. Although their importance (e.g., in mapping out the Milky Way) had been recognised for decades, major progress in this area has only become possible in recent years, both for Galactic and extragalactic cluster populations. Star clusters are the observational foundation for stellar astrophysics and evolution, provide essential tracers of galactic structure, and are unique stellar dynamical environments. Star formation, stellar structure, stellar evolution, and stellar nucleosynthesis continue to benefit and improve tremendously from the study of these systems. Additionally, fundamental quantities such as the initial mass function can be successfully derived from modelling either the Hertzsprung-Russell diagrams or the integrated velocity structures of, respectively, resolved and unresolved clusters and cluster populations. Star cluster studies thus span the fields of Galactic and extragalactic astrophysics, while heavily affecting our detailed understanding of the process of star formation in dense environments. This report highlights science results of the last decade in the major fields covered by IAU Commission 37: Star clusters and associations. Instead of focusing on the business meeting - the out-going president presentation can be found here: http://www.sc.eso.org/gcarraro/splinter2015.pdf - this legacy report contains highlights of the most important scientific achievements in
Fermi GBM: Highlights from the First Year
NASA Technical Reports Server (NTRS)
Wilson-Hodge, Colleen A.
2009-01-01
The Fermi Gamma ray Burst Monitor is an all-sky instrument sensitive to photons from about 8 keV to 40 MeV. I will summarize highlights from the first year, including triggered observations of gamma ray bursts, soft gamma ray repeaters, and terrestrial gamma flashes, and observations in the continuous data of X-ray binaries and accreting X-ray pulsars. GBM provides complementary observations to Swift/BAT, observing many of the same sources, but over a wider energy range.
Highlights and Perspectives from the CMS Experiment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Butler, Joel Nathan
2017-09-09
In 2016, the Large Hadron Collider provided proton-proton collisions at 13 TeV center-of-mass energy and achieved very high luminosity and reliability. The performance of the CMS Experiment in this running period and a selection of recent physics results are presented. These include precision measurements and searches for new particles. The status and prospects for data-taking in 2017 and a brief summary of the highlights of the High Luminosity (HL-LHC) upgrade of the CMS detector are also presented.
Spring Research Festival Highlighted on WHAG-TV | Poster
WHAG-TV (Hagerstown, Md.) visited Fort Detrick to highlight the 2015 Spring Research Festival (SRF), sponsored by the National Interagency Confederation for Biological Research (NICBR). Visit the WHAG-TV website to see the video broadcast, which aired May 6. The video was produced by WHAG Reporter Mallory Sofastaii. The video featured Linganore High School senior Rebecca
Straub, Shannon C.K.; Cronn, Richard C.; Edwards, Christopher; Fishbein, Mark; Liston, Aaron
2013-01-01
Horizontal gene transfer (HGT) of DNA from the plastid to the nuclear and mitochondrial genomes of higher plants is a common phenomenon; however, plastid genomes (plastomes) are highly conserved and have generally been regarded as impervious to HGT. We sequenced the 158 kb plastome and the 690 kb mitochondrial genome of common milkweed (Asclepias syriaca [Apocynaceae]) and found evidence of intracellular HGT for a 2.4-kb segment of mitochondrial DNA to the rps2–rpoC2 intergenic spacer of the plastome. The transferred region contains an rpl2 pseudogene and is flanked by plastid sequence in the mitochondrial genome, including an rpoC2 pseudogene, which likely provided the mechanism for HGT back to the plastome through double-strand break repair involving homologous recombination. The plastome insertion is restricted to tribe Asclepiadeae of subfamily Asclepiadoideae, whereas the mitochondrial rpoC2 pseudogene is present throughout the subfamily, which confirms that the plastid to mitochondrial HGT event preceded the HGT to the plastome. Although the plastome insertion has been maintained in all lineages of Asclepiadoideae, it shows minimal evidence of transcription in A. syriaca and is likely nonfunctional. Furthermore, we found recent gene conversion of the mitochondrial rpoC2 pseudogene in Asclepias by the plastid gene, which reflects continued interaction of these genomes. PMID:24029811
NHTS : highlights of the 2001 National Household Travel Survey
DOT National Transportation Integrated Search
2003-01-01
The 2001 National Household Travel Survey (NHTS) is the first comprehensive household survey of both daily and long-distance travel, allowing for analysis of the full continuum of personal travel by Americans. This report presents selected highlights...
The Shortcomings of Medical Education Highlighted through Film
ERIC Educational Resources Information Center
Mahajan, Pranav
2012-01-01
The aims of this report are to highlight the shortcomings in medical education. To use a student made short film as an example of how issues that cause medical student distress can be displayed. To show that the process of film-making is a useful tool in reflection. To display that film is an effective device in raising awareness. (Contains 3…
Biotransformation and bioactivation reactions - 2015 literature highlights.
Baillie, Thomas A; Dalvie, Deepak; Rietjens, Ivonne M C M; Cyrus Khojasteh, S
2016-05-01
Since 1972, Drug Metabolism Reviews has been recognized as one of the principal resources for researchers in pharmacological, pharmaceutical and toxicological fields to keep abreast of advances in drug metabolism science in academia and the pharmaceutical industry. With a distinguished list of authors and editors, the journal covers topics ranging from relatively mature fields, such as cytochrome P450 enzymes, to a variety of emerging fields. We hope to continue this tradition with the current compendium of mini-reviews that highlight novel biotransformation processes that were published during the past year. Each review begins with a summary of the article followed by our comments on novel aspects of the research and their biological implications. This collection of highlights is not intended to be exhaustive, but rather to be illustrative of recent research that provides new insights or approaches that advance the field of drug metabolism. Abbreviations NAPQI N-acetyl-p-benzoquinoneimine ALDH aldehyde dehydrogenase AO aldehyde oxidase AKR aldo-keto reductase CES carboxylesterase CSB cystathionine β-synthase CSE cystathionine γ-lyase P450 cytochrome P450 DHPO 2,3-dihydropyridin-4-one ESI electrospray FMO flavin monooxygenase GSH glutathione GSSG glutathione disulfide ICPMS inductively coupled plasma mass spectrometry i.p. intraperitoneal MDR multidrug-resistant NNAL 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol NNK 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone oaTOF orthogonal acceleration time-of-flight PBK physiologically based kinetic PCP pentachlorophenol SDR short-chain dehydrogenase/reductase SULT sulfotransferase TB tuberculosis.
Peskin, Alexander V; Midwinter, Robyn G; Harwood, David T; Winterbourn, Christine C
2005-02-01
Hypochlorous acid formed by activated neutrophils reacts with amines to produce chloramines. Chloramines vary in stability, reactivity, and cell permeability. We have examined whether chloramine exchange occurs between physiologically important amines or amino acids and if this affects interactions of chloramines with cells. We have demonstrated transchlorination reactions between histamine, glycine, and taurine chloramines by measuring chloramine decay rates with mixtures as well as by mass spectrometry. Kinetic analysis suggested the formation of an intermediate complex with a high Km. Apparent second-order rate constants, determined for concentrations
Peskin, Alexander V; Midwinter, Robyn G; Harwood, David T; Winterbourn, Christine C
2004-11-15
Hypochlorous acid formed by activated neutrophils reacts with amines to produce chloramines. Chloramines vary in stability, reactivity, and cell permeability. We have examined whether chloramine exchange occurs between physiologically important amines or amino acids and if this affects interactions of chloramines with cells. We have demonstrated transchlorination reactions between histamine, glycine, and taurine chloramines by measuring chloramine decay rates with mixtures as well as by mass spectrometry. Kinetic analysis suggested the formation of an intermediate complex with a high K(m). Apparent second-order rate constants, determined for concentrations
Stroylova, Yulia Y; Semenyuk, Pavel I; Asriyantz, Regina A; Gaillard, Cedric; Haertlé, Thomas; Muronetz, Vladimir I
2014-09-01
The current study describes an approach to creation of catalytically active particles with increased stability from enzymes by N-homocysteinylation, a naturally presented protein modification. Enzymatic activities and properties of two globular tetrameric enzymes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and lactate dehydrogenase (LDH) were studied before and after N-homocysteinylation. Modification of these proteins concerns the accessible lysine residues and introduces an average of 2-2,5 homocysteine residues per protein monomer. Formation of a range of aggregates was observed for both enzymes, which assemble via formation of intermolecular noncovalent bonds and by disulfide bonds. It was demonstrated that both studied enzymes retain their catalytic activities on modification and the subsequent formation of oligomeric forms. At low concentrations of homocysteine thiolactone, modification of GAPDH leads not only to prevention of spontaneous inactivation but also increases thermal stability of this enzyme on heating to 80°C. A moderate reduction of the activity of GAPDH observed in case of its crosslinking with 50-fold excess of homocysteine thiolactone per lysine is probably caused by hindered substrate diffusion. Spherical particles of 100 nm and larger diameters were observed by transmission electron microscopy and atomic force microscope techniques after modification of GAPDH with different homocysteine thiolactone concentrations. In case of LDH, branched fibril-like aggregates were observed under the same conditions. Interestingly, crosslinked samples of both proteins were found to have reversible thermal denaturation profiles, indicating that modification with homocysteine thiolactone stabilizes the spatial structure of these enzymes. © 2014 Wiley Periodicals, Inc.
Zhang, Yanfei; Kouril, Theresa; Snoep, Jacky L; Siebers, Bettina; Barberis, Matteo; Westerhoff, Hans V
2017-04-20
Mathematical models are key to systems biology where they typically describe the topology and dynamics of biological networks, listing biochemical entities and their relationships with one another. Some (hyper)thermophilic Archaea contain an enzyme, called non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase (GAPN), which catalyzes the direct oxidation of glyceraldehyde-3-phosphate to 3-phosphoglycerate omitting adenosine 5'-triphosphate (ATP) formation by substrate-level-phosphorylation via phosphoglycerate kinase. In this study we formulate three hypotheses that could explain functionally why GAPN exists in these Archaea, and then construct and use mathematical models to test these three hypotheses. We used kinetic parameters of enzymes of Sulfolobus solfataricus ( S. solfataricus ) which is a thermo-acidophilic archaeon that grows optimally between 60 and 90 °C and between pH 2 and 4. For comparison, we used a model of Saccharomyces cerevisiae ( S. cerevisiae ), an organism that can live at moderate temperatures. We find that both the first hypothesis, i.e., that the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plus phosphoglycerate kinase (PGK) route (the alternative to GAPN) is thermodynamically too much uphill and the third hypothesis, i.e., that GAPDH plus PGK are required to carry the flux in the gluconeogenic direction, are correct. The second hypothesis, i.e., that the GAPDH plus PGK route delivers less than the 1 ATP per pyruvate that is delivered by the GAPN route, is only correct when GAPDH reaction has a high rate and 1,3- bis -phosphoglycerate (BPG) spontaneously degrades to 3PG at a high rate.
FY17 Transportation and Hydrogen Systems Center Journal Publication Highlights
DOE Office of Scientific and Technical Information (OSTI.GOV)
NREL's Transportation and Hydrogen Systems Center published 39 journal articles in fiscal year 2017 highlighting recent research in advanced vehicle technology, alternative fuels, and hydrogen systems.
Ranking Highlights in Personal Videos by Analyzing Edited Videos.
Sun, Min; Farhadi, Ali; Chen, Tseng-Hung; Seitz, Steve
2016-11-01
We present a fully automatic system for ranking domain-specific highlights in unconstrained personal videos by analyzing online edited videos. A novel latent linear ranking model is proposed to handle noisy training data harvested online. Specifically, given a targeted domain such as "surfing," our system mines the YouTube database to find pairs of raw and their corresponding edited videos. Leveraging the assumption that an edited video is more likely to contain highlights than the trimmed parts of the raw video, we obtain pair-wise ranking constraints to train our model. The learning task is challenging due to the amount of noise and variation in the mined data. Hence, a latent loss function is incorporated to mitigate the issues caused by the noise. We efficiently learn the latent model on a large number of videos (about 870 min in total) using a novel EM-like procedure. Our latent ranking model outperforms its classification counterpart and is fairly competitive compared with a fully supervised ranking system that requires labels from Amazon Mechanical Turk. We further show that a state-of-the-art audio feature mel-frequency cepstral coefficients is inferior to a state-of-the-art visual feature. By combining both audio-visual features, we obtain the best performance in dog activity, surfing, skating, and viral video domains. Finally, we show that impressive highlights can be detected without additional human supervision for seven domains (i.e., skating, surfing, skiing, gymnastics, parkour, dog activity, and viral video) in unconstrained personal videos.
Using Publication Metrics to Highlight Academic Productivity and Research Impact
Carpenter, Christopher R.; Cone, David C.; Sarli, Cathy C.
2016-01-01
This article provides a broad overview of widely available measures of academic productivity and impact using publication data and highlights uses of these metrics for various purposes. Metrics based on publication data include measures such as number of publications, number of citations, the journal impact factor score, and the h-index, as well as emerging metrics based on document-level metrics. Publication metrics can be used for a variety of purposes for tenure and promotion, grant applications and renewal reports, benchmarking, recruiting efforts, and administrative purposes for departmental or university performance reports. The authors also highlight practical applications of measuring and reporting academic productivity and impact to emphasize and promote individual investigators, grant applications, or department output. PMID:25308141
Highlights of the 8th International Veterinary Immunology Symposium
USDA-ARS?s Scientific Manuscript database
Veterinary immunologists have expanded understanding of the immune systems for our companion animals and developed new vaccines and therapeutics. This manuscript summarizes the highlights of the 8th International Veterinary Immunology Symposium (8 th IVIS) held August 15th-19th, 2007, in Ouro Preto,...
Research and technology highlights of the Lewis Research Center
NASA Technical Reports Server (NTRS)
1984-01-01
Highlights of research accomplishments of the Lewis Research Center for fiscal year 1984 are presented. The report is divided into four major sections covering aeronautics, space communications, space technology, and materials and structures. Six articles on energy are included in the space technology section.
Feature highlighting enhances learning of a complex natural-science category.
Miyatsu, Toshiya; Gouravajhala, Reshma; Nosofsky, Robert M; McDaniel, Mark A
2018-04-26
Learning naturalistic categories, which tend to have fuzzy boundaries and vary on many dimensions, can often be harder than learning well defined categories. One method for facilitating the category learning of naturalistic stimuli may be to provide explicit feature descriptions that highlight the characteristic features of each category. Although this method is commonly used in textbooks and classrooms, theoretically it remains uncertain whether feature descriptions should advantage learning complex natural-science categories. In three experiments, participants were trained on 12 categories of rocks, either without or with a brief description highlighting key features of each category. After training, they were tested on their ability to categorize both old and new rocks from each of the categories. Providing feature descriptions as a caption under a rock image failed to improve category learning relative to providing only the rock image with its category label (Experiment 1). However, when these same feature descriptions were presented such that they were explicitly linked to the relevant parts of the rock image (feature highlighting), participants showed significantly higher performance on both immediate generalization to new rocks (Experiment 2) and generalization after a 2-day delay (Experiment 3). Theoretical and practical implications are discussed. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
Science Highlights from the First Year of Advanced Camera for Surveys
NASA Technical Reports Server (NTRS)
Clampin, M.; Ford, H. C.; Illingworth, G. D.; Hartig, G.; Ardila, D. R.; Blakeslee, J. P.; Bouwens, R. J.; Cross, N. J. G.; Feldman, P. D.; Golimowski, D. A.
2003-01-01
The Advanced Camera for Surveys (ACS) is a deep imaging camera installed on the Hubble Space Telescope during the fourth HST servicing mission. ACS recently entered its second year of science operations and continues to perform beyond pre-launch expectations. We present science highlights from the ACS Science Team's GTO program. These highlights include the evolution of Z approx. 6 galaxies from deep imaging observations; deep imaging of strongly lensed clusters which have been used to determine cluster mass, and independently constraint the geometry of the Universe; and coronagraphic observations of debris disks.
Voyager: Neptune Encounter Highlights
NASA Technical Reports Server (NTRS)
1989-01-01
Voyager encounter data are presented in computer animation (CA) and real (R) animation. The highlights include a view of 2 full rotations of Neptune. It shows spacecraft trajectory 'diving' over Neptune and intercepting Triton's orbit, depicting radiation and occulation zones. Also shown are a renegade orbit of Triton and Voyager's encounter with Neptune's Magnetopause. A model of the spacecraft's complex maneuvers during close encounters of Neptune and Triton is presented. A view from Earth of Neptune's occulation experiment is is shown as well as a recreation of Voyager's final pass. There is detail of Voyager's Image Compensation technique which produces Voyager images. Eighteen images were produced on June 22 - 23, 1989, from 57 million miles away. A 68 day sequence which provides a stroboscopic view - colorization approximates what is seen by the human eye. Real time images recorded live from Voyager on 8/24/89 are presented. Photoclinometry produced the topography of Triton. Three images are used to create a sequence of Neptune's rings. The globe of Neptune and 2 views of the south pole are shown as well as Neptune rotating. The rotation of a scooter is frozen in images showing differential motion. There is a view of rotation of the Great Dark Spot about its own axis. Photoclinometry provides a 3-dimensional perspective using a color mosaic of Triton images. The globe is used to indicate the orientation of Neptune's crescent. The east and west plumes on Triton are shown.
STS-114 Flight Day 5 Highlights
NASA Technical Reports Server (NTRS)
2005-01-01
Highlights of Day 5 of the STS-114 Return to Flight mission (Commander Eileen Collins, Pilot James Kelly, Mission Specialists Soichi Noguchi, Stephen Robinson, Andrew Thomas, Wendy Lawrence, and Charles Camarda) include video coverage of an extravehiclular activity (EVA) by Noguchi and Robinson. The other crew members of Discovery are seen on the flight deck and mid-deck helping the astronauts to suit-up. The objectives of the EVA are to test repair techniques on sample tiles in the shuttle's payload bay, to repair electrical equipment for a gyroscope on the International Space Station (ISS), and to install a replacement GPS antenna on the ISS. Noguchi and Robinson use a caulk gun and a putty knife to repair the sample tiles. The video contains several Earth views, including one of Baja California.
Detail view highlighting the series of pointed arch windows along ...
Detail view highlighting the series of pointed arch windows along the North Carrollton facade - Reformed Episcopal Church of the Rock of Ages, 1210 West Lanvale Street, Baltimore, Independent City, MD
EMSL Quarterly Highlights Report: 1st Quarter, Fiscal Year 2009
DOE Office of Scientific and Technical Information (OSTI.GOV)
Showalter, Mary Ann; Kathmann, Loel E.; Manke, Kristin L.
2009-02-02
The EMSL Quarterly Highlights Report covers the science, staff and user recognition, and publication activities that occurred during the 1st quarter (October 2008 - December 2008) of Fiscal Year 2009.
Advanced Education and Technology Business Plan, 2010-13. Highlights
ERIC Educational Resources Information Center
Alberta Advanced Education and Technology, 2010
2010-01-01
The Ministry of Advanced Education and Technology envisions Alberta's prosperity through innovation and lifelong learning. Advanced Education and Technology's mission is to lead the development of a knowledge-driven future through a dynamic and integrated advanced learning and innovation system. This paper presents the highlights of the business…
Highlights in the study of exoplanet atmospheres
NASA Astrophysics Data System (ADS)
Burrows, Adam S.
2014-09-01
Exoplanets are now being discovered in profusion. To understand their character, however, we require spectral models and data. These elements of remote sensing can yield temperatures, compositions and even weather patterns, but only if significant improvements in both the parameter retrieval process and measurements are made. Despite heroic efforts to garner constraining data on exoplanet atmospheres and dynamics, reliable interpretation has frequently lagged behind ambition. I summarize the most productive, and at times novel, methods used to probe exoplanet atmospheres; highlight some of the most interesting results obtained; and suggest various broad theoretical topics in which further work could pay significant dividends.
Selected highlights from the Extreme Ultraviolet Explorer
NASA Technical Reports Server (NTRS)
Bowyer, S.; Malina, R. F.
1995-01-01
We present a few scientific highlights from the Extreme Ultraviolet Explorer (EUVE) all-sky and deep surveys, from the EUVE Righ Angle Program, and from the EUVE Guest Observer Program. The First EUVE Source Catalog includes 410 extreme ultraviolet (EUV) sources detected in the initial processing of the EUVE all-sky data. A program of optical identification indicates that counterparts include cool star coronae, flare stars, hot white dwarfs, central stars of planetary nebulae, B star photospheres and winds, an X-ray binary, extragalactic objects (active galactic nuclei, BL Lacertae), solar system objects (Moon, Mars, Io,), supernova remnants, and two novae.
Ogawa, Yuko; Tsujimoto, Masafumi; Yanoshita, Ryohei
2016-01-01
Exosomes are small extracellular vesicles containing microRNAs and mRNAs that are produced by various types of cells. We previously used ultrafiltration and size-exclusion chromatography to isolate two types of human salivary exosomes (exosomes I, II) that are different in size and proteomes. We showed that salivary exosomes contain large repertoires of small RNAs. However, precise information regarding long RNAs in salivary exosomes has not been fully determined. In this study, we investigated the compositions of protein-coding RNAs (pcRNAs) and long non-protein-coding RNAs (lncRNAs) of exosome I, exosome II and whole saliva (WS) by next-generation sequencing technology. Although 11% of all RNAs were commonly detected among the three samples, the compositions of reads mapping to known RNAs were similar. The most abundant pcRNA is ribosomal RNA protein, and pcRNAs of some salivary proteins such as S100 calcium-binding protein A8 (protein S100-A8) were present in salivary exosomes. Interestingly, lncRNAs of pseudogenes (presumably, processed pseudogenes) were abundant in exosome I, exosome II and WS. Translationally controlled tumor protein gene, which plays an important role in cell proliferation, cell death and immune responses, was highly expressed as pcRNA and pseudogenes in salivary exosomes. Our results show that salivary exosomes contain various types of RNAs such as pseudogenes and small RNAs, and may mediate intercellular communication by transferring these RNAs to target cells as gene expression regulators.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Popp, R.A.; Lalley, P.A.; Whitney, J.B.
A genetic polymorphism for a Bgl I endonuclease site near the ..cap alpha..-globin-like pseudogene ..cap alpha..-4 of C57BL/6 and C3H/HeN mice was used to show that ..cap alpha..-4 was not affected by three independent mutations in which the adult globin genes ..cap alpha..-1 and ..cap alpha..-2 were deleted. These results indicated that ..cap alpha..-4 might not be located adjacent to the adult ..cap alpha..-globin genes on chromosome 11. Restriction endonuclease analysis of DNA of a primary clone of a Chinese hamster-mouse somatic cell hybrid that had lost mouse chromosomes 11 and 18 showed that this clone lacked the adult murinemore » globin genes ..cap alpha..-1 and ..cap alpha..-2 but it did contain the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4. These results indicated that the adult ..cap alpha..-globin genes and ..cap alpha..-globin-like pseudogenes are not located on the same chromosome. Similar analyses of several other Chinese hamster-mouse somatic cell hybrids that had segregated other mouse chromosomes indicated that the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4 are located on mouse chromosomes 15 and 17, respectively. These data explain why ..cap alpha..-3 and ..cap alpha..-4 were not affected by the three independently induced deletion-type mutations that cause ..cap alpha..-thalassemia in the mouse.« less
The human cytochrome P450 3A locus. Gene evolution by capture of downstream exons.
Finta, C; Zaphiropoulos, P G
2000-12-30
Using a bacterial artificial chromosome (BAC) clone, we have mapped the human cytochrome P450 3A (CYP3A) locus containing the genes encoding for CYP3A4, CYP3A5 and CYP3A7. The genes lie in a head-to-tail orientation in the order of 3A4, 3A7 and 3A5. In both intergenic regions (3A4-3A7 and 3A7-3A5), we have detected several additional cytochrome P450 3A exons, forming two CYP3A pseudogenes. These pseudogenes have the same orientation as the CYP3A genes. To our surprise, a 3A7 mRNA species has been detected in which the exons 2 and 13 of one of the pseudogenes (the one that is downstream of 3A7) are spliced after the 3A7 terminal exon. This results in an mRNA molecule that consists of the 13 3A7 exons and two additional exons at the 3' end. The additional two exons originating from the pseudogene are in an altered reading frame and consequently have the capability to code a completely different amino acid sequence than the canonical CYP3A exons 2 and 13. These findings may represent a generalized evolutionary process with genes having the potential to capture neighboring sequences and use them as functional exons.
Molecular evolution tracks macroevolutionary transitions in Cetacea.
McGowen, Michael R; Gatesy, John; Wildman, Derek E
2014-06-01
Cetacea (whales, dolphins, and porpoises) is a model group for investigating the molecular signature of macroevolutionary transitions. Recent research has begun to reveal the molecular underpinnings of the remarkable anatomical and behavioral transformation in this clade. This shift from terrestrial to aquatic environments is arguably the best-understood major morphological transition in vertebrate evolution. The ancestral body plan and physiology were extensively modified and, in many cases, these crucial changes are recorded in cetacean genomes. Recent studies have highlighted cetaceans as central to understanding adaptive molecular convergence and pseudogene formation. Here, we review current research in cetacean molecular evolution and the potential of Cetacea as a model for the study of other macroevolutionary transitions from a genomic perspective. Copyright © 2014 Elsevier Ltd. All rights reserved.
Advanced Education and Technology Business Plan, 2009-12. Highlights
ERIC Educational Resources Information Center
Alberta Advanced Education and Technology, 2009
2009-01-01
Advanced Education and Technology provides strategic leadership for the development of the next generation economy in Alberta through the provision of accessible, affordable and quality learning opportunities for all Albertans and support for a dynamic and integrated innovation system. This paper provides the highlights of the business plan of the…
STS-66 Mission Highlights Resource Tape
NASA Technical Reports Server (NTRS)
1995-01-01
This video contains the mission highlights of the STS-66 Space Shuttle Atlantis Mission in November 1994. Astronauts included: Don McMonagle (Mission Commander), Kurt Brown, Ellen Ochoa (Payload Commander), Joe Tanner, Scott Parazynski, and Jean-Francois Clervoy (collaborating French astronaut). Footage includes: pre-launch suitup, entering Space Shuttle, countdown and launching of Shuttle, EVA activities (ATLAS-3, CRISTA/SPAS, SSBUV/A, ESCAPE-2), on-board experiments dealing with microgravity and its effects, protein crystal growth experiments, daily living and sleeping compartment footage, earthviews of various meteorological processes (dust storms, cloud cover, ocean storms), pre-landing and land footage (both from inside the Shuttle and from outside with long range cameras), and tracking and landing shots from inside Mission Control Center. Included is air-to-ground communication between Mission Control and the Shuttle. This Shuttle was the last launch of 1994.
