Significant effects of atrioventricular node ablation and pacemaker implantation on left ventricular function and long-term survival in patients with atrial fibrillation and left ventricular dysfunction.

PubMed

Ozcan, Cevher; Jahangir, Arshad; Friedman, Paul A; Munger, Thomas M; Packer, Douglas L; Hodge, David O; Hayes, David L; Gersh, Bernard J; Hammill, Stephen C; Shen, Win-Kuang

2003-07-01

Control of ventricular rate by atrioventricular node ablation and pacemaker implantation in patients with drug-refractory atrial fibrillation (AF) is associated with improved left ventricular (LV) function. The objective of this study was to determine the effect of atrioventricular node ablation on long-term survival in patients with AF and LV dysfunction. Survival was determined by the Kaplan-Meier method for 56 study patients with LV ejection fraction (EF) < or =40% who underwent atrioventricular node ablation and pacemaker implantation and 56 age- and gender-matched control patients with AF and LVEF >40%, and age- and gender-matched control subjects from Minnesota. Groups were compared using the log-rank test. In study patients (age 69 +/- 10 years; 45 men), LVEF was 26% +/- 8% and 34% +/- 13% (p <0.001) before and after ablation, respectively. During follow-up (40 +/- 23 months), 23 patients died. Observed survival was worse than that of normal subjects (p <0.001) and control patients (p = 0.005). After ablation, LVEF nearly normalized (> or =45%) in 16 study patients (29%), in whom observed survival was comparable to that of normal subjects (p = 0.37). Coronary artery disease, hyperlipidemia, chronic renal failure, previous myocardial infarction, and coronary artery operation were independent predictors for mortality. Near normalization of LVEF occurred in 29% of study patients, suggesting that AF-induced EF reduction is reversible in many patients. Normal survival in patients with reversible LV dysfunction highlights potential survival benefits of rate control. Poor survival in patients with persistent LV dysfunction confirms the importance of optimal medical therapy.

Altered newborn gender distribution in patients with low mid-trimester maternal serum human chorionic gonadotropin (MShCG).

PubMed

Santolaya-Forgas, J; Meyer, W J; Burton, B K; Scommegna, A

1997-01-01

to determine if the sex ratio (male/female) is altered in infants born to patients with low mid-trimester maternal serum human chorionic gonadotropin (MShCG). Between 2/1/90 and 1/3/91, 3,116 patients underwent prenatal screening using second-trimester maternal serum alpha-fetoprotein (MSAFP), MShCG, and maternal serum unconjugated estriol (MSuE3). Among these, there were 132 patients with low second-trimester MShCG (< 0.4 MoM), normal MSAFP and MSuE3. The gender distribution of these term, normal newborns was compared to that of 237 controls, matched for race, maternal age, and referral source and delivered at term to mothers with normal mid-trimester MSAFP, MSuE3, and MShCG. The gender distribution of these two groups of newborns was also compared to that of 78 term newborns from the same obstetrical population delivered to mothers with second-trimester MShCG > 2.5 MoM and normal MSAFP and MSuE3. All patients had a complete obstetrical history. Forty-nine percent of the controls were male vs. 62% of the group with slow second-trimester MShCG (P < .01). Within the group with low MShCG, 59% of infants were male when the MShCG was between 0.19 and 0.4 MoM (A) and 80% when the MShCG was < 0.2 MoM (B) (control vs. A vs. B P < .005). The sex ratio in the high-MShCG group was similar to control. The data suggest that gender distribution is different from normal in patients with low mid-trimester MShCG.

Memory and phonological awareness in children with Benign Rolandic Epilepsy compared to a matched control group.

PubMed

Northcott, Ellen; Connolly, Anne M; Berroya, Anna; McIntyre, Jenny; Christie, Jane; Taylor, Alan; Bleasel, Andrew F; Lawson, John A; Bye, Ann M E

2007-06-01

In a previous study we demonstrated children with Benign Rolandic Epilepsy have normal intelligence and language ability. However, difficulties in verbal and visual memory and aspects of phonological awareness were found compared to normative data. To address the methodological limitations related to the use of normative data, we compared the same cohort of children with Benign Rolandic Epilepsy to a matched control group. Controls (n=40) matched on age and gender to the Benign Rolandic Epilepsy cohort underwent neuropsychological assessment. The life functioning of the control group was assessed using a modified version of the Quality of Life in Childhood Epilepsy Questionnaire (QOLCE). The study confirmed the previous findings of memory and phonological awareness difficulties. In addition, the children with Benign Rolandic Epilepsy had significantly lower IQ scores than the matched control group. Paired sample t-tests showed that on 8 of 11 QOLCE scales, children with Benign Rolandic Epilepsy were rated by parents as having poorer life functioning compared to matched controls, including lower parental ratings on the subscales of memory and language. Benign Rolandic Epilepsy has an excellent seizure prognosis, but this study further emphasizes potential cognitive difficulties. Using an age and gender matched control group, the previous findings of memory and phonological awareness difficulties were validated. These problems in cognition were also identified by parents of children with Benign Rolandic Epilepsy as problematic and impacting upon the child's quality of life.

Gender Profiles of Behavioral Attention in Children With Autism Spectrum Disorder.

PubMed

May, Tamara; Cornish, Kim; Rinehart, Nicole J

2016-07-01

The attention profile of girls with autism spectrum disorder (ASD) is unclear compared with boys with ASD and typical children. This study aimed to investigate parent-reported ASD and ADHD symptoms in a large sample of boys and girls with and without ASD. A total of 124 normally intelligent children, half of them girls, 64 with autistic disorder or Asperger's disorder, and 60 age- and gender-matched typically developing, aged 7 to 12 years, were recruited. Parents completed questionnaires regarding autistic and ADHD symptoms. No gender differences in social difficulties but more repetitive motor movements, communication difficulties, and inattention were reported in males, regardless of group. Younger boys with ASD had more elevated levels of hyperactivity-impulsivity than younger girls with ASD. Gender differences in autistic symptoms and inattention in ASD reflected gender differences in typical children. More pronounced hyperactivity in younger boys with ASD could contribute to higher rates of clinical referral than girls. © The Author(s) 2012.

Proximal and Overall Gastric Emptying of Solids in Patients with Reduced Gastric Volume Accommodation Compared to Matched Controls

PubMed Central

Camilleri, Michael; Breen, Mary; Ryks, Michael; Burton, Duane

2011-01-01

Background Interventions such as gastric surgery and erythromycin result in displacement of solids to the distal stomach and acceleration of overall and proximal gastric emptying. The effect of non-surgical impairment of gastric accommodation on gastric emptying is unclear. Non-surgical impairment of gastric accommodation is associated with accelerated gastric emptying. Aim To compare measurements of proximal and overall gastric emptying in patients with reduced postprandial gastric volume accommodation with the emptying rates in age- and gender-matched controls with normal postprandial gastric volume accommodation. Methods We evaluated overall and proximal gastric emptying in 9 patients with impaired gastric accommodation and age-equivalent and gender-matched controls. Gastric volumes and emptying were measured using validated SPECT and dual gamma camera scintigraphy respectively. We compared group differences in overall and proximal gastric emptying t1/2 by t test. Results Patients with impaired postprandial gastric volume accommodation had greater fasting gastric volume. The proportion of food emptied from the proximal stomach immediately after meal ingestion was lower and t1/2of proximal gastric emptying correspondingly longer in the group with reduced postprandial gastric accommodation. In contrast, differences were not detected in overall gastric emptying in the two groups, and the ratio of overall to proximal gastric emptying t1/2was greater in the group with impaired volume accommodation. Conclusions Proximal stomach emptying is reduced in patients with impaired postprandial volume accommodation; this difference occurs predominantly during the time of meal ingestion. Compensatory mechanisms that result in normal overall gastric emptying require further elucidation. PMID:21327917

Scientist Role Models in the Classroom: How Important Is Gender Matching?

ERIC Educational Resources Information Center

Conner, Laura D. Carsten; Danielson, Jennifer

2016-01-01

Gender-matched role models are often proposed as a mechanism to increase identification with science among girls, with the ultimate aim of broadening participation in science. While there is a great deal of evidence suggesting that role models can be effective, there is mixed support in the literature for the importance of gender matching. We used…

Gender, Contraceptives and Individual Metabolic Predisposition Shape a Healthy Plasma Lipidome.

PubMed

Sales, Susanne; Graessler, Juergen; Ciucci, Sara; Al-Atrib, Rania; Vihervaara, Terhi; Schuhmann, Kai; Kauhanen, Dimple; Sysi-Aho, Marko; Bornstein, Stefan R; Bickle, Marc; Cannistraci, Carlo V; Ekroos, Kim; Shevchenko, Andrej

2016-06-14

Lipidomics of human blood plasma is an emerging biomarker discovery approach that compares lipid profiles under pathological and physiologically normal conditions, but how a healthy lipidome varies within the population is poorly understood. By quantifying 281 molecular species from 27 major lipid classes in the plasma of 71 healthy young Caucasians whose 35 clinical blood test and anthropometric indices matched the medical norm, we provided a comprehensive, expandable and clinically relevant resource of reference molar concentrations of individual lipids. We established that gender is a major lipidomic factor, whose impact is strongly enhanced by hormonal contraceptives and mediated by sex hormone-binding globulin. In lipidomics epidemiological studies should avoid mixed-gender cohorts and females taking hormonal contraceptives should be considered as a separate sub-cohort. Within a gender-restricted cohort lipidomics revealed a compositional signature that indicates the predisposition towards an early development of metabolic syndrome in ca. 25% of healthy male individuals suggesting a healthy plasma lipidome as resource for early biomarker discovery.

Corneal thickness in dry eyes in an Iraqi population.

PubMed

Ali, Noora Mauwafak; Hamied, Furkaan M; Farhood, Qasim K

2017-01-01

Dry eye disorder is a multifactorial disease of the tears and ocular surface that results in discomfort and visual disturbance. Corneal pachymetry becomes increasingly important in refractive surgery, for the accurate assessment of intraocular pressure, and in the preoperative assessment of other ocular surgeries. To assess the effect of dry eye disorder on the central corneal thickness (CCT) by comparing with CCT of normal eyes of age-matched individuals. The total number of eyes examined was 280 (140 dry eyes from 70 patients and 140 normal eyes from 70 individuals). Pentacam (Scheimpflug imaging system) was used for measuring the CCT of all eyes. Patients with dry eye syndrome had significantly lower CCT compared to the control group ( P <0.01). Its mean was 536.5 versus 561.3, respectively. CCT of dry eyes was significantly reduced when compared with age- and gender-matched population. This result can be attributed to chronic desiccation by the inflammatory mediators in dry eyes, leading to corneal thinning.

Accounting for body size deviations when reporting bone mineral density variables in children.

PubMed

Webber, C E; Sala, A; Barr, R D

2009-01-01

In a child, bone mineral density (BMD) may differ from an age-expected normal value, not only because of the presence of disease, but also because of deviations of height or weight from population averages. Appropriate adjustment for body size deviations simplifies interpretation of BMD measurements. For children, a bone mineral density (BMD) measurement is normally expressed as a Z score. Interpretation is complicated when weight or height distinctly differ from age-matched children. We develop a procedure to allow for the influence of body size deviations upon measured BMD. We examined the relation between body size deviation and spine, hip and whole body BMD deviation in 179 normal children (91 girls). Expressions were developed that allowed derivation of an expected BMD based on age, gender and body size deviation. The difference between measured and expected BMD was expressed as a HAW score (Height-, Age-, Weight-adjusted score). In a second independent sample of 26 normal children (14 girls), measured spine, total femur and whole body BMD all fell within the same single normal range after accounting for age, gender and body size deviations. When traditional Z scores and HAW scores were compared in 154 children, 17.5% showed differences of more than 1 unit and such differences were associated with height and weight deviations. For almost 1 in 5 children, body size deviations influence BMD to an extent that could alter clinical management.

Effects of Sex, Gender Role Identification, and Gender Relevance of Two Types of Stressors on Cardiovascular and Subjective Responses: Sex and Gender Match and Mismatch Effects

ERIC Educational Resources Information Center

van Well, Sonja; Kolk, Annemarie M.; Klugkist, Irene G.

2008-01-01

The authors tested the hypothesis that a match between the gender relevance of a stressor and one's sex or gender role identification would elicit higher cardiovascular responses. Healthy female and male undergraduates (n = 108) were exposed to two stressors: the Cold Pressor Test (CPT) and the n-back task. Stressor relevance was manipulated to be…

Asymptomatic population reference values for three knee patient-reported outcomes measures: evaluation of an electronic data collection system and implications for future international, multi-centre cohort studies.

PubMed

McLean, James M; Brumby-Rendell, Oscar; Lisle, Ryan; Brazier, Jacob; Dunn, Kieran; Gill, Tiffany; Hill, Catherine L; Mandziak, Daniel; Leith, Jordan

2018-05-01

The aim was to assess whether the Knee Society Score, Oxford Knee Score (OKS) and Knee Injury and Osteoarthritis Outcome Score (KOOS) were comparable in asymptomatic, healthy, individuals of different age, gender and ethnicity, across two remote continents. The purpose of this study was to establish normal population values for these scores using an electronic data collection system. There is no difference in clinical knee scores in an asymptomatic population when comparing age, gender and ethnicity, across two remote continents. 312 Australian and 314 Canadian citizens, aged 18-94 years, with no active knee pain, injury or pathology in the ipsilateral knee corresponding to their dominant arm, were evaluated. A knee examination was performed and participants completed an electronically administered questionnaire covering the subjective components of the knee scores. The cohorts were age- and gender-matched. Chi-square tests, Fisher's exact test and Poisson regression models were used where appropriate, to investigate the association between knee scores, age, gender, ethnicity and nationality. There was a significant inverse relationship between age and all assessment tools. OKS recorded a significant difference between gender with females scoring on average 1% lower score. There was no significant difference between international cohorts when comparing all assessment tools. An electronic, multi-centre data collection system can be effectively utilized to assess remote international cohorts. Differences in gender, age, ethnicity and nationality should be taken into consideration when using knee scores to compare to pathological patient scores. This study has established an electronic, normal control group for future studies using the Knee society, Oxford, and KOOS knee scores. Diagnostic Level II.

Age, gender, and percentage of circulating osteoprogenitor (COP) cells: The COP Study.

PubMed

Gunawardene, Piumali; Al Saedi, Ahmed; Singh, Lakshman; Bermeo, Sandra; Vogrin, Sara; Phu, Steven; Suriyaarachchi, Pushpa; Pignolo, Robert J; Duque, Gustavo

2017-10-01

Circulating osteoprogenitor (COP) cells are blood-borne cells which express a variety of osteoblastic markers and are able to form bone nodules in vivo. Whereas a high percentage of COP cells (%COP) is associated with vascular calcification, low %COP has been associated with disability and frailty. However, the reference range of %COP in age- and gender-matching populations, and the age-related changes in %COP remain unknown. A cross-sectional study was undertaken in 144 healthy volunteers in Western Sydney (20-90year-old, 10 male and 10 female subjects per decade). %COP was quantified by flow cytometry. A high inter-and intra-rater reliability was found. In average, in this healthy population average of %COP was 0.42. There was no significant difference in %COP among the age groups. Similarly, no significant difference was found in %COP with gender, weight, height or BMI. In addition, we identified a normal reference range of %COP of 0.1-3.8%. In conclusion, in addition to the identification of steady levels of COP cells with age, we also identified a normal reference range of %COP, which could be used in future studies looking at musculoskeletal diseases in older populations. Copyright © 2017 Elsevier Inc. All rights reserved.

Quality of life in children and adolescents with growth hormone deficiency: association with growth hormone treatment.

PubMed

Geisler, Alexandra; Lass, Nina; Reinsch, Nicole; Uysal, Yvonne; Singer, Viola; Ravens-Sieberer, Ulrike; Reinehr, Thomas

2012-01-01

Quality of life (QoL) as it is related with growth hormone deficiency (GHD) is a matter of controversy. We analyzed QoL in 95 children aged 8-18 years with isolated GHD (72% male) treated with growth hormone (GH). These children were compared to 190 age- and gender-matched healthy children with similar height [height <10th percentile; control group 1 (CG1)] and age- and gender-matched 285 healthy children of normal stature (control group 2: CG2). QoL was measured by the KINDL® questionnaire referring to six domains (physical well-being, emotional well-being, self-esteem, family, friends, and school). QoL was significantly reduced in CG1 (effect-size 0.21) compared to CG2, while QoL was not significantly altered in children with GHD. In multiple linear regression analyses adjusted to age, gender, BMI, migration background, and socioeconomic status, decreasing height-SDS was associated with poorer QoL (especially emotional well-being), and treatment with GH was related significantly to better self-esteem. Increase of height-SDS in children treated with GH was associated positively with QoL and all its subscales except family and school. These findings suggest psychological consequences of short stature in children and an improvement of QoL in children treated with GH with the focus on self-esteem and emotional well-being. Copyright © 2012 S. Karger AG, Basel.

Ethical Behaviours of Student Teachers' Mentors in Forced Same-Gender and Cross-Gender Matches in a Malawian Initial Primary Teacher Education Programme: Implications for Mentor Selection and Development

ERIC Educational Resources Information Center

Mwanza, Alnord L. D.; Moyo, George; Maphosa, Cosmas

2017-01-01

The popularity of assigned or forced same-gender and cross-gender matches between school mentors and student teachers has heightened concerns regarding the ethical and/or unethical behaviours of mentors. In this article the authors present the findings of a cross-sectional survey study on the prevalence of ethical and/or unethical behaviours of…

The effect of sociodemographic (mis)match between interviewers and respondents on unit and item nonresponse in Belgium.

PubMed

Vercruyssen, Anina; Wuyts, Celine; Loosveldt, Geert

2017-09-01

Interviewer characteristics affect nonresponse and measurement errors in face-to-face surveys. Some studies have shown that mismatched sociodemographic characteristics - for example gender - affect people's behavior when interacting with an interviewer at the door and during the survey interview, resulting in more nonresponse. We investigate the effect of sociodemographic (mis)matching on nonresponse in two successive rounds of the European Social Survey in Belgium. As such, we replicate the analyses of the effect of (mis)matching gender and age on unit nonresponse on the one hand, and of gender, age and education level (mis)matching on item nonresponse on the other hand. Recurring effects of sociodemographic (mis)match are found for both unit and item nonresponse. Copyright © 2017 Elsevier Inc. All rights reserved.

Serum transthyretin levels in senile systemic amyloidosis: effects of age, gender and ethnicity

PubMed Central

Buxbaum, Joel; Koziol, James; Connors, Lawreen H.

2017-01-01

Serum transthyretin (TTR) levels are reduced in familial amyloidotic polyneuropathy (FAP). A single study of patients with senile systemic amyloidosis (SSA) in Sweden found that those individuals also had a significantly lower mean serum TTR concentration than age- and gender-matched controls. To determine if the same phenomenon prevailed in an ethnically more heterogeneous population, we compared the serum TTR levels, as determined by ELISA, in 45 documented SSA patients with congestive heart failure, 20 AL patients with congestive heart failure and population controls. Serum TTR concentrations in the controls were influenced in a statistically significant manner by age, gender and ethnicity. Although it is unlikely that such differences are clinically relevant, they must be considered when assessing the meaning of serum TTR concentrations in any clinically defined population. The serum concentrations in patients with SSA did not differ from age, gender and ethnically matched controls or from a group of AL patients with significant clinical cardiac involvement. We also compared TTR concentrations in 12 African-Americans carrying the TTR V122I allele with those in 826 African-Americans who were homozygous wild type at the TTR locus. The TTR V122I carriers had significantly lower serum TTR concentrations than appropriate controls even though the majority of such individuals had not reached the age of clinical or anatomic risk, i.e. over 60. Thus, as in carriers of other TTR mutations the serum TTR level is lower than normal, despite having a much later appearance of clinical disease. PMID:19065297

Gender and speaker identification as a function of the number of channels in spectrally reduced speech

NASA Astrophysics Data System (ADS)

Gonzalez, Julio; Oliver, Juan C.

2005-07-01

Considerable research on speech intelligibility for cochlear-implant users has been conducted using acoustic simulations with normal-hearing subjects. However, some relevant topics about perception through cochlear implants remain scantly explored. The present study examined the perception by normal-hearing subjects of gender and identity of a talker as a function of the number of channels in spectrally reduced speech. Two simulation strategies were compared. They were implemented by two different processors that presented signals as either the sum of sine waves at the center of the channels or as the sum of noise bands. In Experiment 1, 15 subjects determined the gender of 40 talkers (20 males + 20 females) from a natural utterance processed through 3, 4, 5, 6, 8, 10, 12, and 16 channels with both processors. In Experiment 2, 56 subjects matched a natural sentence uttered by 10 talkers with the corresponding simulation replicas processed through 3, 4, 8, and 16 channels for each processor. In Experiment 3, 72 subjects performed the same task but different sentences were used for natural and processed stimuli. A control Experiment 4 was conducted to equate the processing steps between the two simulation strategies. Results showed that gender and talker identification was better for the sine-wave processor, and that performance through the noise-band processor was more sensitive to the number of channels. Implications and possible explanations for the superiority of sine-wave simulations are discussed.

Increased BMI in children-an indicator for less compliance during orthodontic treatment with removable appliances.

PubMed

von Bremen, Julia; Lorenz, Nathalie; Ludwig, Björn; Ruf, Sabine

2018-02-19

To assess whether or not childhood overweight is associated with lower levels of compliance during orthodontic therapy with removable appliances. Starting in 2011, all upper expansion plates and Sander II appliances were equipped with a Theramon® microsensor chip to assess appliance wear time objectively. According to their pre-treatment, BMI normal weight patients were matched to consecutively treated overweight or obese patients by gender, age, and appliance type. Cooperation was assessed with microelectronic wear time documentation over a period of at least 6 months. A total of 50 patients (25 overweight, 25 normal weight) with upper expansion plates and 64 patients (32 overweight, 32 normal weight) with Sander II appliances were analysed. Spearman Rho coefficients showed an indirect association between BMI and appliance wear time, indicating that the higher the BMI, the less the patients wore their appliances (P < 0.05). Furthermore, both normal- and overweight children wore upper expansion plates significantly more than Sander II appliances (P < 0.05). Although no gender-specific difference was found (P = 0.723), an age-related correlation could be verified, indicating a decrease in wear time with increasing age (P < 0.05). An increased BMI appears to be a risk factor for less appliance wear during orthodontic treatment with removable appliances. Additional factors which influenced cooperation during treatment with removable appliances were patient age and appliance type.

Scientist role models in the classroom: how important is gender matching?

NASA Astrophysics Data System (ADS)

Conner, Laura D. Carsten; Danielson, Jennifer

2016-10-01

Gender-matched role models are often proposed as a mechanism to increase identification with science among girls, with the ultimate aim of broadening participation in science. While there is a great deal of evidence suggesting that role models can be effective, there is mixed support in the literature for the importance of gender matching. We used the Eccles Expectancy Value model as a framework to explore how female science role models impact a suite of factors that might predict future career choice among elementary students. We predicted that impacts of female scientist role models would be more pronounced among girls than among boys, as such role models have the potential to normalise what is often perceived as a gender-deviant role. Using a mixed-methods approach, we found that ideas about scientists, self-concept towards science, and level of science participation changed equally across both genders, contrary to our prediction. Our results suggest that engaging in authentic science and viewing the female scientist as personable were keys to changes among students, rather than gender matching between the role model and student. These results imply that scientists in the schools programmes should focus on preparing the visiting scientists in these areas.

Continuous subcutaneous insulin infusion preserves axonal function in type 1 diabetes mellitus.

PubMed

Kwai, Natalie; Arnold, Ria; Poynten, Ann M; Lin, Cindy S-Y; Kiernan, Matthew C; Krishnan, Arun V

2015-02-01

Diabetic peripheral neuropathy is a common and debilitating complication of diabetes mellitus. Although strict glycaemic control may reduce the risk of developing diabetic peripheral neuropathy, the neurological benefits of different insulin regimens remain relatively unknown. In the present study, 55 consecutive patients with type 1 diabetes mellitus underwent clinical neurological assessment. Subsequently, 41 non-neuropathic patients, 24 of whom were receiving multiple daily insulin injections (MDII) and 17 receiving continuous subcutaneous insulin infusion (CSII), underwent nerve excitability testing, a technique that assesses axonal ion channel function and membrane potential in human nerves. Treatment groups were matched for glycaemic control, body mass index, disease duration and gender. Neurophysiological parameters were compared between treatment groups and those taken from age and sex-matched normal controls. Prominent differences in axonal function were noted between MDII-treated and CSII-treated patients. Specifically, MDII patients manifested prominent abnormalities when compared with normal controls in threshold electrotonus (TE) parameters including depolarizing TE(10-20ms), undershoot and hyperpolarizing TE (90-100 ms) (P < 0.05). Additionally, recovery cycle parameters superexcitability and subexcitability were also abnormal (P < 0.05). In contrast, axonal function in CSII-treated patients was within normal limits when compared with age-matched controls. The differences between the groups were noted in cross-sectional analysis and remained at longitudinal follow-up. Axonal function in type 1 diabetes is maintained within normal limits in patients treated with continuous subcutaneous insulin infusion and not with multiple daily insulin injections. This raises the possibility that CSII therapy may have neuroprotective potential in patients with type 1 diabetes. Copyright © 2014 John Wiley & Sons, Ltd.

Inhibitory ability of children with developmental dyscalculia.

PubMed

Zhang, Huaiying; Wu, Hanrong

2011-02-01

Inhibitory ability of children with developmental dyscalculia (DD) was investigated to explore the cognitive mechanism underlying DD. According to the definition of developmental dyscalculia, 19 children with DD-only and 10 children with DD&RD (DD combined with reading disability) were selected step by step, children in two control groups were matched with children in case groups by gender and age, and the match ratio was 1:1. Psychological testing software named DMDX was used to measure inhibitory ability of the subjects. The differences of reaction time in number Stroop tasks and differences of accuracy in incongruent condition of color-word Stroop tasks and object inhibition tasks between DD-only children and their controls reached significant levels (P<0.05), and the differences of reaction time in number Stroop tasks between dyscalculic and normal children did not disappear after controlling the non-executive components. The difference of accuracy in color-word incongruent tasks between children with DD&RD and normal children reached significant levels (P<0.05). Children with DD-only confronted with general inhibitory deficits, while children with DD&RD confronted with word inhibitory deficits only.

Gender differences in match performance characteristics of soccer players competing in the UEFA Champions League.

PubMed

Bradley, Paul S; Dellal, Alexandre; Mohr, Magni; Castellano, Julen; Wilkie, Anna

2014-02-01

The aim of this study was to examine gender differences in match performance characteristics of elite soccer players. Fifty-four male and fifty-nine female soccer players were tracked during UEFA Champions League matches using a multi-camera system (Amisco, Nice, France). Male players covered more (P<.01) distance than female players in total during a match (Effect Size [ES]: 0.5) and at higher speed thresholds (>15, >18, 18-21, 21-23, 23-25 and >27kmh(-1); ES: 0.7-1.4). Decrements in the second versus first half (P<.01) were only evident in female players for the distance covered in total and at selected speed thresholds (12-15, >12 and >15kmh(-1); ES: 0.6). Male central midfielders covered more (P<.01) total distance during a match than female central midfielders and at selected speed thresholds (15-23kmh(-1); ES: 1.3-2.2). Male full-backs and wide midfielders covered a greater distance (P<.01) than female players in the same positions at higher speed thresholds (>15, 21-23, 23-25, 25-27 and >27kmh(-1); ES: 1.5-3.1). The distance covered during the most intense 5min period of the match (>15kmh(-1)) was higher (P<.01) in male compared to female players (ES: 1.0) but no distance deficit in the next versus the average 5min period was observed for either gender (ES: 0.1-0.2). No gender differences were found for technical events such as the number of ball touches, time in possession of the ball or total duels won during both halves and the entire match (ES: 0.1-0.3). However, female players lost the ball more often (P<.05) and displayed lower pass completion rates than male players during both halves and the entire match (ES: 0.5-0.9). The data demonstrate that large gender differences exist for match performance characteristics of players competing at the highest competitive standard of European soccer. Such detailed analyses could be useful for gender-specific training information for optimal preparation. However, more research is warranted to establish gender-specific speed thresholds for elite soccer players. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

Implications of Starvation-Induced Change in Right Dorsal Anterior Cingulate Volume in Anorexia Nervosa

PubMed Central

McCormick, Laurie M.; Keel, Pamela K.; Brumm, Michael C.; Bowers, Wayne; Swayze, Victor; Andersen, Arnold; Andreasen, Nancy

2013-01-01

Objective Converging evidence suggests a role for the anterior cingulate cortex (ACC) in the pathophysiology of anorexia nervosa (AN). This study sought to determine whether ACC volume was affected by starvation in active AN and, if so, whether this had any clinical significance. Method Eighteen patients with active AN and age- and gender-matched normal controls underwent magnetic resonance imaging (MRI). Sixteen patients (89%) with AN had intelligence quotients (IQ) testing at intake, 14 (78%) had repeat MRIs after weight normalization, and 10 (56%) had outcome data at 1-year post-hospitalization. Results Right dorsal ACC volume was significantly reduced in active AN patients versus controls and was correlated with lower performance IQ. While ACC normalization occurred with weight restoration, smaller change in right dorsal ACC volume prospectively predicted relapse after treatment. Conclusion Reduced right dorsal ACC volume during active AN relates to deficits in perceptual organization and conceptual reasoning. The degree of right dorsal ACC normalization during treatment is related to outcome. PMID:18473337

Implications of starvation-induced change in right dorsal anterior cingulate volume in anorexia nervosa.

PubMed

McCormick, Laurie M; Keel, Pamela K; Brumm, Michael C; Bowers, Wayne; Swayze, Victor; Andersen, Arnold; Andreasen, Nancy

2008-11-01

Converging evidence suggests a role for the anterior cingulate cortex (ACC) in the pathophysiology of anorexia nervosa (AN). This study sought to determine whether ACC volume was affected by starvation in active AN and, if so, whether this had any clinical significance. Eighteen patients with active AN and age- and gender-matched normal controls underwent magnetic resonance imaging (MRI). Sixteen patients (89%) with AN had intelligence quotients (IQ) testing at intake, 14 (78%) had repeat MRIs after weight normalization, and 10 (56%) had outcome data at 1-year posthospitalization. Right dorsal ACC volume was significantly reduced in active AN patients versus controls and was correlated with lower performance IQ. While ACC normalization occurred with weight restoration, smaller change in right dorsal ACC volume prospectively predicted relapse after treatment. Reduced right dorsal ACC volume during active AN relates to deficits in perceptual organization and conceptual reasoning. The degree of right dorsal ACC normalization during treatment is related to outcome.

Factor Analysis of Low-Frequency Repetitive Transcranial Magnetic Stimulation to the Temporoparietal Junction for Tinnitus

PubMed Central

Li, Bei; Wang, Meiye; Li, Ming; Yin, Shankai

2016-01-01

Objectives. We investigated factors that contribute to suppression of tinnitus after repetitive transcranial magnetic stimulation (rTMS). Methods. A total of 289 patients with tinnitus underwent active 1 Hz rTMS in the left temporoparietal region. A visual analog scale (VAS) was used to assess tinnitus loudness. All participants were interviewed regarding age, gender, tinnitus duration, laterality and pitch, audiometric parameters, sleep, and so forth. The resting motor thresholds (RMTs) were measured in all patients and 30 age- and gender-matched volunteers. Results. With respect to different factors that contribute to tinnitus suppression, we found improvement in the following domains: shorter duration, normal hearing (OR: 3.25, 95%CI: 2.01–5.27, p = 0.001), and without sleep disturbance (OR: 2.51, 95%CI: 1.56–4.1, p = 0.005) adjusted for age and gender. The patients with tinnitus lasting less than 1 year were more likely to show suppression of tinnitus (OR: 2.77, 95%CI: 1.48–5.19, p = 0.002) compared to those with tinnitus lasting more than 5 years. Tinnitus patients had significantly lower RMTs compared with healthy volunteers. Conclusion. Active low-frequency rTMS results in a significant reduction in the loudness of tinnitus. Significant tinnitus suppression was shown in subjects with shorter tinnitus duration, with normal hearing, and without sleep disturbance. PMID:27847647

Effects of frequency shifts and visual gender information on vowel category judgments

NASA Astrophysics Data System (ADS)

Glidden, Catherine; Assmann, Peter F.

2003-10-01

Visual morphing techniques were used together with a high-quality vocoder to study the audiovisual contribution of talker gender to the identification of frequency-shifted vowels. A nine-step continuum ranging from ``bit'' to ``bet'' was constructed from natural recorded syllables spoken by an adult female talker. Upward and downward frequency shifts in spectral envelope (scale factors of 0.85 and 1.0) were applied in combination with shifts in fundamental frequency, F0 (scale factors of 0.5 and 1.0). Downward frequency shifts generally resulted in malelike voices whereas upward shifts were perceived as femalelike. Two separate nine-step visual continua from ``bit'' to ``bet'' were also constructed, one from a male face and the other a female face, each producing the end-point words. Each step along the two visual continua was paired with the corresponding step on the acoustic continuum, creating natural audiovisual utterances. Category boundary shifts were found for both acoustic cues (F0 and formant frequency shifts) and visual cues (visual gender). The visual gender effect was larger when acoustic and visual information were matched appropriately. These results suggest that visual information provided by the speech signal plays an important supplemental role in talker normalization.

Fasting leptin and glucose in normal weight, over weight and obese men and women diabetes patients with and without clinical depression.

PubMed

Haleem, Darakhshan Jabeen; Sheikh, Shehnaz; Fawad, Asher; Haleem, Muhammad A

2017-06-01

A large number of diabetes patients suffer from major depression and are at high risk of mortality. In view of a role of leptin in diabetes, depression and energy homeostasis, the present study concerns circulating levels of leptin in different BMI groups of un-depressed and depressed diabetes patients. Six hundred thirty male and female patients with a primary diagnosis of diabetes were grouped according to BMI and with or without clinical symptoms of depression. Age matched healthy, normal weight male and female volunteers without clinical symptoms of depression or diabetes were taken as controls. Blood samples were obtained after an overnight fast of 12 h. Serum was stored for the determination of leptin and glucose. We found that there were more female than male diabetes patients with comorbid depression. Fasting leptin was higher in normal weight non-diabetes women than men; but comparable in normal weight men and women diabetes patients. Fasting glucose levels were higher in diabetes than non diabetes groups; values were comparable in men and women. Depression was associated with a decrease and increase in leptin respectively in normal-overweight and obese men and women diabetes patients. Glucose levels were also higher in obese depressed than un-depressed diabetes patients. The results suggested that the female gender is at greater risk to comorbid diabetes with depression. Adipo-insular axis plays an important role in diabetes, associated depression and in the greater risk of the female gender to comorbid diabetes with depression.

Sexual dimorphism of the planum temporale in schizophrenia: A MRI study.

PubMed

Delvecchio, Giuseppe; Pigoni, Alessandro; Perlini, Cinzia; Barillari, Marco; Ruggeri, Mirella; Altamura, Alfredo Carlo; Bellani, Marcella; Brambilla, Paolo

2017-10-01

Anatomical alterations in the superior temporal gyrus have been consistently reported in patients with schizophrenia, and they have mostly been linked to positive symptoms, including hallucinations and thought disorders. The superior temporal gyrus is considered one of the most asymmetric and lateralized structure of the human brain, and the process of lateralization seems to vary according to gender in the normal population. However, although it has been consistently suggested that patients with schizophrenia did not show normal brain lateralization in several regions, only few studies investigated it in the superior temporal gyrus and its sub-regions considering the effects of gender. In this context, the aim of this study was to evaluate sexual dimorphism in superior temporal gyrus volumes in a sample of patients with schizophrenia compared to age- and gender-matched healthy controls. A total of 72 right/left-handed males (40 schizophrenia patients and 32 healthy controls) and 45 right/left-handed females (18 schizophrenia patients and 27 healthy controls) underwent clinical evaluation and a 1.5T magnetic resonance imaging scan. Gray and white matter volumes of regions of interest within the superior temporal gyrus were manually detected, including the Heschl's gyrus and the planum temporale. Female patients with schizophrenia presented a reduction in left planum temporale gray matter volumes ( F = 4.58, p = 0.03) and a lack of the normal planum temporale asymmetry index ( t = 0.27; p = 0.79) compared to female controls ( t = 5.47; p = 0.001). No differences were found between males for any volumes or laterality indices. Finally, in female patients with schizophrenia, Heschl's gyrus gray and white matter volumes negatively correlated with positive symptoms ( r = -0.56, p = 0.01). Our results showed that sexual dimorphism plays a key role on planum temporale in schizophrenia, underlining the importance of gender as a modulator of brain morphology and lateralization of schizophrenia.

The metabolic profile in early rheumatoid arthritis: a high prevalence of metabolic obesity.

PubMed

Müller, Raili; Kull, Mart; Põlluste, Kaja; Aart, Annika; Eglit, Triin; Lember, Margus; Kallikorm, Riina

2017-01-01

The aim of the study was to compare the prevalence of metabolic syndrome (MetS) in early RA patients with age-gender-matched population controls focusing on the presence of MetS in different weight categories. The study group consisted of 91 consecutive patients with early RA and 273 age- and gender-matched controls subjects. MetS was diagnosed according to the National Cholesterol Education Program (NCEP-ATP III) criteria. Mean age in both groups was 52 years, and 72.5 % were female. The prevalence of MetS did not differ between the two groups (35.2 % in RA, 34.1 % in control group). Mean systolic blood pressure in the RA group was 137 mmHg, in control group 131 mmHg, P = 0.01, and diastolic blood pressure 85 versus 81 mmHg, respectively (P < 0.01). We found that 20 of 65 (30.8 %) of RA patients compared to 80 of 152 (52.6 %) of the control subjects with elevated blood pressure received antihypertensive treatment (P < 0.01). When comparing subgroups with normal BMI, the odds of having MetS (being metabolically obese) were higher among early RA subjects (OR 5.6, CI 1.3-23.8). Of the individual components of metabolic syndrome, we found increased prevalence of hypertension (OR 2.8, CI 1.3-6.0) and hyperglycemia (OR 2.9, CI 1.0-8.0) in the RA group. Recognition of abnormal metabolic status among normal-weight RA patients who have not yet developed CVD could provide a valuable opportunity for preventative intervention.

Lexical constraints in second language learning: Evidence on grammatical gender in German*

PubMed Central

BOBB, SUSAN C.; KROLL, JUDITH F.; JACKSON, CARRIE N.

2015-01-01

The present study asked whether or not the apparent insensitivity of second language (L2) learners to grammatical gender violations reflects an inability to use grammatical information during L2 lexical processing. Native German speakers and English speakers with intermediate to advanced L2 proficiency in German performed a translation-recognition task. On critical trials, an incorrect translation was presented that either matched or mismatched the grammatical gender of the correct translation. Results show interference for native German speakers in conditions in which the incorrect translation matched the gender of the correct translation. Native English speakers, regardless of German proficiency, were insensitive to the gender mismatch. In contrast, these same participants were correctly able to assign gender to critical items. These findings suggest a dissociation between explicit knowledge and the ability to use that information under speeded processing conditions and demonstrate the difficulty of L2 gender processing at the lexical level. PMID:26346327

Increased serum leptin and insulin concentrations in canine hypothyroidism.

PubMed

Mazaki-Tovi, Michal; Feuermann, Yonatan; Segev, Gilad; Klement, Eyal; Yas-Natan, Einat; Farkas, Amnon; Kol, Amir; Shamay, Avi

2010-01-01

Serum concentrations of leptin and insulin were compared between gender-matched hypothyroid (n=25) and healthy (n=25) client-owned dogs within comparable age and body condition score (BCS) ranges. Fasted blood samples were collected from each dog and analysed for glucose, cholesterol, triglyceride, leptin and insulin concentrations. Leptin and insulin concentrations were significantly higher in the hypothyroid compared to normal dogs (P=0.006 and P=0.001, respectively) following adjustment for potential confounders. A nearly significant (P=0.051) interaction with BCS was found in the association between hypothyroidism and leptin. Leptin concentrations were significantly higher in hypothyroid dogs compared to normal dogs, in separate analyses for BCS 6 (P=0.036) and 7 (P=0.049). There was no significant difference in glucose concentration between the hypothyroid and normal groups (P=0.84) following adjustment for BCS. This study showed that canine hypothyroidism is associated with increased serum leptin and insulin concentrations, neither of which may be attributed to obesity alone. Copyright 2008 Elsevier Ltd. All rights reserved.

An Investigation of Same- versus Cross-Gender Matching for Boys in Formal School-Based Mentoring Programs

ERIC Educational Resources Information Center

Kanchewa, Stella S.; Rhodes, Jean E.; Schwartz, Sarah E. O.; Olsho, Lauren E. W.

2014-01-01

Although assigned mentoring relationships have typically involved same-gender matches, a growing number of programs, particularly those in schools, have begun pairing female mentors with male mentees. This practice stems, in large part, from the relative dearth of male mentors and programs' efforts to increase the availability of youth mentoring…

Effect of Intrafix® SafeSet infusion apparatus on phlebitis in a neurological intensive care unit: a case-control study.

PubMed

Liu, F; Chen, D; Liao, Y; Diao, L; Liu, Y; Wu, M; Xue, X; You, C; Kang, Y

2012-01-01

To investigate the effect of the Intrafix(®) SafeSet infusion apparatus on the incidence of phlebitis in patients being intravenously infused in a neurological intensive care unit (ICU). Patients aged > 12 years, with no history of diabetes mellitus and no existing phlebitis, requiring a daily peripheral intravenous infusion of ≥ 8 h with the total period lasting ≥ 3 days, were enrolled. Infusions were performed using the Intrafix(®) SafeSet or normal infusion apparatus. Incidence of phlebitis (scored according to the Infusion Nursing Standards of Practice of the American Infusion Nurses Society) was analysed. Patients (n = 1545) were allocated to Intrafix(®) SafeSet (n = 709) or normal infusion (n = 836) groups, matched for age, gender and preliminary diagnosis. Incidence of phlebitis was significantly higher using normal infusion apparatus compared with the Intrafix(®) SafeSet (23.4% versus 17.9%, respectively). Intrafix(®) SafeSet infusion apparatus significantly reduced the incidence of phlebitis in patients in the neurological ICU, compared with normal infusion apparatus, and may be suitable for use in routine clinical practice.

Categorizing with gender: does implicit grammatical gender affect semantic processing in 24-month-old toddlers?

PubMed

Bobb, Susan C; Mani, Nivedita

2013-06-01

The current study investigated the interaction of implicit grammatical gender and semantic category knowledge during object identification. German-learning toddlers (24-month-olds) were presented with picture pairs and heard a noun (without a preceding article) labeling one of the pictures. Labels for target and distracter images either matched or mismatched in grammatical gender and either matched or mismatched in semantic category. When target and distracter overlapped in both semantic and gender information, target recognition was impaired compared with when target and distracter overlapped on only one dimension. Results suggest that by 24 months of age, German-learning toddlers are already forming not only semantic but also grammatical gender categories and that these sources of information are activated, and interact, during object identification. Copyright © 2013 Elsevier Inc. All rights reserved.

Gender differences in the physiological responses and kinematic behaviour of elite sprint cross-country skiers.

PubMed

Sandbakk, Oyvind; Ettema, Gertjan; Leirdal, Stig; Holmberg, Hans-Christer

2012-03-01

Gender differences in performance by elite endurance athletes, including runners, track cyclists and speed skaters, have been shown to be approximately 12%. The present study was designed to examine gender differences in physiological responses and kinematics associated with sprint cross-country skiing. Eight male and eight female elite sprint cross-country skiers, matched for performance, carried out a submaximal test, a test of maximal aerobic capacity (VO(2max)) and a shorter test of maximal treadmill speed (V (max)) during treadmill roller skiing utilizing the G3 skating technique. The men attained 17% higher speeds during both the VO(2max) and the V (max) tests (P < 0.05 in both cases), differences that were reduced to 9% upon normalization for fat-free body mass. Furthermore, the men exhibited 14 and 7% higher VO(2max) relative to total and fat-free body mass, respectively (P < 0.05 in both cases). The gross efficiency was similar for both gender groups. At the same absolute speed, men employed 11% longer cycles at lower rates, and at peak speed, 21% longer cycle lengths (P < 0.05 in all cases). The current study documents approximately 5% larger gender differences in performance and VO(2max) than those reported for comparable endurance sports. These differences reflect primarily the higher VO(2max) and lower percentage of body fat in men, since no gender differences in the ability to convert metabolic rate into work rate and speed were observed. With regards to kinematics, the gender difference in performance was explained by cycle length, not by cycle rate.

On broadening the cognitive, motivational, and sociostructural scope of theorizing about gender development and functioning: comment on Martin, Ruble, and Szkrybalo (2002).

PubMed

Bandura, Albert; Bussey, Kay

2004-09-01

In their article on gender development, C. L. Martin, D. N. Ruble, and J. Szkrybalo (see record 2002-18663-003) contrasted their conception of gender development with that of social cognitive theory. The authors of this commentary correct misrepresentations of social cognitive theory and analyze the conceptual and empirical status of Martin et al.'s (2002) theory that gender stereotype matching is the main motivating force of gender development. Martin et al. (2002) based their claim for the causal primacy of gender self-categorization on construal of gender discrimination as rudimentary self-identity, equivocal empirical evidence, and dismissal of discordant evidence because of methodological deficiencies. The repeated finding that gendered preferences and behavior precede emergence of a sense of self is discordant with their theory. Different lines of evidence confirm that gender development and functioning are socially situated, richly contextualized, and conditionally manifested rather than governed mainly by an intrinsic drive to match stereotypic gender self-conception. ((c) 2004 APA, all rights reserved)

Effects of Severe Bothersome Tinnitus on Cognitive Function Measured with Standardized Tests

PubMed Central

Pierce, Katherine J.; Kallogjeri, Dorina; Piccirillo, Jay F.; Garcia, Keith S.; Nicklaus, Joyce E.; Burton, Harold

2012-01-01

Neurocognitive tests compared abilities in people with bothersome tinnitus against an age, gender, and education matched normative population. Participants between 18 and 60 years had subjective, unilateral or bilateral, non-pulsatile tinnitus for >6 months, and a Tinnitus Handicap Inventory score of ≥38. Results from a first testing session showed deficits in learning, learning rates, immediate recall of heard words, and use of a serial order encoding strategy. Initial reliance on serial order encoding and later, increased intrusion of incorrect words towards normal levels might indicate a less demanding strategy to compensate for weakness in associative memory for semantic categories. PMID:22168528

Perception of Multisensory Gender Coherence in 6- and 9-month-old Infants

PubMed Central

de Boisferon, Anne Hillairet; Dupierrix, Eve; Quinn, Paul C.; Lœvenbruck, Hélène; Lewkowicz, David J.; Lee, Kang; Pascalis, Olivier

2015-01-01

One of the most salient social categories conveyed by human faces and voices is gender. We investigated the developmental emergence of the ability to perceive the coherence of auditory and visual attributes of gender in 6- and 9-month-old infants. Infants viewed two side-by-side video clips of a man and a woman singing a nursery rhyme and heard a synchronous male or female soundtrack. Results showed that 6-month-old infants did not match the audible and visible attributes of gender, and 9-month-old infants matched only female faces and voices. These findings indicate that the ability to perceive the multisensory coherence of gender emerges relatively late in infancy and that it reflects the greater experience that most infants have with female faces and voices. PMID:26561475

McGurk Effect in Gender Identification: Vision Trumps Audition in Voice Judgments.

PubMed

Peynircioǧlu, Zehra F; Brent, William; Tatz, Joshua R; Wyatt, Jordan

2017-01-01

Demonstrations of non-speech McGurk effects are rare, mostly limited to emotion identification, and sometimes not considered true analogues. We presented videos of males and females singing a single syllable on the same pitch and asked participants to indicate the true range of the voice-soprano, alto, tenor, or bass. For one group of participants, the gender shown on the video matched the gender of the voice heard, and for the other group they were mismatched. Soprano or alto responses were interpreted as "female voice" decisions and tenor or bass responses as "male voice" decisions. Identification of the voice gender was 100% correct in the preceding audio-only condition. However, whereas performance was also 100% correct in the matched video/audio condition, it was only 31% correct in the mismatched video/audio condition. Thus, the visual gender information overrode the voice gender identification, showing a robust non-speech McGurk effect.

Normal references of right ventricular strain values by two-dimensional strain echocardiography according to the age and gender.

PubMed

Park, Jae-Hyeong; Choi, Jin-Oh; Park, Seung Woo; Cho, Goo-Yeong; Oh, Jin Kyung; Lee, Jae-Hwan; Seong, In-Whan

2018-02-01

Right ventricular (RV) strain values by 2-dimensional strain echocardiography (STE) can be used as objective markers of RV systolic function. However, there is little data about normal reference RV strain values according to age and gender. We measured normal RV strain values by STE. RV strain values were analyzed from the digitally stored echocardiographic images from NORMAL (Normal echOcardiogRaphic diMensions and functions in KoreAn popuLation) study for the measurement of normal echocardiographic values performed in 23 Korean university hospitals. We enrolled total 1003 healthy persons in the NORMAL study. Of them, we analyzed 2-dimensional RV strain values in 493 subjects (261 females, mean 47 ± 15 years old) only with echocardiographic images by GE machines. Their LV systolic and diastolic functions were normal. RV fractional area change was 48 ± 6% and tricuspid annular plane systolic excursion was 23 ± 3 mm. Total RV global longitudinal peak systolic strain (RVGLS total ) was -21.5 ± 3.2%. Females had higher absolute RVGLS total (-22.3 ± 3.3 vs -20.7 ± 2.9%, p < 0.001) than males. Younger (<50 years old) females had higher absolute RVGLS total (-22.9 ± 3.2 vs -20.5 ± 2.8%, p < 0.001) than age matched males. RVGLS total in females gradually increased according to age (p for trend = 0.002) and becomes almost similar in age ≥50 years. However, this trend was not seen in males (p for trend = 0.287), and younger males had similar RVGLS total value to that of older males (age ≥50 years, -20.5 ± 2.8 vs -20.9 ± 3.1%, p = 0.224). We calculated normal RVGLS values in normal population. Females have higher absolute strain values than males, especially in younger age groups (<50 years old).

Verbal fluency in bilingual Spanish/English Alzheimer's disease patients.

PubMed

Salvatierra, Judy; Rosselli, Monica; Acevedo, Amarilis; Duara, Ranjan

2007-01-01

Studies have demonstrated that in verbal fluency tests, monolinguals with Alzheimer's disease (AD) show greater difficulties retrieving words based on semantic rather than phonemic rules. The present study aimed to determine whether this difficulty was reproduced in both languages of Spanish/English bilinguals with mild to moderate AD whose primary language was Spanish. Performance on semantic and phonemic verbal fluency of 11 bilingual AD patients was compared to the performance of 11 cognitively normal, elderly bilingual individuals matched for gender, age, level of education, and degree of bilingualism. Cognitively normal subjects retrieved significantly more items under the semantic condition compared to the phonemic, whereas the performance of AD patients was similar under both conditions, suggesting greater decline in semantic verbal fluency tests. This pattern was produced in both languages, implying a related semantic decline in both languages. Results from this study should be considered preliminary because of the small sample size.

Predictive value of diminutive colonic adenoma trial: the PREDICT trial.

PubMed

Schoenfeld, Philip; Shad, Javaid; Ormseth, Eric; Coyle, Walter; Cash, Brooks; Butler, James; Schindler, William; Kikendall, Walter J; Furlong, Christopher; Sobin, Leslie H; Hobbs, Christine M; Cruess, David; Rex, Douglas

2003-05-01

Diminutive adenomas (1-9 mm in diameter) are frequently found during colon cancer screening with flexible sigmoidoscopy (FS). This trial assessed the predictive value of these diminutive adenomas for advanced adenomas in the proximal colon. In a multicenter, prospective cohort trial, we matched 200 patients with normal FS and 200 patients with diminutive adenomas on FS for age and gender. All patients underwent colonoscopy. The presence of advanced adenomas (adenoma >or= 10 mm in diameter, villous adenoma, adenoma with high grade dysplasia, and colon cancer) and adenomas (any size) was recorded. Before colonoscopy, patients completed questionnaires about risk factors for adenomas. The prevalence of advanced adenomas in the proximal colon was similar in patients with diminutive adenomas and patients with normal FS (6% vs. 5.5%, respectively) (relative risk, 1.1; 95% confidence interval [CI], 0.5-2.6). Diminutive adenomas on FS did not accurately predict advanced adenomas in the proximal colon: sensitivity, 52% (95% CI, 32%-72%); specificity, 50% (95% CI, 49%-51%); positive predictive value, 6% (95% CI, 4%-8%); and negative predictive value, 95% (95% CI, 92%-97%). Male gender (odds ratio, 1.63; 95% CI, 1.01-2.61) was associated with an increased risk of proximal colon adenomas. Diminutive adenomas on sigmoidoscopy may not accurately predict advanced adenomas in the proximal colon.

Protanomaly-without-darkened-red is deuteranopia with rods

PubMed Central

Shevell, Steven K.; Sun, Yang; Neitz, Maureen

2008-01-01

The Rayleigh match, a color match between a mixture of 545+670 nm lights and 589 nm light in modern instruments, is the definitive measurement for the diagnosis of inherited red/green color defects. All trichromats, whether normal or anomalous, have a limited range of 545+670 nm mixtures they perceive to match 589 nm: a typical color-normal match-range is about 50–55% of 670 nm in the mixture (deutan mode), while deuteranomals have a range that includes mixtures with less 670 nm than normal and protanomals a range that includes mixtures with more 670 nm than normal. Further, the matching luminance of the 589 nm light for deuteranomals is the same as for normals but for protanomals is below normal. An example of an unexpected Rayleigh match, therefore, is a match range above normal (typical of protanomaly) and a normal luminance setting for 589 nm (typical of deuteranomaly), a match that Pickford (1950) called protanomaly “when the red end of the spectrum is not darkened”. In this case, Rayleigh matching does not yield a clear diagnosis. Aside from Pickford, we are aware of only one other report of a similar observer (Pokorny and Smith, 1981); this study predated modern genetic techniques that can reveal the cone photopigment(s) in the red/green range. We recently had the opportunity to conduct genetic and psychophysical tests on such an observer. Genetic results predict he is a deuteranope. His Rayleigh match is consistent with L cones and a contribution from rods. Further, with a rod-suppressing background, his Rayleigh match is characteristic of a single L-cone photopigment (deuteranopia). PMID:18423511

Protanomaly without darkened red is deuteranopia with rods.

PubMed

Shevell, Steven K; Sun, Yang; Neitz, Maureen

2008-11-01

The Rayleigh match, a color match between a mixture of 545+670 nm lights and 589 nm light in modern instruments, is the definitive measurement for the diagnosis of inherited red-green color defects. All trichromats, whether normal or anomalous, have a limited range of 545+670 nm mixtures they perceive to match 589 nm: a typical color-normal match range is about 50-55% of 670 nm in the mixture (deutan mode), while deuteranomals have a range that includes mixtures with less 670 nm than normal and protanomals a range that includes mixtures with more 670 nm than normal. Further, the matching luminance of the 589 nm light for deuteranomals is the same as for normals but for protanomals is below normal. An example of an unexpected Rayleigh match, therefore, is a match range above normal (typical of protanomaly) and a normal luminance setting for 589 nm (typical of deuteranomaly), a match called protanomaly "when the red end of the spectrum is not darkened" [Pickford, R.W. (1950). Three pedigrees for color blindness. Nature, 165, 182.]. In this case, Rayleigh matching does not yield a clear diagnosis. Aside from Pickford, we are aware of only one other report of a similar observer [Pokorny, J., & Smith, V. C. (1981). A variant of red-green color defect. Vision Research, 21, 311-317]; this study predated modern genetic techniques that can reveal the cone photopigment(s) in the red-green range. We recently had the opportunity to conduct genetic and psychophysical tests on such an observer. Genetic results predict he is a deuteranope. His Rayleigh match is consistent with L cones and a contribution from rods. Further, with a rod-suppressing background, his Rayleigh match is characteristic of a single L-cone photopigment (deuteranopia).

Does gender bias in cardiac stress testing still exist? A videographic analysis nested in a randomized controlled trial.

PubMed

Nestler, David M; Gilani, Waqas I; Anderson, Ryan T; Bellolio, M Fernanda; Branda, Megan E; LeBlanc, Annie; Phelan, Sean; Campbell, Ronna L; Hess, Erik P

2017-01-01

Despite a high prevalence of coronary heart disease in both genders, studies show a gender disparity in evaluation whereby women are less likely than men to undergo timely or comprehensive cardiac investigation. Using videographic analysis, we sought to quantify gender differences in provider recommendations and patient evaluations. We analyzed video recordings from our Chest Pain Choice trial, a single center patient-level randomized trial in which emergency department patients with chest pain being considered for cardiac stress testing were randomized to shared decision-making or usual care. Patient-provider interactions were video recorded. We compared characteristics and outcomes by gender. Of the 204 patients enrolled (101 decision aid; 103 usual care), 120 (58.8%) were female. Of the 75 providers evaluated, 20 (26.7%) were female. The mean (SD) pretest probability of acute coronary syndrome was lower in women [3.7% (2.2) vs 6.7% (4.4), P=.0002]. There was no gender effect on duration of discussion, clinician recommendations, OPTION scores, patient perceptions, or eventual patient dispositions. When the clinician and patient gender matched, OPTION scores were lower (interaction P=.002), and patients were less likely to find the information to be very helpful (interaction P=.10). Despite a lower pretest probability of acute coronary syndrome in women, we did not observe any significant gender disparity in how patients were managed and evaluated. When the patients' and providers' gender matched, the provider involved them less in the decision making process, and the information provided was less helpful than when the genders did not match. Copyright © 2016 Elsevier Inc. All rights reserved.

Predictive equations for lung volumes from computed tomography for size matching in pulmonary transplantation.

PubMed

Konheim, Jeremy A; Kon, Zachary N; Pasrija, Chetan; Luo, Qingyang; Sanchez, Pablo G; Garcia, Jose P; Griffith, Bartley P; Jeudy, Jean

2016-04-01

Size matching for lung transplantation is widely accomplished using height comparisons between donors and recipients. This gross approximation allows for wide variation in lung size and, potentially, size mismatch. Three-dimensional computed tomography (3D-CT) volumetry comparisons could offer more accurate size matching. Although recipient CT scans are universally available, donor CT scans are rarely performed. Therefore, predicted donor lung volumes could be used for comparison to measured recipient lung volumes, but no such predictive equations exist. We aimed to use 3D-CT volumetry measurements from a normal patient population to generate equations for predicted total lung volume (pTLV), predicted right lung volume (pRLV), and predicted left lung volume (pLLV), for size-matching purposes. Chest CT scans of 400 normal patients were retrospectively evaluated. 3D-CT volumetry was performed to measure total lung volume, right lung volume, and left lung volume of each patient, and predictive equations were generated. The fitted model was tested in a separate group of 100 patients. The model was externally validated by comparison of total lung volume with total lung capacity from pulmonary function tests in a subset of those patients. Age, gender, height, and race were independent predictors of lung volume. In the test group, there were strong linear correlations between predicted and actual lung volumes measured by 3D-CT volumetry for pTLV (r = 0.72), pRLV (r = 0.72), and pLLV (r = 0.69). A strong linear correlation was also observed when comparing pTLV and total lung capacity (r = 0.82). We successfully created a predictive model for pTLV, pRLV, and pLLV. These may serve as reference standards and predict donor lung volume for size matching in lung transplantation. Copyright © 2016 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.

The influence of matching populations on kinematic and kinetic variables in runners with iliotibial band syndrome.

PubMed

Grau, Stefan; Maiwald, Christian; Krauss, Inga; Axmann, Detlef; Horstmann, Thomas

2008-12-01

The purpose of this study was to assess how participant matching influences biomechanical variables when comparing healthy runners and runners with iliotibial band syndrome (ITBS). We examined 52 healthy runners (CO) and 18 with ITBS, using three-dimensional kinematics and pressure distribution. The study population was matched in three ways and compared with the biomechanical findings: ITBS versus CO I (unmatched), ITBS versus CO II (matched to gender) and ITBS versus CO III (matched to gender height, and weight). The final number of participants in each group was n = 18. The kinematic variables showed a dependency on the matching process. The largest statistically significant differences (after Bonferroni adjustment) in the frontal and transverse planes were between ITBS and CO III (p = .008). Pressure measurements were also dependent on the matching process, with decreasing and nonsignificant differences (p = .006) between ITBS and CO after refining the process (ITBS vs. CO III). The results of this study and the necessity of matching seem to be plausible (lever arms, different running styles). Data matching is important for understanding overuse injuries in running.

IGF-I replacement therapy in children with congenital IGF-I deficiency (Laron syndrome) maintains heart dimension and function.

PubMed

Scheinowitz, Mickey; Feinberg, Micha S; Laron, Zvi

2009-06-01

Untreated patients with congenital growth hormone deficiency (GHD) and IGF-I deficiency are characterized not only by dwarfism but also by acromicria and organomicria, such as the heart. We assessed cardiac dimensions and function in very young patients with Laron syndrome (LS) undergoing IGF-I replacement therapy. Two to seven echocardiographic measurements were performed during IGF-I replacement therapy on male (n=4) and female (n=4) LS -patients, mean+/-SD age of 7.1+/-3.6 years (range 1.6-11.6 years), weight 16.1+/-9.7 kg, and height 89.9+/-18.5 cm. As aged- and gender-matched controls served 44 healthy children, age: 8.7+/-5.5 years, weight: 36.1+/-22.4 kg, and height: 129.7+/-33.1cm. Data of LS patients were normalized to body surface area and compared to the control group as well as nomograms of normal echocardiographic parameters for this age group. Left ventricular diastolic and systolic dimensions (LVDD/ LVSD, mm) and LV mass (gr) were significantly smaller in boys and girls with IGF-I treated LS compared with controls while the shortening fraction (%) and intraventricular septum thickness (mm) were similar. When compared with standard values for this age group, all treated LS patients were within 1 standard deviation of the mean. IGF-I therapy of young patients with Laron syndrome maintain LV dimensions and function within the normal range of aged-matched controls.

Longitudinal assessment of gender differences in the development of PTSD among US military personnel deployed in support of the operations in Iraq and Afghanistan.

PubMed

Jacobson, Isabel G; Donoho, Carrie J; Crum-Cianflone, Nancy F; Maguen, Shira

2015-09-01

Divergent findings from previous research examining gender differences in the development of posttraumatic stress disorder (PTSD) among US military members deployed to the operations in Iraq or Afghanistan (recent operations) prompted this study utilizing a matching approach to examine whether risk for new-onset PTSD and PTSD severity scores differed by gender. US military members from the Millennium Cohort Study deployed in support of the recent operations were followed for approximately 7 years from baseline through 2 follow-up periods between 2001 and 2008. Propensity score matching was used to match 1 male to each female using demographic, military, and behavioral factors including baseline sexual assault. Analyses were stratified by combat experience defined as reporting at least one of five exposures during follow-up. Outcome measures included a positive screen for PTSD and severity scores measured by the PTSD Patient Checklist-Civilian Version. Discrete-time survival analysis quantified the association between gender and incident PTSD. Among 4684 matched subjects (2342 women and men), 6.7% of women and 6.1% of men developed PTSD during follow-up. Results showed no significant gender differences for the likelihood of developing PTSD or for PTSD severity scores among women and men who reported combat experience and among those who did not. This study is the first of its kind to match a large population of male and female service members on important baseline characteristics including sexual assault. Findings suggest that while combat deployed personnel develop PTSD, women do not have a significantly different risk for developing PTSD than men after experiencing combat. Published by Elsevier Ltd.

Oral strength in subjects with a unilateral cleft lip and palate.

PubMed

Van Lierde, Kristiane M; Bettens, Kim; Luyten, Anke; Plettinck, Janne; Bonte, Katrien; Vermeersch, Hubert; Roche, Nathalie

2014-08-01

Facial appearance and speech outcome may affect psychosocial functioning in girls and boys. Several studies reported dissatisfaction with facial appearance and more specifically the lip and mouth profile in children with cleft lip and palate (CLP). The purpose of this controlled study was to measure the tongue and lip strength and endurance in boys and girls with CLP. Twenty-five subjects (mean age: 10.6 years) with a unilateral CLP and a gender- and age- matched control group were selected. All subjects with an unilateral CLP consulted the same craniofacial team and had undergone an identical surgical procedure. Surgical procedure of the lip was performed using a modified Millard technique without primary nose correction at an average age of 5.5 months. The Iowa Oral Performance instrument was used to measure lip and tongue strength and tongue endurance. The results of the Iowa Oral Performance measurement showed no significant differences between the subjects with an unilateral cleft lip and palate and the age and gender matched control group without a cleft lip and palate. There is no significant differences regarding oral strength more specifically the lip and tongue strength and endurance between subjects with and without an unilateral cleft lip and palate. ENT specialists and speech pathologists must be aware of this aspect of the normal lip and tongue functions. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Is Greulich and Pyle atlas still a good reference for bone age assessment?

NASA Astrophysics Data System (ADS)

Zhang, Aifeng; Tsao, Sinchai; Sayre, James W.; Gertych, Arkadiusz; Liu, Brent J.; Huang, H. K.

2007-03-01

The most commonly used method for bone age assessment in clinical practice is the book atlas matching method developed by Greulich and Pyle in the 1950s. Due to changes in both population diversity and nutrition in the United States, this atlas may no longer be a good reference. An updated data set becomes crucial to improve the bone age assessment process. Therefore, a digital hand atlas was built with 1,100 children hand images, along with patient information and radiologists' readings, of normal Caucasian (CAU), African American (BLK), Hispanic (HIS), and Asian (ASI) males (M) and females (F) with ages ranging from 0 - 18 years. This data was collected from Childrens' Hospital Los Angeles. A computer-aided-diagnosis (CAD) method has been developed based on features extracted from phalangeal regions of interest (ROIs) and carpal bone ROIs from this digital hand atlas. Using the data collected along with the Greulich and Pyle Atlas-based readings and CAD results, this paper addresses this question: "Do different ethnicities and gender have different bone growth patterns?" To help with data analysis, a novel web-based visualization tool was developed to demonstrate bone growth diversity amongst differing gender and ethnic groups using data collected from the Digital Atlas. The application effectively demonstrates a discrepancy of bone growth pattern amongst different populations based on race and gender. It also has the capability of helping a radiologist determine the normality of skeletal development of a particular patient by visualizing his or her chronological age, radiologist reading, and CAD assessed bone age relative to the accuracy of the P&G method.