STS-66 mission highlights resource tape
NASA Astrophysics Data System (ADS)
1995-04-01
This video contains the mission highlights of the STS-66 Space Shuttle Atlantis Mission in November 1994. Astronauts included: Don McMonagle (Mission Commander), Kurt Brown, Ellen Ochoa (Payload Commander), Joe Tanner, Scott Parazynski, and Jean-Francois Clervoy (collaborating French astronaut). Footage includes: pre-launch suitup, entering Space Shuttle, countdown and launching of Shuttle, EVA activities (ATLAS-3, CRISTA/SPAS, SSBUV/A, ESCAPE-2), on-board experiments dealing with microgravity and its effects, protein crystal growth experiments, daily living and sleeping compartment footage, earthviews of various meteorological processes (dust storms, cloud cover, ocean storms), pre-landing and land footage (both from inside the Shuttle and from outside with long range cameras), and tracking and landing shots from inside Mission Control Center. Included is air-to-ground communication between Mission Control and the Shuttle. This Shuttle was the last launch of 1994.
The Morehouse College Glee Club: History and Recent Highlights.
ERIC Educational Resources Information Center
Morrow, David
1987-01-01
The history of the Morehouse College Glee Club, founded around 1911 at the Black college, is highlighted by appearances before such notables as Franklin D. Roosevelt, Martin Luther King, Jr., Haile Selassie, Jimmy Carter, and Benjamin E. Mays and performances with people such as Robert Shaw, Leontyne Price, Diahann Carroll, Maynard Jackson, Billy…
Mental Health Disorders. Adolescent Health Highlight. Publication #2013-1
ERIC Educational Resources Information Center
Murphey, David; Barry, Megan; Vaughn, Brigitte
2013-01-01
Mental disorders are diagnosable conditions characterized by changes in thinking, mood, or behavior (or some combination of these) that can cause a person to feel stressed out and impair his or her ability to function. These disorders are common in adolescence. This "Adolescent Health Highlight" presents the warning signs of mental disorders;…
Moving beyond Text Highlights: Inferring Users' Interests to Improve the Relevance of Retrieval
ERIC Educational Resources Information Center
Balakrishnan, Vimala; Mehmood, Yasir; Nagappan, Yoganathan
2016-01-01
Introduction: Studies have indicated that users' text highlighting behaviour can be further manipulated to improve the relevance of retrieved results. This article reports on a study that examined users' text highlight frequency, length and users' copy-paste actions. Method: A binary voting mechanism was employed to determine the weights for the…
NASA Astrophysics Data System (ADS)
1995-09-01
The highlights of the STS-70 mission are presented in this video. The flight crew consisted of Cmdr. John Hendricks, Pilot Kevin Kregel, Flight Engineer Nancy Curie, and Mission Specialists Dr. Don Thomas and Dr. Mary Ellen Weber. The mission's primary objective was the deployment of the 7th Tracking Data and Relay Satellite (TDRS), which will provide a communication, tracking, telemetry, data acquisition, and command services space-based network system essential to low Earth orbital spacecraft. Secondary mission objectives included activating and studying the Physiological and Anatomical Rodent Experiment/National Institutes of Health-Rodents (PARE/NIH-R), The Bioreactor Demonstration System (BDS), the Commercial Protein Crystal Growth (CPCG) studies, the Space Tissue Loss/National Institutes of Health-Cells (STL/NIH-C) experiment, the Biological Research in Canisters (BRIC) experiment, Shuttle Amateur Radio Experiment-2 (SAREX-2), the Visual Function Tester-4 (VFT-4), the Hand-Held, Earth Oriented, Real-Time, Cooperative, User-Friendly, Location-Targeting and Environmental System (HERCULES), the Microcapsules in Space-B (MIS-B) experiment, the Windows Experiment (WINDEX), the Radiation Monitoring Equipment-3 (RME-3), and the Military Applications of Ship Tracks (MAST) experiment. There was an in-orbit dedication ceremony by the spacecrew and the newly Integrated Mission Control Center to commemorate the Center's integration. The STS-70 mission was the first mission monitored by this new control center. Earth views included the Earth's atmosphere, a sunrise over the Earth's horizon, several views of various land masses, some B/W lightning shots, some cloud cover, and a tropical storm.
NASA Astrophysics Data System (ADS)
van der Hucht, Karel
2008-02-01
Preface Karel A. van der Hucht; Part I. Invited Discourses: Part II. Joint Discussions: 1. Particle acceleration - from Solar System to AGN Marian Karlicky and John C. Brown; 2. Pulsar emission and related phenomena Werner Becker, Janusz A. Gil and Bronislaw Rudak; 3. Solar activity regions and magnetic structure Debi Prasad Choudhary and Michal Sobotka; 4. The ultraviolet universe: Stars from birth to death Ana I. Gomez de Castro and Martin A. Barstow; 5. Calibrating the top of the stellar M-L relationship Claus Leitherer, Anthony F. J. Moat and Joachim Puls; 6. Neutron stars and black holes in star clusters Frederic A. Rasio; 7. The Universe at z > 6 Daniel Schaerer and Andrea Ferrara; 8. Solar and stellar activity cycles Klaus G. Strassmeier and Alexander Kosovichev; 9. Supernovae: One millennium after SN 1006 P. Frank Winkler, Wolfgang Hillebrandt and Brian P. Schmidt; 10. Progress in planetary exploration missions Guy J. Consolmagno; 11. Pre-solar grains as astrophysical tools Anja C. Andersen and John C. Lattanzio; 12. Long wavelength astrophysics T. Joseph W. Lazio and Namir E. Kassim; 13. Exploiting large surveys for galactic astronomy Christopher J. Corbally, Coryn A. L. Bailer-Jones, Sunetra Giridhar and Thomas H. Lloyd Evans; 14. Modeling dense stellar systems Alison I. Sills, Ladislav Subr and Simon F. Portegies Zwart; 15. New cosmology results from the Spitzer Space Telescope George Helou and David T. Frayer; 16. Nomenclature, precession and new models in fundamental astronomy Nicole Capitaine, Jan Vondrak & James L. Hilton; 17. Highlights of recent progress in seismology of the Sun and Sun-like stars John W. Leibacher and Michael J. Thompson; Part III. Special Sessions: SpS 1. Large astronomical facilities of the next decade Gerard F. Gilmore and Richard T. Schilizzi; SpS 2. Innovation in teaching and learning astronomy methods Rosa M. Ros and Jay M. Pasachoff; SpS 3. The Virtual Observatory in action: New science, new technology and next
Highlighting Text as a Study Strategy: Beyond Attentional Focusing.
ERIC Educational Resources Information Center
Lindner, Reinhard W.; And Others
Two experiments were conducted to investigate whether the strategy of differentiating main and supporting ideas with different colored highlighter pens resulted in greater use of schema building and increased recall of information by students and whether the benefits of text marking come at the time of encoding or at the time of review. Sixty-six…
Highlighting in Early Childhood: Learning Biases through Attentional Shifting
ERIC Educational Resources Information Center
Burling, Joseph M.; Yoshida, Hanako
2017-01-01
The literature on human and animal learning suggests that individuals attend to and act on cues differently based on the order in which they were learned. Recent studies have proposed that one specific type of learning outcome, the highlighting effect, can serve as a framework for understanding a number of early cognitive milestones. However,…
Langley aeronautics and space test highlights, 1984
NASA Technical Reports Server (NTRS)
1984-01-01
The role of the Langley Research Center is to perform basic and applied research necessary for the advancement of aeronautics and space flight, to generate new and advanced concepts for the accomplishment of related national goals, and to provide research advice, technological support, and assistance to other NASA installations, other government agencies, and industry. Some of the significant tests which were performed during calendar year 1984 in Langley test facilities are highlighted. The broad range of the research and technology activities at the Langley Research Center and the contributions of this work toward maintaining United States leadership in aeronautics and space research are illustrated.
National survey of pedestrian & bicyclist attitudes and behaviors : highlights report
DOT National Transportation Integrated Search
2002-11-30
This report presents highlights of the 2002 National Survey of Pedestrian and Bicyclist Attitudes and Behaviors, jointly sponsored by the U.S. Department of Transportation's National Highway Traffic Safety Administration (NHTSA) and the Bureau of Tra...
Highlights of Aeroacoustics Research in the U.S. 1998
NASA Technical Reports Server (NTRS)
Raman, Ganesh; McLaughlin, Dennis K.
1999-01-01
Highlights of aeroacoustics research in the United States of America during 1998 are reported in a summary compiled from information provided by members of the Aeroacoustics Technical Committee of the American Institute of Aeronautics and Astronautics (AIAA) and other leading research groups in industry, national laboratories, and academia. The past few years have seen significant progress in aeroacoustics. Research has steadily progressed toward enhanced safety, noise benefits, and lower costs. Since industrial progress is generally not published in the archival literature, it is particularly important to highlight these accomplishments. This year we chose to report on five topics of great interest to the aerospace industry including a synopsis of fundamental research at universities and national laboratories. The topics chosen are: (1) Advanced Subsonic Technology (AST), (2) High Speed Research (HSR), (3) Rotorcraft, (4) Weapons bay aeroacoustics control and (5) Academic research including Computational AeroAcoustics (CAA). Although the information presented in this review is not all encompassing we hope that the topics covered will provide some insights into aeroacoustics activity in the U.S.
Harrison, Oliver J; Moorjani, Narain; Torrens, Christopher; Ohri, Sunil K; Cagampang, Felino R
2016-01-01
Bicuspid aortic valve (BAV) disease is the most common congenital cardiac abnormality and predisposes patients to life-threatening aortic complications including aortic aneurysm. Quantitative real-time reverse transcription PCR (qRT-PCR) is one of the most commonly used methods to investigate underlying molecular mechanisms involved in aortopathy. The accuracy of the gene expression data is dependent on normalization by appropriate housekeeping (HK) genes, whose expression should remain constant regardless of aortic valve morphology, aortic diameter and other factors associated with aortopathy. Here, we identified an appropriate set of HK genes to be used as endogenous reference for quantifying gene expression in ascending aortic tissue using a spin column-based RNA extraction method. Ascending aortic biopsies were collected intra-operatively from patients undergoing aortic valve and/or ascending aortic surgery. These patients had BAV or tricuspid aortic valve (TAV), and the aortas were either dilated (≥4.5cm) or undilated. The cohort had an even distribution of gender, valve disease and hypertension. The expression stability of 12 reference genes were investigated (ATP5B, ACTB, B2M, CYC1, EIF4A2, GAPDH, SDHA, RPL13A, TOP1, UBC, YWHAZ, and 18S) using geNorm software. The most stable HK genes were found to be GAPDH, UBC and ACTB. Both GAPDH and UBC demonstrated relative stability regardless of valve morphology, aortic diameter, gender and age. The expression of B2M and SDHA were found to be the least stable HK genes. We propose the use of GAPDH, UBC and ACTB as reference genes for gene expression studies of BAV aortopathy using ascending aortic tissue.
Selection and testing of reference genes for accurate RT-qPCR in rice seedlings under iron toxicity.
Santos, Fabiane Igansi de Castro Dos; Marini, Naciele; Santos, Railson Schreinert Dos; Hoffman, Bianca Silva Fernandes; Alves-Ferreira, Marcio; de Oliveira, Antonio Costa
2018-01-01
Reverse Transcription quantitative PCR (RT-qPCR) is a technique for gene expression profiling with high sensibility and reproducibility. However, to obtain accurate results, it depends on data normalization by using endogenous reference genes whose expression is constitutive or invariable. Although the technique is widely used in plant stress analyzes, the stability of reference genes for iron toxicity in rice (Oryza sativa L.) has not been thoroughly investigated. Here, we tested a set of candidate reference genes for use in rice under this stressful condition. The test was performed using four distinct methods: NormFinder, BestKeeper, geNorm and the comparative ΔCt. To achieve reproducible and reliable results, Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines were followed. Valid reference genes were found for shoot (P2, OsGAPDH and OsNABP), root (OsEF-1a, P8 and OsGAPDH) and root+shoot (OsNABP, OsGAPDH and P8) enabling us to perform further reliable studies for iron toxicity in both indica and japonica subspecies. The importance of the study of other than the traditional endogenous genes for use as normalizers is also shown here.
Selection and testing of reference genes for accurate RT-qPCR in rice seedlings under iron toxicity
dos Santos, Fabiane Igansi de Castro; Marini, Naciele; dos Santos, Railson Schreinert; Hoffman, Bianca Silva Fernandes; Alves-Ferreira, Marcio
2018-01-01
Reverse Transcription quantitative PCR (RT-qPCR) is a technique for gene expression profiling with high sensibility and reproducibility. However, to obtain accurate results, it depends on data normalization by using endogenous reference genes whose expression is constitutive or invariable. Although the technique is widely used in plant stress analyzes, the stability of reference genes for iron toxicity in rice (Oryza sativa L.) has not been thoroughly investigated. Here, we tested a set of candidate reference genes for use in rice under this stressful condition. The test was performed using four distinct methods: NormFinder, BestKeeper, geNorm and the comparative ΔCt. To achieve reproducible and reliable results, Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines were followed. Valid reference genes were found for shoot (P2, OsGAPDH and OsNABP), root (OsEF-1a, P8 and OsGAPDH) and root+shoot (OsNABP, OsGAPDH and P8) enabling us to perform further reliable studies for iron toxicity in both indica and japonica subspecies. The importance of the study of other than the traditional endogenous genes for use as normalizers is also shown here. PMID:29494624
Aeroacoustics research in Europe: The CEAS-ASC report on 2016 highlights
NASA Astrophysics Data System (ADS)
Wilson, Alexander G.
2018-08-01
The Council of European Aerospace Societies (CEAS) Aeroacoustics Specialists Committee (ASC) supports and promotes the interests of the scientific and industrial aeroacoustics community on the European scale, and European aeronautics activities internationally. Each year, the committee highlights several of the research and development projects in Europe. This paper is the 2016 issue of this collection of Aeroacoustic Highlights, compiled from contributions submitted to the CEAS-ASC. The contributions are classified under three main headings; Aircraft and Turbomachinery Noise, Experimental and Numerical Methods and Further Applications of Aeroacoustics. A concise summary of the CEAS-ASC workshop held in Southampton, England, in September 2016 is also included in this report.
Research highlights: microfluidics meets big data.
Tseng, Peter; Weaver, Westbrook M; Masaeli, Mahdokht; Owsley, Keegan; Di Carlo, Dino
2014-03-07
In this issue we highlight a collection of recent work in which microfluidic parallelization and automation have been employed to address the increasing need for large amounts of quantitative data concerning cellular function--from correlating microRNA levels to protein expression, increasing the throughput and reducing the noise when studying protein dynamics in single-cells, and understanding how signal dynamics encodes information. The painstaking dissection of cellular pathways one protein at a time appears to be coming to an end, leading to more rapid discoveries which will inevitably translate to better cellular control--in producing useful gene products and treating disease at the individual cell level. From these studies it is also clear that development of large scale mutant or fusion libraries, automation of microscopy, image analysis, and data extraction will be key components as microfluidics contributes its strengths to aid systems biology moving forward.
Center Overview and UAV Highlights at NASA Ames Research Center
NASA Technical Reports Server (NTRS)
Feng, Deborah; Yan, Jerry Chi Yiu
2017-01-01
The PowerPoint presentation gives an overview of NASA Ames Research Center and its core competencies, as well as some of the highlights of Unmanned Aerial Vehicle (UAV) and Unmanned Aircraft Systems (UAS) accomplishments and innovations by researchers at Ames.
Differences in selection drive olfactory receptor genes in different directions in dogs and wolf.
Chen, Rui; Irwin, David M; Zhang, Ya-Ping
2012-11-01
The olfactory receptor (OR) gene family is the largest gene family found in mammalian genomes. It is known to evolve through a birth-and-death process. Here, we characterized the sequences of 16 segregating OR pseudogenes in the samples of the wolf and the Chinese village dog (CVD) and compared them with the sequences from dogs of different breeds. Our results show that the segregating OR pseudogenes in breed dogs are under strong purifying selection, while evolving neutrally in the CVD, and show a more complicated pattern in the wolf. In the wolf, we found a trend to remove deleterious polymorphisms and accumulate nondeleterious polymorphisms. On the basis of protein structure of the ORs, we found that the distribution of different types of polymorphisms (synonymous, nonsynonymous, tolerated, and untolerated) varied greatly between the wolf and the breed dogs. In summary, our results suggest that different forms of selection have acted on the segregating OR pseudogenes in the CVD since domestication, breed dogs after breed formation, and ancestral wolf population, which has driven the evolution of these genes in different directions.
Wiebe, Victor; Przeworski, Molly; Lancet, Doron; Pääbo, Svante
2004-01-01
Olfactory receptor (OR) genes constitute the molecular basis for the sense of smell and are encoded by the largest gene family in mammalian genomes. Previous studies suggested that the proportion of pseudogenes in the OR gene family is significantly larger in humans than in other apes and significantly larger in apes than in the mouse. To investigate the process of degeneration of the olfactory repertoire in primates, we estimated the proportion of OR pseudogenes in 19 primate species by surveying randomly chosen subsets of 100 OR genes from each species. We find that apes, Old World monkeys and one New World monkey, the howler monkey, have a significantly higher proportion of OR pseudogenes than do other New World monkeys or the lemur (a prosimian). Strikingly, the howler monkey is also the only New World monkey to possess full trichromatic vision, along with Old World monkeys and apes. Our findings suggest that the deterioration of the olfactory repertoire occurred concomitant with the acquisition of full trichromatic color vision in primates. PMID:14737185
Langley aeronautics and space test highlights, 1983
NASA Technical Reports Server (NTRS)
1984-01-01
The role of the Langley Research Center is to perform basic and applied research necessary for the advancement of aeronautics and space flight, to generate new and advanced concepts for the accomplishment of related national goals, and to provide research advice, technological support, and assistance to other NASA installations, other government agencies, and industry. Some of the significant tests which were performed during calendar year 1983 in Langley test facilities, a number of which are unique in the world are highlighted. Both the broad range of the research and technology activities at the Langley Research Center and the contributions of this work toward maintaining United States leadership in aeronautics and space research are illustrated.
Highlights from the ISCB Student Council Symposia in 2016
Siranosian, Ben; Schwahn, Kevin; Conard, Ashley Mae; Aben, Nanne; Hassan, Mehedi; Fatima, Nazeefa; Hermans, Susanne M.A.; Woghiren, Melissa; Meysman, Pieter; Rahman, Farzana; Jigisha, Anupama
2016-01-01
This editorial provides a brief overview of the 12th International Society for Computational Biology (ISCB) Student Council Symposium and the 4th European Student Council Symposium held in Florida, USA and The Hague, Netherlands, respectively. Further, the role of the ISCB Student Council in promoting education and networking in the field of computational biology is also highlighted. PMID:28003876
50 years of Dutch immunology--founders, institutions, highlights.
Gmelig-Meyling, Frits H J; Meyaard, Linde; Mebius, Reina E
2014-12-01
At the occasion of the 50th anniversary of the Dutch Society for Immunology (DSI, de Nederlandse Vereniging voor Immunologie), this contribution deals with some highlights of 50 years of Immunology in the Netherlands. It narrates about the founders and first board members of the DSI, their institutes, progeny and patrimony, describes major centers of immunological activities, mentions key persons in the field, and touches upon some events dear to the Society and its members. Copyright © 2014 Elsevier B.V. All rights reserved.
STS-88 Mission Highlights Resources Tape. Tape C
NASA Technical Reports Server (NTRS)
1999-01-01
The STS-88 flight crew, Commander Robert D. Cabana, Pilot Frederick W. Sturckow, and Mission Specialists Nancy J. Currie, James H. Newman, Jerry L. Ross, and Sergei Krikalev present a video overview of their space flight. This is the last of three videos which show the highlights of the mission. This video covers the last four days (day 9 - 12) of the mission. Important images include the closing of the UNITY Connecting Module's hatch, the crew exercising, and the reentry of the spacecraft into Earth's atmosphere.
Curiosity is Ready for Clay (Highlighted)
2018-03-22
This mosaic taken by NASA's Mars Curiosity rover looks uphill at Mount Sharp, which Curiosity has been climbing. Highlighted in white is an area with clay-bearing rocks that scientists are eager to explore; it could shed additional light on the role of water in creating Mount Sharp. The mosaic was assembled from dozens of images taken by Curiosity's Mast Camera (Mastcam). It was taken on Sol 1931 back in January. Mount Sharp stands in the middle of Gale Crater, which is 96 miles (154 kilometers) in diameter. This mound, which Curiosity has been climbing since 2014, likely formed in the presence of water at various points of time in Mars ancient history. That makes it an ideal place to study how water influenced the habitability of Mars billions of years ago. The scene has been white-balanced so the colors of the rock materials resemble how they would appear under daytime lighting conditions on Earth. https://photojournal.jpl.nasa.gov/catalog/PIA22312
STS-41D Post Flight Press Conference with Highlights
NASA Technical Reports Server (NTRS)
1984-01-01
The crew, Commander Henry W. Hartsfield, Jr., Pilot Michael L. Coats, Mission Specialists Judith A. Resnik, Steven A. Hawley, and Richard M. Mullane, and Payload Specialist Charles D. Walker are seen participating a panel discussion. Live footage of the Press Conference begins with a brief introduction of all the crew, followed by highlights of the flight, a selection of slides and still pictures, and ends with a question and answer segment. The highlights consist of the astronauts walk out to the Astro-Van, panoramic views of the Discovery on the launch pad, main engine start, ignition of the solid rocket boosters, liftoff, and separation of the boosters. Images of the opening of the sun shield and the deployment of the three communication satellites (Satellite Business System (SBS-D), SYNCOM IV-2, and TELSTAR) are also seen. The crew is seen working on experiments, dumping the wastewater, eating supper, and sleeping. Concluding the live footage are slides, and stills of various areas around the world, including the Libyan Desert, Angola, Namibia, and Australia. The Press Conference ends with questions from Houston, NASA Headquarter, Kennedy Space Center, and Marshall Space Flight Center.
Great American Smokeout Highlights the Importance of Smoking Cessation | Poster
Occupational Health Services (OHS) recently took part in the 41st Great American Smokeout, an event that highlights the dangers of smoking and encourages smokers to make a plan to quit. Tobacco smoking is the single most preventable cause of chronic disease and death.
STS-99 Mission Highlights Resource Tape, Part 2 of 2
NASA Technical Reports Server (NTRS)
2000-01-01
A continuation of 'STS-99 Mission Highlights Resource Tape, Part 1 of 2', footage shows the activities of flight days 11 and 12. The retraction of the Shuttle Radar Topography Mission (SRTM) is seen, and the landing of Endeavour is seen from several vantage points.
CITE 3 meteorological highlights
NASA Technical Reports Server (NTRS)
Shipham, Mark C.; Bachmeier, A. Scott; Anderson, Bruce E.
1993-01-01
Meteorological highlights from the third NASA Global Tropospheric Experiment Chemical Instrumentation Test and Evaluation (GTE/CITE 3) are presented. During August and September 1989, research flights were conducted from Wallops Island, Virginia, and Natal, Brazil, and included airborne sampling of air masses over adjacent regions of the Atlantic Ocean. Isentropic backward trajectory calculations, wind vector/streamline fields, rawinsonde data, and GOES and METEOSAT satellite imagery are utilized to examine the meteorological conditions for each flight and to determine the transport paths of the sampled air masses. Some aspects of the chemical signatures of the sampled air are also discussed. During the series of flights based at Wallops Island, Virginia, the flow into the experiment area was governed primarily by the position of the North Atlantic subtropical anticyclone. The large-scale tropospheric circulation switched from primarily a marine flow during flights 1-4, to a predominantly offshore mid-latitude continental flow during flights 5-10. During these later flights, the regional influences of large eastern U.S. cities along with vertical mixing by typical summertime convective activity strongly influenced the chemical characteristics of the sampled air. During the series of flights based at Natal, Brazil, the dominant synoptic feature was the South Atlantic subtropical anticyclone which generally transported air across the tropical Atlantic toward eastern Brazil. Pronounced subsidence and a well-defined trade wind inversion often characterized the lower and middle troposphere over the Natal region. Some high-altitude recirculation of air from South America was observed, as was cross-equatorial transport which had come from northern Africa. Biomass burning plumes were observed on segments of all of the flights, the source region being the central and southern savannah regions of Africa.
Highlights from the 9th Cachexia Conference.
Ebner, Nicole; von Haehling, Stephan
2017-06-01
This article highlights updates of pathways as well as pre-clinical and clinical studies into the field of wasting disorders that were presented at the 9th Cachexia Conference held in Berlin, Germany, December 2016. This year, some interesting results from clinical trials and different new therapeutic targets were shown. This article presents the biological and clinical significance of different markers and new diagnostic tools and cut-offs of detecting skeletal muscle wasting. Effective treatments of cachexia and wasting disorders are urgently needed in order to improve the patients' quality of life and their survival. © 2017 The Authors. Journal of Cachexia, Sarcopenia and Muscle published by John Wiley & Sons Ltd on behalf of the Society on Sarcopenia, Cachexia and Wasting Disorders.
Technical Highlight: NREL Improves Building Energy Simulation Programs Through Diagnostic Testing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Polly, B.
2012-01-09
This technical highlight describes NREL research to develop Building Energy Simulation Test for Existing Homes (BESTEST-EX) to increase the quality and accuracy of energy analysis tools for the building retrofit market.