A new cognitive evaluation battery for Down syndrome and its relevance for clinical trials

PubMed Central

de Sola, Susana; de la Torre, Rafael; Sánchez-Benavides, Gonzalo; Benejam, Bessy; Cuenca-Royo, Aida; del Hoyo, Laura; Rodríguez, Joan; Catuara-Solarz, Silvina; Sanchez-Gutierrez, Judit; Dueñas-Espin, Ivan; Hernandez, Gimena; Peña-Casanova, Jordi; Langohr, Klaus; Videla, Sebastia; Blehaut, Henry; Farre, Magi; Dierssen, Mara; Cuenca-Royo, Aida

2015-01-01

The recent prospect of pharmaceutical interventions for cognitive impairment of Down syndrome (DS) has boosted a number of clinical trials in this population. However, running the trials has raised some methodological challenges and questioned the prevailing methodology used to evaluate cognitive functioning of DS individuals. This is usually achieved by comparing DS individuals to matched healthy controls of the same mental age. We propose a new tool, the TESDAD Battery that uses comparison with age-matched typically developed adults. This is an advantageous method for probing the clinical efficacy of DS therapies, allowing the interpretation and prediction of functional outcomes in clinical trials. In our DS population the TESDAD battery permitted a quantitative assessment of cognitive defects, which indicated language dysfunction and deficits in executive function, as the most important contributors to other cognitive and adaptive behavior outcomes as predictors of functional change in DS. Concretely, auditory comprehension and functional academics showed the highest potential as end-point measures of therapeutic intervention for clinical trials: the former as a cognitive key target for therapeutic intervention, and the latter as a primary functional outcome measure of clinical efficacy. Our results also emphasize the need to explore the modulating effects of IQ, gender and age on cognitive enhancing treatments. Noticeably, women performed significantly better than men of the same age and IQ in most cognitive tests, with the most consistent differences occurring in memory and executive functioning and negative trends rarely emerged on quality of life linked to the effect of age after adjusting for IQ and gender. In sum, the TESDAD battery is a useful neurocognitive tool for probing the clinical efficacy of experimental therapies in interventional studies in the DS population suggesting that age-matched controls are advantageous for determining normalization of DS. PMID:26089807

Differences in Activities of Daily Living Performance Between Long-Term Pediatric Sarcoma Survivors and a Matched Comparison Group on Standardized Testing

PubMed Central

Parks, Rebecca; Rasch, Elizabeth K.; Mansky, Patrick J.; Oakley, Frances

2009-01-01

BACKGROUND: In a cross-sectional study examining late effects of pediatric sarcoma therapy, long-term survivors were evaluated on their activities of daily living (ADL) performance. PROCEDURE: Thirty-two persons with Ewing sarcoma family of tumors, rhabdomyosarcoma, and non-rhabdomysarcoma-soft tissue sarcoma enrolled an average of 17 years after treatment. Participants were evaluated using the Assessment of Motor and Process Skills (AMPS) [1], a standardized observational evaluation of ADL task performance. Means and 95% confidence intervals for ADL motor and ADL process ability measures were calculated for four groups: 1) sarcoma survivors, 2) “well” adults matched for age and gender, 3) “well” adults matched for gender that were 10 years older; and 4) “well” adults matched for gender that were 20 years older. RESULTS: ADL motor ability was significantly lower for sarcoma survivors than for the age and gender matched comparison group (p<0.05). There was no significant difference between ADL motor ability of sarcoma survivors and the comparison group 10 years older, but sarcoma survivors had significantly better ADL motor ability (p<0.05) than the oldest comparison group (20 years older). Sarcoma survivors had significantly worse ADL process ability than the age matched group (p<0.05). There was no difference in ADL process ability between the sarcoma survivors and comparison groups that were 10 and 20 years older. CONCLUSIONS: This first report of a clinical evaluation of ADL limitation in pediatric sarcoma survivors treated with intensive multimodal cancer therapy suggests that influences on performance of daily life activities are more common than previously reported. PMID:19533662

Verbal problem solving in high functioning autistic individuals.

PubMed

Minshew, N J; Siegel, D J; Goldstein, G; Weldy, S

1994-01-01

The verbal problem-solving and abstract reasoning ability of 25 high-functioning autistic individuals ages 11 to 41 was compared with normal controls individually matched on age, gender, race, IQ, and educational level. The Twenty Questions Procedure was administered using a grid of 42 common objects. Time to complete the task, number of correct solutions, and number and type of questions asked were analyzed. Results indicated that controls were more often successful in achieving solutions, and in formulating constraint seeking questions that conceptually grouped, ordered, and sorted the objects. In contrast, the autistics relied primarily on guessing. Findings are consistent with prior studies reporting a core deficit in autism involving abstract reasoning ability.

Reduced auditory efferent activity in childhood selective mutism.

PubMed

Bar-Haim, Yair; Henkin, Yael; Ari-Even-Roth, Daphne; Tetin-Schneider, Simona; Hildesheimer, Minka; Muchnik, Chava

2004-06-01

Selective mutism is a psychiatric disorder of childhood characterized by consistent inability to speak in specific situations despite the ability to speak normally in others. The objective of this study was to test whether reduced auditory efferent activity, which may have direct bearings on speaking behavior, is compromised in selectively mute children. Participants were 16 children with selective mutism and 16 normally developing control children matched for age and gender. All children were tested for pure-tone audiometry, speech reception thresholds, speech discrimination, middle-ear acoustic reflex thresholds and decay function, transient evoked otoacoustic emission, suppression of transient evoked otoacoustic emission, and auditory brainstem response. Compared with control children, selectively mute children displayed specific deficiencies in auditory efferent activity. These aberrations in efferent activity appear along with normal pure-tone and speech audiometry and normal brainstem transmission as indicated by auditory brainstem response latencies. The diminished auditory efferent activity detected in some children with SM may result in desensitization of their auditory pathways by self-vocalization and in reduced control of masking and distortion of incoming speech sounds. These children may gradually learn to restrict vocalization to the minimal amount possible in contexts that require complex auditory processing.

Feeding, eating and behavioral disturbances in Prader-Willi syndrome and non-syndromal obesity.

PubMed

Sonnengrün, Lilli; Schober, Celestina; Vogel, Mandy; Hiemisch, Andreas; Döhnert, Mirko; Hilbert, Anja; Kiess, Wieland

2016-08-01

Although most individuals with Prader-Willi syndrome (PWS) are obese, little is known about the impact of obesity-related psychosocial factors in PWS. In the present study we compared feeding, eating, and behavioral disturbances in children and adolescents with PWS, peers with non-syndromal obesity, and normal weight controls. Twelve persons with PWS, aged 7-22 years, age- and gender-matched obese and normal weight individuals were analyzed regarding parental feeding practices, eating disturbances, and behavioral problems via standardized questionnaires. Parents of individuals with PWS reported significantly more restrictive feeding and monitoring than did parents of obese or normal weight children without PWS (p<0.05). Social problems were more common in the obese and the PWS group than in the normal-weight group (p<0.05). Behavioral problems were significantly correlated with parental restrictive feeding practices. Our data show that children and adolescents with PWS are affected by psychosocial problems, and that restrictive feeding practices might be associated with more severe behavioral problems. Further studies in larger samples will be necessary to replicate these results and possibly provide new therapeutic approaches for the management of PWS.

Music activities and responses of young cochlear implant recipients.

PubMed

van Besouw, Rachel M; Grasmeder, Mary L; Hamilton, Mary E; Baumann, Sarah E

2011-05-01

The development of auditory receptive skills and spoken language is often delayed in children who use cochlear implants, which may affect their appreciation of and responses to music. This in turn may be interpreted as disinterest in music. A questionnaire was developed to determine whether differences in exposure and responses to music exist between young cochlear implant recipients and their normally hearing peers. The questionnaire was developed by a multidisciplinary team and distributed to parents of preschool children with normal hearing and to parents of preschool children who had been implanted at least one year prior. The cochlear implant group comprised 23 children and was gender and age matched (within ±2 months) to a group of children with normal hearing. Young cochlear implant recipients receive similar exposure to audiovisual music media, parental singing and musical instruments at home. However, the data suggest that they receive less exposure to children's music presented without visual stimuli. Parents also reported less sophisticated responses to music for this group. The findings of this study have important implications concerning the provision of age-appropriate music habilitation materials and activities for young cochlear implant recipients.

Impact of gender on long-term outcomes after surgical repair for acute Stanford A aortic dissection: a propensity score matched analysis.

PubMed

Sabashnikov, Anton; Heinen, Stephanie; Deppe, Antje Christin; Zeriouh, Mohamed; Weymann, Alexander; Slottosch, Ingo; Eghbalzadeh, Kaveh; Popov, Aron-Frederik; Liakopoulos, Oliver; Rahmanian, Parwis B; Madershahian, Navid; Kroener, Axel; Choi, Yeong-Hoon; Kuhn-Régnier, Ferdinand; Simon, André R; Wahlers, Thorsten; Wippermann, Jens

2017-05-01

Previous research suggests that female gender is associated with increased mortality rates after surgery for Stanford A acute aortic dissection (AAD). However, women with AAD usually present with different clinical symptoms that may bias outcomes. Moreover, there is a lack of long-term results regarding overall mortality and freedom from major cerebrovascular events. We analysed the impact of gender on long-term outcomes after surgery for Stanford A AAD by comparing genders with similar risk profiles using propensity score matching. A total of 240 patients operated for Stanford A AAD were included in this study. To control for selection bias and other confounders, propensity score matching was applied to gender groups. After propensity score matching, the gender groups were well balanced in terms of risk profiles. There were no statistically significant differences regarding duration of cardiopulmonary bypass ( P  = 0.165) and duration of aortic cross-clamp time ( P  = 0.111). Female patients received less fresh frozen plasma ( P  = 0.021), had shorter stays in the intensive care unit ( P  = 0.031), lower incidence of temporary neurological dysfunction ( P  < 0.001) and lower incidence of dialysis ( P  = 0.008). There were no significant differences regarding intraoperative mortality ( P  = 1.000), 30-day mortality ( P  = 0.271), long-term overall cumulative survival ( P  = 0.954) and long-term freedom from cerebrovascular events ( P  = 0.235) with up to a 9-year follow-up. Considering patients with similar risk profiles, female gender per se is not associated with worse long-term survival and freedom from stroke after surgical aortic repair. Moreover, female patients might even benefit from a smoother early postoperative course and lower incidence of early postoperative complications. © The Author 2017. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.

Blocking landing techniques in volleyball and the possible association with anterior cruciate ligament injury.

PubMed

Zahradnik, David; Jandacka, Daniel; Holcapek, Michal; Farana, Roman; Uchytil, Jaroslav; Hamill, Joseph

2018-04-01

The number and type of landings performed after blocking during volleyball matches has been related to the potential risk of ACL injury. The aim of the present study was to determine whether gender affects the frequency of specific blocking landing techniques with potential risk of ACL injury from the perspective of foot contact and subsequent movement after the block used by volleyball players during competitive matches. Three matches involving four female volleyball teams (fourteen sets) and three matches involving four male volleyball teams (thirteen sets) in the Czech Republic were analyzed for this study. A Pearson chi-square test of independence was used to detect the relationship between gender and different blocking techniques. The results of the present study showed that gender affected single-leg landings with subsequent movement in lateral direction and double-leg landings. Although the total number of landings was lower for male athletes than for female athletes, a larger portion of male athletes demonstrated single leg landings with a subsequent movement than female athletes. Single leg landings with a subsequent movement have a higher potential risk of ACL injury.

Education, College Major, and Job Match: Gender Differences in Reasons for Mismatch

ERIC Educational Resources Information Center

Robst, John

2007-01-01

Many studies have examined the match between years of schooling and the schooling required for the job. The quantity of schooling is only one way to consider the match between schooling and jobs. This paper considers an alternative match between education and jobs based on the relationship between college majors and work activities. Twenty percent…

Implementing Feminist Theory in Engineering: Obstacles within the Gender Studies Tradition

ERIC Educational Resources Information Center

Udén, Maria K.

2017-01-01

Scholars have noted that there is hesitation to utilise findings from gender studies in engineering education. Issues within gender studies may be part of the matching problem. Debates concerning two concepts for new engineering paradigms are investigated: "care" and "heterogeneity." Their appeals and the respective…

Lesion-Site Affects Grammatical Gender Assignment in German: Perception and Production Data

ERIC Educational Resources Information Center

Hofmann, Juliane; Kotz, Sonja A.; Marschhauser, Anke; von Cramon, D. Yves; Friederici, Angela D.

2007-01-01

Two experiments investigated phonological, derivational-morphological and semantic aspects of grammatical gender assignment in a perception and a production task in German aphasic patients and age-matched controls. The agreement of a gender indicating adjective (feminine, masculine or neuter) and a noun was evaluated during perception in…

Social support and psychological well-being in gender dysphoria: a comparison of patients with matched controls.

PubMed

Davey, Amanda; Bouman, Walter P; Arcelus, Jon; Meyer, Caroline

2014-12-01

There is a paucity of research in the area of social support and psychological well-being among people with gender dysphoria. The present study aimed to investigate levels of social support among individuals with gender dysphoria compared with a matched control group. It also aimed to examine the relationship between social support and psychological well-being. Participants were 103 individuals diagnosed with gender dysphoria (according to ICD-10 criteria) attending a national gender identity clinic and an age- and gender-matched nonclinical control group recruited via social networking websites. All participants completed measures of social support (Multidimensional Scale of Perceived Social Support, MSPSS), psychopathology (Symptom Checklist 90 Revised, SCL), quality of life (Short Form 36 version 2, SF), and life satisfaction (Personal Wellbeing Index, PWI). Trans women reported significantly lower MSPSS total and MSPSS family scores compared with control women, although these differences in levels of social support were no longer significant when SCL depression was controlled for. No significant differences were found between trans men and any other group. MSPSS scores did not significantly predict SCL subscales but did predict both SF subscales and PWI total scores. Trans women perceived themselves to be lacking social support. Given that social support is beneficial to quality of life and life satisfaction in those with gender dysphoria, this is of great concern. Though these findings have been derived from correlational results, extended research may highlight the value of clinicians helping trans women to seek out and maintain social support. Additionally, efforts could be made to educate and challenge attitudes of nontrans people towards those with gender dysphoria. © 2014 International Society for Sexual Medicine.

Intoxicated Speech Detection: A Fusion Framework with Speaker-Normalized Hierarchical Functionals and GMM Supervectors

PubMed Central

Bone, Daniel; Li, Ming; Black, Matthew P.; Narayanan, Shrikanth S.

2013-01-01

Segmental and suprasegmental speech signal modulations offer information about paralinguistic content such as affect, age and gender, pathology, and speaker state. Speaker state encompasses medium-term, temporary physiological phenomena influenced by internal or external biochemical actions (e.g., sleepiness, alcohol intoxication). Perceptual and computational research indicates that detecting speaker state from speech is a challenging task. In this paper, we present a system constructed with multiple representations of prosodic and spectral features that provided the best result at the Intoxication Subchallenge of Interspeech 2011 on the Alcohol Language Corpus. We discuss the details of each classifier and show that fusion improves performance. We additionally address the question of how best to construct a speaker state detection system in terms of robust and practical marginalization of associated variability such as through modeling speakers, utterance type, gender, and utterance length. As is the case in human perception, speaker normalization provides significant improvements to our system. We show that a held-out set of baseline (sober) data can be used to achieve comparable gains to other speaker normalization techniques. Our fused frame-level statistic-functional systems, fused GMM systems, and final combined system achieve unweighted average recalls (UARs) of 69.7%, 65.1%, and 68.8%, respectively, on the test set. More consistent numbers compared to development set results occur with matched-prompt training, where the UARs are 70.4%, 66.2%, and 71.4%, respectively. The combined system improves over the Challenge baseline by 5.5% absolute (8.4% relative), also improving upon our previously best result. PMID:24376305

Medical expenditures in division I collegiate athletics: an analysis by sport and gender.

PubMed

Kaeding, Christopher C; Borchers, James; Oman, Janine; Pedroza, Angela

2014-09-01

Medical expenses for collegiate athletics include providing a training room with its supplies, equipment, personnel costs, and insurance coverage. Additional expenses beyond the training room include imaging, diagnostic testing, specialty consultations, and surgeries. We hypothesized that there would be no difference in average expenses or number of claims between male and female athletes over a 5-year period. Prospective patient cohort. A sports medicine center serving athletes in Big 10 Conference intercollegiate sports. All medical claims and charges for 36 varsity teams were analyzed from 2005 to 2010. The teams were categorized into 3 groups: female-only teams, male-only teams, and coed teams. Analysis of sports with corresponding male and female teams was also performed. Claims and charges for medical care for 36 intercollegiate athletic teams over 5 years. Individual team claims and charges were stable over the study period. In 11 of the 14 sex-matched sports, the female teams had higher average annual charges. After normalizing for roster size in the sex-matched sports, females had 0.97 more average annual claims (P < 0.01) and $1459 higher annual charges (P = 0.001) than their male counterparts. The charges per claim were similar between the sexes. The 5 teams with the highest average annual charges were football, wrestling, softball, women's crew, and men's lacrosse. When normalized for roster size, the 5 sports with the highest average annual charges per athlete were softball, women's diving, men's basketball, wrestling, and men's gymnastics. Charges per claim were similar between the sex-matched sports, but the female sports had a higher number of annual claims per athlete and thus higher total charges per athlete/year. Football had the highest average annual total charges as a team, but when normalized for roster size football charges per athlete/year were similar to those of other sports.

Sleep habits, food intake, and physical activity levels in normal and overweight and obese Malaysian children.

PubMed

Firouzi, Somayyeh; Poh, Bee Koon; Ismail, Mohd Noor; Sadeghilar, Aidin

2014-01-01

This study aimed to determine the association between sleep habits (including bedtime, wake up time, sleep duration, and sleep disorder score) and physical characteristics, physical activity level, and food pattern in overweight and obese versus normal weight children. Case control study. 164 Malaysian boys and girls aged 6-€“12 years. Anthropometric measurements included weight, height, waist circumference, and body fat percentage. Subjects divided into normal weight (n = 82) and overweight/obese (n = 82) group based on World Health Organization 2007 BMI-for-age criteria and were matched one by one based on ethnicity, gender, and age plus minus one year. Questionnaires related to sleep habits, physical activity, and food frequency were proxy-reported by parents. Sleep disorder score was measured by Children Sleep Habit Questionnaire. Sleep disorder score and carbohydrate intake (%) to total energy intake were significantly higher in overweight/obese group (p < 0.01 and p < 0.05, respectively). After adjusting for age and gender, sleep disorder score was correlated with BMI (r = 0.275, p < 0.001), weight (r = 0.253, p < 0.001), and WC (r = 0.293, p < 0.001). Based on adjusted odd ratio, children with shortest sleep duration were found to have 4.5 times higher odds of being overweight/obese (odd ratio: 4.536, 95% CI: 1.912-€“8.898) compared to children with normal sleep duration. The odds of being overweight/obese in children with sleep disorder score higher than 48 were 2.17 times more than children with sleep disorder score less than 48. Children who sleep lees than normal amount, had poor sleep quality, and consumed more carbohydrates were at higher risk of overweight/obesity. © 2014 Asian Oceanian Association for the Study of Obesity . Published by Elsevier Ltd. All rights reserved.

Asynchronous (segmental early) relaxation impairs left ventricular filling in patients with coronary artery disease and normal systolic function.

PubMed

Vanoverschelde, J L; Wijns, W; Michel, X; Cosyns, J; Detry, J M

1991-11-01

Asynchronous segmental early relaxation, defined as a localized early segmental outward motion of the left ventricular endocardium during isovolumetric relaxation, has been associated with an altered left ventricular relaxation rate. To determine whether asynchronous segmental early relaxation also results in impaired left ventricular filling, early diastolic ventricular wall motion and Doppler-derived left ventricular filling indexes were examined in 25 patients with documented coronary artery disease and normal systolic function. Patients were further classified into two groups according to the presence (n = 15, group 1) or absence (n = 10, group 2) of asynchronous early relaxation at left ventriculography. A third group of 10 age-matched normal subjects served as a control group. No differences were observed between the two patient groups with coronary artery disease with respect to age, gender distribution, heart rate, left ventricular systolic and diastolic pressures or extent and severity of coronary artery disease. No differences in transmitral filling dynamics were observed between group 2 patients and age-matched control subjects. Conversely, group 1 patients had significantly lower peak early filling velocities (44 +/- 11 vs. 58 +/- 11 cm/s, p less than 0.01), larger atrial filling fraction (45 +/- 4% vs. 38 +/- 4%, p less than 0.001), lower ratio of early to late transmitral filling velocities (0.6 +/- 0.08 vs. 0.99 +/- 0.18, p less than 0.001) and a longer isovolumetric relaxation period (114 +/- 12 vs. 90 +/- 6 ms, p less than 0.001) compared with group 2 patients and control subjects.(ABSTRACT TRUNCATED AT 250 WORDS)

MRI-Based Measurement of Brain Stem Cross-Sectional Area in Relapsing-Remitting Multiple Sclerosis.

PubMed

Chivers, Tomos R; Constantinescu, Cris S; Tench, Christopher R

2015-01-01

To determine if patients with relapsing-remitting multiple sclerosis (RRMS) have a reduced brain stem cross-sectional area (CSA) compared to age- and sex-matched controls. The brain stem is a common site of involvement in MS. However, relatively few imaging studies have investigated brain stem atrophy. Brain magnetic resonance imaging (MRI) was performed on patients and controls using a 1.5T MRI scanner with a quadrature head coil. Three-dimensional magnetization-prepared rapid acquisition gradient-echo (MPRAGE) images with 128 contiguous slices, covering the whole brain and brain stem and a T2-weighted image with 3 mm transverse contiguous images were acquired. We measured the brain stem CSA at three sites, the midbrain, the pons, and the medulla oblongata in 35 RRMS patients and 35 controls using a semiautomated algorithm. CSA readings were normalized using the total external cranial volume to reduce normal population variance and increase statistical power. A significant CSA reduction was found in the midbrain (P ≤ .001), pons (P ≤ .001), and the medulla oblongata (P = .047) postnormalization. A CSA reduction of 9.3% was found in the midbrain, 8.7% in the pons, and 6.5% in the medulla oblongata. A significantly reduced, normalized brain stem CSA was detected in all areas of the brain stem of the RRMS patients, when compared to age- and gender-matched controls. Lack of detectable upper cervical cord atrophy in the same patients suggests some independence of the MS pathology in these regions. Copyright © 2015 by the American Society of Neuroimaging.

Health-related quality of life in fibromyalgia and refractory angina pectoris: a comparison between two chronic non-malignant pain disorders.

PubMed

Andréll, Paulin; Schultz, Tomas; Mannerkorpi, Kaisa; Nordeman, Lena; Börjesson, Mats; Mannheimer, Clas

2014-04-01

To compare health-related quality of life in 2 different populations with chronic pain: patients with fibromyalgia and patients with refractory angina pectoris. Previous separate studies have indicated that these patient groups report different impacts of pain on health-related quality of life. The Short-Form 36 was used to assess health- related quality of life. In order to adjust for age and gender differences between the groups, both patient groups were compared with age- and gender-matched normative controls. The difference in health-related quality of life between the 2 patient groups was assessed by transforming the Short-Form 36 subscale scores to a z-score. The patients with fibromyalgia (n = 203) reported poorer health-related quality of life in all the subscale scores of Short-Form 36 (p < 0.05-0.0001) than the patients with refractory angina (n = 146) when both groups were compared with their corresponding normal population (z-score). Patients with fibromyalgia experience greater impairment in health-related quality of life compared with the normal population than do patients with refractory angina pectoris, despite the fact that the latter have a potentially life-threatening disease. The great impairment in health- related quality of life in patients with fibromyalgia should be taken into consideration when planning rehabilitation.

Gender differences of airway dimensions in anatomically matched sites on CT in smokers.

PubMed

Kim, Yu-Il; Schroeder, Joyce; Lynch, David; Newell, John; Make, Barry; Friedlander, Adam; Estépar, Raúl San José; Hanania, Nicola A; Washko, George; Murphy, James R; Wilson, Carla; Hokanson, John E; Zach, Jordan; Butterfield, Kiel; Bowler, Russell P; Copdgene Investigators

2011-08-01

There are limited data on, and controversies regarding gender differences in the airway dimensions of smokers. Multi-detector CT (MDCT) images were analyzed to examine whether gender could explain differences in airway dimensions of anatomically matched airways in smokers. We used VIDA imaging software to analyze MDCT scans from 2047 smokers (M:F, 1021:1026) from the COPDGene® cohort. The airway dimensions were analyzed from segmental to subsubsegmental bronchi. We compared the differences of luminal area, inner diameter, wall thickness, wall area percentage (WA%) for each airway between men and women, and multiple linear regression including covariates (age, gender, body sizes, and other relevant confounding factors) was used to determine the predictors of each airway dimensions. Lumen area, internal diameter and wall thickness were smaller for women than men in all measured airway (18.4 vs 22.5 mm(2) for segmental bronchial lumen area, 10.4 vs 12.5 mm(2) for subsegmental bronchi, 6.5 vs 7.7 mm(2) for subsubsegmental bronchi, respectively p < 0.001). However, women had greater WA% in subsegmental and subsubsegmental bronchi. In multivariate regression, gender remained one of the most significant predictors of WA%, lumen area, inner diameter and wall thickness. Women smokers have higher WA%, but lower luminal area, internal diameter and airway thickness in anatomically matched airways as measured by CT scan than do male smokers. This difference may explain, in part, gender differences in the prevalence of COPD and airflow limitation.

Girls (and Boys) Just Want to Have Fun: A Mixed-Methods Examination of the Role of Gender in Youth Mentoring Relationship Duration and Quality.

PubMed

Spencer, Renée; Drew, Alison L; Walsh, Jill; Kanchewa, Stella S

2018-02-01

This prospective, mixed-methods study examined the role of gender in youth mentoring relationship duration and quality. Participants were 67 gender-matched pairs of adult mentors and youth participating in community-based mentoring programs as well as the youths' guardians. Mentors and youth completed surveys and qualitative interviews at multiple time points. At baseline, male youth reported stronger relationships with their guardians. Analysis of the survey data from the 3-month follow-up revealed that male mentors and youth reported stronger mentoring relationship quality. Male matches were more likely to last at least 1 year. Further, male youth whose matches lasted at least 1 year reported better relationships with their guardians at baseline and reported stronger mentoring relationships after 3 months, compared to both females whose matches lasted greater than a year, and females whose matches lasted less than 1 year. Examinations of the qualitative interviews from a sub-sample of matched pairs (n = 29) showed that male and female youth and male mentors held similar expectations for the relationship, mainly to engage in fun activities, while female mentors were more often looking for a close relationship to develop quickly, which resulted in a disconnect between female mentees' and female mentors' expectations. Findings highlight the importance of developmentally appropriate relationships for youth and suggest that mentoring programs may be able facilitate longer, more effective matches for girls by tempering female mentors' expectations for how close and quickly those relationships will develop.

On the Assessment of Grammatical Gender Knowledge in Aphasia: The Danger of Relying on Explicit Metalinguistic Tasks.

ERIC Educational Resources Information Center

Scarna, Antonina; Ellis, Andrew W.

2002-01-01

Studied a bilingual Italian-English aphasic patient who was very poor in categorizing Italian nouns for grammatical gender in explicit metalinguistic tasks, and was at chance when gender could not be inferred from the word's phonology. However, he showed a good ability to modify adjectives to match the gender of nouns in a task that involved…

Association of Apical Longitudinal Rotation with Right Ventricular Performance in Patients with Pulmonary Hypertension: Insights into Overestimation of Tricuspid Annular Plane Systolic Excursion.

PubMed

Motoji, Yoshiki; Tanaka, Hidekazu; Fukuda, Yuko; Sano, Hiroyuki; Ryo, Keiko; Sawa, Takuma; Miyoshi, Tatsuya; Imanishi, Junichi; Mochizuki, Yasuhide; Tatsumi, Kazuhiro; Matsumoto, Kensuke; Emoto, Noriaki; Hirata, Ken-ichi

2016-02-01

Current guidelines recommend the routine use of tricuspid annular plane systolic excursion (TAPSE) as a simple method for estimating right ventricular (RV) function. However, when ventricular apical longitudinal rotation (apical-LR) occurs in pulmonary hypertension (PH) patients, it may result in overestimated TAPSE. We studied 105 patients with PH defined as mean pulmonary artery pressure >25 mmHg at rest measured by right heart cardiac catheterization. TAPSE was defined as the maximum displacement during systole in the RV-focused apical four-chamber view. RV free-wall longitudinal speckle tracking strain (RV-free) was calculated by averaging 3 regional peak systolic strains. The apical-LR was measured at the peak rotation in the apical region including both left and right ventricle. The eccentricity index (EI) was defined as the ratio of the length of 2 perpendicular minor-axis diameters, one of which bisected and was perpendicular to the interventricular septum, and was obtained at end-systole (EI-sys) and end-diastole (EI-dia). Twenty age-, gender-, and left ventricular ejection fraction-matched normal controls were studied for comparison. The apical-LR in PH patients was significantly lower than that in normal controls (-3.4 ± 2.7° vs. -1.3 ± 1.9°, P = 0.001). Simple linear regression analysis showed that gender, TAPSE, EI-sys, and EI-dia/EI-sys were associated with apical-LR, but RV-free was not. Multiple regression analysis demonstrated that gender, EI-dia/EI-sys, and TAPSE were independent determinants of apical-LR. TAPSE may be overestimated in PH patients with clockwise rotation resulting from left ventricular compression. TAPSE should thus be evaluated carefully in PH patients with marked apical rotation. © 2015, Wiley Periodicals, Inc.

Sun-induced changes of stratum corneum hydration vary with age and gender in a normal Chinese population.

PubMed

Liu, Zhili; Song, Shunpeng; Luo, Wenhai; Elias, Peter M; Man, Mao-Qiang

2012-02-01

Previous studies have demonstrated that sun-induced alteration of epidermal permeability barrier function varies with gender and age. In the present study, we assess the stratum corneum (SC) hydration in sun-exposed males and females. A total of 168 subjects (84 males and 84 females) aged 19-75 years were enrolled. A multifunctional skin physiology monitor was used to measure SC hydration. In comparison with non-sun exposure, sun exposure does not cause a significant change in SC hydration in either young males or young females, whereas in aged females, a significant reduction of SC hydration is seen on the forehead and the dorsal hand of sun-exposed subjects. SC hydration on the canthus of both aged males and aged females is significantly lower than that of young subjects. Additionally, SC hydration on the dorsal hand of aged females is also significantly lower as compared with young females. Sun-induced reduction of SC hydration is more evident on the dorsal hand of aged females than that of males (P<0.001). Moreover, the SC rehydration capacity is significantly lower in sun-exposed aged females than in age-matched males. These results demonstrated that sun-induced changes of the SC hydration property vary with age and gender. © 2011 John Wiley & Sons A/S.

Granulopoietic Growth Factor Secretion in Ovarian Carcinoma as a Mechanism for the Emergence of Immune Suppressive Myeloid Subsets

DTIC Science & Technology

2014-08-01

levels will be determined and tracked biweekly during the course of tumor growth. Age/ gender -matched non-tumor-bearing mice will serve as controls for...parameter flow cytometry, we compared 21 ovarian cancer patients reflecting stages II - IV to 22 gender - race- and age-matched controls. All patient...Sitkovsky, M. A2A adenosine receptors protect tumors from anti- tumor T cells. (*equal authorship ) Proc. Natl. Acad. Sci. USA 103: 13132-13137, 2006

Detection of Gender-Based Differential Item Functioning in a Mathematics Performance Assessment.

ERIC Educational Resources Information Center

Wang, Ning; Lane, Suzanne

This study used three different differential item functioning (DIF) procedures to examine the extent to which items in a mathematics performance assessment functioned differently for matched gender groups. In addition to examining the appropriateness of individual items in terms of DIF with respect to gender, an attempt was made to identify…

Do Birth Order, Family Size and Gender Affect Arithmetic Achievement in Elementary School?

ERIC Educational Resources Information Center

Desoete, Annemie

2008-01-01

Introduction: For decades birth order and gender differences have attracted research attention. Method: Birth order, family size and gender, and the relationship with arithmetic achievement is studied among 1152 elementary school children (540 girls, 612 boys) in Flanders. Children were matched on socioeconomic status of the parents and…

Using rule-based natural language processing to improve disease normalization in biomedical text.

PubMed

Kang, Ning; Singh, Bharat; Afzal, Zubair; van Mulligen, Erik M; Kors, Jan A

2013-01-01

In order for computers to extract useful information from unstructured text, a concept normalization system is needed to link relevant concepts in a text to sources that contain further information about the concept. Popular concept normalization tools in the biomedical field are dictionary-based. In this study we investigate the usefulness of natural language processing (NLP) as an adjunct to dictionary-based concept normalization. We compared the performance of two biomedical concept normalization systems, MetaMap and Peregrine, on the Arizona Disease Corpus, with and without the use of a rule-based NLP module. Performance was assessed for exact and inexact boundary matching of the system annotations with those of the gold standard and for concept identifier matching. Without the NLP module, MetaMap and Peregrine attained F-scores of 61.0% and 63.9%, respectively, for exact boundary matching, and 55.1% and 56.9% for concept identifier matching. With the aid of the NLP module, the F-scores of MetaMap and Peregrine improved to 73.3% and 78.0% for boundary matching, and to 66.2% and 69.8% for concept identifier matching. For inexact boundary matching, performances further increased to 85.5% and 85.4%, and to 73.6% and 73.3% for concept identifier matching. We have shown the added value of NLP for the recognition and normalization of diseases with MetaMap and Peregrine. The NLP module is general and can be applied in combination with any concept normalization system. Whether its use for concept types other than disease is equally advantageous remains to be investigated.

Individual differences in the processing of referential dependencies: Evidence from event-related potentials.

PubMed

Fiorentino, Robert; Covey, Lauren; Gabriele, Alison

2018-04-23

The present study examines the processing of referential ambiguity and referential failure using event-related potentials (ERPs). Participants read sentences with pronouns (he, she) which contained either one, two, or no potential gender-matching antecedents. Participants also took tests of working memory (Count Span/Reading Span) and attentional control (Number Stroop). In contexts of referential ambiguity with two potential gender-matching antecedents, two different responder types emerged, with some participants yielding a sustained negativity (Nref) and others a sustained positivity. For individuals who elicited Nref, the size of the effect was related to working memory such that higher Count Span scores were related to a larger Nref. For individuals who elicited a positivity, the effect was marginally related to attentional control such that better performance on the Stroop was related to a less positive, or increasingly negative-going ERP effect. Contexts of referential failure, with no gender-matching antecedents, yielded P600 for all participants, suggesting that participants may treat the failure of the pronoun to agree in gender with the antecedents as a violation despite the absence of an explicit acceptability judgment task. Copyright © 2018 Elsevier B.V. All rights reserved.

Everyday physical activity and adiposity in Prader-Willi syndrome.

PubMed

van den Berg-Emons, Rita; Festen, Dederieke; Hokken-Koelega, Anita; Bussmann, Johannes; Stam, Henk

2008-11-01

The aim of this study was to assess the impact of Prader-Willi syndrome (PWS) on the level of everyday physical activity and to explore whether the activity level is related to adiposity. Measurements were performed with an accelerometry-based Activity Monitor during two consecutive schooldays in 12 children with PWS (7-16 years of age) and in 12 age- and gender-matched, healthy children. Adiposity was assessed by body mass index standard deviation scores and by percentage body fat (dual energy X-ray absorptiometry). Mean duration of dynamic activities (expressed as percentage of 24 h) was lower in children with PWS than in the comparison group (8.7 [2.5]% and 12.0 [3.1]%, respectively; p = 0.01). Six children with PWS had normal activity levels. Physical activity level was not related to adiposity. The results indicate that, as a group, children with PWS have an inactive lifestyle. However, children with PWS cannot be stereotyped as inactive since half of them had normal activity levels.

Adverse Effects of Sporadic Dialysis on Body Composition.

PubMed

Workeneh, Biruh; Shypailo, Roman; DeCastro, Iris; Shah, Maulin; Guffey, Danielle; Minard, Charles G; Mitch, William E

2015-01-01

The aim of this study is to analyze the body composition of patients receiving emergent dialysis and compare their body cell mass (BCM) and fat-free mass (FFM) with those of normal subjects. The care of patients receiving sporadic, emergent dialysis treatment is a growing public health concern and the magnitude of muscle wasting that occurs in this population is not known. We used a cross-sectional design with matching to determine differences in total body potassium--an indicator of both BCM and FFM--between emergent dialysis patients and healthy normal subjects. We studied 22 subjects using a 40K counter that measures BCM and FFM and compared them to controls after matching with sex, height and weight. In the matched comparison, BCM and FFM were significantly lower in subjects with end-stage renal disease (ESRD). Unadjusted BCM was 4.7 kg lower and FFM was 8.8 kg lower for those with ESRD compared to those without ESRD (p < 0.001, p < 0.001, respectively). Comparison with unmatched controls who underwent 40K analysis also revealed significantly lower BCM (4.1 kg) and FFM (7.7 kg) in the ESRD subjects (p = 0.004). After adjusting for age, height, weight and gender, BCM and FFM were lower by 4.2 and 7.8 kg, respectively (p < 0.001). Repeated observations were available for a subset of ESRD subjects, and the rate of FFM loss over time was significant, with the ESRD subjects demonstrating 2.2 kg per year decline (p = 0.01). We conclude that among other consequences, muscle wasting indicated by decline in BCM and FFM is a significant concern in the growing emergent dialysis population. © 2015 S. Karger AG, Basel.

MRI-based comparative study of different mild cognitive impairment subtypes: protocol for an observational case-control study.

PubMed

Yu, Yang; Zhao, Weina; Li, Siou; Yin, Changhao

2017-03-08

Amnestic mild cognitive impairment (aMCI) and vascular mild cognitive impairment (VaMCI) comprise the 2 main types of mild cognitive impairment (MCI). The first condition generally progresses to Alzheimer's disease, whereas the second is likely to develop into vascular dementia (VD). The brain structure and function of patients with MCI differ from those of normal elderly individuals. However, whether brain structures or functions differ between these 2 MCI subtypes has not been studied. This study is designed to analyse neuroimages of brain in patients with VaMCI and aMCI using multimodality MRI (structural MRI (sMRI), functional MRI and diffusion tensor imaging (DTI)). In this study, 80 participants diagnosed with aMCI, 80 participants diagnosed with VaMCI, and 80 age-matched, gender-matched and education-matched normal controls (NCs) will be recruited to the Hongqi Hospital of Mudanjiang Medical University, Heilongjiang, China. All participants will undergo neuroimaging and neuropsychological evaluations. The primary outcome measures will be (1) microstructural alterations revealed by multimodal MRIs, including sMRI, resting-state functional MRI and DTI; and (2) a neuropsychological evaluation, including the Mini-Mental State Examination (MMSE), Montreal Cognitive Assessment (MoCA), Auditory Verbal Learning Test (AVLT), Memory and Executive Screening (MES), trail making test, Stroop colour naming condition and Clinical Dementia Rating (CDR) scale, to evaluate global cognition, memory function, attention, visuospatial skills, processing speed, executive function and emotion, respectively. NCT02706210; Pre-results. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

History of Illicit Stimulant Use Is Not Associated with Long-Lasting Changes in Learning of Fine Motor Skills in Humans

PubMed Central

Todd, Gabrielle; Pearson-Dennett, Verity; Flavel, Stanley C.; Haberfield, Miranda; Edwards, Hannah; White, Jason M.

2016-01-01

Little is known about the long-lasting effect of use of illicit stimulant drugs on learning of new motor skills. We hypothesised that abstinent individuals with a history of primarily methamphetamine and ecstasy use would exhibit normal learning of a visuomotor tracking task compared to controls. The study involved three groups: abstinent stimulant users (n = 21; 27 ± 6 yrs) and two gender-matched control groups comprising nondrug users (n = 16; 22 ± 4 yrs) and cannabis users (n = 16; 23 ± 5 yrs). Motor learning was assessed with a three-minute visuomotor tracking task. Subjects were instructed to follow a moving target on a computer screen with movement of the index finger. Metacarpophalangeal joint angle and first dorsal interosseous electromyographic activity were recorded. Pattern matching was assessed by cross-correlation of the joint angle and target traces. Distance from the target (tracking error) was also calculated. Motor learning was evident in the visuomotor task. Pattern matching improved over time (cross-correlation coefficient) and tracking error decreased. However, task performance did not differ between the groups. The results suggest that learning of a new fine visuomotor skill is unchanged in individuals with a history of illicit stimulant use. PMID:26819778

History of Illicit Stimulant Use Is Not Associated with Long-Lasting Changes in Learning of Fine Motor Skills in Humans.

PubMed

Todd, Gabrielle; Pearson-Dennett, Verity; Flavel, Stanley C; Haberfield, Miranda; Edwards, Hannah; White, Jason M

2016-01-01

Little is known about the long-lasting effect of use of illicit stimulant drugs on learning of new motor skills. We hypothesised that abstinent individuals with a history of primarily methamphetamine and ecstasy use would exhibit normal learning of a visuomotor tracking task compared to controls. The study involved three groups: abstinent stimulant users (n = 21; 27 ± 6 yrs) and two gender-matched control groups comprising nondrug users (n = 16; 22 ± 4 yrs) and cannabis users (n = 16; 23 ± 5 yrs). Motor learning was assessed with a three-minute visuomotor tracking task. Subjects were instructed to follow a moving target on a computer screen with movement of the index finger. Metacarpophalangeal joint angle and first dorsal interosseous electromyographic activity were recorded. Pattern matching was assessed by cross-correlation of the joint angle and target traces. Distance from the target (tracking error) was also calculated. Motor learning was evident in the visuomotor task. Pattern matching improved over time (cross-correlation coefficient) and tracking error decreased. However, task performance did not differ between the groups. The results suggest that learning of a new fine visuomotor skill is unchanged in individuals with a history of illicit stimulant use.

Gender differences in brain development in Chinese children and adolescents: a structural MRI study

NASA Astrophysics Data System (ADS)

Guo, Xiaojuan; Jin, Zhen; Chen, Kewei; Peng, Danling; Yao, Li

2008-03-01

Using optimized voxel-based morphometry (VBM), this study systematically investigated gender differences in brain development through magnetic resonance imaging (MRI) data in 158 Chinese normal children and adolescents aged 7.26 to 22.80 years (mean age 15.03+/-4.70 years, 78 boys and 80 girls). Gender groups were matched for measures of age, handedness, education level. The customized brain templates, including T I-weighted image and gray matter (GM)/white matter (WM)/cerebro-spinal fluid (CSF) prior probability maps, were created from all participants. Results showed that the total intracranial volume (TIV), global absolute GM and global WM volume in girls were significantly smaller than those in boys. The hippocampus grew faster in girls than that in boys, but the amygdala grew faster in boys than that in girls. The rate of regional GM decreases with age was steeper in the left superior parietal lobule, bilateral inferior parietal lobule, left precuneus, and bilateral supramarginal gyrus in boys compared to girls, which was possibly related to better spatial processing ability in boys. Regional GM volumes were greater in bilateral superior temporal gyrus, bilateral inferior frontal gyrus and bilateral middle frontal gyrus in girls. Regional WM volumes were greater in the left temporal lobe, right inferior parietal and bilateral middle frontal gyrus in girls. The gender differences in the temporal and frontal lobe maybe be related to better language ability in girls. These findings may aid in understanding the differences in cognitive function between boys and girls.

Ethnicity identification from face images

NASA Astrophysics Data System (ADS)

Lu, Xiaoguang; Jain, Anil K.

2004-08-01

Human facial images provide the demographic information, such as ethnicity and gender. Conversely, ethnicity and gender also play an important role in face-related applications. Image-based ethnicity identification problem is addressed in a machine learning framework. The Linear Discriminant Analysis (LDA) based scheme is presented for the two-class (Asian vs. non-Asian) ethnicity classification task. Multiscale analysis is applied to the input facial images. An ensemble framework, which integrates the LDA analysis for the input face images at different scales, is proposed to further improve the classification performance. The product rule is used as the combination strategy in the ensemble. Experimental results based on a face database containing 263 subjects (2,630 face images, with equal balance between the two classes) are promising, indicating that LDA and the proposed ensemble framework have sufficient discriminative power for the ethnicity classification problem. The normalized ethnicity classification scores can be helpful in the facial identity recognition. Useful as a "soft" biometric, face matching scores can be updated based on the output of ethnicity classification module. In other words, ethnicity classifier does not have to be perfect to be useful in practice.

Associated factors with attention deficit hyperactivity disorder (ADHD): a case-control study.

PubMed

Malek, Ayyoub; Amiri, Shahrokh; Sadegfard, Majid; Abdi, Salman; Amini, Saeedeh

2012-09-01

The current study attempted to investigate factors associated with attention deficit hyperactivity disorder (ADHD) in children without co-morbidities. In this case-control study, 164 ADHD children who attended the Child and Adolescent Psychiatric Clinics of Tabriz University of Medical Sciences, Iran were compared with 166 normal children selected in a random-cluster method from primary and secondary schools. Clinical interviews based on DSM-IV-TR using K-SADS were used to diagnose ADHD cases and to select the control group. Participants were matched for age. We used chi-square and binary logistic regression for data analysis. Among the associated factors with ADHD were gender and maternal employment. Boys (OR 0.54; 95% confidence interval: 0.34 - 0.86) and those children with working mothers (OR 0.16: 95% confidence interval: 0.06 - 0.86) suffered more from ADHD. The birth season, family size, birth order, and parental kinship were not among risk factors for ADHD. The results of the study show that maternal employment and male gender are among the associated risk factors for ADHD.

"Someone like Me Can Be Successful": Do College Students Need Same-Gender Role Models

ERIC Educational Resources Information Center

Lockwood, Penelope

2006-01-01

Two studies examined the extent to which matching on gender determines the impact of career role models on the self. Because women face negative stereotypes regarding their competence in the workplace, they may derive particular benefit from the example of an outstanding woman who illustrates the possibility of overcoming gender barriers to…

Detecting a Gender-Related Differential Item Functioning Using Transformed Item Difficulty

ERIC Educational Resources Information Center

Abedalaziz, Nabeel; Leng, Chin Hai; Alahmadi, Ahlam

2014-01-01

The purpose of the study was to examine gender differences in performance on multiple-choice mathematical ability test, administered within the context of high school graduation test that was designed to match eleventh grade curriculum. The transformed item difficulty (TID) was used to detect a gender related DIF. A random sample of 1400 eleventh…

Categorizing with Gender: Does Implicit Grammatical Gender Affect Semantic Processing in 24-Month-Old Toddlers?

ERIC Educational Resources Information Center

Bobb, Susan C.; Mani, Nivedita

2013-01-01

The current study investigated the interaction of implicit grammatical gender and semantic category knowledge during object identification. German-learning toddlers (24-month-olds) were presented with picture pairs and heard a noun (without a preceding article) labeling one of the pictures. Labels for target and distracter images either matched or…

The Extreme Male Brain Theory and Gender Role Behaviour in Persons with an Autism Spectrum Condition

ERIC Educational Resources Information Center

Stauder, J. E. A.; Cornet, L. J. M.; Ponds, R. W. H. M.

2011-01-01

According to the Extreme Male Brain theory persons with autism possess masculinised cognitive traits. In this study masculinisation of gender role behaviour is evaluated in 25 persons with an autism spectrum condition (ASC) and matched controls with gender role behaviour as part of a shortened version of the Minnesota Multiphasic Personality…

The effect of patient-centeredness and gender of professional role models on trainees' mentalization responses. Implications for film-aided education.

PubMed

Bálint, Katalin; Nagy, Tamás; Csabai, Márta

2014-10-01

To examine how certain characteristics of film-presented practitioner role-models influence trainees' mentalization. In an experimental setting, psychology students watched four film clips presenting a patient-practitioner session; the clips varied in the practitioner's patient-centeredness (positive vs. negative) and gender. Participants commented on the practitioner's thoughts, emotions and intentions through the session. Analysis of 116 comments focused on the effect of patient-centeredness and gender variables on mentalization and judgment utterances. Negative role-models and female role-models induced higher levels of mentalization compared to positive and male role-models. There was no gender difference in the level of mentalization; however male participants gave more judgmental responses than female participants. The patient-centeredness had a larger effect on mentalization when trainees described the opposite gender role-model. In a systematic comparison, students' capacity for mentalization differed according to role-models' patient-centeredness and gender, as well as the gender-match of students with role-models. When working with film-presented role-models, educators should be aware of the differences in the level of mentalization elicited by positive and male role-models, as opposed to negative and female role-models. Educators should also consider the gender-match between trainees and role-models, therefore students should be exposed to both cross- and same-gender role-models. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Changes in Cerebral Cortex of Children Treated for Medulloblastoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Arthur K.; Marcus, Karen J.; Department of Radiation Oncology, Dana Farber Cancer Institute, Harvard Medical School, Boston, MA

2007-07-15

Purpose: Children with medulloblastoma undergo surgery, radiotherapy, and chemotherapy. After treatment, these children have numerous structural abnormalities. Using high-resolution magnetic resonance imaging, we measured the thickness of the cerebral cortex in a group of medulloblastoma patients and a group of normally developing children. Methods and Materials: We obtained magnetic resonance imaging scans and measured the cortical thickness in 9 children after treatment of medulloblastoma. The measurements from these children were compared with the measurements from age- and gender-matched normally developing children previously scanned. For additional comparison, the pattern of thickness change was compared with the cortical thickness maps from amore » larger group of 65 normally developing children. Results: In the left hemisphere, relatively thinner cortex was found in the perirolandic region and the parieto-occipital lobe. In the right hemisphere, relatively thinner cortex was found in the parietal lobe, posterior superior temporal gyrus, and lateral temporal lobe. These regions of cortical thinning overlapped with the regions of cortex that undergo normal age-related thinning. Conclusion: The spatial distribution of cortical thinning suggested that the areas of cortex that are undergoing development are more sensitive to the effects of treatment of medulloblastoma. Such quantitative methods may improve our understanding of the biologic effects that treatment has on the cerebral development and their neuropsychological implications.« less

Match Duration and Number of Rallies in Men’s and Women’s 2000–2010 FIVB World Tour Beach Volleyball

PubMed Central

Palao, José Manuel; Valades, David; Ortega, Enrique

2012-01-01

After the 2000 Olympic Games, the Fédération Internationale de Volleyball (FIVB) modified the scoring system used in beach volleyball from side-out to a rally point system. The goal was to facilitate the comprehension of the game and to stabilize match duration. The purpose of this study was to assess the duration and number of rallies in men’s and women’s beach volleyball matches (2000–2010 FIVB World Tour). Data from 14,432 men’s matches and 14,175 women’s matches of the 2000–2010 World Tour were collected. The variables studied were: match duration, total rallies per set and match, number of sets, team that won the set and match, type of match (equality in score), and gender. The average match duration in beach volleyball is stable, ranging from 30 to 64 minutes, regardless of the number of sets, the stage of the tournament (qualifying round or main draw), or gender. The average number of rallies per match were 78–80 for two-set matches and 94–96 for three-set matches. Matches from the main draw are more balanced than matches from the qualifying round. More balanced matches (smaller point difference between teams) have longer durations. It is not clear why there is no relationship between the number of rallies and match duration. Future studies are needed to clarify this aspect. The results can serve as a reference to guide beach volleyball training (with regard to duration and number of rallies) and to help understand the effect of the rule change. PMID:23486703

Gender Differences of Airway Dimensions in Anatomically Matched Sites on CT in Smokers

PubMed Central

Kim, Yu-Il; Schroeder, Joyce; Lynch, David; Newell, John; Make, Barry; Friedlander, Adam; Estépar, Raúl San José; Hanania, Nicola A.; Washko, George; Murphy, James R.; Wilson, Carla; Hokanson, John E.; Zach, Jordan; Butterfield, Kiel; Bowler, Russell P.

2013-01-01

Rationale and Objectives There are limited data on, and controversies regarding gender differences in the airway dimensions of smokers. Multi-detector CT (MDCT) images were analyzed to examine whether gender could explain differences in airway dimensions of anatomically matched airways in smokers. Materials and Methods We used VIDA imaging software to analyze MDCT scans from 2047 smokers (M:F, 1021:1026) from the COPDGene® cohort. The airway dimensions were analyzed from segmental to subsubsegmental bronchi. We compared the differences of luminal area, inner diameter, wall thickness, wall area percentage (WA%) for each airway between men and women, and multiple linear regression including covariates (age, gender, body sizes, and other relevant confounding factors) was used to determine the predictors of each airway dimensions. Results Lumen area, internal diameter and wall thickness were smaller for women than men in all measured airway (18.4 vs 22.5 mm2 for segmental bronchial lumen area, 10.4 vs 12.5 mm2 for subsegmental bronchi, 6.5 vs 7.7 mm2 for subsubsegmental bronchi, respectively p < 0.001). However, women had greater WA% in subsegmental and subsubsegmental bronchi. In multivariate regression, gender remained one of the most significant predictors of WA%, lumen area, inner diameter and wall thickness. Conclusion Women smokers have higher WA%, but lower luminal area, internal diameter and airway thickness in anatomically matched airways as measured by CT scan than do male smokers. This difference may explain, in part, gender differences in the prevalence of COPD and airflow limitation. PMID:21756032

Semantically Transparent and Opaque Compounds in German Noun-Phrase Production: Evidence for Morphemes in Speaking.

PubMed

Lorenz, Antje; Zwitserlood, Pienie

2016-01-01

This study examines the lexical representation and processing of noun-noun compounds and their grammatical gender during speech production in German, a language that codes for grammatical gender (masculine, feminine, and neuter). Using a picture-word interference paradigm, participants produced determiner-compound noun phrases in response to pictures, while ignoring written distractor words. Compound targets were either semantically transparent (e.g., birdhouse) or opaque (e.g., hotdog), and their constituent nouns either had the same or a different gender (internal gender match). Effects of gender-congruent but otherwise unrelated distractor nouns, and of two morphologically related distractors corresponding to the first or second constituent were assessed relative to a completely unrelated, gender-incongruent distractor baseline. Both constituent distractors strongly facilitated compound naming, and these effects were independent of the targets' semantic transparency. This supports retrieval of constituent morphemes for semantically transparent and opaque compounds during speech production. Furthermore, gender congruency between compounds and distractors did not speed up naming in general, but interacted with gender match of the compounds' constituent nouns, and their semantic transparency. A significant gender-congruency effect was obtained with semantically transparent compounds, consisting of two constituent nouns of the same gender, only. In principle, this pattern is compatible with a multiple lemma representation account for semantically transparent, but not for opaque compounds. The data also fit with a more parsimonious, holistic representation for all compounds at the lemma level, when differences in co-activation patterns for semantically transparent and opaque compounds are considered.

The Pitch-Matching Ability of High School Choral Students: A Justification for Continued Direct Instruction

ERIC Educational Resources Information Center

Riegle, Aaron M.; Gerrity, Kevin W.

2011-01-01

The purpose of this study was to determine the pitch-matching ability of high school choral students. Years of piano experience, middle school performance experience, and model were considered as variables that might affect pitch-matching ability. Gender of participants was also considered when identifying the effectiveness of each model.…

Toothguide Trainer tests with color vision deficiency simulation monitor.

PubMed

Borbély, Judit; Varsányi, Balázs; Fejérdy, Pál; Hermann, Péter; Jakstat, Holger A

2010-01-01

The aim of this study was to evaluate whether simulated severe red and green color vision deficiency (CVD) influenced color matching results and to investigate whether training with Toothguide Trainer (TT) computer program enabled better color matching results. A total of 31 color normal dental students participated in the study. Every participant had to pass the Ishihara Test. Participants with a red/green color vision deficiency were excluded. A lecture on tooth color matching was given, and individual training with TT was performed. To measure the individual tooth color matching results in normal and color deficient display modes, the TT final exam was displayed on a calibrated monitor that served as a hardware-based method of simulating protanopy and deuteranopy. Data from the TT final exams were collected in normal and in severe red and green CVD-simulating monitor display modes. Color difference values for each participant in each display mode were computed (∑ΔE(ab)(*)), and the respective means and standard deviations were calculated. The Student's t-test was used in statistical evaluation. Participants made larger ΔE(ab)(*) errors in severe color vision deficient display modes than in the normal monitor mode. TT tests showed significant (p<0.05) difference in the tooth color matching results of severe green color vision deficiency simulation mode compared to normal vision mode. Students' shade matching results were significantly better after training (p=0.009). Computer-simulated severe color vision deficiency mode resulted in significantly worse color matching quality compared to normal color vision mode. Toothguide Trainer computer program improved color matching results. Copyright © 2010 Elsevier Ltd. All rights reserved.

The Effect of Tinnitus on Listening Effort in Normal-Hearing Young Adults: A Preliminary Study.

PubMed

Degeest, Sofie; Keppler, Hannah; Corthals, Paul

2017-04-14

The objective of this study was to investigate the effect of chronic tinnitus on listening effort. Thirteen normal-hearing young adults with chronic tinnitus were matched with a control group for age, gender, hearing thresholds, and educational level. A dual-task paradigm was used to evaluate listening effort in different listening conditions. A primary speech-recognition task and a secondary memory task were performed both separately and simultaneously. Furthermore, subjective listening effort was questioned for various listening situations. The Tinnitus Handicap Inventory was used to control for tinnitus handicap. Listening effort significantly increased in the tinnitus group across listening conditions. There was no significant difference in listening effort between listening conditions, nor was there an interaction between groups and listening conditions. Subjective listening effort did not significantly differ between both groups. This study is a first exploration of listening effort in normal-hearing participants with chronic tinnitus showing that listening effort is increased as compared with a control group. There is a need to further investigate the cognitive functions important for speech understanding and their possible relation with the presence of tinnitus and listening effort.

Unequal depression for equal work? How the wage gap explains gendered disparities in mood disorders.

PubMed

Platt, Jonathan; Prins, Seth; Bates, Lisa; Keyes, Katherine

2016-01-01

Mood disorders, such as depression and anxiety, are more prevalent among women than men. This disparity may be partially due to the effects of structural gender discrimination in the work force, which acts to perpetuate gender differences in opportunities and resources and may manifest as the gender wage gap. We sought to quantify and operationalize the wage gap in order to explain the gender disparity in depression and anxiety disorders, using data from a 2001-2002 US nationally representative survey of 22,581 working adults ages 30-65. Using established Oaxaca-Blinder decomposition methods to account for gender differences in individual-level productivity, our models reduced the wage gap in our sample by 13.5%, from 54% of men's pay to 67.5% of men's pay. We created a propensity-score matched sample of productivity indicators to test if the direction of the wage gap moderated the effects of gender on depression or anxiety. Where female income was less than the matched male counterpart, odds of both disorders were significantly higher among women versus men (major depressive disorder OR: 2.43, 95% CI: 1.95-3.04; generalized anxiety disorder OR: 4.11, 95% CI: 2.80-6.02). Where female income was greater than the matched male, the higher odds ratios for women for both disorders were significantly attenuated (Major Depressive Disorder OR: 1.20; 95% CI: 0.96-1.52) (Generalized Anxiety Disorder OR: 1.5; 95% CI: 1.04-2.29). The test for effect modification by sex and wage gap direction was statistically significant for both disorders. Structural forms of discrimination may explain mental health disparities at the population level. Beyond prohibiting overt gender discrimination, policies must be created to address embedded inequalities in procedures surrounding labor markets and compensation in the workplace. Copyright © 2015 Elsevier Ltd. All rights reserved.

Unequal Depression for Equal Work? How the wage gap explains gendered disparities in mood disorders

PubMed Central

Platt, Jonathan; Prins, Seth; Bates, Lisa; Keyes, Katherine

2016-01-01

Mood disorders, such as depression and anxiety, are more prevalent among women than men. This disparity may be partially due to the effects of structural gender discrimination in the work force, which acts to perpetuate gender differences in opportunities and resources and may manifest as the gender wage gap. We sought to quantify and operationalize the wage gap in order to explain the gender disparity in depression and anxiety disorders, using data from a 2001–2002 US nationally representative survey of 22,581 working adults ages 30–65. Using established Oaxaca-Blinder decomposition methods to account for gender differences in individual-level productivity, our models reduced the wage gap in our sample by 13.5%, from 54% of men’s pay to 67.5% of men’s pay. We created a propensity-score matched sample of productivity indicators to test if the direction of the wage gap moderated the effects of gender on depression or anxiety. Where female income was less than the matched male counterpart, odds of both disorders were significantly higher among women versus men (major depressive disorder OR: 2.43, 95% CI: 1.95–3.04; generalized anxiety disorder OR: 4.11, 95% CI: 2.80–6.02). Where female income was greater than the matched male, the higher odds ratios for women for both disorders were significantly attenuated (Major Depressive Disorder OR: 1.20; 95% CI: 0.96–1.52) (Generalized Anxiety Disorder OR: 1.5; 95% CI: 1.04–2.29). The test for effect modification by sex and wage gap direction was statistically significant for both disorders. Structural forms of discrimination may explain mental health disparities at the population level. Beyond prohibiting overt gender discrimination, policies must be created to address embedded inequalities in procedures surrounding labor markets and compensation in the workplace. PMID:26689629

Evaluation of Hypoxia Inducible Factor-1α and Glucose Transporter-1 Expression in Non Melanoma Skin Cancer: An Immunohistochemical Study

PubMed Central

Seleit, Iman; Bakry, Ola Ahmed; Ragab, Rania Abdel Aziz; Al-Shiemy, shimaa Ahmed

2017-01-01

Introduction Hypoxia Inducible Factor-1 (HIF-1) is a mediator enabling cell adaptation to hypoxia. It plays its role mainly through transcription of many target genes including Glucose Transporter-1 (GLUT-1) gene. Aim The present work aimed at evaluating the pattern and distribution of HIF-1α and GLUT-1 in each case and control. Materials and Methods A case-control and retrospective study was conducted on archival blocks diagnosed from pathology department as, Basal Cell Carcinoma (BCC, 20 cases), cutaneous Squamous Cell Carcinoma (SCC, 20 cases) and 20 normal site-matched skin biopsies from age and gender-matched healthy subjects as a control. Evaluation of both HIF-1α and GLUT1 expression using standard immunohistochemical techniques was performed on cut sections from selected paraffin embedded blocks. Results HIF-1α was expressed in 90%, 35% and 100% of normal skin, BCC and SCC tumour islands respectively. It was up regulated in both BCC and SCC compared with normal skin (p= 0.001, p<0.001 respectively). GLUT-1 was expressed in 100%, 70% and 100% of normal skin, BCC and SCC tumour islands respectively. It was down regulated in Non Melanoma Skin Cancer (NMSC) cases compared with normal skin (p=0.004). HIF-1α and GLUT-1 localization in tumour nests was central, peripheral or central and peripheral. Both HIF-1α and GLUT-1 showed variable expression in stroma, adnexa and inflammatory cells. No significant correlation was found between Histo (H) score or expression percentage values of HIF-1α and those of GLUT-1 in tumour islands or in overlying epidermis either in BCC or SCC. Conclusion HIF-1α may have a role in NMSC pathogenesis through adaptation to hypoxia which results from excessive proliferation. GLUT-1 down regulation in NMSC may be explained by its consumption by proliferating tumour cells. The expression of HIF-1α and GLUT-1 in normal epidermis, stromal and adnexal structures needs further research. PMID:28764171

Shoulder strength value differences between genders and age groups.

PubMed

Balcells-Diaz, Eudald; Daunis-I-Estadella, Pepus

2018-03-01

The strength of a normal shoulder differs according to gender and decreases with age. Therefore, the Constant score, which is a shoulder function measurement tool that allocates 25% of the final score to strength, differs from the absolute values but likely reflects a normal shoulder. To compare group results, a normalized Constant score is needed, and the first step to achieving normalization involves statistically establishing the gender differences and age-related decline. In this investigation, we sought to verify the gender difference and age-related decline in strength. We obtained a randomized representative sample of the general population in a small to medium-sized Spanish city. We then invited this population to participate in our study, and we measured their shoulder strength. We performed a statistical analysis with a power of 80% and a P value < .05. We observed a statistically significant difference between the genders and a statistically significant decline with age. To the best of our knowledge, this is the first investigation to study a representative sample of the general population from which conclusions can be drawn regarding Constant score normalization. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

Parental satisfaction in Ugandan children with cleft lip and palate following synchronous lip and palatal repair.

PubMed

Luyten, Anke; D'haeseleer, Evelien; Budolfsen, Dorte; Hodges, Andrew; Galiwango, George; Vermeersch, Hubert; Van Lierde, Kristiane

2013-01-01

The purpose of the present case control study was to assess parental satisfaction with speech and facial appearance in Ugandan children with complete unilateral or bilateral cleft lip and palate (CLP), who underwent a synchronous lip and palatal closure. The results are compared with an age- and gender-matched control group. The experimental group consisted of the parents or guardians of 44 Ugandan patients (21 males, 23 females) with complete unilateral or bilateral CLP (mean age: 3;1 years). The control group included the foster mothers of 44 orphan children matched by age and gender (mean age: 3;7 years). A survey based on the Cleft Evaluation Profile was used to assess the perceived satisfaction for individual features related to cleft care. Overall high levels of satisfaction were observed in the experimental group for all features (range: 56-100%). No significant differences could be established regarding age, gender, age of lip and palatal closure, cleft type or maternal vs. paternal judgments. In participants who were dissatisfied with the appearance of the lip, the time period between the cleft closure and the survey was significantly larger compared with satisfied participants. Furthermore, significantly lower levels of satisfaction were observed in the cleft group for speech and the appearance of the teeth and the nose compared with the control group. Satisfaction with speech and facial appearance in Ugandan children with cleft lip and/or palate is important since normal esthetics and speech predominantly determine the children's social acceptance in the Ugandan society. As a result of reading this manuscript, the reader will be able to explain the attitudes of parents toward the surgical repair of their children's cleft lip and palate. As a result of reading this manuscript, the reader will be able to identify differences in parental attitudes toward synchronous lip and palate repair. Copyright © 2013 Elsevier Inc. All rights reserved.