Fu, Shulin; Zhang, Minmin; Xu, Juan; Ou, Jiwen; Wang, Yan; Liu, Huazhen; Liu, Jinlin; Chen, Huanchun; Bei, Weicheng
2013-01-02
Haemophilus parasuis (H. parasuis), the causative agent of swine polyserositis, polyarthritis, and meningitis, is one of the most important bacterial diseases of pigs worldwide. Little vaccines currently exist that have a significant effect on infections with all pathogenic serovars of H. parasuis. H. parasuis putative outer membrane proteins (OMPs) are potentially essential components of more effective vaccines. Recently, the genomic sequence of H. parasuis serovar 5 strain SH0165 was completed in our laboratory, which allow us to target OMPs for the development of recombinant vaccines. In this study, we focused on 10 putative OMPs and all the putative OMPs were cloned, expressed and purified as HIS fusion proteins. Primary screening for immunoprotective potential was performed in mice challenged with an LD50 challenge. Out of these 10 OMPs three fusion proteins rGAPDH, rOapA, and rHPS-0675 were found to be protective in a mouse model of H. parasuis infection. We further evaluated the immune responses and protective efficacy of rGAPDH, rOapA, and rHPS-0675 in pig models. All three proteins elicited humoral antibody responses and conferred different levels of protection against challenge with a lethal dose of H. parasuis SH0165 in pig models. In addition, the antisera against the three individual proteins and the synergistic protein efficiently inhibited bacterial growth in a whole blood assay. The data demonstrated that the three proteins showed high value individually and the combination of rGAPDH, rOapA, and rHPS-0675 offered the best protection. Our results indicate that rGAPDH, rOapA, and rHPS-0675 induced protection against H. parasuis SH0165 infection, which may facilitate the development of a multi-component vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.
The MeteoMet2 project—highlights and results
NASA Astrophysics Data System (ADS)
Merlone, A.; Sanna, F.; Beges, G.; Bell, S.; Beltramino, G.; Bojkovski, J.; Brunet, M.; del Campo, D.; Castrillo, A.; Chiodo, N.; Colli, M.; Coppa, G.; Cuccaro, R.; Dobre, M.; Drnovsek, J.; Ebert, V.; Fernicola, V.; Garcia-Benadí, A.; Garcia-Izquierdo, C.; Gardiner, T.; Georgin, E.; Gonzalez, A.; Groselj, D.; Heinonen, M.; Hernandez, S.; Högström, R.; Hudoklin, D.; Kalemci, M.; Kowal, A.; Lanza, L.; Miao, P.; Musacchio, C.; Nielsen, J.; Nogueras-Cervera, M.; Oguz Aytekin, S.; Pavlasek, P.; de Podesta, M.; Rasmussen, M. K.; del-Río-Fernández, J.; Rosso, L.; Sairanen, H.; Salminen, J.; Sestan, D.; Šindelářová, L.; Smorgon, D.; Sparasci, F.; Strnad, R.; Underwood, R.; Uytun, A.; Voldan, M.
2018-02-01
Launched in 2011 within the European Metrology Research Programme (EMRP) of EURAMET, the joint research project ‘MeteoMet’—Metrology for Meteorology—is the largest EMRP consortium; national metrology institutes, universities, meteorological and climate agencies, research institutes, collaborators and manufacturers are working together, developing new metrological techniques, as well as improving existing ones, for use in meteorological observations and climate records. The project focuses on humidity in the upper and surface atmosphere, air temperature, surface and deep-sea temperatures, soil moisture, salinity, permafrost temperature, precipitation, and the snow albedo effect on air temperature. All tasks are performed using a rigorous metrological approach and include the design and study of new sensors, new calibration facilities, the investigation of sensor characteristics, improved techniques for measurements of essential climate variables with uncertainty evaluation, traceability, laboratory proficiency and the inclusion of field influencing parameters, long-lasting measurements, and campaigns in remote and extreme areas. The vision for MeteoMet is to take a step further towards establishing full data comparability, coherency, consistency, and long-term continuity, through a comprehensive evaluation of the measurement uncertainties for the quantities involved in the global climate observing systems and the derived observations. The improvement in quality of essential climate variables records, through the inclusion of measurement uncertainty budgets, will also highlight possible strategies for the reduction of the uncertainty. This contribution presents selected highlights of the MeteoMet project and reviews the main ongoing activities, tasks and deliverables, with a view to its possible future evolution and extended impact.
Fabricating graphene supercapacitors: highlighting the impact of surfactants and moieties.
Brownson, Dale A C; Banks, Craig E
2012-02-01
We highlight the impact of surfactants, routinely used in the fabrication of graphene, which can significantly influence the performance of supercapacitors. Through the utilisation of various graphitic forms we offer insight into the design and fabrication of graphene based supercapacitors. This journal is © The Royal Society of Chemistry 2012
Biotransformation and bioactivation reactions - 2016 literature highlights.
Khojasteh, S Cyrus; Rietjens, Ivonne M C M; Dalvie, Deepak; Miller, Grover
2017-08-01
We are pleased to present a second annual issue highlighting a previous year's literature on biotransformation and bioactivation. Each contributor to this issue worked independently to review the articles published in 2016 and proposed three to four articles, which he or she believed would be of interest to the broader research community. In each synopsis, the contributing author summarized the procedures, analyses and conclusions as described in the original manuscripts. In the commentary sections, our authors offer feedback and highlight aspects of the work that may not be apparent from an initial reading of the article. To be fair, one should still read the original article to gain a more complete understanding of the work conducted. Most of the articles included in this review were published in Drug Metabolism and Disposition or Chemical Research in Toxicology, but attempts were made to seek articles in 25 other journals. Importantly, these articles are not intended to represent a consensus of the best papers of the year, as we did not want to make any arbitrary standards for this purpose, but rather they were chosen by each author for their notable findings and descriptions of novel metabolic pathways or biotransformations. I am pleased that Drs. Rietjens and Dalvie have again contributed to this annual review. We would like to welcome Grover P Miller as an author for this year's issue, and we thank Tom Baillie for his contributions to last year's edition. We have intentionally maintained a balance of authors such that two come from an academic setting and two come from industry. Finally, please drop us a note if you find this review helpful. We would be pleased to hear your opinions of our commentary, and we extend an invitation to anyone who would like to contribute to a future edition of this review. This article is dedicated to Professor Thomas Baillie for his exceptional contributions to the field of drug metabolism.
Sex Equity in Guidance and Counseling. Highlights: An ERIC/CAPS Digest.
ERIC Educational Resources Information Center
Hansen, Sunny; Harless, Deb
This document highlights progress in sex equity over the past 15 years, examines the current status and trends, and describes the role of counselors and educators as change agents in reducing sex bias. (NB)
NASA Astrophysics Data System (ADS)
2005-01-01
new interesting scientific results on the basis of data from ESO telescopes, including several results from the unmatched interferometer mode of the VLT, the VLTI, some of which were highlighted in ESO Press Releases. Certainly worth noting is the possible first ever bona-fide image of an exoplanet and the discovery of the lightest known exoplanet . At the beginning of the year, Paranal welcomed the first Auxiliary Telescope, while on the instrument side as well, 2004 was a good year: we saw the arrival of SINFONI on the VLT, of AMBER on the VLTI, and the installation at the NACO Adaptive Optics instrument of the " Simultaneous Differential Imager (SDI)" to detect exoplanets. And the first prototype of the Astrophysical Virtual Observatory was able to provide unprecedented results on the existence of Type-2 quasars by discovering an entire population of obscured, powerful supermassive black holes. Many of these developments are described in ESO's Press Releases, most with Press Photos, cf. the 2004 PR Index. Some of last year's ESO PR highlights may be accessed directly via the clickable image above.
WFC3: In-Flight Performance Highlights
NASA Astrophysics Data System (ADS)
Kimble, Randy A.; MacKenty, J. W.; O'Connell, R. W.; Townsend, J. A.; WFC3 Team
2010-01-01
Wide Field Camera 3 (WFC3), a powerful new imager for the Hubble Space Telescope (HST), was successfully installed in the telescope in May 2009 during the first dramatic spacewalk of space shuttle flight STS-125, also known as HST Servicing Mission 4. This new camera offers unique observing capabilities in two channels spanning a broad wavelength range from the near ultraviolet to the near infrared (200-1000nm in the UV/Visible [UVIS] channel; 850-1700nm in the IR channel). After an initial outgassing period, WFC3 was cooled to its observing configuration in June. In the following months, a highly successful Servicing Mission Observatory Verification (SMOV4) program was executed, which has confirmed the exciting scientific potential of the instrument. Detailed performance results from the SMOV4 program are presented in a number of papers in this session. In this paper, we highlight some top-level performance assessments (throughput, limiting magnitudes, survey speeds) for WFC3, which is now actively engaged in the execution of forefront astronomical observing programs.
SOFIA: first science highlights and future science potential
NASA Astrophysics Data System (ADS)
Zinnecker, H.
2013-06-01
SOFIA, the Stratospheric Observatory for Infrared Astronomy, is a joint project between NASA and the German Aerospace Agency (DLR) to develop and operate a 2.5 m airborne telescope in a highly modified Boeing 747SP aircraft that can fly as high as 45 000 feet (13.7 km). This is above 99.8 % of the precipitable water vapor which blocks much of the mid- and far-infrared radiation from reaching ground-based telescopes. In this review, we briefly discuss the characteristics of the Observatory and present a number of early science highlights obtained with the FORCAST camera in 5-40 micron spectral region and with the GREAT heterodyne spectrometer in the 130-240 micron spectral region. The FORCAST images in Orion show the discovery of a new high-mass protostar (IRc4), while GREAT observations at 1 km s-1 velocity resolution detected velocity-resolved, redshifted ammonia spectra at 1.81 THz in absorption against several strong far-infrared dust continuum sources, clear evidence of substantial protostellar infall onto massive (non-ionizing) protostars. These powerful new data allow us to determine how massive stars form in our Galaxy. Another highlight is the stunning image taken by FORCAST that reveals the transient circumnuclear 1.5 pc radius (dust) ring around our Galactic center, heated by hundreds of massive stars in the young nuclear star cluster. The GREAT heterodyne spectrometer also observed the circumnuclear ring in highly excited CO rotational lines, indicative of emission from warm dense molecular gas with broad velocity structure, perhaps due to local shock heating. GREAT also made superb mapping observations of the [C II] fine structure cooling line at 158 microns, for example in M17-SW molecular cloud-star cluster interface, observations which disprove the simple canonical photodissociation models. The much better baseline stability of the GREAT receivers (compared to Herschel HIFI) allows efficient on-the-fly mapping of extended [C II] emission in our
NASA Astrophysics Data System (ADS)
2006-01-01
2005 was the year of Physics. It was thus also in part the year of astronomy and this is clearly illustrated by the numerous breakthroughs that were achieved, in particular using ESO's telescopes. One of the highlights was without any doubt the confirmation of the first image of an exoplanet , around the star 2M1207 (see ESO PR 12/05). ESO's telescopes also found a Neptune-mass exoplanet around a small star ( PR 30/05) - a discovery that proves crucial in the census of other planetary systems, and imaged a tiny companion in the close vicinity of the star GQ Lupi, a very young object still surrounded by a disc, with an age between 100,000 and 2 million years ( PR 09/05). Moreover, using a new high-contrast adaptive optics camera on the VLT, the NACO Simultaneous Differential Imager, or NACO SDI, astronomers were able for the first time to image a companion 120 times fainter than its star , very near the star AB Doradus A. This companion appears to be almost twice as heavy as theory predicts it to be ( PR 02/05). ESO's telescopes proved very useful in helping to solve a 30-year old puzzle . Astronomers have for the first time observed the visible light from a short gamma-ray burst (GRB). Using the 1.5m Danish telescope at La Silla (Chile), they showed that these short, intense bursts of gamma-ray emission most likely originate from the violent collision of two merging neutron stars ( PR 26/05). Additional evidence came from witnessing another event with the VLT ( PR 32/05). Also in this field, astronomers found the farthest known gamma-ray burst with ESO's VLT, observing an object with a redshift 6.3, i.e. that is seen when the Universe was less than 900 million years old ( PR 22/05). On July 4, NASA's Deep Impact spacecraft plunged onto Comet 9P/Tempel 1 with the aim to create a crater and expose pristine material from beneath the surface. For two days before and six days after, all major ESO telescopes have been observing the comet, in a coordinated fashion and in
Fermi Gamma-Ray Observatory-Science Highlights for the First 8 Months
NASA Technical Reports Server (NTRS)
Moiseev, Alexander
2009-01-01
This viewgraph presentation reviews the science highlights for the first 8 months of the Fermi Gamma-Ray Observatory. Results from pulsars, flaring AGN, gamma ray bursts, diffuse radiation, LMC and electron spectrum are also presented.
ERIC Educational Resources Information Center
Yeari, Menahem; Oudega, Marja; van den Broek, Paul
2017-01-01
The present study investigated the effect of text highlighting on online processing and memory of central and peripheral information. We compared processing time (using eye-tracking methodology) and recall of central and peripheral information for three types of highlighting: (a) highlighting of central information, (b) highlighting of peripheral…
Highlights of Transient Plume Impingement Model Validation and Applications
NASA Technical Reports Server (NTRS)
Woronowicz, Michael
2011-01-01
This paper describes highlights of an ongoing validation effort conducted to assess the viability of applying a set of analytic point source transient free molecule equations to model behavior ranging from molecular effusion to rocket plumes. The validation effort includes encouraging comparisons to both steady and transient studies involving experimental data and direct simulation Monte Carlo results. Finally, this model is applied to describe features of two exotic transient scenarios involving NASA Goddard Space Flight Center satellite programs.
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
HIV and Cancer Interaction Highlights Need to Address Disease Stigma
The global landscape of disease highlights disparities that exist between nations. An estimated 36 million people worldwide live with HIV and AIDS, of which only 1 million are located within the United States. While the diagnosis of a life-threatening disease can be devastating, individuals with HIV and AIDS frequently bear an additional burden of stigma and discrimination.
McGowen, Michael R; Clark, Clay; Gatesy, John
2008-08-01
The macroevolutionary transition of whales (cetaceans) from a terrestrial quadruped to an obligate aquatic form involved major changes in sensory abilities. Compared to terrestrial mammals, the olfactory system of baleen whales is dramatically reduced, and in toothed whales is completely absent. We sampled the olfactory receptor (OR) subgenomes of eight cetacean species from four families. A multigene tree of 115 newly characterized OR sequences from these eight species and published data for Bos taurus revealed a diverse array of class II OR paralogues in Cetacea. Evolution of the OR gene superfamily in toothed whales (Odontoceti) featured a multitude of independent pseudogenization events, supporting anatomical evidence that odontocetes have lost their olfactory sense. We explored the phylogenetic utility of OR pseudogenes in Cetacea, concentrating on delphinids (oceanic dolphins), the product of a rapid evolutionary radiation that has been difficult to resolve in previous studies of mitochondrial DNA sequences. Phylogenetic analyses of OR pseudogenes using both gene-tree reconciliation and supermatrix methods yielded fully resolved, consistently supported relationships among members of four delphinid subfamilies. Alternative minimizations of gene duplications, gene duplications plus gene losses, deep coalescence events, and nucleotide substitutions plus indels returned highly congruent phylogenetic hypotheses. Novel DNA sequence data for six single-copy nuclear loci and three mitochondrial genes (> 5000 aligned nucleotides) provided an independent test of the OR trees. Nucleotide substitutions and indels in OR pseudogenes showed a very low degree of homoplasy in comparison to mitochondrial DNA and, on average, provided more variation than single-copy nuclear DNA. Our results suggest that phylogenetic analysis of the large OR superfamily will be effective for resolving relationships within Cetacea whether supermatrix or gene-tree reconciliation procedures are
The Third International Congress on Child Abuse and Neglect: Conference Highlights.
ERIC Educational Resources Information Center
Besharov, Douglas J.
1981-01-01
Presents highlights from the Third International Congress on Child Abuse and Neglect. The topic of child sexual abuse dominated the Congress; other topics included malnutrition, research problems, and concerns of Third World countries. Recommendations of the Congress are summarized.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matthews, T. David; Schmieder, Robert; Silva, Genivaldo G. Z.
The Salmonella enterica serovars Enteritidis, Dublin, and Gallinarum are closely related but differ in virulence and host range. To identify the genetic elements responsible for these differences and to better understand how these serovars are evolving, we sequenced the genomes of Enteritidis strain LK5 and Dublin strain SARB12 and compared these genomes to the publicly available Enteritidis P125109, Dublin CT 02021853 and Dublin SD3246 genome sequences. We also compared the publicly available Gallinarum genome sequences from biotype Gallinarum 287/91 and Pullorum RKS5078. Using bioinformatic approaches, we identified single nucleotide polymorphisms, insertions, deletions, and differences in prophage and pseudogene content betweenmore » strains belonging to the same serovar. Through our analysis we also identified several prophage cargo genes and pseudogenes that affect virulence and may contribute to a host-specific, systemic lifestyle. These results strongly argue that the Enteritidis, Dublin and Gallinarum serovars of Salmonella enterica evolve by acquiring new genes through horizontal gene transfer, followed by the formation of pseudogenes. As a result, the loss of genes necessary for a gastrointestinal lifestyle ultimately leads to a systemic lifestyle and niche exclusion in the host-specific serovars.« less
Matthews, T. David; Schmieder, Robert; Silva, Genivaldo G. Z.; ...
2015-06-03
The Salmonella enterica serovars Enteritidis, Dublin, and Gallinarum are closely related but differ in virulence and host range. To identify the genetic elements responsible for these differences and to better understand how these serovars are evolving, we sequenced the genomes of Enteritidis strain LK5 and Dublin strain SARB12 and compared these genomes to the publicly available Enteritidis P125109, Dublin CT 02021853 and Dublin SD3246 genome sequences. We also compared the publicly available Gallinarum genome sequences from biotype Gallinarum 287/91 and Pullorum RKS5078. Using bioinformatic approaches, we identified single nucleotide polymorphisms, insertions, deletions, and differences in prophage and pseudogene content betweenmore » strains belonging to the same serovar. Through our analysis we also identified several prophage cargo genes and pseudogenes that affect virulence and may contribute to a host-specific, systemic lifestyle. These results strongly argue that the Enteritidis, Dublin and Gallinarum serovars of Salmonella enterica evolve by acquiring new genes through horizontal gene transfer, followed by the formation of pseudogenes. As a result, the loss of genes necessary for a gastrointestinal lifestyle ultimately leads to a systemic lifestyle and niche exclusion in the host-specific serovars.« less
Bardella, Vanessa Bellini; Cabral-de-Mello, Diogo Cavalcanti
2018-03-10
One cluster of 5S rDNA per haploid genome is the most common pattern among Heteroptera. However, in Chariesterus armatus, highly scattered signals were noticed. We isolated and characterized the entire 5S rDNA unit of C. armatus aiming to a deeper knowledge of molecular organization of the 5S rDNA among Heteroptera and to understand possible causes and consequences of 5S rDNA chromosomal spreading. For a comparative analysis, we performed the same approach in Holymenia histrio with 5S rDNA restricted to one bivalent. Multiple 5S rDNA variants were observed in both species, though they were more variable in C. armatus, with some of variants corresponding to pseudogenes. These pseudogenes suggest birth-and-death mechanism, though homogenization was also observed (concerted evolution), indicating evolution through mixed model. Association between transposable elements and 5S rDNA was not observed, suggesting spreading of 5S rDNA through other mechanisms, like ectopic recombination. Scattered organization is a rare example for 5S rDNA, and such organization in C. armatus genome could have led to the high diversification of sequences favoring their pseudogenization. Copyright © 2017. Published by Elsevier B.V.
Matthews, T. David; Schmieder, Robert; Silva, Genivaldo G. Z.; Busch, Julia; Cassman, Noriko; Dutilh, Bas E.; Green, Dawn; Matlock, Brian; Heffernan, Brian; Olsen, Gary J.; Farris Hanna, Leigh; Schifferli, Dieter M.; Maloy, Stanley; Dinsdale, Elizabeth A.; Edwards, Robert A.
2015-01-01
The Salmonella enterica serovars Enteritidis, Dublin, and Gallinarum are closely related but differ in virulence and host range. To identify the genetic elements responsible for these differences and to better understand how these serovars are evolving, we sequenced the genomes of Enteritidis strain LK5 and Dublin strain SARB12 and compared these genomes to the publicly available Enteritidis P125109, Dublin CT 02021853 and Dublin SD3246 genome sequences. We also compared the publicly available Gallinarum genome sequences from biotype Gallinarum 287/91 and Pullorum RKS5078. Using bioinformatic approaches, we identified single nucleotide polymorphisms, insertions, deletions, and differences in prophage and pseudogene content between strains belonging to the same serovar. Through our analysis we also identified several prophage cargo genes and pseudogenes that affect virulence and may contribute to a host-specific, systemic lifestyle. These results strongly argue that the Enteritidis, Dublin and Gallinarum serovars of Salmonella enterica evolve by acquiring new genes through horizontal gene transfer, followed by the formation of pseudogenes. The loss of genes necessary for a gastrointestinal lifestyle ultimately leads to a systemic lifestyle and niche exclusion in the host-specific serovars. PMID:26039056
50 years of Arabidopsis research: highlights and future directions.
Provart, Nicholas J; Alonso, Jose; Assmann, Sarah M; Bergmann, Dominique; Brady, Siobhan M; Brkljacic, Jelena; Browse, John; Chapple, Clint; Colot, Vincent; Cutler, Sean; Dangl, Jeff; Ehrhardt, David; Friesner, Joanna D; Frommer, Wolf B; Grotewold, Erich; Meyerowitz, Elliot; Nemhauser, Jennifer; Nordborg, Magnus; Pikaard, Craig; Shanklin, John; Somerville, Chris; Stitt, Mark; Torii, Keiko U; Waese, Jamie; Wagner, Doris; McCourt, Peter
2016-02-01
922 I. 922 II. 922 III. 925 IV. 925 V. 926 VI. 927 VII. 928 VIII. 929 IX. 930 X. 931 XI. 932 XII. 933 XIII. Natural variation and genome-wide association studies 934 XIV. 934 XV. 935 XVI. 936 XVII. 937 937 References 937 SUMMARY: The year 2014 marked the 25(th) International Conference on Arabidopsis Research. In the 50 yr since the first International Conference on Arabidopsis Research, held in 1965 in Göttingen, Germany, > 54 000 papers that mention Arabidopsis thaliana in the title, abstract or keywords have been published. We present herein a citational network analysis of these papers, and touch on some of the important discoveries in plant biology that have been made in this powerful model system, and highlight how these discoveries have then had an impact in crop species. We also look to the future, highlighting some outstanding questions that can be readily addressed in Arabidopsis. Topics that are discussed include Arabidopsis reverse genetic resources, stock centers, databases and online tools, cell biology, development, hormones, plant immunity, signaling in response to abiotic stress, transporters, biosynthesis of cells walls and macromolecules such as starch and lipids, epigenetics and epigenomics, genome-wide association studies and natural variation, gene regulatory networks, modeling and systems biology, and synthetic biology. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
STS-114 Flight Day 3 Highlights
NASA Technical Reports Server (NTRS)
2005-01-01
Video coverage of Day 3 includes highlights of STS-114 during the approach and docking of Discovery with the International Space Station (ISS). The Return to Flight continues with space shuttle crew members (Commander Eileen Collins, Pilot James Kelly, Mission Specialists Soichi Noguchi, Stephen Robinson, Andrew Thomas, Wendy Lawrence, and Charles Camarda) seen in onboard activities on the fore and aft portions of the flight deck during the orbiter's approach. Camarda sends a greeting to his family, and Collins maneuvers Discovery as the ISS appears steadily closer in sequential still video from the centerline camera of the Orbiter Docking System. The approach includes video of Discovery from the ISS during the orbiter's Rendezvous Pitch Maneuver, giving the ISS a clear view of the thermal protection systems underneath the orbiter. Discovery docks with the Destiny Laboratory of the ISS, and the shuttle crew greets the Expedition 11 crew (Commander Sergei Krikalev and NASA ISS Science Officer and Flight Engineer John Phillips) of the ISS onboard the station. Finally, the Space Station Remote Manipulator System hands the Orbiter Boom Sensor System to its counterpart, the Shuttle Remote Manipulator System.
CROI 2018: Highlights of Viral Hepatitis.
Luetkemeyer, Anne F; Wyles, David L
2018-05-01
At the 2018 Conference on Retroviruses and Opportunistic Infections (CROI), there was a major focus on hepatitis C virus (HCV) elimination and improving each component of the hepatitis C care cascade. Several countries and cohorts have demonstrated the remarkable impact that universal HCV testing and unrestricted access to hepatitis C treatment can have on markedly reducing incident HCV infections and HCV infection prevalence, including in people who inject drugs and HIV/HCV-coinfected populations. However, in many settings, substantial barriers to widespread HCV treatment remain, including undiagnosed HCV infection, particularly in populations outside the standard "baby boomer" birth cohort (ie, born 1945-1965); restricted access to hepatitis C treatment in those with known HCV infection; reinfection with HCV; and migration of HCV-infected populations. Many innovative programs have successfully implemented HCV testing and treatment outside of traditional care settings, expanding access for harder-to-reach populations, which will be crucial to successful elimination efforts. Outbreaks of hepatitis A virus (HAV) infection continue to occur in among men who have sex with men and homeless populations in the United States, Europe, and Southeast Asia, highlighting the need for improved HAV vaccination programs for populations at risk.
NASA Technical Reports Server (NTRS)
Jones, F. C. (Compiler)
1986-01-01
Invited talks, rapporteur talks, and highlight talks are included. Topics of the invited and highlight talks include astrophysical jets, gamma-ray line astronomy, cosmic rays and gamma rays in astrophysics, the early universe, elementary particle physics, solar flares and acceleration of energetic particles, cosmogenic nuclei, extragalactic astronomy, composition of solar flare particles, very high energy gamma ray sources, gamma-ray bursts, shock acceleration in the solar wind, cosmic rays in deep underground detectors, spectrum of cosmic rays at 10 to the 19th power eV, and nucleus-nucleus interactions.
Adaptive Highlighting of Links to Assist Surfing on the Internet
2002-01-01
search engines do not offer a satisfactory solution, their indexing cycle is long and creates a time lag of about one month. Moreover, sometimes search engines offer a huge amount of documents, which is hard to constrain and to increase the ratio of relevant information. A novel AI-assisted surfing method, which highlights links during surfing is studied here. The method makes use
Highlighting material structure with transmission electron diffraction correlation coefficient maps.
Kiss, Ákos K; Rauch, Edgar F; Lábár, János L
2016-04-01
Correlation coefficient maps are constructed by computing the differences between neighboring diffraction patterns collected in a transmission electron microscope in scanning mode. The maps are shown to highlight material structural features like grain boundaries, second phase particles or dislocations. The inclination of the inner crystal interfaces are directly deduced from the resulting contrast. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
2001-01-01
At the beginning of the new millennium, ESO and its staff are facing the future with confidence. The four 8.2-m Unit Telescopes of the Very Large Telescope (VLT) are in great shape and the VLT Interferometer (VLTI) will soon have "first fringes". The intercontinental ALMA project is progressing well and concepts for extremely large optical/infrared telescopes are being studied. They can also look back at a fruitful and rewarding past year. Perhaps the most important, single development has been the rapid transition of the Very Large Telescope (VLT). From being a "high-tech project under construction" it has now become a highly proficient, world-class astronomical observatory. This trend is clearly reflected in ESO's Press Releases , as more and more front-line scientific results emerge from rich data obtained at this very efficient facility. There were also exciting news from several of the instruments at La Silla. At the same time, the ESO community may soon grow, as steps towards membership are being taken by various European countries. Throughout 2000, a total of 54 PR communications were made, with a large number of Press Photos and Video Clips, cf. the 2000 PR Index. Some of the ESO PR highlights may be accessed directly via the clickable image on the present page. ESO PR Photo 01/01 is also available in a larger (non-clickable) version [ JPEG: 566 x 566 pix - 112k]. It may be reproduced, if credit is given to the European Southern Observatory.
Research highlights: impacts of microplastics on plankton.
Lin, Vivian S
2016-02-01
Each year, millions of metric tons of the plastic produced for food packaging, personal care products, fishing gear, and other human activities end up in lakes, rivers, and the ocean. The breakdown of these primary plastics in the environment results in microplastics, small fragments of plastic typically less than 1-5 mm in size. These synthetic particles have been detected in all of the world's oceans and also in many freshwater systems, accumulating in sediment, on shorelines, suspended in surface waters, and being ingested by plankton, fish, birds, and marine mammals. While the occurrence of plastics in surface waters has been surveyed in a number of studies, the impacts of microplastics on marine organisms are still being elucidated. This highlight features three recent publications that explore the interactions of microplastics with planktonic organisms to clarify the effects of these pollutants on some of the ocean's smallest and most important inhabitants.
Frayne, Jan; Taylor, Abby; Cameron, Gus; Hadfield, Andrea T.
2009-01-01
Sperm glyceraldehyde-3-phosphate dehydrogenase has been shown to be a successful target for a non-hormonal contraceptive approach, but the agents tested to date have had unacceptable side effects. Obtaining the structure of the sperm-specific isoform to allow rational inhibitor design has therefore been a goal for a number of years but has proved intractable because of the insoluble nature of both native and recombinant protein. We have obtained soluble recombinant sperm glyceraldehyde-3-phosphate dehydrogenase as a heterotetramer with the Escherichia coli glyceraldehyde-3-phosphate dehydrogenase in a ratio of 1:3 and have solved the structure of the heterotetramer which we believe represents a novel strategy for structure determination of an insoluble protein. A structure was also obtained where glyceraldehyde 3-phosphate binds in the Ps pocket in the active site of the sperm enzyme subunit in the presence of NAD. Modeling and comparison of the structures of human somatic and sperm-specific glyceraldehyde-3-phosphate dehydrogenase revealed few differences at the active site and hence rebut the long presumed structural specificity of 3-chlorolactaldehyde for the sperm isoform. The contraceptive activity of α-chlorohydrin and its apparent specificity for the sperm isoform in vivo are likely to be due to differences in metabolism to 3-chlorolactaldehyde in spermatozoa and somatic cells. However, further detailed analysis of the sperm glyceraldehyde-3-phosphate dehydrogenase structure revealed sites in the enzyme that do show significant difference compared with published somatic glyceraldehyde-3-phosphate dehydrogenase structures that could be exploited by structure-based drug design to identify leads for novel male contraceptives. PMID:19542219
2013-08-01
CCT G-30; KLK2 F: 50- TGG CTG TGT ACA GTC ATG GA-30; KLK2 R: 50- CCT GTG TCT TCA GGC TCA AA-30; TMPRSS2 F: 50-AGG TGC ATC CGG CTC AGT A-30; TMPRSS2 R...50-GGG TCA AGG TGA TGC ACA GT-30; PCDH11 F: 50-GCG TTT CTG ACT GTG GCT ATC-30; PCDH11 R: 50-GGA AGG GGA ATG GAA TTT TG-30; UGT2B15 F: 50-TCA AATc-Jun...GAPDH F: 50-CTG ACT TCA ACA GCG ACA CC-30; GAPDH R: 50-CCC TGT TGC TGT AGC CAA AT-30; AR F: 50- GTG GAA GCT GCA AGG TCT TC-30; AR R 50-CGA AGA CGA
DOE Office of Scientific and Technical Information (OSTI.GOV)
None
2015-06-01
This NREL Highlight discusses a recent state-of-the-art review of membrane processes for air conditioning that identifies future research opportunities. This highlight is being developed for the June 2015 S&T Alliance Board meeting.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Launay, Hélène; Barré, Patrick; Puppo, Carine
2016-08-12
The redox switch protein CP12 is a key player of the regulation of the Benson–Calvin cycle. Its oxidation state is controlled by the formation/dissociation of two intramolecular disulphide bridges during the day/night cycle. CP12 was known to be globally intrinsically disordered on a large scale in its reduced state, while being partly ordered in the oxidised state. By combining Nuclear Magnetic Resonance and Small Angle X-ray Scattering experiments, we showed that, contrary to secondary structure or disorder predictions, reduced CP12 is fully disordered, with no transient or local residual structure likely to be precursor of the structures identified in themore » oxidised active state and/or in the bound state with GAPDH or PRK. These results highlight the diversity of the mechanisms of regulation of conditionally disordered redox switches, and question the stability of oxidised CP12 scaffold. - Highlights: • CP12 is predicted to form two helices in its N-terminal sequence. • Reduced CP12 is disordered as a random coil according to SAXS. • Limited or no transient structures are observed in reduced CP12 by NMR.« less
Berardinelli–Seip syndrome: highlight of treatment challenge
Ferraria, Nélia; Pedrosa, Cristina; Amaral, Daniela; Lopes, Lurdes
2013-01-01
Berardinelli–Seip congenital lipodystrophy (BSCL) syndrome is a rare autosomal-recessive disease characterised by lipoatrophy and associated with deregulations of glycidic and lipid metabolism. We report three BSCL cases with its typical clinical picture and complications. Clinically, they all show marked atrophy of adipose tissue, acromegaly, acanthosis nigricans and tall stature. Two cases present attention deficit hyperactivity and developmental learning disorders; another patient has hypertrophic myocardiopathy and polycystic ovary syndrome. In all the cases AGPAT2 was the identified mutation. All the cases present hypertriglyceridemia. One case has developed hyperinsulinism controlled with metformin and another case already has type 2 diabetes with a difficult clinical control. There is no curative treatment and the current treatment options are based only on symptomatic control of the complications. Recently, published studies showed that leptin-replacement therapy appears a promising tool in the metabolic correction of BSCL complications, highlighting the importance of further investigations in BSCL treatment. PMID:23362058
Highlighting cancer cells with macromolecular probes
NASA Astrophysics Data System (ADS)
Tang, Sicheng; Zhang, Yang; Thapaliya, Ek Raj; Brown, Adrienne S.; Wilson, James N.; Raymo, Françisco M.
2017-02-01
Conventional fluorophore-ligand constructs for the detection of cancer cells generally produce relatively weak signals with modest contrast. The inherently low brightness accessible per biding event with the pairing of a single organic fluorophore to a single ligand as well as the contribution of unbound probes to background fluorescence are mainly responsible for these limitations. Our laboratories identified a viable structural design to improve both brightness and contrast. It is based on the integration of activatable fluorophores and targeting ligands within the same macromolecular construct. The chromophoric components are engineered to emit bright fluorescence exclusively in acidic environments. The targeting agents are designed to bind complementary receptors overexpressed on the surface of cancer cells and allow internalization of the macromolecules into acidic organelles. As a result of these properties, our macromolecular probes switch their intense emission on exclusively in the intracellular space of target cells with minimal background fluorescence from the extracellular matrix. In fact, these operating principles translate into a 170-fold enhancement in brightness, relative to equivalent but isolated chromophoric components, and a 3-fold increase in contrast, relative to model but non-activatable fluorophores. Thus, our macromolecular probes might ultimately evolve into valuable analytical tools to highlight cancer cells with optimal signal-to-noise ratios in a diversity of biomedical applications.
Fifteen Years of Chandra Operation: Scientific Highlights and Lessons Learned
NASA Technical Reports Server (NTRS)
Weisskopf, Martin C.
2014-01-01
NASA's Chandra X-Ray Observatory, designed for three years of operation with a goal of five years is now entering its 15-th year of operation. Thanks to its superb angular resolution, the Observatory continues to yield new and exciting results, many of which were totally unanticipated prior to launch. We will review some scientific highlights and present "lessons learned" from the experience of operating this great observatory.
Major taste loss in carnivorous mammals
Jiang, Peihua; Josue, Jesusa; Li, Xia; Glaser, Dieter; Li, Weihua; Brand, Joseph G.; Margolskee, Robert F.; Reed, Danielle R.; Beauchamp, Gary K.
2012-01-01
Mammalian sweet taste is primarily mediated by the type 1 taste receptor Tas1r2/Tas1r3, whereas Tas1r1/Tas1r3 act as the principal umami taste receptor. Bitter taste is mediated by a different group of G protein-coupled receptors, the Tas2rs, numbering 3 to ∼66, depending on the species. We showed previously that the behavioral indifference of cats toward sweet-tasting compounds can be explained by the pseudogenization of the Tas1r2 gene, which encodes the Tas1r2 receptor. To examine the generality of this finding, we sequenced the entire coding region of Tas1r2 from 12 species in the order Carnivora. Seven of these nonfeline species, all of which are exclusive meat eaters, also have independently pseudogenized Tas1r2 caused by ORF-disrupting mutations. Fittingly, the purifying selection pressure is markedly relaxed in these species with a pseudogenized Tas1r2. In behavioral tests, the Asian otter (defective Tas1r2) showed no preference for sweet compounds, but the spectacled bear (intact Tas1r2) did. In addition to the inactivation of Tas1r2, we found that sea lion Tas1r1 and Tas1r3 are also pseudogenized, consistent with their unique feeding behavior, which entails swallowing food whole without chewing. The extensive loss of Tas1r receptor function is not restricted to the sea lion: the bottlenose dolphin, which evolved independently from the sea lion but displays similar feeding behavior, also has all three Tas1rs inactivated, and may also lack functional bitter receptors. These data provide strong support for the view that loss of taste receptor function in mammals is widespread and directly related to feeding specializations. PMID:22411809
Are Synonymous Sites in Primates and Rodents Functionally Constrained?
Price, Nicholas; Graur, Dan
2016-01-01
It has been claimed that synonymous sites in mammals are under selective constraint. Furthermore, in many studies the selective constraint at such sites in primates was claimed to be more stringent than that in rodents. Given the larger effective population sizes in rodents than in primates, the theoretical expectation is that selection in rodents would be more effective than that in primates. To resolve this contradiction between expectations and observations, we used processed pseudogenes as a model for strict neutral evolution, and estimated selective constraint on synonymous sites using the rate of substitution at pseudosynonymous and pseudononsynonymous sites in pseudogenes as the neutral expectation. After controlling for the effects of GC content, our results were similar to those from previous studies, i.e., synonymous sites in primates exhibited evidence for higher selective constraint that those in rodents. Specifically, our results indicated that in primates up to 24% of synonymous sites could be under purifying selection, while in rodents synonymous sites evolved neutrally. To further control for shifts in GC content, we estimated selective constraint at fourfold degenerate sites using a maximum parsimony approach. This allowed us to estimate selective constraint using mutational patterns that cause a shift in GC content (GT ↔ TG, CT ↔ TC, GA ↔ AG, and CA ↔ AC) and ones that do not (AT ↔ TA and CG ↔ GC). Using this approach, we found that synonymous sites evolve neutrally in both primates and rodents. Apparent deviations from neutrality were caused by a higher rate of C → A and C → T mutations in pseudogenes. Such differences are most likely caused by the shift in GC content experienced by pseudogenes. We conclude that previous estimates according to which 20-40% of synonymous sites in primates were under selective constraint were most likely artifacts of the biased pattern of mutation.
Minaya, Miguel; Díaz-Pérez, Antonio; Mason-Gamer, Roberta; Pimentel, Manuel; Catalán, Pilar
2015-10-01
Low-copy nuclear genes (LCNGs) have complex genetic architectures and evolutionary dynamics. However, unlike multicopy nuclear genes, LCNGs are rarely subject to gene conversion or concerted evolution, and they have higher mutation rates than organellar or nuclear ribosomal DNA markers, so they have great potential for improving the robustness of phylogenetic reconstructions at all taxonomic levels. In this study, our first objective is to evaluate the evolutionary dynamics of the LCNG β-amylase by testing for potential pseudogenization, paralogy, homeology, recombination, and phylogenetic incongruence within a broad representation of the main Pooideae lineages. Our second objective is to determine whether β-amylase shows sufficient phylogenetic signal to reconstruct the evolutionary history of the Pooid grasses. A multigenic (ITS, matK, ndhF, trnTL, and trnLF) tree of the study group provided a framework for assessing the β-amylase phylogeny. Eight accessions showed complete absence of selection, suggesting putative pseudogenic copies or other relaxed selection pressures; resolution of Vulpia alopecuros 2x clones indicated its potential (semi) paralogy; and homeologous copies of allopolyploid species Festuca simensis, F. fenas, and F. arundinacea tracked their Mediterranean origin. Two recombination events were found within early-diverged Pooideae lineages, and five within the PACCMAD clade. The unexpected phylogenetic relationships of 37 grass species (26% of the sampled species) highlight the frequent occurrence of non-treelike evolutionary events, so this LCNG should be used with caution as a phylogenetic marker. However, once the pitfalls are identified and removed, the phylogenetic reconstruction of the grasses based on the β-amylase exon+intron positions is optimal at all taxonomic levels. Copyright © 2015 Elsevier Inc. All rights reserved.
Regional differences in mitochondrial DNA methylation in human post-mortem brain tissue.
Devall, Matthew; Smith, Rebecca G; Jeffries, Aaron; Hannon, Eilis; Davies, Matthew N; Schalkwyk, Leonard; Mill, Jonathan; Weedon, Michael; Lunnon, Katie
2017-01-01
DNA methylation is an important epigenetic mechanism involved in gene regulation, with alterations in DNA methylation in the nuclear genome being linked to numerous complex diseases. Mitochondrial DNA methylation is a phenomenon that is receiving ever-increasing interest, particularly in diseases characterized by mitochondrial dysfunction; however, most studies have been limited to the investigation of specific target regions. Analyses spanning the entire mitochondrial genome have been limited, potentially due to the amount of input DNA required. Further, mitochondrial genetic studies have been previously confounded by nuclear-mitochondrial pseudogenes. Methylated DNA Immunoprecipitation Sequencing is a technique widely used to profile DNA methylation across the nuclear genome; however, reads mapped to mitochondrial DNA are often discarded. Here, we have developed an approach to control for nuclear-mitochondrial pseudogenes within Methylated DNA Immunoprecipitation Sequencing data. We highlight the utility of this approach in identifying differences in mitochondrial DNA methylation across regions of the human brain and pre-mortem blood. We were able to correlate mitochondrial DNA methylation patterns between the cortex, cerebellum and blood. We identified 74 nominally significant differentially methylated regions ( p < 0.05) in the mitochondrial genome, between anatomically separate cortical regions and the cerebellum in matched samples ( N = 3 matched donors). Further analysis identified eight significant differentially methylated regions between the total cortex and cerebellum after correcting for multiple testing. Using unsupervised hierarchical clustering analysis of the mitochondrial DNA methylome, we were able to identify tissue-specific patterns of mitochondrial DNA methylation between blood, cerebellum and cortex. Our study represents a comprehensive analysis of the mitochondrial methylome using pre-existing Methylated DNA Immunoprecipitation
Chavez, Juan D.; Bisson, William H.
2011-01-01
The site-specific identification of α-aminoadipic semialdehyde (AAS) and γ-glutamic semialdehyde (GGS) residues in proteins is reported. Semialdehydic protein modifications result from the metal-catalyzed oxidation of Lys or Arg and Pro residues, respectively. Most of the analytical methods for the analysis of protein carbonylation measure change to the global level of carbonylation and fail to provide details regarding protein identity, site, and chemical nature of the carbonylation. In this work, we used a targeted approach, which combines chemical labeling, enrichment, and tandem mass spectrometric analysis, for the site-specific identification of AAS and GGS sites in proteins. The approach is applied to in vitro oxidized glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and an untreated biological sample, namely cardiac mitochondrial proteins. The analysis of GAPDH resulted in the site-specific identification of two AAA and four GGS residues. Computational evaluation of the identified AAS and GGS sites in GAPDH indicated that these sites are located in flexible regions, show high solvent accessibility values, and are in proximity with possible metal ion binding sites. The targeted proteomic analysis of semialdehydic modifications in cardiac mitochondria yielded nine AAS modification sites which were unambiguously assigned to distinct lysine residues in the following proteins: ATP/ATP translocase isoforms 1 and 2, ubiquinol cytochrome-c reductase core protein 2, and ATP synthase α-subunit. PMID:20957471
Dad, Azra; Jeong, Clara H; Pals, Justin A; Wagner, Elizabeth D; Plewa, Michael J
2013-10-01
Monohaloacetic acids (monoHAAs) are a major class of drinking water disinfection by-products (DBPs) and are cytotoxic, genotoxic, mutagenic, and teratogenic. We propose a model of toxic action based on monoHAA-mediated inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a target cytosolic enzyme. This model predicts that GAPDH inhibition by the monoHAAs will lead to a severe reduction of cellular ATP levels and repress the generation of pyruvate. A loss of pyruvate will lead to mitochondrial stress and genomic DNA damage. We found a concentration-dependent reduction of ATP in Chinese hamster ovary cells after monoHAA treatment. ATP reduction per pmol monoHAA followed the pattern of iodoacetic acid (IAA) > bromoacetic acid (BAA) > chloroacetic acid (CAA), which is the pattern of potency observed with many toxicological endpoints. Exogenous supplementation with pyruvate enhanced ATP levels and attenuated monoHAA-induced genomic DNA damage as measured with single cell gel electrophoresis. These data were highly correlated with the SN 2 alkylating potentials of the monoHAAs and with the induction of toxicity. The results from this study strongly support the hypothesis that GAPDH inhibition and the possible subsequent generation of reactive oxygen species is linked with the cytotoxicity, genotoxicity, teratogenicity, and neurotoxicity of these DBPs. Copyright © 2013 Wiley Periodicals, Inc.
Highlighted scientific findings of the Interior Columbia Basin Ecosystem Management Project.
Thomas M. Quigley; Heidi Bigler Cole
1997-01-01
Decisions regarding 72 million acres of Forest Service- and Bureau of Land Management- administered lands will be based on scientific findings brought forth in the Interior Columbia Basin Ecosystem Management Project. Some highlights of the scientific findings are presented here. Project scientists drew three general conclusions: (1) Conditions and trends differ widely...
ERIC Educational Resources Information Center
Colby, Anne; Beaumont, Elizabeth; Ehrlich, Thomas; Corngold, Josh
2007-01-01
This paper, highlights the forthcoming book "Educating for Democracy." The book articulates the conditions under which political teaching and learning in college is and is not legitimate, making the case that education for political development can and should be conducted in a manner that is consistent with the core values of higher education…
Highlights of Science Launching on SpaceX CRS-15
2018-06-24
A new batch of science is headed to the International Space Station aboard the SpaceX Dragon on the company’s 15th mission for commercial resupply services. Among the research being delivered is science that studies the use of artificial intelligence for crew support, plant water use all over the planet, gut health in space, more efficient drug development and the formation of inorganic structures without the influence of Earth’s gravity. The International Space Station is a convergence of science, technology and human innovation that demonstrates new technologies and enables research not possible on Earth. The space station has been occupied continuously since November 2000. In that time, more than 230 people and a variety of international and commercial spacecraft have visited the orbiting laboratory. The space station remains the springboard to NASA's next great leap in exploration, including future human missions to the Moon and eventually to Mars. Highlighted investigations shown: Mobile Companion/CIMON: https://go.nasa.gov/2JCgPRf ECOSTRESS: https://go.nasa.gov/2sT87DV Angiex Cancer Therapy: https://go.nasa.gov/2LA1Cgc Rodent Research-7: https://go.nasa.gov/2JlVQlC Chemical Gardens: https://go.nasa.gov/2JDCYie Follow updates on the science conducted aboard the space station on Twitter: https://twitter.com/iss_research For more information on how you can conduct your research in microgravity, visit https://go.nasa.gov/2q84LJj HD Download: https://archive.org/details/jsc2018m000428_Highlights_of_Science_Launching_on_SpaceX_CRS-15
Two interesting cases highlighting an oblivious specialty of psychoneuroendocrinology.
Hari Kumar, K V S; Dhull, Pawan; Somasekharan, Manoj; Seshadri, K
2012-01-01
Psychoneuroendocrinology deals with the overlap disorders pertaining to three different specialties. Awareness about the somatic manifestations of psychiatric diseases and vice versa is a must for all the clinicians. The knowledge of this interlinked specialty is essential because of the obscure presentation of certain disorders. Our first case was treated as depressive disorder, whereas the diagnosis was hypogonadism with empty sella. Our second patient was managed as schizophrenia and the evaluation revealed bilateral basal ganglia calcification and a diagnosis of Fahr's disease. We report these cases for their unusual presentation and to highlight the importance of this emerging specialty.
Highlights lecture EANM 2014: "Gimme gimme gimme those nuclear Super Troupers".
de Jong, Marion; Van Laere, Koen
2015-04-01
The EANM Congress 2014 took place in Gothenburg, Sweden, from 18 to 22 October under the presidency of Prof. Wim Oyen, chair of the EANM Scientific Committee. Prof. Peter Gjertsson chaired the Local Organizing Committee, according to the standardized EANM congress structure. The meeting was a highlight for the multidisciplinary community that forms the heart and soul of nuclear medicine; attendance was exceptionally high. In total almost 5,300 participants came to Gothenburg, and 1,397 colleagues participated via the EANM LIVE sessions ( http://eanmlive.eanm.org/index.php ). Participants from all continents were presented with an excellent programme consisting of symposia, scientific and featured sessions, CME sessions, and plenary lectures. These lectures were devoted to nuclear medicine therapy, hybrid imaging and molecular life sciences. Two tracks were included in the main programme, clustering multi-committee involvement: the 5th International Symposium on Targeted Radionuclide-therapy and Dosimetry (ISTARD) and the first Molecules to Man (M2M) track, an initiative of the EANM Committees for Translational Molecular Imaging, Radiopharmacy and Drug Development. The industry made a substantial contribution to the success of the congress demonstrating the latest technology and innovations in the field. During the closing Highlights Lecture, a selection of the best-rated abstracts was presented including diverse areas of nuclear medicine: physics and instrumentation, radiopharmacy, preclinical imaging, oncology (with a focus on the clinical application of newly developed tracers) and radionuclide therapy, cardiology and neurosciences. This Highlights Lecture could only be a brief summary of the large amount of data presented and discussed during the meeting, which can be found in much greater detail in the congress proceedings book, published as Volume 41, Supplement 2 of the European Journal of Nuclear Medicine and Molecular Imaging in October 2014.
Mogal, Ashish; Abdulkadir, Sarki A
2006-04-01
In quantitative RT-PCR (qRT-PCR), analysis of gene expression is dependent on normalization using housekeeping genes such as 18S rRNA, GAPDH and beta actin. However, variability in their expression has been reported to be caused by factors like drug treatment, pathological states and cell-cycle phase. An emerging area of cancer research focuses on identifying the role of epigenetic alterations such as histone modifications and DNA methylation in the initiation and progression of cancer. Histone acetylation is the best studied modification so far and has been probed through the use of histone deacetylase inhibitors (HDACi). Further, modulation of histone acetylation is currently being explored as a therapeutic strategy in the treatment of cancer and HDACis have shown promise in inhibiting tumorigenesis and metastasis. Trichostatin-A (TSA) is the most widely used HDACi. Therefore, we were driven to identify a suitable internal control for RT-PCR following TSA treatment. We performed quantitative RT-PCR analysis using mouse prostate tissue explants, human prostate cancer (LNCaP) cells and human breast cancer (T-47D and ZR-75-1) cells following TSA treatment. Expression of housekeeping genes including 18S rRNA, beta actin, GAPDH and ribosomal highly-basic 23-kDa protein (rb 23-kDa, RPL13A) were compared in vehicle versus TSA treated samples. Our results showed marked variations in 18S rRNA, beta actin mRNA and GAPDH mRNA levels in mouse prostate explants and a human prostate cancer (LNCaP) cell line following TSA treatment. Furthermore, in two human breast cancer cell lines (T-47D and ZR-75-1) 18S rRNA, beta actin mRNA and GAPDH mRNA levels varied significantly. However, RPL13A mRNA levels remained constant in all the conditions tested. Therefore, we recommend use of RPL13A as a standard for normalization during TSA treatment.