Gender Identity and Sex Role of Patients Operated on for Bladder Exstrophy-Epispadias.

PubMed

Taskinen, Seppo; Suominen, Janne S; Mattila, Aino K

2016-08-01

We evaluated whether genital deformity has an impact on gender identity and sex role in patients operated on for bladder exstrophy-epispadias complex. A total of 62 adolescents and adults operated on for bladder exstrophy-epispadias complex were mailed questionnaires evaluating gender identity (Gender Identity/Gender Dysphoria Questionnaire for Adolescents and Adults) and sex role (Bem Sex Role Inventory). Of the patients 33 responded and the results were compared with 99 gender matched controls. On the gender identity questionnaire female patients had median scores similar to those of their gender matched controls (4.93 vs 4.89, p = 0.412) but in males the score was lower compared to controls (4.87 vs 4.96, p = 0.023), indicating somewhat more conflicted gender identity. However, no patient had gender dysphoria. Female sex role index was higher in female patients vs controls (5.9 vs 5.3, p = 0.003) but was comparable between male patients and controls (5.2 vs 5.0, p = 0.459). Masculine sex role indices were comparable between female patients and controls as well as between male patients and controls. Of 32 patients 17 were considered to have androgynous sex role, as were 24 of 97 controls (p = 0.004). The exact diagnosis (bladder exstrophy or epispadias) or dissatisfaction with appearance of the genitals had no impact on gender identity or on sex role indices. Male patients had lower gender identity scores compared to controls and female sex role was enhanced among female patients. Androgynous sex role was more common in patients vs controls. Gender dysphoria was not noted in any patient. Copyright © 2016 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Low HDL-cholesterol among normal weight, normoglycemic offspring of individuals with type 2 diabetes mellitus.

PubMed

Praveen, Edavan P; Kulshreshtha, Bindu; Khurana, Madan L; Sahoo, Jayaprakash; Gupta, Nandita; Kumar, Guresh; Ammini, Ariachery; Knadgawat, Rajech

2011-01-01

Offspring of type 2 diabetics have an increased risk of dyslipidemia, glucose intolerance and obesity. The aim of this study was to assess the lipid levels in the offspring of diabetics with normal glucose tolerance and normal body weight. Normal weight offspring of patients with type 2 diabetes mellitus (DM) who had normal glucose tolerance, and healthy gender matched controls of comparable age without a family history of diabetes mellitus, were the subjects of this study. Lipid profiles were determined in cases and controls. The study included 114 subjects (64 males and 50 females) in each group, aged (mean ± SD) 24.0 ± 7.9 in cases and 24.1 ± 8.0 years in controls. The body mass index (BMI) was 20.8 ± 3.0 and 20.2 ± 3.1 kg/m2 in cases and controls, respectively. Serum total cholesterol, triglycerides, plasma glucose, fasting insulin, C-peptide and proinsulin levels were comparable in cases and controls. Serum high density lipoprotein (HDL) cholesterol was lower (p <0.001), whilst the serum triglyceride/HDL ratio, low density lipoprotein (LDL) cholesterol and area under the curve for insulin and proinsulin during an oral glucose tolerance test were higher in cases compared to controls. HDL cholesterol showed no significant correlation with plasma glucose, insulin or proinsulin. Plasma HDL cholesterol is low among normal weight, normoglycemic offspring of subjects with type 2 diabetes mellitus. The implications of this finding are not apparent.

Resolving Conflicts in Natural and Grammatical Gender Agreement: Evidence from Eye Movements.

PubMed

Dank, Maya; Deutsch, Avital; Bock, Kathryn

2015-08-01

The present research investigated the attraction phenomenon, which commonly occurs in the domain of production but is also apparent in comprehension. It particularly focused on its accessibility to conceptual influence, in analogy to previous findings in production in Hebrew (Deutsch and Dank, J Mem Lang, 60:112-143, 2009). The experiments made use of the contrast between grammatical and natural gender in Hebrew, using complex subject noun phrases containing head nouns and prepositional phrases with local nouns. Noun phrases were manipulated to produce (a) matches and mismatches in grammatical gender between heads and local nouns; and (b) inanimate nouns and animate nouns with natural gender that served either as head or as local nouns. These noun phrases were the subjects of sentences that ended with predicates agreeing in gender with the head noun, with the local noun, or both. The ungrammatical sentences were those in which the gender of the predicate and the head noun did not match. To assess the impact of conflicts in grammatical and natural gender on the time course of reading, participants' eye movements were monitored. The results revealed clear disruptions in reading the predicate due to grammatical-gender mismatches with head and local nouns, in analogy to attraction in production. When the head nouns conveyed natural gender these effects were amplified, but variations in the natural gender of local nouns had negligible consequences. The results imply that comprehension and production are similarly sensitive to the control of grammatical agreement by grammatical and natural gender in subject noun phrases.

Laparoscopic gastric bypass in patients on thyroid replacement therapy for subnormal thyroid function - prevalence and short-term outcome.

PubMed

Szomstein, Samuel; Avital, Shmuel; Brasesco, Oscar; Mehran, Amir; Cabral, Jose M; Rosenthal, Raul

2004-01-01

Hypothyroidism is associated with increased body weight. Weight gain may occur despite normal levels of serum thyroid stimulating hormone (TSH) and thyroxine (T4) achieved by replacement therapy. We evaluated the prevalence of patients on thyroid replacement for subnormal thyroid function who were operated on for morbid obesity and monitored their postoperative weight loss pattern. Data was identified from a prospectively accrued database of patients undergoing laparoscopic Roux-en-Y gastric bypass (LRYGBP) or laparoscopic adjustable gastric banding (LAGB) for morbid obesity from February 2000 to November 2001. All patients with subnormal thyroid function, diagnosed by past thyroid function tests and treated by an endocrinologist, who were on thyroid replacement therapy, were identified; 5 of these were matched for age, gender, preoperative body mass index (BMI) and surgical procedure (LRYGBP) to 5 non-hypothyroid patients. Weight loss at 3 and 9 months after surgery was compared between the 2 groups. 192 patients underwent LRYGBP (n=155) or LAGB (n=37). Of the 21 patients (10.9%) on thyroid replacement identified, 14 were primary, 4 were postablative, and 3 were post-surgical; 17 underwent LRYGBP. All patients had normal preoperative serum levels of TSH and T4. Comparison of the 2 matched groups of patients revealed no difference in weight loss at 3 and 9 months after surgery (P=1.0). The prevalence of euthyroid patients on thyroid replacement for subnormal thyroid function who undergo surgical intervention for morbid obesity is high. Short-term weight loss in these patients is comparable to normal thyroid patients. Longer follow-up may be necessary to demonstrate the weight loss pattern in this group.

Perception of Musical Emotion in the Students with Cognitive and Acquired Hearing Loss.

PubMed

Mazaheryazdi, Malihe; Aghasoleimani, Mina; Karimi, Maryam; Arjmand, Pirooz

2018-01-01

Hearing loss can affect the perception of emotional reaction to the music. The present study investigated whether the students with congenital hearing loss exposed to the deaf culture, percept the same emotion from the music as students with acquired hearing loss. Participants were divided into two groups; 30 students with bilaterally congenital moderate to severe hearing loss that were selected from deaf schools located in Tehran, Iran and 30 students with an acquired hearing loss with the same degree of hearing loss selected from Amiralam Hospital, Tehran, Iran and compared with the group of 30 age and gender-matched normal hearing subjects served our control in 2012. The musical stimuli consisted of three different sequences of music, (sadness, happiness, and fear) each with the duration of 60 sec. The students were asked to point to the lists of words that best matched with their emotions. Emotional perception of sadness, happiness, and fear in congenital hearing loss children was significantly poorly than acquired hearing loss and normal hearing group ( P <0.001). There was no significant difference in the emotional perception of sadness, happiness, and fear among the group of acquired hearing loss and normal hearing group ( P =0.75), ( P =1) and ( P =0.16) respectively. Neural plasticity induced by hearing assistant devises may be affected by the time when a hearing aid was first fitted and how the auditory system responds to the reintroduction of certain sounds via amplification. Therefore, children who experienced auditory input of different sound patterns in their early childhood will show more perceptual flexibility in different situations than the children with congenital hearing loss and Deaf culture.

Stimulus Equivalence, Generalization, and Contextual Stimulus Control in Verbal Classes

PubMed Central

Sigurðardóttir, Zuilma Gabriela; Mackay, Harry A; Green, Gina

2012-01-01

Stimulus generalization and contextual control affect the development of equivalence classes. Experiment 1 demonstrated primary stimulus generalization from the members of trained equivalence classes. Adults were taught to match six spoken Icelandic nouns and corresponding printed words and pictures to one another in computerized three-choice matching-to-sample tasks. Tests confirmed that six equivalence classes had formed. Without further training, plural forms of the stimuli were presented in tests for all matching performances. All participants demonstrated virtually errorless performances. In Experiment 2, classifications of the nouns used in Experiment 1 were brought under contextual control. Three nouns were feminine and three were masculine. The match-to-sample training taught participants to select a comparison of the same number as the sample (i.e., singular or plural) in the presence of contextual stimulus A regardless of noun gender. Concurrently, in the presence of contextual stimulus B, participants were taught to select a comparison of the same gender as the sample (i.e., feminine or masculine), regardless of number. Generalization was assessed using a card-sorting test. All participants eventually sorted the cards correctly into gender and number stimulus classes. When printed words used in training were replaced by their picture equivalents, participants demonstrated almost errorless performances. PMID:22754102

[The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

PubMed

Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J

2017-11-01

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1.92-8.79, P <0.001) in males and 1.73 (95% CI 0.80-3.76, P =0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.

Vision-related quality of life in patients with chronic central serous chorioretinopathy.

PubMed

Türkcü, Fatih Mehmet; Şahin, Alparslan; Bez, Yasin; Yüksel, Harun; Cinar, Yasin; Kürşat Cingü, Abdullah; Çaça, İhsan

2015-07-01

To evaluate vision-related quality of life in patients with chronic central serous chorioretinopathy (CSCR). Prospective, cross-sectional study. The interviewer-administered National Eye Institute visual function questionnaire (NEI-VFQ-25) was used in 30 adult consecutive patients with chronic CSCR patients. The controls were 30 gender- and age-matched people with normal visual function who came from the same socioeconomic and educational background as the participants. Patients with CSCR had statistically significant lower scores than controls for all the subscales, except for general health. In the study group, all subscale scores of vision-related quality of life, except general health, showed statistically significant negative correlations with the visual acuity. People with CSCR have worse vision-related quality of life than people without the condition.

Energy normalization of TV viewed optical correlation (automated correlation plane analyzer for an optical processor)

NASA Technical Reports Server (NTRS)

Grumet, A.

1981-01-01

An automatic correlation plane processor that can rapidly acquire, identify, and locate the autocorrelation outputs of a bank of multiple optical matched filters is described. The read-only memory (ROM) stored digital silhouette of each image associated with each matched filter allows TV video to be used to collect image energy to provide accurate normalization of autocorrelations. The resulting normalized autocorrelations are independent of the illumination of the matched input. Deviation from unity of a normalized correlation can be used as a confidence measure of correct image identification. Analog preprocessing circuits permit digital conversion and random access memory (RAM) storage of those video signals with the correct amplitude, pulse width, rising slope, and falling slope. TV synchronized addressing of 3 RAMs permits on-line storage of: (1) the maximum unnormalized amplitude, (2) the image x location, and (3) the image y location of the output of each of up to 99 matched filters. A fourth RAM stores all normalized correlations. A normalization approach, normalization for cross correlations, a system's description with block diagrams, and system's applications are discussed.

Relational Inequality: Gender Earnings Inequality in U.S. and Japanese Manufacturing Plants in the Early 1980s

ERIC Educational Resources Information Center

Avent-Holt, Dustin; Tomaskovic-Devey, Donald

2012-01-01

We examine the relational model of inequality using samples of employer-employee matched data from manufacturing plants in the United States and Japan. We argue that gender is a salient status characteristic in both the United States and Japan, but because of differences in gender politics, wage inequality will vary more across U.S. workplaces…

Correlations among Brain Gray Matter Volumes, Age, Gender, and Hemisphere in Healthy Individuals

PubMed Central

Taki, Yasuyuki; Thyreau, Benjamin; Kinomura, Shigeo; Sato, Kazunori; Goto, Ryoi; Kawashima, Ryuta; Fukuda, Hiroshi

2011-01-01

To determine the relationship between age and gray matter structure and how interactions between gender and hemisphere impact this relationship, we examined correlations between global or regional gray matter volume and age, including interactions of gender and hemisphere, using a general linear model with voxel-based and region-of-interest analyses. Brain magnetic resonance images were collected from 1460 healthy individuals aged 20–69 years; the images were linearly normalized and segmented and restored to native space for analysis of global gray matter volume. Linearly normalized images were then non-linearly normalized and smoothed for analysis of regional gray matter volume. Analysis of global gray matter volume revealed a significant negative correlation between gray matter ratio (gray matter volume divided by intracranial volume) and age in both genders, and a significant interaction effect of age × gender on the gray matter ratio. In analyzing regional gray matter volume, the gray matter volume of all regions showed significant main effects of age, and most regions, with the exception of several including the inferior parietal lobule, showed a significant age × gender interaction. Additionally, the inferior temporal gyrus showed a significant age × gender × hemisphere interaction. No regional volumes showed significant age × hemisphere interactions. Our study may contribute to clarifying the mechanism(s) of normal brain aging in each brain region. PMID:21818377

The role of spectral and temporal cues in voice gender discrimination by normal-hearing listeners and cochlear implant users.

PubMed

Fu, Qian-Jie; Chinchilla, Sherol; Galvin, John J

2004-09-01

The present study investigated the relative importance of temporal and spectral cues in voice gender discrimination and vowel recognition by normal-hearing subjects listening to an acoustic simulation of cochlear implant speech processing and by cochlear implant users. In the simulation, the number of speech processing channels ranged from 4 to 32, thereby varying the spectral resolution; the cutoff frequencies of the channels' envelope filters ranged from 20 to 320 Hz, thereby manipulating the available temporal cues. For normal-hearing subjects, results showed that both voice gender discrimination and vowel recognition scores improved as the number of spectral channels was increased. When only 4 spectral channels were available, voice gender discrimination significantly improved as the envelope filter cutoff frequency was increased from 20 to 320 Hz. For all spectral conditions, increasing the amount of temporal information had no significant effect on vowel recognition. Both voice gender discrimination and vowel recognition scores were highly variable among implant users. The performance of cochlear implant listeners was similar to that of normal-hearing subjects listening to comparable speech processing (4-8 spectral channels). The results suggest that both spectral and temporal cues contribute to voice gender discrimination and that temporal cues are especially important for cochlear implant users to identify the voice gender when there is reduced spectral resolution.

Shade matching performance of normal and color vision-deficient dental professionals with standard daylight and tungsten illuminants.

PubMed

Gokce, Hasan Suat; Piskin, Bulent; Ceyhan, Dogan; Gokce, Sila Mermut; Arisan, Volkan

2010-03-01

The lighting conditions of the environment and visual deficiencies such as red-green color vision deficiency affect the clinical shade matching performance of dental professionals. The purpose of this study was to evaluate the shade matching performance of normal and color vision-deficient dental professionals with standard daylight and tungsten illuminants. Two sets of porcelain disc replicas of 16 shade guide tabs (VITA Lumin) were manufactured to exact L*a*b* values by using a colorimeter. Then these twin porcelain discs (13 mm x 2.4 mm) were mixed up and placed into a color-matching cabinet that standardized the lighting conditions for the observation tests. Normal and red-green color vision-deficient dental professionals were asked to match the 32 porcelain discs using standard artificial daylight D65 (high color temperature) and tungsten filament lamp light (T) (low color temperature) illuminants. The results were analyzed by repeated-measures ANOVA and paired and independent samples t tests for the differences between dental professionals and differences between the illuminants (alpha=.05). Regarding the sum of the correct shade match scores of all observations with both illuminants, the difference between normal vision and red-green color vision-deficient dental professional groups was not statistically significant (F=4.132; P=.054). However, the correct shade match scores of each group were significantly different for each illuminant (P<.005). The correct shade matching scores of normal color vision dental professionals were significantly higher with D65 illuminant (t=7.004; P<.001). Color matching scores of red-green color vision-deficient dental professionals (approximately 5.7 more pairs than with D65) were significantly higher with T illuminant (t=5.977; P<.001). CONCLUSIONS.: Within the limitations of this study, the shade matching performance of dental professionals was affected by color vision deficiency and the color temperature of the illuminant. The color vision-deficient group was notably unsuccessful with the D65 illuminant in shade matching. In contrast, there was a significant increase in the shade matching performance of the color vision-deficient group with T illuminant. The lower color temperature illuminant dramatically decreased the normal color vision groups' correct shade matching score. (c) 2010 The Editorial Council of the Journal of Prosthetic Dentistry. Published by Mosby, Inc. All rights reserved.

Taxonomic Knowledge of Children with and without Cochlear Implants

ERIC Educational Resources Information Center

Lund, Emily; Dinsmoor, Jessica

2016-01-01

Purpose: The purpose of this study was to compare the taxonomic vocabulary knowledge and organization of children with cochlear implants to (a) children with normal hearing matched for age, and (b) children matched for vocabulary development. Method: Ten children with cochlear implants, 10 age-matched children with normal hearing, and 10…

Gender discrimination in the influence of hyperglycemia and hyperosmolarity on rat aortic tissue responses to insulin.

PubMed

Wong, Nikki L; Achike, Francis I

2010-08-09

Hyperglycaemia initiates endothelial dysfunction causing diabetic macro- and micro-vasculopathy, the main causes of morbidity and mortality in diabetes mellitus. The vasculopathy exhibits gender peculiarities. We therefore explored gender differences in comparing the effects of hyperglycaemia (50 mM) per se with its hyperosmolar (50 mM) effects on vascular tissue responses to insulin. Endothelium-intact or denuded thoracic aortic rings from age-matched male and female Sprague-Dawley rats were incubated for 10 min or 6 h (acute versus chronic exposure) in normal, hyperglycaemic or hyperosmolar Krebs solution. Relaxant responses to insulin (6.9x10(-7)-6.9x10(-5) M) of the phenylephrine-contracted tissues were recorded. Endothelium denudation in both genders inhibited relaxation to insulin in all conditions, more significantly in female than in male tissues, suggesting the female response to insulin is more endothelium-dependent than the male. Acutely and chronically exposed normoglycemic endothelium-intact or -denuded tissues responded similarly to insulin. Chronic hyperglycemic or hyperosmolar exposure did not alter the endothelium-denuded tissue responses to insulin, whereas the responses of the endothelium-intact male and female hyperosmolar, and male hyperglycemic tissues were enhanced. The results show that insulin exerts an endothelium-dependent and independent relaxation with the female tissue responses more endothelium-dependent than the male. The data also suggest that hyperosmolarity per se enhances aortic tissue relaxant responses to insulin whereas hyperglycemia per se inhibits the same and more so in female than male tissues. These effects are endothelium-dependent. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Examining Moderation Analyses in Propensity Score Methods: Application to Depression and Substance Use

PubMed Central

Green, Kerry M.; Stuart, Elizabeth A.

2014-01-01

Objective This study provides guidance on how propensity score methods can be combined with moderation analyses (i.e., effect modification) to examine subgroup differences in potential causal effects in non-experimental studies. As a motivating example, we focus on how depression may affect subsequent substance use differently for men and women. Method Using data from a longitudinal community cohort study (N=952) of urban African Americans with assessments in childhood, adolescence, young adulthood and midlife, we estimate the influence of depression by young adulthood on substance use outcomes in midlife, and whether that influence varies by gender. We illustrate and compare five different techniques for estimating subgroup effects using propensity score methods, including separate propensity score models and matching for men and women, a joint propensity score model for men and women with matching separately and together by gender, and a joint male/female propensity score model that includes theoretically important gender interactions with matching separately and together by gender. Results Analyses showed that estimating separate models for men and women yielded the best balance and, therefore, is a preferred technique when subgroup analyses are of interest, at least in this data. Results also showed substance use consequences of depression but no significant gender differences. Conclusions It is critical to prespecify subgroup effects before the estimation of propensity scores and to check balance within subgroups regardless of the type of propensity score model used. Results also suggest that depression may affect multiple substance use outcomes in midlife for both men and women relatively equally. PMID:24731233

Study design and baseline findings from the progression of ocular findings (PROOF) natural history study of dry eye.

PubMed

McDonnell, Peter J; Pflugfelder, Stephen C; Stern, Michael E; Hardten, David R; Conway, Taryn; Villanueva, Linda; Hollander, David A

2017-12-28

The aim of this research is to initiate a 5-year natural history study of dry eye disease (DED) using objectively assessed and patient-reported outcomes, to explore the hypothesis that DED is a progressive condition that has substantive and measurable impacts not only on the ocular surface, but on quality of life and visual functioning. Our objective for this report is to examine the baseline data. A multicenter, prospective, controlled, observational study of Level 2 (mild-to-moderate) DED patients based on International Task Force Delphi Panel severity grading, and controls, documented baseline measures (including tear film biomarkers and quality of life). Tear cytokine concentrations were also measured in the tear film. Patients were using artificial tears as needed. Two hundred seventeen DED patients and 67 gender- and age-matched controls were enrolled. A majority were females and Caucasian and groups did not differ significantly in terms of gender, race, or age. Differences between DED and matched controls, at baseline, included mean scores for Ocular Surface Disease Index (31.7 vs 4.1, P < 0.0001), Schirmer test (5.7 vs 15.3 mm, P < 0.0001), corneal staining (1.4 vs 0.2, P < 0.0001), conjunctival staining (1.4 vs 0.3, P < 0.0001), and tear break-up time (5.7 vs 8.5 s, P < 0.0001). Tear cytokines levels were determined and included interferon-γ, interleukin (IL)-1β, IL-2, IL-4, IL-6, IL-8, tumor necrosis factor-α, epidermal growth factor, IL-13, IL-17, IL-1α, and inducible protein-10. The mean levels of IL-8 and IL-6 were slightly higher in the DED group at baseline. Blurred vision was reported as moderate/severe/very severe at baseline in 57.6% of DED patients vs.10.5% of normal controls (P < 0.0001). DED patients reported greater reductions in work and non-work productivity, as well as greater need for visits to ophthalmologists during the prior year. In this report of the baseline findings of a 5-year natural history study of DED, a striking disease burden is observed with regard to blurred vision, productivity, and visits to eye care practitioners in mild to moderate DED patients compared to normal subjects of similar ages and genders. ClinicalTrials.gov NCT00833235 on January 30, 2009.

Gender differences between muscle activation and onset timing of the four subdivisions of trapezius during humerothoracic elevation.

PubMed

Szucs, Kimberly A; Borstad, John D

2013-12-01

The aim of this study was to provide a description of gender differences of the normal muscle activation patterns of the four subdivisions of the trapezius (clavicular, descending, transverse, ascending) during arm elevation. Surface EMG was collected from these four subdivisions from twenty-two healthy subjects (12 females, 10 males) during arm elevation in the scapular plane. Percent activation (RMS) of each subdivision was compared between genders across arm angles and elevation phase and onset time of each subdivision was compared between genders. Females demonstrated significantly higher % activation levels for each subdivision (p<.05), except transverse trapezius (p=.36). A statistically significant difference for onset time was observed between gender for the descending trapezius, with a slower onset time for females (p<.05). Findings from this study support the theory that subdivisions within descending trapezius are preferentially activated and demonstrate that gender differences are present within the fourth subdivision of trapezius. As subjects were without shoulder pathology, the observed gender differences may be explained by normal motor control variations. However, as coordinated activation of trapezius is required for normal shoulder motion, it is recommended to include all four subdivisions of trapezius and address gender differences in future studies. Copyright © 2013 Elsevier B.V. All rights reserved.

Sensory neuropathic symptoms in idiopathic Parkinson's disease: prevalence and impact on quality of life.

PubMed

Adewusi, Joy K; Hadjivassiliou, Marios; Vinagre-Aragón, Ana; O'Connor, Karen Ruth; Khan, Aijaz; Grünewald, Richard Adam; Zis, Panagiotis

2018-05-23

Neuropathic symptoms are commonly reported in Parkinson's disease (PD), but robust data on the epidemiology of such symptoms are lacking. The present study sought to investigate the prevalence and determinants of peripheral sensory neuropathic symptoms (PSNS) in idiopathic PD (IPD) and ascertain the effects of such symptoms on the patients' quality of life (QoL). Patients with IPD and age-matched and gender-matched controls were screened for neuropathic symptoms using the Michigan Neuropathy Screening Instrument. The impact of neuropathic symptoms on QoL was investigated using the 36-Item Short Form Survey. Fifty-two patients and 52 age-matched and gender-matched controls were recruited. PSNS were reported more frequently in patients with IPD than in the control subjects (57.7 versus 28.8%, p = 0.003). No significant relationships were found between PD-related clinical characteristics (i.e. disease severity and duration, duration of exposure to levodopa) and the presence of PSNS. Significant correlations were found between the number of PSNS and physical functioning (Spearman's Rho - 0.351), even after adjusting for age, gender and Hoehn and Yahr score. Our results support the notion of a greater prevalence of PSNS in IPD patients as compared to the general population, which, at least in part, may be secondary to large and/or small fibre peripheral neuropathy. This warrants further investigation in larger studies that include detailed neurophysiological assessments.

Teacher-Child Relationships: Contribution of Teacher and Child Characteristics

ERIC Educational Resources Information Center

Choi, Ji Young; Dobbs-Oates, Jennifer

2016-01-01

This study investigates potential predictors of teacher-child relationships (i.e., closeness and conflict) focusing on child gender, teacher-child ethnicity match, and teacher education. Additionally, the study explores the possible moderation effect of teacher education on the associations between teacher-child relationships and child gender or…

Gender differences in the association between cohabitation with parents and stress among married adults: A propensity score-matched analysis from the Korean National Health and Nutrition Examination Survey (KNHANES).

PubMed

Kim, Dae-Hwan; Mak, Kwok-Kei

2016-01-01

This study examined the gender-specific associations between cohabitation with parents and stress using an econometric approach. A total of 13,565 (41.7% men and 58.3% women) Korean adults aged 20-59 years from the Korean National Health and Nutrition Examination Survey (KNHANES) 2008 to 2011 were pooled. They reported their gender, age, marital status, education level, employment status, income, home ownership, and cohabitation status with their parents. The association of living with parents and stress, as well as the gender difference in the association, was investigated using propensity score matching and the average treatment effect on the treated. Adults with higher education and income, not owning a house, or living in larger cities were less likely to live with parents. Stress was associated with having children and participating in the labor market for both married men and women. Moreover, living with parents was a protective factor for stress among husbands, but a risk factor for wives in Korea. Gender differences existed in the association between cohabitation with parents and stress. Greater stress was related to cohabiting with parents and working for married women.

Psychological outcomes and gender-related development in complete androgen insensitivity syndrome.

PubMed

Hines, Melissa; Ahmed, S Faisal; Hughes, Ieuan A

2003-04-01

We evaluated psychological outcomes and gender development in 22 women with complete androgen insensitivity syndrome (CAIS). Participants were recruited through a medical database (n = 10) or through a patient support group (n = 12). Controls included 14 males and 33 females, of whom 22 were matched to women with CAIS for age, race, and sex-of-rearing. Outcome measures included quality of life (self-esteem and psychological general well-being), gender-related psychological characteristics (gender identity, sexual orientation, and gender role behavior in childhood and adulthood), marital status, personality traits that show sex differences, and hand preferences. Women recruited through the database versus the support group did not differ systematically, and there were no statistically significant differences between the 22 women with CAIS and the matched controls for any psychological outcome. These findings argue against the need for two X chromosomes or ovaries to determine feminine-typical psychological development in humans and reinforce the important role of the androgen receptor in influencing masculine-typical psychological development. They also suggest that psychological outcomes in women with CAIS are similar to those in other women. However, additional attention to more detailed aspects of psychological well-being in CAIS is needed.

Statistical 3D shape analysis of gender differences in lateral ventricles

NASA Astrophysics Data System (ADS)

He, Qing; Karpman, Dmitriy; Duan, Ye

2010-03-01

This paper aims at analyzing gender differences in the 3D shapes of lateral ventricles, which will provide reference for the analysis of brain abnormalities related to neurological disorders. Previous studies mostly focused on volume analysis, and the main challenge in shape analysis is the required step of establishing shape correspondence among individual shapes. We developed a simple and efficient method based on anatomical landmarks. 14 females and 10 males with matching ages participated in this study. 3D ventricle models were segmented from MR images by a semiautomatic method. Six anatomically meaningful landmarks were identified by detecting the maximum curvature point in a small neighborhood of a manually clicked point on the 3D model. Thin-plate spline was used to transform a randomly selected template shape to each of the rest shape instances, and the point correspondence was established according to Euclidean distance and surface normal. All shapes were spatially aligned by Generalized Procrustes Analysis. Hotelling T2 twosample metric was used to compare the ventricle shapes between males and females, and False Discovery Rate estimation was used to correct for the multiple comparison. The results revealed significant differences in the anterior horn of the right ventricle.

Thoughts on the nature of identity: disorders of sex development and gender identity.

PubMed

Reiner, William G; Reiner, D Townsend

2011-10-01

Children with disorders of sex development have similarities to, but also marked contrasts with, children with normal anatomy but who have gender dysphoria. Understanding gender identity development in children with sex disorders will probably help us understand typical gender identity development more than in understanding gender development in children with gender identity disorder.

Too Bad the Teachers Are Reading This!

ERIC Educational Resources Information Center

Collins, Marian; Baird, Scott

Over a 6-year period, a secondary level English teachers and a college composition instructor have exchanged their students' journals. After initial introductory exchanges between the groups, the instructors match pairs of students, who then correspond. The teachers attempt to match students of similar interests, and they have found gender mixing…

An automated normative-based fluorodeoxyglucose positron emission tomography image-analysis procedure to aid Alzheimer disease diagnosis using statistical parametric mapping and interactive image display

NASA Astrophysics Data System (ADS)

Chen, Kewei; Ge, Xiaolin; Yao, Li; Bandy, Dan; Alexander, Gene E.; Prouty, Anita; Burns, Christine; Zhao, Xiaojie; Wen, Xiaotong; Korn, Ronald; Lawson, Michael; Reiman, Eric M.

2006-03-01

Having approved fluorodeoxyglucose positron emission tomography (FDG PET) for the diagnosis of Alzheimer's disease (AD) in some patients, the Centers for Medicare and Medicaid Services suggested the need to develop and test analysis techniques to optimize diagnostic accuracy. We developed an automated computer package comparing an individual's FDG PET image to those of a group of normal volunteers. The normal control group includes FDG-PET images from 82 cognitively normal subjects, 61.89+/-5.67 years of age, who were characterized demographically, clinically, neuropsychologically, and by their apolipoprotein E genotype (known to be associated with a differential risk for AD). In addition, AD-affected brain regions functionally defined as based on a previous study (Alexander, et al, Am J Psychiatr, 2002) were also incorporated. Our computer package permits the user to optionally select control subjects, matching the individual patient for gender, age, and educational level. It is fully streamlined to require minimal user intervention. With one mouse click, the program runs automatically, normalizing the individual patient image, setting up a design matrix for comparing the single subject to a group of normal controls, performing the statistics, calculating the glucose reduction overlap index of the patient with the AD-affected brain regions, and displaying the findings in reference to the AD regions. In conclusion, the package automatically contrasts a single patient to a normal subject database using sound statistical procedures. With further validation, this computer package could be a valuable tool to assist physicians in decision making and communicating findings with patients and patient families.

Low serum uric acid levels in chronic insomnia patients: A case-control study.

PubMed

Zhao, Kai; Luan, Xiaoqian; Liu, Zhihua; Zhu, Zhuoying; Chen, Huijun; Shen, Huiping; Cai, Yan; Qiu, Huihua; Wang, Qiongzhang; Gu, Yingying; Zhu, Lin; He, Jincai

2017-09-14

Recent studies have demonstrated the presence of oxidative stress in insomnia patients. Uric acid (UA) is regarded as one of the most important antioxidants that may attenuate oxidative stress. The aim of our study was to investigate whether there is an alteration of serum UA levels in chronic insomnia patients. The association between sleep quality and serum UA in chronic insomnia patients was also investigated. We recruited 300 chronic insomnia patients and 300 age- and gender-matched normal controls. The uricase-PAP method was used to measure the concentration of UA both in patient and normal control subjects. The Pittsburgh Sleep Quality Index (PSQI) was used to assess the sleep quality of chronic insomniac participants. As a result, significantly lower serum UA levels were observed in patients with chronic insomnia when compared with normal control subjects (279.56±65.80 vs. 299.10±61.17μmol/L, t=-3.991, p<0.001). Low serum UA levels were correlated with high PSQI scores in multiple linear regression models (β=-0.322, p<0.001). Our results suggested that low serum UA levels were associated with the presence and severity of chronic insomnia. Copyright © 2017 Elsevier B.V. All rights reserved.

Quantitative Balance and Gait Measurement in Patients with Frontotemporal Dementia and Alzheimer Diseases: A Pilot Study.

PubMed

Velayutham, Selva Ganapathy; Chandra, Sadanandavalli Retnaswami; Bharath, Srikala; Shankar, Ravi Girikamatha

2017-01-01

Alzhiemers disease and Frontotemporal dementia are common neurodegenerative dementias with a wide prevalence. Falls are a common cause of morbidity in these patients. Identifying subclinical involvement of these parameters might serve as a tool in differential analysis of these distinct parameters involved in these conditions and also help in planning preventive strategies to prevent falls. Eight patients in age and gender matched patients in each group were compared with normal controls. Standardizes methods of gait and balance aseesment were done in all persons. Results revealed subclinical involvement of gait and balancesin all groups specially during divided attention. The parameters were significantly more affected in patients. Patients with AD and FTD had involement of over all ambulation index balance more affected in AD patients FTD patients showed step cycle, stride length abnormalities. There is balance and gait involvement in normal ageing as well as patients with AD and FTD. The pattern of involvement in AD correlates with WHERE pathway involvement and FTD with frontal subcortical circuits involvement. Identification the differential patterns of involvement in subclinical stage might help to differentiate normal ageing and the different types of cortical dementias. This could serve as an additional biomarker and also assist in initiating appropriate training methods to prevent future falls.

Increased determinism in brain electrical activity occurs in association with multiple sclerosis.

PubMed

Carrubba, Simona; Minagar, Alireza; Chesson, Andrew L; Frilot, Clifton; Marino, Andrew A

2012-04-01

Increased determinism (decreased complexity) of brain electrical activity has been associated with some brain diseases. Our objective was to determine whether a similar association occurred for multiple sclerosis (MS). Ten subjects with a relapsing-remitting course of MS who were in remission were studied; the controls were age- and gender-matched clinically normal subjects. Recurrence plots were calculated using representative electroencephalogram (EEG) epochs (1-7 seconds) from six derivations; the plots were quantified using the nonlinear variables percent recurrence (%R) and percent determinism (%D). The results were averaged over all derivations for each participant, and the means were compared between the groups. As a linear control procedure the groups were also compared using spectral analysis. The mean±SD of %R for the MS subjects was 6·6±1·3%, compared with 5·1±1·3% in the normal group (P = 0·017), indicating that brain activity in the subjects with MS was less complex, as hypothesized. The groups were not distinguishable using %D or spectral analysis. Taken together with our earlier report that %R could be used to discriminate between MS and normal subjects based on the ability to exhibit evoked potentials, the evidence suggests that complexity analysis of the EEG has potential for development as a diagnostic test for MS.

The effect of abnormal colour vision on the ability to identify and outline coloured clinical signs and to count stained bacilli in sputum.

PubMed

Campbell, John L; Griffin, Lewis; Spalding, J Anthony B; Mir, Fraz A

2005-11-01

To determine if medical practitioners with congenital colour vision deficiencies (CCVD) are less able to identify and delineate the extent of coloured abnormal signs than those with normal colour vision. Twenty-two medical practitioners with CCVD and 17 with normal colour vision, matched for age and gender, were shown 10 photographs. They were asked to identify and outline the extent of the clinical sign in eight that were of vomit or stool (six of these showing fresh blood), one of a skin rash and for one to mark the position of bacilli in sputum stained by the Ziehl-Neelsen method. There were statistically significant differences between the CCVD practitioners and those with normal colour vision in their ability to outline abnormalities in five of the six photographs that showed fresh blood, in the photograph of a rash and in marking the position of bacilli in the photograph of a stained slide. Medical practitioners with CCVD are handicapped in their evaluation of the presence and extent of coloured clinical signs. Medical schools should ensure that students with CCVD are aware of their deficiency and know its severity, so they can take special care in clinical practice.

Accuracy of shade matching performed by colour blind and normal dental students using 3D Master and Vita Lumin shade guides.

PubMed

Vafaee, F; Rakhshan, V; Vafaei, M; Khoshhal, M

2012-03-01

The purpose of this study was to investigate whether 3D Master or VitaLumin shade guides could improve colour selection in individuals with normal and defective colour vision. First, colour perception of 260 dental students was evaluated. Afterwards, 9 colour blind and 9 matched normal subjects tried to detect colours of 10 randomly selected tabs from each kit and the correct/false answers were counted. Of the colour-defective subjects, 47.8% and 33.3% correctly detected the shade using 3D Master and VitaLumin, respectively. These statistics were 62.2% and 42.2% in normal subjects. In normal participants, but not in colour blind ones, 3D Master significantly improved shade matching accuracy compared to VitaLumin.

Outcomes of cochlear implantation in deaf children of deaf parents: comparative study.

PubMed

Hassanzadeh, S

2012-10-01

This retrospective study compared the cochlear implantation outcomes of first- and second-generation deaf children. The study group consisted of seven deaf, cochlear-implanted children with deaf parents. An equal number of deaf children with normal-hearing parents were selected by matched sampling as a reference group. Participants were matched based on onset and severity of deafness, duration of deafness, age at cochlear implantation, duration of cochlear implantation, gender, and cochlear implant model. We used the Persian Auditory Perception Test for the Hearing Impaired, the Speech Intelligibility Rating scale, and the Sentence Imitation Test, in order to measure participants' speech perception, speech production and language development, respectively. Both groups of children showed auditory and speech development. However, the second-generation deaf children (i.e. deaf children of deaf parents) exceeded the cochlear implantation performance of the deaf children with hearing parents. This study confirms that second-generation deaf children exceed deaf children of hearing parents in terms of cochlear implantation performance. Encouraging deaf children to communicate in sign language from a very early age, before cochlear implantation, appears to improve their ability to learn spoken language after cochlear implantation.

Gender Advantages and Gender Normality in the Views of Estonian Secondary School Students

ERIC Educational Resources Information Center

Kuurme, Tiiu; Kasemaa, Gertrud

2015-01-01

The aim of the study on Estonian secondary school students was to obtain an overview of the gender-related views and experiences of the everyday school life by students, and to analyse the school-related factors in the development of gender roles and gender-related expectations. We view gender equality as a central condition for social…

From motherhood penalties to husband premia: the new challenge for gender equality and family policy, lessons from Norway.

PubMed

Petersen, Trond; Penner, Andrew M; Høgsnes, Geir

2014-03-01

Given the key role that processes occurring in the family play in creating gender inequality, the family is a central focus of policies aimed at creating greater gender equality. We examine how family status affects the gender wage gap using longitudinal matched employer-employee data from Norway, 1979-96, a period with extensive expansion of family policies. The motherhood penalty dropped dramatically from 1979 to 1996. Among men the premia for marriage and fatherhood remained constant. In 1979, the gender wage gap was primarily due to the motherhood penalty, but by 1996 husband premia were more important than motherhood penalties.

Identity, gender, and subjective well-being.

PubMed

Chang, Wen-Chun

2011-01-01

Using the self-reported level of happiness as a measure of subjective well-being, this study examines the relationship between gender identity and subjective well-being with data from Taiwan. The findings suggest that an individual's perceptions about the ideals of women's gender roles in the labor market, the family, and politics are strongly related to his or her assigned social category, the prescriptions and characteristics associated with the social category, and the actions taken to match the ideals of gender identity. Consistent with Akerlof and Kranton's (2000) identity model, it is also found that an individual's gains or losses in gender identity lead to increases or decreases in the level of happiness.

Gendered Perceptions of Intimate Partner Violence Normality: An Experimental Study.

PubMed

Kuijpers, Karlijn F; Blokland, Arjan A J; Mercer, Natalie C

2017-12-01

Knowledge on young adults' perceptions of intimate partner violence (IPV) is important as these are the ages at which most people form their first serious intimate relationships and begin to develop norms about how to communicate within a relationship. This study uses an experimental vignette design to examine whether the type of violence employed and the gender dynamics within the couple (male perpetrator and female victim vs. female perpetrator and male victim) affect young adults' perceptions of IPV normality. Gender differences in these perceptions are assessed and moreover, we explore whether these differences can be attributed to respondents' prior IPV experiences. Young adults ( N = 599) were recruited from various schools and universities throughout the Netherlands. They were randomly assigned to one of 10 experimental vignettes. Findings demonstrate that, generally, scenarios describing more serious types of IPV as well as those describing a male perpetrator and a female victim received lower ratings of normality. Gender differences in perceptions were found and, moreover, the direction of these gender differences appeared to depend on the actual gender dynamics described in the IPV scenario. Prior IPV experiences increased perceptions of IPV normality among female respondents in particular. Moreover, the suggestion that respondents' prior IPV experiences may better explain respondents' IPV perceptions than respondents' gender, was only partly supported. Our findings suggest that this is true for respondents' prior psychological, but not physical IPV experiences and for the manipulations of the gender dynamics within the couple, but not so much for the type of violence employed. Implications of these findings are discussed. From a prevention perspective, greater insight into these perceptions is relevant as they have been shown to be related to help-seeking and reporting behavior in the case of experiencing or witnessing IPV.

Lactose Intolerance: Lack of Evidence for Short Stature or Vitamin D Deficiency in Prepubertal Children

PubMed Central

Setty-Shah, Nithya; Maranda, Louise; Candela, Ninfa; Fong, Jay; Dahod, Idris; Rogol, Alan D.; Nwosu, Benjamin Udoka

2013-01-01

ABSTRACT Background The health consequences of lactose intolerance (LI) are unclear. Aims To investigate the effects of LI on stature and vitamin D status. Hypotheses LI subjects will have similar heights and vitamin D status as controls. Subjects and Methods Prepubertal children of ages 3-12 years with LI (n=38, age 8.61 ± 3.08y, male/female 19/19) were compared to healthy, age- and gender-matched controls (n=49, age 7.95±2.64, male/female 28/21). Inclusion criteria: prepubertal status (boys: testicular volume <3cc; girls: Tanner 1 breasts), diagnosis of LI by hydrogen breath test, and no history of calcium or vitamin D supplementation. Vitamin D deficiency was defined as 25-hydroxyvitamin D [25(OH)D] <50 nmol/L. Gender-adjusted midparental target height (MPTH) z-score was calculated using NCHS data for 18 year-old adults. Data were expressed as mean ± SD. Results There was no significant difference in 25(OH)D between the LI and non-LI subjects (60.1±21.1, vs. 65.4 ± 26.1 nmol/L, p = 0.29). Upon stratification into normal weight (BMI <85th percentile) vs. overweight/obese (BMI ≥85th percentile), the normal weight controls had significantly higher 25(OH)D level than both the normal weight LI children (78.3 ± 32.6 vs. 62.9 ± 23.2, p = 0.025), and the overweight/obese LI children (78.3±32.6 vs. 55.3±16.5, p = 0.004). Secondly, there was no overall difference in height z-score between the LI children and controls. The normal weight LI patients had similar height as normal controls (-0.46 ± 0.89 vs. -0.71 ± 1.67, p = 0.53), while the overweight/obese LI group was taller than the normal weight controls (0.36 ± 1.41 vs. -0.71 ± 1.67, p = 0.049), and of similar height as the overweight/obese controls (0.36 ± 1.41 vs. 0.87 ± 1.45, p = 0.28). MPTH z-score was similar between the groups. Conclusion Short stature and vitamin D deficiency are not features of LI in prepubertal children. PMID:24205288

The "Box"ing Match: Narratives from Queer Adults Growing up through the Heterosexual Matrix

ERIC Educational Resources Information Center

Leonardi, Bethy

2017-01-01

Using queer theories of sexuality and gender, this study centers on "coming out" stories of ten queer adults. Engaging Butler's heterosexual matrix (1990) as an analytic tool, stories are analyzed with respect to agency and positioning. Findings suggest that participants' positioning and agency were largely affected by gender identity…

Student vs. Faculty Perspectives on Quality Instruction: Gender Bias, "Hotness," and "Easiness" in Evaluating Teaching

ERIC Educational Resources Information Center

Boehmer, Devin M.; Wood, William C.

2017-01-01

This article systematically examines differences between student and faculty perspectives on quality instruction, using local data for a regional university's college of business matched to RateMyProfessors.com evaluations. Particular attention is focused on gender bias, "hotness," and "easiness." In addition to documenting a…

Gender Differences in the Motivational Processing of Facial Beauty

ERIC Educational Resources Information Center

Levy, Boaz; Ariely, Dan; Mazar, Nina; Chi, Won; Lukas, Scott; Elman, Igor

2008-01-01

Gender may be involved in the motivational processing of facial beauty. This study applied a behavioral probe, known to activate brain motivational regions, to healthy heterosexual subjects. Matched samples of men and women were administered two tasks: (a) key pressing to change the viewing time of average or beautiful female or male facial…

Quantitation of circulating tumor cells in blood samples from ovarian and prostate cancer patients using tumor-specific fluorescent ligands.

PubMed

He, Wei; Kularatne, Sumith A; Kalli, Kimberly R; Prendergast, Franklyn G; Amato, Robert J; Klee, George G; Hartmann, Lynn C; Low, Philip S

2008-10-15

Quantitation of circulating tumor cells (CTCs) can provide information on the stage of a malignancy, onset of disease progression and response to therapy. In an effort to more accurately quantitate CTCs, we have synthesized fluorescent conjugates of 2 high-affinity tumor-specific ligands (folate-AlexaFluor 488 and DUPA-FITC) that bind tumor cells >20-fold more efficiently than fluorescent antibodies. Here we determine whether these tumor-specific dyes can be exploited for quantitation of CTCs in peripheral blood samples from cancer patients. A CTC-enriched fraction was isolated from the peripheral blood of ovarian and prostate cancer patients by an optimized density gradient centrifugation protocol and labeled with the aforementioned fluorescent ligands. CTCs were then quantitated by flow cytometry. CTCs were detected in 18 of 20 ovarian cancer patients (mean 222 CTCs/ml; median 15 CTCs/ml; maximum 3,118 CTCs/ml), whereas CTC numbers in 16 gender-matched normal volunteers were negligible (mean 0.4 CTCs/ml; median 0.3 CTCs/ml; maximum 1.5 CTCs/ml; p < 0.001, chi(2)). CTCs were also detected in 10 of 13 prostate cancer patients (mean 26 CTCs/ml, median 14 CTCs/ml, maximum 94 CTCs/ml) but not in 18 gender-matched healthy donors (mean 0.8 CTCs/ml, median 1, maximum 3 CTC/ml; p < 0.0026, chi(2)). Tumor-specific fluorescent antibodies were much less efficient in quantitating CTCs because of their lower CTC labeling efficiency. Use of tumor-specific fluorescent ligands to label CTCs in peripheral blood can provide a simple, accurate and sensitive method for determining the number of cancer cells circulating in the bloodstream.

The peer relationships of girls with ASD at school: comparison to boys and girls with and without ASD.

PubMed

Dean, Michelle; Kasari, Connie; Shih, Wendy; Frankel, Fred; Whitney, Rondalyn; Landa, Rebecca; Lord, Catherine; Orlich, Felice; King, Bryan; Harwood, Robin

2014-11-01

This study examines the social relationships of elementary school children with high-functioning autism, focusing on how gender relates to social preferences and acceptance, social connections, reciprocal friendships, and rejection. Peer nomination data were analyzed for girls with and without ASD (n = 50) and boys with and without ASD (n = 50). Girls and boys with ASD were matched by age, gender, and IQ. Each child with ASD was matched by age and gender to a typically developing classmate. Consistent with typically developing populations, children with ASD preferred, were accepted by, and primarily socialized with same-gender friends. With fewer nominations and social relationships, girls and boys with ASD appear more socially similar to each other than to the same-gender control group. Additionally, girls and boys with ASD showed higher rates of social exclusion than their typically developing peers. However, boys with ASD were more overtly socially excluded compared to girls with ASD, who seemed to be overlooked, rather than rejected. Our data suggest a number of interesting findings in the social relationships of children with ASD in schools. Like typically developing populations, children with ASD identify with their own gender when socializing and choosing friends. But given the social differences between genders, it is likely that girls with ASD are experiencing social challenges that are different from boys with ASD. Therefore, gender is an important environmental factor to consider when planning social skills interventions at school. © 2014 The Authors. Journal of Child Psychology and Psychiatry. © 2014 Association for Child and Adolescent Mental Health.

Effects of Vocal Fold Nodules on Glottal Cycle Measurements Derived from High-Speed Videoendoscopy in Children

PubMed Central

2016-01-01

The goal of this study is to quantify the effects of vocal fold nodules on vibratory motion in children using high-speed videoendoscopy. Differences in vibratory motion were evaluated in 20 children with vocal fold nodules (5–11 years) and 20 age and gender matched typically developing children (5–11 years) during sustained phonation at typical pitch and loudness. Normalized kinematic features of vocal fold displacements from the mid-membranous vocal fold point were extracted from the steady-state high-speed video. A total of 12 kinematic features representing spatial and temporal characteristics of vibratory motion were calculated. Average values and standard deviations (cycle-to-cycle variability) of the following kinematic features were computed: normalized peak displacement, normalized average opening velocity, normalized average closing velocity, normalized peak closing velocity, speed quotient, and open quotient. Group differences between children with and without vocal fold nodules were statistically investigated. While a moderate effect size was observed for the spatial feature of speed quotient, and the temporal feature of normalized average closing velocity in children with nodules compared to vocally normal children, none of the features were statistically significant between the groups after Bonferroni correction. The kinematic analysis of the mid-membranous vocal fold displacement revealed that children with nodules primarily differ from typically developing children in closing phase kinematics of the glottal cycle, whereas the opening phase kinematics are similar. Higher speed quotients and similar opening phase velocities suggest greater relative forces are acting on vocal fold in the closing phase. These findings suggest that future large-scale studies should focus on spatial and temporal features related to the closing phase of the glottal cycle for differentiating the kinematics of children with and without vocal fold nodules. PMID:27124157

Post-transplant outcomes of patients with and without hepatitis C virus infection according to donor age and gender matching.

PubMed

Grąt, Michał; Kornasiewicz, Oskar; Lewandowski, Zbigniew; Ligocka, Joanna; Grąt, Karolina; Wronka, Karolina Maria; Zieniewicz, Krzysztof; Krawczyk, Marek

2013-12-23

The purpose of this study was to evaluate the impact of donor age and donor-recipient gender matching on liver transplantation outcomes, focusing on differences between patients with and without hepatitis C virus (HCV) infection. This retrospective cohort study evaluated 622 liver transplantation recipients. HCV (n=164) and non-HCV (n=458) patients were subdivided by donor age (≤ 30, 31-50, and >50 years) and donor-recipient gender configurations. Five-year patient survival (PS) and graft survival (GS) were set as outcome measures. Five-year PS was 83.1% for HCV-positive and 81.6% for HCV-negative patients (p=0.614), with the corresponding GS rates of 81.2% and 79.3% (p=0.538), respectively. In HCV patients, transplantations from donors older than 50 years were associated with lower PS (p=0.035) and GS (p=0.006) than those from donors aged 31-50 years. This difference was not observed among non-HCV recipients (PS, p=0.994; GS, p=0.878). Regarding donor-recipient gender configurations, outcomes were similar in HCV (PS, p=0.751; GS, p=0.592) and non-HCV patients (PS, p=0.217; GS, p=0.249), except for a tendency toward lower PS for male-to-female transplantations than female-to-female transplantations in non-HCV patients (p=0.064). Outcomes of HCV patients were superior to those of non-HCV patients after transplantation from donors aged 31-50 years (PS, p=0.080; GS, p=0.026). Avoiding the transplantation of grafts from donors aged over 50 years to patients with HCV infection might improve the general outcomes of liver transplantation programs. There is no specific rationale for gender matching with respect to HCV status.

Gender differences in knee morphology and the prospects for implant design in total knee replacement.

PubMed

Asseln, Malte; Hänisch, Christoph; Schick, Fabian; Radermacher, Klaus

2018-05-14

Morphological differences between female and male knees have been reported in the literature, which led to the development of so-called gender-specific implants. However, detailed morphological descriptions covering the entire joint are rare and little is known regarding whether gender differences are real sexual dimorphisms or can be explained by overall differences in size. We comprehensively analysed knee morphology using 33 features of the femur and 21 features of the tibia to quantify knee shape. The landmark recognition and feature extraction based on three-dimensional surface data were fully automatically applied to 412 pathological (248 female and 164 male) knees undergoing total knee arthroplasty. Subsequently, an exploratory statistical analysis was performed and linear correlation analysis was used to investigate normalization factors and gender-specific differences. Statistically significant differences between genders were observed. These were pronounced for distance measurements and negligible for angular (relative) measurements. Female knees were significantly narrower at the same depth compared to male knees. The correlation analysis showed that linear correlations were higher for distance measurements defined in the same direction. After normalizing the distance features according to overall dimensions in the direction of their definition, gender-specific differences disappeared or were smaller than the related confidence intervals. Implants should not be linearly scaled according to one dimension. Instead, features in medial/lateral and anterior/posterior directions should be normalized separately (non-isotropic scaling). However, large inter-individual variations of the features remain after normalization, suggesting that patient-specific design solutions are required for an improved implant design, regardless of gender. Copyright © 2018 Elsevier B.V. All rights reserved.

Individual differences in children's pronoun processing during reading: Detection of incongruence is associated with higher reading fluency and more regressions.

PubMed

Eilers, Sarah; Tiffin-Richards, Simon P; Schroeder, Sascha

2018-05-10

In two eye tracking experiments, we tested fourth graders' and adults' sensitivity to gender feature mismatches during reading of pronouns and their susceptibility to interference of feature-matching entities in the sentence. In Experiment 1, we showed children and adults two-phrase sentences such as "Leon{m}/Lisa{f} shooed away the sparrow{m}/the seagull{f} and then he{m} ate the tasty sandwich." Eye tracking measures showed no qualitative differences between children's and adults' processing of the pronouns. Both age groups showed longer gaze durations on subject mismatching than on matching pronouns, and there was no evidence of interference of a gender-matching object. Strikingly, in contrast to the adults, not all fourth graders reported detection of the subject gender mismatch. In Experiment 2, we replicated earlier results with a larger sample of children (N = 75) and found that only half of the fourth graders detected the gender mismatch during reading. The detectors' reading pattern at the pronoun differed from that of the non-detectors. Children who reported detection of the mismatch showed a reading pattern more similar to the adults. Children who did not report detection of the mismatch had comparably slower gaze durations and were less likely to make regressions directly at the pronoun. We conclude that children who read more fluently use their available processing resources to immediately repair grammatical inconsistencies encountered in a text. Copyright © 2018 Elsevier Inc. All rights reserved.

Gender identification of Grasshopper Sparrows comparing behavioral, morphological, and molecular techniques

USGS Publications Warehouse

Ammer, F.K.; Wood, P.B.; McPherson, R.J.

2008-01-01

Correct gender identification in monomorphic species is often difficult especially if males and females do not display obvious behavioral and breeding differences. We compared gender specific morphology and behavior with recently developed DNA techniques for gender identification in the monomorphic Grasshopper Sparrow (Ammodramus savannarum). Gender was ascertained with DNA in 213 individuals using the 2550F/2718R primer set and 3% agarose gel electrophoresis. Field observations using behavior and breeding characteristics to identify gender matched DNA analyses with 100% accuracy for adult males and females. Gender was identified with DNA for all captured juveniles that did not display gender specific traits or behaviors in the field. The molecular techniques used offered a high level of accuracy and may be useful in studies of dispersal mechanisms and winter assemblage composition in monomorphic species.

On the Gender Effects of Handedness in Professional Tennis

PubMed Central

Breznik, Kristijan

2013-01-01

The aim of this study was to explore the effects of the gender variable in relation to other player and match characteristics on the advantage possessed by left-handed professional tennis players over their right-handed rivals. The data include 16 732 male tennis players and 16 432 female tennis players who played 438 937 and 415 346 matches, respectively, in the period from 1968 to the end of 2011. The results revealed that the advantage of left-handed professional tennis players is higher in males compared to females. The inverse impact of player and match quality on the left- handers’ advantage was clearly confirmed. On the contrary, it seems that the type of court surface does not directly imply this advantage. To obtain an overview on the individual level, directed and weighted networks of tennis matches in both gender categories were constructed. Applying network analytic methods and the PageRank algorithm, the best left and right-handed players in the Open Era of tennis were identified. The top three ranked left-handed players in the male and female categories were found to be far more consistent in their ranks achieved against left and right-handed opponents compared to their right-handed counterparts. Key Points The advantage of left-handed professional tennis players over their right-handed opponents is higher in males compared to females. The quality of player and match is inversely proportional to the advantage of left-handers against their right-handed counterparts. On the contrary, it seems that the type of court surface does not directly imply this advantage. When the tennis talent appears in left-handers it is likely to be an outstanding one, particularly in the female category. PMID:24149815

Acoustic analysis of voice in children with cleft palate and velopharyngeal insufficiency.

PubMed

Villafuerte-Gonzalez, Rocio; Valadez-Jimenez, Victor M; Hernandez-Lopez, Xochiquetzal; Ysunza, Pablo Antonio

2015-07-01

Acoustic analysis of voice can provide instrumental data concerning vocal abnormalities. These findings can be used for monitoring clinical course in cases of voice disorders. Cleft palate severely affects the structure of the vocal tract. Hence, voice quality can also be also affected. To study whether the main acoustic parameters of voice, including fundamental frequency, shimmer and jitter are significantly different in patients with a repaired cleft palate, as compared with normal children without speech, language and voice disorders. Fourteen patients with repaired unilateral cleft lip and palate and persistent or residual velopharyngeal insufficiency (VPI) were studied. A control group was assembled with healthy volunteer subjects matched by age and gender. Hypernasality and nasal emission were perceptually assessed in patients with VPI. Size of the gap as assessed by videonasopharyngoscopy was classified in patients with VPI. Acoustic analysis of voice including Fundamental frequency (F0), shimmer and jitter were compared between patients with VPI and control subjects. F0 was significantly higher in male patients as compared with male controls. Shimmer was significantly higher in patients with VPI regardless of gender. Moreover, patients with moderate VPI showed a significantly higher shimmer perturbation, regardless of gender. Although future research regarding voice disorders in patients with VPI is needed, at the present time it seems reasonable to include strategies for voice therapy in the speech and language pathology intervention plan for patients with VPI. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Role of fetal sex in amniotic fluid alphafetoprotein screening.

PubMed

Knippel, Alexander Johannes

2002-10-01

Previous studies have shown that fetal gender has influence on various pregnancy complications and prenatal diagnostic biochemical markers. We have evaluated, whether elevation of amniotic fluid alphafetoprotein (AF AFP) is associated with fetal sex and whether a sex-related difference can help to identify pregnancies with AFP-associated malformations or fetal loss. From our database we obtained 6461 singleton gestations with AF AFP measurements for the period April 1997-March 1999. Patients with AF AFP >1.9 MoM were identified, details of pregnancy outcome were obtained and compared to matched-pair controls having AF AFP <2 MoM. In 232 of 262 patients having AF AFP levels >1.9 MoM outcome information was available. Of these fetuses, significantly more had male gender (147 male fetuses versus 85 female). Having a screen-positive result the risk of AFP-associated malformations was significantly higher for female fetuses (25 female fetuses (29.4%) versus 22 male fetuses (15%) with AFP-associated malformations). Adjusting the cut-off MoM to 2.5 for male and to 2.0 for female fetuses halves the false positive rate from 3.4 to 1.7% without affecting the detection rate of 95%. Pregnancies with false positive AF AFP had a significantly higher risk for fetal loss compared with pregnancies having normal AF AFP (ten fetal losses from 185 versus two fetal losses from 232), but fetal gender had no significant influence. Adjusting AF AFP MoM cut-offs for fetal gender could increase performance of AF-AFP screening. Larger studies are required to determine suitable sex-adjusted cut-off levels. Copyright 2002 John Wiley & Sons, Ltd.

Which Neuropsychological Tests Predict Progression to Alzheimer’s Disease in Hispanics?

PubMed Central

Weissberger, Gali H.; Salmon, David P.; Bondi, Mark W.; Gollan, Tamar H.

2013-01-01

Objective To investigate which neuropsychological tests predict eventual progression to Alzheimer’s disease (AD) in both Hispanic and non-Hispanic individuals. Although our approach was exploratory, we predicted that tests that underestimate cognitive ability in healthy aging Hispanics might not be sensitive to future cognitive decline in this cultural group. Method We compared first-year data of 22 older adults (11 Hispanic) who were diagnosed as cognitively normal but eventually developed AD (decliners), to 60 age- and education-matched controls (27 Hispanic) who remained cognitively normal. To identify tests that may be culturally biased in our sample, we compared Hispanic with non-Hispanic controls on all tests and asked which tests were sensitive to future decline in each cultural group. Results Compared to age-, education-, and gender-matched non-Hispanic controls, Hispanic controls obtained lower scores on tests of language, executive function, and some measures of global cognition. Consistent with our predictions, some tests identified non-Hispanic, but not Hispanic, decliners (vocabulary, semantic fluency). Contrary to our predictions, a number of tests on which Hispanics obtained lower scores than non-Hispanics nevertheless predicted eventual progression to AD in both cultural groups (e.g., Boston Naming Test [BNT], Trails A and B). Conclusions Cross-cultural variation in test sensitivity to decline may reflect greater resistance of medium difficulty items to decline and bilingual advantages that initially protect Hispanics against some aspects of cognitive decline commonly observed in non-Hispanics with preclinical AD. These findings highlight a need for further consideration of cross-cultural differences in neuropsychological test performance and development of culturally unbiased measures. PMID:23688216

The Influence of Sex Information on Gender Word Processing.

PubMed

Casado, Alba; Palma, Alfonso; Paolieri, Daniela

2018-06-01

Three different tasks (word repetition, lexical decision, and gender decision) were designed to explore the impact of the sex clues (sex of the speaker, sex of the addressee) and the type of gender (semantic, arbitrary) on the processing of isolated Spanish gendered words. The findings showed that the grammatical gender feature was accessed when no mandatory attentional focus was required. In addition, the results indicated that the participants organize information according to their own sex role, which provides more salience to the words that match in grammatical gender with their own sex role representation, even when the gender assignment is arbitrary. Finally, the sex of the speaker biased the lexical access and the grammatical gender selection, serving as a semantic prime when the two dimensions have a congruent relationship. Furthermore, the masculine form serves as the generic gender representing both male and female figures.

Composite recovery type curves in normalized time from Theis' exact solution

USGS Publications Warehouse

Goode, Daniel J.

1997-01-01

Type curves derived from Theis’ exact nonequilibrium well function solution are proposed for graphical estimation of aquifer hydraulic properties, transmissivity (T), and storage coefficient (S), from water-level recovery data after cessation of a constant-rate discharge test. Drawdown (on log scale) is plotted versus the ratio of time since pumping stopped to duration of pumping, a normalized time. Under Theis conditions, individual type curves depend on only the dimensionless pumping duration, which depends in turn on S and radial distance from the pumping well. Type curve matching, in contrast to the Theis procedure for pumping data, is performed by shifting only the drawdown axis; the time axis is fixed because it is a relative or normalized time. The match-point for the drawdown axis is used to compute T, and S is determined from matching the curve shape, which depends on early dimensionless-time data. Multiple well data can be plotted and matched simultaneously (a composite plot), with drawdown at different radial distances matching different curves. The ratio of dimensionless pumping durations for any two matched curves is equal to one over the squared ratio of radial distances. Application to two recovery datasets from the literature confirm the utility of these type curves in normalized time for composite estimation of T and S.

A new algorithm for distorted fingerprints matching based on normalized fuzzy similarity measure.

PubMed

Chen, Xinjian; Tian, Jie; Yang, Xin

2006-03-01

Coping with nonlinear distortions in fingerprint matching is a challenging task. This paper proposes a novel algorithm, normalized fuzzy similarity measure (NFSM), to deal with the nonlinear distortions. The proposed algorithm has two main steps. First, the template and input fingerprints were aligned. In this process, the local topological structure matching was introduced to improve the robustness of global alignment. Second, the method NFSM was introduced to compute the similarity between the template and input fingerprints. The proposed algorithm was evaluated on fingerprints databases of FVC2004. Experimental results confirm that NFSM is a reliable and effective algorithm for fingerprint matching with nonliner distortions. The algorithm gives considerably higher matching scores compared to conventional matching algorithms for the deformed fingerprints.

Gender differences in game responses during badminton match play.

PubMed

Fernandez-Fernandez, Jaime; de la Aleja Tellez, Jose G; Moya-Ramon, Manuel; Cabello-Manrique, David; Mendez-Villanueva, Alberto

2013-09-01

The aim of this study was to evaluate possible gender differences in match play activity pattern [rally duration, rest time between rallies, effective playing time, and strokes performed during a rally] and exercise intensity (heart rate [HR], blood lactate [La], and subjective ratings of perceived exertion [RPE]) during 9 simulated badminton matches in male (n = 8) and female (n = 8) elite junior (16.0 ± 1.4 years) players. Results showed significant differences (all p < 0.05; effect size (ES) = 0.80-1.56) between male and female players in the activity pattern of match play, with male players engaged in longer rallies (6.8 ± 4.8 vs. 5.7 ± 3.1 seconds), executing more strokes per rally (6.4 ± 4.8 vs. 4.7 ± 2.8) and resting more between rallies (10.5 ± 8.8 vs. 8.8 ± 7.2 seconds) than female players. No clear differences (all p > 0.05; ES = -0.33 to 0.08) were observed between female or male players in average HR (174 ± 7 vs. 170 ± 9 b·min(-1)), %HRmax (89.2 ± 4.0% vs. 85.9 ± 4.3%), La (2.5 ± 1.3 vs. 3.2 ± 1.8 mmol·L(-1)), and RPE values (14.2 ± 1.9 vs. 14.6 ± 1.8) during match play, although male players spent more time (moderate effect sizes) at intensities between 81 and 90% HRmax (35.3 ± 17.9 vs. 25.3 ± 13.6; p < 0.05; ES = 0.64) in the second game. There seemed to be a trend toward an increased playing intensity (i.e., higher HR, La, and RPE) from the first to the second game, highlighting the higher exercise intensity experienced during the last part of the match. The clear between-gender differences in activity patterns induced only slightly different physiological responses.

Normal limits in relation to age, body size and gender of two-dimensional echocardiographic aortic root dimensions in persons ≥15 years of age.

PubMed

Devereux, Richard B; de Simone, Giovanni; Arnett, Donna K; Best, Lyle G; Boerwinkle, Eric; Howard, Barbara V; Kitzman, Dalane; Lee, Elisa T; Mosley, Thomas H; Weder, Alan; Roman, Mary J

2012-10-15

Nomograms to predict normal aortic root diameter for body surface area (BSA) in broad ranges of age have been widely used but are limited by lack of consideration of gender effects, jumps in upper limits of aortic diameter among age strata, and data from older teenagers. Sinus of Valsalva diameter was measured by American Society of Echocardiography convention in normal-weight, nonhypertensive, nondiabetic subjects ≥15 years old without aortic valve disease from clinical or population-based samples. Analyses of covariance and linear regression with assessment of residuals identified determinants and developed predictive models for normal aortic root diameter. In 1,207 apparently normal subjects ≥15 years old (54% women), aortic root diameter was 2.1 to 4.3 cm. Aortic root diameter was strongly related to BSA and height (r = 0.48 for the 2 comparisons), age (r = 0.36), and male gender (+2.7 mm adjusted for BSA and age, p <0.001 for all comparisons). Multivariable equations using age, gender, and BSA or height predicted aortic diameter strongly (R = 0.674 for the 2 comparisons, p <0.001) with minimal relation of residuals to age or body size: for BSA 2.423 + (age [years] × 0.009) + (BSA [square meters] × 0.461) - (gender [1 = man, 2 = woman] × 0.267), SEE 0.261 cm; for height 1.519 + (age [years] × 0.010) + (height [centimeters] × 0.010) - (gender [1 = man, 2 = woman] × 0.247), SEE 0.215 cm. In conclusion, aortic root diameter is larger in men and increases with body size and age. Regression models incorporating body size, age, and gender are applicable to adolescents and adults without limitations of previous nomograms. Copyright © 2012 Elsevier Inc. All rights reserved.

Prosody Perception and Production in Children with Hearing Loss and Age- and Gender-Matched Controls.

PubMed

Kalathottukaren, Rose Thomas; Purdy, Suzanne C; Ballard, Elaine

2017-04-01

Auditory development in children with hearing loss, including the perception of prosody, depends on having adequate input from cochlear implants and/or hearing aids. Lack of adequate auditory stimulation can lead to delayed speech and language development. Nevertheless, prosody perception and production in people with hearing loss have received less attention than other aspects of language. The perception of auditory information conveyed through prosody using variations in the pitch, amplitude, and duration of speech is not usually evaluated clinically. This study (1) compared prosody perception and production abilities in children with hearing loss and children with normal hearing; and (2) investigated the effect of age, hearing level, and musicality on prosody perception. Participants were 16 children with hearing loss and 16 typically developing controls matched for age and gender. Fifteen of the children with hearing loss were tested while using amplification (n = 9 hearing aids, n = 6 cochlear implants). Six receptive subtests of the Profiling Elements of Prosody in Speech-Communication (PEPS-C), the Child Paralanguage subtest of Diagnostic Analysis of Nonverbal Accuracy 2 (DANVA 2), and Contour and Interval subtests of the Montreal Battery of Evaluation of Amusia (MBEA) were used. Audio recordings of the children's reading samples were rated using a perceptual prosody rating scale by nine experienced listeners who were blinded to the children's hearing status. Thirty two children, 16 with hearing loss (mean age = 8.71 yr) and 16 age- and gender-matched typically developing children with normal hearing (mean age = 8.87 yr). Assessments were completed in one session lasting 1-2 hours in a quiet room. Test items were presented using a laptop computer through loudspeaker at a comfortable listening level. For children with hearing loss using hearing instruments, all tests were completed with hearing devices set at their everyday listening setting. All PEPS-C subtests and total scores were significantly lower for children with hearing loss compared to controls (p < 0.05). The hearing loss group performed more poorly than the control group in recognizing happy, sad, and fearful emotions in the DANVA 2 subtest. Musicality (composite MBEA scores and musical experience) was significantly correlated with prosody perception scores, but this link was not evident in the regression analyses. Regression modeling showed that age and hearing level (better ear pure-tone average) accounted for 55.4% and 56.7% of the variance in PEPS-C and DANVA 2 total scores, respectively. There was greater variability for the ratings of pitch, pitch variation, and overall impression of prosody in the hearing loss group compared to control group. Prosody perception (PEPS-C and DANVA 2 total scores) and ratings of prosody production were not correlated. Children with hearing loss aged 7-12 yr had significant difficulties in understanding different aspects of prosody and were rated as having more atypical prosody overall than controls. These findings suggest that clinical assessment and speech-language therapy services for children with hearing loss should be expanded to target prosodic difficulties. Future studies should investigate whether musical training is beneficial for improving receptive prosody skills. American Academy of Audiology

The Nature of Victimization among Youths with Hearing Loss in Substance Abuse Treatment

ERIC Educational Resources Information Center

Titus, Janet C.

2010-01-01

The author profiles the prevalence, severity, and characteristics of victimization among a group of youths with hearing loss presenting to substance abuse treatment. Intake data on 111 deaf and hard of hearing youths (42% female) were analyzed and compared with data from a weighted, gender-matched sample of hearing youths. After gender is…

School-to-Work Transition Performance of "Male", "Female" and "Neutral" Vocational Streams: A Gender Balance Sheet for Vocational Education Graduates in Greece

ERIC Educational Resources Information Center

Paleocrassas, Stamatis; Rousseas, Panagiotis; Vretakou, Vassilia

2003-01-01

The issue of gender-related differences in the transition of secondary vocational education graduates from school-to-work is discussed, relative to "male", "female" and "neutral" curriculum choices, using findings from a national survey of graduates. The discussion explores this issue using matched employment and…

Early Language Experience Facilitates the Processing of Gender Agreement in Spanish Heritage Speakers

ERIC Educational Resources Information Center

Montrul, Silvina; Davidson, Justin; De La Fuente, Israel; Foote, Rebecca

2014-01-01

We examined how age of acquisition in Spanish heritage speakers and L2 learners interacts with implicitness vs. explicitness of tasks in gender processing of canonical and non-canonical ending nouns. Twenty-three Spanish native speakers, 29 heritage speakers, and 33 proficiency-matched L2 learners completed three on-line spoken word recognition…

Gender reassignment surgery: an overview.

PubMed

Selvaggi, Gennaro; Bellringer, James

2011-05-01

Gender reassignment (which includes psychotherapy, hormonal therapy and surgery) has been demonstrated as the most effective treatment for patients affected by gender dysphoria (or gender identity disorder), in which patients do not recognize their gender (sexual identity) as matching their genetic and sexual characteristics. Gender reassignment surgery is a series of complex surgical procedures (genital and nongenital) performed for the treatment of gender dysphoria. Genital procedures performed for gender dysphoria, such as vaginoplasty, clitorolabioplasty, penectomy and orchidectomy in male-to-female transsexuals, and penile and scrotal reconstruction in female-to-male transsexuals, are the core procedures in gender reassignment surgery. Nongenital procedures, such as breast enlargement, mastectomy, facial feminization surgery, voice surgery, and other masculinization and feminization procedures complete the surgical treatment available. The World Professional Association for Transgender Health currently publishes and reviews guidelines and standards of care for patients affected by gender dysphoria, such as eligibility criteria for surgery. This article presents an overview of the genital and nongenital procedures available for both male-to-female and female-to-male gender reassignment.

Skeletal status and body composition in young women with functional hypothalamic amenorrhea.

PubMed

Podfigurna-Stopa, Agnieszka; Pludowski, Pawel; Jaworski, Maciej; Lorenc, Roman; Genazzani, Andrea R; Meczekalski, Blazej

2012-04-01

Functional hypothalamic amenorrhea (FHA) related to hypoestrogenism and hormonal status may influence skeletal homeostasis and body composition. The study aimed to evaluate hormones concentrations, body composition and bone strength in FHA cases. Total body scans using DXA method (DPX-L, GE Lunar) were performed in a group of 27 women aged 21.8 years ± 3.9 with FHA related to weight loss. References of healthy control subjects were used to calculate Z-scores (age and gender matched), SD-scores (height and gender matched), and SDs-scores (weight and gender matched). Whole skeleton bone mineral content (TBBMC, g) and density (TBBMD, g/cm(2)), lumbar spine (L2-L4) bone mineral density (SBMD; g/cm(2)), lean body mass (LBM, g) and fat mass (FM, g) were investigated. Relative bone strength index was calculated as the TBBMC/LBM ratio. Serum follicle-stimulating hormone (FSH), luteinizing hormone (LH), estradiol, testosterone, and prolactin (PRL) concentrations were assayed to characterize hormonal profile of FHA cases. Hormonal evaluation in patients with FHA revealed significantly decreased serum concentrations of gonadotropins and estradiol. Serum LH concentrations were 1.47 ± 0.89 mIU/ml, FSH 4.44 ± 1.94 mIU/ml. Estradiol concentrations in serum were 27.08 ± 13.10 pg/ml. As evidenced by Z-scores, FHA cases had decreased SBMD, TBBMD and TBBMC Z-scores of -1.23 ± 0.90 (p < 0.0001), -0.72 ± 0.86 (p < 0.001), and -0.90 ± 1.40 (p < 0.01), respectively. Reduced FM, LBM and FM/LBM ratio Z-scores of -1.80 ± 2.28 (p < 0.001), -0.59 ± 1.49 (p < 0.05) and -0.74 ± 1.55 (p < 0.05), but not TBBMC/LBM Z-score of -0.54 ± 2.14 (ns) were noted in FHA cases compared with healthy control cases. TBBMC, TBBMD, TBBMC/LBM when BH- or BW-matched were normal as evidenced by SD-scores and SDs-scores. SBMD remained reduced when BH-matched (SD-score = -0.40 ± 0.86; p < 0.05) whereas FM and FM/LBM were lower than expected in healthy, both compared to BH- and BW-dependent references. The length of amenorrhea in months negatively correlated with SBMD Z-score (R = -0.39, p < 0.05), and SD-scores for SBMD (R = -0.48), TBBMD (R = -0.43), TBBMC (R = -0.46) (all p < 0.05) and positively with SDs-scores for FM (R = 0.44, p < 0.05). Patients with FHA were characterized by lower concentrations of serum FSH, LH and estradiol concentrations. Moreover, FHA cases had decreased FM and an imbalanced relationship between BW, FM, and LBM. Despite reduced BMD and BMC, bone strength was not significantly affected by FHA.

"My greatest dream is to be normal": the impact of gender on the depression narratives of young Swedish men and women.

PubMed

Danielsson, Ulla E; Bengs, Carita; Samuelsson, Eva; Johansson, Eva E

2011-05-01

Depression is common among young people. Gender differences in diagnosing depression appear during adolescence. The study aim was to explore the impact of gender on depression in young Swedish men and women. Grounded theory was used to analyze interviews with 23 young people aged 17 to 25 years who had been diagnosed with depression. Their narratives were marked by a striving to be normal and disclosed strong gender stereotypes, constructed in interaction with parents, friends, and the media. Gender norms were upheld by feelings of shame, and restricted the acting space of our informants. However, we also found transgressions of these gender norms. Primary health care workers could encourage young men to open up emotionally and communicate their personal distress, and young women to be daring and assertive of their own strengths, so that both genders might gain access to the positive coping strategies practiced respectively by each.

How Needs-Reward Match and Demographic Attributes Relate to Absenteeism and Work Attitudes.

ERIC Educational Resources Information Center

Eagle, Bruce W.

1995-01-01

A study conducted in private industry (n=383) found that while flexible work arrangements and child care arrangements were not related to employee absences due to child care difficulties, employee demographic attributes, particularly age and gender, were. Both demographic factors and needs-reward match did account for some variation in job…

Referees' Decision Making about Transgressions: The Influence of Player Gender at the Highest National Level

ERIC Educational Resources Information Center

Souchon, Nicolas; Cabagno, Genevieve; Rascle, Olivier; Traclet, Alan; Dosseville, Fabrice; Maio, Gregory R.

2009-01-01

Prior research has found that referees are harsher toward sporting offenses in regional-level matches between women than in regional-level matches between men. We tested whether this bias also occurs at a higher, national level of competition, despite the greater pressures for objectivity and fairness at this level. Referees' decisions were…

The reproduction of gender norms through downsizing in later life residential relocation.

PubMed

Addington, Aislinn; Ekerdt, David J

2014-01-01

Using data collected from qualitative interviews in 36 households, this article examines people's use of social relations based on gender to perform tasks associated with residential relocation in later life. Without prompting, our respondents addressed the social relations of gender in the meanings of things, in the persons of gift recipients, and in the persons of actors accomplishing the tasks. They matched gender-typed objects to same-sex recipients, reproducing circumstances of possession and passing on expectations for gender identity. The accounts of our respondents also depicted a gendered division of household labor between husbands and wives and a gendered division of care work by daughters and sons. These strategies economized a big task by shaping decisions about who should get what and who will do what. In turn, these practices affirmed the gendered nature of possession and care work into another generation. © The Author(s) 2012.

An event-related potential study of semantic style-match judgments of artistic furniture.

PubMed

Lin, Ming-Huang; Wang, Ching-yi; Cheng, Shih-kuen; Cheng, Shih-hung

2011-11-01

This study investigates how semantic networks represent different artistic furniture. Event-related potentials (ERPs) were recorded while participants made style-match judgments for table and chair sets. All of the tables were in the Normal style, whereas the chairs were in the Normal, Minimal, ReadyMade, or Deconstruction styles. The Normal and Minimal chairs had the same rates of "match" responses, which were both higher than the rates for the ReadyMade and Deconstruction chairs. Compared with Normal chairs, the ERPs elicited by both ReadyMade chairs and Deconstruction chairs exhibited reliable N400 effects, which suggests that these two design styles were unlike the Normal design style. However, Minimal chairs evoked ERPs that were similar to the ERPs of Normal chairs. Furthermore, the N400 effects elicited by ReadyMade and Deconstruction chairs showed different scalp distributions. These findings reveal that semantic networks represent different design styles for items of the same category. Copyright © 2011 Elsevier B.V. All rights reserved.

Case Management of the Gender Incongruity Syndrome in Childhood and Adolescence

ERIC Educational Resources Information Center

Higham, Eileen

1976-01-01

Evidence from both normal and incongruous gender differentiation shows that a rehabilitative rather than a curative approach may be an effect form of treatment for some gender transpositions. The approach to gender disturbances is consonant with the American Psychiatric Association's discontinuance of defining all homosexuality as a disease.…

Central auditory processing effects induced by solvent exposure.

PubMed

Fuente, Adrian; McPherson, Bradley

2007-01-01

Various studies have demonstrated that organic solvent exposure may induce auditory damage. Studies conducted in workers occupationally exposed to solvents suggest, on the one hand, poorer hearing thresholds than in matched non-exposed workers, and on the other hand, central auditory damage due to solvent exposure. Taking into account the potential auditory damage induced by solvent exposure due to the neurotoxic properties of such substances, the present research aimed at studying the possible auditory processing disorder (APD), and possible hearing difficulties in daily life listening situations that solvent-exposed workers may acquire. Fifty workers exposed to a mixture of organic solvents (xylene, toluene, methyl ethyl ketone) and 50 non-exposed workers matched by age, gender and education were assessed. Only subjects with no history of ear infections, high blood pressure, kidney failure, metabolic and neurological diseases, or alcoholism were selected. The subjects had either normal hearing or sensorineural hearing loss, and normal tympanometric results. Hearing-in-noise (HINT), dichotic digit (DD), filtered speech (FS), pitch pattern sequence (PPS), and random gap detection (RGD) tests were carried out in the exposed and non-exposed groups. A self-report inventory of each subject's performance in daily life listening situations, the Amsterdam Inventory for Auditory Disability and Handicap, was also administered. Significant threshold differences between exposed and non-exposed workers were found at some of the hearing test frequencies, for both ears. However, exposed workers still presented normal hearing thresholds as a group (equal or better than 20 dB HL). Also, for the HINT, DD, PPS, FS and RGD tests, non-exposed workers obtained better results than exposed workers. Finally, solvent-exposed workers reported significantly more hearing complaints in daily life listening situations than non-exposed workers. It is concluded that subjects exposed to solvents may acquire an APD and thus the sole use of pure-tone audiometry is insufficient to assess hearing in solvent-exposed populations.

Gender compatibility, math-gender stereotypes, and self-concepts in math and physics

NASA Astrophysics Data System (ADS)

Koul, Ravinder; Lerdpornkulrat, Thanita; Poondej, Chanut

2016-12-01

[This paper is part of the Focused Collection on Gender in Physics.] Positive self-assessment of ability in the quantitative domains is considered critical for student participation in science, technology, engineering, and mathematics field studies. The present study investigated associations of gender compatibility (gender typicality and contentedness) and math-gender stereotypes with self-concepts in math and physics. Statistical analysis of survey data was based on a sample of 170 male and female high school science students matched on propensity scores based on age and past GPA scores in math. Results of MANCOVA analyses indicated that the combination of high personal gender compatibility with low endorsement of math-gender stereotypes was associated with low gender differentials in math and physics self-concepts whereas the combination of high personal gender compatibility with high endorsement of math-gender stereotypes was associated with high gender differentials in math and physics self-concepts. These results contribute to the recent theoretical and empirical work on antecedents to the math and physics identities critical to achieving gender equity in STEM fields.

Walking speed and peak plantar pressure distribution during barefoot walking in persons with diabetes.

PubMed

Ko, Mansoo; Hughes, Lynne; Lewis, Harriet

2012-03-01

The impact of walking speed has not been evaluated as a feasible outcome measure associated with peak plantar pressure (PPP) distribution, which may result in tissue damage in persons with diabetic foot complications. The objective of this pilot study was to determine the walking speed and PPP distribution during barefoot walking in persons with diabetes.   Nine individuals with diabetes and nine age-gender matched individuals without diabetes participated in this study. Each individual was marked at 10 anatomical landmarks for vibration and tactile pressure sensation tests to determine the severity of sensory deficits on the plantar surface of the dominant limb foot. A steady state walking speed, PPP, the fore and rear foot (F/R) PPP ratio and gait variables were measured during barefoot walking.   Persons with diabetes had a significantly slower walking speed than the age-gender matched group resulting in a significant reduction of PPP at the F/R foot during barefoot walking (p < 0.05). There was no significant difference in F/R foot PPP ratio in the diabetic group compared with the age-gender matched group during barefoot walking (p > 0.05). There was a significant difference between the diabetic and non-diabetic groups for cadence, step time, toe out angle and the anterior-posterior excursion (APE) for centre of force (p < 0.05).   Walking speed may be a potential indicator for persons with diabetes to identify PPP distribution during barefoot walking in a diabetic foot. However, the diabetic group demonstrated a more cautious walking pattern than the age-gender matched group by decreasing cadence, step length and APE, and increasing step time and toe in/out angle. People with diabetes may reduce the risk of foot ulcerations as long as they are able to prevent severe foot deformities such as callus, hammer toe or charcot foot. Copyright © 2011 John Wiley & Sons, Ltd.

The aging population: imperative to uncouple sex and gender to establish "gender equal" health care.

PubMed

Bachmann, Gloria A; Mussman, Brianna

2015-04-01

The transgender community has long been marginalized in society. As the world's population ages, gender-unbiased health services for this growing population, with age-related chronic illnesses, will be essential. To optimally eliminate hurdles that trans individuals often confront when requesting services, it appears judicious to eliminate the strict and antiquated definition of what constitutes "normal" female and "normal" male. A review of literature on transgender medicine on PubMed over the last five years was conducted. Existing statistics indicate that unacceptable bias and discrimination are occurring, making trans patients less likely to seek care. There are emerging initiatives that address the transgender and gender non-conforming population. Ongoing needs include defining what constitutes "gender equal," understanding the continuum of gender identity, and establishing and implementing guidelines for gender equal counseling and care. With the routine practice of defining sex at birth and equating sex with gender in the health care setting, the transgender patient encounters multiple barriers to accessing and acquiring health care services. These strict gender labels appear to preclude the institution of gender equal care. Care templates on gender equal patient encounters should be implemented to better address transgender health needs in a non-biased manner. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Attention-deficit/hyperactivity disorder: the impact of methylphenidate on working memory, inhibition capacity and mental flexibility.

PubMed

Bolfer, Cristiana; Pacheco, Sandra Pasquali; Tsunemi, Miriam Harumi; Carreira, Walter Souza; Casella, Beatriz Borba; Casella, Erasmo Barbante

2017-04-01

To compare children with attention-deficit/hyperactivity disorder (ADHD), before and after the use of methylphenidate, and a control group, using tests of working memory, inhibition capacity and mental flexibility. Neuropsychological tests were administrated to 53 boys, 9-12 years old: the WISC-III digit span backward, and arithmetic; Stroop Color; and Trail Making Tests. The case group included 23 boys with ADHD, who were combined type, treatment-naive, and with normal intelligence without comorbidities. The control group (n = 30) were age and gender matched. After three months on methylphenidate, the ADHD children were retested. The control group was also retested after three months. Before treatment, ADHD children had lower scores than the control group on the tests (p ≤ 0.001) and after methylphenidate had fewer test errors than before (p ≤ 0.001). Methylphenidate treatment improves the working memory, inhibitory control and mental flexibility of ADHD boys.

An assessment of WISC-IIIUK on children with HIV infection.

PubMed

James, Anu Nikitha; Ittyerah, Miriam

2016-10-01

The Wechsler Intelligence Scale for Children - Third Edition UK test was administered to groups of children between the ages of 6 and 12 years with vertically transmitted HIV infection (n = 70) and a control group who were not infected by the virus (n = 70). The study was conducted in India. The two groups were matched for general verbal abilities, age and gender. The children were assessed for Verbal IQ, Performance IQ and Full-Scale IQ. The Verbal Comprehension Index, Perceptual Organization Index and Freedom from Distractibility Index were also obtained. A three-factor analysis of variance disclosed that school-age children with vertically transmitted HIV infection notched below in the areas of Verbal IQ, Performance IQ, Full-Scale IQ, Verbal Comprehension Index, Perceptual Organization Index and Freedom from Distractibility Index when collated with normal uninfected cohorts. Findings are discussed in the light of both theoretical and clinical implications. © The Author(s) 2015.

Analysis of anatomic variability in children with low mathematical skills

NASA Astrophysics Data System (ADS)

Han, Zhaoying; Fuchs, Lynn; Davis, Nikki; Cannistraci, Christopher J.; Anderson, Adam W.; Gore, John C.; Dawant, Benoit M.

2008-03-01

Mathematical difficulty affects approximately 5-9% of the population. Studies on individuals with dyscalculia, a neurologically based math disorder, provide important insight into the neural correlates of mathematical ability. For example, cognitive theories, neuropsychological studies, and functional neuroimaging studies in individuals with dyscalculia suggest that the bilateral parietal lobes and intraparietal sulcus are central to mathematical performance. The purpose of the present study was to investigate morphological differences in a group of third grade children with poor math skills. We compare population averages of children with low math skill (MD) to gender and age matched controls with average math ability. Anatomical data were gathered with high resolution MRI and four different population averaging methods were used to study the effect of the normalization technique on the results. Statistical results based on the deformation fields between the two groups show anatomical differences in the bilateral parietal lobes, right frontal lobe, and left occipital/parietal lobe.

[Research on brain white matter network in cerebral palsy infant].

PubMed

Li, Jun; Yang, Cheng; Wang, Yuanjun; Nie, Shengdong

2017-10-01

Present study used diffusion tensor image and tractography to construct brain white matter networks of 15 cerebral palsy infants and 30 healthy infants that matched for age and gender. After white matter network analysis, we found that both cerebral palsy and healthy infants had a small-world topology in white matter network, but cerebral palsy infants exhibited abnormal topological organization: increased shortest path length but decreased normalize clustering coefficient, global efficiency and local efficiency. Furthermore, we also found that white matter network hub regions were located in the left cuneus, precuneus, and left posterior cingulate gyrus. However, some abnormal nodes existed in the frontal, temporal, occipital and parietal lobes of cerebral palsy infants. These results indicated that the white matter networks for cerebral palsy infants were disrupted, which was consistent with previous studies about the abnormal brain white matter areas. This work could help us further study the pathogenesis of cerebral palsy infants.

Quality of life assessment in ocular toxoplasmosis in a Colombian population.

PubMed

de-la-Torre, Alejandra; González-López, Gilberto; Montoya-Gutiérrez, Johanna Milena; Marín-Arango, Viviana; Gómez-Marín, Jorge Enrique

2011-08-01

To assess the quality of life in patients with ocular toxoplasmosis. The participants were 29 otherwise healthy patients with retinochoroidal lesions consistent with Toxoplasma infection. The controls were 29 gender and age-matched people with normal visual function who came from the same socioeconomic and educational background as the participants. The authors used the version of the National Eye Institute 25-item visual function questionnaire (NEI VFQ25). Patients with ocular toxoplasmosis had statistically significant lower scores than controls for all the subscales, except for color vision. Patients with bilateral lesions were more affected in the mental health, difficulties role, and specific vision subscales. The median of the compound score for the participants was 79 (range 35-99) and for the controls was 95 (range 72-98). People with ocular toxoplasmosis have worse vision-related quality of life than people without the condition, especially if they have bilateral lesions and more recurrences.

Micronuclei and other nuclear anomalies in normal human buccal mucosa cells of oral cancer patients undergoing radiotherapy: a field effect.

PubMed

Tak, A; Metgud, R; Astekar, M; Tak, M

2014-08-01

We evaluated micronuclei and other nuclear anomalies in exfoliated epithelial cells of the oral cavity on the side opposite the lesion targeted by radiotherapy and correlated them with radiation doses. Buccal smears were obtained from oral cancer patients undergoing radiotherapy with a cumulative dose of at least 1000 rad for 3 weeks and from controls matched for age, gender and habits. The exfoliated cells from the mucosa were collected using a cytobrush; smears were prepared, fixed in 80% methanol and stained using the Feulgen plus fast green method. The mean number of micronuclei and other nuclear anomalies/1000 cells was significantly greater in patients undergoing radiotherapy treatment, but the differences were not significant compared to radiation doses. It appears that radiotherapy has a potent clastogenic effect on buccal mucosal cells of oral cancer patients.

[Influence of three booster doses hepatitis B vaccine on the persistence of immune-protection among infants with normal and high antibody response to primary vaccination: a matched case-control study].

PubMed

Feng, Yi; Lyu, Jingjing; Liu, Jiaye; Yan, Bingyu; Song, Lizhi; Liang, Xiaofeng; Li, Li; Zhang, Guomin; Wang, Fuzhen; Zhang, Li; Xu, Aiqiang

2016-04-01

To examine the influence of three-booster-doses hepatitis B vaccines on children with normal and high antibody response to primary vaccination. Antibody against hepatitis B surface antigen (anti-HBs) were detected after primary vaccination and children with normal or high response to hepatitis B primary vaccination at infancy, were identified. Children who were given three booster doses were selected to form the booster group and who were given no booster dose were 1∶1 matched with the same gender and residence to form the control group. Blood samples were obtained from all the participants and tested for anti-HBs and anti-HBc, 5 years after the primary vaccination. The positive rates of anti-HBs response to primary vaccination were 97.39% (224/230, 95% CI: 94.41%-99.04%) in the booster group and 53.91% (124/230, 95% CI: 47.24%-60.48%) in the control group (P<0.05), 5 years after the primary vaccination. Geometric mean concentration (GMC) of anti-HBs were 1 140.02 (887.46-1 464.46) mIU/ml in the booster group and 11.53 (8.73-15.23) mIU/ml in the control group (P<0.05). The prevalence rates of breakthrough HBV infection were 0.87% (2/230) in the booster group and 2.17%(5/230) in the control group (P>0.05). RESULTS from the multivariable analysis showed that the booster doses (OR=38.75, 95%CI: 16.23-92.54) and the level of anti-HBs after the primary vaccination (OR =3.06, 95%CI:1.51-6.17) were independently associated with the positive rates of anti-HBs, 5 years after the primary vaccination (P<0.05). Programs with three booster doses to children that showing normal and high antibody response to primary vaccination could improve the persistence of anti-HBs but possibly would not be able to prevent the HBV infection.

Gender Verification of Female Olympic Athletes.

ERIC Educational Resources Information Center

Dickinson, Barry D.; Genel, Myron; Robinowitz, Carolyn B.; Turner, Patricia L.; Woods, Gary L.

2002-01-01

Gender verification of female athletes has long been criticized by geneticists, endocrinologists, and others in the medical community. Recently, the International Olympic Committee's Athletic Commission called for discontinuation of mandatory laboratory-based gender verification of female athletes. This article discusses normal sexual…

Erosive Esophagitis in the Obese: The Effect of Ethnicity and Gender on Its Association.

PubMed

Abraham, Albin; Lipka, Seth; Hajar, Rabab; Krishnamachari, Bhuma; Virdi, Ravi; Jacob, Bobby; Viswanathan, Prakash; Mustacchia, Paul

2016-01-01

Background. Data examining the association between obesity and erosive esophagitis (ErE) have been inconsistent, with very little known about interracial variation. Goals. To examine the association between obesity and ErE among patients of different ethnic/racial backgrounds. Methods. The study sample included 2251 patients who underwent esophagogastroduodenoscopy (EGD). The effects of body mass index (BMI) on ErE were assessed by gender and in different ethnic groups. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using multivariate logistic regression analysis. Results. The prevalence of ErE was 29.4% (661/2251). Overweight and obese subjects were significantly more likely to have ErE than individuals with a normal BMI, with the highest risk seen in the morbidly obese (OR 6.26; 95% CI 3.82-10.28; p < 0.0001). Normal weight Black patients were less likely to have ErE as compared to Caucasians (OR 0.46; 95% CI 0.27-0.79; p = 0.005), while the odds ratio comparing normal weight Hispanics to normal weight Whites was not statistically significant. No effect modification was seen between BMI and race/ethnicity or BMI and gender. Significant trends were seen in each gender and ethnicity. Conclusions. The effect of BMI on ErE does not appear to vary by race/ethnicity or gender.

Does gender impact upon application rejection rate among Canadian radiology residency applicants?

PubMed

Baerlocher, Mark O; Walker, Michelle

2005-10-01

To determine if and how gender ratios have changed within Canadian radiology, and to determine if gender discrimination occurs at the level of the radiology resident selection committee. The Canadian Medical Association, Canadian Association of Radiologists, Canadian Institute for Health Information, Royal College of Physicians and Surgeons of Canada, and Canadian Residency Matching Service provided gender-specific data. We compared the proportion of female applicants who ranked a radiology program as their top choice and were rejected from any radiology program with the corresponding proportion for male applicants. The numbers of women and men being awarded an MD from a Canadian university equalized nearly a decade ago. Women continue to be numerically underrepresented among practicing radiologists; however, the proportion of women continues to increase so that there is 1 female radiologist in practice to every 3 male radiologists in practice in 2005. More male medical students ranked a radiology residency training program as their top choice in the residency match; however, of those who did, they were as likely as women to be rejected from a radiology residency training program. Grouping all female and male graduating medical students participating in the residency match and ranking a radiology residency as their top choice between 1993 and 2004, the odds of men being rejected were 1.4 times (95% CI 0.99-1.9, p = 0.07) greater than for women. There continues to be more men than women radiologists in practice; however, the female-to-male ratio continues to increase. Our data suggest that discrimination against female applicants at the level of radiology residency selection does not occur.

Mitotane treatment in patients with adrenocortical cancer causes central hypothyroidism.

PubMed

Russo, Marco; Scollo, Claudia; Pellegriti, Gabriella; Cotta, Oana Ruxandra; Squatrito, Sebastiano; Frasca, Francesco; Cannavò, Salvatore; Gullo, Damiano

2016-04-01

Mitotane, a steroidogenesis inhibitor with adrenolytic properties used to treat adrenocortical cancer (ACC), can affect thyroid function. A reduction of FT4 levels with normal FT3 and TSH has been described in these patients. Using an in vitro murine model, the secretory capacity of thyrotrophic cells has been shown to be inhibited by mitotane. To investigate the pathogenesis of thyroid abnormalities in mitotane-treated patients with ACC. In five female patients with ACC (median age 47; range 31-65) treated with mitotane (dosage 1·5 g/day; 1·0-3·0), we analysed the pattern of TSH and thyroid function index (FT4, FT3 and FT3/FT4 ratio) compared to an age- and gender-matched control group. The in vivo secretory activity of the thyrotrophic cells was evaluated using a standard TRH test (200 μg), and the response was compared to both a group of age-matched female controls (n = 10) and central hypothyroid patients (n = 10). Basal TSH (median 1·54 mU/l; range 1·20-2·17) was normal and scattered around our median reference value, FT3 levels (median 3·80 pmol/l; 3·30-4·29) were normal but below the median reference value of 4·37 pmol/l and FT4 levels were below the normal range in all patients (median 8·40 pmol/l; 7·6-9·9). FT3/FT4 ratio was in the upper range in 4 patients and higher than normal in one patient. A blunted TSH response to TRH was observed in mitotane-treated patients. ΔTSH (absolute TSH response, peak TSH minus basal TSH) was 3·65 (range 3·53-5·26), 12·37 (range 7·55-19·97) and 1·32 mU/l (range 0·52-4·66) in mitotane-treated patients, controls and central hypothyroid patients, respectively. PRL secretion was normal. Mitotane-treated patients with ACC showed low FT4, normal FT3 and TSH and impaired TSH response to TRH, characteristic of central hypothyroidism. Furthermore, the elevated FT3/FT4 ratio of these subjects reflects an enhanced T4 to T3 conversion rate, a compensatory mechanism characteristic of thyroid function changes observed in hypothyroid conditions. This finding thus confirms in vitro studies and may have a therapeutic implication for treatment with thyroid hormones, as suggested by current guidelines for this specific condition. © 2015 John Wiley & Sons Ltd.

Characteristics Expected in Fields of Higher Education and Gender Stereotypical Traits Related to Academic Success: A Mirror Effect

ERIC Educational Resources Information Center

Verniers, Catherine; Martinot, Delphine

2015-01-01

The aim of the present study was to test whether the content of a gender stereotype concerning general academic achievement matched the characteristics deemed to predict success in the fields of higher education dominated by women and men respectively. A sample of 207 undergraduate students rated the extent to which characteristics ascribed to…

A spline-based regression parameter set for creating customized DARTEL MRI brain templates from infancy to old age.

PubMed

Wilke, Marko

2018-02-01

This dataset contains the regression parameters derived by analyzing segmented brain MRI images (gray matter and white matter) from a large population of healthy subjects, using a multivariate adaptive regression splines approach. A total of 1919 MRI datasets ranging in age from 1-75 years from four publicly available datasets (NIH, C-MIND, fCONN, and IXI) were segmented using the CAT12 segmentation framework, writing out gray matter and white matter images normalized using an affine-only spatial normalization approach. These images were then subjected to a six-step DARTEL procedure, employing an iterative non-linear registration approach and yielding increasingly crisp intermediate images. The resulting six datasets per tissue class were then analyzed using multivariate adaptive regression splines, using the CerebroMatic toolbox. This approach allows for flexibly modelling smoothly varying trajectories while taking into account demographic (age, gender) as well as technical (field strength, data quality) predictors. The resulting regression parameters described here can be used to generate matched DARTEL or SHOOT templates for a given population under study, from infancy to old age. The dataset and the algorithm used to generate it are publicly available at https://irc.cchmc.org/software/cerebromatic.php.

Impact of Having a Mentally Disabled Child in the Family on the Oral Health of the Healthy Sibling: A Comparative Study.

PubMed

Chauhan, Astha; Nagarajappa, Sandesh; Dasar, Pralhad L; Mishra, Prashant

To determine and compare oral health status, knowledge and attitude among siblings of mentally disabled with siblings of normal healthy children. 240 study subjects consisting of 120 each of siblings of mentally disabled and normal, healthy children (control group) matched for age and gender were selected by convenience sampling. Oral health was assessed using the WHO-1997 proforma. A pretested questionnaire (30 items) was used for oral health knowledge and attitude assessment. Statistical analysis was performed using the chi-squared and Mann-Whitney tests. Caries prevalence among the siblings of mentally disabled and control group was 82% (mean DMFT 1.68 ± 1.18) and 45% (mean DMFT 0.58 ± 0.72), respectively (p < 0.05). The siblings of mentally disabled children also showed good oral health knowledge (mean 7.1 ± 1.4) and a positive attitude (p < 0.05). Siblings of mentally disabled children showed higher caries experience. Knowledge and attitude towards oral health was comparatively good among siblings of mentally disabled children. They exhibited favourable attitudes and involvement in helping their sibling to maintain oral health.

The Pattern Glare Test: a review and determination of normative values.

PubMed

Evans, B J W; Stevenson, S J

2008-07-01

Pattern glare is characterised by symptoms of visual perceptual distortions and visual stress on viewing striped patterns. People with migraine or Meares-Irlen syndrome (visual stress) are especially prone to pattern glare. The literature on pattern glare is reviewed, and the goal of this study was to develop clinical norms for the Wilkins and Evans Pattern Glare Test. This comprises three test plates of square wave patterns of spatial frequency 0.5, 3 and 12 cycles per degree (cpd). Patients are shown the 0.5 cpd grating and the number of distortions that are reported in response to a list of questions is recorded. This is repeated for the other patterns. People who are prone to pattern glare experience visual perceptual distortions on viewing the 3 cpd grating, and pattern glare can be quantified as either the sum of distortions reported with the 3 cpd pattern or as the difference between the number of distortions with the 3 and 12 cpd gratings, the '3-12 cpd difference'. In study 1, 100 patients consulting an optometrist performed the Pattern Glare Test and the 95th percentile of responses was calculated as the limit of the normal range. The normal range for the number of distortions was found to be <4 on the 3 cpd grating and <2 for the 3-12 cpd difference. Pattern glare was similar in both genders but decreased with age. In study 2, 30 additional participants were given the test in the reverse of the usual testing order and were compared with a sub-group from study 1, matched for age and gender. Participants experienced more distortions with the 12 cpd grating if it was presented after the 3 cpd grating. However, the order did not influence the two key measures of pattern glare. In study 3, 30 further participants who reported a medical diagnosis of migraine were compared with a sub-group of the participants in study 1 who did not report migraine or frequent headaches, matched for age and gender. The migraine group reported more symptoms on viewing all gratings, particularly the 3 cpd grating. The only variable to be significantly different between the groups was the 3-12 cpd difference. In conclusion, people have an abnormal degree of pattern glare if they have a Pattern Glare Test score of >3 on the 3 cpd grating or a score of >1 on the 3-12 cpd difference. The literature suggests that these people are likely to have visual stress in everyday life and may therefore benefit from interventions designed to alleviate visual stress, such as precision tinted lenses.

Screening of egocentric and unemotional characteristics in incarcerated and community children.

PubMed

Scholte, E M; Stoutjesdijk, R; Van Oudheusden, M A G; Lodewijks, H; Van der Ploeg, J D

2010-01-01

A two-dimensional instrument to screen egocentric and unemotional traits in children was tested in this study, and the associations with the aggressive and the antisocial symptoms of conduct disorder were determined. To this end the narcissistic-egocentric and callous-unemotional characteristics associated with psychopathy were, along with the symptoms of conduct disorder, rated by teachers in a general community sample of 1179 four-to-eighteen-year-old Dutch children, and by professional care takers in a sample of 145 twelve-to eighteen-year-old incarcerated adolescents. Confirmatory factor analysis showed that the ratings of the psychopathic characteristics indeed clustered into a dimension with egocentric characteristics and a dimension with unemotional characteristics. Both dimensions were reliable and stable across age and gender groups. In both samples aggressive behavior was primarily linked to the interaction of egocentric and unemotional characteristics, while antisocial behavior was primarily linked to egocentric characteristics only. The incarcerated adolescents showed substantially more characteristics on both psychopathic dimensions than a comparable age and gender matched group with adolescents from the general community sample. The discrimination between normal and incarcerated adolescent youngsters and the linkage with aggressive behavior suggests the existence of a subtype of conduct disordered children displaying narcissism, deficient affect and disruptive social problem behavior.

Epidemiologic Study of Malassezia Yeasts in Patients with Malassezia Folliculitis by 26S rDNA PCR-RFLP Analysis

PubMed Central

Ko, Jong Hyun; Choe, Yong Beom; Ahn, Kyu Joong

2011-01-01

Background So far, studies on the inter-relationship between Malassezia and Malassezia folliculitis have been rather scarce. Objective We sought to analyze the differences in body sites, gender and age groups, and to determine whether there is a relationship between certain types of Malassezia species and Malassezia folliculitis. Methods Specimens were taken from the forehead, cheek and chest of 60 patients with Malassezia folliculitis and from the normal skin of 60 age- and gender-matched healthy controls by 26S rDNA PCR-RFLP. Results M. restricta was dominant in the patients with Malassezia folliculitis (20.6%), while M. globosa was the most common species (26.7%) in the controls. The rate of identification was the highest in the teens for the patient group, whereas it was the highest in the thirties for the control group. M. globosa was the most predominant species on the chest with 13 cases (21.7%), and M. restricta was the most commonly identified species, with 17 (28.3%) and 12 (20%) cases on the forehead and cheek, respectively, for the patient group. Conclusion Statistically significant differences were observed between the patient and control groups for the people in their teens and twenties, and in terms of the body site, on the forehead only. PMID:21747616

Indirect Estimates of Jaw Muscle Tension in Children with Suspected Hypertonia, Children with Suspected Hypotonia, and Matched Controls

ERIC Educational Resources Information Center

Connaghan, Kathryn P.; Moore, Christopher A.

2013-01-01

Purpose: In this study, the authors compared indirect estimates of jaw-muscle tension in children with suspected muscle-tone abnormalities with age- and gender-matched controls. Method: Jaw movement and muscle activation were measured in children (ages 3 years, 11 months, to 10 years) with suspected muscle-tone abnormalities (Down syndrome or…

Impact of age and gender interaction on circulating endothelial progenitor cells in healthy subjects.

PubMed

Rousseau, Alexandra; Ayoubi, Fida; Deveaux, Christel; Charbit, Beny; Delmau, Catherine; Christin-Maitre, Sophie; Jaillon, Patrice; Uzan, Georges; Simon, Tabassome

2010-02-01

To assess the level of circulating endothelial progenitor cells (CEPC) in cycling women compared with men and menopausal women. Controlled clinical study. Healthy, nonsmoking volunteers. Twelve women, aged 18-40 years, with regular menstrual cycles, 12 menopausal women, and two groups of 12 age-matched men were recruited. Women did not receive any hormone therapy. Collection of 20 mL of peripheral blood. The number of CEPC, defined as (Lin-/7AAD-/CD34+/CD133+/KDR+) cells per 10(6) mononuclear cells (MNC), was measured by flow cytometry. The number of CEPC was significantly higher in cycling women than in age-matched men and menopausal women (26.5 per 10(6) MNC vs. 10.5 per 10(6) MNC vs. 10 per 10(6) MNC, respectively). The number of CEPC was similar in menopausal women, age-matched, and young men. The number of CEPC is influenced by an age-gender interaction. This phenomenon may explain in part the better vascular repair and relative cardiovascular protection in younger women as compared with age-matched men. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Sporadic occurrence of completely lateralized vertex sharp transients of sleep is a normal phenomenon: a retrospective, blinded, case-control study.

PubMed

Brenton, J Nicholas; Mytinger, John R

2015-04-01

Vertex sharp transients (VSTs) of sleep often lateralize to the left or right frontocentral regions and can be mistaken as epileptiform. The aim of this study was to determine the prevalence of completely lateralized VSTs in pediatric-aged individuals and to assess their significance by comparing cohorts with and without epilepsy. The authors hypothesized that completely lateralized VSTs are normal and occur with similar frequencies in patients with and without epilepsy. The authors conducted a retrospective, blinded, case-control study comparing completely lateralized VSTs within a 5-minute EEG sleep epoch between cohorts of 100 patients with epilepsy and 100 age- and gender-matched controls. The number of patients with completely lateralized VSTs was not significantly different between cases (62%) and controls (65%) (P = 0.66). The median number of completely lateralized VSTs was small but not significantly different between cases (median 3) and controls (median 4) (P = 0.11). The presence of completely lateralized VSTs in cases (generalized vs. focal epilepsy) was not significantly different (P > 0.95). This is the first systematic study of the prevalence and significance of completely lateralized VSTs of sleep. This study provides class III evidence that completely lateralized VSTs, occurring in a sporadic fashion, are a normal phenomenon and should not be confused with epileptiform discharges.

Disruptions of brain structural network in end-stage renal disease patients with long-term hemodialysis and normal-appearing brain tissues.

PubMed

Chou, Ming-Chung; Ko, Chih-Hung; Chang, Jer-Ming; Hsieh, Tsyh-Jyi

2018-05-04

End-stage renal disease (ESRD) patients on hemodialysis were demonstrated to exhibit silent and invisible white-matter alterations which would likely lead to disruptions of brain structural networks. Therefore, the purpose of this study was to investigate the disruptions of brain structural network in ESRD patients. Thiry-three ESRD patients with normal-appearing brain tissues and 29 age- and gender-matched healthy controls were enrolled in this study and underwent both cognitive ability screening instrument (CASI) assessment and diffusion tensor imaging (DTI) acquisition. Brain structural connectivity network was constructed using probabilistic tractography with automatic anatomical labeling template. Graph-theory analysis was performed to detect the alterations of node-strength, node-degree, node-local efficiency, and node-clustering coefficient in ESRD patients. Correlational analysis was performed to understand the relationship between network measures, CASI score, and dialysis duration. Structural connectivity, node-strength, node-degree, and node-local efficiency were significantly decreased, whereas node-clustering coefficient was significantly increased in ESRD patients as compared with healthy controls. The disrupted local structural networks were generally associated with common neurological complications of ESRD patients, but the correlational analysis did not reveal significant correlation between network measures, CASI score, and dialysis duration. Graph-theory analysis was helpful to investigate disruptions of brain structural network in ESRD patients with normal-appearing brain tissues. Copyright © 2018. Published by Elsevier Masson SAS.

Cerebrovascular Smooth Muscle Actin Is Increased in Non-Demented Subjects with Frequent Senile Plaques at Autopsy: Implications for the Pathogenesis of Alzheimer Disease

PubMed Central

Hulette, Christine M.; Ervin, John F.; Edmonds, Yvette; Antoine, Samantha; Stewart, Nicolas; Szymanski, Mari H.; Hayden, Kathleen M; Pieper, Carl F.; Burke, James R.; Welsh-Bohmer, Kathleen A.

2009-01-01

We previously found that vascular smooth muscle actin (SMA) is reduced in the brains of patients with late stage Alzheimer disease (AD) compared to brains of non-demented, neuropathologically normal subjects. To assess the pathogenetic significance and disease specificity of this finding, we studied 3 additional patient groups: non-demented subjects without significant AD type pathology (“Normal”, n = 20); non-demented subjects with frequent senile plaques at autopsy (“Preclinical AD”, n = 20); and subjects with frontotemporal dementia, (“FTD”, n = 10). The groups were matched for gender and age with those previously reported; SMA immunohistochemistry and image analysis were performed as previously described. Surprisingly, SMA expression in arachnoid, cerebral cortex and white matter arterioles was greater in the Preclinical AD group than in the Normal and FTD groups. The plaques were not associated with amyloid angiopathy or other vascular disease in this group. SMA expression in the brains of the Normal group was intermediate between the Preclinical AD and FTD groups. All 3 groups exhibited much greater SMA expression than in our previous report. The presence of frequent plaques and increased arteriolar SMA expression in the brains of non-demented subjects suggest that increased SMA expression might represent a physiologic response to neurodegeneration that could prevent or delay overt expression dementia in AD. PMID:19287310

Quantitative Balance and Gait Measurement in Patients with Frontotemporal Dementia and Alzheimer Diseases: A Pilot Study

PubMed Central

Velayutham, Selva Ganapathy; Chandra, Sadanandavalli Retnaswami; Bharath, Srikala; Shankar, Ravi Girikamatha

2017-01-01

Introduction: Alzhiemers disease and Frontotemporal dementia are common neurodegenerative dementias with a wide prevalence. Falls are a common cause of morbidity in these patients. Identifying subclinical involvement of these parameters might serve as a tool in differential analysis of these distinct parameters involved in these conditions and also help in planning preventive strategies to prevent falls. Patients and Methods: Eight patients in age and gender matched patients in each group were compared with normal controls. Standardizes methods of gait and balance aseesment were done in all persons. Results: Results revealed subclinical involvement of gait and balancesin all groups specially during divided attention. The parameters were significantly more affected in patients. Patients with AD and FTD had involement of over all ambulation index balance more affected in AD patients FTD patients showed step cycle, stride length abnormalities. Discussion: There is balance and gait involvement in normal ageing as well as patients with AD and FTD. The pattern of involvement in AD correlates with WHERE pathway involvement and FTD with frontal subcortical circuits involvement. Conclusion: Identification the differential patterns of involvement in subclinical stage might help to differentiate normal ageing and the different types of cortical dementias. This could serve as an additional biomarker and also assist in initiating appropriate training methods to prevent future falls. PMID:28515555

Immunolocalization of glioma-associated oncogene homolog 1 in non melanoma skin cancer.

PubMed

Bakry, Ola Ahmed; Samaka, Rehab Monir; Shoeib, Mohamed Abdel Moneim; Megahed, Doaa Mohamed

2015-04-01

Glioma-associated oncogene homolog (GLI)1 is involved in controlling cell proliferation and angiogenesis. The aim of this work was to explore its possible role in non-melanoma skin cancer pathogenesis through its immunohistochemical (IHC) expression in skin biopsies of these diseases and correlating this expression with the clinico-pathological parameters of the studied cases. Seventy-six cutaneous specimens were studied; 30 cases with basal cell carcinoma (BCC), 30 cases with squamous cell carcinoma (SCC) and 16 normal skin samples, from age- and gender-matched subjects, as a control group. GLI1 was expressed in all BCC cases and in 60% of SCC cases. All SCC cases showed cytoplasmic, while 70% of BCC cases showed nucleocytoplasmic immunoreactivity. It was over expressed in BCC and SCC compared to normal skin (p = 0.01 and 0.0006, respectively). Higher Histo (H) score in BCC cases was significantly associated with female gender (p = 0.04), multiple lesions, desmoplastic stromal reaction and stromal angiogenesis (p < 0.001 for all). Higher H score in SCC cases was significantly associated with scalp location, nodular type, recurrent lesions, high tumor grade, lymphovascular invasion (p = 0.004 for all), inflammatory stromal reaction (p = 0.01), lymph node involvement and absence of calcification (p = 0.001 for both). In conclusion, GLI1 may play a role in BCC pathogenesis through its role in cell proliferation, migration, and angiogenesis. Its upregulation and cytoplasmic localization in SCC may suggest that its role in tumor pathogenesis is through mechanisms other than Hedgehog pathway activation. Further studies are needed to clarify the exact molecular basis of its oncogenic action.

Plasma urocortin in human systolic heart failure.

PubMed

Ng, Leong L; Loke, Ian W; O'Brien, Russell J; Squire, Iain B; Davies, Joan E

2004-04-01

Urocortin (UCN), a member of the corticotrophin-releasing factor family, is expressed in heart, brain and gut. UCN has potent cardiostimulatory, cardioprotective, vasodilator and diuretic/natriuretic effects, and cardiac UCN expression is increased in heart failure (HF). In the present study, we investigated plasma levels of UCN in 119 patients with HF and 212 age- and gender-matched controls to clarify its relationship with gender and disease severity. UCN was elevated in HF [normal males, 19.5 (3.9-68.8) pmol/l and HF males, 50.2 (6.9-108.2) pmol/l, P < 0.0005; normal females, 14.2 (3.9-53.5) pmol/l and HF females, 21.8 (3.9-112.5) pmol/l, P < 0.001; values are medians (range)]. The relative increase was greater in males than females ( P < 0.03). UCN fell with increasing age, especially in HF patients ( r(s) = -0.56, P < 0.0005) and with increasing New York Heart Association (NYHA) class ( r(s) = -0.55, P < 0.0005). The fall in UCN levels with increasing NYHA class was reinforced by a significant correlation between UCN and ejection fraction ( r(s) = 0.45, P < 0.0005) in HF patients. Although receiver operating characteristic (ROC) curves for diagnosis of all HF cases yielded an area under the curve (AUC) of 0.76, ROC AUCs for patients with early HF (NYHA class I and II) were better (0.91). ROC AUCs for logistic models incorporating N-terminal probrain natriuretic peptide (N-BNP) and UCN were better than either peptide alone. In conclusion, plasma UCN is elevated in HF, especially in its early stages. Its decline with increasing HF severity may expedite disease progression due to diminished cardioprotective/anti-inflammatory effects. UCN measurement may also complement N-BNP in the diagnosis of early HF.

Differences in dynamic balance scores in one sport versus multiple sport high school athletes.

PubMed

Gorman, Paul P; Butler, Robert J; Rauh, Mitchell J; Kiesel, Kyle; Plisky, Phillip J

2012-04-01

Researchers have previously reported on the importance of dynamic balance in assessing an individual's risk for injury during sport. However, to date there is no research on whether multiple sport participation affects dynamic balance ability. Therefore, the purpose of this study was to determine if there was a difference in dynamic balance scores in high school athletes that competed in one sport only as compared athletes who competed in multiple sports, as tested by the Lower Quarter Y Balance Test (YBT-LQ). Ninety-two high school athletes who participated in one sport were matched, by age, gender and sport played, to athletes who participated in the same sport as well as additional sports. All individuals were assessed using the YBT-LQ to examine differences in composite reach score and reach direction asymmetry between single sport and multiple sport athletes. The greatest reach distance of three trials in each reach direction for right and left lower-extremities was normalized by limb length and used for analysis. A two-way ANOVA (gender x number of sports played) was used to statistically analyze the variables in the study. No significant interactions or main effects related to number of sports played were observed for any YBT-LQ score (p>0.05). Male athletes exhibited significantly greater normalized reach values for the posteromedial, posterolateral, and composite reach while also exhibiting a larger anterior reach difference when compared to the females. Athletes who participated in multiple sports had similar performances on the YBT-LQ when compared to athletes who participated in a single sport. The findings of this study suggest that the number of sports played by a high school athlete does not need to be controlled for when evaluating dynamic balance with the YBT-LQ.

Color matches in diseased eyes with good acuity: detection of deficits in cone optical density and in chromatic discrimination

NASA Astrophysics Data System (ADS)

Swanson, William H.; Fish, Gary E.

1995-10-01

Reduced foveal cone optical density in diseased eyes with normal acuity can affect color matches. Using field diameters of 1 deg, 2 deg, 4 deg, and 8 deg, we measured mean color-match midpoints and match widths in patients who had good acuity and who hereditary macular degeneration ( n=12 ), retinitis pigmentosa ( n=19 ), and glaucoma ( n=18 ). Results were compared with those for normal observers of comparable ages. Mean color-match midpoints were abnormal only for the population with hereditary macular degeneration, indicating a reduction in cone optical density in the central 4 deg. Mean color-match widths were enlarged for both hereditary macular degeneration and retinitis pigmentosa, a result consistent with a reduction in the number of foveal cones. chromatic discrimination, macular degeneration, retinitis pigmentosa, glaucoma.

A multistage gene normalization system integrating multiple effective methods.

PubMed

Li, Lishuang; Liu, Shanshan; Li, Lihua; Fan, Wenting; Huang, Degen; Zhou, Huiwei

2013-01-01

Gene/protein recognition and normalization is an important preliminary step for many biological text mining tasks. In this paper, we present a multistage gene normalization system which consists of four major subtasks: pre-processing, dictionary matching, ambiguity resolution and filtering. For the first subtask, we apply the gene mention tagger developed in our earlier work, which achieves an F-score of 88.42% on the BioCreative II GM testing set. In the stage of dictionary matching, the exact matching and approximate matching between gene names and the EntrezGene lexicon have been combined. For the ambiguity resolution subtask, we propose a semantic similarity disambiguation method based on Munkres' Assignment Algorithm. At the last step, a filter based on Wikipedia has been built to remove the false positives. Experimental results show that the presented system can achieve an F-score of 90.1%, outperforming most of the state-of-the-art systems.

Best-Matched Internal Standard Normalization in Liquid Chromatography-Mass Spectrometry Metabolomics Applied to Environmental Samples.

PubMed

Boysen, Angela K; Heal, Katherine R; Carlson, Laura T; Ingalls, Anitra E

2018-01-16

The goal of metabolomics is to measure the entire range of small organic molecules in biological samples. In liquid chromatography-mass spectrometry-based metabolomics, formidable analytical challenges remain in removing the nonbiological factors that affect chromatographic peak areas. These factors include sample matrix-induced ion suppression, chromatographic quality, and analytical drift. The combination of these factors is referred to as obscuring variation. Some metabolomics samples can exhibit intense obscuring variation due to matrix-induced ion suppression, rendering large amounts of data unreliable and difficult to interpret. Existing normalization techniques have limited applicability to these sample types. Here we present a data normalization method to minimize the effects of obscuring variation. We normalize peak areas using a batch-specific normalization process, which matches measured metabolites with isotope-labeled internal standards that behave similarly during the analysis. This method, called best-matched internal standard (B-MIS) normalization, can be applied to targeted or untargeted metabolomics data sets and yields relative concentrations. We evaluate and demonstrate the utility of B-MIS normalization using marine environmental samples and laboratory grown cultures of phytoplankton. In untargeted analyses, B-MIS normalization allowed for inclusion of mass features in downstream analyses that would have been considered unreliable without normalization due to obscuring variation. B-MIS normalization for targeted or untargeted metabolomics is freely available at https://github.com/IngallsLabUW/B-MIS-normalization .

Insulin Dynamics in Young Women with Polycystic Ovary Syndrome and Normal Glucose Tolerance across Categories of Body Mass Index

PubMed Central

Manco, Melania; Castagneto-Gissey, Lidia; Arrighi, Eugenio; Carnicelli, Annamaria; Brufani, Claudia; Luciano, Rosa; Mingrone, Geltrude

2014-01-01

Background Evidence favours insulin resistance and compensatory hyperinsulinemia as the predominant, perhaps primary, defects in polycystic ovary syndrome (PCOS). The aim of the present study was to evaluate insulin metabolism in young women with PCOS but normal glucose tolerance as compared with age, body mass index and insulin resistance-matched controls to answer the question whether women with PCOS hypersecrete insulin in comparison to appropriately insulin resistance-matched controls. Research Design and Methods Sixty-nine cases were divided according to their body mass index (BMI) in normal-weight (N = 29), overweight (N = 24) and obese patients (N = 16). Controls were 479 healthy women (age 16–49 y). Whole body Insulin Sensitivity (WBISI), fasting, and total insulin secretion were estimated following an oral glucose tolerance test (C-peptide deconvolution method). Results Across classes of BMI, PCOS patients had greater insulin resistance than matched controls (p<0.0001 for all the comparisons), but they showed higher fasting and total insulin secretion than their age, BMI and insulin resistance-matched peers (p<0.0001 for all the comparisons). Conclusion Women with PCOS show higher insulin resistance but also larger insulin secretion to maintain normal glucose homeostasis than age-, BMI- and insulin resistance-matched controls. PMID:24705280

Gender and single nucleotide polymorphisms in MTHFR, BHMT, SPTLC1, CRBP2R, and SCARB1 are significant predictors of plasma homocysteine normalized by RBC folate in healthy adults.

USDA-ARS?s Scientific Manuscript database

Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...

Gender identity disorder: a literature review from a developmental perspective.

PubMed

Shechner, Tomer

2010-01-01

The present paper reviews the theoretical and empirical literature on children and adolescents with gender variant behaviors. The organizational framework underlying this review is one that presents gender behavior in children and adolescents as a continuum rather than as a dichotomy of normal versus abnormal categories. Seven domains are reviewed in relation to gender variant behavior in general, and to Gender Identity Disorder (GID) in particular: theories of normative gender development, phenomenology, prevalence, assessment, developmental trajectories, comorbidity and treatment.

Normal reference values of diastolic strain rate in healthy individuals: Chronological trends and the comparison according to genders.

PubMed

Sun, Byung Joo; Park, Jae-Hyeong; Kim, Jeongai; Choi, Jin-Oh; Lee, Ju-Hee; Shin, Mi-Seung; Kim, Mi-Jeong; Jung, Hae Ok; Park, Jeong Rang; Sohn, Il Suk; Kim, Hyungseop; Kim, Hyung-Kwan; Cho, Goo-Yeong; Park, Jin-Sun; Shim, Chi Young; Shin, Sung Hee; Kim, Kye Hun; Kim, Woo-Shik; Park, Seung Woo

2018-06-19

Recently, the diastolic strain rate (DSR) utilizing speckle-tracking echocardiography has been proposed as a novel parameter for left ventricular diastolic function. We aimed to present normal reference data for those in a large-sized, selected group of healthy individuals. The current study was a part of the Normal echOcardiogRaphic Measurements in KoreAn popuLation (NORMAL), a prospective nationwide survey from 23 centers in Korea. We analyzed 447 subjects (age 48 ± 15 years, 234 females) without any history of cardiovascular disease and presented the early and late DSRs (SR e and SR a , respectively) in a total and gender-/age-specified groups. Among the total subjects, the mean SR e and SR a were 1.6 ± 0.4 S -1 and 0.8 ± 0.3 S -1 , respectively. With increasing age, there were significant trends of decreasing SR e and increasing SR a . Although both gender groups showed comparable age, the female group presented significantly higher SR e compared to male subjects with age of 20-59 years, which diminished after the age of 60 years. However, the SR a was comparable between genders in all age groups. On multiple linear regression, age showed independent associations with both SR e (β = -0.132, P = .010) and SR a (β = 0.440, P < .001), whereas gender did not show any association with SR e or SR a . We present normal reference data of a novel parameter, DSR, in a large-sized selected group with healthy Korean subjects. Additionally, we present significant age-related changes both in SR e and SR a without the impact of their gender. © 2018 Wiley Periodicals, Inc.

The Online STEM Classroom--Who Succeeds? An Exploration of the Impact of Ethnicity, Gender, and Non-Traditional Student Characteristics in the Community College Context

ERIC Educational Resources Information Center

Wladis, Claire; Conway, Katherine M.; Hachey, Alyse C.

2015-01-01

Objective: This study analyzes how ethnicity, gender, and non-traditional student characteristics relate to differential online versus face-to-face outcomes in science, technology, engineering, and mathematics (STEM) courses at community colleges. Method: This study used a sample of 3,600 students in online and face-to-face courses matched by…

Prenatal Androgens and Gender-Typed Behavior: A Study of Girls with Mild and Severe Forms of Congenital Adrenal Hyperplasia.

ERIC Educational Resources Information Center

Servin, Anna; Nordenstrom, Anna; Larsson, Agne; Bohlin, Gunilla

2003-01-01

Examined gender-typed behavior and interests in 2- to 10-year-old girls with congenital adrenal hyperplasia (CAH) and in unaffected girls matched for age. Found that, compared with unaffected girls, girls with CAH were more interested in masculine toys and less interested in feminine toys and were more likely to report having male playmates and…

A Preliminary Study of Gender Differences in Autobiographical Memory in Children with an Autism Spectrum Disorder

ERIC Educational Resources Information Center

Goddard, Lorna; Dritschel, Barbara; Howlin, Patricia

2014-01-01

Autobiographical memory was assessed in 24 children (12 male, 12 female, aged between 8 and 16 years) with autism spectrum disorder (ASD) and a comparison group of 24 typically developing (TD) children matched for age, IQ, gender and receptive language. Results suggested that a deficit in specific memory retrieval in the ASD group was more…

Effect of School Pretend Play on Preschoolers' Social Competence in Peer Interactions: Gender as a Potential Moderator

ERIC Educational Resources Information Center

Fung, Wing-kai; Cheng, Rebecca Wing-yi

2017-01-01

This study investigated the moderating effect of gender on the causal relationships between different school play activities (pretend and non-pretend play) and social competence in peer interactions among a sample of Hong Kong children. Participants were 60 Hong Kong preschoolers (mean age = 5.44, 36.67% female). Children with matched home pretend…

Gender Differences in Co-Morbid Psychopathology and Clinical Management in Adults with Autism Spectrum Disorders

ERIC Educational Resources Information Center

Tsakanikos, Elias; Underwood, Lisa; Kravariti, Eugenia; Bouras, Nick; McCarthy, Jane

2011-01-01

The present study examined rates of co-morbid psychopathology and clinical management/care pathways in adult females (N = 50) and males (N = 100) with autism spectrum disorders (ASD) and intellectual disability (ID) living in community settings. We also compared a sub-sample (N = 60) with ASD to an age-, gender- and ID-matched control group (N =…

Is Adam worth more than Eve? The financial impact of gender bias in the federal reimbursement of gynecological procedures.

PubMed

Goff, B A; Muntz, H G; Cain, J M

1997-03-01

On January 1, 1992, Congress implemented a Medicare payment system based on relative value units (RVU). The RVU multiplied by a dollar conversion factor sets the reimbursement for all procedures covered by Medicare and many other private insurers. This study was undertaken to evaluate discrepancies in federal reimbursement for gender-specific procedures. Using the December 1995 Federal Register and the regional Medicare conversion factor ($40.08/RVU), we compared the work RVU and total reimbursement of 24 groups of gender-specific surgical procedures. The groups were matched as carefully as possible so that the amount of work and level of difficulty would be similar, if not identical. Some examples of comparisons are as follows: biopsy of male vs female genitals, hysterectomy vs prostatectomy, staging for ovarian vs testicular cancer, and exenteration for cervical vs prostate cancer. In the 24 matched procedures, the male-specific procedures were reimbursed at a higher amount in 19 (79%) cases. The female-specific procedures were reimbursed at a higher amount in 3 (12%) cases (P = 0.004). There was no difference in reimbursement for two of the comparisons. Overall, we found that male-specific procedures are reimbursed at an amount which is 44% higher than female-specific procedures. Comparison of work RVU revealed that male-specific procedures were assigned higher values in 19 cases and, overall, male gender-related surgeries had work RVU that were 50% higher than female gender-related surgeries. There is significant gender bias against the Medicare reimbursement of female-specific services. This results in a lower net reimbursement for gynecologic procedures. In addition, since many private sector insurance carriers now use the resource-based relative value scale system, this gender bias is further potentiated.