Karataylı, Ersin; Altunoğlu, Yasemin Çelik; Karataylı, Senem Ceren; Yurdaydın, Cihan; Bozdayı, A Mithat
2014-10-01
Internal controls (ICs), are the main components of any real-time PCR based amplification methods, which are co-purified and co-amplified with the actual target. The existence of free circulating nucleic acids in plasma and serum (CNAPS) has been known for many years. The aim of this study was to verify whether CNAPS can be used as ICs in real-time PCR based detection and quantification of DNA or RNA targets in plasma and serum samples. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a housekeeping gene, was chosen at random as CNAPS to serve as an intrinsic internal control in two different real-time PCR based quantification models in plasma and serum. Viral loads of hepatitis B virus (HBV) DNA and hepatitis delta virus (HDV) RNA were quantified as actual targets in parallel to GAPDH as IC in a total of 519 serum or plasma samples including 21 healthy controls, 202 positive chronic hepatitis delta patients, 37 chronic hepatitis C patients, 168 chronic hepatitis B patients, 52 patients with hepatocellular carcinoma, and 39 patients with non-alcoholic steatohepatitis/non-alcoholic fatty liver disease. GAPDH levels did not show significant variance in different patient groups and yielded positive signals in all 519 patients with persistent cycle threshold (CT) values 27.85±1.57 (mean±standard deviation (SD)). Reproducibility of the GAPDH amplification in HDV RNA and HBV DNA quantifications was shown with a SD value of CT ranging from 0.42 to 2.14 (mean SD; 1.18) and 0.24 to 1.75 (mean SD; 1.03), respectively. In conclusion, the freely circulating nucleic acids can clearly be used as internal controls for real-time PCR based detection and quantification of any RNA and mainly DNA targets (pathogens) in serum or plasma and this simply excludes the compulsory external addition of any IC molecules into the reaction. Copyright © 2014 Elsevier B.V. All rights reserved.
New steroid 5alpha-reductase type I (SRD5A1) homologous sequences on human chromosomes 6 and 8.
Eminović, I; Liović, M; Prezelj, J; Kocijancic, A; Rozman, D; Komel, R
2001-01-01
To date, two genes encoding 5alpha-reductase isoenzymes are known (type I, type II), and one type I pseudogene. The divergent localization of these genes and the still not fully understood function of the encoded enzymes as well as the perplexing results we obtained after sequencing PCR-amplified SRD5A1 gene fragments (out of genomic DNA), made us assume that, in addition to the known SRD5A1 gene, one or more different human 5alpha-reductase type I coding genes may exist. Our research provide the first evidence for the existence of two new SRD5A1 related, previously unidentified sequences in the human genome. These sequences which were localized to chromosomes 6 and 8 are highly homologous (> 99%) to SRD5A1, and also do not contain any deletions or insertions that are otherwise a characteristic of the SRD5API pseudogene. Our results imply that these sequences may be either coding parts of yet unknown, active SRD5A1 genes, and/or of previously unidentified pseudogenes. These findings additionally support data of Chen et al. who confirmed the existence of various SRD5A1 proteins in cultured human skin cells.
STS-88 Mission Highlights Resources Tape. Tape A
NASA Technical Reports Server (NTRS)
1999-01-01
The STS-88 flight crew, Commander Robert D. Cabana, Pilot Frederick W. Sturckow, and Mission Specialists Nancy J. Currie, James H. Newman, Jerry L. Ross, and Sergei Krikalev present a video overview of their space flight. This is the first of three videos which show the highlights of the Endeavour mission. Important visual images include pre-launch activities such as the eating the traditional breakfast, crew suit-up, and the ride out to the launch pad. Also included are various panoramic views of the shuttle on the pad. After the closing of the hatch and arm retraction, launch activities are shown including countdown, engine ignition, launch, and the separation of the Solid Rocket Boosters. Once on-orbit crew members are seen delivering and connecting the UNITY Connecting Module to the ZARYA Control Module.
STS-47 Mission Highlights Resource Tape
NASA Technical Reports Server (NTRS)
1992-01-01
The mission of the STS-47 flight is highlighted in this video. The flight crew consisted of: Cmdr. 'Hoot' Gibson, Pilot Kurt Brown, Payload Cmdr. Jan Davis, Payload Specialist. M. Mohri (Japanese Astronaut), and Mission Specialists Jay Apt and May Jemison. The primary goal of this mission was the set-up and carrying out of experiments in the accompanying Japanese Spacelab (SL-J) in cooperation with the Japanese Space Program. Dr. Mohri is the first professional Japanese astronaut to fly in space. Vice President Dan Quayle and his wife are shown addressing the astronauts of the Space Shuttle Endeavour with a small pre-launch speech. On this flight many different physical, physiological, and biological spaceborne experiments were performed. These experiments included: a gas evaporation in low gravity environment experiment; a brainwave signals from carp experiment; several human eye movement and visual physiological tests; various physiological tests on a variety of insects and frogs; a embryology experiments on tadpoles; several experiments concerned with fluid dynamics; an imaging furnace test with heated glass containing gold particles (flow measurement); a Solid Surface Combustion Experiment; and a protein crystal growth experiment. Launch, in-orbit, and landing footage is shown, along with a variety of crew activities. One feature that astronauts were able to videotape was the actual in-orbit movement of the side wing flaps of the Space Shuttle.
Stecyk, Jonathan A W; Couturier, Christine S; Fagernes, Cathrine E; Ellefsen, Stian; Nilsson, Göran E
2012-03-01
The mRNA expression of heat-shock protein 90 (HSP90) and heat-shock cognate 70 (HSC70) was examined in cardiac chambers and telencephalon of warm- (21°C) and cold-acclimated (5°C) turtles (Trachemys scripta) exposed to normoxia, prolonged anoxia or anoxia followed by reoxygenation. Additionally, the suitability of total RNA as well as mRNA from β-actin, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and cyclophilin A (PPIA) for normalizing gene expression data was assessed, as compared to the use of an external RNA control. Measurements of HSP90 and HSC70 mRNA expression revealed that anoxia and reoxygenation have tissue- and gene-specific effects. By and large, the alterations support previous investigations on HSP protein abundance in the anoxic turtle heart and brain, as well as the hypothesized roles of HSP90 and HSC70 during stress and non-stress conditions. However, more prominent was a substantially increased HSP90 and HSC70 mRNA expression in the cardiac chambers with cold acclimation. The finding provides support for the notion that cold temperature induces a number of adaptations in tissues of anoxia-tolerant vertebrates that precondition them for winter anoxia. β-actin, GAPDH and PPIA mRNA expression and total RNA also varied with oxygenation state and acclimation temperature in a tissue- and gene-specific manner, as well as among tissue types, thus disqualifying them as suitable for real-time RT-PCR normalization. Thus, the present data highlights the advantages of normalizing real-time RT-PCR data to an external RNA control, an approach that also allows inter-tissue and potentially inter-species comparisons of target gene expression. Copyright © 2011 Elsevier Inc. All rights reserved.
Hanke, Nina; Scheibe, Renate J; Manukjan, Georgi; Ewers, David; Umeda, Patrick K; Chang, Kin-Chow; Kubis, Hans-Peter; Gros, Gerolf; Meissner, Joachim D
2011-03-01
Adaptations in the oxidative capacity of skeletal muscle cells can occur under several physiological or pathological conditions. We investigated the effect of increasing extracellular glucose concentration on the expression of markers of energy metabolism in primary skeletal muscle cells and the C2C12 muscle cell line. Growth of myotubes in 25mM glucose (high glucose, HG) compared with 5.55mM led to increases in the expression and activity of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a marker of glycolytic energy metabolism, while oxidative markers peroxisome proliferator-activated receptor γ coactivator 1α and citrate synthase decreased. HG induced metabolic adaptations as are seen during a slow-to-fast fiber transformation. Furthermore, HG increased fast myosin heavy chain (MHC) IId/x but did not change slow MHCI/β expression. Protein phosphatase 2A (PP2A) was shown to mediate the effects of HG on GAPDH and MHCIId/x. Carbohydrate response element-binding protein (ChREBP), a glucose-dependent transcription factor downstream of PP2A, partially mediated the effects of glucose on metabolic markers. The glucose-induced increase in PP2A activity was associated with an increase in p38 mitogen-activated protein kinase activity, which presumably mediates the increase in MHCIId/x promoter activity. Liver X receptor, another possible mediator of glucose effects, induced only an incomplete metabolic shift, mainly increasing the expression of the glycolytic marker. Taken together, HG induces a partial slow-to-fast transformation comprising metabolic enzymes together with an increased expression of MHCIId/x. This work demonstrates a functional role for ChREBP in determining the metabolic type of muscle fibers and highlights the importance of glucose as a signaling molecule in muscle. Copyright © 2011 Elsevier B.V. All rights reserved.
Shekh, Kamran; Tang, Song; Niyogi, Som; Hecker, Markus
2017-09-01
Gene expression analysis represents a powerful approach to characterize the specific mechanisms by which contaminants interact with organisms. One of the key considerations when conducting gene expression analyses using quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is the selection of appropriate reference genes, which is often overlooked. Specifically, to reach meaningful conclusions when using relative quantification approaches, expression levels of reference genes must be highly stable and cannot vary as a function of experimental conditions. However, to date, information on the stability of commonly used reference genes across developmental stages, tissues and after exposure to contaminants such as metals is lacking for many vertebrate species including teleost fish. Therefore, in this study, we assessed the stability of expression of 8 reference gene candidates in the gills and skin of three different early life-stages of rainbow trout after acute exposure (24h) to two metals, cadmium (Cd) and copper (Cu) using qPCR. Candidate housekeeping genes were: beta actin (b-actin), DNA directed RNA polymerase II subunit I (DRP2), elongation factor-1 alpha (EF1a), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), glucose-6-phosphate dehydrogenase (G6PD), hypoxanthine phosphoribosyltransferase (HPRT), ribosomal protein L8 (RPL8), and 18S ribosomal RNA (18S). Four algorithms, geNorm, NormFinder, BestKeeper, and the comparative ΔCt method were employed to systematically evaluate the expression stability of these candidate genes under control and exposed conditions as well as across three different life-stages. Finally, stability of genes was ranked by taking geometric means of the ranks established by the different methods. Stability of reference genes was ranked in the following order (from lower to higher stability): HPRT<GAPDH
Calderon-Gonzalez, Ricardo; Teran-Navarro, Hector; Marimon, José María; González-Rico, Claudia; Calvo-Montes, Jorge; Frande-Cabanes, Elisabet; Alkorta-Gurrutxaga, Miriam; Fariñas, M. C.; Martínez-Martínez, Luis; Perez-Trallero, Emilio; Alvarez-Dominguez, Carmen
2016-01-01
Two regions of northern Spain, Gipuzkoa, and Cantabria present high annual incidence of listeriosis (1.86 and 1.71 cases per 100,000 inhabitants, respectively). We report that the high annual incidences are a consequence of infection with highly virulent Listeria monocytogenes isolates linked to fatal outcomes in elderly patients with cancer. In addition, listeriosis patients with cancer present low IL-17A/IL-6 ratios and significantly reduced levels of anti-GAPDH1–22 antibodies, identified as two novel biomarkers of poor prognosis. Analysis of these biomarkers may aid in reducing the incidence of listeriosis. Moreover, GAPDH1–22-activated monocyte-derived dendritic cells of listeriosis patients with cancer seem useful tools to prepare clinical vaccines as they produce mainly Th1 cytokines. PMID:27965668
Antidepressant action of ketamine via mTOR is mediated by inhibition of nitrergic Rheb degradation.
Harraz, M M; Tyagi, R; Cortés, P; Snyder, S H
2016-03-01
As traditional antidepressants act only after weeks/months, the discovery that ketamine, an antagonist of glutamate/N-methyl-D-aspartate (NMDA) receptors, elicits antidepressant actions in hours has been transformative. Its mechanism of action has been elusive, though enhanced mammalian target of rapamycin (mTOR) signaling is a major feature. We report a novel signaling pathway wherein NMDA receptor activation stimulates generation of nitric oxide (NO), which S-nitrosylates glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Nitrosylated GAPDH complexes with the ubiquitin-E3-ligase Siah1 and Rheb, a small G protein that activates mTOR. Siah1 degrades Rheb leading to reduced mTOR signaling, while ketamine, conversely, stabilizes Rheb that enhances mTOR signaling. Drugs selectively targeting components of this pathway may offer novel approaches to the treatment of depression.
Laboratory for Atmospheres 2008 Technical Highlights
NASA Technical Reports Server (NTRS)
Cote, Charles E.
2009-01-01
The 2008 Technical Highlights describes the efforts of all members of the Laboratory for Atmospheres. Their dedication to advancing Earth Science through conducting research, developing and running models, designing instruments, managing projects, running field campaigns, and numerous other activities, is highlighted in this report. The Laboratory for Atmospheres (Code 613) is part of the Earth Sciences Division (Code 610), formerly the Earth Sun Exploration Division, under the Sciences and Exploration Directorate (Code 600) based at NASA s Goddard Space Flight Center in Greenbelt, Maryland. In line with NASA s Exploration Initiative, the Laboratory executes a comprehensive research and technology development program dedicated to advancing knowledge and understanding of the atmospheres of Earth and other planets. The research program is aimed at understanding the influence of solar variability on the Earth s climate; predicting the weather and climate of Earth; understanding the structure, dynamics, and radiative properties of precipitation, clouds, and aerosols; understanding atmospheric chemistry, especially the role of natural and anthropogenic trace species on the ozone balance in the stratosphere and the troposphere; and advancing our understanding of physical properties of Earth s atmosphere. The research program identifies problems and requirements for atmospheric observations via satellite missions. Laboratory scientists conceive, design, develop, and implement ultraviolet, infrared, optical, radar, laser, and lidar technology for remote sensing of the atmosphere. Laboratory members conduct field measurements for satellite data calibration and validation, and carry out numerous modeling activities. These modeling activities include climate model simulations, modeling the chemistry and transport of trace species on regional-to-global scales, cloud-resolving models, and development of next-generation Earth system models. Interdisciplinary research is carried
NASA Astrophysics Data System (ADS)
2009-01-01
As is now the tradition, the European Southern Observatory looks back at the exciting moments of last year. 2008 was in several aspects an exceptionally good year. Over the year, ESO's telescopes provided data for more than 700 scientific publications in refereed journals, making ESO the most productive ground-based observatory in the world. ESO PR Highlights 2008 ESO PR Photo 01a/09 The image above is a clickable map. These are only some of the press releases issued by ESO in 2008. For a full listing, please go to ESO 2008 page. Austria signed the agreement to join the other 13 ESO member states (ESO 11/08 and 20/08), while the year marked the 10th anniversary of first light for ESO's "perfect science machine", the Very Large Telescope (ESO 16/08 and 17/08). The ALMA project, for which ESO is the European partner, had a major milestone in December, as the observatory was equipped with its first antenna (ESO 49/08). Also the Atacama Pathfinder Experiment (APEX) telescope impressed this year with some very impressive and publicly visible results. Highlights came in many fields: Astronomers for instance used the Very Large Telescope (VLT) to discover and image a probable giant planet long sought around the star Beta Pictoris (ESO 42/08). This is now the eighth extrasolar planet to have been imaged since the VLT imaged the first extrasolar planet in 2004 (three of eight were imaged with VLT). The VLT also enabled three students to confirm the nature of a unique planet (ESO 45/08). This extraordinary find, which turned up during their research project, is a planet about five times as massive as Jupiter. This is the first planet discovered orbiting a fast-rotating hot star. The world's foremost planet-hunting instrument, HARPS, located at ESO's La Silla observatory, scored a new first, finding a system of three super-Earths around a star (ESO 19/08). Based on the complete HARPS sample, astronomers now think that one Sun-like star out of three harbours short orbit, low
Highlights of X-Stack ExM Deliverable: MosaStore
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ripeanu, Matei
2016-07-20
This brief report highlights the experience gained with MosaStore, an exploratory part of the X-Stack project “ExM: System support for extreme-scale, many-task applications”. The ExM project proposed to use concurrent workflows supported by the Swift language and runtime as an innovative programming model to exploit parallelism in exascale computers. MosaStore aims to support this endeavor by improving storage support for workflow-based applications, more precisely by exploring the gains that can be obtained from co-designing the storage system and the workflow runtime engine. MosaStore has been developed primarily at the University of British Columbia.
STS-71 mission highlights resource tape
NASA Astrophysics Data System (ADS)
1995-09-01
This video highlights the international cooperative Shuttle/Mir mission of the STS-71 flight. The STS-71 flightcrew consists of Cmdr. Robert Hoot' Gibson, Pilot Charles Precourt, and Mission Specialists Ellen Baker, Bonnie Dunbar, and Gregory Harbaugh. The Mir 18 flightcrew consisted of Cmdr. Vladamir Dezhurov, Flight Engineer Gennady Strekalov, and Cosmonaut-Research Dr. Norman Thagard. The Mir 18 crew consisted of Cmdr. Anatoly Solovyev and Flight Engineer Nikolai Budarin. The prelaunch, launch, shuttle in-orbit, and in-orbit rendezvous and docking of the Mir Space Station to the Atlantis Space Shuttle are shown. The Mir 19 crew accompanied the STS-71 crew and will replace the Mir 18 crew upon undocking from the Mir Space Station. Shown is on-board footage from the Mir Space Station of the Mir 18 crew engaged in hardware testing and maintenance, medical and physiological tests, and a tour of the Mir. A spacewalk by the two Mir 18 cosmonauts is shown as they performed maintenance of the Mir Space Station. After the docking between Atlantis and Mir is completed, several mid-deck physiological experiments are performed along with a tour of Atlantis. Dr Thagard remained behind with the Shuttle after undocking to return to Earth with reports from his Mir experiments and observations. In-cabin experiments included the IMAX Camera Systems tests and the Shuttle Amateur Radio Experiment-2 (SAREX-2). There is footage of the shuttle landing.
Frontiers: Research highlights 1946-1996 [50th Anniversary Edition. Argonne National Laboratory
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1996-12-31
This special edition of 'Frontiers' commemorates Argonne National Laboratory's 50th anniversary of service to science and society. America's first national laboratory, Argonne has been in the forefront of U.S. scientific and technological research from its beginning. Past accomplishments, current research, and future plans are highlighted.
Frontiers: Research Highlights 1946-1996 [50th Anniversary Edition. Argonne National Laboratory
DOE R&D Accomplishments Database
1996-01-01
This special edition of 'Frontiers' commemorates Argonne National Laboratory's 50th anniversary of service to science and society. America's first national laboratory, Argonne has been in the forefront of U.S. scientific and technological research from its beginning. Past accomplishments, current research, and future plans are highlighted.
Variety and Service Highlight the 2010 Effective and Innovative Practices Award Winners
ERIC Educational Resources Information Center
Facilities Manager, 2010
2010-01-01
APPA's Effective & Innovative Practices Award continues to highlight the best of the most creative and practical programs and processes that enhance and transform service delivery, lower costs, increase productivity, improve customer service, generate revenue, or otherwise benefit an educational institution. This article features five 2010…
Panoramic autofluorescence: highlighting retinal pathology.
Slotnick, Samantha; Sherman, Jerome
2012-05-01
Recent technological advances in fundus autofluorescence (FAF) are providing new opportunities for insight into retinal physiology and pathophysiology. FAF provides distinctly different imaging information than standard photography or color separation. A review of the basis for this imaging technology is included to help the clinician understand how to interpret FAF images. Cases are presented to illustrate image interpretation. Optos, which manufactures equipment for simultaneous panoramic imaging, has recently outfitted several units with AF capabilities. Six cases are presented in which panoramic autofluorescent (PAF) images highlight retinal pathology, using Optos' Ultra-Widefield technology. Supportive imaging technologies, such as Optomap® images and spectral domain optical coherence tomography (SD-OCT), are used to assist in the clinical interpretation of retinal pathology detected on PAF. Hypofluorescent regions on FAF are identified to occur along with a disruption in the photoreceptors and/or retinal pigment epithelium, as borne out on SD-OCT. Hyperfluorescent regions on FAF occur at the advancing zones of retinal degeneration, indicating impending damage. PAF enables such inferences to be made in retinal areas which lie beyond the reach of SD-OCT imaging. PAF also enhances clinical pattern recognition over a large area and in comparison with the fellow eye. Symmetric retinal degenerations often occur with genetic conditions, such as retinitis pigmentosa, and may impel the clinician to recommend genetic testing. Autofluorescent ophthalmoscopy is a non-invasive procedure that can detect changes in metabolic activity at the retinal pigment epithelium before clinical ophthalmoscopy. Already, AF is being used as an adjunct technology to fluorescein angiography in cases of age-related macular degeneration. Both hyper- and hypoautofluorescent changes are indicative of pathology. Peripheral retinal abnormalities may precede central retinal impacts, potentially
Highlighting Your Science to NASA
NASA Astrophysics Data System (ADS)
Sharkey, C.
2003-12-01
An effort is underway to provide greater visibility within NASA headquarters, and to those who provide funding to NASA, of the outstanding work that is being performed by scientists involved in the Solar System Exploration Research and Analysis Programs, most of whom are DPS members. In support of this effort, a new feature has been developed for the NASA Headquarters Solar System Exploration Division web site whereby researchers can provide a synopsis of their current research results. The site (http://solarsystem.nasa.gov/spotlight/ - Username: your email address Password: sse) is an online submission area where NASA-funded scientists can upload the results of their research. There they provide their contact information, briefly describe their research, and upload any associated images or graphics. The information is available to a limited number of reviewers and writers at JPL. Each month, one researcher's work will be chosen as a science spotlight. After a writer interviews the scientist, a brief Power Point presentation that encapsulates their work will be given to Dr. Colleen Hartman at NASA headquarters. She will then present the exciting findings to Associate Administrator for Space Science, Dr. Ed Weiler. The information from some of these highlights can serve as a basis to bring Principal Investigators to NASA Headquarters for exposure to media through Space Science Updates on NASA television. In addition, the science results may also be incorporated into briefing material for the Office of Management and Budget and congressional staffers. Some spotlights will also be converted into feature stories for the Solar System Exploration website so the public, too, can learn about exciting new research. The site, http://solarsystem.nasa.gov/, is one of NASA's most visited. Over the past decade, there has been a trend of flat budgets for Research and Analysis activities. By giving more visibility to results of Solar System research, our goal is to encourage
Cassini's Grand Finale Science Highlights
NASA Astrophysics Data System (ADS)
Spilker, Linda
2017-10-01
After 13 years in orbit, the Cassini-Huygens Mission to Saturn ended in a science-rich blaze of glory. Cassini returned its final bits of unique science data on September 15, 2017, as it plunged into Saturn's atmosphere satisfying planetary protection requirements. Cassini's Grand Finale covered a period of roughly five months and ended with the first time exploration of the region between the rings and planet.The final close flyby of Titan in late April 2017 propelled Cassini across Saturn’s main rings and into its Grand Finale orbits; 22 orbits that repeatedly dove between Saturn’s innermost rings and upper atmosphere making Cassini the first spacecraft to explore this region. The last orbit turned the spacecraft into the first Saturn upper atmospheric probe.The Grand Finale orbits provided highest resolution observations of both the rings and Saturn, and in-situ sampling of the ring particle composition, Saturn's atmosphere, plasma, and innermost radiation belts. The gravitational field was measured to unprecedented accuracy, providing information on the interior structure of the planet, winds in the deeper atmosphere, and mass of the rings. The magnetic field provided insight into the physical nature of the magnetic dynamo and structure of the internal magnetic field. The ion and neutral mass spectrometer sampled the upper atmosphere for molecules that escape the atmosphere in addition to molecules originating from the rings. The cosmic dust analyzer directly sampled the composition from different parts of the main rings for the first time. Fields and particles instruments directly measured the plasma environment between the rings and planet.Science highlights and new mysteries gleaned to date from the Grand Finale orbits will be discussed.The research described in this paper was carried out in part at the Jet Propulsion Laboratory, California Institute of Technology, under a contract with the National Aeronautics and Space Administration. Copyright 2017
Water Reuse Highlights: A Summary Volume of Wastewater Reclamation and Reuse Information.
ERIC Educational Resources Information Center
American Water Works Association, Denver, CO. Research Foundation.
This document reports the efforts of the AWWA Research Foundation to gather, prepare, and distribute current technical information in the wastewater reclamation and reuse field. The information reported has been abstracted from other Foundation publications and only attempts here to highlight the field. Categories discussed include research,…
The Ftx Noncoding Locus Controls X Chromosome Inactivation Independently of Its RNA Products.
Furlan, Giulia; Gutierrez Hernandez, Nancy; Huret, Christophe; Galupa, Rafael; van Bemmel, Joke Gerarda; Romito, Antonio; Heard, Edith; Morey, Céline; Rougeulle, Claire
2018-05-03
Accumulation of the Xist long noncoding RNA (lncRNA) on one X chromosome is the trigger for X chromosome inactivation (XCI) in female mammals. Xist expression, which needs to be tightly controlled, involves a cis-acting region, the X-inactivation center (Xic), containing many lncRNA genes that evolved concomitantly to Xist from protein-coding ancestors through pseudogeneization and loss of coding potential. Here, we uncover an essential role for the Xic-linked noncoding gene Ftx in the regulation of Xist expression. We show that Ftx is required in cis to promote Xist transcriptional activation and establishment of XCI. Importantly, we demonstrate that this function depends on Ftx transcription and not on the RNA products. Our findings illustrate the multiplicity of layers operating in the establishment of XCI and highlight the diversity in the modus operandi of the noncoding players. Copyright © 2018 Elsevier Inc. All rights reserved.
Teaching World Geography to Late-Arrival Immigrant Students: Highlighting Practice and Content
ERIC Educational Resources Information Center
Salinas, Cinthia; Franquiz, Maria E.; Reidel, Michelle
2008-01-01
In this case study, the work of an exemplary high school social studies teacher is highlighted. In her class, late-arrival immigrant students participated in oral, writing, and demonstration activities as they learned the physical, cultural, and historical traditions of geography education. As newcomers to the English language, the students'…
Brookhaven highlights. Report on research, October 1, 1992--September 30, 1993
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rowe, M.S.; Belford, M.; Cohen, A.
This report highlights the research activities of Brookhaven National Laboratory during the period dating from October 1, 1992 through September 30, 1993. There are contributions to the report from different programs and departments within the laboratory. These include technology transfer, RHIC, Alternating Gradient Synchrotron, physics, biology, national synchrotron light source, applied science, medical science, advanced technology, chemistry, reactor physics, safety and environmental protection, instrumentation, and computing and communications.