Odours reduce the magnitude of object substitution masking for matching visual targets in females.

PubMed

Robinson, Amanda K; Laning, Julia; Reinhard, Judith; Mattingley, Jason B

2016-08-01

Recent evidence suggests that olfactory stimuli can influence early stages of visual processing, but there has been little focus on whether such olfactory-visual interactions convey an advantage in visual object identification. Moreover, despite evidence that some aspects of olfactory perception are superior in females than males, no study to date has examined whether olfactory influences on vision are gender-dependent. We asked whether inhalation of familiar odorants can modulate participants' ability to identify briefly flashed images of matching visual objects under conditions of object substitution masking (OSM). Across two experiments, we had male and female participants (N = 36 in each group) identify masked visual images of odour-related objects (e.g., orange, rose, mint) amongst nonodour-related distracters (e.g., box, watch). In each trial, participants inhaled a single odour that either matched or mismatched the masked, odour-related target. Target detection performance was analysed using a signal detection (d') approach. In females, but not males, matching odours significantly reduced OSM relative to mismatching odours, suggesting that familiar odours can enhance the salience of briefly presented visual objects. We conclude that olfactory cues exert a subtle influence on visual processes by transiently enhancing the salience of matching object representations. The results add to a growing body of literature that points towards consistent gender differences in olfactory perception.

Gender minority social stress in adolescence: disparities in adolescent bullying and substance use by gender identity.

PubMed

Reisner, Sari L; Greytak, Emily A; Parsons, Jeffrey T; Ybarra, Michele L

2015-01-01

Bullying and substance use represent serious public health issues facing adolescents in the United States. Few large-sample national studies have examined differences in these indicators by gender identity. The Teen Health and Technology Study (N = 5,542) sampled adolescents ages 13 to 18 years old online. Weighted multivariable logistic regression models investigated disparities in substance use and tested a gender minority social stress hypothesis, comparing gender minority youth (i.e., who are transgender/gender nonconforming and have a gender different from their sex assigned at birth) and cisgender (i.e., whose gender identity or expression matches theirs assigned at birth). Overall, 11.5% of youth self-identified as gender minority. Gender minority youth had increased odds of past-12-month alcohol use, marijuana use, and nonmarijuana illicit drug use. Gender minority youth disproportionately experienced bullying and harassment in the past 12 months, and this victimization was associated with increased odds of all substance use indicators. Bullying mediated the elevated odds of substance use for gender minority youth compared to cisgender adolescents. Findings support the use of gender minority stress perspectives in designing early interventions aimed at addressing the negative health sequelae of bullying and harassment.

Steroid hormones and psychological responses to soccer matches: Insights from a systematic review and meta-analysis.

PubMed

Slimani, Maamer; Baker, Julien S; Cheour, Foued; Taylor, Lee; Bragazzi, Nicola Luigi

2017-01-01

The present systematic review and meta-analysis aimed to assess the perturbations in hormonal and psychological homeostasis in response to soccer match-play. These perturbations were explored according to match outcome (i.e., win versus loss), gender, type of contest (i.e., competitive versus non-competitive fixtures) and competitive level (i.e., novice versus high-level). The review was conducted according to the Population/Intervention or Exposure/Comparison/Outcome(s) (PICO) criteria and the Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA) guidelines. Match outcome, type of contest and competitive levels were moderator variables in the examined steroid hormones responses to a soccer match-play. Different testosterone responses were seen between match winners (increase) and losers (decrease) when compared to pre-game or baseline values (p <0.05), whilst no changes could be detected for cortisol relative to match outcome in female soccer players. Males (Δ% = 6.26; ES = 0.28) demonstrated a marginally lower increase in testosterone levels when compared to females (Δ% = 49.16; ES = 1.00), though not statistically significant. Females (Δ% = 162.7; ES = 0.98) did not demonstrate elevated cortisol match response compared to males (Δ% = 34.60; ES = 1.20). Male novice soccer match-play increased cortisol levels compared to high-level soccer match-play (Q = 18.08, p<0.001). Competitive soccer matches increased cortisol levels compared to non-competitive fixtures (i.e., collegiate tournament). Additionally, competitive levels moderate the relationship between a soccer match and testosterone levels (p <0.001), regardless of gender differences. From the presented systematic review and meta-analysis it appears (1) cortisol changes are associated with cognitive anxiety in starter female soccer players, while (2) testosterone changes are associated with changes in mood state in females and social connectedness in male soccer players. This apparent psycho-physiological relationship may proffer the opportunity for targeted intervention(s) by practitioners to favorably influence performance and/or recovery agendas. Further mechanistic and/or applied evidence is required in this regard in addition to further data sets from females.

Steroid hormones and psychological responses to soccer matches: Insights from a systematic review and meta-analysis

PubMed Central

Baker, Julien S.

2017-01-01

The present systematic review and meta-analysis aimed to assess the perturbations in hormonal and psychological homeostasis in response to soccer match-play. These perturbations were explored according to match outcome (i.e., win versus loss), gender, type of contest (i.e., competitive versus non-competitive fixtures) and competitive level (i.e., novice versus high-level). The review was conducted according to the Population/Intervention or Exposure/Comparison/Outcome(s) (PICO) criteria and the Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA) guidelines. Match outcome, type of contest and competitive levels were moderator variables in the examined steroid hormones responses to a soccer match-play. Different testosterone responses were seen between match winners (increase) and losers (decrease) when compared to pre-game or baseline values (p <0.05), whilst no changes could be detected for cortisol relative to match outcome in female soccer players. Males (Δ% = 6.26; ES = 0.28) demonstrated a marginally lower increase in testosterone levels when compared to females (Δ% = 49.16; ES = 1.00), though not statistically significant. Females (Δ% = 162.7; ES = 0.98) did not demonstrate elevated cortisol match response compared to males (Δ% = 34.60; ES = 1.20). Male novice soccer match-play increased cortisol levels compared to high-level soccer match-play (Q = 18.08, p<0.001). Competitive soccer matches increased cortisol levels compared to non-competitive fixtures (i.e., collegiate tournament). Additionally, competitive levels moderate the relationship between a soccer match and testosterone levels (p <0.001), regardless of gender differences. From the presented systematic review and meta-analysis it appears (1) cortisol changes are associated with cognitive anxiety in starter female soccer players, while (2) testosterone changes are associated with changes in mood state in females and social connectedness in male soccer players. This apparent psycho-physiological relationship may proffer the opportunity for targeted intervention(s) by practitioners to favorably influence performance and/or recovery agendas. Further mechanistic and/or applied evidence is required in this regard in addition to further data sets from females. PMID:29023546

Dearth by a Thousand Cuts? Accounting for Gender Differences in Top-Ranked Publication Rates in Social Psychology.

PubMed

Cikara, Mina; Rudman, Laurie; Fiske, Susan

2012-01-01

Publication in the Journal of Personality and Social Psychology , a flagship indicator of scientific prestige, shows dramatic gender disparities. A bibliometric analysis included yoked-control authors matched for Ph.D. prestige and cohort. Though women publish less, at slower annual rates, they are more cited in handbooks and textbooks per JPSP -article-published. No gender differences emerged on variables reflecting differential qualifications. Many factors explain gender discrepancy in productivity. Among top publishers, per-year rate and first authorship especially differ by gender; rate uniquely predicts top-male productivity, whereas career-length uniquely predicts top-female productivity. Among men, across top-publishers and controls, productivity correlates uniquely with editorial negotiating and being married. For women, no personal variables predict productivity. A separate inquiry shows tiny gender differences in acceptance rates per JPSP article submitted; discrimination would be a small-but-plausible contributor, absent independent indicators of manuscript quality. Recent productivity rates mirror earlier gender disparities, suggesting gender gaps will continue.

Fast Legendre moment computation for template matching

NASA Astrophysics Data System (ADS)

Li, Bing C.

2017-05-01

Normalized cross correlation (NCC) based template matching is insensitive to intensity changes and it has many applications in image processing, object detection, video tracking and pattern recognition. However, normalized cross correlation implementation is computationally expensive since it involves both correlation computation and normalization implementation. In this paper, we propose Legendre moment approach for fast normalized cross correlation implementation and show that the computational cost of this proposed approach is independent of template mask sizes which is significantly faster than traditional mask size dependent approaches, especially for large mask templates. Legendre polynomials have been widely used in solving Laplace equation in electrodynamics in spherical coordinate systems, and solving Schrodinger equation in quantum mechanics. In this paper, we extend Legendre polynomials from physics to computer vision and pattern recognition fields, and demonstrate that Legendre polynomials can help to reduce the computational cost of NCC based template matching significantly.

Termination Proofs for String Rewriting Systems via Inverse Match-Bounds

NASA Technical Reports Server (NTRS)

Butler, Ricky (Technical Monitor); Geser, Alfons; Hofbauer, Dieter; Waldmann, Johannes

2004-01-01

Annotating a letter by a number, one can record information about its history during a reduction. A string rewriting system is called match-bounded if there is a global upper bound to these numbers. In earlier papers we established match-boundedness as a strong sufficient criterion for both termination and preservation of regular languages. We show now that the string rewriting system whose inverse (left and right hand sides exchanged) is match-bounded, also have exceptional properties, but slightly different ones. Inverse match-bounded systems effectively preserve context-free languages; their sets of normalized strings and their sets of immortal strings are effectively regular. These sets of strings can be used to decide the normalization, the termination and the uniform termination problems of inverse match-bounded systems. We also show that the termination problem is decidable in linear time, and that a certain strong reachability problem is deciable, thus solving two open problems of McNaughton's.

Potentially Reversible Social Deficits Among Transgender Youth.

PubMed

Turban, Jack L

2018-05-12

Recently, there has been increased attention to a putative relationship between Autism Spectrum Disorder (ASD) and gender dysphoria, the Diagnostic and Statistical Manual of Mental Disorders, 5th Edition (DSM-5) diagnosis for those whose gender assigned at birth does not match their gender identity. Studies have shown an over-representation of ASD symptoms among transgender youth. These studies, however, have used scales that are non-specific for ASD. These ASD symptoms may represent social deficits that are secondary to social stress and deprivation, as transgender youth suffer high rates of peer and family rejection. These social deficits may not represent true ASD and may be reversible as patients are affirmed in their gender identities and social stress is reduced.

Perceptual Adaptation of Voice Gender Discrimination with Spectrally Shifted Vowels

ERIC Educational Resources Information Center

Li, Tianhao; Fu, Qian-Jie

2011-01-01

Purpose: To determine whether perceptual adaptation improves voice gender discrimination of spectrally shifted vowels and, if so, which acoustic cues contribute to the improvement. Method: Voice gender discrimination was measured for 10 normal-hearing subjects, during 5 days of adaptation to spectrally shifted vowels, produced by processing the…

Gender Difference in Academic Planning Activity among Medical Students

PubMed Central

Nguyen, Huy Van; Giang, Thao Thach

2013-01-01

Background In Vietnam, as doctor of medicine is socially considered a special career, both men and women who are enrolled in medical universities often study topics of medicine seriously. However, as culturally expected, women often perform better than men. Because of this, teaching leadership and management skill (LMS) to develop academic planning activity (APA) for female medical students would also be expected to be more effective than male counterparts. This research aimed to compare by gender the effect of teaching LMS on increasing APA, using propensity score matching (PSM). Methods In a cross-sectional survey utilizing a self-reported structured questionnaire on a systematic random sample of 421 male and female medical students in Hanoi Medical University, this study adopted first regression techniques to construct a fit model, then PSM to create a matched control group in order to allow for evaluating the effect of LMS education. Results There were several interesting gender differences. First, while for females LMS education had both direct and indirect effects on APA, it had only direct effect on males’ APA. Second, after PSM to adjust for the possible confounders to balance statistically two groups – with and without LMS education, there is statistically a significant difference in APA between male and female students, making a net difference of 11% (p<.01), equivalent to 173 students. The difference in APA between exposed and matched control group in males and females was 9% and 20%, respectively. These estimates of 9.0 and 20.0 percentage point increase can be translated into the practice of APA by 142 males and 315 females, respectively, in the population. These numbers of APA among male and female students can be explained by LMS education. Conclusions Gender appears to be a factor explaining in part academic planning activity. PMID:23418467

Individual Colorimetric Observer Model

PubMed Central

Asano, Yuta; Fairchild, Mark D.; Blondé, Laurent

2016-01-01

This study proposes a vision model for individual colorimetric observers. The proposed model can be beneficial in many color-critical applications such as color grading and soft proofing to assess ranges of color matches instead of a single average match. We extended the CIE 2006 physiological observer by adding eight additional physiological parameters to model individual color-normal observers. These eight parameters control lens pigment density, macular pigment density, optical densities of L-, M-, and S-cone photopigments, and λmax shifts of L-, M-, and S-cone photopigments. By identifying the variability of each physiological parameter, the model can simulate color matching functions among color-normal populations using Monte Carlo simulation. The variabilities of the eight parameters were identified through two steps. In the first step, extensive reviews of past studies were performed for each of the eight physiological parameters. In the second step, the obtained variabilities were scaled to fit a color matching dataset. The model was validated using three different datasets: traditional color matching, applied color matching, and Rayleigh matches. PMID:26862905

Age and Gender Effects on Wideband Absorbance in Adults with Normal Outer and Middle Ear Function

ERIC Educational Resources Information Center

Mazlan, Rafidah; Kei, Joseph; Ya, Cheng Li; Yusof, Wan Nur Hanim Mohd; Saim, Lokman; Zhao, Fei

2015-01-01

Purpose: This study examined the effects of age and gender on wideband energy absorbance in adults with normal middle ear function. Method: Forty young adults (14 men, 26 women, aged 20-38 years), 31 middle-aged adults (16 men, 15 women, aged 42-64 years), and 30 older adults (20 men, 10 women, aged 65-82 years) were assessed. Energy absorbance…

The biology of human psychosexual differentiation.

PubMed

Gooren, Louis

2006-11-01

Most attempts to identify biological underpinnings of gender identity and sexual orientation in humans have investigated effects of sex steroids, so pivotal in the differentiation of the genitalia, showing strong parallels between animals and the human. The information on humans is derived from the so-called 'experiments of nature', clinical entities with a lesser-than-normal androgen exposure in XY subjects and a higher than normal androgen exposure in XX subjects. Prenatal androgenization appears to predispose to a male gender identity development, but apparently not decisively since 40-50% of 46,XY intersexed children with a history of prenatal androgen exposure do not develop a male gender identity. Obviously, male-to-female transsexuals, with a normal androgen exposure prenatally (there is no serious evidence to the contrary) develop a female gender identity, through unknown biological mechanisms apparently overriding the effects of prenatal androgens. The latest studies in 46, XX subjects exposed to prenatal androgens show that prenatal androgenization of 46,XX fetuses leads to marked masculinization of later gender-related behavior but does not lead to gender confusion/dysphoria. The example of female-to-male transsexuals, without evidence of prenatal androgen exposure, indicates that a male gender identity can develop without a significant androgen stimulus. So we are far away from any comprehensive understanding of hormonal imprinting on gender identity formation. Brain studies in homosexuals have not held up in replication studies or are in need of replication in transsexuals. Genetic studies and the fraternal birth order hypothesis provide indications of familial clustering of homosexuality but in many homosexuals these genetic patterns cannot be identified. The biological explanations advanced for the birth order hypothesis lack any experimental support.

Levels of depression in transgender people and its predictors: Results of a large matched control study with transgender people accessing clinical services.

PubMed

Witcomb, Gemma L; Bouman, Walter Pierre; Claes, Laurence; Brewin, Nicola; Crawford, John R; Arcelus, Jon

2018-08-01

Depression is a serious disorder which significantly impacts wellbeing and quality of life. Studies exploring mental wellbeing in the transgender population are mostly limited by small, non-homogenous samples and lack of matched controls. This study aimed to address these limitations and explore depression rates in a large sample of transgender people, compared with matched controls from the general population, as well as factors predicting depression in those taking cross-sex hormone treatment (CHT) compared to those not. Transgender individuals (n = 913) completed a measure of depression, measures which predict psychopathology (self-esteem, victimization, social support, interpersonal problems), and information regarding CHT use. Participants were matched by age and experienced gender with adults from the general population who had completed the measure of depression. Individuals were categorized as having no, possible or probable depressive disorder. Transgender individuals not on CHT had a nearly four-fold increased risk of probable depressive disorder, compared to controls. Older age, lower self-esteem, poorer interpersonal function and less social support predicted depressive disorder. Use of CHT was associated with less depression. Participants were attending a national gender identity service and therefore represent only a sub-group of transgender people. Due to the cross-sectional design, longitudinal research is required to fully confirm the finding that CHT use reduces depression. This study confirms that non-treated transgender individuals have an increased risk of a depressive disorder. Interventions offered alongside gender affirming treatment to develop interpersonal skills, increase self-esteem and improve social support may reduce depression and prepare individuals for a more successful transition. Copyright © 2018. Published by Elsevier B.V.

Knee joint stiffness in individuals with and without knee osteoarthritis: a preliminary study.

PubMed

Oatis, Carol A; Wolff, Edward F; Lennon, Sandra K

2006-12-01

Descriptive, case-matched comparison. To compare the knee joint stiffness and damping coefficients of individuals with knee osteoarthritis (KOA) to those of age- and gender-matched individuals without KOA. A secondary purpose was to investigate relationships between these coefficients and complaints of stiffness in individuals with KOA. KOA is a leading cause of disability, and stiffness is a common complaint in individuals with KOA. Yet the most common method of assessing knee joint stiffness is through a self-report questionnaire. Stiffness and damping coefficients at the knee were calculated in 10 volunteers (mean age +/- SD, 64.1+/-15.5 years) with KOA and compared to coefficients from age-and gender-matched individuals without KOA, collected in a previous study (mean age +/- SD, 62.1+/-13.9 years). Stiffness and damping coefficients were calculated from the angular motion of the knee during a relaxed oscillation. Spearman correlation coefficients were calculated between stiffness and damping coefficients and WOMAC (Western Ontario and McMaster Universities Osteoarthritis Index) scores for subjects with KOA. Independent 2-tailed t tests revealed significantly larger damping coefficients (P = .035) among those with KOA (95% CI, 0.10-2.32 Nm s/rad). Spearman rank correlations revealed a significant positive relationship (r = .85, P = .003) between the damping coefficient and the stiffness subscore of the WOMAC. This study offers preliminary data demonstrating the feasibility of measuring stiffness and damping coefficients in individuals with KOA. Additionally, the damping coefficient is increased in people with KOA when compared to age- and gender-matched individuals without KOA. The damping coefficient appears to be associated with the complaints of stiffness reported by the WOMAC.

Neural Mechanism of Inferring Person's Inner Attitude towards Another Person through Observing the Facial Affect in an Emotional Context.

PubMed

Kim, Ji-Woong; Kim, Jae-Jin; Jeong, Bumseok; Kim, Sung-Eun; Ki, Seon Wan

2010-03-01

The goal of the present study was to identify the brain mechanism involved in the attribution of person's attitude toward another person, using facial affective pictures and pictures displaying an affectively-loaded situation. Twenty four right-handed healthy subjects volunteered for our study. We used functional magnetic resonance imaging (MRI) to examine brain activation during attitude attribution task as compared to gender matching tasks. We identified activation in the left inferior frontal cortex, left superior temporal sulcus, and left inferior parietal lobule during the attitude attribution task, compared to the gender matching task. This study suggests that mirror neuron system and ventrolateral inferior frontal cortex play a critical role in the attribution of a person's inner attitude towards another person in an emotional situation.

Reducing selection bias in case-control studies from rare disease registries.

PubMed

Cole, J Alexander; Taylor, John S; Hangartner, Thomas N; Weinreb, Neal J; Mistry, Pramod K; Khan, Aneal

2011-09-12

In clinical research of rare diseases, where small patient numbers and disease heterogeneity limit study design options, registries are a valuable resource for demographic and outcome information. However, in contrast to prospective, randomized clinical trials, the observational design of registries is prone to introduce selection bias and negatively impact the validity of data analyses. The objective of the study was to demonstrate the utility of case-control matching and the risk-set method in order to control bias in data from a rare disease registry. Data from the International Collaborative Gaucher Group (ICGG) Gaucher Registry were used as an example. A case-control matching analysis using the risk-set method was conducted to identify two groups of patients with type 1 Gaucher disease in the ICGG Gaucher Registry: patients with avascular osteonecrosis (AVN) and those without AVN. The frequency distributions of gender, decade of birth, treatment status, and splenectomy status were presented for cases and controls before and after matching. Odds ratios (and 95% confidence intervals) were calculated for each variable before and after matching. The application of case-control matching methodology results in cohorts of cases (i.e., patients with AVN) and controls (i.e., patients without AVN) who have comparable distributions for four common parameters used in subject selection: gender, year of birth (age), treatment status, and splenectomy status. Matching resulted in odds ratios of approximately 1.00, indicating no bias. We demonstrated bias in case-control selection in subjects from a prototype rare disease registry and used case-control matching to minimize this bias. Therefore, this approach appears useful to study cohorts of heterogeneous patients in rare disease registries.

[Comparative analysis of some factors in tooth color matching].

PubMed

Török, Judit; Mauks, Levente; Márton, Sándor; Hegedűs, Csaba

2014-09-01

Recently (nowadays) to achieve a natural looking restoration is an ever increasing demand from the patients and also from the doctor side. To select the right color of the restoration matching the remaining natural teeth is always a challenging task. A clinical study was performed at the University of Debrecen Faculty of Dentristry with the help of dental students using two different shade guides. The study tested the influence of gender and knowledge of color science on shade matching. 78 students were asked to find the right matching color of the same upper canine to two different shade guides (Vitapan Classic and Vita 3D-Master) under standard condition. After informing the student about the basic principles of color the matching procedure was repeated. Results were analyzed statistically. In our study we found that gender does not influence the color choice. Matching accuracy is not increased by better knowledge of colors. We can conclude that significantly less students matched the proper color with Vitapan Classic shade guide after information of the property of colors without training the shade selection. Within the limitation of the study design it was concluded that not more students selected the proper color even after giving them information about colors, instructions about shade selections. For the same one canine several color were selected by the participants (6 types with Vitapan Classic and 19 types with Vita 3D-Master) which conformed that visual determination is not a reliably consistent way of the tooth shade selection. The Vita Company 1990s developed 3D-Master shade guide is not widely used, although we found the repeatability is more than 70%.

Preimplantation genetic diagnosis for gender selection in the United States

DOE Office of Scientific and Technical Information (OSTI.GOV)

Colls, P.; Silver, L.; Olivera, G.

Preimplantation genetic diagnosis (PGD) of gender selection for non medical reasons has been considered an unethical procedure by several authors and agencies in the Western society on the basis of disrupting the sex ratio, being discriminatory againsts women and disposal of normal embryos of the non desired gender. In this study, the analysis of a large series of PGD procedures for gender selection from a wide geographical area in the United States, shows that in general there is no deviation in preference towards any specific gender except for a preference of males in some ethnic populations of Chinese, Indian andmore » Middle Eastern origin that represent a small percentage of the US population. In cases where only normal embryos of the non-desired gender are available, 45.5% of the couples elect to cancel the transfer, while 54.5% of them are open to have transferred embryos of the non-desired gender, this fact being strongly linked to cultural and ethnical background of the parents. In addition this study adds some evidence to the proposition that in couples with previous children of a given gender there is no biological predisposition towards producing embryos of that same gender. Based on these facts, it seems that objections to gender selection formulated by ethics committees and scientific societies are not well-founded.« less

Radiation dose and image quality in pediatric chest CT: effects of iterative reconstruction in normal weight and overweight children.

PubMed

Yoon, Haesung; Kim, Myung-Joon; Yoon, Choon-Sik; Choi, Jiin; Shin, Hyun Joo; Kim, Hyun Gi; Lee, Mi-Jung

2015-03-01

New CT reconstruction techniques may help reduce the burden of ionizing radiation. To quantify radiation dose reduction when performing pediatric chest CT using a low-dose protocol and 50% adaptive statistical iterative reconstruction (ASIR) compared with age/gender-matched chest CT using a conventional dose protocol and reconstructed with filtered back projection (control group) and to determine its effect on image quality in normal weight and overweight children. We retrospectively reviewed 40 pediatric chest CT (M:F = 21:19; range: 0.1-17 years) in both groups. Radiation dose was compared between the two groups using paired Student's t-test. Image quality including noise, sharpness, artifacts and diagnostic acceptability was subjectively assessed by three pediatric radiologists using a four-point scale (superior, average, suboptimal, unacceptable). Eight children in the ASIR group and seven in the control group were overweight. All radiation dose parameters were significantly lower in the ASIR group (P < 0.01) with a greater than 57% dose reduction in overweight children. Image noise was higher in the ASIR group in both normal weight and overweight children. Only one scan in the ASIR group (1/40, 2.5%) was rated as diagnostically suboptimal and there was no unacceptable study. In both normal weight and overweight children, the ASIR technique is associated with a greater than 57% mean dose reduction, without significantly impacting diagnostic image quality in pediatric chest CT examinations. However, CT scans in overweight children may have a greater noise level, even when using the ASIR technique.

Identifying Neurobiological Markers of the Broader Autism Phenotype

DTIC Science & Technology

2015-01-01

the BAP. Control participants matched for age, sex and IQ with no history of neurologic, psychiatric or hearing disorders have also been successfully...were then required to imitate the speaker’s emotional expression as accurately as possible. Gender -specific MAV stimuli were presented to each...Participants completed a total of 35 randomized trials, over which five gender -specific MAV stimuli were presented from each of the six emotions and

Portion size tells who I am, food type tells who you are: Specific functions of amount and type of food in same- and opposite-sex dyadic eating contexts.

PubMed

Cavazza, Nicoletta; Guidetti, Margherita; Butera, Fabrizio

2017-05-01

Previous research has shown that women eating small portions of food (vs. eating big portions) are perceived as more feminine, whereas men eating large portions are perceived as more masculine. The specific type of food items have also been shown to carry connotations for gender stereotyping. In addition, matching the co-eater's food quantity is also a means to ingratiate him or her. Thus, a potential motivational conflict between gender identity expression and ingratiation arises when people eat in opposite-sex dyads. Scholars have, thus far, focused their attention on one of these two dimensions at a time, and rarely in relation to the co-eaters' sex. The present study investigated, through a restaurant scenario, the way in which women and men, when asked to imagine having lunch in dyads, combine food choice and quantity regulation as a function of the co-eater's sex. Results showed that participants use the quantity dimension to communicate gender identity, and the food type dimension to ingratiate the co-eater's preferences by matching her/his presumed choice, following gender-based stereotypes about food. In opposite-sex dyads, dishes that incorporate the two dimensions were chosen above the expected frequency. Copyright © 2017 Elsevier Ltd. All rights reserved.

Does Segmentation Really Work? Effectiveness of Matched Graphic Health Warnings on Cigarette Packaging by Race, Gender and Chronic Disease Conditions on Cognitive Outcomes among Vulnerable Populations.

PubMed

Hayashi, Hana; Tan, Andy; Kawachi, Ichiro; Minsky, Sara; Viswanath, Kasisomayajula

2018-06-18

We examined the differential impact of exposure to smoking-related graphic health warnings (GHWs) on risk perceptions and intentions to quit among different audience segments characterized by gender, race/ethnic group, and presence of chronic disease condition. Specifically, we sought to test whether GHWs that portray specific groups (in terms of gender, race, and chronic disease conditions) are associated with differences in risk perception and intention to quit among smokers who match the portrayed group. We used data from Project CLEAR, which oversampled lower SES groups as well as race/ethnic minority groups living in the Greater Boston area (n = 565). We fitted multiple linear regression models to examine the impact of exposure to different GHWs on risk perceptions and quit intentions. After controlling for age, gender, education and household income, we found that women who viewed GHWs portraying females reported increased risk perception as compared to women who viewed GHWs portraying men. However, no other interactions were found between the groups depicted in GHWs and audience characteristics. The findings suggest that audience segmentation of GHWs may have limited impact on risk perceptions and intention to quit smoking among adult smokers.

Culture and vocational interests: the moderating role of collectivism and gender egalitarianism.

PubMed

Ott-Holland, Catherine J; Huang, Jason L; Ryan, Ann Marie; Elizondo, Fabian; Wadlington, Patrick L

2013-10-01

In some cultures, individuals are free to pursue careers that match their personalities. In others, familial and societal expectations regarding career paths may restrict the links between individual personality and interests. Gender role expectations also may vary across cultures and may be associated with gender differences in interests. Past meta-analytic research has shown some career interests are related to personality traits (Barrick, Mount, & Gupta, 2003; Larson, Rottinghaus, & Borgen, 2002), but the cross-cultural variation of these relationships has not been sufficiently explored. Interest and personality data were obtained from an archival data set of 391,485 individuals from 20 countries. Results indicated that in cultures with high in-group collectivism, connections between personality traits and occupational interests may be less pronounced. Cultural gender egalitarianism moderated the level of gender differences in interests, unexpectedly demonstrating that gender differences may be wider in egalitarian cultures. Implications for career guidance in multicultural settings are discussed.

A cognitive neuropsychological approach to the study of delusions in late-onset schizophrenia.

PubMed

Phillips, M L; Howard, R; David, A S

1997-09-01

Hypotheses to explain delusion formation include distorted perceptual processing of meaningful stimuli (e.g. faces), abnormal reasoning, or a combination of both. The study investigated these hypotheses using standardized neuropsychological tests. A three-patient case-study, compared with a small group (n = 8) of age-matched normal control subjects. Hospital in- and outpatients. Age-matched normal controls were from local residential homes. Three subjects with late-onset schizophrenia, two currently deluded and one in remission. Both deluded subjects had persecutory beliefs. One had a delusion of misidentification. All subjects were administered standardized neuropsychological tests of facial processing and tests of verbal reasoning. The test scores of the three patients were compared with published normal values and the age-matched control data. The tests demonstrated impaired matching of unfamiliar faces in deluded subjects, particularly in the subject with delusional misidentification. Increasing the emotional content of logical reasoning problems had a significant effect on the deluded subjects' reasoning but not that of the normal controls. The findings suggest impaired visual processing plus abnormal reasoning in deluded subjects. However, these impairments are relatively subtle given the severity of psychiatric disorder in the patients studied.

Gender effects on mental rotation in pilots vs. nonpilots.

PubMed

Verde, Paola; Piccardi, Laura; Bianchini, Filippo; Trivelloni, Pierandrea; Guariglia, Cecilia; Tomao, Enrico

2013-07-01

Mental rotation ability has an important role in human navigation and, together with other cognitive abilities such as processing speed, working memory, and attention, is crucial for aircraft navigation. In the human performance literature, mental rotation tasks have consistently yielded reports of gender differences favoring men. The aim of this study was to compare the gender difference measured in a specialized population of aviators vs. a matched population of nonpilots. : Studied were 41 pilots (20 men and 21 women) and 38 nonpilots (20 men and 18 women) matched for age and education. Pilots were stratified for flying hours. Participants performed a mental rotation task (MRT) in which accuracy and response time were recorded, and also completed sense-of-direction (SOD) and spatial cognitive styles self-evaluation scales. Men had significantly smaller response time in the MRT (men 279.6 +/- 147.0 s, women 401.6 +/- 361.3) and greater SOD (men's score 49.1 +/- 8.6, women's score 46.6 +/- 7.8), but these differences were absent among pilots. A positive relationship was also identified between pilots' response times and their flight hours. These data suggest that the effect of gender on the speed of cognitive spatial processing is absent in a population with aviation experience. Gender effects may be associated with a low spatial cognitive style, whereas in groups such as aviators, who are expected to have high spatial cognitive style, other factors such as experience may come into play.

Gender influence on postprandial lipemia in heterozygotes for familial hypercholesterolemia.

PubMed

Kolovou, Genovefa D; Anagnostopoulou, Katherine K; Damaskos, Dimitris S; Mihas, Constantinos; Mavrogeni, Sofia; Hatzigeorgiou, George; Theodoridis, Theodor; Mikhailidis, Dimitri P; Cokkinos, Dennis V

2007-01-01

The aim of this study was to evaluate the influence of gender differences on triglyceride (TG) response after a fatty meal in clinically defined heterozygous (h) patients with familial hypercholesterolemia (FH). Nineteen hFH men were age-matched with an equal number of premenopausal women. Plasma TG was measured before and 2, 4, 6, and 8 hr after a standardized fat load. The men with hFH had a greater body mass index (BMI) than hFH women. An abnormal postprandial response was observed in 63% and 16% of hFH men and women, respectively. The mean TG-area under the curve value was higher in hFH men compared to hFH women. Both gender (p = 0.032) and BMI (p = 0.006) equally affected postprandial TG response, but fasting TG levels (p <0.001) were the main determinant. In summary, hFH men have higher BMI, fasting TG level, and postprandial TG level, compared to age-matched premenopausal hFH women, which may partially explain the earlier onset of coronary heart disease in hFH men.

Not Too "College-Like," Not Too Normal: American Muslim Undergraduate Women's Gendered Discourses

ERIC Educational Resources Information Center

Mir, Shabana

2009-01-01

Building on an ethnographic study of American Muslim undergraduate women at two universities in Washington, D.C., I examine undergraduate Muslim women's construction of gendered discourses. Stereotypes feed into both majority and minority constructions of Muslim women's gendered identities. I highlight Muslim women's resistance to and adoption of…

Gender Relations and the Production of Difference in School-based Sexuality and HIV/AIDS Education in Australia.

ERIC Educational Resources Information Center

Harrison, Lyn

2000-01-01

Uses data from an evaluation of a high school sexuality education program to examine gender relations and production of difference. Participating schools incorporated teaching and learning that normalized sexual diversity and explored HIV-related discrimination and homophobia. Discussion of gender, power, and menstruation and heterosexism and…

[A questionnaire study of the relationship between gender and chronic pain].

PubMed

Teuber, N; Thiele, A; Eberhardt, B

2006-08-01

The aim of this study was to assess the relationship between gender role orientation and the prevalence of chronic pain. The individual gender role orientation in a sample of 45 chronic pain patients (ICD 10 diagnosis, F 45.4) was compared to gender role orientation in a matched, pain-free control group. Gender role orientation was assessed by questionnaires on the self-attribution of stereotypic gender traits (GEPAQ) and on the extent of agreement with traditional feminine and masculine role norms (MRNS, FRNS). Group differences were compared by multivariate analysis. In accordance with the hypothesis, results confirmed that pain patients showed stronger feminine and weaker masculine role orientations than healthy controls. Pain patients additionally ascribed to themselves more 'feminine' (e.g. worried, nervous) and less 'masculine' (e.g. aggressive, cynical) traits. Sociopsychological variables of gender role orientation were related to chronic pain in the groups observed. An integrated model consisting of psychodynamic, sociological, and sociopsychological factors is proposed.

Matching donor to recipient in liver transplantation: Relevance in clinical practice

PubMed Central

Reddy, Mettu Srinivas; Varghese, Joy; Venkataraman, Jayanthi; Rela, Mohamed

2013-01-01

Achieving optimum outcomes after liver transplantation requires an understanding of the interaction between donor, graft and recipient factors. Within the cohort of patients waiting for a transplant, better matching of the donor organ to the recipient will improve transplant outcomes and benefit the overall waiting list by minimizing graft failure and need for re-transplantation. A PubMed search was conducted to identify published literature investigating the effects of donor factors such as age, gender, ethnicity, viral serology; graft factors such as size and quality, recipient factors such as age, size, gender and transplant factors such as major or minor blood group incompatibility and immunological factors. We also report technical and therapeutic modifications that can be used to manage donor-recipient mismatch identified from literature and the authors’ clinical experience. Multiple donor and recipient factors impact graft survival after liver transplantation. Appropriate matching based on donor-organ-recipient variables, modification of surgical technique and innovative peri-transplant strategies can increase the donor pool by utilizing grafts from marginal donors that are traditionally turned down. PMID:24303088

Gender Minority Social Stress in Adolescence: Disparities in Adolescent Bullying and Substance Use by Gender Identity

PubMed Central

Reisner, Sari L.; Greytak, Emily A.; Parsons, Jeffrey T.; Ybarra, Michele

2014-01-01

Bullying and substance use represent serious public health issues facing adolescents in the U.S. Few large-sample national studies have examined differences in these indicators by gender identity. The Teen Health and Technology Study (N=5,542) sampled adolescents 13–18 years-old online. Weighted multivariable logistic regression models investigated disparities in substance use and tested a gender minority social stress hypothesis, comparing gender minority youth (i.e., who are transgender/gender nonconforming and have a gender different from their sex assigned at birth) and cisgender (i.e., whose gender identity or expression matches one’s sex assigned at birth). Overall, 11.5% of youth self-identified as gender minority. Gender minority youth had increased odds of past-12 month alcohol use, marijuana use, and non-marijuana illicit drug use. Gender minority youth disproportionately experienced bullying and harassment in the past 12 months, and this victimization was associated with increased odds of all substance use indicators. Bullying mediated the elevated odds of substance use for gender minority youth compared to cisgender adolescents. Findings support the use of gender minority stress perspectives in designing early interventions aimed at addressing the negative health sequelae of bullying and harassment. PMID:24742006

[Influence of the sex and gender in the sexual behavior of adolescents].

PubMed

García-Vega, Elena; Menéndez Robledo, Elena; García Fernández, Paula; Rico Fernández, Rosana

2010-11-01

The aim of this study is to evaluate the relation between gender and sex with the sexual behavior of adolescents. The sample comprised 815 teenagers (M=15.65, Sd.=1.42). The assessment instruments were the BEM Sex Role Inventory, the Sexual Opinion Survey, the Questionnaire of Risk Perception of Bayés and a questionnaire designed for the study. The results revealed that the majority of adolescents do not match the traditional gender stereotypes, defining themselves as adrogynes (34.4%). The teenagers who are defined as adrogynes or masculine carry out more sexual behaviors, and who display more erotophilia. The need to include the variable "gender" as a category of analysis in research on sexual behavior is indicated.

Gender difference in association between appendicular skeletal muscle mass and cardiometabolic abnormalities in normal-weight and obese adults: Korea National Health and Nutrition Examination Survey (KNHANES) IV-3 and V-1.

PubMed

Kim, Jaehee

2015-03-01

The objective of this study was to investigate whether the relationships of appendicular muscle mass (ASM) with insulin resistance (IR) and metabolic syndrome (MS) vary by gender or obesity. Data of 10 146 normal-weight and obese men and women aged 19 to 93 years from the Korea National Health and Nutrition Examination Survey in 2009 and 2010 were analyzed. In normal-weight men and women, unadjusted odds ratio (OR) of being MS and IR significantly increased with lower ASM/wt. After adjusting for lifestyle factors, these ORs were still significant in normal-weight men but not in women. After controlling for other covariates, lower ASM/wt was related to higher risk for IR but not to MS in obese men. In obese women, relationship of lower ASM/wt with higher risk for MS disappeared after adjusting for covariates. Association between skeletal muscle mass and cardiometabolic abnormalities is dependent on gender and obesity in Korean adults. © 2012 APJPH.

Nuclear Matrix Proteins in Disparity of Prostate Cancer

DTIC Science & Technology

2013-09-01

nuclear coactivator-3 (NCOA3). 5 Methods Patients and Prostate Cancer Specimens Fresh, flash -frozen specimens were obtained from age- (50 to...for reliable data interpretation. Gene Array Analysis Total RNA isolated from LCM-procured normal epithelium and tumor cells from flash -frozen...PCR Briefly, RNA was extracted from matched LCM procured normal epithelium and tumor cells of age-, tumor grade-matched flash -frozen sections (n=24

Symmetrical and Asymmetrical Interactions between Facial Expressions and Gender Information in Face Perception.

PubMed

Liu, Chengwei; Liu, Ying; Iqbal, Zahida; Li, Wenhui; Lv, Bo; Jiang, Zhongqing

2017-01-01

To investigate the interaction between facial expressions and facial gender information during face perception, the present study matched the intensities of the two types of information in face images and then adopted the orthogonal condition of the Garner Paradigm to present the images to participants who were required to judge the gender and expression of the faces; the gender and expression presentations were varied orthogonally. Gender and expression processing displayed a mutual interaction. On the one hand, the judgment of angry expressions occurred faster when presented with male facial images; on the other hand, the classification of the female gender occurred faster when presented with a happy facial expression than when presented with an angry facial expression. According to the evoked-related potential results, the expression classification was influenced by gender during the face structural processing stage (as indexed by N170), which indicates the promotion or interference of facial gender with the coding of facial expression features. However, gender processing was affected by facial expressions in more stages, including the early (P1) and late (LPC) stages of perceptual processing, reflecting that emotional expression influences gender processing mainly by directing attention.

Prevalence of Colour Vision Anomalies Amongst Dental Professionals and its Effect on Shade Matching of Teeth.

PubMed

Khosla, Amrit; Maini, Anuj Paul; Wangoo, Anuj; Singh, Sukhman; Mehar, Damanpreet Kaur

2017-01-01

The success of a restoration is dependent on accurate shade matching of teeth leading to studies evaluating the factors affecting the perception of shades. Colour vision anomalies including colour blindness have been found to exist in the population and it has been thought to be a potential factor affecting the colour perception ability. The present study was done to evaluate the prevalence of colour vision anomalies and its effect on matching of shades of teeth. A total of 147 dental professionals were randomly selected for the study and were first tested for visual acuity using the Snellen's Eye Chart so as to carry on the study with only those operators who had a vision of 6/6. Then, the Ishihara's colour charts were used to test the operators for colour vision handicap. In the last stage of the study, test for accuracy of shade selection was done using the Vitapan Classical shade guide. The shade guide tabs were covered to avoid bias. Percentage was used to calculate the prevalence of colour vision handicap and its effect on matching of shades of teeth as compared to normal vision, which was evaluated using Chi square test. Nineteen operators had colour vision anomalies out of hundred operators and only two operators presented with colour blindness. Colour vision anomaly was more prevalent than colour blindness and it was also found that it was more prevalent in males than females. The difference between the accuracy of shade matching between the operators with normal vision and colour vision defect and operators with normal vision and colour blindness was statistically not significant. Colour blindness and colour vision handicap are rare conditions, with the latter being more common in the population. According to our study, it was concluded that no statistically significant difference existed amongst the operators with normal vision and colour vision anomaly or operators with normal vision and colour blindness during the matching of shades of teeth.

Reducing the motor response in haptic parallel matching eliminates the typically observed gender difference.

PubMed

van Mier, Hanneke I

2016-01-01

When making two bars haptically parallel to each other, large deviations have been observed, most likely caused by the bias of a hand-centered egocentric reference frame. A consistent finding is that women show significantly larger deviations than men when performing this task. It has been suggested that this difference might be due to the fact that women are more egocentrically oriented than men or are less efficient in overcoming the egocentric bias of the hand. If this is indeed the case, reducing the bias of the egocentric reference frame should eliminate the above-mentioned gender difference. This was investigated in the current study. Sixty participants (30 men, 30 women) were instructed to haptically match (task HP) the orientation of a test bar with the dominant hand to the orientation of a reference bar that was perceived with the non-dominant hand. In a haptic visual task (task HV), in which only the reference bar and exploring hand were out of view, no motor response was required, but participants had to "match" the perceived orientation by verbally naming the parallel orientation that was read out on a test protractor. Both females and males performed better in the HV task than in the HP task. Significant gender effects were only found in the haptic parallelity task (HP), corroborating the idea that women perform at the same level as men when the egocentric bias of the hand is reduced.

Gender differences in work–home interplay and symptom perception among Swedish white‐collar employees

PubMed Central

Berntsson, L; Lundberg, U; Krantz, G

2006-01-01

Objective To analyse gender differences in paid and unpaid workload and symptoms in matched groups of Swedish white‐collar workers with children. Design and setting Paid and unpaid workload and perceived stress from paid work, conflict between demands and control over household work were measured by a total workload (TWL) questionnaire. Some symptoms were rated with regard to frequency and severity as a measure of health. Cross‐sectional analyses were performed. Participants Matched groups of male (n = 440) and female (n = 529) well‐educated white‐collar workers in full‐time employment, aged 32–58 years and living with children in the home. Results Women in higher positions in Sweden are healthier than the average population of women, but report more symptoms than men in the same position as well as more stress from paid work, more conflict between demands and a greater TWL. However, women also reported more control over household duties and TWL was not associated with more symptoms. The men were mainly focused on their paid work role and perhaps even more so than men in the general population as they were fairly resistant to feelings of conflicting demands. Conclusion Even among matched groups of full‐time employed, well‐educated men and women, traditional gender differences in division of responsibilities and time allocation were found. Even though the women were healthy at this stage, they might risk future ill health, owing to high workload, stress and feelings of conflicting demands. PMID:17108304

Gender differences in work-home interplay and symptom perception among Swedish white-collar employees.

PubMed

Berntsson, L; Lundberg, U; Krantz, G

2006-12-01

To analyse gender differences in paid and unpaid workload and symptoms in matched groups of Swedish white-collar workers with children. Paid and unpaid workload and perceived stress from paid work, conflict between demands and control over household work were measured by a total workload (TWL) questionnaire. Some symptoms were rated with regard to frequency and severity as a measure of health. Cross-sectional analyses were performed. Matched groups of male (n = 440) and female (n = 529) well-educated white-collar workers in full-time employment, aged 32-58 years and living with children in the home. Women in higher positions in Sweden are healthier than the average population of women, but report more symptoms than men in the same position as well as more stress from paid work, more conflict between demands and a greater TWL. However, women also reported more control over household duties and TWL was not associated with more symptoms. The men were mainly focused on their paid work role and perhaps even more so than men in the general population as they were fairly resistant to feelings of conflicting demands. Even among matched groups of full-time employed, well-educated men and women, traditional gender differences in division of responsibilities and time allocation were found. Even though the women were healthy at this stage, they might risk future ill health, owing to high workload, stress and feelings of conflicting demands.

Contralateral suppression of transient-evoked otoacoustic emissions in children with sickle cell disease.

PubMed

Stuart, Andrew; Preast, June L

2012-01-01

In previous studies, otoacoustic emissions (OAEs) have been found to be larger in normal-hearing children with sickle cell disease (SCD). It was hypothesized that some dysfunction or reduction in the medial olivocochlear efferent suppression of outer hair cell activity was responsible for this phenomenon. To test this hypothesis, contralateral suppression of transient-evoked otoacoustic emissions (TEOAEs) was examined in children with and without SCD. Thirteen African American school-aged normal-hearing children with homozygous SCD and 13 age- and gender-matched control children participated. TEOAEs were obtained bilaterally with 80 dB peSPL nonlinear click stimuli. To examine contralateral suppression, TEOAEs were obtained with 60 dB peSPL linear click stimuli with and without a contralateral 65 dB SPL white noise suppressor. Overall and half-octave band TEOAE levels were found to be larger in children with SCD relative to the normal control children (p < 0.05), consistent with previous reports of increased OAE levels. There was no significant difference (p > 0.05) in the absolute or proportional amount of TEOAE suppression as a function of group and ear. There were also no significant correlations or linear predictive relationships between TEOAE suppression and TEOAE level for either ear or group (p > 0.05). These findings do not support the notion that increased OAE levels in children with SCD are a consequence of abnormal medial olivocochlear system function as assessed with contralateral suppression of TEOAEs.

Normalization of Cortical Gray Matter Deficits in Nonpsychotic Siblings of Patients With Childhood-Onset Schizophrenia

PubMed Central

Mattai, Anand A.; Weisinger, Brian; Greenstein, Deanna; Stidd, Reva; Clasen, Liv; Miller, Rachel; Tossell, Julia W.; Rapoport, Judith L.; Gogtay, Nitin

2012-01-01

Objective Cortical gray matter (GM) abnormalities in patients with childhood-onset schizophrenia (COS) progress during adolescence ultimately localizing to prefrontal and temporal cortices by early adult age. A previous study of 52 nonpsychotic siblings of COS probands had significant prefrontal and temporal GM deficits that appeared to “normalize” by age 17 years. Here we present a replication with nonoverlapping groups of healthy full siblings and healthy controls. Method Using an automated measure and prospectively acquired anatomical brain magnetic resonance images, we mapped cortical GM thickness in nonpsychotic full siblings (n = 43, 68 scans; ages 5 through 26 years) of patients with COS, contrasting them with age-, gender-, and scan interval–matched healthy controls (n = 86, 136 scans). The false-discovery rate procedure was used to control for type I errors due to multiple comparisons. Results As in our previous study, young nonpsychotic siblings (<17 years) showed significant GM deficits in bilateral prefrontal and left temporal cortices and, in addition, smaller deficits in the parietal and right inferior temporal cortices. These deficits in nonpsychotic siblings normalized with age with minimal abnormalities remaining by age 17. Conclusions Our results support previous findings showing nonpsychotic siblings of COS probands to have early GM deficits that ameliorate with time. At early ages, prefrontal and/or temporal loss may serve as a familial/trait marker for COS. Late adolescence appears to be a critical period for greatest localization of deficits in probands or normalization in nonpsychotic siblings. PMID:21703497

Peer Instruction in introductory physics: A method to bring about positive changes in students' attitudes and beliefs

NASA Astrophysics Data System (ADS)

Zhang, Ping; Ding, Lin; Mazur, Eric

2017-06-01

This paper analyzes pre-post matched gains in the epistemological views of science students taking the introductory physics course at Beijing Normal University (BNU) in China. In this study we examined the attitudes and beliefs of science majors (n =441 ) in four classes, one taught using traditional (lecture) teaching methods, and the other three taught with Peer Instruction (PI). In two of the PI classes, student peer groups were constantly changing throughout the semester, while in the other PI class student groups remained fixed for the duration of the semester. The results of the pre- and post-test using the Colorado Learning Attitudes about Science Survey showed that students in traditional lecture settings became significantly more novicelike in their beliefs about physics and learning physics over the course of a semester, a result consistent with what was reported in the literature. However, all three of the classes taught using the PI method improved student attitudes and beliefs about physics and learning physics. In the PI class with fixed peer groups, students exhibited a greater positive shift in attitudes and beliefs than in the other PI class with changing peer groups. The study also looked at gender differences in student learning attitudes. Gender results revealed that female science majors in the PI classes achieved a greater positive shift in attitudes and beliefs after instruction than did male students.

Childhood acute lymphoblastic leukaemia and indicators of early immune stimulation: the Estelle study (SFCE)

PubMed Central

Ajrouche, R; Rudant, J; Orsi, L; Petit, A; Baruchel, A; Lambilliotte, A; Gambart, M; Michel, G; Bertrand, Y; Ducassou, S; Gandemer, V; Paillard, C; Saumet, L; Blin, N; Hémon, D; Clavel, J

2015-01-01

Background: Factors related to early stimulation of the immune system (breastfeeding, proxies for exposure to infectious agents, normal delivery, and exposure to animals in early life) have been suggested to decrease the risk of childhood acute lymphoblastic leukaemia (ALL). Methods: The national registry-based case–control study, ESTELLE, was carried out in France in 2010–2011. Population controls were frequency matched with cases on age and gender. The participation rates were 93% for cases and 86% for controls. Data were obtained from structured telephone questionnaires administered to mothers. Odds ratios (OR) were estimated using unconditional regression models adjusted for age, gender, and potential confounders. Results: In all, 617 ALL and 1225 controls aged ⩾1 year were included. Inverse associations between ALL and early common infections (OR=0.8, 95% confidence interval (CI): 0.6, 1.0), non-first born (⩾3 vs 1; OR=0.7, 95% CI: 0.5, 1.0), attendance of a day-care centre before age 1 year (OR=0.7, 95% CI: 0.5, 1.0), breastfeeding (OR=0.8, 95% CI: 0.7, 1.0), and regular contact with pets (OR=0.8, 95% CI: 0.7, 1.0) in infancy were observed. Conclusions: The results support the hypothesis that conditions promoting the maturation of the immune system in infancy have a protective role with respect to ALL. PMID:25675150

Color Doppler orbital hemodynamics in healthy individuals and patients with vascular disorders in Taiwan.

PubMed

Kahn, Mon-Te

2008-01-01

The main purpose of this study was to establish a data bank of orbital vasculature hemodynamics as assessed by color Doppler imaging (CDI) for normal Taiwanese. In addition, we compared the hemodynamic variables in subjects with a healthy orbital vasculature and 10 patients with various orbital disorders. From 1994 to 1995, we collected data from 90 age-and gender-matched (43 males, 47 females) healthy individuals, with age stratified by decades (ranging from 4 to 79 years). Ten patients with various orbital lesions were also examined by CDI. Peak systolic velocity (PSV), end diastolic velocity (EDV), mean velocity (MV), pulsatility index (PI), and resistivity index (RI) were obtained for the ophthalmic, central retinal, and posterior ciliary arteries. The MV was also measured in the ophthalmic, central retinal, and vortex veins. The mean and standard deviation of the values were calculated for each decade of age. There was no correlation between the CDI-generated values and gender. Student's t-test showed that the flow velocity in the group below age 10, compared with that of the other groups, is significantly higher (p < 0.05). The CDI values in diseased orbits could be classified as hyper-, iso-, or hypovascular in comparison with healthy orbits. On linear regression, there was a correlation between age and the PSV, EDV, and MV of healthy ophthalmic arteries.

The effect of congenital deafness on duration judgment.

PubMed

Kowalska, Joanna; Szelag, Elzbieta

2006-09-01

Congenital deafness provides the opportunity to study how atypical sensory and language experiences affect different aspects of information processing, e.g., time perception. Using two methods of temporal estimation, reproduction (Exp. 1) and production (Exp. 2), the effect of deafness on duration judgment was investigated within a time domain of a few seconds. We examined 16 congenitally deaf adolescents, aged between 16 and 19 years, and 16 normally hearing subjects, matched for gender and age. In Exp. 1 subjects were asked to reproduce durations from 1 to 5.5 s, whereas in Exp. 2 they produced durations from 1 to 6 s. The results showed that in both experiments, the region of accurate estimation was significantly limited in deaf individuals, compared to normal hearing ones. Deaf adolescents judged accurately only intervals around 3 s, whereas they overestimated standards shorter than 2 s and underestimated those above 3 s. In contrast, controls correctly estimated the majority of standards applied in both experiments, with the exception of underreproduction of intervals longer than 3 s (Exp. 1). The effect of deafness on the accuracy of duration judgment can be linked to differences in the use of conventional time units, applied strategy as well as cognitive processes such as attention or working memory.

Nucleolar Organizer Regions of Oral Epithelial Cells in Crack Cocaine Users

PubMed Central

Carvalho de M. Thiele, Magna; Carlos Bohn, Joslei; Lima Chaiben, Cassiano; Trindade Grégio, Ana Maria; Ângela Naval Machado, Maria; Adilson Soares de Lima, Antonio

2013-01-01

Background: The health risks of crack cocaine smoking on the oral mucosa has not been widely researched and documented. Objective: The purpose of this study was to analyze the proliferative activity of oral epithelial cells exposed to crack cocaine smoke using silver nucleolar organizer region (AgNOR) staining. Methods: Oral smears were collected from clinically normal-appearing buccal mucosa by liquid-based exfoliative cytology of 60 individuals (30 crack cocaine users and 30 healthy controls matched for age and gender) and analyzed for cytomorphologic and cytomorphometric techniques. Results: Crack cocaine users consumed about 13.3 heat-stable rocks per day and the time consumption of the drug was of 5.2 (± 3.3) years. Mean values of AgNOR counting for case and control groups were 5.18 ± 1.83 and 3.38 ± 1.02 (P<0.05), respectively. AgNOR area and percentage of AgNOR-occupied nuclear area were increased in comparison with the control (P<0.05). There was no statistically significant difference in the mean values of the nuclear area between the groups (P>0.05). Conclusion: This study revealed that crack cocaine smoke increases the rate of cellular proliferation in cells of normal buccal mucosa. PMID:23567853

Exfoliative cytology of the oral mucosa in burning mouth syndrome: a cytomorphological and cytomorphometric analysis.

PubMed

Wandeur, Talita; de Moura, Sérgio Adriane Bezerra; de Medeiros, Ana Miryam Costa; Machado, Maria Ângela Naval; Alanis, Luciana Reis de Azevedo; Grégio, Ana Maria Trindade; Trevilatto, Paula Cristina; de Lima, Antonio Adilson Soares

2011-03-01

The aim of this study was to evaluate oral epithelial cells by exfoliative cytology in burning mouth syndrome (BMS). Oral smears were collected from clinically normal-appearing mucosa by liquid-based exfoliative cytology in 40 individuals (20 BMS patients and 20 healthy controls matched for age and gender) and analysed for cytological and cytomorphometric techniques. Mean values of nuclear area (NA) for experimental and control groups were, respectively, 67.52 and 55.64 μm² (p < 0.05). Cytoplasmic area (CA) showed the following mean values: 1258.0 (experimental) and 2069.0 μm² (control). Nucleus-to-cytoplasm area ratio for the experimental group was 0.07, besides the control group was 0.03 (p < 0.05). Morphologically, oral smears exhibited normal epithelial cells in both experimental and control groups. There was a significant predominance of nucleated cells of the superficial layer in the smears of BMS patients (p = 0.00001). This study revealed that oral mucosa of BMS patients exhibited significant cytomorphometric changes in the oral epithelial cells. These changes probably are associated with epithelial atrophy and a deregulated maturation process that may contribute to the oral symptoms of pain and discomfort in BMS. © 2010 The Gerodontology Society and John Wiley & Sons A/S.

Aided speech recognition in single-talker competition by elderly hearing-impaired listeners

NASA Astrophysics Data System (ADS)

Coughlin, Maureen; Humes, Larry

2004-05-01

This study examined the speech-identification performance in one-talker interference conditions that increased in complexity while audibility was ensured over a wide bandwidth (200-4000 Hz). Factorial combinations of three independent variables were used to vary the amount of informational masking. These variables were: (1) competition playback direction (forward or reverse); (2) gender match between target and competition talkers (same or different); and (3) target talker uncertainty (one of three possible talkers from trial to trial). Four groups of listeners, two elderly hearing-impaired groups differing in age (65-74 and 75-84 years) and two young normal-hearing groups, were tested. One of the groups of young normal-hearing listeners was tested under acoustically equivalent test conditions and one was tested under perceptually equivalent test conditions. The effect of each independent variable on speech-identification performance and informational masking was generally consistent with expectations. Group differences in the observed informational masking were most pronounced for the oldest group of hearing-impaired listeners. The eight measures of speech-identification performance were found to be strongly correlated with one another, and individual differences in speech understanding performance among the elderly were found to be associated with age and level of education. [Work supported, in part, by NIA.

A systematic quality assurance study in bone densitometry devices

NASA Astrophysics Data System (ADS)

Tuncman, Duygu; Kovan, Hatice; Kovan, Bilal; Demir, Bayram; Turkmen, Cuneyt

2015-07-01

Osteoporosis is the most common metabolic bone disease and can result in devastating physical, psychosocial, and economic consequences. It occurs in women after menopause and affects most elderly. Dual-energy x-ray absorptiometry (DXA) is currently the most widely used method for the measurement of areal Bone Mineral Density (BMD) (g/cm2) .DXA is based on the variable absorption of X-ray by the different body components and uses high and low energy X-ray photons. There are two important values in the assessment of the DXA. These values are T-score and Z-score. The T-score is calculated by taking the difference between a patient's measured BMD with the mean BMD of the young normal population, matched for gender and ethnicity, and then by dividing the difference with the standard deviation (SD) of the BMD of the young normal population. T-score and also Z-score are directly depends on the Bone Mineral Density (BMD). BMD measurements should be made periodically in a patient life. But mostly, it is not possible with the same device. Therefore, in this study, for the quality assurance of bone densitometry devices, we evaluated the BMD results measured in the different Bone Densitometry (DXA) devices using a spine phantom.

Odour recognition memory and odour identification in patients with mild and severe major depressive disorders.

PubMed

Zucco, Gesualdo M; Bollini, Fabiola

2011-12-30

Olfactory deficits, in detection, recognition and identification of odorants have been documented in ageing and in several neurodegenerative and psychiatric conditions. However, olfactory abilities in Major Depressive Disorder (MDD) have been less investigated, and available studies have provided inconsistent results. The present study assessed odour recognition memory and odour identification in two groups of 12 mild MDD patients (M age 41.3, range 25-57) and 12 severe MDD patients (M age, 41.9, range 23-58) diagnosed according to DSM-IV criteria and matched for age and gender to 12 healthy normal controls. The suitability of olfactory identification and recognition memory tasks as predictors of the progression of MDD was also addressed. Data analyses revealed that Severe MDD patients performed significantly worse than Mild MDD patients and Normal controls on both tasks, with these last groups not differing significantly from one another. The present outcomes are consistent with previous studies in other domains which have shown reliable, although not conclusive, impairments in cognitive function, including memory, in patients with MDD, and highlight the role of olfactory identification and recognition tasks as an important additional tool to discriminate between patients characterised by different levels of severity of MDD. Copyright © 2011 Elsevier Ltd. All rights reserved.

Normal reference values for bladder wall thickness on CT in a healthy population.

PubMed

Fananapazir, Ghaneh; Kitich, Aleksandar; Lamba, Ramit; Stewart, Susan L; Corwin, Michael T

2018-02-01

To determine normal bladder wall thickness on CT in patients without bladder disease. Four hundred and nineteen patients presenting for trauma with normal CTs of the abdomen and pelvis were included in our retrospective study. Bladder wall thickness was assessed, and bladder volume was measured using both the ellipsoid formula and an automated technique. Patient age, gender, and body mass index were recorded. Linear regression models were created to account for bladder volume, age, gender, and body mass index, and the multiple correlation coefficient with bladder wall thickness was computed. Bladder volume and bladder wall thickness were log-transformed to achieve approximate normality and homogeneity of variance. Variables that did not contribute substantively to the model were excluded, and a parsimonious model was created and the multiple correlation coefficient was calculated. Expected bladder wall thickness was estimated for different bladder volumes, and 1.96 standard deviation above expected provided the upper limit of normal on the log scale. Age, gender, and bladder volume were associated with bladder wall thickness (p = 0.049, 0.024, and < 0.001, respectively). The linear regression model had an R 2 of 0.52. Age and gender were negligible in contribution to the model, and a parsimonious model using only volume was created for both the ellipsoid and automated volumes (R 2  = 0.52 and 0.51, respectively). Bladder wall thickness correlates with bladder wall volume. The study provides reference bladder wall thicknesses on CT utilizing both the ellipsoid formula and automated bladder volumes.

Sex matters: Systemic complement activity of female C57BL/6J and BALB/cJ mice is limited by serum terminal pathway components.

PubMed

Kotimaa, Juha; Klar-Mohammad, Ngaisah; Gueler, Faikah; Schilders, Geurt; Jansen, Aswin; Rutjes, Helma; Daha, Mohamed R; van Kooten, Cees

2016-08-01

Experimental mouse models have been extensively used to elucidate the role of the complement system in different diseases and injuries. Contribution of gender has revealed an intriguing gender specific difference; female mice often show protection against most complement driven injuries such as ischemia/reperfusion injury, graft rejection and sepsis. Interestingly, early studies to the mouse complement system revealed that female mice have very low total complement activity (CH50), which is related to androgen regulation of hepatic complement synthesis. Here, our aim was to understand at which level the female specific differences in mouse complement resides. We have used recently developed complement assays to study the functional activities of female and male mice at the level of C3 and C9 activation, and furthermore assayed key complement factor levels in serum of age-matched female and male C57BL/6 mice. Our results show that the female mice have normal complement cascade functionality at the level of C3 activation, which was supported by determinations of early complement factors. However, all pathways are strongly reduced at the level of C9 activation, suggesting a terminal pathway specific difference. This was in line with C6 and C9 measurements, showing strongly decreased levels in females. Furthermore, similar gender differences were also found in BALB/cJ mice, but not in CD-1 mice. Our results clearly demonstrate that the complement system in females of frequently used mouse strains is restricted by the terminal pathway components and that the perceived female specific protection against experimental disease and injury might be in part explained by the inability promote inflammation through C5b-9. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Processing of food pictures: influence of hunger, gender and calorie content.

PubMed

Frank, Sabine; Laharnar, Naima; Kullmann, Stephanie; Veit, Ralf; Canova, Carlos; Hegner, Yiwen Li; Fritsche, Andreas; Preissl, Hubert

2010-09-02

In most cases obesity, a major risk factor for diabetes mellitus type 2 and other associated chronic diseases, is generated by excessive eating. For a better understanding of eating behavior, it is necessary to determine how it is modulated by factors such as the calorie content of food, satiety and gender. Twelve healthy normal weighted participants (six female) were investigated in a functional magnetic resonance imaging (fMRI) study. In order to prevent the influence of social acceptability, an implicit one-back task was chosen for stimulus presentation. We presented food (high- and low-caloric) and non-food pictures in a block design and subjects had to indicate by button press whether two consecutive pictures were the same or not. Each subject performed the task in a hungry and satiated state on two different days. High-caloric pictures compared to low-caloric pictures led to increased activity in food processing and reward related areas, like the orbitofrontal and the insular cortex. In addition, we found activation differences in visual areas (occipital lobe), despite the fact that the stimuli were matched for their physical features. Detailed investigation also revealed gender specific effects in the fusiform gyrus. Women showed higher activation in the fusiform gyrus while viewing high-caloric pictures in the hungry state. This study shows that the calorie content of food pictures modulates the activation of brain areas related to reward processing and even early visual areas. In addition, satiation seems to influence the processing of food pictures differently in men and women. Even though an implicit task was used, activation differences could also be observed in the orbitofrontal cortex, known to be activated during explicit stimulation with food related stimuli. 2010 Elsevier B.V. All rights reserved.

Characterization of Skin Friction Coefficient, and Relationship to Stratum Corneum Hydration in a Normal Chinese Population

PubMed Central

Zhu, Y.H.; Song, S.P.; Luo, W.; Elias, P.M.; Man, M.Q.

2011-01-01

Background and Objectives Studies have demonstrated that some cutaneous biophysical properties vary with age, gender and body sites. However, the characteristics of the skin friction coefficient in different genders and age groups have not yet been well established. In the present study, we assess the skin friction coefficient in a larger Chinese population. Methods A total of 633 subjects (300 males and 333 females) aged 0.15–79 years were enrolled. A Frictiometer® FR 770 and Corneometer® CM 825 (C&K MPA 5) were used to measure the skin friction coefficient and stratum corneum hydration, respectively, on the dorsal surface of the hand, the forehead and the canthus. Results In the females, the maximum skin friction coefficients on both the canthus and the dorsal hand skin were observed around the age of 40 years. In the males, the skin friction coefficient on the dorsal hand skin gradually increased from 0 to 40 years of age, and changed little afterward. Skin friction coefficients on some body sites were higher in females than in age-matched males in some age groups. On the canthus and the dorsal hand skin of females, a positive correlation was found between skin friction coefficient and stratum corneum hydration (p < 0.001 and p < 0.0001, respectively). In contrast, in males, the skin friction coefficient was positively correlated with stratum corneum hydration on the forehead and the dorsal hand skin (p < 0.05 and p < 0.0001, respectively). Conclusion The skin friction coefficient varies with age, gender and body site, and positively correlates with stratum corneum hydration on some body sites. PMID:21088455

Characterization of skin friction coefficient, and relationship to stratum corneum hydration in a normal Chinese population.

PubMed

Zhu, Y H; Song, S P; Luo, W; Elias, P M; Man, M Q

2011-01-01

Studies have demonstrated that some cutaneous biophysical properties vary with age, gender and body sites. However, the characteristics of the skin friction coefficient in different genders and age groups have not yet been well established. In the present study, we assess the skin friction coefficient in a larger Chinese population. A total of 633 subjects (300 males and 333 females) aged 0.15-79 years were enrolled. A Frictiometer FR 770 and Corneometer CM 825 (C&K MPA 5) were used to measure the skin friction coefficient and stratum corneum hydration, respectively, on the dorsal surface of the hand, the forehead and the canthus. In the females, the maximum skin friction coefficients on both the canthus and the dorsal hand skin were observed around the age of 40 years. In the males, the skin friction coefficient on the dorsal hand skin gradually increased from 0 to 40 years of age, and changed little afterward. Skin friction coefficients on some body sites were higher in females than in age-matched males in some age groups. On the canthus and the dorsal hand skin of females, a positive correlation was found between skin friction coefficient and stratum corneum hydration (p < 0.001 and p < 0.0001, respectively). In contrast, in males, the skin friction coefficient was positively correlated with stratum corneum hydration on the forehead and the dorsal hand skin (p < 0.05 and p < 0.0001, respectively). The skin friction coefficient varies with age, gender and body site, and positively correlates with stratum corneum hydration on some body sites. Copyright © 2010 S. Karger AG, Basel.

Regional gray matter atrophy in relapsing remitting multiple sclerosis: baseline analysis of multi-center data.

PubMed

Datta, Sushmita; Staewen, Terrell D; Cofield, Stacy S; Cutter, Gary R; Lublin, Fred D; Wolinsky, Jerry S; Narayana, Ponnada A

2015-03-01

Regional gray matter (GM) atrophy in multiple sclerosis (MS) at disease onset and its temporal variation can provide objective information regarding disease evolution. An automated pipeline for estimating atrophy of various GM structures was developed using tensor based morphometry (TBM) and implemented on a multi-center sub-cohort of 1008 relapsing remitting MS (RRMS) patients enrolled in a Phase 3 clinical trial. Four hundred age and gender matched healthy controls were used for comparison. Using the analysis of covariance, atrophy differences between MS patients and healthy controls were assessed on a voxel-by-voxel analysis. Regional GM atrophy was observed in a number of deep GM structures that included thalamus, caudate nucleus, putamen, and cortical GM regions. General linear regression analysis was performed to analyze the effects of age, gender, and scanner field strength, and imaging sequence on the regional atrophy. Correlations between regional GM volumes and expanded disability status scale (EDSS) scores, disease duration (DD), T2 lesion load (T2 LL), T1 lesion load (T1 LL), and normalized cerebrospinal fluid (nCSF) were analyzed using Pearson׳s correlation coefficient. Thalamic atrophy observed in MS patients compared to healthy controls remained consistent within subgroups based on gender and scanner field strength. Weak correlations between thalamic volume and EDSS (r=-0.133; p<0.001) and DD (r=-0.098; p=0.003) were observed. Of all the structures, thalamic volume moderately correlated with T2 LL (r=-0.492; P-value<0.001), T1 LL (r=-0.473; P-value<0.001) and nCSF (r=-0.367; P-value<0.001). Copyright © 2015 Elsevier B.V. All rights reserved.

Colour vision in AIDS patients without HIV retinopathy.

PubMed

Sommerhalder, J; Baglivo, E; Barbey, C; Hirschel, B; Roth, A; Pelizzone, M

1998-11-01

Patients suffering from AIDS develop ocular complications, the most frequent being HIV retinopathy. It is however not clear, if functional visual impairments can be observed as early indicators of ocular complications, before clinical diagnosis of HIV retinopathy is made at fundus examination. To address this issue, we measured colour vision in a group of 49 AIDS subjects with normal clinical fundi using the 'two equation method'. This method, combining red-green Rayleigh and the blue-green Moreland metameric matches, enables more complete and quantitative assessments of colour vision than those based on pigmentary tests. Data were collected on our computer controlled colorimeter and compared to those of normal subjects. While most AIDS subjects without HIV retinopathy demonstrated normal colour vision, a significant portion of them had wider matches than normal subjects (11% for the Rayleigh equation and 16% for the Moreland equation). Furthermore, matching ranges of the Moreland equation were significantly correlated with CD4 lymphocyte counts. Patients with low CD4 values tended to produce larger matching ranges than the patients with high CD4 values. A within subject study on 17 patients confirmed this trend and showed that the patients who increased/decreased their CD4 blood counts generally improved/impaired their colour discrimination in the Moreland match. No such correlation was found between the matching ranges of the Rayleigh equation and the CD4 counts. These results show that colour discrimination is slightly reduced in some AIDS subjects, although there are no detectable ocular complications. They also suggest two different types of colour vision impairments in AIDS patients without retinopathy: one reversible process affecting colour discrimination in the blue-green range; and another irreversible process affecting colour discrimination in the red-green range.

Derivation of gender and age-specific reference intervals from fully normal Japanese individuals and the implications for health screening.

PubMed

Yamakado, Minoru; Ichihara, Kiyoshi; Matsumoto, Yoshiyuki; Ishikawa, Yoshiki; Kato, Kiminori; Komatsubara, Yusuke; Takaya, Norihide; Tomita, Shohken; Kawano, Reo; Takada, Keisuke; Watanabe, Kiyoaki

2015-07-20

With nationwide standardization of laboratory tests among institutions for health screening in Japan, common reference intervals (RIs) were derived from records of 1,500,000 health check attendees. Targets were 20 basic laboratory tests including body mass index (BMI) and systolic and diastolic blood pressures (SBP, DBP). Individuals fulfilling the following strict criteria were chosen: SBP<130, DBP<85mmHg, BMI<25kg/m(2), non-smoking, ethanol consumption<20g/day and under no mediation with no remarkable current/past illnesses. The latent abnormal values exclusion (LAVE) method was applied to ensure fully normal results. RIs were derived by parametric method using modified Box-Cox power transformation. Among all attendees, 23% fulfilled the criteria. Application of the LAVE method further reduced the dataset by 40%-50%. Age-related charts of test results differed greatly between genders in almost all tests. Comparison of derived RIs with clinical decision limits (CDLs) revealed that the upper limits of RIs differed from CDLs according to gender and age. Implementation of gender and age-specific RIs derived from individuals with fully normal health attributes will (1) enable appropriate interpretation of test results in health screening and (2) promote judicious application of CDLs for therapeutic intervention, taking into account gender, age and other health attributes. Copyright © 2015 Elsevier B.V. All rights reserved.

Age and Gender Effects on Wideband Absorbance in Adults With Normal Outer and Middle Ear Function.

PubMed

Mazlan, Rafidah; Kei, Joseph; Ya, Cheng Li; Yusof, Wan Nur Hanim Mohd; Saim, Lokman; Zhao, Fei

2015-08-01

This study examined the effects of age and gender on wideband energy absorbance in adults with normal middle ear function. Forty young adults (14 men, 26 women, aged 20-38 years), 31 middle-aged adults (16 men, 15 women, aged 42-64 years), and 30 older adults (20 men, 10 women, aged 65-82 years) were assessed. Energy absorbance (EA) data were collected at 30 frequencies using a prototype commercial instrument developed by Interacoustics. Results showed that the young adult group had significantly lower EA (between 400 and 560 Hz) than the middle-aged group. However, the middle-aged group showed significantly lower EA (between 2240 and 5040 Hz) than the young adult group. In addition, the older adult group had significantly lower EA than the young adult group (between 2520 and 5040 Hz). No significant difference in EA was found at any frequency between middle-aged and older adults. Across age groups, gender differences were found with men having significantly higher EA values than women at lower frequencies, whereas women had significantly higher EA at higher frequencies. This study provides evidence of the influence of gender and age on EA in adults with normal outer and middle ear function. These findings support the importance of establishing age- and gender-specific EA norms for the adult population.

Kidney allograft survival of African American and Caucasian American recipients with lupus.

PubMed

Contreras, G; Li, H; Gonzalez-Suarez, M; Isakova, T; Scialla, J J; Pedraza, F; Mattiazzi, A; Diaz-Wong, R; Sageshima, J; Brito, Y; Guerra, G; Acevedo, B; Sajid Ali, A; Kershaw, T J; Chen, L; Burke, G W; Kupin, W; Ciancio, G; Roth, D

2014-02-01

African Americans with lupus who receive kidney transplants have high prevalence of predictors of allograft failure, which can explain their poor outcomes. Of 1223 African Americans and 1029 Caucasian Americans with lupus who received kidney transplants from deceased donors between 1987 and 2006 with complete records in the UNOS program, 741 pairs were matched in 16 predictors employing a predicted probability of group membership. The primary outcome was allograft failure. Main secondary outcomes were rejection, allograft failure due to rejection, and mortality. Matched pairs were predominantly women (82%) with a mean age of 39 years. Twenty-four percent of recipients received kidneys from expanded criteria donors. African Americans and Caucasian Americans matched well (p ≥ 0.05): donor age, gender and race; recipient age, gender, education and insurance; dialysis prior to transplant, kidneys from expanded criteria donors, cold ischemia time, history of prior kidney transplant, panel reactive antibodies, human leukocyte antigens mismatch, blood type compatibility, transplant Era, and follow-up time. Contrary to the unmatched cohort with significantly higher allograft failure rate (events per 100 patient-years) in African Americans compared to Caucasian Americans (10.49 vs 6.18, p<0.001), matched pairs had similar allograft failure rates (8.41 vs 7.81, p=0.418). Matched pairs also had similar rates of rejections (9.82 vs 9.39, p=0.602), allograft failure due to rejection (6.19 vs 5.71, p=0.453), and mortality (2.79 vs 3.52, p=0.097). In lupus recipients of kidney transplants from deceased donors, African American and Caucasian Americans have similar allograft failure rates when predictors are matched between groups.

Fat-free mass is not lower 24 months postbariatric surgery than nonoperated matched controls

PubMed Central

Strain, Gladys Witt; Ebel, Faith; Honohan, Jamie; Gagner, Michel; Dakin, Gregory F.; Pomp, Alfons; Gallagher, Dympna

2017-01-01

Objective Concerns about an excessive loss of fat-free mass (FFM) after bariatric surgery prompted this comparison of operated versus matched nonoperated controls regarding FFM. Setting University Hospital and University Research Unit in an urban medical center. Methods Body composition with bioelectric impedance (Tanita 310, Tanita Corp, Arlington Heights, IL) was measured approximately 2 years after bariatric surgery in weight stable patients and nonoperated weight stable controls matched for body mass index (BMI), gender, and age. t tests provided comparisons. Analysis of variance was used to compare FFM changes for 4 procedures. Levene’s test evaluated variance. Results Patients (n = 252; 24.7 ± 15 mo after surgery) and nonoperated controls (n = 252) were matched for gender (71.8% female), age (44.5 ± 11.0 yr), and BMI (32.8 ± 7.0 kg/m2). Patients had different surgical procedures: 107 gastric bypasses (RYGBs), 62 biliopancreatic diversions with duodenal switch (BPD/DSs), 40 adjustable gastric bands (AGBs), and 43 sleeve gastrectomies (LSGs). FFM percentage was significantly higher in the operated patients than controls, 66% versus 62%, P < .0001. For 3 procedures, the FFM was significantly higher; however, AGBs changed only 7.3 BMI units and FFM was not significantly different from their matched controls, 59.8% versus 58.2%. Across surgical groups, FFM percentage differed, P < .0001 (RYGB 66.5 ± 9.2%, BPD/DS 74.0 ± 9.3%, AGB 59.8 ± 7.0%, LSG 59.6 ± 9.3%). Variance was not different (P = .17). Conclusion Weight-reduced bariatric surgery patients have greater FFM compared with nonoperated matched controls. These findings support surgically assisted weight loss as a physiologic process and in general patients do not suffer from excessive FFM depletion after bariatric procedures. PMID:27387700

Endoscopic detection rate of sessile serrated lesions in Lynch syndrome patients is comparable with an age- and gender-matched control population: case-control study with expert pathology review.

PubMed

Vleugels, Jasper L A; Sahin, Husna; Hazewinkel, Yark; Koens, Lianne; van den Berg, Jose G; van Leerdam, Monique E; Dekker, Evelien

2018-05-01

Carcinogenesis in Lynch syndrome involves fast progression of adenomas to colorectal cancer (CRC) because of microsatellite instability. The role of sessile serrated lesions (SSLs) and the serrated neoplasia pathway in these patients is unknown. The aim of this matched case-control study was to compare endoscopic detection rates and distribution of SSLs in Lynch syndrome patients with a matched control population. We collected data of Lynch syndrome patients with a proven germline mutation who underwent colonoscopy between January 2011 and April 2016 in 2 tertiary referral hospitals. Control subjects undergoing elective colonoscopy from 2011 and onward for symptoms or surveillance were selected from a prospectively collected database. Patients were matched 1:1 for age, gender, and index versus surveillance colonoscopy. An expert pathology review of serrated polyps was performed. The primary outcomes included the detection rates and distribution of SSLs. We identified 321 patients with Lynch syndrome who underwent at least 1 colonoscopy. Of these, 223 Lynch syndrome patients (mean age, 49.3; 59% women; index colonoscopy, 56%) were matched to 223 control subjects. SSLs were detected in 7.6% (95% confidence interval, 4.8-11.9) of colonoscopies performed in Lynch syndrome patients and in 6.7% (95% confidence interval, 4.1-10.8) of control subjects (P = .86). None of the detected SSLs in Lynch syndrome patients contained dysplasia. The detection rate of SSLs in Lynch syndrome patients undergoing colonoscopy is comparable with a matched population. These findings suggest that the role of the serrated neoplasia pathway in CRC development in Lynch syndrome seems to be comparable with that in the general population. Copyright © 2018 American Society for Gastrointestinal Endoscopy. Published by Elsevier Inc. All rights reserved.

Are the deficits in navigational abilities present in the Williams syndrome related to deficits in the backward inhibition?

PubMed Central

Foti, Francesca; Sdoia, Stefano; Menghini, Deny; Mandolesi, Laura; Vicari, Stefano; Ferlazzo, Fabio; Petrosini, Laura

2015-01-01

Williams syndrome (WS) is associated with a distinct profile of relatively proficient skills within the verbal domain compared to the severe impairment of visuo-spatial processing. Abnormalities in executive functions and deficits in planning ability and spatial working memory have been described. However, to date little is known about the influence of executive function deficits on navigational abilities in WS. This study aimed at analyzing in WS individuals a specific executive function, the backward inhibition (BI) that allows individuals to flexibly adapt to continuously changing environments. A group of WS individuals and a mental age- and gender-matched group of typically developing children were subjected to three task-switching experiments requiring visuospatial or verbal material to be processed. Results showed that WS individuals exhibited clear BI deficits during visuospatial task-switching paradigms and normal BI effect during verbal task-switching paradigm. Overall, the present results suggest that the BI involvement in updating environment representations during navigation may influence WS navigational abilities. PMID:25852605

Differentiating Patients with Parkinson's Disease from Normal Controls Using Gray Matter in the Cerebellum.

PubMed

Zeng, Ling-Li; Xie, Liang; Shen, Hui; Luo, Zhiguo; Fang, Peng; Hou, Yanan; Tang, Beisha; Wu, Tao; Hu, Dewen

2017-02-01

Parkinson's disease (PD) is one of the most common neurodegenerative disorders in the world. Previous studies have focused on the basal ganglia and cerebral cortices. To date, the cerebellum has not been systematically investigated in patients with PD. In the current study, 45 probable PD patients and 40 age- and gender-matched healthy controls underwent structural magnetic resonance imaging, and we used support vector machines combining with voxel-based morphometry to explore the cerebellar structural changes in the probable PD patients relative to healthy controls. The results revealed that the gray matter alterations were primarily located within the cerebellar Crus I, implying a possible important role of this region in PD. Furthermore, the gray matter alterations in the cerebellum could differentiate the probable PD patients from healthy controls with accuracies of more than 95 % (p < 0.001, permutation test) via cross-validation, suggesting the potential of analyzing the cerebellum in the clinical diagnosis of PD.

Right hemisphere specialization for the identification of emotional words and sentences: evidence from stroke patients.

PubMed

Borod, J C; Andelman, F; Obler, L K; Tweedy, J R; Welkowitz, J

1992-09-01

This study examines the contribution of the lexical/verbal channel to emotional processing in 16 right brain-damaged (RBD), 16 left brain-damaged (LBD) and 16 normal control (NC) right-handed adults. Emotional lexical perception tasks were developed; analogous nonemotional tasks were created to control for cognitive and linguistic factors. The three subject groups were matched for gender, age and education. The brain-damaged groups were similar with respect to cerebrovascular etiology, months post-onset, sensory-motor status and lesion location. Parallel emotional and nonemotional tasks included word identification, sentence identification and word discrimination. For both word tasks, RBDs were significantly more impaired than LBDs and NCs in the emotional condition. For all three tasks, RBDs showed a significantly greater performance discrepancy between emotional and nonemotional conditions than did LBDs or NCs. Results were not affected by the valence (i.e. positive/negative) of the stimuli. These findings suggest a dominant role for the right hemisphere in the perception of lexically-based emotional stimuli.

Atrial remodeling and metabolic dysfunction in idiopathic isolated fibrotic atrial cardiomyopathy.

PubMed

Cui, Chang; Jiang, Xiaohong; Ju, Weizhu; Wang, Jiaxian; Wang, Daowu; Sun, Zheng; Chen, Minglong

2018-08-15

Idiopathic isolated fibrotic atrial cardiomyopathy (IIF-ACM) is a novel subtype of cardiomyopathy characterized by atrial fibrosis that does not involve the ventricular myocardium and is associated with significant atrial tachyarrhythmia. The mechanisms underlying its pathogenesis are unknown. Atrium samples were obtained from 3 patients with IIF-ACM via surgical intervention. Control samples were consisted of 3 atrium biopsies from patients with congenital heart disease and normal sinus rhythm, matched for gender, age and basic clinical characteristics. Comparative histology, immunofluorescence staining, electron microscopy and proteomics analyses were carried out to explore the unique pathogenesis of IIF-ACM. IIF-ACM atria displayed disordered myofibrils, profound fibrosis and mitochondrial damages compared to the control atria. Proteomics profiling identified metabolic pathways as the most profound changes in IIF-ACM. Our study suggested that metabolic changes in the atrial myocardium caused mitochondrial oxidative stress and potential cell damage, which further led to atrial fibrosis and myofibril disorganization, the characteristic phenotype of IIF-ACM. Copyright © 2018 Elsevier B.V. All rights reserved.

Does the arousal system contribute to near death experience?

PubMed

Nelson, Kevin R; Mattingly, Michelle; Lee, Sherman A; Schmitt, Frederick A

2006-04-11

The neurophysiologic basis of near death experience (NDE) is unknown. Clinical observations suggest that REM state intrusion contributes to NDE. Support for the hypothesis follows five lines of evidence: REM intrusion during wakefulness is a frequent normal occurrence, REM intrusion underlies other clinical conditions, NDE elements can be explained by REM intrusion, cardiorespiratory afferents evoke REM intrusion, and persons with an NDE may have an arousal system predisposing to REM intrusion. To investigate a predisposition to REM intrusion, the life-time prevalence of REM intrusion was studied in 55 NDE subjects and compared with that in age/gender-matched control subjects. Sleep paralysis as well as sleep-related visual and auditory hallucinations were substantially more common in subjects with an NDE. These findings anticipate that under circumstances of peril, an NDE is more likely in those with previous REM intrusion. REM intrusion could promote subjective aspects of NDE and often associated syncope. Suppression of an activated locus ceruleus could be central to an arousal system predisposed to REM intrusion and NDE.

Age-dependent oxidative stress-induced DNA damage in Down's lymphocytes.

PubMed

Zana, Marianna; Szécsényi, Anita; Czibula, Agnes; Bjelik, Annamária; Juhász, Anna; Rimanóczy, Agnes; Szabó, Krisztina; Vetró, Agnes; Szucs, Péter; Várkonyi, Agnes; Pákáski, Magdolna; Boda, Krisztina; Raskó, István; Janka, Zoltán; Kálmán, János

2006-06-30

The aim of the present study was to investigate the oxidative status of lymphocytes from children (n=7) and adults (n=18) with Down's syndrome (DS). The basal oxidative condition, the vulnerability to in vitro hydrogen peroxide exposure, and the repair capacity were measured by means of the damage-specific alkaline comet assay. Significantly and age-independently elevated numbers of single strand breaks and oxidized bases (pyrimidines and purines) were found in the nuclear DNA of the lymphocytes in the DS group in the basal condition. These results may support the role of an increased level of endogenous oxidative stress in DS and are similar to those previously demonstrated in Alzheimer's disease. In the in vitro oxidative stress-induced state, a markedly higher extent of DNA damage was observed in DS children as compared with age- and gender-matched healthy controls, suggesting that young trisomic lymphocytes are more sensitive to oxidative stress than normal ones. However, the repair ability itself was not found to be deteriorated in either DS children or DS adults.

[Compulsive buying and psychiatric comorbidity].

PubMed

Mueller, Astrid; Mühlhans, Barbara; Silbermann, Andrea; Müller, Ulrike; Mertens, Christian; Horbach, Thomas; Mitchell, James E; de Zwaan, Martina

2009-08-01

Compulsive buying is an excessive behavior that has begun to receive attention from researchers in recent years. The current study provides an overview of research on compulsive buying and examines the psychiatric co-morbidity in a German female treatment seeking compulsive buying sample in comparison with age and gender-matched normal buying control groups. Thirty women suffering from compulsive buying disorder, 30 community controls, and 30 bariatric surgery candidates were assessed with the German versions of the Structured Clinical Interview for DSM-IV diagnoses (SCID). Women with compulsive buying disorder showed significantly higher prevalence rates of affective, anxiety, and eating disorders compared to community controls, and suffered significantly more often from affective and anxiety disorders compared to bariatric surgery candidates. The compulsive buying group presented with the highest rates of personality disorders, most commonly avoidant, depressive, obsessive-compulsive, and borderline personality disorder, and reported the highest prevalence rates of other impulse control disorders, especially for intermittent explosive disorder. The findings suggest an elevated psychiatric co-morbidity in patients with compulsive buying disorder.

Hematologic and lymphocyte immunophenotypic reference values for normal rhesus monkey (Macaca mulatta) umbilical cord blood; gravidity may play a role in study design.

PubMed

Rogers, Linda B; Kaack, M Bernice; Henson, Michael C; Rasmussen, Terri; Henson, Elizabeth; Veazey, Ronald S; Krogstad, Donald J; Davison, Billie B

2005-06-01

Hematology and flow cytometry reference values for rhesus umbilical cord blood (UCB) were established in 17 healthy infant rhesus monkeys delivered by elective cesarean section 10 days preterm. The infants were born to age matched, singly caged primigravid or secundigravid dams. The hematology and flow cytometry values were determined by automated cell counter and by FACS. No significant differences were observed with respect to infant gender. With respect to gravida, the primigravid infants had a significantly higher percentage (P= 0.05) of CD20(+) B lymphocytes in UCB. These results provide useful reference values for future studies of maternal - fetal disease transmission, vaccine and drug evaluation in non-human primate pregnancy, as well as fetal programming and immune modulation, gene therapy and the use of UCB as a source of stem cells for research and transplantation. Importantly, our results suggest that maternal gravidity may be an important variable to consider.

Food-Predicting Stimuli Differentially Influence Eye Movements and Goal-Directed Behavior in Normal-Weight, Overweight, and Obese Individuals

PubMed Central

Lehner, Rea; Balsters, Joshua H.; Bürgler, Alexandra; Hare, Todd A.; Wenderoth, Nicole

2017-01-01

Obese individuals have been shown to exhibit abnormal sensitivity to rewards and reward-predicting cues as for example food-associated cues frequently used in advertisements. It has also been shown that food-associated cues can increase goal-directed behavior but it is currently unknown, whether this effect differs between normal-weight, overweight, and obese individuals. Here, we investigate this question by using a Pavlovian-to-instrumental transfer (PIT) task in normal-weight (N = 20), overweight (N = 17), and obese (N = 17) individuals. Furthermore, we applied eye tracking during Pavlovian conditioning to measure the participants’ conditioned response as a proxy of the incentive salience of the predicted reward. Our results show that the goal-directed behavior of overweight individuals was more strongly influenced by food-predicting cues (i.e., stronger PIT effect) than that of normal-weight and obese individuals (p < 0.001). The weight groups were matched for age, gender, education, and parental education. Eye movements during Pavlovian conditioning also differed between weight categories (p < 0.05) and were used to categorize individuals based on their fixation style into “high eye index” versus “low eye index” as well. Our main finding was that the fixation style exhibited a complex interaction with the weight category. Furthermore, we found that normal-weight individuals of the group “high eye index” had higher body mass index within the healthy range than individuals of the group “low eye index” (p < 0.001), but this relationship was not found within in the overweight or obese groups (p > 0.646). Our findings are largely consistent with the incentive sensitization theory predicting that overweight individuals are more susceptible to food-related cues than normal-weight controls. However, this hypersensitivity might be reduced in obese individuals, possibly due to habitual/compulsive overeating or differences in reward valuation. PMID:29180968

Food-Predicting Stimuli Differentially Influence Eye Movements and Goal-Directed Behavior in Normal-Weight, Overweight, and Obese Individuals.

PubMed

Lehner, Rea; Balsters, Joshua H; Bürgler, Alexandra; Hare, Todd A; Wenderoth, Nicole

2017-01-01

Obese individuals have been shown to exhibit abnormal sensitivity to rewards and reward-predicting cues as for example food-associated cues frequently used in advertisements. It has also been shown that food-associated cues can increase goal-directed behavior but it is currently unknown, whether this effect differs between normal-weight, overweight, and obese individuals. Here, we investigate this question by using a Pavlovian-to-instrumental transfer (PIT) task in normal-weight ( N  = 20), overweight ( N  = 17), and obese ( N  = 17) individuals. Furthermore, we applied eye tracking during Pavlovian conditioning to measure the participants' conditioned response as a proxy of the incentive salience of the predicted reward. Our results show that the goal-directed behavior of overweight individuals was more strongly influenced by food-predicting cues (i.e., stronger PIT effect) than that of normal-weight and obese individuals ( p  < 0.001). The weight groups were matched for age, gender, education, and parental education. Eye movements during Pavlovian conditioning also differed between weight categories ( p  < 0.05) and were used to categorize individuals based on their fixation style into "high eye index" versus "low eye index" as well. Our main finding was that the fixation style exhibited a complex interaction with the weight category. Furthermore, we found that normal-weight individuals of the group "high eye index" had higher body mass index within the healthy range than individuals of the group "low eye index" ( p  < 0.001), but this relationship was not found within in the overweight or obese groups ( p  > 0.646). Our findings are largely consistent with the incentive sensitization theory predicting that overweight individuals are more susceptible to food-related cues than normal-weight controls. However, this hypersensitivity might be reduced in obese individuals, possibly due to habitual/compulsive overeating or differences in reward valuation.

Gender gap on concept inventories in physics: What is consistent, what is inconsistent, and what factors influence the gap?

NASA Astrophysics Data System (ADS)

Madsen, Adrian; McKagan, Sarah B.; Sayre, Eleanor C.

2013-12-01

We review the literature on the gender gap on concept inventories in physics. Across studies of the most commonly used mechanics concept inventories, the Force Concept Inventory and Force and Motion Conceptual Evaluation, men’s average pretest scores are always higher than women’s, and in most cases men’s posttest scores are higher as well. The weighted average gender difference on these tests is 13% for pretest scores, 12% for posttest scores, and 6% for normalized gain. This difference is much smaller than the average difference in normalized gain between traditional lecture and interactive engagement (25%), but it is large enough that it could impact the results of studies comparing the effectiveness of different teaching methods. There is sometimes a gender gap on commonly used electricity and magnetism concept inventories, the Brief Electricity and Magnetism Assessment and Conceptual Survey of Electricity and Magnetism, but it is usually much smaller and sometimes is zero or favors women. The weighted average gender difference on these tests is 3.7% for pretest scores, 8.5% for posttest scores, and 6% for normalized gain. There are far fewer studies of the gender gap on electricity and magnetism concept inventories and much more variation in the existing studies. Based on our analysis of 26 published articles comparing the impact of 30 factors that could potentially influence the gender gap, no single factor is sufficient to explain the gap. Several high-profile studies that have claimed to account for or reduce the gender gap have failed to be replicated in subsequent studies, suggesting that isolated claims of explanations of the gender gap should be interpreted with caution. For example, claims that the gender gap could be eliminated through interactive engagement teaching methods or through a “values affirmation writing exercise” were not supported by subsequent studies. Suggestions that the gender gap might be reduced by changing the wording of “male-oriented” questions or refraining from asking demographic questions before administering the test are not supported by the evidence. Other factors, such as gender differences in background preparation, scores on different kinds of assessment, and splits between how students respond to test questions when answering for themselves or for a “scientist” do contribute to a difference between male and female responses, but the size of these differences is smaller than the size of the overall gender gap, suggesting that the gender gap is most likely due to the combination of many small factors rather than any one factor that can easily be modified.

Exploring the Cause of English Pronoun Gender Errors by Chinese Learners of English: Evidence from the Self-paced Reading Paradigm.

PubMed

Dong, Yanping; Wen, Yun; Zeng, Xiaomeng; Ji, Yifei

2015-12-01

To locate the underlying cause of biological gender errors of oral English pronouns by proficient Chinese-English learners, two self-paced reading experiments were conducted to explore whether the reading time for each 'he' or 'she' that matched its antecedent was shorter than that in the corresponding mismatch situation, as with native speakers of English. The critical manipulation was to see whether highlighting the gender information of an antecedent with a human picture would make a difference. The results indicate that such manipulation did make a difference. Since oral Chinese does not distinguish 'he' and 'she', the findings suggest that Chinese speakers probably do not usually process biological gender for linguistic purposes and the mixed use of 'he' and 'she' is probably a result of deficient processing of gender information in the conceptualizer. Theoretical and pedagogical implications are discussed.

Cardiorespiratory fitness and nutritional status of schoolchildren: 30-year evolution.

PubMed

Moraes Ferrari, Gerson Luis de; Bracco, Mario Maia; Matsudo, Victor K Rodrigues; Fisberg, Mauro

2013-01-01

To compare the changes in cardiorespiratory fitness in evaluations performed every ten years since 1978/1980, according to the nutritional status and gender of students in the city of Ilhabela, Brazil. The study is part of the Mixed Longitudinal Project on Growth, Development and Physical Fitness of Ilhabela. The study included 1,291 students of both genders, aged 10 to 11 years old. The study periods were: 1978/1980, 1988/1990, 1998/2000, and 2008/2010. The variables analyzed were: body weight, height, and cardiorespiratory fitness (VO2max - L.min-1 and mL.kg-1.min-1) performed using a submaximal progressive protocol on a cycle ergometer. Individuals were classified as normal weight and overweight according to curves proposed by the World Health Organization of body mass index for age and gender. Analysis of variance (ANOVA) with three factors followed by the Bonferroni method were used to compare the periods. The number of normal weight individuals (61%) was higher than that of overweight. There was a significant decrease in cardiorespiratory fitness in both genders. Among the schoolchildren with normal weight, there was a decrease of 22% in males and 26% in females. In overweight schoolchildren, males showed a decrease of 12.7% and females, of 18%. During a 30-year analysis with reviews every ten years from 1978/1980, there was a significant decrease in cardiorespiratory fitness in schoolchildren of both genders, which cannot be explained by the nutritional status. The decline in cardiorespiratory fitness was greater in individuals with normal weight than in overweight individuals. Copyright © 2013 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

Do grammatical-gender distinctions learned in the second language influence native-language lexical processing?

PubMed Central

Kaushanskaya, Margarita; Smith, Samantha

2015-01-01

How does learning a second language influence native language processing? In the present study, we examined whether knowledge of Spanish – a language that marks grammatical gender on inanimate nouns – influences lexical processing in English – a language that does not mark grammatical gender. We tested three groups of adult English native speakers: monolinguals, emergent bilinguals with high exposure to Spanish, and emergent bilinguals with low exposure to Spanish. Participants engaged in an associative learning task in English where they learned to associate names of inanimate objects with proper names. For half of the pairs, the grammatical gender of the noun’s Spanish translation matched the gender of the proper name (e.g., corn-Patrick). For half of the pairs, the grammatical gender of the noun’s Spanish translation mismatched the gender of the proper noun (e.g., beach-William). High-Spanish-exposure bilinguals (but not monolinguals or low-Spanish-exposure bilinguals) were less accurate at retrieving proper names for gender-incongruent than for gender-congruent pairs. This indicates that second-language morphosyntactic information is activated during native-language processing, even when the second language is acquired later in life. PMID:26977134

Competing for jobs: labor queues and gender sorting in the hiring process.

PubMed

Fernandez, Roberto M; Mors, Marie Louise

2008-12-01

While much research has documented the pattern and extent of sex segregation of workers once they are employed, few studies have addressed the pre-hire mechanisms that are posited to produce sex segregation in employment. While the notion of a labor queue-the rank order of the set of people that employers choose among-plays a prominent role in pre-hire accounts of job sex sorting mechanisms, few studies have examined the ways in which job candidates are sorted into labor queues. In this paper, we explore the mechanisms by which labor queues contribute to the gendering of jobs by studying the hiring process for all jobs at a call center. Being placed in a queue has a clear gendering effect on the hiring process: the sex distribution of applicants who are matched to queues and those who are rejected at this phase diverge, and among those assigned to queues, women are prevalent in queues for low pay, low status jobs. The screening process also contributes to the gendering of the population of hires at this firm. Females are more prevalent among hires than they are among candidates at initial queue assignment. Among high status jobs, however, males are more prevalent than females. Moreover, there are important wage implications associated with matching to queues. While there are large between-queue sex differences in the paid wages associated with allocation to queues, once allocated to queues the wage differences between male and female candidates are nil. Consequently, the roots of gender wage inequality in this setting lie in the initial sorting of candidates to labor queues.

Acoustic markers to differentiate gender in prepubescent children's speaking and singing voice.

PubMed

Guzman, Marco; Muñoz, Daniel; Vivero, Martin; Marín, Natalia; Ramírez, Mirta; Rivera, María Trinidad; Vidal, Carla; Gerhard, Julia; González, Catalina

2014-10-01

Investigation sought to determine whether there is any acoustic variable to objectively differentiate gender in children with normal voices. A total of 30 children, 15 boys and 15 girls, with perceptually normal voices were examined. They were between 7 and 10 years old (mean: 8.1, SD: 0.7 years). Subjects were required to perform the following phonatory tasks: (1) to phonate sustained vowels [a:], [i:], [u:], (2) to read a phonetically balanced text, and (3) to sing a song. Acoustic analysis included long-term average spectrum (LTAS), fundamental frequency (F0), speaking fundamental frequency (SFF), equivalent continuous sound level (Leq), linear predictive code (LPC) to obtain formant frequencies, perturbation measures, harmonic to noise ratio (HNR), and Cepstral peak prominence (CPP). Auditory perceptual analysis was performed by four blinded judges to determine gender. No significant gender-related differences were found for most acoustic variables. Perceptual assessment showed good intra and inter rater reliability for gender. Cepstrum for [a:], alpha ratio in text, shimmer for [i:], F3 in [a:], and F3 in [i:], were the parameters that composed the multivariate logistic regression model to best differentiate male and female children's voices. Since perceptual assessment reliably detected gender, it is likely that other acoustic markers (not evaluated in the present study) are able to make clearer gender differences. For example, gender-specific patterns of intonation may be a more accurate feature for differentiating gender in children's voices. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Gene Expression Profiling of Multiple Leiomyomata Uteri and Matched Normal Tissue from a Single Patient

PubMed Central

Dimitrova, Irina K.; Richer, Jennifer K.; Rudolph, Michael C.; Spoelstra, Nicole S.; Reno, Elaine M.; Medina, Theresa M.; Bradford, Andrew P.

2009-01-01

Objective To identify differentially expressed genes between fibroid and adjacent normal myometrium in an identical hormonal and genetic background. Design Array analysis of 3 leiomyomata and matched adjacent normal myometrium in a single patient. Setting University of Colorado Hospital. Patient(s) A single female undergoing medically indicated hysterectomy for symptomatic fibroids. Interventions(s) mRNA isolation and microarray analysis, reverse-transcriptase polymerase chain reaction, western blotting and immunohistochemistry. Main Outcome Measure(s) Changes in mRNA and protein levels in leiomyomata and matched normal myometrium. Result(s) Expression of 197 genes was increased and 619 decreased, significantly by at least 2 fold, in leiomyomata relative to normal myometrium. Expression profiles between tumors were similar and normal myometrial samples showed minimal variation. Changes in, and variation of, expression of selected genes were confirmed in additional normal and leiomyoma samples from multiple patients. Conclusion(s) Analysis of multiple tumors from a single patient confirmed changes in expression of genes described in previous, apparently disparate, studies and identified novel targets. Gene expression profiles in leiomyomata are consistent with increased activation of mitogenic pathways and inhibition of apoptosis. Down-regulation of genes implicated in invasion and metastasis, of cancers, was observed in fibroids. This expression pattern may underlie the benign nature of uterine leiomyomata and may aid in the differential diagnosis of leiomyosarcoma. PMID:18672237

Gender Diversity, Sexual Orientation, and Bone Health in the Maturing Dancer.

PubMed

Brown, Derrick D

2017-12-01

Gender identity forms an important aspect of still developing youths. Gender is traditionally classified into two distinct categories, female and male. Transgender is a general term that describes individuals who self-identity as male, female, both, or neither (i.e., gender fluid) and do not match the assigned at-birth gender. Adolescent transgender individuals are currently a marginal population. There are limited demographics on youths, but as of 2014 an estimate of 1.4 million adults in the USA identified as transgender. It does seem, however, as more adults embrace their gender diversity and come out as transgender, in some cases opting for surgical reassignment, more adolescents and families are accepting their diversity. A growing body of research highlights transgender adolescents and their specific medical and mental health needs. This review seeks to underscore physiological phenomena relevant to trans-individuals, particularly in adolescents maturing into young adults, and disseminate this knowledge to dance, health, and education professionals.

Representations of abstract grammatical feature agreement in young children.

PubMed

Melançon, Andréane; Shi, Rushen

2015-11-01

A fundamental question in language acquisition research is whether young children have abstract grammatical representations. We tested this question experimentally. French-learning 30-month-olds were first taught novel word-object pairs in the context of a gender-marked determiner (e.g., un MASC ravole 'a ravole'). Test trials presented the objects side-by-side while one of them was named in new phrases containing other determiners and an adjective (e.g., le MASC joli ravole MASC 'the pretty ravole'). The gender agreement between the new determiner and the non-adjacent noun was manipulated in different test trials (e.g., le MASC __ravole MASC; *la FEM __ravole MASC). We found that online comprehension of the named target was facilitated in gender-matched trials but impeded in gender-mismatched trials. That is, children assigned the determiner genders to the novel nouns during word learning. They then processed the non-adjacent gender agreement between the two categories (Det, Noun) during test. The results demonstrate abstract featural representation and grammatical productivity in young children.

Collagen fragment biomarkers as serological biomarkers of lean body mass – a biomarker pilot study from the DAHANCA25B cohort and matched controls

PubMed Central

Nedergaard, Anders; Dalgas, Ulrik; Primdahl, Hanne; Johansen, Jørgen; Overgaard, Jens; Overgaard, Kristian; Henriksen, Kim; Karsdal, Morten Asser; Lønbro, Simon

2015-01-01

Background Loss of muscle mass and function is an important complication to ageing and a range of pathologies, including, but not restricted to, cancer, organ failures, and sepsis. A number of interventions have been proposed ranging from exercise to anabolic pharmacological therapy, with varying success. Easily applicable serological biomarkers of lean and/or muscle mass and change therein would benefit monitoring of muscle mass during muscle atrophy as well as during recovery. We set out to validate if novel peptide biomarkers derived from Collagen III and VI were markers of lean body mass (LBM) or change therein in head and neck cancer patients in the Danish Head and Neck Cancer Group(DAHANCA) 25B cohort subjected to resistance training as well as in an age-matched and gender-matched control group. Methods Blood samples and dual X-ray absorptiometry data were measured at baseline, after 12 and 24 weeks in 41 HNSCC subjects of the DAHANCA 25B cohort of subjects recovering from neck and head cancer (stages provided in Table 1), and at baseline only in 21 healthy age-matched and gender-matched controls. Serum from blood was analyzed for the ProC3, IC6, and C6M peptide biomarkers and LBM were derived from the dual X-ray absorptiometry scans. Results We were not able to show any correlation between biomarkers and LBM or C6M and anabolic response to exercise in recovering head and neck cancer patients. However, we did find that the biomarkers IC6, IC6/C6M, and ProC3 are biomarkers of LBM in the control group subjects (R2/P of 0.249/0.035, 0.416/0.007 and 0.178 and P = 0.057, respectively), Conclusion In conclusion, the IC6, ProC3, and IC6/C6M biomarkers are indeed biomarkers of LBM in healthy individuals of both genders, but not in HNSCC patients. PMID:26673155

Women in Orthopaedic Fellowships: What Is Their Match Rate, and What Specialties Do They Choose?

PubMed

Cannada, Lisa K

2016-09-01

Orthopaedic fellowship training is a common step before becoming a practicing orthopaedic surgeon. In the past, fellowship decisions in orthopaedics were made early in the residency and without a formal match. The process was disorganized, often not fair to the applicants or fellowship programs. More recently, there has been an organized match process for nine different disciplines in orthopaedics. Although the numbers of women applicants into orthopaedic residency has been reported and is the target of efforts to continue to improve gender diversity in orthopaedics, the numbers regarding women in orthopaedic fellowships have not been known. Other details including if there is a difference in match rate between male and female fellowship applicants and what discipline they choose to pursue across orthopaedic surgery has not been reported. (1) How have the numbers of women applying to orthopaedic fellowships changed over a 5-year period? (2) Is gender associated with fellowship match success? (3) Which subspecialties have greater proportions of female applicants? Available orthopaedic residency match data regarding number of applicants and number of female residents between 2010 and 2014 were obtained. For fellowship data, our method was a review of the applicants who submitted rank lists and the number of applicants who matched in all subspecialties through San Francisco Match and from the American Shoulder and Elbow Society from 2010 to 2014. For each year, the number of females versus males applying was abstracted. The total number of females versus males who matched was then obtained. For each subspecialty represented in this article, the number of female applicants and matches was compared with the male applicants and matches. The proportion of fellowship applicants who are female ranged from 7% to 10% annually, and the percentage of matched female applicants ranged from 8% to 12%. Overall, combining results from 2010 to 2014, female fellowship applicants had a higher proportion of match success when compared with men (women: 320 of 335 [96%]; men: 2696 of 3325 [81%]; p < 0.001). Pediatric orthopaedic fellowships had the highest proportion of women (79 of 318 [25%] followed by foot and ankle (42 of 311 [14%]; spine had the lowest (15 of 525 [3%]). Women applicants for advanced orthopaedic training matched at a higher proportion than men in fellowship training. Pediatrics has a higher proportion of women applicants and fellows. Orthopaedics should be a model for other surgical specialties by encouraging women to successfully pursue advanced training.

Functional outcome in amputation versus limb sparing of patients with lower extremity sarcoma: a matched case-control study.

PubMed

Davis, A M; Devlin, M; Griffin, A M; Wunder, J S; Bell, R S

1999-06-01

To quantify the differences in physical disability and handicap experienced by patients with lower extremity sarcoma who required amputation for their primary tumor as compared with those treated by limb-sparing surgery. Matched case-control study. Twelve patients with amputation were matched with 24 patients treated by limb-sparing surgery on the following variables: age, gender, length of follow-up, bone versus soft-tissue tumor, anatomic site, and treatment with adjuvant chemotherapy. Patients who underwent above-knee amputation (AKA) or below-knee amputation (BKA) for primary soft-tissue or bone sarcoma, who had not developed local or systemic recurrence, and who had been followed up for at least 1 year since surgery. The Toronto Extremity Salvage Score (TESS), a measure of physical disability; the Shortform-36 (SF-36), a generic health status measure; and the Reintegration to Normal Living (RNL), a measure of handicap. Mean TESS score for the patients with amputations was 74.5 versus 85.1 for the limb-sparing patients. (p = .15). Only the physical function subscale of the SF-36 showed statistically significant differences, with means of 45 and 71.1 for the amputation versus limb-sparing groups, respectively (p = .03). The RNL for the amputation group was 84.4 versus 97 for the limb-sparing group (p = .05). Seven of the 12 patients with amputations experienced ongoing difficulty with the soft tissues overlying their stumps. There was a trend toward increased disability for those in the amputation group versus those in the limb-sparing group, with the amputation group showing significantly higher levels of handicap. These data suggest that the differences in disability between amputation and limb-sparing patients are smaller than anticipated. The differences may be more notable in measuring handicap.

Elimination of 1994 Gender Restriction: Will Earning the Ranger Tab Achieve Full Career Potential for Women?

DTIC Science & Technology

2013-12-13

groomed to meet the physical and psychological demands of Ranger School. They will also be given time, and possibly multiple attempts at gaining the...the U.S. have potentially influenced these four outcomes in our research, which provides the policy be revised to match the operational environment...assignment requirement. The bottom line is the policy did not match the operational picture, or composition of tactical units. The opportunity has

EEG abnormalities and two year outcome in first episode psychosis.

PubMed

Manchanda, R; Norman, R; Malla, A; Harricharan, R; Takhar, J; Northcott, S

2005-03-01

This study examines the relationship of EEG to 2 year symptomatic outcome, duration of illness and untreated psychosis and gender. A total of 122 patients presenting for treatment of first episode psychosis had their baseline EEG classified by modified Mayo Clinic system criteria as normal, essentially normal or dysrhythmia. Positive and negative symptoms of psychoses were rated on entry and after 2 years of treatment. The socio-demographic variables and duration of illness and of untreated psychosis were also recorded. Patients with a normal EEG showed significantly more reduction in both positive and negative symptoms of psychoses over 2 years and were more likely to be in 'remission' as compared with the essentially normal or dysrhythmia group. The dysrhythmic group had significantly higher duration of illness than either the normal or essentially normal groups. There were no gender differences in the distribution of EEGs. An abnormal EEG in patients with first episode psychosis is associated with a poorer prognosis and a longer duration of untreated illness. Copyright (c) Blackwell Munksgaard 2005

The effect of dentists' body-weight size on student social judgments of dental skill and patients' behavioural intentions: a vignette study.

PubMed

Asimakopoulou, Koula; Ignatius, Jessica; While, Alison; Newton, Tim

2015-02-01

Where previous work has suggested that over-weight individuals may be subject to negative social judgments, a finding also seen in judgments applied to healthcare professionals (HCPs), this study investigated whether these findings extend to judgments made about dental practitioners. A photo of a normal weight male and one of a normal weight female dentist were digitally modified to reliably show them as overweight, giving a total of 4 conditions. In a single-blind quasi-randomised controlled study of 302 undergraduate and postgraduate student participants used a 5 point Likert scale to appraise a single, gender-matched colour photograph as to whether they thought the dentist depicted was competent, professional, caring, had patients' best interests at heart, and was a good dentist. They further rated their future intentions to follow behavioural advice (reduce snacking and take-up flossing) given by the depicted dentist. The data were analysed using independent sample t-tests. There were no differences in outcomes as a function of the weight status of the depicted dentist in any of the variables explored with the exception of the normal-weight images being rated as more caring than the overweight ones (p<.04). Images of overweight dentists do not receive lower social judgement ratings than images of normal-weight dentists. Previous research in medicine reporting adverse social judgments made of over-weight HCPs does not apply to dental practitioners. Future research should focus on factors that may explain these findings. Dentists appear to be protected from the adverse effect of overweight on social judgments of their personal characteristics and on their health-promoting advice. Copyright © 2014 Elsevier Ltd. All rights reserved.

Reading instead of reasoning? Predictors of arithmetic skills in children with cochlear implants.

PubMed

Huber, Maria; Kipman, Ulrike; Pletzer, Belinda

2014-07-01

The aim of the present study was to evaluate whether the arithmetic achievement of children with cochlear implants (CI) was lower or comparable to that of their normal hearing peers and to identify predictors of arithmetic achievement in children with CI. In particular we related the arithmetic achievement of children with CI to nonverbal IQ, reading skills and hearing variables. 23 children with CI (onset of hearing loss in the first 24 months, cochlear implantation in the first 60 months of life, atleast 3 years of hearing experience with the first CI) and 23 normal hearing peers matched by age, gender, and social background participated in this case control study. All attended grades two to four in primary schools. To assess their arithmetic achievement, all children completed the "Arithmetic Operations" part of the "Heidelberger Rechentest" (HRT), a German arithmetic test. To assess reading skills and nonverbal intelligence as potential predictors of arithmetic achievement, all children completed the "Salzburger Lesetest" (SLS), a German reading screening, and the Culture Fair Intelligence Test (CFIT), a nonverbal intelligence test. Children with CI did not differ significantly from hearing children in their arithmetic achievement. Correlation and regression analyses revealed that in children with CI, arithmetic achievement was significantly (positively) related to reading skills, but not to nonverbal IQ. Reading skills and nonverbal IQ were not related to each other. In normal hearing children, arithmetic achievement was significantly (positively) related to nonverbal IQ, but not to reading skills. Reading skills and nonverbal IQ were positively correlated. Hearing variables were not related to arithmetic achievement. Children with CI do not show lower performance in non-verbal arithmetic tasks, compared to normal hearing peers. Copyright © 2014. Published by Elsevier Ireland Ltd.

The asymmetric distribution of informative face information during gender recognition.

PubMed

Hu, Fengpei; Hu, Huan; Xu, Lian; Qin, Jungang

2013-02-01

Recognition of the gender of a face is important in social interactions. In the current study, the distribution of informative facial information was systematically examined during gender judgment using two methods, Bubbles and Focus windows techniques. Two experiments found that the most informative information was around the eyes, followed by the mouth and nose. Other parts of the face contributed to the gender recognition but were less important. The left side of the face was used more during gender recognition in two experiments. These results show mainly areas around the eyes are used for gender judgment and demonstrate perceptual asymmetry with a normal (non-chimeric) face.

Maternal stress and perinatal features in autism and attention deficit/hyperactivity disorder.

PubMed

Say, Gökçe Nur; Karabekiroğlu, Koray; Babadağı, Zehra; Yüce, Murat

2016-04-01

We investigated the shared and non-shared perinatal risk factors for autism spectrum disorders (ASD) and attention deficit/hyperactivity disorder (ADHD) in a clinical sample. Additionally, we compared these groups regarding pre/postpartum maternal stress and the duration of breastfeeding. Children aged 3-18 years old with ASD (n = 100) were compared with age- and gender-matched children with ADHD (n = 100) and with age- and gender-matched healthy controls (n = 80). Prematurity of the neonate and maternal stress/depressive mood in pregnancy were common risk factors shared by ASD and ADHD. Postpartum maternal depressive mood may be more specific to ASD, while shorter duration of breastfeeding may be related to ADHD. ASD and ADHD may have some perinatal features in common. Identification of perinatal factors for ASD and ADHD carries clinical implications in terms of primary prevention. © 2015 Japan Pediatric Society.

Investigation of gender role behaviors in boys with hypospadias: comparative study with unaffected boys and girls.

PubMed

Sung, Ji Yean; Han, Sang Won; Chung, Kyong-Mee; Lee, Hyeyoung; Cho, Sang Hee

2014-10-01

The purpose of the study was (1) to investigate gender role behaviors of boys with hypospadias compared with groups of unaffected boys and girls using parental reports and direct observations; and (2) to directly observe effects of socialization (mothers' presence) on children's gender role behaviors. Ages of 19 children with hypospadias ranged from 3 to 7 years, and each of them were matched to controls of unaffected boys and girls by age. All the children participated with their mothers. Children's gender role behaviors and their mothers' behaviors were evaluated using an observation coding system. Mothers also completed questionnaires regarding their children's gender role behaviors. Results indicated no atypical gender role behavior for the boys with hypospadias and no direct effects of socialization on their gender role behaviors. However, differences were found in negative communicative behaviors between boys with hypospadias and unaffected boys, suggesting a possible role of socialization. © The Author 2014. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Postural control assessment in students with normal hearing and sensorineural hearing loss.

PubMed

Melo, Renato de Souza; Lemos, Andrea; Macky, Carla Fabiana da Silva Toscano; Raposo, Maria Cristina Falcão; Ferraz, Karla Mônica

2015-01-01

Children with sensorineural hearing loss can present with instabilities in postural control, possibly as a consequence of hypoactivity of their vestibular system due to internal ear injury. To assess postural control stability in students with normal hearing (i.e., listeners) and with sensorineural hearing loss, and to compare data between groups, considering gender and age. This cross-sectional study evaluated the postural control of 96 students, 48 listeners and 48 with sensorineural hearing loss, aged between 7 and 18 years, of both genders, through the Balance Error Scoring Systems scale. This tool assesses postural control in two sensory conditions: stable surface and unstable surface. For statistical data analysis between groups, the Wilcoxon test for paired samples was used. Students with hearing loss showed more instability in postural control than those with normal hearing, with significant differences between groups (stable surface, unstable surface) (p<0.001). Students with sensorineural hearing loss showed greater instability in the postural control compared to normal hearing students of the same gender and age. Copyright © 2014 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

The quantitative measurements of foveal avascular zone using optical coherence tomography angiography in normal volunteers.

PubMed

Ghassemi, Fariba; Mirshahi, Reza; Bazvand, Fatemeh; Fadakar, Kaveh; Faghihi, Houshang; Sabour, Siamak

2017-12-01

To provide normative data of foveal avascular zone (FAZ) and thickness. In this cross-sectional study both eyes of each normal subject were scanned with optical coherence tomography angiography (OCTA) for foveal superficial and deep avascular zone (FAZ) and central foveal thickness (CFT) and parafoveal thickness (PFT). Out of a total of 224 eyes of 112 volunteers with a mean age of 37.03 (12-67) years, the mean superficial FAZ area was 0.27 mm 2 , and deep FAZ area was 0.35 mm 2 ( P  < 0.001), with no difference between both eyes. Females had a larger superficial (0.32 ± 0.11 mm 2 versus 0.23 ± 0.09 mm 2 ) and deep FAZ (0.40 ± 0.14 mm 2 versus 0.31 ± 0.10 mm 2 ) ( P  < 0.001) than males. By multivariate linear regression analysis, in normal eyes, superficial FAZ area varied significantly with the gender, CFT, and deep FAZ. Deep FAZ varied with the gender and CFT. The gender and CFT influence the size of normal superficial and deep FAZ of capillary network.

Event-related brain potentials index cue-based retrieval interference during sentence comprehension.

PubMed

Martin, Andrea E; Nieuwland, Mante S; Carreiras, Manuel

2012-01-16

Successful language use requires access to products of past processing within an evolving discourse. A central issue for any neurocognitive theory of language then concerns the role of memory variables during language processing. Under a cue-based retrieval account of language comprehension, linguistic dependency resolution (e.g., retrieving antecedents) is subject to interference from other information in the sentence, especially information that occurs between the words that form the dependency (e.g., between the antecedent and the retrieval site). Retrieval interference may then shape processing complexity as a function of the match of the information at retrieval with the antecedent versus other recent or similar items in memory. To address these issues, we studied the online processing of ellipsis in Castilian Spanish, a language with morphological gender agreement. We recorded event-related brain potentials while participants read sentences containing noun-phrase ellipsis indicated by the determiner otro/a ('another'). These determiners had a grammatically correct or incorrect gender with respect to their antecedent nouns that occurred earlier in the sentence. Moreover, between each antecedent and determiner, another noun phrase occurred that was structurally unavailable as an antecedent and that matched or mismatched the gender of the antecedent (i.e., a local agreement attractor). In contrast to extant P600 results on agreement violation processing, and inconsistent with predictions from neurocognitive models of sentence processing, grammatically incorrect determiners evoked a sustained, broadly distributed negativity compared to correct ones between 400 and 1000ms after word onset, possibly related to sustained negativities as observed for referential processing difficulties. Crucially, this effect was modulated by the attractor: an increased negativity was observed for grammatically correct determiners that did not match the gender of the attractor, suggesting that structurally unavailable noun phrases were at least temporarily considered for grammatically correct ellipsis. These results constitute the first ERP evidence for cue-based retrieval interference during comprehension of grammatical sentences. Copyright © 2011 Elsevier Inc. All rights reserved.

Anticipating words and their gender: an event-related brain potential study of semantic integration, gender expectancy, and gender agreement in Spanish sentence reading.

PubMed

Wicha, Nicole Y Y; Moreno, Eva M; Kutas, Marta

2004-09-01

Recent studies indicate that the human brain attends to and uses grammatical gender cues during sentence comprehension. Here, we examine the nature and time course of the effect of gender on word-by-word sentence reading. Event-related brain potentials were recorded to an article and noun, while native Spanish speakers read medium- to high-constraint Spanish sentences for comprehension. The noun either fit the sentence meaning or not, and matched the preceding article in gender or not; in addition, the preceding article was either expected or unexpected based on prior sentence context. Semantically anomalous nouns elicited an N400. Gender-disagreeing nouns elicited a posterior late positivity (P600), replicating previous findings for words. Gender agreement and semantic congruity interacted in both the N400 window--with a larger negativity frontally for double violations--and the P600 window--with a larger positivity for semantic anomalies, relative to the prestimulus baseline. Finally, unexpected articles elicited an enhanced positivity (500-700 msec post onset) relative to expected articles. Overall, our data indicate that readers anticipate and attend to the gender of both articles and nouns, and use gender in real time to maintain agreement and to build sentence meaning.

Anticipating Words and Their Gender: An Event-related Brain Potential Study of Semantic Integration, Gender Expectancy, and Gender Agreement in Spanish Sentence Reading

PubMed Central

Wicha, Nicole Y. Y.; Moreno, Eva M.; Kutas, Marta

2012-01-01

Recent studies indicate that the human brain attends to and uses grammatical gender cues during sentence comprehension. Here, we examine the nature and time course of the effect of gender on word-by-word sentence reading. Event-related brain potentials were recorded to an article and noun, while native Spanish speakers read medium- to high-constraint Spanish sentences for comprehension. The noun either fit the sentence meaning or not, and matched the preceding article in gender or not; in addition, the preceding article was either expected or unexpected based on prior sentence context. Semantically anomalous nouns elicited an N400. Gender-disagreeing nouns elicited a posterior late positivity (P600), replicating previous findings for words. Gender agreement and semantic congruity interacted in both the N400 window—with a larger negativity frontally for double violations—and the P600 window—with a larger positivity for semantic anomalies, relative to the prestimulus baseline. Finally, unexpected articles elicited an enhanced positivity (500–700 msec post onset) relative to expected articles. Overall, our data indicate that readers anticipate and attend to the gender of both articles and nouns, and use gender in real time to maintain agreement and to build sentence meaning. PMID:15453979

Fast image matching algorithm based on projection characteristics

NASA Astrophysics Data System (ADS)

Zhou, Lijuan; Yue, Xiaobo; Zhou, Lijun

2011-06-01

Based on analyzing the traditional template matching algorithm, this paper identified the key factors restricting the speed of matching and put forward a brand new fast matching algorithm based on projection. Projecting the grayscale image, this algorithm converts the two-dimensional information of the image into one-dimensional one, and then matches and identifies through one-dimensional correlation, meanwhile, because of normalization has been done, when the image brightness or signal amplitude increasing in proportion, it could also perform correct matching. Experimental results show that the projection characteristics based image registration method proposed in this article could greatly improve the matching speed, which ensuring the matching accuracy as well.

Reference right atrial dimensions and volume estimation by steady state free precession cardiovascular magnetic resonance

PubMed Central

2013-01-01

Background Cardiovascular magnetic resonance (CMR) steady state free precession (SSFP) cine sequences with high temporal resolution and improved post-processing can accurately measure RA dimensions. We used this technique to define ranges for normal RA volumes and dimensions normalized, when necessary, to the influence of gender, body surface area (BSA) and age, and also to define the best 2D images-derived predictors of RA enlargement. Methods For definition of normal ranges of RA volume we studied 120 healthy subjects (60 men, 60 women; 20 subjects per age decile from 20 to 80 years), after careful exclusion of cardiovascular abnormality. We also studied 120 patients (60 men, 60 women; age range 20 to 80 years) with a clinical indication for CMR in order to define the best 1D and 2D predictors of RA enlargement. Data were generated from SSFP cine CMR, with 3-dimensional modeling, including tracking of the atrioventricular ring motion and time-volume curves analysis. Results In the group of healthy individuals, age influenced RA 2-chamber area and transverse diameter. Gender influenced most absolute RA dimensions and volume. Interestingly, right atrial volumes did not change with age and gender when indexed to body surface area. New CMR normal ranges for RA dimensions were modeled and displayed for clinical use with normalization for BSA and gender and display of parameter variation with age. Finally, the best 2D images-derived independent predictors of RA enlargement were indexed area and indexed longitudinal diameter in the 2-chamber view. Conclusion Reference RA dimensions and predictors of RA enlargement are provided using state-of-the-art CMR techniques. PMID:23566426

Reference left atrial dimensions and volumes by steady state free precession cardiovascular magnetic resonance

PubMed Central

2010-01-01

Background Left atrial (LA) size is related to cardiovascular morbidity and mortality. Cardiovascular magnetic resonance (CMR) provides high quality images of the left atrium with high temporal resolution steady state free precession (SSFP) cine sequences. We used SSFP cines to define normal ranges for LA volumes and dimensions relative to gender, age and body surface area (BSA), and examine the relative value of 2D atrial imaging techniques in patients. For definition of normal ranges of LA volume we studied 120 healthy subjects after careful exclusion of cardiovascular abnormality (60 men, 60 women; 20 subjects per age decile from 20 to 80 years). Data were generated from 3-dimensional modeling, including tracking of the atrioventricular ring motion and time-volume curves analysis. For definition of the best 2D images-derived predictors of LA enlargement, we studied 120 patients (60 men, 60 women; age range 20 to 80 years) with a clinical indication for CMR. Results In the healthy subjects, age was associated with LA 4-chamber transverse and 3-chamber anteroposterior diameters, but not with LA volume. Gender was an independent predictor of most absolute LA dimensions and volume, but following normalization to BSA, some associations became non-significant. CMR normal ranges were modeled and are tabled for clinical use with normalization, where appropriate, for BSA and gender and display of parameter variation with age. The best 2D predictors of LA volume were the 2-chamber area and 3-chamber area (both r = 0.90, p < 0.001). Conclusions These CMR data show that LA dimensions and volume in healthy, individuals vary significantly by BSA, with lesser effects of age and gender. PMID:21070636

Apolipoprotein E genotype in matched men and women with coronary heart disease.

PubMed

Kolovou, Genovefa D; Anagnostopoulou, Katherine K; Salpea, Klelia D; Panagiotakos, Demosthenes B; Hoursalas, Ioannis S; Cariolou, Marios A; Koniavitou, Katerina; Cokkinos, Dennis V

2005-01-01

Apolipoprotein E (apo E) plays an important role in lipid metabolism and its polymorphism may be a risk determinant of coronary heart disease (CHD). Since evidence suggested a gender-specific effect of apo E polymorphism, we studied the influence of gender-specific interaction of the polymorphism on CHD. From a total of 463 Greek Caucasians (314 men and 149 postmenopausal women) with angiographically documented CHD, we selected 79 women (68+/- 9 yr old) and 79 men (66+/- 9 yr old) who were matched for clinical characteristics. Apo E genotyping was performed by PCR and RFLP analysis. Biochemical parameters were also measured. The results were as follows: the E3/3 genotype occurred in 78.5% of the patients, followed by E3/4, E2/3, E2/4, and E4/4 genotypes, which occurred in 9.5%, 9.5%, 1.9%, and 0.6% of the patients, respectively. No significant differences were observed in the apo E allele or apo E genotype distributions between the matched Greek men and women with CHD. The E3/3 men patients were more frequently part of a family with a history of CHD, compared to women (p=0.035).

Argyrophilic grain disease as a neurodegenerative substrate in late-onset schizophrenia and delusional disorders.