Wang, Min; Wang, Qinglian; Zhang, Baohong
2013-11-01
Reference genes are critical for normalization of the gene expression level of target genes. The widely used housekeeping genes may change their expression levels at different tissue under different treatment or stress conditions. Therefore, systematical evaluation on the housekeeping genes is required for gene expression analysis. Up to date, no work was performed to evaluate the housekeeping genes in cotton under stress treatment. In this study, we chose 10 housekeeping genes to systematically assess their expression levels at two different tissues (leaves and roots) under two different abiotic stresses (salt and drought) with three different concentrations. Our results show that there is no best reference gene for all tissues at all stress conditions. The reliable reference gene should be selected based on a specific condition. For example, under salt stress, UBQ7, GAPDH and EF1A8 are better reference genes in leaves; TUA10, UBQ7, CYP1, GAPDH and EF1A8 were better in roots. Under drought stress, UBQ7, EF1A8, TUA10, and GAPDH showed less variety of expression level in leaves and roots. Thus, it is better to identify reliable reference genes first before performing any gene expression analysis. However, using a combination of housekeeping genes as reference gene may provide a new strategy for normalization of gene expression. In this study, we found that combination of four housekeeping genes worked well as reference genes under all the stress conditions. © 2013.
Reference genes for reverse transcription quantitative PCR in canine brain tissue.
Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C
2015-12-09
In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and inexpensive method to study expression levels of genes involved in disease processes. Accurate normalisation with stably expressed so-called reference genes is crucial for reliable expression analysis. Following the minimum information for publication of quantitative real-time PCR experiments precise guidelines, the expression of ten frequently used reference genes, namely YWHAZ, HMBS, B2M, SDHA, GAPDH, HPRT, RPL13A, RPS5, RPS19 and GUSB was evaluated in seven brain regions (frontal lobe, parietal lobe, occipital lobe, temporal lobe, thalamus, hippocampus and cerebellum) and whole brain of healthy dogs. The stability of expression varied between different brain areas. Using the GeNorm and Normfinder software HMBS, GAPDH and HPRT were the most reliable reference genes for whole brain. Furthermore based on GeNorm calculations it was concluded that as little as two to three reference genes are sufficient to obtain reliable normalisation, irrespective the brain area. Our results amend/extend the limited previously published data on canine brain reference genes. Despite the excellent expression stability of HMBS, GAPDH and HRPT, the evaluation of expression stability of reference genes must be a standard and integral part of experimental design and subsequent data analysis.
Ogawa, Kiyohiro; Hirooka, Yoshitaka; Kishi, Takuya; Ide, Tomomi; Sunagawa, Kenji
2013-01-01
Left ventricular (LV) remodeling and activation of sympathetic nervous system (SNS) are cardinal features of heart failure. We previously demonstrated that enhanced central sympathetic outflow is associated with brain toll-like receptor 4 (TLR4) probably mediated by brain angiotensin II type 1 receptor in mice with myocardial infarction (MI)-induced heart failure. The purpose of the present study was to examine whether silencing brain TLR4 could prevent LV remodeling with sympathoinhibition in MI-induced heart failure. MI-induced heart failure model rats were created by ligation of left coronary artery. The expression level of TLR4 in brainstem was significantly higher in MI-induced heart failure treated with intracerebroventricular (ICV) injection of hGAPDH-SiRNA than in sham. TLR4 in brainstem was significantly lower in MI-induced heart failure treated with ICV injection of TLR4-SiRNA than in that treated with ICV injection of hGAPDH-SiRNA. Lung weight, urinary norepinephrine excretion, and LV end-diastolic pressure were significantly lower and LV dimension was significantly smaller in MI-induced heart failure treated with TLR4-SiRNA than in that treated with hGAPDH-SiRNA for 2 weeks. Partially silencing brain TLR4 by ICV injection of TLR4-SiRNA for 2 weeks could in part prevent LV remodeling with sympathoinhibition in rats with MI-induced heart failure. Brain TLR4 has a potential to be a target of the treatment for MI-induced heart failure.
Data-Driven Decisions: Using Equity Theory to Highlight Implications for Underserved Students
ERIC Educational Resources Information Center
Fowler, Denver J.; Brown, Kelly
2018-01-01
By using equity theory through a social justice lens, the authors intend to highlight how data are currently being used to solve the "what" and not the "why" as it relates to achievement gaps for marginalized students in urban settings. School practitioners have been utilizing quantitative data, such as district and state…
Aly, Hanan F; Rizk, Maha Z; Abo-Elmatty, Dina M; Desoky, M M; Ibrahim, N A; Younis, Eman A
2016-04-01
The present work aims to evaluate the protective and ameliorative effects of two plant-derived proteins obtained from the seeds of Cajanus cajan and Caesalpinia gilliesii(Leguminosae) against the toxic effects of acetaminophen in kidney after chronic dose through determination of certain biochemical markers including total urea, creatinine, and kidney marker enzyme, that is, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). In addition histopathological examination of intoxicated and treated kidney with both proteins was performed. The present results show a significant increase in serum total urea and creatinine, while significant decrease in GAPDH. Improvement in all biochemical parameters studied was demonstrated, which was documented by the amelioration signs in rats kidney architecture. Thus, both plant protein extracts can counteract the nephrotoxic process, minimize damage to the kidney, delay disease progression, and reduce its complications. © The Author(s) 2013.
Kling, Peter; Förlin, Lars
2009-10-01
Proteomic effect screening in zebrafish liver cells was performed to generate hypotheses regarding single and mixed exposure to the BFRs HBCD and TBBPA. Responses at sublethal exposure were analysed by two-dimensional gel electrophoresis followed by MALDI-TOF and FT-ICR protein identification. Mixing of HBCD and TBBPA at sublethal doses of individual substances seemed to increase toxicity. Proteomic analyses revealed distinct exposure-specific and overlapping responses suggesting novel mechanisms with regard to HBCD and TBBPA exposure. While distinct HBCD responses were related to decreased protein metabolism, TBBPA revealed effects related to protein folding and NADPH production. Overlapping responses suggest increased gluconeogenesis (GAPDH and aldolase) while distinct mixture effects suggest a pronounced NADPH production and changes in proteins related to cell cycle control (prohibitin and crk-like oncogene). We conclude that mixtures containing HBCD and TBBPA may result in unexpected effects highlighting proteomics as a sensitive tool for detecting and hypothesis generation of mixture effects.
“State of NASA” Events Highlight Agency Goals for Space Exploration
2018-02-12
On Feb. 12, NASA centers across the country hosted “State of NASA” events, following President Trump’s Fiscal Year 2019 budget proposal delivery to the U.S. Congress. The events included an address, by acting NASA Administrator Robert Lightfoot, to the agency’s workforce, from NASA’s Marshall Space Flight Center, in Huntsville, Alabama. During his speech, Lightfoot highlighted how the budget would help the agency achieve its goals for space exploration.
Harnessing Gene Conversion in Chicken B Cells to Create a Human Antibody Sequence Repertoire
Schusser, Benjamin; Yi, Henry; Collarini, Ellen J.; Izquierdo, Shelley Mettler; Harriman, William D.; Etches, Robert J.; Leighton, Philip A.
2013-01-01
Transgenic chickens expressing human sequence antibodies would be a powerful tool to access human targets and epitopes that have been intractable in mammalian hosts because of tolerance to conserved proteins. To foster the development of the chicken platform, it is beneficial to validate transgene constructs using a rapid, cell culture-based method prior to generating fully transgenic birds. We describe a method for the expression of human immunoglobulin variable regions in the chicken DT40 B cell line and the further diversification of these genes by gene conversion. Chicken VL and VH loci were knocked out in DT40 cells and replaced with human VK and VH genes. To achieve gene conversion of human genes in chicken B cells, synthetic human pseudogene arrays were inserted upstream of the functional human VK and VH regions. Proper expression of chimeric IgM comprised of human variable regions and chicken constant regions is shown. Most importantly, sequencing of DT40 genetic variants confirmed that the human pseudogene arrays contributed to the generation of diversity through gene conversion at both the Igl and Igh loci. These data show that engineered pseudogene arrays produce a diverse pool of human antibody sequences in chicken B cells, and suggest that these constructs will express a functional repertoire of chimeric antibodies in transgenic chickens. PMID:24278246
Šmajs, David; Zobaníková, Marie; Strouhal, Michal; Čejková, Darina; Dugan-Rocha, Shannon; Pospíšilová, Petra; Norris, Steven J.; Albert, Tom; Qin, Xiang; Hallsworth-Pepin, Kym; Buhay, Christian; Muzny, Donna M.; Chen, Lei; Gibbs, Richard A.; Weinstock, George M.
2011-01-01
Treponema paraluiscuniculi is the causative agent of rabbit venereal spirochetosis. It is not infectious to humans, although its genome structure is very closely related to other pathogenic Treponema species including Treponema pallidum subspecies pallidum, the etiological agent of syphilis. In this study, the genome sequence of Treponema paraluiscuniculi, strain Cuniculi A, was determined by a combination of several high-throughput sequencing strategies. Whereas the overall size (1,133,390 bp), arrangement, and gene content of the Cuniculi A genome closely resembled those of the T. pallidum genome, the T. paraluiscuniculi genome contained a markedly higher number of pseudogenes and gene fragments (51). In addition to pseudogenes, 33 divergent genes were also found in the T. paraluiscuniculi genome. A set of 32 (out of 84) affected genes encoded proteins of known or predicted function in the Nichols genome. These proteins included virulence factors, gene regulators and components of DNA repair and recombination. The majority (52 or 61.9%) of the Cuniculi A pseudogenes and divergent genes were of unknown function. Our results indicate that T. paraluiscuniculi has evolved from a T. pallidum-like ancestor and adapted to a specialized host-associated niche (rabbits) during loss of infectivity to humans. The genes that are inactivated or altered in T. paraluiscuniculi are candidates for virulence factors important in the infectivity and pathogenesis of T. pallidum subspecies. PMID:21655244
Long-range PCR facilitates the identification of PMS2-specific mutations.
Clendenning, Mark; Hampel, Heather; LaJeunesse, Jennifer; Lindblom, Annika; Lockman, Jan; Nilbert, Mef; Senter, Leigha; Sotamaa, Kaisa; de la Chapelle, Albert
2006-05-01
Mutations within the DNA mismatch repair gene, "postmeiotic segregation increased 2" (PMS2), have been associated with a predisposition to hereditary nonpolyposis colorectal cancer (HNPCC; Lynch syndrome). The presence of a large family of highly homologous PMS2 pseudogenes has made previous attempts to sequence PMS2 very difficult. Here, we describe a novel method that utilizes long-range PCR as a way to preferentially amplify PMS2 and not the pseudogenes. A second, exon-specific, amplification from diluted long-range products enables us to obtain a clean sequence that shows no evidence of pseudogene contamination. This method has been used to screen a cohort of patients whose tumors were negative for the PMS2 protein by immunohistochemistry and had not shown any mutations within the MLH1 gene. Sequencing of the PMS2 gene from 30 colorectal and 11 endometrial cancer patients identified 10 novel sequence changes as well as 17 sequence changes that had previously been identified. In total, putative pathologic mutations were detected in 11 of the 41 families. Among these were five novel mutations, c.705+1G>T, c.736_741del6ins11, c.862_863del, c.1688G>T, and c.2007-1G>A. We conclude that PMS2 mutation detection in selected Lynch syndrome and Lynch syndrome-like patients is both feasible and desirable. Published 2006 Wiley-Liss, Inc.
Alexander, Stephen P. H.; Sharman, Joanna L.; Pawson, Adam J.; Benson, Helen E.; Monaghan, Amy E.; Liew, Wen Chiy; Mpamhanga, Chidochangu P.; Bonner, Tom I.; Neubig, Richard R.; Pin, Jean Philippe; Spedding, Michael; Harmar, Anthony J.
2013-01-01
In 2005, the International Union of Basic and Clinical Pharmacology Committee on Receptor Nomenclature and Drug Classification (NC-IUPHAR) published a catalog of all of the human gene sequences known or predicted to encode G protein-coupled receptors (GPCRs), excluding sensory receptors. This review updates the list of orphan GPCRs and describes the criteria used by NC-IUPHAR to recommend the pairing of an orphan receptor with its cognate ligand(s). The following recommendations are made for new receptor names based on 11 pairings for class A GPCRs: hydroxycarboxylic acid receptors [HCA1 (GPR81) with lactate, HCA2 (GPR109A) with 3-hydroxybutyric acid, HCA3 (GPR109B) with 3-hydroxyoctanoic acid]; lysophosphatidic acid receptors [LPA4 (GPR23), LPA5 (GPR92), LPA6 (P2Y5)]; free fatty acid receptors [FFA4 (GPR120) with omega-3 fatty acids]; chemerin receptor (CMKLR1; ChemR23) with chemerin; CXCR7 (CMKOR1) with chemokines CXCL12 (SDF-1) and CXCL11 (ITAC); succinate receptor (SUCNR1) with succinate; and oxoglutarate receptor [OXGR1 with 2-oxoglutarate]. Pairings are highlighted for an additional 30 receptors in class A where further input is needed from the scientific community to validate these findings. Fifty-seven human class A receptors (excluding pseudogenes) are still considered orphans; information has been provided where there is a significant phenotype in genetically modified animals. In class B, six pairings have been reported by a single publication, with 28 (excluding pseudogenes) still classified as orphans. Seven orphan receptors remain in class C, with one pairing described by a single paper. The objective is to stimulate research into confirming pairings of orphan receptors where there is currently limited information and to identify cognate ligands for the remaining GPCRs. Further information can be found on the IUPHAR Database website (http://www.iuphar-db.org). PMID:23686350
Takase, Yuta; Tadokoro, Ryosuke; Takahashi, Yoshiko
2013-12-01
To understand how blood vessels form to establish the intricate network during vertebrate development, it is helpful if one can visualize the vasculature in embryos. We here describe a novel labeling method using highlighter ink, easily obtained in stationery stores with a low cost, to visualize embryo-wide vasculatures in avian and mice. We tested 50 different highlighters for fluorescent microscopy with filter sets equipped in a standard fluorescent microscope. The yellow and violet inks yielded fluorescent signals specifically detected by the filters used for green fluorescent protein (GFP) and red fluorescent protein (RFP) detections, respectively. When the ink solution was infused into chicken/quail and mouse embryos, vasculatures including large vessels and capillaries were labeled both in living and fixed embryos. Ink-infused embryos were further subjected to histological sections, and double stained with antibodies including QH-1 (quail), α smooth muscle actin (αSMA), and PECAM-1 (mouse), revealing that the endothelial cells were specifically labeled by the infused highlighter ink. Highlighter-labeled signals were detected with a resolution comparable to or higher than signals of fluorescein isothiocyanate (FITC)-lectin and Rhodamine-dextran, conventionally used for angiography. Furthermore, macroconfocal microscopic analyses with ink-infused embryos visualized fine vascular structures of both embryo proper and extra-embryonic plexus in a Z-stack image of 2400 μm thick with a markedly high resolution. Together, the low cost highlighter ink serves as an alternative reagent useful for visualization of blood vessels in developing avian and mouse embryos and possibly in other animals. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.
Highlight removal based on the regional-projection fringe projection method
NASA Astrophysics Data System (ADS)
Qi, Zhaoshuai; Wang, Zhao; Huang, Junhui; Xing, Chao; Gao, Jianmin
2018-04-01
In fringe projection profilometry, highlight usually causes the saturation and blooming in captured fringes and reduces the measurement accuracy. To solve the problem, a regional-projection fringe projection (RP-FP) method is proposed. Regional projection patterns (RP patterns) are projected onto the tested object surface to avoid the saturation and blooming. Then, an image inpainting technique is employed to reconstruct the missing phases in the captured RP patterns and a complete surface of the tested object is obtained. Experiments verified the effectiveness of the proposed method. The method can be widely used in industrial inspections and quality controlling in mechanical and manufacturing industries.
Agricultural Research Service research highlights in remote sensing for calendar year 1981
NASA Technical Reports Server (NTRS)
Ritchie, J. C. (Compiler)
1982-01-01
Selected examples of research accomplishments related to remote sensing are compiled. A brief statement is given to highlight the significant results of each research project. A list of 1981 publication and location contacts is given also. The projects cover emission and reflectance analysis, identification of crop and soil parameters, and the utilization of remote sensing data.
Highlights of Astronomy, Volume 14
NASA Astrophysics Data System (ADS)
van der Hucht, Karel
2007-08-01
Preface Karel A. van der Hucht; Part I. Invited Discourses: Part II. Joint Discussions: 1. Particle acceleration - from Solar System to AGN Marian Karlicky and John C. Brown; 2. Pulsar emission and related phenomena Werner Becker, Janusz A. Gil and Bronislaw Rudak; 3. Solar activity regions and magnetic structure Debi Prasad Choudhary and Michal Sobotka; 4. The ultraviolet universe: Stars from birth to death Ana I. Gomez de Castro and Martin A. Barstow; 5. Calibrating the top of the stellar M-L relationship Claus Leitherer, Anthony F. J. Moat and Joachim Puls; 6. Neutron stars and black holes in star clusters Frederic A. Rasio; 7. The Universe at z > 6 Daniel Schaerer and Andrea Ferrara; 8. Solar and stellar activity cycles Klaus G. Strassmeier and Alexander Kosovichev; 9. Supernovae: One millennium after SN 1006 P. Frank Winkler, Wolfgang Hillebrandt and Brian P. Schmidt; 10. Progress in planetary exploration missions Guy J. Consolmagno; 11. Pre-solar grains as astrophysical tools Anja C. Andersen and John C. Lattanzio; 12. Long wavelength astrophysics T. Joseph W. Lazio and Namir E. Kassim; 13. Exploiting large surveys for galactic astronomy Christopher J. Corbally, Coryn A. L. Bailer-Jones, Sunetra Giridhar and Thomas H. Lloyd Evans; 14. Modeling dense stellar systems Alison I. Sills, Ladislav Subr and Simon F. Portegies Zwart; 15. New cosmology results from the Spitzer Space Telescope George Helou and David T. Frayer; 16. Nomenclature, precession and new models in fundamental astronomy Nicole Capitaine, Jan Vondrak & James L. Hilton; 17. Highlights of recent progress in seismology of the Sun and Sun-like stars John W. Leibacher and Michael J. Thompson; Part III. Special Sessions: SpS 1. Large astronomical facilities of the next decade Gerard F. Gilmore and Richard T. Schilizzi; SpS 2. Innovation in teaching and learning astronomy methods Rosa M. Ros and Jay M. Pasachoff; SpS 3. The Virtual Observatory in action: New science, new technology and next
Sex bias in copy number variation of olfactory receptor gene family depends on ethnicity.
Shadravan, Farideh
2013-01-01
Gender plays a pivotal role in the human genetic identity and is also manifested in many genetic disorders particularly mental retardation. In this study its effect on copy number variation (CNV), known to cause genetic disorders was explored. As the olfactory receptor (OR) repertoire comprises the largest human gene family, it was selected for this study, which was carried out within and between three populations, derived from 150 individuals from the 1000 Genome Project. Analysis of 3872 CNVs detected among 791 OR loci, in which 307 loci showed CNV, revealed the following novel findings: Sex bias in CNV was significantly more prevalent in uncommon than common CNV variants of OR pseudogenes, in which the male genome showed more CNVs; and in one-copy number loss compared to complete deletion of OR pseudogenes; both findings implying a more recent evolutionary role for gender. Sex bias in copy number gain was also detected. Another novel finding was that the observed sex bias was largely dependent on ethnicity and was in general absent in East Asians. Using a CNV public database for sick children (International Standard Cytogenomic Array Consortium) the application of these findings for improving clinical molecular diagnostics is discussed by showing an example of sex bias in CNV among kids with autism. Additional clinical relevance is discussed, as the most polymorphic CNV-enriched OR cluster in the human genome, located on chr 15q11.2, is found near the Prader-Willi syndrome/Angelman syndrome bi-directionally imprinted region associated with two well-known mental retardation syndromes. As olfaction represents the primitive cognition in most mammals, arguably in competition with the development of a larger brain, the extensive retention of OR pseudogenes in females of this study, might point to a parent-of-origin indirect regulatory role for OR pseudogenes in the embryonic development of human brain. Thus any perturbation in the temporal regulation of olfactory
Concolino, Paola; Mello, Enrica; Minucci, Angelo; Giardina, Emiliano; Zuppi, Cecilia; Toscano, Vincenzo; Capoluongo, Ettore
2009-01-01
Background More than 90% of Congenital Adrenal Hyperplasia (CAH) cases are associated with mutations in the 21-hydroxylase gene (CYP21A2) in the HLA class III area on the short arm of chromosome 6p21.3. In this region, a 30 kb deletion produces a non functional chimeric gene with its 5' and 3' ends corresponding to CYP21A1P pseudogene and CYP21A2, respectively. To date, five different CYP21A1P/CYP21A2 chimeric genes have been found and characterized in recent studies. In this paper, we describe a new CYP21A1P/CYP21A2 chimera (CH-6) found in an Italian CAH patient. Methods Southern blot analysis and CYP21A2 sequencing were performed on the patient. In addition, in order to isolate the new CH-6 chimeric gene, two different strategies were used. Results The CYP21A2 sequencing analysis showed that the patient was homozygote for the g.655C/A>G mutation and heterozygote for the p.P30L missense mutation. In addition, the promoter sequence revealed the presence, in heterozygosis, of 13 SNPs generally produced by microconversion events between gene and pseudogene. Southern blot analysis showed that the woman was heterozygote for the classic 30-kb deletion producing a new CYP21A1P/CYP21A2 chimeric gene (CH-6). The hybrid junction site was located between the end of intron 2 pseudogene, after the g.656C/A>G mutation, and the beginning of exon 3, before the 8 bp deletion. Consequently, CH-6 carries three mutations: the weak pseudogene promoter region, the p.P30L and the g.655C/A>G splice mutation. Conclusion We describe a new CYP21A1P/CYP21A2 chimera (CH-6), associated with the HLA-B15, DR13 haplotype, in a young Italian CAH patient. PMID:19624807
Linking challenges in wound healing: key highlights from the Hartmann congress.
2017-11-02
With a special focus on advanced wound healing (wound bed preparation, epithelialisation and hydration) and negative pressure wound therapy, the Hartmann LINK for Wound Healing Congress took place in Belfast, Northern Ireland, on 19 September. The event aimed to promote the latest advances in wound care and highlight the main challenges that clinicians face when treating different types of wounds. Annabel De Coster, editor of the British Journal of Community Nursing, gives an overview of selected talks from the congress.
Barsalobres-Cavallari, Carla F; Severino, Fábio E; Maluf, Mirian P; Maia, Ivan G
2009-01-01
Background Quantitative data from gene expression experiments are often normalized by transcription levels of reference or housekeeping genes. An inherent assumption for their use is that the expression of these genes is highly uniform in living organisms during various phases of development, in different cell types and under diverse environmental conditions. To date, the validation of reference genes in plants has received very little attention and suitable reference genes have not been defined for a great number of crop species including Coffea arabica. The aim of the research reported herein was to compare the relative expression of a set of potential reference genes across different types of tissue/organ samples of coffee. We also validated the expression profiles of the selected reference genes at various stages of development and under a specific biotic stress. Results The expression levels of five frequently used housekeeping genes (reference genes), namely alcohol dehydrogenase (adh), 14-3-3, polyubiquitin (poly), β-actin (actin) and glyceraldehyde-3-phosphate dehydrogenase (gapdh) was assessed by quantitative real-time RT-PCR over a set of five tissue/organ samples (root, stem, leaf, flower, and fruits) of Coffea arabica plants. In addition to these commonly used internal controls, three other genes encoding a cysteine proteinase (cys), a caffeine synthase (ccs) and the 60S ribosomal protein L7 (rpl7) were also tested. Their stability and suitability as reference genes were validated by geNorm, NormFinder and BestKeeper programs. The obtained results revealed significantly variable expression levels of all reference genes analyzed, with the exception of gapdh, which showed no significant changes in expression among the investigated experimental conditions. Conclusion Our data suggests that the expression of housekeeping genes is not completely stable in coffee. Based on our results, gapdh, followed by 14-3-3 and rpl7 were found to be homogeneously
Dang, Wei; Sun, Li
2011-02-01
In recent years, quantitative real time reverse transcriptase-PCR (qRT-PCR) has been used frequently in the study of gene expression in turbot (Scophthalmus maximus) in relation to bacterial infection. However, no investigations on appropriate qRT-PCR reference genes have been documented. In this report, we determined the potential of eight housekeeping genes, i.e. β-actin (ACTB), ribosomal protein L17 (RPL17), α-tubulin (TUBA), elongation factor-1-α(EF1A), β-2-Microglobulin (B2M), RNA polymerase II subunit D (RPSD), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and 18S ribosomal RNA (18S rRNA), as internal standards for qRT-PCR analysis of gene expression in turbot as a function of bacterial infection. For this purpose, the expression of the eight housekeeping genes in seven turbot tissues was determined by qRT-PCR before and after bacterial challenge, and the data were analyzed with the geNorm and NormFinder algorisms. The results showed that the expression of all the examined genes exhibited tissue-dependent variations both before and after bacterial challenge. Before bacterial challenge, geNorm and NormFinder identified RPSD as the gene that showed least tissue specific expression. At 12 h post-bacterial infection, geNorm ranked ACTB/GAPDH, 18S rRNA/ACTB, ACTB/GAPDH, 18S rRNA/ACTB, RPL17/TUBA, RPSD/GAPDH, and RPSD/B2M, respectively, as the most stably expressed genes in liver, spleen, kidney, gill, heart, muscle, and brain. Comparable ranking orders were produced by NormFinder. Similar results were obtained at 24 h post-bacterial infection. Taken together, these results indicate that RPSD is the most stable gene across tissue types under normal physiological conditions and that, during bacterial infection, ACTB might be used as an internal standard for the normalization of gene expression in immune relevant organs; however, no single gene or single pair of genes in the examined set of housekeeping genes can serve as a universal reference across all
The Probability Evaluation Game: An Instrument to Highlight the Skill of Reflexive Listening
ERIC Educational Resources Information Center
Butler, Clare
2016-01-01
This paper describes the development of the Probability Evaluation Game (PEG): an innovative teaching instrument that emphasises the sophistication of listening and highlights listening as a key skill for accounting practitioners. Whilst in a roundtable format, playing PEG involves participants individually evaluating a series of probability terms…
STS-99 Mission Highlights Resource Tape, Part 1 of 2
NASA Technical Reports Server (NTRS)
2000-01-01
An overview of the STS-99 Endeavour mission is given through footage of each flight day. Scenes from flight days one through ten show activities such as astronaut prelaunch procedures (breakfast, suit-up, and boarding Endeavour), launch, and on-orbit activities such as the deployment of the Shuttle Radar Topography Mission (SRTM) instrument. Crewmembers are seeing during such everyday activities as brushing their teeth, exercising (bicycle), and emerging from their sleeping bunks. One of the crewmembers shows the contents of the onboard medical kit. See 'STS-99 Mission Highlights Resource Tape, Part 2 of 2' for the activities of flight days 11-12 and the landing of Endeavour.