PubMed

Nagao, Shigeto; Yokota, Osamu; Ikeda, Chikako; Takeda, Naoya; Ishizu, Hideki; Kuroda, Shigetoshi; Sudo, Koichiro; Terada, Seishi; Murayama, Shigeo; Uchitomi, Yosuke

2014-06-01

To study the relationship between neurodegenerative diseases including argyrophilic grain disease (AGD) and late-onset schizophrenia and delusional disorders (LOSD; onset ≥40 years of age), we pathologically examined 23 patients with LOSD, 71 age-matched normal controls, and 22 psychiatric disease controls (11 depression, six personality disorder, two bipolar disorders, and three neurotic disorders cases). In all LOSD cases (compared to age-matched normal controls), the frequencies of Lewy body disease (LBD), AGD, and corticobasal degeneration (CBD) were 26.1 % (11.3 %), 21.7 % (8.5 %), and 4.3 % (0.0 %), respectively. There was no case of pure Alzheimer's disease (AD). The total frequency of LBD, AGD, and CBD was significantly higher in LOSD cases than in normal controls. Argyrophilic grains were significantly more severe in LOSD than in controls, but were almost completely restricted to the limbic system and adjacent temporal cortex. In LOSD patients whose onset occurred at ≥65 years of age (versus age-matched normal controls), the frequencies of LBD and AGD were 36.4 % (19.4 %) and 36.4 % (8.3 %), respectively, and AGD was significantly more frequent in LOSD patients than in normal controls. In LOSD patients whose onset occurred at <65 years of age, the frequencies of LBD, AGD, and CBD were 16.7, 8.3, and 8.3 %, comparable to those of age-matched normal controls (10.2, 5.1, and 0.0 %). In all psychiatric cases, delusion was significantly more frequent in AGD cases than in cases bearing minimal AD pathology alone. Given these findings, LOSD patients may have heterogeneous pathological backgrounds, and AGD may be associated with the occurrence of LOSD especially after 65 years of age.

Intermodal Matching of Emotional Expressions in Young Children with Autism

ERIC Educational Resources Information Center

Kahana-Kalman, Ronit; Goldman, Sylvie

2008-01-01

This study examined the ability of young children with autism spectrum disorders (ASD) to detect affective correspondences between facial and vocal expressions of emotion using an intermodal matching paradigm. Four-year-old children with ASD (n = 18) and their age-matched normally developing peers (n = 18) were presented pairs of videotaped facial…

Bloom's "Normal" (2002) and Tarttelin's "Golden Boy" (2013): Teaching Gender Fluidity Written across Time and Text

ERIC Educational Resources Information Center

LeSavoy, Barbara

2016-01-01

The author is in a faculty position in women and gender studies (WGST) at a comprehensive public university in western New York. In this article, the author summarize theories of identity and voice as backdrop for inquiry, transitioning to a systematic discussion of teaching about sex and gender identity to differently positioned learners, drawing…

The change in color matches with retinal angle of incidence of the colorimeter beams.

PubMed

Alpern, M; Kitahara, H; Fielder, G H

1987-01-01

Differences between W.D.W. chromaticities of monochromatic lights obtained with all colorimeter beams incident on the retina "off-axis" and those found for lights striking the retina normally have been studied throughout the visible spectrum on 4 normal trichromats. The results are inconsistent with: (i) the assumption in Weale's theories of the Stiles-Crawford hue shift that the sets of absorption spectra of the visual pigments catching normally and obliquely incident photons are identical, and (ii) "self-screening" explanations for the change in color with angle of incidence on the retina. The color matching functions of a protanomalous trichromat are inconsistent with the hypothesis that the absorption spectra of the visual pigments catching normally incident photons in his retina are those catching obliquely incident photons in the normal retina.

The Effect of Acclydine in Chronic Fatigue Syndrome: A Randomized Controlled Trial

PubMed Central

The, Gerard K. H; Bleijenberg, Gijs; van der Meer, Jos W. M

2007-01-01

Objectives: It is unclear whether insulin-like growth factor (IGF) function is involved in the pathophysiology of chronic fatigue syndrome (CFS). Unpublished data and reports in patient organization newsletters suggest that Acclydine, a food supplement, could be effective in the treatment of CFS by increasing biologically active IGF1 levels. Here we aimed to measure the IGF1 and IGF binding protein (IGFBP) 3 status of CFS patients compared to age- and gender-matched neighborhood controls, and to assess the effect of Acclydine on fatigue severity, functional impairment, and biologically active IGF1 level (IGFBP3/IGF1 ratio). Design: A randomized, placebo-controlled, double-blind clinical trial. Setting: Radboud University Nijmegen Medical Centre, The Netherlands. Participants: Fifty-seven adult patients who fulfilled the US Centers for Disease Control and Prevention criteria for CFS. IGF status of 22 CFS patients was compared to that of 22 healthy age- and gender-matched neighborhood control individuals. Intervention: Acclydine or placebo for 14 wk. Outcome measures: Outcomes were fatigue severity (Checklist Individual Strength, subscale fatigue severity [CIS-fatigue]), functional impairment (Sickness Impact Profile-8 [SIP-8]), and biologically active IGF1 serum concentrations. Analyses were on an intention-to-treat basis. Results: There was no difference in IGF status in 22 CFS patients compared to healthy age- and gender-matched control individuals. Treatment with Acclydine did not result in significant differences compared with the placebo group on any of the outcome measures: CIS-fatigue +1.1 (95% CI −4.4 to +6.5, p = 0.70), SIP-8 +59.1 (95% CI −201.7 to +319.8, p = 0.65), and IGFBP3/IGF1 ratio −0.5 (95% CI −2.8 to +1.7, p = 0.63). Conclusion: We found no differences in IGF1 status in CFS patients compared to healthy matched neighborhood controls. In addition, the results of this clinical trial do not demonstrate any benefit of Acclydine over placebo in the treatment of CFS. PMID:17525791

The effect of acclydine in chronic fatigue syndrome: a randomized controlled trial.

PubMed

The, Gerard K H; Bleijenberg, Gijs; van der Meer, Jos W M

2007-05-18

It is unclear whether insulin-like growth factor (IGF) function is involved in the pathophysiology of chronic fatigue syndrome (CFS). Unpublished data and reports in patient organization newsletters suggest that Acclydine, a food supplement, could be effective in the treatment of CFS by increasing biologically active IGF1 levels. Here we aimed to measure the IGF1 and IGF binding protein (IGFBP) 3 status of CFS patients compared to age- and gender-matched neighborhood controls, and to assess the effect of Acclydine on fatigue severity, functional impairment, and biologically active IGF1 level (IGFBP3/IGF1 ratio). A randomized, placebo-controlled, double-blind clinical trial. Radboud University Nijmegen Medical Centre, The Netherlands. Fifty-seven adult patients who fulfilled the US Centers for Disease Control and Prevention criteria for CFS. IGF status of 22 CFS patients was compared to that of 22 healthy age- and gender-matched neighborhood control individuals. Acclydine or placebo for 14 wk. Outcomes were fatigue severity (Checklist Individual Strength, subscale fatigue severity [CIS-fatigue]), functional impairment (Sickness Impact Profile-8 [SIP-8]), and biologically active IGF1 serum concentrations. Analyses were on an intention-to-treat basis. There was no difference in IGF status in 22 CFS patients compared to healthy age- and gender-matched control individuals. Treatment with Acclydine did not result in significant differences compared with the placebo group on any of the outcome measures: CIS-fatigue +1.1 (95% CI -4.4 to +6.5, p = 0.70), SIP-8 +59.1 (95% CI -201.7 to +319.8, p = 0.65), and IGFBP3/IGF1 ratio -0.5 (95% CI -2.8 to +1.7, p = 0.63). We found no differences in IGF1 status in CFS patients compared to healthy matched neighborhood controls. In addition, the results of this clinical trial do not demonstrate any benefit of Acclydine over placebo in the treatment of CFS.

Chromosomal DNA damage measured using the cytokinesis-block micronucleus cytome assay is significantly associated with cognitive impairment in South Australians.

PubMed

Lee, Sau Lai; Thomas, Philip; Hecker, Jane; Faunt, Jeffrey; Fenech, Michael

2015-01-01

Loss of genome integrity may be associated with increased risk for neurodegenerative disease. The aim of this study was to investigate whether mild cognitive impairment (MCI) or Alzheimer's disease (AD) individuals have increased DNA damage relative to age- and gender- matched controls using the cytokinesis-block micronucleus cytome (CBMN-Cyt) assay. DNA damage was measured as micronuclei (MN), nucleoplasmic bridges (NPB), and nuclear buds (NBUD) in binucleated cells. The assay was performed on blood samples from 80 participants consisting of (i) MCI cases (N = 20) and age- and gender- matched controls (N = 20), and (ii) AD cases (N = 20) and age- and gender- matched controls (N = 20). There was a significant increase in MCI NBUD frequency (P = 0.006) relative to controls, which was also observed in male (P = 0.03) and female (P = 0.04) subgroups. For AD cases, there were no significant differences in assay biomarkers relative to controls. There was a significant negative correlation between Mini Mental State Examination (MMSE) and (i) MN in all controls, (R = -0.3, P = 0.04), and AD cases (R = -0.4, P = 0.03), (ii) NPB in all controls, (R = -0.4, P = 0.006) and AD cases (R = -0.5, P = 0.01), and (iii) NBUD in MCI cases (R = -0.5, P = 0.007) and AD cases (R = -0.7, P = 0.0002). The results suggest that an increase in lymphocyte CBMN-Cyt DNA damage biomarkers may be associated with cognitive decline. © 2014 Wiley Periodicals, Inc.

Prognostic significance of normal-sized ovary in advanced serous epithelial ovarian cancer.

PubMed

Paik, E Sun; Kim, Ji Hye; Kim, Tae Joong; Lee, Jeong Won; Kim, Byoung Gie; Bae, Duk Soo; Choi, Chel Hun

2018-01-01

We compared survival outcomes of advanced serous type epithelial ovarian cancer (EOC) patients with normal-sized ovaries and enlarged-ovarian tumors by propensity score matching analysis. The medical records of EOC patients treated at Samsung Medical Center between 2002 and 2015 were reviewed retrospectively. We investigated EOC patients with high grade serous type histology and International Federation of Gynecology and Obstetrics (FIGO) stage IIIB, IIIC, or IV who underwent primary debulking surgery (PDS) and adjuvant chemotherapy to identify patients with normal-sized ovaries. Propensity score matching was performed to compare patients with normal-sized ovaries to patients with enlarged-ovarian tumors (ratio, 1:3) according to age, FIGO stage, initial cancer antigen (CA)-125 level, and residual disease status after PDS. Of the 419 EOC patients, 48 patients had normal-sized ovary. Patients with enlarged-ovarian tumor were younger (54.0±10.3 vs. 58.4±9.2 years, p=0.005) than those with normal-sized ovary, and there was a statistically significant difference in residual disease status between the 2 groups. In total cohort with a median follow-up period of 43 months (range, 3-164 months), inferior overall survival (OS) was shown in the normal-sized ovary group (median OS, 71.2 vs. 41.4 months; p=0.003). After propensity score matching, the group with normal-sized ovary showed inferior OS compared to the group with enlarged-ovarian tumor (median OS, 72.1 vs. 41.4 months; p=0.031). In multivariate analysis for OS, normal-sized ovary remained a significant factor. Normal-sized ovary was associated with poor OS compared with the common presentation of enlarged ovaries in EOC, independent of CA-125 level or residual disease. Copyright © 2018. Asian Society of Gynecologic Oncology, Korean Society of Gynecologic Oncology

Environmental Enrichment Rescues Binocular Matching of Orientation Preference in Mice that Have a Precocious Critical Period

PubMed Central

Wang, Bor-Shuen; Feng, Liang; Liu, Mingna; Liu, Xiaorong; Cang, Jianhua

2013-01-01

SUMMARY Experience shapes neural circuits during critical periods in early life. The timing of critical periods is regulated by both genetics and the environment. Here we study the functional significance of such temporal regulations in the mouse primary visual cortex, where critical period plasticity drives binocular matching of orientation preference. We find that the binocular matching is permanently disrupted in mice that have a precocious critical period due to genetically enhanced inhibition. The disruption is specific to one type of neurons, the complex cells, which, as we reveal, normally match after the simple cells. Early environmental enrichment completely rescues the deficit by inducing histone acetylation and consequently advancing the matching process to coincide with the precocious plasticity. Our experiments thus demonstrate that the proper timing of the critical period is essential for establishing normal binocularity and the detrimental impact of its genetic misregulation can be ameliorated by environmental manipulations via epigenetic mechanisms. PMID:24012279

Matching forensic sketches to mug shot photos.

PubMed

Klare, Brendan F; Li, Zhifeng; Jain, Anil K

2011-03-01

The problem of matching a forensic sketch to a gallery of mug shot images is addressed in this paper. Previous research in sketch matching only offered solutions to matching highly accurate sketches that were drawn while looking at the subject (viewed sketches). Forensic sketches differ from viewed sketches in that they are drawn by a police sketch artist using the description of the subject provided by an eyewitness. To identify forensic sketches, we present a framework called local feature-based discriminant analysis (LFDA). In LFDA, we individually represent both sketches and photos using SIFT feature descriptors and multiscale local binary patterns (MLBP). Multiple discriminant projections are then used on partitioned vectors of the feature-based representation for minimum distance matching. We apply this method to match a data set of 159 forensic sketches against a mug shot gallery containing 10,159 images. Compared to a leading commercial face recognition system, LFDA offers substantial improvements in matching forensic sketches to the corresponding face images. We were able to further improve the matching performance using race and gender information to reduce the target gallery size. Additional experiments demonstrate that the proposed framework leads to state-of-the-art accuracys when matching viewed sketches.

Gender identification from high-pass filtered vowel segments: the use of high-frequency energy.

PubMed

Donai, Jeremy J; Lass, Norman J

2015-10-01

The purpose of this study was to examine the use of high-frequency information for making gender identity judgments from high-pass filtered vowel segments produced by adult speakers. Specifically, the effect of removing lower-frequency spectral detail (i.e., F3 and below) from vowel segments via high-pass filtering was evaluated. Thirty listeners (ages 18-35) with normal hearing participated in the experiment. A within-subjects design was used to measure gender identification for six 250-ms vowel segments (/æ/, /ɪ /, /ɝ/, /ʌ/, /ɔ/, and /u/), produced by ten male and ten female speakers. The results of this experiment demonstrated that despite the removal of low-frequency spectral detail, the listeners were accurate in identifying speaker gender from the vowel segments, and did so with performance significantly above chance. The removal of low-frequency spectral detail reduced gender identification by approximately 16 % relative to unfiltered vowel segments. Classification results using linear discriminant function analyses followed the perceptual data, using spectral and temporal representations derived from the high-pass filtered segments. Cumulatively, these findings indicate that normal-hearing listeners are able to make accurate perceptual judgments regarding speaker gender from vowel segments with low-frequency spectral detail removed via high-pass filtering. Therefore, it is reasonable to suggest the presence of perceptual cues related to gender identity in the high-frequency region of naturally produced vowel signals. Implications of these findings and possible mechanisms for performing the gender identification task from high-pass filtered stimuli are discussed.

Prevalence of Colour Vision Anomalies Amongst Dental Professionals and its Effect on Shade Matching of Teeth

PubMed Central

Maini, Anuj Paul; Wangoo, Anuj; Singh, Sukhman; Mehar, Damanpreet Kaur

2017-01-01

Abstract Introduction The success of a restoration is dependent on accurate shade matching of teeth leading to studies evaluating the factors affecting the perception of shades. Colour vision anomalies including colour blindness have been found to exist in the population and it has been thought to be a potential factor affecting the colour perception ability. Aim The present study was done to evaluate the prevalence of colour vision anomalies and its effect on matching of shades of teeth. Materials and Methods A total of 147 dental professionals were randomly selected for the study and were first tested for visual acuity using the Snellen’s Eye Chart so as to carry on the study with only those operators who had a vision of 6/6. Then, the Ishihara’s colour charts were used to test the operators for colour vision handicap. In the last stage of the study, test for accuracy of shade selection was done using the Vitapan Classical shade guide. The shade guide tabs were covered to avoid bias. Percentage was used to calculate the prevalence of colour vision handicap and its effect on matching of shades of teeth as compared to normal vision, which was evaluated using Chi square test. Results Nineteen operators had colour vision anomalies out of hundred operators and only two operators presented with colour blindness. Colour vision anomaly was more prevalent than colour blindness and it was also found that it was more prevalent in males than females. The difference between the accuracy of shade matching between the operators with normal vision and colour vision defect and operators with normal vision and colour blindness was statistically not significant. Conclusion Colour blindness and colour vision handicap are rare conditions, with the latter being more common in the population. According to our study, it was concluded that no statistically significant difference existed amongst the operators with normal vision and colour vision anomaly or operators with normal vision and colour blindness during the matching of shades of teeth. PMID:28274040

The membrane mucin MUC4 is elevated in breast tumor lymph node metastases relative to matched primary tumors and confers aggressive properties to breast cancer cells.

PubMed

Workman, Heather C; Miller, Jamie K; Ingalla, Ellen Q; Kaur, Rouminder P; Yamamoto, Diane I; Beckett, Laurel A; Young, Lawrence Jt; Cardiff, Robert D; Borowsky, Alexander D; Carraway, Kermit L; Sweeney, Colleen; Carraway, Kermit L

2009-01-01

Previous studies indicate that overexpression of the membrane-associated mucin MUC4 is potently anti-adhesive to cultured tumor cells, and suppresses cellular apoptotic response to a variety of insults. Such observations raise the possibility that MUC4 expression could contribute to tumor progression or metastasis, but the potential involvement of MUC4 in breast cancer has not been rigorously assessed. The present study aimed to investigate the expression of the membrane mucin MUC4 in normal breast tissue, primary breast tumors and lymph node metastases, and to evaluate the role of MUC4 in promoting the malignant properties of breast tumor cells. MUC4 expression levels in patient-matched normal and tumor breast tissue was initially examined by immunoblotting lysates of fresh frozen tissue samples with a highly specific preparation of anti-MUC4 monoclonal antibody 1G8. Immunohistochemical analysis was then carried out using tissue microarrays encompassing patient-matched normal breast tissue and primary tumors, and patient-matched lymph node metastases and primary tumors. Finally, shRNA-mediated knockdown was employed to assess the contribution of MUC4 to the cellular growth and malignancy properties of JIMT-1 breast cancer cells. Immunoblotting and immunohistochemistry revealed that MUC4 levels are suppressed in the majority (58%, p < 0.001) of primary tumors relative to patient-matched normal tissue. On the other hand, lymph node metastatic lesions from 37% (p < 0.05) of patients expressed higher MUC4 protein levels than patient-matched primary tumors. MUC4-positive tumor emboli were often found in lymphovascular spaces of lymph node metastatic lesions. shRNA-mediated MUC4 knockdown compromised the migration, proliferation and anoikis resistance of JIMT-1 cells, strongly suggesting that MUC4 expression actively contributes to cellular properties associated with breast tumor metastasis. Our observations suggest that after an initial loss of MUC4 levels during the transition of normal breast tissue to primary tumor, the re-establishment of elevated MUC4 levels confers an advantage to metastasizing breast tumor cells by promoting the acquisition of cellular properties associated with malignancy.

Role of gender in heart failure with normal left ventricular ejection fraction.

PubMed

Regitz-Zagrosek, Vera; Brokat, Sebastian; Tschope, Carsten

2007-01-01

Heart failure with normal ejection fraction (HF-NEF) is frequently believed to be more common in women than in men. However, the interaction of gender and age has rarely been analyzed in detail, and knowledge of the distinction between pre- and postmenopausal women is lacking. Some of the studies that have described a higher prevalence of HF-NEF in women relied on clinical diagnoses of HF together with normal systolic function and did not measure diastolic function. This applies to the analysis of patients hospitalized for HF and some epidemiological investigations that agree on the greater prevalence of HF-NEF in women. Population-based studies with echocardiographic determination of diastolic function have suggested equal or greater prevalence of diastolic dysfunction in men. Major risk factors for HF-NEF include hypertension, aging, obesity, diabetes, and ischemia. Hypertension is more frequent in women and can contribute to left ventricular and arterial stiffening in a gender-specific way. Aging, obesity, and diabetes affect myocardial and vascular stiffness differently and lead to different forms of myocardial hypertrophy in women and men. In contrast, ischemia may play a greater role in men. Gender differences in ventricular diastolic distensibility, in vascular stiffness and ventricular/vascular coupling, in skeletal muscle adaptation to HF, and in the perception of symptoms may contribute to a greater rate of HF-NEF in women. The underlying molecular mechanisms include gender differences in calcium handling, in the NO system, and in natriuretic peptides. Estrogen affects collagen synthesis and degradation and inhibits the renin-angiotensin system. Effects of estrogen may provide benefit to premenopausal women, and the loss of its protective mechanisms may render the heart of postmenopausal women more vulnerable. Thus, a number of molecular mechanisms can contribute to the gender differences in HF-NEF.

Nystagmus responses in a group of normal humans during earth-horizontal axis rotation

NASA Technical Reports Server (NTRS)

Wall, Conrad, III; Furman, Joseph M. R.

1989-01-01

Horizontal eye movement responses to earth-horizontal yaw axis rotation were evaluated in 50 normal human subjects who were uniformly distributed in age (20-69 years) and each age group was then divided by gender. Subjects were rotated with eyes open in the dark, using clockwise and counter-clockwise 60 deg velocity trapezoids. The nystagmus slow component velocity is analyzed. It is shown that, despite large intersubject variability, parameters which describe earth-horizontal yaw axis responses are loosely interrelated, and some of them vary significantly with gender and age.

Children's judgments about prosocial decisions and emotions: gender of the helper and recipient matters.

PubMed

Weller, Drika; Lagattuta, Kristin Hansen

2014-01-01

Children ages 5-13 years (N = 82) responded to prosocial and prohibitive moral dilemmas featuring characters whose desires conflicted with another person's need for help or ownership rights. The gender of the characters matched for half the trials (in-group version) and mismatched for the other half (out-group version). Both boys and girls judged that people would more likely help and not harm the gender in-group versus out-group. Only girls exhibited gender bias in emotion attributions, expecting girls to feel happier helping girls and better ignoring the needs of boys. With increasing age, children exhibited greater awareness of the emotional benefits of prosocial sacrifice and made stronger distinctions by need level when evaluating prosocial decisions, obligations, and permissibility. © 2014 The Authors. Child Development © 2014 Society for Research in Child Development, Inc.

[Patients with fibromyalgia: gender differences].

PubMed

Lange, M; Karpinski, N; Krohn-Grimberghe, B; Petermann, F

2010-06-01

The aim of this study was to investigate how sex differences affect psychological measures and coping with pain of patients with fibromyalgia. Gender differences in pain coping strategies would require different gender-specific interventions. Men with fibromyalgia were matched to women with fibromyalgia. Data were collected using the German pain questionnaire (DSF), the Hospital Anxiety and Depression Scale (HADS-D) and the questionnaire for assessment of level of coping with pain (FESV). Multivariate variance models were used for data analysis. No gender differences were found in pain measures. Differences were found regarding psychological measures and coping strategies. Women showed more psychological strains and used more adaptive coping strategies on the scales "cognitive restructuring", "perceived self-competence", "mental diversion" and "counterbalancing activities" than men. This implies that women need more treatment for psychological aspects and men need assistance in pain management.

Morphological Features in Children with Autism Spectrum Disorders: A Matched Case-Control Study

ERIC Educational Resources Information Center

Ozgen, Heval; Hellemann, Gerhard S.; Stellato, Rebecca K.; Lahuis, Bertine; van Daalen, Emma; Staal, Wouter G.; Rozendal, Marije; Hennekam, Raoul C.; Beemer, Frits A.; van Engeland, Herman

2011-01-01

This study was designed to examine morphological features in a large group of children with autism spectrum disorder versus normal controls. Amongst 421 patients and 1,007 controls, 224 matched pairs were created. Prevalence rates and odds ratios were analyzed by conditional regression analysis, McNemar test or paired t-test matched pairs.…

Gender differences in nigrostriatal dopaminergic innervation are present at young-to-middle but not at older age in normal adults.

PubMed

Wong, Ka Kit; Müller, Martijn L T M; Kuwabara, Hiroto; Studenski, Stephanie A; Bohnen, Nicolaas I

2012-01-01

Gender differences in brain dopaminergic activity have been variably reported in the literature. We performed an evaluation for gender effects on striatal dopamine transporter (DAT) binding in a group of normal subjects. Community-dwelling adults (n = 85, 50F/35M, mean age 62.7 ± 16.2 SD, range 20-85) underwent DAT [(11)C]2-β-carbomethoxy-3β-(4-fluorophenyl) tropane (β-CFT) positron emission tomography (PET) imaging. Gender effects for DAT binding were compared using ANCOVA for two subgroups; young-to-middle aged adults and older adults, using an age threshold of 60 years. There were 54 subjects (24M/30F; mean age 72.9 ± 7.3) 60 years and older and 31 (11M/20F; mean age 45.0 ± 11.4) subjects younger than 60. Age-adjusted striatal DAT gender effects were present in the young-to-middle (F = 10.4, P = 0.003) but not in the elderly age group (F = 0.5, ns). Gender differences in nigrostriatal dopaminergic innervation are present, with higher levels of DAT binding in young-to-middle age women compared to men, but not present in the elderly. Published by Elsevier Ltd.

Single nucleotide polymorphisms related to cystic fibrosis in chronic rhinositus-a pilot study.

PubMed

Hull, Benjamin P; Jiramongkolchai, Pawina; Turner, Justin H; Olson, Lana; Chandra, Rakesh K

2017-05-01

The clinical association between cystic fibrosis (CF) and chronic rhinosinusitis (CRS) is well known. Studies have identified several non-CF transmembrane conductance regulator single nucleotide polymorphisms (SNPs) associated with disease severity in CF patients. We hypothesized that prevalence of these SNPs would be different between CRS patients and age/gender-matched non-CRS controls. This is a targeted SNP study of 1231 CRS patients identified through a large university hospital database who were compared with 8796 age- and gender-matched controls without a history of rhinitis, sinusitis, allergies, or asthma. Prevalence of 5 relevant SNPs was compared between groups, with p < 0.05 considered significant. Stratification by race and gender was performed among groups when statistically appropriate. CRS patients exhibited a statistically significant (p = 0.036) lower prevalence of rs12883884 (associated with an ion transporter) compared with controls. This association was lost when patients were stratified by race. CRS patients manifested a greater prevalence of rs1403543 (chromosome 23) in both Caucasian and African American subgroups (p = 0.036 and p = 0.026, respectively). Statistical significance disappeared among Caucasians when stratified by gender, but persisted among African American women (p = 0.047). rs12188164 and rs12793173 were both more prevalent in African Americans with CRS than controls (p = 0.042 and p = 0.020, respectively). A trend was also observed for decreased prevalence of rs12883884 in CRS patients compared with controls in the African American subgroup (p = 0.086). The identified SNPs were differentially prevalent in CRS compared with control groups, with some variability as a function of race and gender. Further research is required to confirm these findings and elucidate clinical significance. © 2017 ARS-AAOA, LLC.

College major, gender and heterosexism reconsidered under more controlled conditions.

PubMed

Fisher, Leslie E; Banik, Swagata

2007-01-01

To test the hypothesis that under controlled conditions respondent's gender and college major are related to heterosexism, four groups (n = 40 each)-male psychology majors, female psychology majors, male non-psychology majors, and female non-psychology majors-were formed from an initial sample of convenience (N = 1,947) of urban university students. Respondents were matched for age, race, college level, closeness of relationships to lesbian and gay men, religious affiliation, and religious attendance. Each student was requested to complete the Herek Attitude Scale towards Lesbians and Gay Men and these scores were subjected to a three factor (2x2x2) mixed analysis of variance. The three factors were respondent's gender, respondent's college major, and target's gender with repeated measures on target's gender. A significant respondent's gender by target's gender F(1/156) = 50.59, p < .001 interaction was observed. Male respondent's attitude toward gay males was significantly more negative than that of the other groups which did not differ significantly from one another. Significant main effects due to respondent's gender F(1/156) = 11.9, p < .001 and target's gender F(1/156) = 43.1, p < .001 were also observed. No significant college major effect F(1/156) = 1.60, p >.05 or interaction was found.

Influence of background/surrounding area on accuracy of visual color matching.

PubMed

Dudea, Diana; Gasparik, Cristina; Botos, Alexandra; Alb, Florin; Irimie, Ada; Paravina, Rade D

2016-07-01

Visual shade selection is subjective and influenced by factors that might be operator-dependent or not. The objective was to evaluate influence of observer nonrelated factors (background/surrounding area, and light) and observer-related factors (gender and color competence) on shade-matching quality and to identify the most often mismatched shades in correlation with the background. Ten observers with average or superior color discrimination competence according to ISO TR 28642:2011 were asked to match 48 shade tabs of three VITA Classical shade guides, in a viewing booth under two light sources: D65 and D50. Gray, white, black, red, and light blue background/surrounding area simulated various clinical situations. The results were statistically analyzed using Kruskal-Wallis test and Mann-Whitney U test. Post hoc power analyses and sample size calculations were also conducted. The matching scores ranged between 72.7 % (using blue background) and 85.9 % (using white and black backgrounds). There was a statistically significant difference between matching scores on the five backgrounds (χ (2)(4) = 12.67, p = 0.01). When neutral gray was used as reference, Mann-Whitney U value was statistically significant only for the blue background (U = 107.00, Z = -2.52, p = 0.01). The influence of gender and lighting condition was also assessed, no statistically significance being found, but in both cases, the effect size and the achieved power were small. However, color discrimination competence did influence the results (p < 0.01). Background influenced shade matching results for tabs A3, B3, B4, and D4. Within the limitations of this study, it was concluded that 1. When it comes to the influence of the background/surround area on quality of color matching, no difference among achromatic backgrounds was recorded. Significantly worse results were recorded when the blue background was used. 2. Observers with superior color matching competence performed significantly better than the ones with average competence 3. The most frequently mismatched shade tabs were A3.5, B3, B4, and D4.

Influence of donor–recipient gender mismatch on graft function and survival following lung transplantation†

PubMed Central

Alvarez, Antonio; Moreno, Paula; Illana, Jennifer; Espinosa, Dionisio; Baamonde, Carlos; Arango, Elisabet; Algar, Francisco Javier; Salvatierra, Angel

2013-01-01

OBJECTIVES In current practice, donors and recipients are not matched for gender in lung transplantation. However, some data have suggested a possible effect of gender combinations on lung transplant outcomes. We examined whether donor–recipient (D/R) gender mismatch is related to adverse outcomes after lung transplantation in terms of early and long-term graft function and survival. METHODS We reviewed 256 donors and lung transplant recipients over a 14-year period. Patients were distributed into four groups: Group A (D/R: female/female), Group B (D/R: male/male), Group C (D/R: female/male), Group D (D/R: male/female). Donor and recipient variables were compared among groups, including early graft function, 30-day mortality, freedom from bronchiolitis obliterans syndrome (BOS), and long-term survival. RESULTS Group A: 57 (22%), Group B: 99 (39%), Group C: 62 (24%), Group D: 38 (15%) transplants (P = 0.001). Donor age was 29 ± 14, 27 ± 12, 33 ± 13 and 23 ± 12 years for Groups A, B, C and D, respectively (P = 0.004). Recipient age was 31 ± 15, 44 ± 17, 42 ± 16 and 30 ± 16 years for Groups A, B, C and D, respectively (P = 0.000). PaO2/FiO2 (mmHg) 24 h post-transplant was: Group A: 276 ± 144, Group B: 297 ± 131, Group C: 344 ± 133 and Group D: 238 ± 138 (P = 0.015). Primary graft dysfunction developed in 23, 14, 17 and 21% of recipients from Groups A, B, C and D, respectively (P = 0.45). Operative mortality was 4.4, 6.5, 5.2 and 2%, for recipients from Groups A, B, C and D, respectively (P = 0.66). Freedom from BOS was 73, 59 and 36% for gender-matched transplants vs 76, 67 and 40% for gender-mismatched transplants at 3, 5 and 10 years, respectively (P = 0.618), without differences among groups. A non-significant survival benefit was observed for female recipients, irrespective of the donor gender. CONCLUSIONS Donor–recipient gender mismatch does not have a negative impact on early graft function and mortality following lung transplantation. There is a trend towards a survival benefit for female recipients, irrespective of the donor gender. PMID:23322094

Laryngeal Reinnervation Using Ansa Cervicalis for Thyroid Surgery-Related Unilateral Vocal Fold Paralysis: A Long-Term Outcome Analysis of 237 Cases

PubMed Central

Li, Ding; Li, Meng; Xia, Siwen; Zheng, Hongliang

2011-01-01

Objective To evaluate the long-term efficacy of delayed laryngeal reinnervation using the main branch of the ansa cervicalis in treatment of unilateral vocal fold paralysis (UVFP) caused by thyroid surgery. Summary of Background Data UVFP remains a serious complication of thyroid surgery. Up to now, a completely satisfactory surgical treatment of UVFP has been elusive. Methods From Jan. 1996 to Jan. 2008, a total of 237 UVFP patients who underwent ansa cervicalis main branch-to-recurrent laryngeal nerve (RLN) anastomosis were enrolled as UVFP group; another 237 age- and gender-matched normal subjects served as control group. Videostroboscopy, vocal function assessment (acoustic analysis, perceptual evaluation and maximum phonation time), and electromyography were performed preoperatively and postoperatively. The mean follow-up period was 5.2±2.7 years, ranging from 2 to 12 years. Results Analysis of videostroboscopic findings indicated that the glottic closure, vocal fold edge, vocal fold position, phase symmetry and regularity were significantly improved in the UVFP group (P<0.001, postoperative vs. preoperative). The postoperative parameters of vocal function were also significantly improved in the UVFP group (P<0.001) and showed no statistical differences compared to the control group (P>0.05, respectively). Postoperative laryngeal electromyography confirmed successful reinnervation of laryngeal muscle. Conclusions Delayed laryngeal reinnervation with the main branch of ansa cervicalis is a feasible and effective approach for treatment of thyroid surgery-related UVFP; it can restore the physiological laryngeal phonatory function to the normal or a nearly normal voice quality. PMID:21559458

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cho, Nancy L., E-mail: nlcho@partners.org; Lin, Chi-Iou; Du, Jinyan

Highlights: Black-Right-Pointing-Pointer Kinome profiling is a novel technique for identifying activated kinases in human cancers. Black-Right-Pointing-Pointer Src activity is increased in invasive thyroid cancers. Black-Right-Pointing-Pointer Inhibition of Src activity decreased proliferation and invasion in vitro. Black-Right-Pointing-Pointer Further investigation of Src targeted therapies in thyroid cancer is warranted. -- Abstract: Background: Novel therapies are needed for the treatment of invasive thyroid cancers. Aberrant activation of tyrosine kinases plays an important role in thyroid oncogenesis. Because current targeted therapies are biased toward a small subset of tyrosine kinases, we conducted a study to reveal novel therapeutic targets for thyroid cancer using amore » bead-based, high-throughput system. Methods: Thyroid tumors and matched normal tissues were harvested from twenty-six patients in the operating room. Protein lysates were analyzed using the Luminex immunosandwich, a bead-based kinase phosphorylation assay. Data was analyzed using GenePattern 3.0 software and clustered according to histology, demographic factors, and tumor status regarding capsular invasion, size, lymphovascular invasion, and extrathyroidal extension. Survival and invasion assays were performed to determine the effect of Src inhibition in papillary thyroid cancer (PTC) cells. Results: Tyrosine kinome profiling demonstrated upregulation of nine tyrosine kinases in tumors relative to matched normal thyroid tissue: EGFR, PTK6, BTK, HCK, ABL1, TNK1, GRB2, ERK, and SRC. Supervised clustering of well-differentiated tumors by histology, gender, age, or size did not reveal significant differences in tyrosine kinase activity. However, supervised clustering by the presence of invasive disease showed increased Src activity in invasive tumors relative to non-invasive tumors (60% v. 0%, p < 0.05). In vitro, we found that Src inhibition in PTC cells decreased cell invasion and proliferation. Conclusion: Global kinome analysis enables the discovery of novel targets for thyroid cancer therapy. Further investigation of Src targeted therapy for advanced thyroid cancer is warranted.« less

Insulin resistance according to β-cell function in women with polycystic ovary syndrome and normal glucose tolerance.

PubMed

Song, Do Kyeong; Hong, Young Sun; Sung, Yeon-Ah; Lee, Hyejin

2017-01-01

Polycystic ovary syndrome (PCOS) is associated with insulin resistance (IR) and compensatory hyperinsulinemia. IR is recognized as a major risk factor for the development of type 2 diabetes mellitus. However, few studies have investigated IR in women with PCOS and normal glucose tolerance. The objective of this study was to evaluate IR and β-cell function in women with PCOS and normal glucose tolerance. Additionally, we sought to evaluate the usefulness of oral glucose tolerance test (OGTT)-derived IR indices in lean women with PCOS. We recruited 100 women with PCOS and normal glucose tolerance and 100 age- and BMI-matched women as controls. IR and insulin secretory indices, including the homeostasis-model assessment (HOMA)-IR, HOMA-M120, HOMA-F and the Stumvoll index, were calculated from an OGTT. Increased β-cell function was defined as>75th percentile for the HOMA-F in control women. Women with PCOS had higher values for post-load 2-hour glucose, fasting insulin, post-load 2-hour insulin, HOMA-IR, HOMA-M120, HOMA-F and lower values for the Stumvoll index than the controls (all Ps<0.05). Women with PCOS and increased β-cell function showed lower Stumvoll index values than the matched controls (P<0.05). The HOMA-F was significantly associated with the HOMA-M120 and Stumvoll index when adjusted for age and BMI in a multiple regression analysis (all Ps<0.05). The HOMA-M120 was positively correlated with triglycerides and free testosterone, and the Stumvoll index was negatively correlated with triglycerides and free testosterone in lean women with PCOS (all Ps<0.05). Women with PCOS and normal glucose tolerance showed higher IR than controls matched for age, BMI, and β-cell function. β-cell function was increased in women with PCOS when compared to the matched controls, but not when the lean subjects were compared to the matched controls separately. Therefore, early evaluation of IR in women with PCOS and normal glucose tolerance may be needed.

Insulin resistance according to β-cell function in women with polycystic ovary syndrome and normal glucose tolerance

PubMed Central

Hong, Young Sun; Sung, Yeon-Ah

2017-01-01

Background Polycystic ovary syndrome (PCOS) is associated with insulin resistance (IR) and compensatory hyperinsulinemia. IR is recognized as a major risk factor for the development of type 2 diabetes mellitus. However, few studies have investigated IR in women with PCOS and normal glucose tolerance. The objective of this study was to evaluate IR and β-cell function in women with PCOS and normal glucose tolerance. Additionally, we sought to evaluate the usefulness of oral glucose tolerance test (OGTT)-derived IR indices in lean women with PCOS. Methods We recruited 100 women with PCOS and normal glucose tolerance and 100 age- and BMI-matched women as controls. IR and insulin secretory indices, including the homeostasis-model assessment (HOMA)-IR, HOMA-M120, HOMA-F and the Stumvoll index, were calculated from an OGTT. Increased β-cell function was defined as>75th percentile for the HOMA-F in control women. Results Women with PCOS had higher values for post-load 2-hour glucose, fasting insulin, post-load 2-hour insulin, HOMA-IR, HOMA-M120, HOMA-F and lower values for the Stumvoll index than the controls (all Ps<0.05). Women with PCOS and increased β-cell function showed lower Stumvoll index values than the matched controls (P<0.05). The HOMA-F was significantly associated with the HOMA-M120 and Stumvoll index when adjusted for age and BMI in a multiple regression analysis (all Ps<0.05). The HOMA-M120 was positively correlated with triglycerides and free testosterone, and the Stumvoll index was negatively correlated with triglycerides and free testosterone in lean women with PCOS (all Ps<0.05). Conclusions Women with PCOS and normal glucose tolerance showed higher IR than controls matched for age, BMI, and β-cell function. β-cell function was increased in women with PCOS when compared to the matched controls, but not when the lean subjects were compared to the matched controls separately. Therefore, early evaluation of IR in women with PCOS and normal glucose tolerance may be needed. PMID:28542421

[Inhibition and resource capacity during normal aging: a confrontation of the dorsal-ventral and frontal models in a modified version of negative priming].

PubMed

Martin, S; Brouillet, D; Guerdoux, E; Tarrago, R

2006-01-01

Over the past decades, cognitive psychology contribution to our understanding of aging relies on two major perspectives, focusing on the selective impact of age on either cognitive multiple-systems or global factors of cognition: slowing, working memory and inhibition. In the latter, reduction in inhibitory control during aging (in its access, deletion or restraint functions) is associated with poorer performance on a variety of tasks referring to memory, comprehension or language [Hasher, Zacks and May (16)]. The attractiveness of inhibition as an explanatory factor results in part in the absence of negative priming during aging. Negative priming refers to the slow down of latencies when individuals have to respond to recently ignored informations, compared to unrelated informations. The dissociation, between a preserved location negative priming and an absence of identity negative priming during aging, supports the dorsal-ventral model of inhibition which suggests that spatial and identity inhibition are supported by different and independent visual pathways. An alternative model, directly at odds, is that inhibitory mechanisms are supported by the frontal lobe. In this perspective, inhibition is not a central process responsible for the control of working memory contents, but an automatic and local mechanism whose triggering depends on controlled attention. Therefore, working memory drives efficient inhibition by sustaining task instructions and appropriate responses throughout task execution. This hypothesis is consistent with Houghton and Tipper's (17) architecture of selective attention. According to the authors, the presence or absence of automatic inhibition is very closely linked to a Match/Mismatch field whose function is to compare the present stimulus to an internal self-generated internal template. When an information fails to match the subject's current goals, the match/mismatch field causes an automatic inhibitory imbalance which reduces the to-be-ignored properties' responsiveness. In contrast, information matching subjects' goal is enhanced through an automatic excitatory imbalance. The accurate functioning of the Match/Mismatch field requires efficient executive functioning responsible for the uphold of goals and correct responses. In the case of negative priming, manipulating the efficiency of working memory is of interest as it should affect the triggering of slowing, ie, an indirect inhibitory deficit, when the task is resource demanding [Conwayet al. (6)]. Moreover, if inhibition, as reflected by negative priming, is mediated by individual resource capacity, then NP should disappear during aging only when individuals are engaged in a resource-demanding task. To address this issue, we examine whether cognitive control load in a gender decision task contributed to the presence or absence of NP during aging. According to the dorsal-ventral model, task complexity should not have any impact on performance, since gender decision task relies on a conceptual analysis of information. In turn, the frontal model predicts that age differences in performance profile will only differ when individual resource capacity is overloaded. Sixty-four participants (32 young and 32 older adults) performed a gender categorisation task through two experiments. Trials involved two stimuli presented successively at the same location. A word served as a prime and a word as a target. Both prime and target could be male or female. When prime and target matched on gender, we talked about VALID pairs (or compatible). When prime and target mismatched on the manipulated features, we talked about INVALID pairs (or incompatible). Participants' task was to identify the gender of the target. They were explicitly instructed not to respond to primes but to read them silently. Our interest was in response latencies for valid versus invalid pairs. We manipulated task complexity by the absence (experiment 1) or presence (experiment 2) of a distractor during probe trials. For younger adults, primes presented before targets gave rise to behavioural costs when pairs were mapped to the same response compared to pairs that were mapped to opposite ones. This slowing, called Negative Compatibility Effect (NCE), was independent of the presence or absence of a distractor. NCE was reliable for the elderly patients only under condition of no interfering information during the probe trial: pattern of performance of older participants was identical to that of young adults (experiment 1). This effect disappeared as task complexity increased (experiment 2). This result suggests that NCE triggering is dependant on the amount of cognitive control engaged by the task, and therefore that the ability to inhibit irrelevant information is secondary to a general capacity of the working memory. The implications of our data are consistent with the level of processing account, as well as the recent neuroimaging contributions which suggest, for example, the involvement of the dorso-lateral prefrontal cortex (sensitive to aging) when task demands are high, and a ventro-lateral prefrontal implication when demands are low [see Eenshuistra et al. for a review (10)].

Comparative peptidomic profile between human hypertrophic scar tissue and matched normal skin for identification of endogenous peptides involved in scar pathology.

PubMed

Li, Jingyun; Chen, Ling; Li, Qian; Cao, Jing; Gao, Yanli; Li, Jun

2018-08-01

Endogenous peptides recently attract increasing attention for their participation in various biological processes. Their roles in the pathogenesis of human hypertrophic scar remains poorly understood. In this study, we used liquid chromatography-tandem mass spectrometry to construct a comparative peptidomic profiling between human hypertrophic scar tissue and matched normal skin. A total of 179 peptides were significantly differentially expressed in human hypertrophic scar tissue, with 95 upregulated and 84 downregulated peptides between hypertrophic scar tissue and matched normal skin. Further bioinformatics analysis (Gene ontology and Kyoto Encyclopedia of Genes and Genomes pathway analysis) indicated that precursor proteins of these differentially expressed peptides correlate with cellular process, biological regulation, cell part, binding and structural molecule activity ribosome, and PPAR signaling pathway occurring during pathological changes of hypertrophic scar. Based on prediction database, we found that 78 differentially expressed peptides shared homology with antimicrobial peptides and five matched known immunomodulatory peptides. In conclusion, our results show significantly altered expression profiles of peptides in human hypertrophic scar tissue. These peptides may participate in the etiology of hypertrophic scar and provide beneficial scheme for scar evaluation and treatments. © 2017 Wiley Periodicals, Inc.

Stressors and affective states among professional rugby union players.

PubMed

Nicholls, A R; Backhouse, S H; Polman, R C J; McKenna, J

2009-02-01

The purpose of the present study was to examine (a) the sources of sport and non-sport stress and their associated symptoms on rest days, training days, and match days and (b) the temporal aspects of sources and symptoms of stress and affective states. Professional male rugby union players (n=16) completed the Daily Analysis of Life Demands in Athletes (DALDA) and the Activation Deactivation Adjective Check List (AD ACL) for 28 days. On match days players reported that few stressors were "worse than normal." Most stressors were "worse than normal" on training days followed by rest days and more stressors were "worse than normal" on the day after a match than on match days. Further, players reported an unpleasant, low activation state across the three analysis days, suggesting they were in an overtrained state. The findings of this study demonstrate that professional rugby players experience negative affect and a multitude of sport and non-sport stressors. Early detection of stressors and negative affective states could help prevent symptoms of overtraining and burnout and facilitate optimal training and sporting performance. Coaches and practitioners are encouraged to integrate the DALDA and AD ACL in their training and performance monitoring regimes.

Modification Site Localization in Peptides.

PubMed

Chalkley, Robert J

2016-01-01

There are a large number of search engines designed to take mass spectrometry fragmentation spectra and match them to peptides from proteins in a database. These peptides could be unmodified, but they could also bear modifications that were added biologically or during sample preparation. As a measure of reliability for the peptide identification, software normally calculates how likely a given quality of match could have been achieved at random, most commonly through the use of target-decoy database searching (Elias and Gygi, Nat Methods 4(3): 207-214, 2007). Matching the correct peptide but with the wrong modification localization is not a random match, so results with this error will normally still be assessed as reliable identifications by the search engine. Hence, an extra step is required to determine site localization reliability, and the software approaches to measure this are the subject of this part of the chapter.

Working memory in Farsi-speaking children with normal development and cochlear implant.

PubMed

Soleymani, Zahra; Amidfar, Meysam; Dadgar, Hooshang; Jalaie, Shohre

2014-04-01

Working memory has an important role in language acquisition and development of cognition skills. The ability of encoding, storage and retrieval of phonological codes, as activities of working memory, acquired by audition sense. Children with cochlear implant experience a period that they are not able to perceive sounds. In order to assess the effect of hearing on working memory, we investigated working memory as a cognition skill in children with normal development and cochlear implant. Fifty students with normal hearing and 50 students with cochlear implant aged 5-7 years participated in this study. Children educated in the preschool, the first and second grades. Children with normal development were matched based on age, gender, and grade of education with cochlear implant. Two components of working memory including phonological loop and central executive were compared between two groups. Phonological loop assessed by nonword repetition task and forward digit span. To assess central executive component backward digit span was used. The developmental trend was studied in children with normal development and cochlear implant as well. The effect of age at implantation in children with cochlear implants on components of working memory was investigated. There are significant differences between children with normal development and cochlear implant in all tasks that assess working memory (p < 0.001). The children's age at implantation was negatively correlated with all tasks (p < 0.001). In contrast, duration of usage of cochlear implant set was positively correlated with all tasks (p < 0.001). The comparison of working memory between different grades showed significant differences both in children with normal development and in children with cochlear implant (p < 0.05). These results implied that children with cochlear implant may experience difficulties in working memory. Therefore, these children have problems in encoding, practicing, and repeating phonological units. The results also suggested working memory develops when the child grows up. In cochlear implant children, with decreasing age at implantation and increasing their experience in perceiving sound, working memory skills improved. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

"Guys, She's Humongous!": Gender and Weight-Based Teasing in Adolescence

ERIC Educational Resources Information Center

Taylor, Nicole L.

2011-01-01

Ethnographic research, including individual interviews, focus groups, and participant observation, was conducted to examine how adolescents defined and negotiated the boundaries between normal/acceptable weight and overweight through direct and indirect teasing. In particular, this article focuses on gender differences in weight-based teasing and…

Beyond Gender Stereotypes in Language Comprehension: Self Sex-Role Descriptions Affect the Brain's Potentials Associated with Agreement Processing.

PubMed

Canal, Paolo; Garnham, Alan; Oakhill, Jane

2015-01-01

We recorded Event-Related Potentials to investigate differences in the use of gender information during the processing of reflexive pronouns. Pronouns either matched the gender provided by role nouns (such as "king" or "engineer") or did not. We compared two types of gender information, definitional information, which is semantic in nature (a mother is female), or stereotypical (a nurse is likely to be female). When they followed definitional role-nouns, gender-mismatching pronouns elicited a P600 effect reflecting a failure in the agreement process. When instead the gender violation occurred after stereotypical role-nouns the Event Related Potential response was biphasic, being positive in parietal electrodes and negative in anterior left electrodes. The use of a correlational approach showed that those participants with more "feminine" or "expressive" self sex-role descriptions showed a P600 response for stereotype violations, suggesting that they experienced the mismatch as an agreement violation; whereas less "expressive" participants showed an Nref effect, indicating more effort spent in linking the pronouns with the possible, although less likely, counter-stereotypical referent.

Automatic gender detection of dream reports: A promising approach.

PubMed

Wong, Christina; Amini, Reza; De Koninck, Joseph

2016-08-01

A computer program was developed in an attempt to differentiate the dreams of males from females. Hypothesized gender predictors were based on previous literature concerning both dream content and written language features. Dream reports from home-collected dream diaries of 100 male (144 dreams) and 100 female (144 dreams) adolescent Anglophones were matched for equal length. They were first scored with the Hall and Van de Castle (HVDC) scales and quantified using DreamSAT. Two male and two female undergraduate students were asked to read all dreams and predict the dreamer's gender. They averaged a pairwise percent correct gender prediction of 75.8% (κ=0.516), while the Automatic Analysis showed that the computer program's accuracy was 74.5% (κ=0.492), both of which were higher than chance of 50% (κ=0.00). The prediction levels were maintained when dreams containing obvious gender identifiers were eliminated and integration of HVDC scales did not improve prediction. Copyright © 2016 Elsevier Inc. All rights reserved.

Use of a midstream clean catch mobile application did not lower urine contamination rates in an ED.

PubMed

Jacob, Mary S; Kulie, Paige; Benedict, Cameron; Ordoobadi, Alexander J; Sikka, Neal; Steinmetz, Erika; McCarthy, Melissa L

2018-01-01

Urine microscopy is a common test performed in emergency departments (EDs). Urine specimens can easily become contaminated by different factors, including the collection method. The midstream clean-catch (MSCC) collection technique is commonly used to reduce urine contamination. The urine culture contamination rate from specimens collected in our ED is 30%. We developed an instructional application (app) to show ED patients how to provide a MSCC urine sample. We hypothesized that ED patients who viewed our instructional app would have significantly lower urine contamination rates compared to patients who did not. We prospectively enrolled 257 subjects with a urinalysis and/or urine culture test ordered in the ED and asked them to watch our MSCC instructional app. After prospective enrollment was complete, we retrospectively matched each enrolled subject to an ED patient who did not watch the instructional app. Controls were matched to cases based on gender, type of urine specimen provided, ED visit date and shift. Urinalysis and urine culture contamination results were compared between the matched pairs using McNemar's test. The overall urine culture contamination rate of the 514 subjects was 38%. The majority of the matched pairs had a urinalysis (63%) or urinalysis plus urine culture (35%) test done. There were no significant differences in our urine contamination rates between the matched pairs overall or when stratified by gender, by prior knowledge of the clean catch process or by type of urine specimen. We did not see a lower contamination rate for patients who viewed our instructional app compared to patients who did not. It is possible that MSCC is not effective for decreasing urine specimen contamination. Copyright © 2017 Elsevier Inc. All rights reserved.

Shade guide optimization--a novel shade arrangement principle for both ceramic and composite shade guides when identifying composite test objects.

PubMed

Østervemb, Niels; Jørgensen, Jette Nedergaard; Hørsted-Bindslev, Preben

2011-02-01

The most widely used shade guide for composite materials is made of ceramic and arranged according to a non-proven method. There is a need for a composite shade guide using a scientifically based arrangement principle. To compare the shade tab arrangement of the Vitapan Classical shade guide and an individually made composite shade guide using both the originally proposed arrangement principle and arranged according to ΔE2000 values with hue group division. An individual composite shade guide made from Filtek Supreme XT body colors was compared to the Vitapan Classical shade guide. Twenty-five students matched color samples made from Filtek Supreme XT body colors using the two shade guides arranged after the two proposed principles--four shade guides in total. Age, sequence, gender, time, and number of correct matches were recorded. The proposed visually optimal composite shade guide was both fastest and had the highest number of correct matches. Gender was significantly associated with time used for color sampling but not regarding the number of correct shade matches. A composite shade guide is superior compared to the ceramic Vitapan Classical guide when using composite test objects. A rearrangement of the shade guide according to hue, subdivided according to ΔE2000, significantly reduces the time needed to take a color sample and increases the number of correct shade matches. Total color difference in relation to the lightest tab with hue group division is recommended as a possible and universally applicable mode of tab arrangement in dental color standards. Moreover, a shade guide made of the composite materials itself is to be preferred as both a faster and more accurate method of determining color. © 2011, COPYRIGHT THE AUTHORS. JOURNAL COMPILATION © 2011, WILEY PERIODICALS, INC.

High altitude is an independent risk factor for venous thromboembolism following arthroscopic rotator cuff repair: a matched case-control study in Medicare patients.

PubMed

Cancienne, Jourdan M; Burrus, M Tyrrell; Diduch, David R; Werner, Brian C

2017-01-01

Although the risk of venous thromboembolism (VTE) following elective shoulder arthroscopy is low, the large volume of procedures performed each year yields a significant annual burden of patients with thromboembolic complications. The purpose of this study was to evaluate the association of high procedural altitude with the incidence of postoperative VTE following arthroscopic rotator cuff repair. A Medicare database was queried for all patients undergoing arthroscopic rotator cuff repair from 2005 to 2012. All patients with procedures performed at an altitude of 4000 feet or higher were grouped into the "high-altitude" study cohort. Patients with procedures performed at an altitude of 100 feet or lower were then matched to patients in the high-altitude cohort on the basis of age, gender, and medical comorbidities. The rate of VTE was then assessed for both the high-altitude and matched low-altitude cohorts within 90 days postoperatively. The rates of combined VTE (odds ratio [OR], 2.6; P < .0001), pulmonary embolism (OR, 4.3; P < .0001), and lower extremity deep venous thrombosis within 90 days (OR, 2.2; P = .029) were all significantly higher in patients with procedures performed at high altitude compared with matched patients with the same procedures performed at low altitude. Procedural altitude >4000 feet is associated with significantly increased rates of postoperative VTE, including deep venous thrombosis and pulmonary embolism, compared with age-, gender-, and comorbidity-matched patients undergoing the same procedures at altitudes <100 feet. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

Alcohol intoxication at Swedish football matches: A study using biological sampling to assess blood alcohol concentration levels among spectators.

PubMed

Durbeej, Natalie; Elgán, Tobias H; Jalling, Camilla; Gripenberg, Johanna

2017-01-01

Alcohol use and alcohol-related problems, including accidents, vandalism and violence, at sporting events are of increased concern in Sweden and other countries. The relationship between alcohol use and violence has been established and can be explained by the level of intoxication. Given the occurrence of alcohol use and alcohol-related problems at sporting events, research has assessed intoxication levels measured through biological sampling among spectators. This cross-sectional study aimed to assess the level of alcohol intoxication among spectators at football matches in the Swedish Premier Football League. Spectators were randomly selected and invited to participate in the study. Alcohol intoxication was measured with a breath analyser for Blood Alcohol Concentration levels, and data on gender, age, and recent alcohol use were gathered through a face-to-face interview. Blood Alcohol Concentration samples from 4420 spectators were collected. Almost half (46.8%) had a positive Blood Alcohol Concentration level, with a mean value of 0.063%, while 8.9% had a Blood Alcohol Concentration level ≥ 0.1%, with a mean value of 0.135%. Factors that predicted a higher Blood Alcohol Concentration level included male gender (p = 0.005), lower age (p < 0.001), attending a local derby (p < 0.001), alcohol use prior to having entered the arena (p < 0.001), attending a weekend match (p < 0.001), and being a spectator at supporter sections (p < 0.001). About half of all spectators at football matches in the Swedish Premier Football League drink alcohol in conjunction with the match. Approximately one tenth have a high level of alcohol intoxication.

Design and implementation of an SVM-based computer classification system for discriminating depressive patients from healthy controls using the P600 component of ERP signals.

PubMed

Kalatzis, I; Piliouras, N; Ventouras, E; Papageorgiou, C C; Rabavilas, A D; Cavouras, D

2004-07-01

A computer-based classification system has been designed capable of distinguishing patients with depression from normal controls by event-related potential (ERP) signals using the P600 component. Clinical material comprised 25 patients with depression and an equal number of gender and aged-matched healthy controls. All subjects were evaluated by a computerized version of the digit span Wechsler test. EEG activity was recorded and digitized from 15 scalp electrodes (leads). Seventeen features related to the shape of the waveform were generated and were employed in the design of an optimum support vector machine (SVM) classifier at each lead. The outcomes of those SVM classifiers were selected by a majority-vote engine (MVE), which assigned each subject to either the normal or depressive classes. MVE classification accuracy was 94% when using all leads and 92% or 82% when using only the right or left scalp leads, respectively. These findings support the hypothesis that depression is associated with dysfunction of right hemisphere mechanisms mediating the processing of information that assigns a specific response to a specific stimulus, as those mechanisms are reflected by the P600 component of ERPs. Our method may aid the further understanding of the neurophysiology underlying depression, due to its potentiality to integrate theories of depression and psychophysiology.

Disrupted topological organization in whole-brain functional networks of heroin-dependent individuals: a resting-state FMRI study.

PubMed

Jiang, Guihua; Wen, Xue; Qiu, Yingwei; Zhang, Ruibin; Wang, Junjing; Li, Meng; Ma, Xiaofen; Tian, Junzhang; Huang, Ruiwang

2013-01-01

Neuroimaging studies have shown that heroin addiction is related to abnormalities in widespread local regions and in the functional connectivity of the brain. However, little is known about whether heroin addiction changes the topological organization of whole-brain functional networks. Seventeen heroin-dependent individuals (HDIs) and 15 age-, gender-matched normal controls (NCs) were enrolled, and the resting-state functional magnetic resonance images (RS-fMRI) were acquired from these subjects. We constructed the brain functional networks of HDIs and NCs, and compared the between-group differences in network topological properties using graph theory method. We found that the HDIs showed decreases in the normalized clustering coefficient and in small-worldness compared to the NCs. Furthermore, the HDIs exhibited significantly decreased nodal centralities primarily in regions of cognitive control network, including the bilateral middle cingulate gyrus, left middle frontal gyrus, and right precuneus, but significantly increased nodal centralities primarily in the left hippocampus. The between-group differences in nodal centralities were not corrected by multiple comparisons suggesting these should be considered as an exploratory analysis. Moreover, nodal centralities in the left hippocampus were positively correlated with the duration of heroin addiction. Overall, our results indicated that disruptions occur in the whole-brain functional networks of HDIs, findings which may be helpful in further understanding the mechanisms underlying heroin addiction.

Measurement of cervical flexor endurance following whiplash.

PubMed

Kumbhare, Dinesh A; Balsor, Brad; Parkinson, William L; Harding Bsckin, Peter; Bedard, Michel; Papaioannou, Alexandra; Adachi, Jonathan D

2005-07-22

To investigate measurement properties of a practical test of cervical flexor endurance (CFE) in whiplash patients including inter-rater reliability, sensitivity to clinical change, criterion related validity against the Neck Disability Index (NDI), and discriminant validity for injured versus uninjured populations. Two samples were recruited, 81 whiplash patients, and a convenience sample of 160 subjects who were not seeking treatment and met criteria for normal pain and range of motion. CFE was measured using a stopwatch while the subject, in crook lying, held their head against gravity to fatigue. Inter-rater reliability in whiplash patients was in a range considered 'almost perfect' (Intraclass Correlation=0.96). CFE had greater inter-subject variability than the NDI or range of motion in any of three planes. However, the effect size for improvement in CFE over treatment was as large as the effect sizes for all of those measures. In multivariate regression, CFE changes accounted for changes on the NDI better than the three ranges of motion. CFE discriminated whiplash patients who were within six months of injury (n=71) from age and gender matched normals with high effect size (ES=1.5). These findings provide evidence of reliability and validity for CFE measurement, and demonstrate that CFE detects clinical improvements. Variance on CFE emphasizes the need to consider inter-, and intra-subject standard deviations to interpret scores.

Is the main goal of mastication achieved after orthodontic treatment? A prospective longitudinal study

PubMed Central

Gameiro, Gustavo Hauber; Magalhães, Isabela Brandão; Szymanski, Mariana Marcon; Andrade, Annicele Silva

2017-01-01

ABSTRACT Objective: To investigate the masticatory and swallowing performances in patients with malocclusions before and after orthodontic treatment, comparing them to an age- and gender-matched control group with normal occlusion. Methods: Twenty-three patients with malocclusions requiring orthodontic treatment were included in this prospective study. One month after appliance removal, seventeen patients completed a follow-up examination and the data were compared with those of a control group with thirty subjects with normal occlusion. Masticatory performance was determined by the median particle size for the Optocal Plus® test food after 15 chewing strokes, and three variables related to swallowing were assessed: a) time and b) number of strokes needed to prepare the test-food for swallowing, and c) median particle size of the crushed particles at the moment of swallowing. Results: At the baseline examination, the malocclusion group had a significantly lower masticatory performance and did not reach the particle size reduction at the moment of swallowing, when compared with the control group. After treatment, the masticatory performance significantly improved in the malocclusion group and the particle size reduction at swallowing reached the same level as in the control group. Conclusions: The present results showed that the correction of malocclusions with fixed appliances can objectively provide positive effects in both mastication and deglutition processes, reinforcing that besides aesthetic reasons, there are also functional indications for orthodontic treatment. PMID:28746490

Women have farther to fall: gender differences between normal elderly and Alzheimer's disease in verbal memory engender better detection of Alzheimer's disease in women.

PubMed

Chapman, Robert M; Mapstone, Mark; Gardner, Margaret N; Sandoval, Tiffany C; McCrary, John W; Guillily, Maria D; Reilly, Lindsey A; DeGrush, Elizabeth

2011-07-01

We analyzed verbal episodic memory learning and recall using the Logical Memory (LM) subtest of the Wechsler Memory Scale-III to determine how gender differences in AD compare to those seen in normal elderly and whether or not these differences impact assessment of AD. We administered the LM to both an AD and a Control group, each comprised of 21 men and 21 women, and found a large drop in performance from normal elders to AD. Of interest was a gender interaction whereby the women's scores dropped 1.6 times more than the men's did. Control women on average outperformed Control men on every aspect of the test, including immediate recall, delayed recall, and learning. Conversely, AD women tended to perform worse than AD men. Additionally, the LM achieved perfect diagnostic accuracy in discriminant analysis of AD versus Control women, a statistically significantly higher result than for men. The results indicate the LM is a more powerful and reliable tool in detecting AD in women than in men.

Gender differences in sociodemographic and clinical characteristic and the quality of life of Chinese schizophrenia patients.

PubMed

Xiang, Yu-Tao; Weng, Yong-Zhen; Leung, Chi-Ming; Tang, Wai-Kwong; Chan, Sandra S M; Wang, Chuan-Yue; Han, Bai; Ungvari, Gabor S

2010-05-01

The aim of the present study was to determine the sociodemographic and clinical correlates of the gender of Chinese schizophrenia outpatients and their impact on patients quality of life (QOL). Two hundred and fifty-five clinically stable schizophrenia outpatients were randomly selected in Hong Kong. Counterparts matched according to gender, age, age at onset, and length of illness were recruited in Beijing, China. All of the subjects at both sites were interviewed by the same investigator using standardized assessment instruments. The combined Beijing-Hong Kong sample contained 251 male and 254 female patients. On univariate analysis more male patients were employed, they had a significantly higher monthly income, and took higher doses of antipsychotic drugs. No difference was found, however, in any of the QOL domains between the genders. On multivariate analysis being employed, taking a higher dose of antipsychotic drugs, having more severe extrapyramidal side-effects, and a higher score on the physical domain of QOL were independently associated with male gender. Female gender is independently associated with lower scores on the physical aspects of QOL, but there is no difference between the genders in the psychological, social and environmental aspects.

High reliability solid refractive index matching materials for field installable connections in FTTH network

NASA Astrophysics Data System (ADS)

Saito, Kotaro; Kihara, Mitsuru; Shimizu, Tomoya; Yoneda, Keisuke; Kurashima, Toshio

2015-06-01

We performed environmental and accelerated aging tests to ensure the long-term reliability of solid type refractive index matching material at a splice point. Stable optical characteristics were confirmed in environmental tests based on an IEC standard. In an accelerated aging test at 140 °C, which is very much higher than the specification test temperature, the index matching material itself and spliced fibers passing through it had steady optical characteristics. Then we performed an accelerated aging test on an index matching material attached to a built-in fiber before splicing it in the worst condition, which is different from the normal use configuration. As a result, we confirmed that the repeated insertion and removal of fiber for splicing resulted in failure. We consider that the repetition of adhesion between index matching material and fibers causes the splice to degrade. With this result, we used the Arrhenius model to estimate a median lifetime of about 68 years in a high temperature environment of 60 °C. Thus solid type index matching material at a splice point is highly reliable over long periods under normal conditions of use.

The differential effects of gender, anthropometry, and prior hormonal state on frontal plane knee joint stiffness

PubMed Central

Cammarata, Martha L.; Dhaher, Yasin Y.