Treatment regimens for rifampicin-resistant tuberculosis: highlighting a research gap.
Stagg, H R; Hatherell, H-A; Lipman, M C; Harris, R J; Abubakar, I
2016-07-01
Treatment guidance for non-multidrug-resistant (MDR) rifampicin-resistant (RMP-R) tuberculosis (TB) is variable. We aimed to undertake a systematic review and meta-analysis of the randomised controlled trial (RCT) data behind such guidelines to identify the most efficacious treatment regimens. Ovid MEDLINE, the Web of Science and EMBASE were mined using search terms for TB, drug therapy and RCTs. Despite 12 604 records being retrieved, only three studies reported treatment outcomes by regimen for patients with non-MDR RMP-R disease, preventing meta-analysis. Our systematic review highlights a substantial gap in the literature regarding evidence-based treatment regimens for RMP-R TB.
USDA-ARS?s Scientific Manuscript database
CP12 is a small intrinsically unstructured protein that forms a multiprotein complex with two Calvin Cycle enzymes, phosphoribulokinase (PRK) and NAD(P)-dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The complex can be reconstituted in vitro from recombinant proteins under conditions t...
Hoque, Tafazzal; Bhogal, Meetu; Boghal, Meetu; Webb, Rodney A
2007-12-01
The non-invasive parasitic cestode Hymenolepis diminuta induces hypertrophy, hyperplasia and other changes in cell activity in the intestine of rats which are indicated in the expression of mRNA. We have investigated various house-keeping genes (GAPDH, beta-actin, 18S and HPRT) and other internal controls (total RNA/unit biomass, total RNA/unit length of intestine) to validate gene expression in the rat intestine after cestode infection and drug-induced neuromodulation. Variation in GAPDH, beta-actin, 18S and HPRT expression was observed in rat jejunal tissue according to treatment. Total RNA/unit length of intestine was found to be the most suitable internal control for normalizing target gene mRNA expression in both infected and/or drug-induced rat intestine. This normalization method may be applied to studies of gene expression levels in intestinal tissue where hypertrophy, hyperplasia, rapid growth and cell differentiation generally occur.
Highlighting non-uniform temperatures close to liquid/solid surfaces
NASA Astrophysics Data System (ADS)
Noirez, L.; Baroni, P.; Bardeau, J. F.
2017-05-01
The present experimental measurements reveal that similar to external fields such as electric, magnetic, or flow fields, the vicinity of a solid surface can preclude the liquid molecules from relaxing to equilibrium, generating located non-uniform temperatures. The non-uniform temperature zone extends up to several millimeters within the liquid with a lower temperature near the solid wall (reaching ΔT = -0.15 °C ± 0.02 °C in the case of liquid water) counterbalanced at larger distances by a temperature rise. These effects highlighted by two independent methods (thermistor measurement and infra-red emissivity) are particularly pronounced for highly wetting surfaces. The scale over which non-uniform temperatures are extended indicates that the effect is assisted by intermolecular interactions, in agreement with recent developments showing that liquids possess finite shear elasticity and theoretical approaches integrating long range correlations.
History highlights and future trends of infrared sensors
NASA Astrophysics Data System (ADS)
Corsi, Carlo
2010-10-01
Infrared (IR) technologies (materials, devices and systems) represent an area of excellence in science and technology and, even if they have been generally confined to a selected scientific community, they have achieved technological and scientific highlights constituting 'innovation drivers' for neighbouring disciplines, especially in the sensors field. The development of IR sensors, initially linked to astronomical observations, since World War II and for many years has been fostered essentially by defence applications, particularly thermo-vision and, later on, smart vision and detection, for surveillance and warning. Only in the last few decades, the impact of silicon technology has changed the development of IR detectors dramatically, with the advent of integrated signal read-outs and the opening of civilian markets (EO communications, biomedical, environmental, transport and energy applications). The history of infrared sensors contains examples of real breakthroughs, particularly true in the case of focal plane arrays that first appeared in the late 1970s, when the superiority of bi-dimensional arrays for most applications pushed the development of technologies providing the highest number of pixels. An impressive impulse was given to the development of FPA arrays by integration with charge coupled devices (CCD), with strong competition from different technologies (high-efficiency photon sensors, Schottky diodes, multi-quantum wells and, later on, room temperature microbolometers/cantilevers). This breakthrough allowed the development of high performance IR systems of small size, light weight and low cost - and therefore suitable for civil applications - thanks to the elimination of the mechanical scanning system and the progressive reduction of cooling requirements (up to the advent of microbolometers, capable of working at room temperature). In particular, the elimination of cryogenic cooling allowed the development and commercialisation of IR Smart Sensors
Optimal Reference Gene Selection for Expression Studies in Human Reticulocytes.
Aggarwal, Anu; Jamwal, Manu; Viswanathan, Ganesh K; Sharma, Prashant; Sachdeva, ManUpdesh S; Bansal, Deepak; Malhotra, Pankaj; Das, Reena
2018-05-01
Reference genes are indispensable for normalizing mRNA levels across samples in real-time quantitative PCR. Their expression levels vary under different experimental conditions and because of several inherent characteristics. Appropriate reference gene selection is thus critical for gene-expression studies. This study aimed at selecting optimal reference genes for gene-expression analysis of reticulocytes and at validating them in hereditary spherocytosis (HS) and β-thalassemia intermedia (βTI) patients. Seven reference genes (PGK1, MPP1, HPRT1, ACTB, GAPDH, RN18S1, and SDHA) were selected because of published reports. Real-time quantitative PCR was performed on reticulocytes in 20 healthy volunteers, 15 HS patients, and 10 βTI patients. Threshold cycle values were compared with fold-change method and RefFinder software. The stable reference genes recommended by RefFinder were validated with SLC4A1 and flow cytometric eosin-5'-maleimide binding assay values in HS patients and HBG2 and high performance liquid chromatography-derived percentage of hemoglobin F in βTI. Comprehensive ranking predicted MPP1 and GAPDH as optimal reference genes for reticulocytes that were not affected in HS and βTI. This was further confirmed on validation with eosin-5'-maleimide results and percentage of hemoglobin F in HS and βTI patients, respectively. Hence, MPP1 and GAPDH are good reference genes for reticulocyte expression studies compared with ACTB and RN18S1, the two most commonly used reference genes. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Malhotra, Himanshu; Sheokand, Navdeep; Kumar, Santosh; Chauhan, Anoop S; Kumar, Manoj; Jakhar, Priyanka; Boradia, Vishant M; Raje, Chaaya I; Raje, Manoj
2016-05-01
Due to their abundant ubiquitous presence, rapid uptake and increased requirement in neoplastic tissue, the delivery of the iron carrier macromolecules transferrin (Tf) and lactoferrin (Lf) into mammalian cells is the subject of intense interest for delivery of drugs and other target molecules into cells. Utilizing exosomes obtained from cells of diverse origin we confirmed the presence of the multifunctional protein glyceraldehyde-3-phosphate dehydrogenase (GAPDH) which has recently been characterized as a Tf and Lf receptor. Using a combination of biochemical, biophysical and imaging based methodologies, we demonstrate that GAPDH present in exosomes captures Tf and Lf and subsequently effectively delivers these proteins into mammalian cells. Exosome vesicles prepared had a size of 51.2 ± 23.7 nm. They were found to be stable in suspension with a zeta potential (ζ-potential) of -28.16 ± 1.15 mV. Loading of Tf/Lf did not significantly affect ζ-potential of the exosomes. The carrier protein loaded exosomes were able to enhance the delivery of Tf/Lf by 2 to 3 fold in a diverse panel of cell types. Ninety percent of the internalized cargo via this route was found to be specifically delivered into late endosome and lysosomes. We also found exosomes to be tunable nano vehicles for cargo delivery by varying the amount of GAPDH associated with exosome. The current study opens a new avenue of research for efficient delivery of these vital iron carriers into cells employing exosomes as a nano delivery vehicle.
Epigenetics, chromatin and genome organization: recent advances from the ENCODE project.
Siggens, L; Ekwall, K
2014-09-01
The organization of the genome into functional units, such as enhancers and active or repressed promoters, is associated with distinct patterns of DNA and histone modifications. The Encyclopedia of DNA Elements (ENCODE) project has advanced our understanding of the principles of genome, epigenome and chromatin organization, identifying hundreds of thousands of potential regulatory regions and transcription factor binding sites. Part of the ENCODE consortium, GENCODE, has annotated the human genome with novel transcripts including new noncoding RNAs and pseudogenes, highlighting transcriptional complexity. Many disease variants identified in genome-wide association studies are located within putative enhancer regions defined by the ENCODE project. Understanding the principles of chromatin and epigenome organization will help to identify new disease mechanisms, biomarkers and drug targets, particularly as ongoing epigenome mapping projects generate data for primary human cell types that play important roles in disease. © 2014 The Association for the Publication of the Journal of Internal Medicine.
Highlights of Aeroacoustics Research in the U.S.—1998
NASA Astrophysics Data System (ADS)
RAMAN, G.; MCLAUGHLIN, D. K.
1999-12-01
Highlights of aeroacoustics research in the United States of America during 1998 are reported in a summary compiled from information provided by members of the Aeroacoustics Technical Committee of the American Institute of Aeronautics and Astronautics (AIAA) and other leading research groups in industry, national laboratories, and academia. The past few years have seen significant progress in aeroacoustics. Research has steadily progressed toward enhanced safety, noise benefits, and lower costs. Since industrial progress is generally not published in the archival literature, it is particularly important to highlight these accomplishments. This year we chose to report on five topics of great interest to the aerospace industry including a synopsis of fundamental research at universities and national laboratories. The topics chosen are: (1) advanced subsonic technology (AST), (2) high-speed research (HSR), (3) rotorcraft, (4) weapons bay aeroacoustics control and (5) academic research including computational aeroacoustics (CAA). Although the information presented in this review is not all encompassing, we hope that the topics covered will provide some insights into aeroacoustics activity in the U.S. With contributions from members of the AIAA Aeroacoustics Technical Committee and others including D. Huff, E. Envia, C. Hughes, J. Bridges, and N. Saiyed (NASA Glenn), R. Hixon (ICOMP), R. M. Nallasamy (Dynacs, Inc.), M. Ponton, J. Posey (NASA Langley), C. Horne and P. Soderman (NASA Ames), D. Reed, B. Shivashankara, A. Cain, and V. Kibens (Boeing), D. Mathews (Pratt & Whitney), S. Martens (General Electric Aircraft Engines), S. H. Walker (AFOSR), M. J. Stanek (AFRL), K. K. Ahuja (GTRI), S. K. Lele (Stanford), J. Freund (UCLA), S. Dash (Craft Tech), P. J. Morris, L. N. Long (Penn State Univ.), and C. K. W. Tam (Florida State Univ.).
Highlights of contractor initiatives in quality enhancement and productivity improvement
NASA Technical Reports Server (NTRS)
1986-01-01
The NASA/Contractor Team efforts are presented as part of NASA's continuing effort to facilitate the sharing of quality and productivity improvement ideas among its contractors. This complilation is not meant to be a comprehensive review of contractor initiative nor does it necessarily express NASA's views. The submissions represent samples from a general survey, and were not edited by NASA. The efforts are examples of quality and productivity programs in private industry, and as such, highlight company efforts in individual areas. Topics range from modernization of equipment, hardware, and technology to management of human resources. Of particular interest are contractor initiatives which deal with measurement and evaluation data pertaining to quality and productivity performance.
Americans and the Arts 1984: Highlights from a Nationwide Survey of Public Opinion.
ERIC Educational Resources Information Center
Harris (Louis) and Associates, Inc., New York, NY.
Highlights of a nationwide public opinion survey concerning the interest and involvement of Americans in the arts are summarized. Telephone interviews were conducted with 1,504 adults. Results showed that the arts are indisputably a part of the mainstream of American life. Because Americans have limited leisure time, the arts must increasingly…
2005-01-01
the Selected Genes Sense Antisense Product length (bp) G3PDH 5=-TCCTGCACCACCAACTGCTTAG-3= 5=-TGCTTCACCACCTTCTTGATGTC-3= 341 iNOS 5...GAPDH, as a housekeeping gene, was not affected significantly by the hemorrhage protocol. The results showed that mRNA levels of all enzymes and
Jenkins, Mary G; Ford, Jane B; Morris, Jonathan M; Roberts, Christine L
2014-09-01
Although surveys have identified that women are generally highly satisfied with maternity care provision, those aspects of care that women highlight as most important for achieving satisfaction and a satisfactory maternity care experience have not been reported. The aim of this study was to investigate how women understand and experience their maternity care and to report which aspects of care women highlight as most important. This large qualitative study explored women's expectations and experiences of maternity care provision. In-depth semi-structured interviews were conducted with 53 women experiencing maternity care in a range of tertiary, regional, rural, remote hospitals and midwife-led practices in the state of New South Wales, Australia during 2011-2012. Included in the interview schedule was the question 'What 3 aspects would you see as most important for delivery of maternity care?' Descriptive analyses of entire transcripts and responses to the question on most important aspects of care were undertaken. Descriptive analyses of women's responses identified 5 important aspects of care: woman-focused care, staff qualities, systems and facilities, family-focused care and continuity of care/information. First-time mothers were more likely to identify woman-focused care, staff qualities and continuity of care/information as important aspects than multiparous mothers. Urban and regional mothers highlighted staff qualities as having greater importance for satisfaction with their care while rural and particularly remote women nominated systems and facilities as important. Our study showed that women from a range of settings are more concerned with staff and relational issues than facilities. Differences in perceptions among primiparous versus multiparous women, at different stages of pregnancy and among women from rural and remote compared to urban settings highlight the need to include women with a diversity of experience when trying to understand the aspects
Haas, David M.; Hebert, Mary F.; Soldin, Offie P.; Flockhart, David A.; Madadi, Parvaz; Nocon, James J.; Chambers, Christina D.; Hankins, Gary D.; Clark, Shannon; Wisner, Katherine L.; Li, Lang; Renbarger, Jamie L.; Learman, Lee A.
2009-01-01
Abstract To address provider struggles to provide evidence‐based, rational drug therapy to pregnant women, a second conference was convened to highlight the current research in the field. Speakers from academic centers and institutions spoke about: the unique physiology and pathology of pregnancy; pharmacokinetic changes in pregnancy; thyroid disorders in pregnancy; pharmacogenetics in pregnancy; the role of CYP2D6 in pregnancy; treating addiction in pregnancy; the power of teratology networks to inform clinical decisions; the use of anti‐depressants in pregnancy; and how to utilize computer‐based modeling to aid with individualized pharmacotherapy in pregnancy. The Conference highlighted several areas of collaboration with the current Obstetrics Pharmacology Research Units Network (OPRU) and hoped to stimulate further collaboration and knowledge in the area with the common goal to improve the ability to safely and effectively use individualized pharmacotherapy in pregnancy. PMID:20443937
Correa, Fernanda A; França, Marcela M; Fang, Qing; Ma, Qianyi; Bachega, Tania A; Rodrigues, Andresa; Ozel, Bilge A; Li, Jun Z; Mendonca, Berenice B; Jorge, Alexander A L; Carvalho, Luciani R; Camper, Sally A; Arnhold, Ivo J P
2017-12-01
Isolated growth hormone deficiency (IGHD) is the most common pituitary hormone deficiency and, clinically, patients have delayed bone age. High sequence similarity between CYP21A2 gene and CYP21A1P pseudogene poses difficulties for exome sequencing interpretation. A 7.5 year-old boy born to second-degree cousins presented with severe short stature (height SDS -3.7) and bone age of 6 years. Clonidine and combined pituitary stimulation tests revealed GH deficiency. Pituitary MRI was normal. The patient was successfully treated with rGH. Surprisingly, at 10.8 years, his bone age had advanced to 13 years, but physical exam, LH and testosterone levels remained prepubertal. An ACTH stimulation test disclosed a non-classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency explaining the bone age advancement and, therefore, treatment with cortisone acetate was added. The genetic diagnosis of a homozygous mutation in GHRHR (p.Leu144His), a homozygous CYP21A2 mutation (p.Val282Leu) and CYP21A1P pseudogene duplication was established by Sanger sequencing, MLPA and whole-exome sequencing. We report the unusual clinical presentation of a patient born to consanguineous parents with two recessive endocrine diseases: non-classic congenital adrenal hyperplasia modifying the classical GH deficiency phenotype. We used a method of paired read mapping aided by neighbouring mis-matches to overcome the challenges of exome-sequencing in the presence of a pseudogene.
A case of early onset rectal cancer of Lynch syndrome with a novel deleterious PMS2 mutation.
Nomura, Sachio; Fujimoto, Yoshiya; Yamamoto, Noriko; Sato, Yuri; Ashihara, Yuumi; Kita, Mizuho; Yamaguchi, Junya; Ishikawa, Yuichi; Ueno, Masashi; Arai, Masami
2015-10-01
Heterozygous deleterious mutation of the PMS2 gene is a cause of Lynch syndrome, an autosomal dominant cancer disease. However, the frequency of PMS2 mutation is rare compared with that of the other causative genes; MSH2, MLH1 and MSH6. PMS2 mutation has so far only been reported once from a Japanese facility. Detection of PMS2 mutation is relatively complicated due to the existence of 15 highly homologous pseudogenes, and its gene conversion event with the pseudogene PMS2CL. Therefore, for PMS2 mutation analysis, it is crucial to clearly distinguish PMS2 from its pseudogenes. We report here a novel deleterious 11 bp deletion mutation of exon 11 of PMS2 distinguished from PMS2CL in a 34-year-old Japanese female with rectal cancer. PMS2 mutated at c.1492del11 results in a truncated 500 amino acid protein rather than the wild-type protein of 862 amino acids. This is supported by the fact that, although there is usually concordance between MLH1 and PMS2 expression, cells were immunohistochemically positive for MLH1, whereas PMS2 could not be immunohistochemically stained using an anti-C-terminal PMS2 antibody, or effective PMS2 mRNA degradation with NMD caused by the frameshift mutation. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
State Digital Learning Exemplars: Highlights from States Leading Change through Policies and Funding
ERIC Educational Resources Information Center
Acree, Lauren; Fox, Christine
2015-01-01
States are striving to support the expansion of technology tools and resources in K-12 education through state policies, programs, and funding in order to provide digital learning opportunities for all students. This paper highlights examples of states with policies in support of five key areas: (1) innovative funding streams and policy; (2)…
ERIC Educational Resources Information Center
National Occupational Information Coordinating Committee (DOL/ETA), Washington, DC.
This publication provides highlights from a conference of the National Occupational Information Coordinating Committee (NOICC) and the State Occupational Information Coordinating Committees (SOICCs). Highlights of presentations include the following: (1) NOICC initiatives reflect an integrated, long-range planning approach; (2) business,…
Respiratory Highlights, 2015 - 2016 Influenza Season (4 October 2015 - 1 October 2016)
2016-12-09
REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour ...Flu Report 3. DATES COVERED (From – To) October 2015 – October 2016 4 . TITLE AND SUBTITLE Respiratory Highlights, 2015-2016 Influenza Season... 4 October 2015 - 1 October 2016) 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Jeffrey Thervil 5d
Respiratory Highlights: 2015-2016 Influenza Season (4 October 2015 - 1 October 2016)
2016-12-09
REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour ...Flu Report 3. DATES COVERED (From – To) October 2015 – October 2016 4 . TITLE AND SUBTITLE Respiratory Highlights, 2015-2016 Influenza Season... 4 October 2015 - 1 October 2016) 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Jeffrey Thervil 5d
Brookhaven highlights for fiscal year 1991, October 1, 1990--September 30, 1991
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rowe, M.S.; Cohen, A.; Greenberg, D.
1991-12-31
This report highlights Brookhaven National Laboratory`s activities for fiscal year 1991. Topics from the four research divisions: Computing and Communications, Instrumentation, Reactors, and Safety and Environmental Protection are presented. The research programs at Brookhaven are diverse, as is reflected by the nine different scientific departments: Accelerator Development, Alternating Gradient Synchrotron, Applied Science, Biology, Chemistry, Medical, National Synchrotron Light Source, Nuclear Energy, and Physics. Administrative and managerial information about Brookhaven are also disclosed. (GHH)
Brookhaven highlights for fiscal year 1991, October 1, 1990--September 30, 1991
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rowe, M.S.; Cohen, A.; Greenberg, D.
1991-01-01
This report highlights Brookhaven National Laboratory's activities for fiscal year 1991. Topics from the four research divisions: Computing and Communications, Instrumentation, Reactors, and Safety and Environmental Protection are presented. The research programs at Brookhaven are diverse, as is reflected by the nine different scientific departments: Accelerator Development, Alternating Gradient Synchrotron, Applied Science, Biology, Chemistry, Medical, National Synchrotron Light Source, Nuclear Energy, and Physics. Administrative and managerial information about Brookhaven are also disclosed. (GHH)
Research highlights of the global modeling and simulation branch for 1986-1987
NASA Technical Reports Server (NTRS)
Baker, Wayman (Editor); Susskind, Joel (Editor); Pfaendtner, James (Editor); Randall, David (Editor); Atlas, Robert (Editor)
1988-01-01
This document provides a summary of the research conducted in the Global Modeling and Simulation Branch and highlights the most significant accomplishments in 1986 to 1987. The Branch has been the focal point for global weather and climate prediction research in the Laboratory for Atmospheres through the retrieval and use of satellite data, the development of global models and data assimilation techniques, the simulation of future observing systems, and the performance of atmospheric diagnostic studies.
The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae).
Pan, Hong-Chun; Fang, Hong-Yan; Li, Shi-Wei; Liu, Jun-Hong; Wang, Ying; Wang, An-Tai
2014-12-01
The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae) is composed of two linear DNA molecules. The mitochondrial DNA (mtDNA) molecule 1 is 8010 bp long and contains six protein-coding genes, large subunit rRNA, methionine and tryptophan tRNAs, two pseudogenes consisting respectively of a partial copy of COI, and terminal sequences at two ends of the linear mtDNA, while the mtDNA molecule 2 is 7576 bp long and contains seven protein-coding genes, small subunit rRNA, methionine tRNA, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mtDNA. COI gene begins with GTG as start codon, whereas other 12 protein-coding genes start with a typical ATG initiation codon. In addition, all protein-coding genes are terminated with TAA as stop codon.
Al Nsour, M; Kaiser, R; Abd Elkreem, E; Walke, H; Kandeel, A; Bloland, R
2012-02-01
As a follow up of a short communication that the Eastern Mediterranean Health journal published in December 2011, this article reports on highlights and conclusions from scientific abstracts, methodology workshops and plenary sessions that were presented as part of the Eastern Mediterranean Public Health Network (EMPHNET) conference held from 6 to 9 December 2011 in Sharm Al Sheikh, Egypt.
Highlights of recent results from the VERITAS gamma-ray observatory
NASA Astrophysics Data System (ADS)
Fortson, Lucy;
2016-05-01
VERITAS is a major ground-based gamma-ray observatory comprising an array of four 12 meter air Cherenkov telescopes operating at the Fred Lawrence Whipple Observatory near Tucson, Arizona. Data taking has continued from 2007 with a major camera upgrade completed in 2012 resulting in the current sensitivity to very-high-energy (VHE) gamma rays between 85 GeV and 30 TeV. VERITAS has detected 54 sources (half of which have been discoveries) leading to many significant contributions to the field of VHE astronomy. These proceedings highlight some of the more recent VERITAS results from the blazar and galactic observing programs as well as measurements of the cosmic-ray electron spectrum, constraints on dark matter and a follow-up program for astrophysical neutrinos.
2012-10-01
ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1
Mycophagous rove beetles highlight diverse mushrooms in the Cretaceous
Cai, Chenyang; Leschen, Richard A. B.; Hibbett, David S; Xia, Fangyuan; Huang, Diying
2017-01-01
Agaricomycetes, or mushrooms, are familiar, conspicuous and morphologically diverse Fungi. Most Agaricomycete fruiting bodies are ephemeral, and their fossil record is limited. Here we report diverse gilled mushrooms (Agaricales) and mycophagous rove beetles (Staphylinidae) from mid-Cretaceous Burmese amber, the latter belonging to Oxyporinae, modern members of which exhibit an obligate association with soft-textured mushrooms. The discovery of four mushroom forms, most with a complete intact cap containing distinct gills and a stalk, suggests evolutionary stasis of body form for ∼99 Myr and highlights the palaeodiversity of Agaricomycetes. The mouthparts of early oxyporines, including enlarged mandibles and greatly enlarged apical labial palpomeres with dense specialized sensory organs, match those of modern taxa and suggest that they had a mushroom feeding biology. Diverse and morphologically specialized oxyporines from the Early Cretaceous suggests the existence of diverse Agaricomycetes and a specialized trophic interaction and ecological community structure by this early date. PMID:28300055
Wildlife studies on the Hanford Site: 1993 Highlights report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cadwell, L.L.
The Pacific Northwest Laboratory (PNL) Wildlife Resources Monitoring Project was initiated by DOE to track the status of wildlife populations to determine whether Hanford operations affected them. The project continues to conduct a census of wildlife populations that are highly visible, economically or aesthetically important, and rare or otherwise considered sensitive. Examples of long-term data collected and maintained through the Wildlife Resources Monitoring Project include annual goose nesting surveys conducted on islands in the Hanford Reach, wintering bald eagle surveys, and fall Chinook salmon redd (nest) surveys. The report highlights activities related to salmon and mollusks on the Hanford Reachmore » of the Columbia River; describes efforts to map vegetation on the Site and efforts to survey species of concern; provides descriptions of shrub-steppe bird surveys, including bald eagles, Canada geese, and hawks; outlines efforts to monitor mule deer and elk populations on the Site; and describes development of a biological database management system.« less
Wang, Lirui; Li, Yuhua; Fu, Jieli; Zhen, Linqing; Zhao, Na; Yang, Qiangzhen; Li, Sisi; Li, Xinhong
2016-08-01
Cadmium (Cd) has been reported to impair male fertility, primarily by disrupting sperm motility, but the underlying molecular mechanism remains unclear. Here we investigated the effects of Cd on sperm motility, tyrosine phosphorylation, AMP-activated protein kinase (AMPK) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) activity, and ATP levels in vitro. Our results demonstrated that Cd inhibited sperm motility, GAPDH activity, AMPK activity and ATP production, and induced tyrosine phosphorylation of 55-57KDa proteins. Importantly, all the parameters affected by Cd were restored to normal levels when incubated with 10μM Cd in the presence of 30μM ethylene diamine tetraacetic acid (EDTA). Interestingly, changes of tyrosine phosphorylation levels of 55-57KDa proteins are completely contrary to that of other parameters. These results suggest that Cd-induced tyrosine phosphorylation of 55-57KDa proteins might act as an engine to block intracellular energy metabolism and thus decrease sperm motility. Copyright © 2016 Elsevier Inc. All rights reserved.
Posttranscriptional Control of T Cell Effector Function by Aerobic Glycolysis
Chang, Chih-Hao; Curtis, Jonathan D.; Maggi, Leonard B.; Faubert, Brandon; Villarino, Alejandro V.; O’Sullivan, David; Huang, Stanley Ching-Cheng; van der Windt, Gerritje J.W.; Blagih, Julianna; Qiu, Jing; Weber, Jason D.; Pearce, Edward J.; Jones, Russell G.; Pearce, Erika L.
2013-01-01
SUMMARY A “switch” from oxidative phosphorylation (OXPHOS) to aerobic glycolysis is a hallmark of T cell activation and is thought to be required to meet the metabolic demands of proliferation. However, why proliferating cells adopt this less efficient metabolism, especially in an oxygen-replete environment, remains incompletely understood. We show here that aerobic glycolysis is specifically required for effector function in T cells but that this pathway is not necessary for proliferation or survival. When activated T cells are provided with costimulation and growth factors but are blocked from engaging glycolysis, their ability to produce IFN-γ is markedly compromised. This defect is translational and is regulated by the binding of the glycolysis enzyme GAPDH to AU-rich elements within the 3′ UTR of IFN-γ mRNA. GAPDH, by engaging/disengaging glycolysis and through fluctuations in its expression, controls effector cytokine production. Thus, aerobic glycolysis is a metabolically regulated signaling mechanism needed to control cellular function. PMID:23746840
Validation of reference genes for quantifying changes in gene expression in virus-infected tobacco.
Baek, Eseul; Yoon, Ju-Yeon; Palukaitis, Peter
2017-10-01
To facilitate quantification of gene expression changes in virus-infected tobacco plants, eight housekeeping genes were evaluated for their stability of expression during infection by one of three systemically-infecting viruses (cucumber mosaic virus, potato virus X, potato virus Y) or a hypersensitive-response-inducing virus (tobacco mosaic virus; TMV) limited to the inoculated leaf. Five reference-gene validation programs were used to establish the order of the most stable genes for the systemically-infecting viruses as ribosomal protein L25 > β-Tubulin > Actin, and the least stable genes Ubiquitin-conjugating enzyme (UCE) < PP2A < GAPDH. For local infection by TMV, the most stable genes were EF1α > Cysteine protease > Actin, and the least stable genes were GAPDH < PP2A < UCE. Using two of the most stable and the two least stable validated reference genes, three defense responsive genes were examined to compare their relative changes in gene expression caused by each virus. Copyright © 2017 Elsevier Inc. All rights reserved.
Transdermal Delivery of siRNA through Microneedle Array
NASA Astrophysics Data System (ADS)
Deng, Yan; Chen, Jiao; Zhao, Yi; Yan, Xiaohui; Zhang, Li; Choy, Kwongwai; Hu, Jun; Sant, Himanshu J.; Gale, Bruce K.; Tang, Tao
2016-02-01
Successful development of siRNA therapies has significant potential for the treatment of skin conditions (alopecia, allergic skin diseases, hyperpigmentation, psoriasis, skin cancer, pachyonychia congenital) caused by aberrant gene expression. Although hypodermic needles can be used to effectively deliver siRNA through the stratum corneum, the major challenge is that this approach is painful and the effects are restricted to the injection site. Microneedle arrays may represent a better way to deliver siRNAs across the stratum corneum. In this study, we evaluated for the first time the ability of the solid silicon microneedle array for punching holes to deliver cholesterol-modified housekeeping gene (Gapdh) siRNA to the mouse ear skin. Treating the ear with microneedles showed permeation of siRNA in the skin and could reduce Gapdh gene expression up to 66% in the skin without accumulation in the major organs. The results showed that microneedle arrays could effectively deliver siRNA to relevant regions of the skin noninvasively.
Gagl, Benjamin
2016-01-01
Highlighted text in the Internet (i.e., hypertext) is predominantly blue and underlined. The perceptibility of these hypertext characteristics was heavily questioned by applied research and empirical tests resulted in inconclusive results. The ability to recognize blue text in foveal and parafoveal vision was identified as potentially constrained by the low number of foveally centered blue light sensitive retinal cells. The present study investigates if foveal and parafoveal perceptibility of blue hypertext is reduced in comparison to normal black text during reading. A silent-sentence reading study with simultaneous eye movement recordings and the invisible boundary paradigm, which allows the investigation of foveal and parafoveal perceptibility, separately, was realized (comparing fixation times after degraded vs. un-degraded parafoveal previews). Target words in sentences were presented in either black or blue and either underlined or normal. No effect of color and underlining, but a preview benefit could be detected for first pass reading measures. Fixation time measures that included re-reading, e.g., total viewing times, showed, in addition to a preview effect, a reduced fixation time for not highlighted (black not underlined) in contrast to highlighted target words (either blue or underlined or both). The present pattern reflects no detectable perceptual disadvantage of hyperlink stimuli but increased attraction of attention resources, after first pass reading, through highlighting. Blue or underlined text allows readers to easily perceive hypertext and at the same time readers re-visited highlighted words longer. On the basis of the present evidence, blue hypertext can be safely recommended to web designers for future use.
2016-01-01
Background Highlighted text in the Internet (i.e., hypertext) is predominantly blue and underlined. The perceptibility of these hypertext characteristics was heavily questioned by applied research and empirical tests resulted in inconclusive results. The ability to recognize blue text in foveal and parafoveal vision was identified as potentially constrained by the low number of foveally centered blue light sensitive retinal cells. The present study investigates if foveal and parafoveal perceptibility of blue hypertext is reduced in comparison to normal black text during reading. Methods A silent-sentence reading study with simultaneous eye movement recordings and the invisible boundary paradigm, which allows the investigation of foveal and parafoveal perceptibility, separately, was realized (comparing fixation times after degraded vs. un-degraded parafoveal previews). Target words in sentences were presented in either black or blue and either underlined or normal. Results No effect of color and underlining, but a preview benefit could be detected for first pass reading measures. Fixation time measures that included re-reading, e.g., total viewing times, showed, in addition to a preview effect, a reduced fixation time for not highlighted (black not underlined) in contrast to highlighted target words (either blue or underlined or both). Discussion The present pattern reflects no detectable perceptual disadvantage of hyperlink stimuli but increased attraction of attention resources, after first pass reading, through highlighting. Blue or underlined text allows readers to easily perceive hypertext and at the same time readers re-visited highlighted words longer. On the basis of the present evidence, blue hypertext can be safely recommended to web designers for future use. PMID:27688970
Aeronautics and Space Highlights [1979 Highlights
NASA Technical Reports Server (NTRS)
1979-01-01
The videotape includes footage of the following: Voyagers to Jupiter, Pioneer to Saturn, High Energy Astronomy Observatory, space telescope, space shuttle, astronauts Young and Crippen, 10th anniversary of Apollo 11, Skylab reentry, Landsat, satellite freeze warning, Fire Fighting Module, SAGE, wind generators, Solar Energy Project, electric car research, XV-15, HiMAT, and crash worthiness tests.
The 1990 annual statistics and highlights report
NASA Technical Reports Server (NTRS)
Green, James L.
1991-01-01
The National Space Science Data Center (NSSDC) has archived over 6 terabytes of space and Earth science data accumulated over nearly 25 years. It now expects these holdings to nearly double every two years. The science user community needs rapid access to this archival data and information about data. The NSSDC has been set on course to provide just that. Five years ago the NSSDC came on line, becoming easily reachable for thousands of scientists around the world through electronic networks it managed and other international electronic networks to which it connected. Since that time, the data center has developed and implemented over 15 interactive systems, operational nearly 24 hours per day, and is reachable through DECnet, TCP/IP, X25, and BITnet communication protocols. The NSSDC is a clearinghouse for the science user to find data needed through the Master Directory system whether it is at the NSSDC or deposited in over 50 other archives and data management facilities around the world. Over 13,000 users accessed the NSSDC electronic systems, during the past year. Thousands of requests for data have been satisfied, resulting in the NSSDC's sending out a volume of data last year that nearly exceeded a quarter of its holdings. This document reports on some of the highlights and distribution statistics for most of the basic NSSDC operational services for fiscal year 1990. It is intended to be the first of a series of annual reports on how well NSSDC is doing in supporting the space and Earth science user communities.
Al Nsour, M.; Kaiser, R.; Abd Elkreem, E.; Walke, H.; Kandeel, A.; Bloland, P.
2017-01-01
As a follow up of a short communication that the Eastern Mediterranean Health Journal published in December 2011, this article reports on highlights and conclusions from scientific abstracts, methodology workshops and plenary sessions that were presented as part of the Eastern Mediterranean Public Health Network (EMPHNET) conference held from 6 to 9 December 2011 in Sharm Al Sheikh, Egypt. PMID:22571098
Making the Connection: Some People, Programs and Ideas Highlighted by Adult Learners Week 2001.
ERIC Educational Resources Information Center
Cross, John; Della, Jennie
This document profiles selected people, programs, and ideas highlighted by Australia's Adult Learners Week 2001 and begins with these papers: "Adult Learners Week: A National Celebration" (Ned Dennis); "A Message from the Adult Learners Week Patron" (Peter Hollingworth); "A Message of Support from the Prime Minister of…
Haas, David M.; Gallauresi, Beverly; Shields, Kristine; Zeitlin, Deborah; Clark, Shannon M.; Hebert, Mary F.; Ren, Zhaoxia; Nallani, Srikanth C.; Meslin, Eric M.; Feibus, Karen B.; Koren, Gideon; Goebel, W. Scott; Easterling, Thomas; Denne, Scott C.; Flockhart, David A.; Renbarger, Jamie L.
2011-01-01
Abstract To address provider struggles to provide evidence‐based, rational drug therapy to pregnant women, this third Conference was convened to highlight the current progress and research in the field. Speakers from academic centers, industry, and governmental institutions spoke about: the Food and Drug Administration’s role in pregnancy pharmacology and the new labeling initiative; drug registries in pregnancy; the pharmacist’s role in medication use in pregnancy; therapeutic areas such as preterm labor, gestational diabetes, nausea and vomiting in pregnancy, and hypertension; breast‐feeding and medications; ethical challenges for consent in pregnancy drug studies; the potential for cord blood banks; and concerns about the fetus when studying drugs in pregnancy. The Conference highlighted several areas of collaboration within the current Obstetrics Pharmacology Research Units Network and hoped to educate providers, researchers, and agencies with the common goal to improve the ability to safely and effectively use individualized pharmacotherapy in pregnancy. Clin Trans Sci 2011; Volume 4: 204–209 PMID:21707952
Haas, David M; Gallauresi, Beverly; Shields, Kristine; Zeitlin, Deborah; Clark, Shannon M; Hebert, Mary F; Ren, Zhaoxia; Nallani, Srikanth C; Meslin, Eric M; Feibus, Karen B; Koren, Gideon; Goebel, W Scott; Easterling, Thomas; Denne, Scott C; Flockhart, David A; Renbarger, Jamie L
2011-06-01
To address provider struggles to provide evidence-based, rational drug therapy to pregnant women, this third Conference was convened to highlight the current progress and research in the field. Speakers from academic centers, industry, and governmental institutions spoke about: the Food and Drug Administration's role in pregnancy pharmacology and the new labeling initiative; drug registries in pregnancy; the pharmacist's role in medication use in pregnancy; therapeutic areas such as preterm labor, gestational diabetes, nausea and vomiting in pregnancy, and hypertension; breast-feeding and medications; ethical challenges for consent in pregnancy drug studies; the potential for cord blood banks; and concerns about the fetus when studying drugs in pregnancy. The Conference highlighted several areas of collaboration within the current Obstetrics Pharmacology Research Units Network and hoped to educate providers, researchers, and agencies with the common goal to improve the ability to safely and effectively use individualized pharmacotherapy in pregnancy. © 2011 Wiley Periodicals, Inc.
Research highlights: Microtechnologies for engineering the cellular environment.
Tseng, Peter; Kunze, Anja; Kittur, Harsha; Di Carlo, Dino
2014-04-07
In this issue we highlight recent microtechnology-enabled approaches to control the physical and biomolecular environment around cells: (1) developing micropatterned surfaces to quantify cell affinity choices between two adhesive patterns, (2) controlling topographical cues to align cells and improve reprogramming to a pluripotent state, and (3) controlling gradients of biomolecules to maintain pluripotency in embryonic stem cells. Quantitative readouts of cell-surface affinity in environments with several cues should open up avenues in tissue engineering where self-assembly of complex multi-cellular structures is possible by precisely engineering relative adhesive cues in three dimensional constructs. Methods of simple and local epigenetic modification of chromatin structure with microtopography and biomolecular gradients should also be of use in regenerative medicine, as well as in high-throughput quantitative analysis of external signals that impact and can be used to control cells. Overall, approaches to engineer the cellular environment will continue to be an area of further growth in the microfluidic and lab on a chip community, as the scale of the technologies seamlessly matches that of biological systems. However, because of regulations and other complexities with tissue engineered therapies, these micro-engineering approaches will likely first impact organ-on-a-chip technologies that are poised to improve drug discovery pipelines.
Can Chimpanzee Biology Highlight Human Origin and Evolution?
Roffman, Itai; Nevo, Eviatar
2010-01-01
The closest living relatives of humans are their chimpanzee/bonobo (Pan) sister species, members of the same subfamily “Homininae”. This classification is supported by over 50 years of research in the fields of chimpanzee cultural diversity, language competency, genomics, anatomy, high cognition, psychology, society, self-consciousness and relation to others, tool use/production, as well as Homo level emotions, symbolic competency, memory recollection, complex multifaceted problem-solving capabilities, and interspecies communication. Language competence and symbolism can be continuously bridged from chimpanzee to man. Emotions, intercommunity aggression, body language, gestures, facial expressions, and vocalization of intonations seem to parallel between the sister taxa Homo and Pan. The shared suite of traits between Pan and Homo genus demonstrated in this article integrates old and new information on human–chimpanzee evolution, bilateral informational and cross-cultural exchange, promoting the urgent need for Pan cultures in the wild to be protected, as they are part of the cultural heritage of mankind. Also, we suggest that bonobos, Pan paniscus, based on shared traits with Australopithecus, need to be included in Australopithecine’s subgenus, and may even represent living-fossil Australopithecines. Unfolding bonobo and chimpanzee biology highlights our common genetic and cultural evolutionary origins. PMID:23908781
Oliveira, Sara R; Vieira, Helena L A; Duarte, Carlos B
2015-09-15
Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a widely used technique to characterize changes in gene expression in complex cellular and tissue processes, such as cytoprotection or inflammation. The accurate assessment of changes in gene expression depends on the selection of adequate internal reference gene(s). Carbon monoxide (CO) affects several metabolic pathways and de novo protein synthesis is crucial in the cellular responses to this gasotransmitter. Herein a selection of commonly used reference genes was analyzed to identify the most suitable internal control genes to evaluate the effect of CO on gene expression in cultured cerebrocortical astrocytes. The cells were exposed to CO by treatment with CORM-A1 (CO releasing molecule A1) and four different algorithms (geNorm, NormFinder, Delta Ct and BestKeeper) were applied to evaluate the stability of eight putative reference genes. Our results indicate that Gapdh (glyceraldehyde-3-phosphate dehydrogenase) together with Ppia (peptidylpropyl isomerase A) is the most suitable gene pair for normalization of qRT-PCR results under the experimental conditions used. Pgk1 (phosphoglycerate kinase 1), Hprt1 (hypoxanthine guanine phosphoribosyl transferase I), Sdha (Succinate Dehydrogenase Complex, Subunit A), Tbp (TATA box binding protein), Actg1 (actin gamma 1) and Rn18s (18S rRNA) genes presented less stable expression profiles in cultured cortical astrocytes exposed to CORM-A1 for up to 60 min. For validation, we analyzed the effect of CO on the expression of Bdnf and bcl-2. Different results were obtained, depending on the reference genes used. A significant increase in the expression of both genes was found when the results were normalized with Gapdh and Ppia, in contrast with the results obtained when the other genes were used as reference. These findings highlight the need for a proper and accurate selection of the reference genes used in the quantification of qRT-PCR results
ERIC Educational Resources Information Center
Ponce, Héctor R.; Mayer, Richard E.; Figueroa, Verónica A.; López, Mario J.
2018-01-01
This article examines the effectiveness of a software that supports formative assessment in real-time of learners' vocabulary knowledge through an interactive highlighting method. Students in a classroom are given a passage on their computer screen and asked to highlight the words they do not understand. This information is summarized on the…
Instrument developments and recent scientific highlights at the J-NSE
NASA Astrophysics Data System (ADS)
Ivanova, Oxana; Pasini, Stefano; Monkenbusch, Michael; Holderer, Olaf
2017-06-01
The J-NSE neutron spin echo spectrometer faces now 10 years of successful user operation at the FRM II research reactor at the Heinz Maier-Leibnitz Zentrum (MLZ). We present scientific highlights and instrumental developments of the last decade, for example the development of grazing incidence neutron spin echo spectroscopy (GINSES) at the J-NSE and investigations of the dynamics at solid-liquid interfaces with this new option. Polymers in confinement have been a prominent topic, as well as the internal dynamics of proteins. The scientific questions also triggered instrumental developments such as a new polarizer and a new neutron guide concept. Finally, the future of the J-NSE will be addressed with a short presentation of the current upgrade program with superconducting main coils with reduced intrinsic field integral inhomogeneity.
Bioanalysis-related highlights from the 2011 AAPS National Biotechnology Conference.
Crisino, Rebecca M; Dulanto, Beatriz
2011-08-01
The American Association of Pharmaceutical Scientists is a dynamic international forum for the exchange of knowledge among scientists to enhance their contributions to drug development. The annual National Biotechnology Conference, conducted and organized by the American Association of Pharmaceutical Scientists, is a forum dedicated to advancements in science and technology related to discovery, development and manufacture of medical biotechnology products. The 2011 National Biotechnology Conference meeting convened in San Francisco, CA, USA on 16-18 May. Over 300 abstracts were submitted and approximately 50 sessions examined topics pertaining to advances in drug development, emerging analytical technologies, bioanalysis-related issues, biosimilar therapies, updates on global regulatory documents and expectations, and other topics. The focus of this article is to highlight key developments relevant to immunogenicity and pharmacokinetic drug concentration bioanalysis.
Early Detection of Breast Cancer Using Molecular Beacons
2005-09-01
and Truica, CI Challenges in the development of anti-epidermal growth factor receptor therapies in breast cancer. Semin Oncol, 2004; 31(1 Suppl 3): 3...forward, 5’-AAAGACCTGTA CGCCAACACAGTGCTGTCTGG-3’, and P-actin reverse, 5’- CGTCA - Results TACTCCTGCTTGCTGATCCACATCTGC-3’, and for GAPDH were forward 5
Wu, Honghan; Oellrich, Anika; Girges, Christine; de Bono, Bernard; Hubbard, Tim J P; Dobson, Richard J B
2017-01-01
Neurodegenerative disorders such as Parkinson's and Alzheimer's disease are devastating and costly illnesses, a source of major global burden. In order to provide successful interventions for patients and reduce costs, both causes and pathological processes need to be understood. The ApiNATOMY project aims to contribute to our understanding of neurodegenerative disorders by manually curating and abstracting data from the vast body of literature amassed on these illnesses. As curation is labour-intensive, we aimed to speed up the process by automatically highlighting those parts of the PDF document of primary importance to the curator. Using techniques similar to those of summarisation, we developed an algorithm that relies on linguistic, semantic and spatial features. Employing this algorithm on a test set manually corrected for tool imprecision, we achieved a macro F 1 -measure of 0.51, which is an increase of 132% compared to the best bag-of-words baseline model. A user based evaluation was also conducted to assess the usefulness of the methodology on 40 unseen publications, which reveals that in 85% of cases all highlighted sentences are relevant to the curation task and in about 65% of the cases, the highlights are sufficient to support the knowledge curation task without needing to consult the full text. In conclusion, we believe that these are promising results for a step in automating the recognition of curation-relevant sentences. Refining our approach to pre-digest papers will lead to faster processing and cost reduction in the curation process. https://github.com/KHP-Informatics/NapEasy. © The Author(s) 2017. Published by Oxford University Press.
Highlights from the CERN/ESO/NordForsk ''Gender in Physics Day''
NASA Astrophysics Data System (ADS)
Primas, F.; Guinot, G.; Strandberg, L.
2017-03-01
In their role as observers on the EU Gender Equality Network in the European Research Area (GENERA) project, funded under the Horizon 2020 framework, CERN, ESO and NordForsk joined forces and organised a Gender in Physics Day at the CERN Globe of Science and Innovation. The one-day conference aimed to examine innovative activities promoting gender equality, and to discuss gender-oriented policies and best practice in the European Research Area (with special emphasis on intergovernmental organisations), as well as the importance of building solid networks. The event was very well attended and was declared a success. The main highlights of the meeting are reported.
The benchmark aeroelastic models program: Description and highlights of initial results
NASA Technical Reports Server (NTRS)
Bennett, Robert M.; Eckstrom, Clinton V.; Rivera, Jose A., Jr.; Dansberry, Bryan E.; Farmer, Moses G.; Durham, Michael H.
1991-01-01
An experimental effort was implemented in aeroelasticity called the Benchmark Models Program. The primary purpose of this program is to provide the necessary data to evaluate computational fluid dynamic codes for aeroelastic analysis. It also focuses on increasing the understanding of the physics of unsteady flows and providing data for empirical design. An overview is given of this program and some results obtained in the initial tests are highlighted. The tests that were completed include measurement of unsteady pressures during flutter of rigid wing with a NACA 0012 airfoil section and dynamic response measurements of a flexible rectangular wing with a thick circular arc airfoil undergoing shock boundary layer oscillations.
Branny, P; de la Torre, F; Garel, J R
1998-04-01
The structural genes gap, pgk and tpi encoding three glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinase (PGK) and triosephosphate isomerase (TPI), respectively, have been cloned and sequenced from Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus). The genes were isolated after screening genomic sublibraries with specific gap and pgk probes obtained by PCR amplification of chromosomal DNA with degenerate primers corresponding to amino acid sequences highly conserved in GAPDHs and PGKs. Nucleotide sequencing revealed that the three genes were organized in the order gap-pgk-tpi. The translation start codons of the three genes were identified by alignment of the N-terminal sequences. These genes predicted polypeptide chains of 338, 403 and 252 amino acids for GAPDH, PGK and TPI, respectively, and they were separated by 96 bp between gap and pgk, and by only 18 bp between pgk and tpi. The codon usage in gap, pgk, tpi and three other glycolytic genes from L. bulgaricus differed, noticeably from that in other chromosomal genes. The site of transcriptional initiation was located by primer extension, and a probable promoter was identified for the gap-pgk-tpi operon. Northern hybridization of total RNA with specific probes showed two transcripts, an mRNA of 1.4 kb corresponding to the gap gene, and a less abundant mRNA of 3.4 kb corresponding to the gap-pgk-tpi cluster. The absence of a visible terminator in the 3'-end of the shorter transcript and the location of this 3'-end inside the pgk gene indicated that this shorter transcript was produced by degradation of the longer one, rather than by an early termination of transcription after the gap gene.
31P magnetization transfer measurements of Pi→ATP flux in exercising human muscle
Savage, David B.; Williams, Guy B.; Porter, David; Carpenter, T. Adrian; Brindle, Kevin M.; Kemp, Graham J.
2016-01-01
Fundamental criticisms have been made over the use of 31P magnetic resonance spectroscopy (MRS) magnetization transfer estimates of inorganic phosphate (Pi)→ATP flux (VPi-ATP) in human resting skeletal muscle for assessing mitochondrial function. Although the discrepancy in the magnitude of VPi-ATP is now acknowledged, little is known about its metabolic determinants. Here we use a novel protocol to measure VPi-ATP in human exercising muscle for the first time. Steady-state VPi-ATP was measured at rest and over a range of exercise intensities and compared with suprabasal oxidative ATP synthesis rates estimated from the initial rates of postexercise phosphocreatine resynthesis (VATP). We define a surplus Pi→ATP flux as the difference between VPi-ATP and VATP. The coupled reactions catalyzed by the glycolytic enzymes GAPDH and phosphoglycerate kinase (PGK) have been shown to catalyze measurable exchange between ATP and Pi in some systems and have been suggested to be responsible for this surplus flux. Surplus VPi-ATP did not change between rest and exercise, even though the concentrations of Pi and ADP, which are substrates for GAPDH and PGK, respectively, increased as expected. However, involvement of these enzymes is suggested by correlations between absolute and surplus Pi→ATP flux, both at rest and during exercise, and the intensity of the phosphomonoester peak in the 31P NMR spectrum. This peak includes contributions from sugar phosphates in the glycolytic pathway, and changes in its intensity may indicate changes in downstream glycolytic intermediates, including 3-phosphoglycerate, which has been shown to influence the exchange between ATP and Pi catalyzed by GAPDH and PGK. PMID:26744504