2012-01-01

Background Gender differences in passive frontal plane knee stiffness may contribute to the increased anterior cruciate ligament injury rate in females. Gender-based stiffness differences have been attributed to anthropometric variations, but little data exist describing this relationship. Furthermore, sex hormone levels appear to influence joint stiffness, but the differential effects of instantaneous and prior hormonal concentrations remain unknown. This study sought to explore the effect of gender, prior hormonal status, and anthropometry on passive frontal plane knee joint stiffness. Methods Twelve males and 31 females participated. Females were grouped by hormonal contraceptive use (non users [n=11], monophasic contraceptive users [n=11], and triphasic contraceptive users [n=9]) and tested at the same point in the menstrual cycle. Subjects’ right knee was passively stretched ±7° in the frontal plane at 3°/s. Stiffness was estimated at three loading levels and normalized by body size to minimize anthropometric biases. A 4 (group) × 3 (load) repeated measures analysis of variance was performed for both raw and normalized stiffness. Linear regression analyses were preformed between stiffness estimates and knee diameter and quadriceps femoris angle. Findings Males displayed significantly greater (P<0.05) frontal plane stiffness than females. When normalized, males displayed significantly greater stiffness in valgus (P<0.05), but not varus (P>0.05) than females. No significant effect (P>0.05) of prior hormonal state was found; however, when normalized, varus stiffness was significantly less for triphasic contraceptive users than the other female groups (P<0.05). Quadriceps femoris angle was negatively correlated and knee diameter was positively correlated to knee stiffness. Interpretation Consistent with earlier in vitro findings, our data may indicate that ligament material properties are gender specific. A deficit in passive knee joint stiffness may place a larger burden on the neuromuscular system to resist frontal plane loading in females. PMID:18479791

Evaluating acoustic speaker normalization algorithms: evidence from longitudinal child data.

PubMed

Kohn, Mary Elizabeth; Farrington, Charlie

2012-03-01

Speaker vowel formant normalization, a technique that controls for variation introduced by physical differences between speakers, is necessary in variationist studies to compare speakers of different ages, genders, and physiological makeup in order to understand non-physiological variation patterns within populations. Many algorithms have been established to reduce variation introduced into vocalic data from physiological sources. The lack of real-time studies tracking the effectiveness of these normalization algorithms from childhood through adolescence inhibits exploration of child participation in vowel shifts. This analysis compares normalization techniques applied to data collected from ten African American children across five time points. Linear regressions compare the reduction in variation attributable to age and gender for each speaker for the vowels BEET, BAT, BOT, BUT, and BOAR. A normalization technique is successful if it maintains variation attributable to a reference sociolinguistic variable, while reducing variation attributable to age. Results indicate that normalization techniques which rely on both a measure of central tendency and range of the vowel space perform best at reducing variation attributable to age, although some variation attributable to age persists after normalization for some sections of the vowel space. © 2012 Acoustical Society of America

Metabolic Syndrome Components After Pediatric Liver Transplantation: Prevalence and the Impact of Obesity and Immunosuppression.

PubMed

Perito, E R; Lustig, R H; Rosenthal, P

2016-06-01

Metabolic syndrome is associated with long-term morbidity and mortality after adult liver transplantation (LT). Whether pediatric LT recipients have a higher prevalence of metabolic syndrome remains controversial. In a cross-sectional study, we evaluated pediatric LT recipients aged 8-30 years using National Health and Nutrition Examination Survey (NHANES) protocols. LT recipients were matched by gender, race/ethnicity, and age with controls from NHANES. Pediatric LT recipients (n = 83), after adjusting for overweight/obesity and glucocorticoid use, had increased prevalence of prehypertension and hypertension, impaired glucose tolerance (IGT; 2-h glucose after oral glucose tolerance test ≥140 mg/dL), and low high-density lipoprotein compared to matched NHANES controls (n = 235) despite a lower prevalence of overweight/obesity. Among LT recipients, the adjusted odds of IGT doubled for every 7.5 years taking calcineurin inhibitors (odds ratio = 2.10, 95% confidence interval 1.06-4.17 per 7.5 years taking calcineurin inhibitors, p = 0.03). Among all subjects with IGT, LT recipients had a lower prevalence of overweight/obesity and less insulin resistance (homeostatic model assessment of insulin resistance) than did controls with IGT. Among normal weight subjects, LT recipients were significantly more likely than controls to have prehypertension/hypertension, IGT, low high-density lipoprotein, and metabolic syndrome. Pediatric LT recipients have unique metabolic syndrome profiles and risk factors and will require tailored screening and management protocols. © Copyright 2016 The American Society of Transplantation and the American Society of Transplant Surgeons.

Contact Heat Evoked Potentials (CHEPs) in Patients with Mild-Moderate Alzheimer's Disease and Matched Control--A Pilot Study.

PubMed

Jensen-Dahm, Christina; Madsen, Caspar Skau; Waldemar, Gunhild; Ballegaard, Martin; Hejl, Anne-Mette; Johnsen, Birger; Jensen, Troels Staehelin

2016-04-01

Clinical studies have found that patients with Alzheimer's disease report pain of less intensity and with a lower affective response, which has been thought to be due to altered pain processing. The authors wished to examine the cerebral processing of non-painful and painful stimuli using somatosensory evoked potentials and contact heat evoked potentials in patients with Alzheimer's disease and in healthy elderly controls. Case-control study Twenty outpatients with mild-moderate Alzheimer's disease and in 17 age- and gender-matched healthy controls were included Contact heat evoked potentials and somatosensory evoked potentials were recorded in all subjects. Furthermore, warmth detection threshold and heat pain threshold were assessed. Patients and controls also rated quality and intensity of the stimuli. The authors found no difference on contact heat evoked potential amplitude (P = 0.59) or latency of N2 or P2 wave (P = 0.62 and P = 0.75, respectively) between patients and controls. In addition, there was no difference in regard to pain intensity scores or pain quality. The patients and controls had similar warmth detection threshold and heat pain threshold. Somatosensory evoked potentials, amplitude, and latency were within normal range and similar for the two groups. The findings suggest that the processing of non-painful and painful stimuli is preserved in patients with mild to moderate Alzheimer's disease. © 2015 American Academy of Pain Medicine. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Gender Identification Using High-Frequency Speech Energy: Effects of Increasing the Low-Frequency Limit.

PubMed

Donai, Jeremy J; Halbritter, Rachel M

The purpose of this study was to investigate the ability of normal-hearing listeners to use high-frequency energy for gender identification from naturally produced speech signals. Two experiments were conducted using a repeated-measures design. Experiment 1 investigated the effects of increasing high-pass filter cutoff (i.e., increasing the low-frequency spectral limit) on gender identification from naturally produced vowel segments. Experiment 2 studied the effects of increasing high-pass filter cutoff on gender identification from naturally produced sentences. Confidence ratings for the gender identification task were also obtained for both experiments. Listeners in experiment 1 were capable of extracting talker gender information at levels significantly above chance from vowel segments high-pass filtered up to 8.5 kHz. Listeners in experiment 2 also performed above chance on the gender identification task from sentences high-pass filtered up to 12 kHz. Cumulatively, the results of both experiments provide evidence that normal-hearing listeners can utilize information from the very high-frequency region (above 4 to 5 kHz) of the speech signal for talker gender identification. These findings are at variance with current assumptions regarding the perceptual information regarding talker gender within this frequency region. The current results also corroborate and extend previous studies of the use of high-frequency speech energy for perceptual tasks. These findings have potential implications for the study of information contained within the high-frequency region of the speech spectrum and the role this region may play in navigating the auditory scene, particularly when the low-frequency portion of the spectrum is masked by environmental noise sources or for listeners with substantial hearing loss in the low-frequency region and better hearing sensitivity in the high-frequency region (i.e., reverse slope hearing loss).

Comparison of Masculine and Feminine Gender Roles in Iranian Patients with Gender Identity Disorder.

PubMed

Alavi, Kaveh; Eftekhar, Mehrdad; Jalali Nadoushan, Amir Hossein

2015-12-01

Gender identity disorders (GID) are heterogeneous disorders that may be influenced by culture and social norms. The aim of this study was to determine masculine and feminine gender roles in a group of Iranian patients with GID and compare these roles with two control groups. Twelve male-to-female (MF) and 27 female-to-male (FM) individuals with GID referred to Tehran Psychiatric Institute in Tehran, I. R. Iran were evaluated by self-report inventories and were compared with two groups of healthy controls (81 men and 89 women). Diagnoses were established based on the Diagnostic and Statistical Manual of Mental Disorders, fourth edition (DSM-IV) criteria. Data analysis was done using analysis of variance and chi-squared test. Masculine and feminine gender roles were assessed by two questionnaires: (i) Gender-Masculine (GM) and Gender-Feminine (GF) scales derived from the Minnesota Multiphasic Inventory-2 (MMPI-2); (ii) Bem Sex Role Inventory (BSRI). In the scales of masculinity, MF-GID individuals scored as male controls, but lower than female controls. FM-GID individuals scored similar to female controls and higher than male controls. In femininity scales, MF-GID individuals and control women seemed similar, and both scored higher than the other groups. FM-GID persons were considered less feminine than both controls in the GF scale of MMPI-2, but not in the BSRI. In both scales, FM-GID persons had higher scores than control women and MF-GID individuals. Iranian FM-GID individuals were less feminine than normal men. However, MF-GID individuals were similar to normal women or more feminine. Cultural considerations remain to be investigated. Alavi K, Eftekhar M and Jalali Nadoushan AH. Comparison of masculine and feminine gender roles in Iranian patients with gender identity disorder. Sex Med 2015;3:261-268.

Ambiguous Loss after Lesbian Couples with Children Break up: A Case for Same-Gender Divorce

ERIC Educational Resources Information Center

Allen, Katherine R.

2007-01-01

The theory of ambiguous loss is applied to structural ambiguity and personal transcendence in the parent-child relationship following a same-gender relational ending. Working recursively through the six guidelines of ambiguous loss (finding meaning, tempering mastery, reconstructing identity, normalizing ambivalence, revising attachment, and…

Normal Psychosexual Development

ERIC Educational Resources Information Center

Rutter, Michael

1971-01-01

Normal sexual development is reviewed with respect to physical maturation, sexual interests, sex drive", psychosexual competence and maturity, gender role, object choice, children's concepts of sexual differences, sex role preference and standards, and psychosexual stages. Biologic, psychoanalytic and psychosocial theories are briefly considered.…

Neural activity to intense positive versus negative stimuli can help differentiate bipolar disorder from unipolar major depressive disorder in depressed adolescents: a pilot fMRI study.

PubMed

Diler, Rasim Somer; de Almeida, Jorge Renner Cardoso; Ladouceur, Cecile; Birmaher, Boris; Axelson, David; Phillips, Mary

2013-12-30

Failure to distinguish bipolar depression (BDd) from the unipolar depression of major depressive disorder (UDd) in adolescents has significant clinical consequences. We aimed to identify differential patterns of functional neural activity in BDd versus UDd and employed two (fearful and happy) facial expression/ gender labeling functional magnetic resonance imaging (fMRI) experiments to study emotion processing in 10 BDd (8 females, mean age=15.1 ± 1.1) compared to age- and gender-matched 10 UDd and 10 healthy control (HC) adolescents who were age- and gender-matched to the BDd group. BDd adolescents, relative to UDd, showed significantly lower activity to both intense happy (e.g., insula and temporal cortex) and intense fearful faces (e.g., frontal precentral cortex). Although the neural regions recruited in each group were not the same, both BDd and UDd adolescents, relative to HC, showed significantly lower neural activity to intense happy and mild happy faces, but elevated neural activity to mild fearful faces. Our results indicated that patterns of neural activity to intense positive and negative emotional stimuli can help differentiate BDd from UDd in adolescents. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Frontal and temporal volumes in Childhood Absence Epilepsy.

PubMed

Caplan, Rochelle; Levitt, Jennifer; Siddarth, Prabha; Wu, Keng Nei; Gurbani, Suresh; Sankar, Raman; Shields, W Donald

2009-11-01

This study compared frontotemporal brain volumes in children with childhood absence epilepsy (CAE) to age- and gender-matched children without epilepsy. It also examined the association of these volumes with seizure, demographic, perinatal, intelligence quotient (IQ), and psychopathology variables. Twenty-six children with CAE, aged 7.5-11.8 years, and 37 children without epilepsy underwent brain magnetic resonance imaging (MRI) scans at 1.5 Tesla. Tissue was segmented, and total brain, frontal lobe, frontal parcellations, and temporal lobe volumes were computed. All children had IQ testing and structured psychiatric interviews. Parents provided seizure, perinatal, and behavioral information on each child. The CAE group had significantly smaller gray matter volumes of the left orbital frontal gyrus as well as both left and right temporal lobes compared to the age- and gender-matched children without epilepsy. In the CAE group these volumes were related to age, gender, ethnicity, and pregnancy complications but not to seizure, IQ, and psychopathology variables. In the group of children without epilepsy, however, the volumes were related to IQ. These findings suggest that CAE impacts brain development in regions implicated in behavior, cognition, and language. In addition to supporting the cortical focus theory of CAE, these findings also imply that CAE is not a benign disorder.

Gendered education in a gendered world: looking beyond cosmetic solutions to the gender gap in science

NASA Astrophysics Data System (ADS)

Sinnes, Astrid T.; Løken, Marianne

2014-06-01

Young people in countries considered to be at the forefront of gender equity still tend to choose very traditional science subjects and careers. This is particularly the case in science, technology, engineering and mathematics subjects (STEM), which are largely male dominated. This article uses feminist critiques of science and science education to explore the underlying gendered assumptions of a research project aiming to contribute to improving recruitment, retention and gender equity patterns in STEM educations and careers. Much research has been carried out to understand this gender gap phenomenon as well as to suggest measures to reduce its occurrence. A significant portion of this research has focused on detecting the typical "female" and "male" interest in science and has consequently suggested that adjustments be made to science education to cater for these interests. This article argues that adjusting science subjects to match perceived typical girls' and boys' interests risks being ineffective, as it contributes to the imposition of stereotyped gender identity formation thereby also imposing the gender differences that these adjustments were intended to overcome. This article also argues that different ways of addressing gender issues in science education themselves reflects different notions of gender and science. Thus in order to reduce gender inequities in science these implicit notions of gender and science have to be made explicit. The article begins with an overview of the current situation regarding gender equity in some so- called gender equal countries. We then present three perspectives from feminist critiques of science on how gender can be seen to impact on science and science education. Thereafter we analyze recommendations from a contemporary research project to explore which of these perspectives is most prevalent.

Muscle strength and quality of life in patients with childhood cancer at early phase of primary treatment.

PubMed

Deisenroth, Anne; Söntgerath, Regine; Schuster, Anne Judith; von Busch, Christine; Huber, Gerhard; Eckert, Katharina; Kulozik, Andreas E; Wiskemann, Joachim

2016-09-01

Cancer- and treatment-related side effects in patients with childhood cancer may cause limitations in motor performance affecting activities of daily living (ADLs). Data focusing on long-term effects are available, but little is known with regard to the short-term perspective. Therefore, the purpose of this study was to assess muscle strength performance and quality of life (QoL) in children and adolescents with cancer at the beginning of primary treatment. Forty children and adolescents aged 5-18 years (mean: 11.39 ± 4.08 years) with different types of childhood cancer were enrolled. On average 36 ± 20.5 days after diagnosis, strength performance in 7 muscle groups was assessed by handheld dynamometry. KINDL questionnaires were completed to evaluate QoL (children's self-report and parents' report). All parameters were compared with age- and gender-matched reference values. Patients with childhood cancer showed significantly lower strength values in all muscle groups (P < .01) compared with age- and gender-matched controls. Most affected were the lower extremities, with a -57.1% ± 10.4%, median: -59.2%, minimum: -75.4%, maximum: -41.4% percentage deviation in knee flexion from healthy peers. Children themselves and parents assessed total QoL significantly below age- and gender-matched reference values (P < .01). Correlation between elbow flexion and self-reported QoL was detected. Broader correlations were found for the parents' report. Muscle weakness and decreased QoL in children and adolescents seem to persist already at the beginning of anticancer treatment. This underlines the need of counteracting measures, such as exercise intervention programs, starting as early as possible during the treatment process. Efforts on this topic are currently being carried out by our group.

Dating relationships in college students with childhood-onset asthma.

PubMed

Eddington, Angelica R; Mullins, Larry L; Fedele, David A; Ryan, Jamie L; Junghans, Ashley N

2010-02-01

The current study investigated whether differences existed in dating anxiety and fear of intimacy between individuals with childhood-onset asthma and individuals without a chronic illness. Analyses were also conducted to determine if dating anxiety or fear of intimacy were predictors of health-related quality of life in individuals with asthma and healthy controls. Additionally, potential gender differences in dating anxiety and fear of intimacy in individuals with childhood-onset asthma were explored. College undergraduates at least 17 years of age who self-identified as having childhood asthma were randomly matched by age and gender to healthy control participants. Participants completed a demographic form, the Dating Anxiety Scale for Adolescents, the Fear of Intimacy Scale, and the SF-36 Health Survey, a measure of health-related quality of life. There were no significant differences between self-identified participants with asthma and matched healthy controls on the Dating Anxiety Scale or Fear of Intimacy Scale. However, dating anxiety was a significant predictor of mental health-related quality of life in participants with asthma but not in matched health controls. Fear of intimacy was not a significant predictor of mental or physical health-related quality of life in individuals with asthma. In addition, women with asthma endorsed significantly more dating anxiety and lower physical health-related quality of life than males with asthma. College students with asthma appear to experience similar levels of dating anxiety and fear of intimacy than healthy college students; however, their anxiety about dating may have a larger effect on health-related quality of life than healthy individuals. Additional examination of dating and interpersonal relationships among individuals with asthma appears warranted, particularly as it concerns possible gender differences in individuals with childhood-onset asthma.

Effect of Yoga Practice on Levels of Inflammatory Markers After Moderate and Strenuous Exercise

PubMed Central

Doreswamy, Venkatesh; Narasipur, Omkar Subbaramajois; Kunnavil, Radhika; Srinivasamurthy, Nandagudi

2015-01-01

Background and Objectives To evaluate the effect of yoga practice and exercise challenge on Tumour Necrosis Factor alpha (TNF-α), Interleukin-6 (IL-6) levels and lipid profile. Materials and Methods Two hundred and eighteen subjects participated in the study. One hundred and nine volunteers (51 males and 58 females) in the age group of 20 to 60 years, who practiced yoga regularly for over five years for a period of one hour daily, performed a bout of moderate exercise and a bout of strenuous exercise as per Standardized Shuttle Walk test protocol. Anthropometrically matched, age matched and gender matched subjects, who did not practice yoga (non-yoga group) were chosen as controls (non-yoga, n=109). The non-yoga group also performed similar exercises. The blood samples of both the groups were collected before and after the exercises. TNF-α and IL-6 was analysed before and after the exercise by Sandwich ELISA (Enzyme Linked Immunosorbent Assay). Results Resting plasma TNF-α concentration was significantly higher in non-yoga group when compared to yoga group (p<0.05). There was an increase in TNF-α levels in both the groups in response to strenuous exercise. There was no gender difference in TNF-α and IL-6 levels before and after exercise in yoga and non-yoga groups. Conclusion Regular practice of yoga lowers basal TNF-α and IL-6 levels. It also reduces the extent of increase of TNF-α and IL-6 to a physical challenge of moderate exercise and strenuous exercise. There is no significant gender difference in the TNF-α and IL-6 levels. Regular practice of yoga can protect the individual against inflammatory diseases by favourably altering pro-inflammatory cytokine levels. PMID:26266115

Familial pachygyria in both genders related to a DCX mutation.

PubMed

Kim, Young Ok; Nam, Tai-Seung; Park, Chungoo; Kim, Seul Kee; Yoon, Woong; Choi, Seok-Yong; Kim, Myeong-Kyu; Woo, Young Jong

2016-06-01

Doublecortin (DCX) and tubulin play critical roles in neuronal migration. DCX mutations usually cause anterior dominant lissencephaly in males and subcortical band heterotopia (SBH) in females. We used whole-exome sequencing to investigate causative gene variants in a large family with late-childhood-onset focal epilepsy and anterior dominant pachygyria without SBH in both genders. Two potential variants were found for the genes encoding DCX and beta tubulin isotype 1 (TUBB1). The novel DCX mutation (p.D90G, NP_000546.2) appeared to be a major causative variant, whereas the novel mutation of TUBB1 (p.R62fsX, NP_110400.1) was found only in patients with more-severe intellectual disability after gender matching. We report an unusual DCX-related disorder exhibiting familial pachygyria without SBH in both genders. Copyright © 2015 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Gender typicality in children's speech: A comparison of boys with and without gender identity disorder.

PubMed

Munson, Benjamin; Crocker, Laura; Pierrehumbert, Janet B; Owen-Anderson, Allison; Zucker, Kenneth J

2015-04-01

This study examined whether boys with gender identity disorder (GID) produced less prototypically male speech than control boys without GID, a possibility that has been suggested by clinical observations. Two groups of listeners participated in tasks where they rated the gender typicality of single words (group 1) or sentences (group 2) produced by 15 5-13 year old boys with GID and 15 age-matched boys without GID. Detailed acoustic analyses of the stimuli were also conducted. Boys with GID were rated as less boy-like than boys without GID. In the experiment using sentence stimuli, these group differences were larger than in the experiment using single-word stimuli. Listeners' ratings were predicted by a variety of acoustic parameters, including ones that differ between the two groups and ones that are stereotypically associated with adult men's and women's speech. Future research should examine how these variants are acquired.

Fat-free mass is not lower 24 months postbariatric surgery than nonoperated matched controls.

PubMed

Strain, Gladys Witt; Ebel, Faith; Honohan, Jamie; Gagner, Michel; Dakin, Gregory F; Pomp, Alfons; Gallagher, Dympna

2017-01-01

Concerns about an excessive loss of fat-free mass (FFM) after bariatric surgery prompted this comparison of operated versus matched nonoperated controls regarding FFM. University Hospital and University Research Unit in an urban medical center. Body composition with bioelectric impedance (Tanita 310, Tanita Corp, Arlington Heights, IL) was measured approximately 2 years after bariatric surgery in weight stable patients and nonoperated weight stable controls matched for body mass index (BMI), gender, and age. t tests provided comparisons. Analysis of variance was used to compare FFM changes for 4 procedures. Levene's test evaluated variance. Patients (n = 252; 24.7±15 mo after surgery) and nonoperated controls (n = 252) were matched for gender (71.8% female), age (44.5±11.0 yr), and BMI (32.8±7.0 kg/m 2 ). Patients had different surgical procedures: 107 gastric bypasses (RYGBs), 62 biliopancreatic diversions with duodenal switch (BPD/DSs), 40 adjustable gastric bands (AGBs), and 43 sleeve gastrectomies (LSGs). FFM percentage was significantly higher in the operated patients than controls, 66% versus 62%, P<.0001. For 3 procedures, the FFM was significantly higher; however, AGBs changed only 7.3 BMI units and FFM was not significantly different from their matched controls, 59.8% versus 58.2%. Across surgical groups, FFM percentage differed, P<.0001 (RYGB 66.5±9.2%, BPD/DS 74.0±9.3%, AGB 59.8±7.0%, LSG 59.6±9.3%). Variance was not different (P = .17). Weight-reduced bariatric surgery patients have greater FFM compared with nonoperated matched controls. These findings support surgically assisted weight loss as a physiologic process and in general patients do not suffer from excessive FFM depletion after bariatric procedures. Copyright © 2017 American Society for Bariatric Surgery. Published by Elsevier Inc. All rights reserved.

College drinking behaviors: mediational links between parenting styles, impulse control, and alcohol-related outcomes.

PubMed

Patock-Peckham, Julie A; Morgan-Lopez, Antonio A

2006-06-01

Mediational links between parenting styles (authoritative, authoritarian, permissive), impulsiveness (general control), drinking control (specific control), and alcohol use and abuse were tested. A pattern-mixture approach (for modeling non-ignorable missing data) with multiple-group structural equation models with 421 (206 female, 215 male) college students was used. Gender was examined as a potential moderator of parenting styles on control processes related to drinking. Specifically, the parent-child gender match was found to have implications for increased levels of impulsiveness (a significant mediator of parenting effects on drinking control). These findings suggest that a parent with a permissive parenting style who is the same gender as the respondent can directly influence control processes and indirectly influence alcohol use and abuse.

Effect of gender on computerized electrocardiogram measurements in college athletes.

PubMed

Mandic, Sandra; Fonda, Holly; Dewey, Frederick; Le, Vy-van; Stein, Ricardo; Wheeler, Matt; Ashley, Euan A; Myers, Jonathan; Froelicher, Victor F

2010-06-01

Broad criteria for classifying an electrocardiogram (ECG) as abnormal and requiring additional testing prior to participating in competitive athletics have been recommended for the preparticipation examination (PPE) of athletes. Because these criteria have not considered gender differences, we examined the effect of gender on the computerized ECG measurements obtained on Stanford student athletes. Currently available computer programs require a basis for "normal" in athletes of both genders to provide reliable interpretation. During the 2007 PPE, computerized ECGs were recorded and analyzed on 658 athletes (54% male; mean age, 19 +/- 1 years) representing 22 sports. Electrocardiogram measurements included intervals and durations in all 12 leads to calculate 12-lead voltage sums, QRS amplitude and QRS area, spatial vector length (SVL), and the sum of the R wave in V5 and S wave in V2 (RSsum). By computer analysis, male athletes had significantly greater QRS duration, PR interval, Q-wave duration, J-point amplitude, and T-wave amplitude, and shorter QTc interval compared with female athletes (all P < 0.05). All ECG indicators of left ventricular electrical activity were significantly greater in males. Although gender was consistently associated with indices of atrial and ventricular electrical activity in multivariable analysis, ECG measurements correlated poorly with body dimensions. Significant gender differences exist in ECG measurements of college athletes that are not explained by differences in body size. Our tables of "normal" computerized gender-specific measurements can facilitate the development of automated ECG interpretation for screening young athletes.

Everything's better in moderation: young women's gender role attitudes and risky sexual behavior.

PubMed

Leech, Tamara G J

2010-05-01

This study examines the association between gender role attitudes and risky sexual behavior among young women. Previous studies have posed seemingly contradictory arguments: that either traditional attitudes or egalitarian attitudes are associated with riskier behavior. Data are based on the children of the National Longitudinal Survey of Youth, representing 520 sexually active 18-19-year-old women. Propensity radius matching was used to assess differences in rates of multiple sexual partners and sex outside of a committed relationship. Relative to moderate gender role attitudes, both egalitarian gender role attitudes and traditional gender role attitudes are associated with higher rates of risky sexual behavior. Both women with egalitarian role attitudes and those with traditional role attitudes have about a 10% higher prevalence of risky behavior compared to women with more moderate gender role attitudes. Existing, seemingly contradictory contentions about the relationship between gender role attitudes and risky sexual behavior may be more coherent than they seem. By shifting focus from risk to protection, the results suggest that moderate gender role attitudes are protective against risky sexual behavior. Future studies should investigate the causal mechanisms and intervention implications of this protective relationship. Copyright 2010 Society for Adolescent Medicine. Published by Elsevier Inc. All rights reserved.

LINE1 and Alu repetitive element DNA methylation in tumors and white blood cells from epithelial ovarian cancer patients.

PubMed

Akers, Stacey N; Moysich, Kirsten; Zhang, Wa; Collamat Lai, Golda; Miller, Austin; Lele, Shashikant; Odunsi, Kunle; Karpf, Adam R

2014-02-01

We determined whether DNA methylation of repetitive elements (RE) is altered in epithelial ovarian cancer (EOC) patient tumors and white blood cells (WBC), compared to normal tissue controls. Two different quantitative measures of RE methylation (LINE1 and Alu bisulfite pyrosequencing) were used in normal and tumor tissues from EOC cases and controls. Tissues analyzed included: i) EOC, ii) normal ovarian surface epithelia (OSE), iii) normal fallopian tube surface epithelia (FTE), iv) WBC from EOC patients, obtained before and after treatment, and v) WBC from demographically-matched controls. REs were significantly hypomethylated in EOC compared to OSE and FTE, and LINE1 and Alu methylation showed a significant direct association in these tissues. In contrast, WBC RE methylation was significantly higher in EOC cases compared to controls. RE methylation in patient-matched EOC tumors and pre-treatment WBC did not correlate. EOC shows robust RE hypomethylation compared to normal tissues from which the disease arises. In contrast, RE are generally hypermethylated in EOC patient WBC compared to controls. EOC tumor and WBC methylation did not correlate in matched patients, suggesting that RE methylation is independently controlled in tumor and normal tissues. Despite the significant differences observed over the population, the range of RE methylation in patient and control WBC overlapped, limiting their specific utility as an EOC biomarker. However, our data demonstrate that DNA methylation is deranged in normal tissues from EOC patients, supporting further investigation of WBC DNA methylation biomarkers suitable for EOC risk assessment. Copyright © 2013 Elsevier Inc. All rights reserved.

Evaluation of chromium, cobalt and manganese in biological samples (scalp hair, blood, and urine) of Pakistani viral hepatitis (A-E) patients and controls.

PubMed

Afridi, Hassan Imran; Kazi, Tasneem Gul; Kazi, Naveed; Naeemullah; Arain, Sadaf Sadia; Brahman, Kapil Dev; Wadhwa, Sham Kumar

2013-01-01

The aim of the present study was to compare the level of chromium (Cr), cobalt (Co), and manganese (Mn) in biological samples (blood, urine, and scalp hair) of patients suffering from different types of viral hepatitis (A, B, C, D, and E; n = 521) of both genders, ages ranging from 31 - 45 years. For comparative study, 255 age-matched control subjects of both genders residing in the same city were selected as referents. The digests of all biological samples were analysed for Cr, Co, and Mn by electrothermal atomic absorption spectrometry (ETAAS). The validity and accuracy of the methodology was checked by using certified reference materials (CRMs) and compared with those values obtained by conventional wet acid digestion method on same CRMs. The results of this study showed that the mean values of Cr, Co, and Mn were higher in blood and scalp hair samples of hepatitis patients than in age-matched control subjects. The urinary levels of these elements were found to be higher in the hepatitis patients than in the age-matched healthy controls (p <0.001). These results are consistent with literature-reported data, confirming that the overload of these trace elements can directly cause lipid peroxidation and eventually hepatic damage.

Is Statin Use Associated With Tendon Rupture? A Population-Based Retrospective Cohort Analysis.

PubMed

Contractor, Tahmeed; Beri, Abhimanyu; Gardiner, Joseph C; Tang, Xiaoqin; Dwamena, Francesca C

2015-01-01

Previous case reports and small studies have suggested that 3-hydroxy-3-methylglutaryl-CoA reductase inhibitors (HMG-CoA-Is) may increase the risk of tendon rupture. We conducted a population-based retrospective cohort evaluation to better assess this relationship. From approximately 800,000 enrollees of a private insurance database, those who were aged ≤64 years with at least 1 year of continuous enrollment were selected. Exposure was defined as initiation of HMG-CoA-I after the beginning of the study period. Each exposed person was matched with 2 controls of similar age and gender. Baseline characteristics, including known risk factors for tendon rupture, were compared between exposed and control cohorts with fidelity to the study's matched design. After adjusting for differences in follow-up and baseline characteristics, incidence rate ratios for tendon rupture was assessed in HMG-CoA-I users and nonusers. A total of 34,749 exposed patients were matched with 69,498 controls. There was no difference in the occurrence of tendon ruptures in HMG-CoA-I users versus nonusers. The results remained unchanged after adjustment for age and gender. In conclusion, this population-based retrospective cohort evaluation suggests that use of HMG-CoA-Is as a group are not associated with tendon rupture.

Gendered Processes in Hospice Palliative Home Care for Seniors With Cancer and Their Family Caregivers.

PubMed

Sutherland, Nisha; Ward-Griffin, Catherine; McWilliam, Carol; Stajduhar, Kelli

2016-06-01

There has been limited investigation into the processes that shape gender (in)equities in hospice palliative home care. As part of a larger critical ethnographic study, we examined how and why gender relations occur in this context. Using a critical feminist lens, we conducted in-depth interviews with clients living with terminal cancer, their family caregivers and primary nurses; observations of agency home visits; and review of institutional documents. A gender-based analysis revealed that gender enactments of Regulating Gender Relations were legitimized through ideological processes of Normalizing Gender Relations and Equalizing Gender Relations (Re)produced through institutional discourses of individualism and egalitarianism, these gendered processes both advantaged and disadvantaged men and women in hospice palliative home care. Findings suggest that to promote equity, health care providers and policy makers must attend to gender as a prevalent social determinant of health and health care. Implications for policy, practice, education, and research are discussed. © The Author(s) 2015.

Ocular vestibular evoked myogenic potentials in response to air-conducted 500 Hz short tones: Effect of stimulation procedure (monaural or binaural), age and gender.

PubMed

Versino, Maurizio; Colnaghi, Silvia; Ranzani, Marina; Alloni, Roberto; Bolis, Carlotta; Sacco, Simone; Moglia, Arrigo; Callieco, Roberto

2015-01-01

The ocular vestibular myogenic potentials (oVEMP) can be elicited by monaural air-conducted sound stimulation, and are usually recorded from the contralateral eye. In clinical setting a binaural stimulation would save time and require less effort from the subjects. We evaluated the differences between monaural and binaural stimulation, and the possible effect of age and gender on oVEMP parameters. Air-conducted oVEMP were recorded by binaural and by monaural stimulation in a group of 54 normal subjects, aged from 12 to 83 years, and in 50 vestibular patients. From each side, we measured the latency of the N1 component, and the peak-to-peak N1-P1 amplitude. For both parameters we also computed the asymmetry ratio. In normal subjects binaural stimulation produced slightly larger responses than monaural stimulation; detectability, latency and amplitude ratio were the same for the two techniques. We found no differences related to gender, and the age-induced amplitude decline was likely to be negligible.oVEMP recorded not in an acute phase of their disorder, proved to be abnormal in about 20% of the patients, and the normal or abnormal findings obtained either with monaural or with binaural stimulation were always concordant. The oVEMP obtained after binaural and monaural stimulation are very similar, and they are largely independent from age and gender.

Physiological Regulation and Infantile Anorexia: A Pilot Study

ERIC Educational Resources Information Center

Chatoor, Irene; Ganiban, Jody; Surles, Jaclyn; Doussard-Roosevelt, Jane

2004-01-01

Objective: To examine whether infantile anorexia is associated with physiological dysregulation. Method: This study included eight toddlers with infantile anorexia and eight healthy eaters matched for age, race, socioeconomic status, and gender. Physiological measures of heart period and respiratory sinus arrhythmia were assessed across three…

Changes in gross grasp strength and fine motor skills in adolescents with pediatric multiple sclerosis.

PubMed

Squillace, Mary; Ray, Sharon; Milazzo, Maria

2015-01-01

This study examined the gross grasp strength and fine motor dexterity of adolescents, who are diagnosed with multiple sclerosis (MS). A total sample size of 72 participants between the ages of 13 to 17 was studied. Thirty six with a diagnosis of pediatric relapse remitting MS and 36 matched control participants were selected from various local youth groups. Data on hand strength and dexterity was collected using a dynamometer, nine hole peg board and Purdue pegboard on both groups. Utilizing ANCOVA to describe the differences across the two groups by diagnosis, controlling for age and gender, it was found that the MS group demonstrated significantly decreased dexterity when compared to age and gender matched controls. There was no significant difference in gross grasp strength by diagnostic group. This preliminary study showed that children with a diagnosis of pediatric MS may have differences in fine motor dexterity, but not gross grasp strength from their peers who do not have the diagnosis. Further study is indicated to examine this phenomenon.

Local gradient Gabor pattern (LGGP) with applications in face recognition, cross-spectral matching, and soft biometrics

NASA Astrophysics Data System (ADS)

Chen, Cunjian; Ross, Arun

2013-05-01

Researchers in face recognition have been using Gabor filters for image representation due to their robustness to complex variations in expression and illumination. Numerous methods have been proposed to model the output of filter responses by employing either local or global descriptors. In this work, we propose a novel but simple approach for encoding Gradient information on Gabor-transformed images to represent the face, which can be used for identity, gender and ethnicity assessment. Extensive experiments on the standard face benchmark FERET (Visible versus Visible), as well as the heterogeneous face dataset HFB (Near-infrared versus Visible), suggest that the matching performance due to the proposed descriptor is comparable against state-of-the-art descriptor-based approaches in face recognition applications. Furthermore, the same feature set is used in the framework of a Collaborative Representation Classification (CRC) scheme for deducing soft biometric traits such as gender and ethnicity from face images in the AR, Morph and CAS-PEAL databases.

Sex-typed play in gender-disturbed children: a comparison to sibling and psychiatric controls.

PubMed

Zucker, K J; Doering, R W; Bradley, S J; Finegan, J K

1982-08-01

Gender-disturbed children (n = 14) were compared to their preadolescent siblings (n = 16) and psychiatric controls (n = 13) on a sex-typed free-play task previously shown to differentiate gender-disturbed boys from normal boys. On three separate trials totaling 20 minutes, the gender-disturbed children played for a significantly longer period of time with cross-sex toys and for a significantly shorter period of time with same-sex toys than did the two control groups. The gender-disturbed children also showed greater trial-to-trial consistency in their play preferences than the other two groups. The utility of this task in the assessment of childhood gender disturbance is discussed. In addition, the results are discussed in relation to a number of perspectives regarding both typical and atypical gender identity development in childhood.

Gender does matter: gender-specific outcome analysis of 67,855 heart transplants.

PubMed

Kaczmarek, Ingo; Meiser, Bruno; Beiras-Fernandez, Andres; Guethoff, Sonja; Überfuhr, Peter; Angele, Martin; Seeland, Ute; Hagl, Christian; Reichart, Bruno; Eifert, Sandra

2013-01-01

Gender differences between donor and recipient might have an impact on the outcome after heart transplantation (HT). Data of more than 67,000 patients registered at the International Society of Heart Lung Transplantation (ISHLT) were reviewed focusing on the influence of gender differences on short- and long-term outcome after HT. We performed a retrospective analysis of 67,855 cardiac allograft recipients. They received orthotopic HT between January 1, 1980 and June 30, 2009. In contrast to other studies the data for gender differences (donor gender and recipient gender) were calculated with respect to actuarial and conditional survival (without 30-day mortality). One-year survival was highest in male recipients of male donor hearts (mR/mD: 83.74%). The lowest 1-year outcome showed male recipients of female donor organs (mR/fD: 78.95%). Best 5-year survival rates were shown by male recipients with male donor organs (70.75%, p < 0.0001). These differences disappeared in survival conditional to 1 year, indicating that gender predominantly influences short-term outcome. The combination male recipient/female donor carries a higher risk for early mortality, whereas female recipients/male donor reveals favorable short-term results. Gender-matched HT would be ideal, but not suitable in practice because of the shortage of organs. Georg Thieme Verlag KG Stuttgart · New York.

Bin Ratio-Based Histogram Distances and Their Application to Image Classification.

PubMed

Hu, Weiming; Xie, Nianhua; Hu, Ruiguang; Ling, Haibin; Chen, Qiang; Yan, Shuicheng; Maybank, Stephen

2014-12-01

Large variations in image background may cause partial matching and normalization problems for histogram-based representations, i.e., the histograms of the same category may have bins which are significantly different, and normalization may produce large changes in the differences between corresponding bins. In this paper, we deal with this problem by using the ratios between bin values of histograms, rather than bin values' differences which are used in the traditional histogram distances. We propose a bin ratio-based histogram distance (BRD), which is an intra-cross-bin distance, in contrast with previous bin-to-bin distances and cross-bin distances. The BRD is robust to partial matching and histogram normalization, and captures correlations between bins with only a linear computational complexity. We combine the BRD with the ℓ1 histogram distance and the χ(2) histogram distance to generate the ℓ1 BRD and the χ(2) BRD, respectively. These combinations exploit and benefit from the robustness of the BRD under partial matching and the robustness of the ℓ1 and χ(2) distances to small noise. We propose a method for assessing the robustness of histogram distances to partial matching. The BRDs and logistic regression-based histogram fusion are applied to image classification. The experimental results on synthetic data sets show the robustness of the BRDs to partial matching, and the experiments on seven benchmark data sets demonstrate promising results of the BRDs for image classification.

Abnormalities of P300 cortical current density in unmedicated depressed patients revealed by LORETA analysis of event-related potentials.

PubMed

Kawasaki, Toshihiko; Tanaka, Shin; Wang, Jijun; Hokama, Hiroto; Hiramatsu, Kenichi

2004-02-01

The purpose of the present study was to investigate the neural substrates underlying event-related potential (ERP) abnormalities, with respect to the generators of the ERP components in depressed patients. Using an oddball paradigm, ERP from auditory stimuli were recorded from 22 unmedicated patients with current depressive episodes and compared with those from 22 age- and gender-matched normal controls. Cortical current densities of the N100 and P300 components were analyzed using low-resolution electromagnetic tomography (LORETA). Group differences in cortical current density were mapped on a 3-D cortex model. The results revealed that N100 cortical current densities did not differ between the two groups, while P300 cortical current densities were significantly lower in depressed patients over the bilateral temporal lobes, the left frontal region, and the right temporal-parietal area. Furthermore, the cortical area in which the group difference in P300 current density had been identified was remarkably larger over the right than the left hemisphere, thus supporting the hypothesis of right hemisphere dysfunction in depression.

Complexity analysis of brain activity in attention-deficit/hyperactivity disorder: A multiscale entropy analysis.

PubMed

Chenxi, Li; Chen, Yanni; Li, Youjun; Wang, Jue; Liu, Tian

2016-06-01

The multiscale entropy (MSE) is a novel method for quantifying the intrinsic dynamical complexity of physiological systems over several scales. To evaluate this method as a promising way to explore the neural mechanisms in ADHD, we calculated the MSE in EEG activity during the designed task. EEG data were collected from 13 outpatient boys with a confirmed diagnosis of ADHD and 13 age- and gender-matched normal control children during their doing multi-source interference task (MSIT). We estimated the MSE by calculating the sample entropy values of delta, theta, alpha and beta frequency bands over twenty time scales using coarse-grained procedure. The results showed increased complexity of EEG data in delta and theta frequency bands and decreased complexity in alpha frequency bands in ADHD children. The findings of this study revealed aberrant neural connectivity of kids with ADHD during interference task. The results showed that MSE method may be a new index to identify and understand the neural mechanism of ADHD. Copyright © 2016 Elsevier Inc. All rights reserved.

Speech production in experienced cochlear implant users undergoing short-term auditory deprivation

NASA Astrophysics Data System (ADS)

Greenman, Geoffrey; Tjaden, Kris; Kozak, Alexa T.

2005-09-01

This study examined the effect of short-term auditory deprivation on the speech production of five postlingually deafened women, all of whom were experienced cochlear implant users. Each cochlear implant user, as well as age and gender matched control speakers, produced CVC target words embedded in a reading passage. Speech samples for the deafened adults were collected on two separate occasions. First, the speakers were recorded after wearing their speech processor consistently for at least two to three hours prior to recording (implant ``ON''). The second recording occurred when the speakers had their speech processors turned off for approximately ten to twelve hours prior to recording (implant ``OFF''). Acoustic measures, including fundamental frequency (F0), the first (F1) and second (F2) formants of the vowels, vowel space area, vowel duration, spectral moments of the consonants, as well as utterance duration and sound pressure level (SPL) across the entire utterance were analyzed in both speaking conditions. For each implant speaker, acoustic measures will be compared across implant ``ON'' and implant ``OFF'' speaking conditions, and will also be compared to data obtained from normal hearing speakers.

Fragile X syndrome: panoramic radiographic evaluation of dental anomalies, dental mineralization stage, and mandibular angle.

PubMed

Sabbagh-Haddad, Aida; Haddad, Denise Sabbagh; Michel-Crosato, Edgard; Arita, Emiko Saito

2016-01-01

The purpose of this study was to evaluate the dental radiographic characteristics as described in 40 records of patients with panoramic radiography. The patients were in the range of 6-17 years old, and were divided into two groups (20 subjects who were compatible with the normality standard and 20 individuals diagnosed with the FXS), which were matched for gender and age. Analysis of the panoramic radiographic examination involved the evaluation of dental mineralization stage, mandibular angle size, and presence of dental anomalies in both deciduous and permanent dentitions. The results of radiographic evaluation demonstrated that the chronology of tooth eruption of all third and second lower molars is anticipated in individuals with FXS (p<0.05). In this group, supernumerary deciduous teeth (2.83%), giroversion of permanent teeth (2.31%), and partial anodontia (1.82%) were the most frequent dental anomalies. In addition, an increase was observed in the mandibular angle size in the FXS group (p<0.05). We conclude that knowledge of dental radiographic changes is of great importance for dental surgeons to plan the treatment of these individuals.

Dyslipidaemia in woman with polycystic ovarian syndrome: a case control study in tertiary care hospital of Karachi.

PubMed

Hussain, Amna; Alam, Junaid Mahmood

2014-09-01

To compare lipid profile in lean and obese women with polycystic ovary syndrome with normal weight and obese controls. The case-control study was conducted at the Department of Chemical Pathology, Liaquat National Hospital, Karachi, from March 2006 to April 2007. It comprised 50 cases of polycystic ovary syndrome along with 50 healthy controls matching for age, gender and weight. SPSS 14 was used for statistical analysis. The mean fasting levels of triglyceride and Low density lipoprotein cholesterol were considerably higher in women with polycystic ovary syndrome than those in the control group (p < 0.05), while high-density lipoprotein cholesterolwas significantly low in patients than the controls (p <0.001). Obese patients had high triglyceride value (p < 0.05). There was significant interaction between polycystic ovary syndrome, obesity and triglyceride levels (p < 0.05). Polycystic ovary syndrome is associated with a more pronounced atherogenic lipid profile. Lipid parameters were adversely affected in a subgroup that was obese. As such, women with polycystic ovary syndrome are at high risk of developing cardiovascular disease due to the presence of dyslipidaemia.

Sleep and circadian rhythm disruption in schizophrenia†

PubMed Central

Wulff, Katharina; Dijk, Derk-Jan; Middleton, Benita; Foster, Russell G.; Joyce, Eileen M.

2012-01-01

Background Sleep disturbances comparable with insomnia occur in up to 80% of people with schizophrenia, but very little is known about the contribution of circadian coordination to these prevalent disruptions. Aims A systematic exploration of circadian time patterns in individuals with schizophrenia with recurrent sleep disruption. Method We examined the relationship between sleep-wake activity, recorded actigraphically over 6 weeks, along with ambient light exposure and simultaneous circadian clock timing, by collecting weekly 48 h profiles of a urinary metabolite of melatonin in 20 out-patients with schizophrenia and 21 healthy control individuals matched for age, gender and being unemployed. Results Significant sleep/circadian disruption occurred in all the participants with schizophrenia. Half these individuals showed severe circadian misalignment ranging from phase-advance/delay to non-24 h periods in sleep-wake and melatonin cycles, and the other half showed patterns from excessive sleep to highly irregular and fragmented sleep epochs but with normally timed melatonin production. Conclusions Severe circadian sleep/wake disruptions exist despite stability in mood, mental state and newer antipsychotic treatment. They cannot be explained by the individuals' level of everyday function. PMID:22194182

Lack of Gender Influence on Cortical and Subcortical Gray Matter Development in Childhood-Onset Schizophrenia

PubMed Central

Weisinger, Brian; Greenstein, Deanna; Mattai, Anand; Clasen, Liv; Lalonde, Francois; Feldman, Sara; Miller, Rachel; Tossell, Julia W.; Vyas, Nora S.; Stidd, Reva; David, Christopher; Gogtay, Nitin

2013-01-01

Background: Progressive cortical gray matter (GM) abnormalities are an established feature of schizophrenia and are more pronounced in rare, severe, and treatment refractory childhood-onset schizophrenia (COS) cases. The effect of sex on brain development in schizophrenia is poorly understood and studies to date have produced inconsistent results. >Methods: Using the largest to date longitudinal sample of COS cases (n = 104, scans = 249, Male/Female [M/F] = 57/47), we compared COS sex differences with sex differences in a sample of matched typically developing children (n = 104, scans = 244, M/F = 57/47), to determine whether or not sex had differential effects on cortical and subcortical brain development in COS. Results: Our results showed no significant differential sex effects in COS for either GM cortical thickness or subcortical volume development (sex × diagnosis × age interaction; false discovery rate q = 0.05). Conclusion: Sex appears to play a similar role in cortical and subcortical GM development in COS as it does in normally developing children. PMID:21613381

Auditory processing deficits in individuals with primary open-angle glaucoma.

PubMed

Rance, Gary; O'Hare, Fleur; O'Leary, Stephen; Starr, Arnold; Ly, Anna; Cheng, Belinda; Tomlin, Dani; Graydon, Kelley; Chisari, Donella; Trounce, Ian; Crowston, Jonathan

2012-01-01

The high energy demand of the auditory and visual pathways render these sensory systems prone to diseases that impair mitochondrial function. Primary open-angle glaucoma, a neurodegenerative disease of the optic nerve, has recently been associated with a spectrum of mitochondrial abnormalities. This study sought to investigate auditory processing in individuals with open-angle glaucoma. DESIGN/STUDY SAMPLE: Twenty-seven subjects with open-angle glaucoma underwent electrophysiologic (auditory brainstem response), auditory temporal processing (amplitude modulation detection), and speech perception (monosyllabic words in quiet and background noise) assessment in each ear. A cohort of age, gender and hearing level matched control subjects was also tested. While the majority of glaucoma subjects in this study demonstrated normal auditory function, there were a significant number (6/27 subjects, 22%) who showed abnormal auditory brainstem responses and impaired auditory perception in one or both ears. The finding that a significant proportion of subjects with open-angle glaucoma presented with auditory dysfunction provides evidence of systemic neuronal susceptibility. Affected individuals may suffer significant communication difficulties in everyday listening situations.

Do patients with amyotrophic lateral sclerosis (ALS) have increased energy needs?

PubMed

Vaisman, Nachum; Lusaus, Michal; Nefussy, Beatrice; Niv, Eva; Comaneshter, Doron; Hallack, Ron; Drory, Vivian E

2009-04-15

Nutritional status is a prognostic factor for survival in amyotrophic lateral sclerosis (ALS) patients. We investigated the contribution of some of the components contributing to resting energy expenditure (REE) in order to determine whether potentially higher energy needs should be considered for these patients. Thirty three ALS patients and 33 age- and gender-matched healthy controls participated. REE was measured by an open-circuit indirect calorimeter, body composition by dual energy X-ray absorptiometry, and estimated caloric intake by 7-day food records. Patients had lower body mass indices and lower lean body mass (LBM) than healthy controls. REE values (as a percentage of predicted) was similar but increased when normalized by LBM (P<0.001). LBM and REE decreased while REE/LBM increased in ten patients who were reassessed 6 months later. A model for predicting measured REE was constructed based on the different components, with 86% prediction of its variability. ALS is associated with increased REE. Various factors, such as poor caloric intake and mechanical ventilation, may mask this tendency. All the above parameters need to be considered during nutritional intervention to prevent additional muscle loss.

Increase of Reproductive Life Span Delays Age of Onset of Parkinson’s Disease

PubMed Central

Frentzel, Dominik; Judanin, Grigorij; Borozdina, Olga; Klucken, Jochen; Winkler, Jürgen; Schlachetzki, Johannes C. M.

2017-01-01

One striking observation in Parkinson’s disease (PD) is the remarkable gender difference in incidence and prevalence of the disease. Data on gender differences with regard to disease onset, motor and non-motor symptoms, and dopaminergic medication are limited. Furthermore, whether estrogen status affects disease onset and progression of PD is controversially discussed. In this retrospective single center study, we extracted clinical data of 226 ambulatory PD patients and compared age of disease onset, disease stage, motor impairment, non-motor symptoms, and dopaminergic medication between genders. We applied a matched-pairs design to adjust for age and disease duration. To determine the effect of estrogen-related reproductive factors including number of children, age at menarche, and menopause on the age of onset, we applied a standardized questionnaire and performed a regression analysis. The male to female ratio in the present PD cohort was 1.9:1 (147 men vs. 79 women). Male patients showed increased motor impairment than female patients. The levodopa equivalent daily dose was increased by 18.9% in male patients compared to female patients. Matched-pairs analysis confirmed the increased dose of dopaminergic medication in male patients. No differences were observed in age of onset, type of medication, and non-motor symptoms between both groups. Female reproductive factors including number of children, age at menarche, and age at menopause were positively associated with a delay of disease onset up to 30 months. The disease-modifying role of estrogen-related outcome measures warrants further clinical and experimental studies targeting gender differences, specifically hormone-dependent pathways in PD. PMID:28871235

Mental Health of Transgender and Gender Nonconforming Youth Compared With Their Peers.

PubMed

Becerra-Culqui, Tracy A; Liu, Yuan; Nash, Rebecca; Cromwell, Lee; Flanders, W Dana; Getahun, Darios; Giammattei, Shawn V; Hunkeler, Enid M; Lash, Timothy L; Millman, Andrea; Quinn, Virginia P; Robinson, Brandi; Roblin, Douglas; Sandberg, David E; Silverberg, Michael J; Tangpricha, Vin; Goodman, Michael

2018-05-01

Understanding the magnitude of mental health problems, particularly life-threatening ones, experienced by transgender and/or gender nonconforming (TGNC) youth can lead to improved management of these conditions. Electronic medical records were used to identify a cohort of 588 transfeminine and 745 transmasculine children (3-9 years old) and adolescents (10-17 years old) enrolled in integrated health care systems in California and Georgia. Ten male and 10 female referent cisgender enrollees were matched to each TGNC individual on year of birth, race and/or ethnicity, study site, and membership year of the index date (first evidence of gender nonconforming status). Prevalence ratios were calculated by dividing the proportion of TGNC individuals with a specific mental health diagnosis or diagnostic category by the corresponding proportion in each reference group by transfeminine and/or transmasculine status, age group, and time period before the index date. Common diagnoses for children and adolescents were attention deficit disorders (transfeminine 15%; transmasculine 16%) and depressive disorders (transfeminine 49%; transmasculine 62%), respectively. For all diagnostic categories, prevalence was severalfold higher among TGNC youth than in matched reference groups. Prevalence ratios (95% confidence intervals [CIs]) for history of self-inflicted injury in adolescents 6 months before the index date ranged from 18 (95% CI 4.4-82) to 144 (95% CI 36-1248). The corresponding range for suicidal ideation was 25 (95% CI 14-45) to 54 (95% CI 18-218). TGNC youth may present with mental health conditions requiring immediate evaluation and implementation of clinical, social, and educational gender identity support measures. Copyright © 2018 by the American Academy of Pediatrics.

Handling of induced hypercalcaemia in hyperthyroidism

PubMed Central

Lim, P.; Jacob, E.; Khoo, O. T.

1969-01-01

The mean serum calcium of 13 hyperthyroid patients was found to be significantly higher than that of controls matched for sex and age, though none of the patients' values were outside the normal range. Nevertheless, these patients responded very promptly to hypercalcaemia (induced by an intravenous calcium load), and their serum calcium returned to normal much more rapidly compared with the matched controls. There was also increased retention of intravenous calcium load, possibly owing to increased calcitonin production. Calcium infusion may be useful in treating bone diseases in which increased bone resorption exceeds bone accretion. PMID:5354875

Gents, Jerks, and Jocks: What Male Students Learn about Masculinity in College

ERIC Educational Resources Information Center

Harris, Frank, III; Struve, Laura E.

2009-01-01

The academy plays a significant role in male students' experience of gender. In this article, the authors explore how educators can effectively support healthy and productive gender identity development among college men. Their goal is to provide insight into how campus cultures convey and reinforce lessons about what constitutes "normal"…

Matching motivation enhancement treatment to client motivation: re-examining the Project MATCH motivation matching hypothesis.

PubMed

Witkiewitz, Katie; Hartzler, Bryan; Donovan, Dennis

2010-08-01

The current study was designed to re-examine the motivation matching hypothesis from Project MATCH using growth mixture modeling, an analytical technique that models variation in individual drinking patterns. Secondary data analyses of data from Project MATCH (n = 1726), a large multi-site alcoholism treatment-matching study. Percentage of drinking days was the primary outcome measure, assessed from 1 month to 12 months following treatment. Treatment assignment, alcohol dependence symptoms and baseline percentage of drinking days were included as covariates. The results provided support for the motivation matching hypothesis in the out-patient sample and among females in the aftercare sample: the majority of individuals with lower baseline motivation had better outcomes if assigned to motivation enhancement treatment (MET) compared to those assigned to cognitive behavioral treatment (CBT). In the aftercare sample there was a moderating effect of gender and alcohol dependence severity, whereby males with lower baseline motivation and greater alcohol dependence drank more frequently if assigned to MET compared to those assigned to CBT. Results from the current study lend partial support to the motivation-matching hypothesis and also demonstrated the importance of moderating influences on treatment matching effectiveness. Based upon these findings, individuals with low baseline motivation in out-patient settings and males with low levels of alcohol dependence or females in aftercare settings may benefit more from motivational enhancement techniques than from cognitive-behavioral techniques.

Small-worldness and gender differences of large scale brain metabolic covariance networks in young adults: a FDG PET study of 400 subjects.

PubMed

Hu, Yuxiao; Xu, Qiang; Shen, Junkang; Li, Kai; Zhu, Hong; Zhang, Zhiqiang; Lu, Guangming

2015-02-01

Many studies have demonstrated the small-worldness of the human brain, and have revealed a sexual dimorphism in brain network properties. However, little is known about the gender effects on the topological organization of the brain metabolic covariance networks. To investigate the small-worldness and the gender differences in the topological architectures of human brain metabolic networks. FDG-PET data of 400 healthy right-handed subjects (200 women and 200 age-matched men) were involved in the present study. Metabolic networks of each gender were constructed by calculating the covariance of regional cerebral glucose metabolism (rCMglc) across subjects on the basis of AAL parcellation. Gender differences of network and nodal properties were investigated by using the graph theoretical approaches. Moreover, the gender-related difference of rCMglc in each brain region was tested for investigating the relationships between the hub regions and the brain regions showing significant gender-related differences in rCMglc. We found prominent small-world properties in the domain of metabolic networks in each gender. No significant gender difference in the global characteristics was found. Gender differences of nodal characteristic were observed in a few brain regions. We also found bilateral and lateralized distributions of network hubs in the females and males. Furthermore, we first reported that some hubs of a gender located in the brain regions showing weaker rCMglc in this gender than the other gender. The present study demonstrated that small-worldness was existed in metabolic networks, and revealed gender differences of organizational patterns in metabolic network. These results maybe provided insights into the understanding of the metabolic substrates underlying individual differences in cognition and behaviors. © The Foundation Acta Radiologica 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Gender Development in Indonesian Children, Adolescents, and Adults with Disorders of Sex Development.

PubMed

Ediati, Annastasia; Juniarto, Achmad Zulfa; Birnie, Erwin; Drop, Stenvert L S; Faradz, Sultana M H; Dessens, Arianne B

2015-07-01

In most Western countries, clinical management of disorders of sex development (DSD), including ambiguous genitalia, begins at diagnosis soon after birth. For many Indonesian patients born with ambiguous genitalia, limited medical treatment is available. Consequently, affected individuals are raised with ambiguous genitalia and atypical secondary sex characteristics. We investigated gender identity and gender role behavior in 118 Indonesian subjects (77 males, 41 females) with different types of DSD in comparison with 118 healthy controls matched for gender, age, and residential setting (rural, suburban, or urban). In Study 1, we report on methodological aspects of the investigation, including scale adaptation, pilot testing, and determining reliability and validity of measures. In Study 2, we report on gender development in 60 children (42 boys, 18 girls), 24 adolescents (15 boys, 9 girls), and 34 adults (19 men, 15 women) with DSD. The majority of participants with DSD never received any medical or surgical treatment prior to this study. We observed a gender change in all age groups, with the greatest incidence in adults. Among patients who changed, most changed from female to male, possessed a 46,XY karyotype, and had experienced significant masculinization during life. Gender identity confusion and cross-gender behavior was more frequently observed in children with DSD raised as girls compared to boys. Puberty and associated masculinization were related to gender problems in individuals with 46,XY DSD raised female. An integrated clinical and psychological follow-up on gender outcome is necessary prior to puberty and adulthood.

Ideologies of self, suffering, and gender nonconformity at work in a US gender identity clinic.

PubMed

van Eijk, Marieke

2014-01-01

Health care institutions are often severely criticized for regulating the lives of individuals who deviate from socially sanctioned norms. In teaching people where they fit in the conventional scheme of things, institutions often reproduce socially dominant ideologies of normality, health, and self. Drawing on ethnographic fieldwork conducted at a university-based gender identity clinic in the United States, I demonstrate that while some institutions adopt dominant cultural frameworks, others critically assess these. To understand the intricacies of the clinic's psychotherapeutic practices, I analyze the clinicians' constructions of health and suffering. Instead of viewing transgenderism as a psychiatric condition, these clinicians approach it as a normal human condition that is marginalized by society's heteronormative values. The analysis, attentive to the interaction among social context, institutional work, and psychotherapeutic ideologies, shows that while some institutions reproduce hegemonic cultural frameworks, others, in their attempts to alleviate people's suffering, do challenge dominant social norms.

Effect of age and gender on sudomotor and cardiovagal function and blood pressure response to tilt in normal subjects

NASA Technical Reports Server (NTRS)

Low, P. A.; Denq, J. C.; Opfer-Gehrking, T. L.; Dyck, P. J.; O'Brien, P. C.; Slezak, J. M.

1997-01-01

Normative data are limited on autonomic function tests, especially beyond age 60 years. We therefore evaluated these tests in a total of 557 normal subjects evenly distributed by age and gender from 10 to 83 years. Heart rate (HR) response to deep breathing fell with increasing age. Valsalva ratio varied with both age and gender. QSART (quantitative sudomotor axon-reflex test) volume was consistently greater in men (approximately double) and progressively declined with age for all three lower extremity sites but not the forearm site. Orthostatic blood pressure reduction was greater with increasing age. HR at rest was significantly higher in women, and the increment with head-up tilt fell with increasing age. For no tests did we find a regression to zero, and some tests seem to level off with increasing age, indicating that diagnosis of autonomic failure was possible to over 80 years of age.

Variable corneal compensation improves discrimination between normal and glaucomatous eyes with the scanning laser polarimeter.

PubMed

Tannenbaum, Dana P; Hoffman, Douglas; Lemij, Hans G; Garway-Heath, David F; Greenfield, David S; Caprioli, Joseph

2004-02-01

The presently available scanning laser polarimeter (SLP) has a fixed corneal compensator (FCC) that neutralizes corneal birefringence only in eyes with birefringence that matches the population mode. A prototype variable corneal compensator (VCC) provides neutralization of individual corneal birefringence based on individual macular retardation patterns. The aim of this study was to evaluate the relative ability of the SLP with the FCC and with the VCC to discriminate between normal and glaucomatous eyes. Prospective, nonrandomized, comparative case series. Algorithm-generating set consisting of 56 normal eyes and 55 glaucomatous eyes and an independent data set consisting of 83 normal eyes and 56 glaucomatous eyes. Sixteen retardation measurements were obtained with the SLP with the FCC and the VCC from all subjects. Dependency of parameters on age, gender, ethnic origin, and eye side was sought. Logistic regression was used to evaluate how well the various parameters could detect glaucoma. Discriminant functions were generated, and the area under the receiver operating characteristic (ROC) curve was determined. Discrimination between normal and glaucomatous eyes on the basis of single parameters was significantly better with the VCC than with the FCC for 6 retardation parameters: nasal average (P = 0.0003), superior maximum (P = 0.0003), ellipse average (P = 0.002), average thickness (P = 0.003), superior average (P = 0.010), and inferior average (P = 0.010). Discriminant analysis identified the optimal combination of parameters for the FCC and for the VCC. When the discriminant functions were applied to the independent data set, areas under the ROC curve were 0.84 for the FCC and 0.90 for the VCC (P<0.021). When the discriminant functions were applied to a subset of patients with early visual field loss, areas under the ROC curve were 0.82 for the FCC and 0.90 for the VCC (P<0.016). Individual correction for corneal birefringence with the VCC significantly improved the ability of the SLP to distinguish between normal and glaucomatous eyes and enabled detection of patients with early glaucoma.

The presence of African American race predicts improvement in coronary endothelial function after supplementary L-arginine.

PubMed

Houghton, Jan L; Philbin, Edward F; Strogatz, David S; Torosoff, Mikhail T; Fein, Steven A; Kuhner, Patricia A; Smith, Vivienne E; Carr, Albert A

2002-04-17

The purpose of our study was to determine if the presence of African American ethnicity modulates improvement in coronary vascular endothelial function after supplementary L-arginine. Endothelial dysfunction is an early stage in the development of coronary atherosclerosis and has been implicated in the pathogenesis of hypertension and cardiomyopathy. Amelioration of endothelial dysfunction has been demonstrated in patients with established coronary atherosclerosis or with risk factors in response to infusion of L-arginine, the precursor of nitric oxide. Racial and gender patterns in L-arginine responsiveness have not, heretofore, been studied. Invasive testing of coronary artery and microvascular reactivity in response to graded intracoronary infusions of acetylcholine (ACh) +/- L-arginine was carried out in 33 matched pairs of African American and white subjects with no angiographic coronary artery disease. Pairs were matched for age, gender, indexed left ventricular mass, body mass index and low-density lipoprotein cholesterol. In addition to the matching parameters, there were no significant differences in peak coronary blood flow (CBF) response to intracoronary adenosine or in the peak CBF response to ACh before L-arginine infusion. However, absolute percentile improvement in CBF response to ACh infusion after L-arginine, as compared with before, was significantly greater among African Americans as a group (45 +/- 10% vs. 4 +/- 6%, p = 0.0016) and after partitioning by gender. The mechanism of this increase was mediated through further reduction in coronary microvascular resistance. L-arginine infusion also resulted in greater epicardial dilator response after ACh among African Americans. We conclude that intracoronary infusion of L-arginine provides significantly greater augmentation of endothelium-dependent vascular relaxation in those of African American ethnicity when compared with matched white subjects drawn from a cohort electively referred for coronary angiography. Our findings suggest that there are target populations in which supplementary L-arginine may be of therapeutic benefit in the amelioration of microvascular endothelial dysfunction. In view of the excess prevalence of cardiomyopathy among African Americans, pharmacologic correction of microcirculatory endothelial dysfunction in this group is an important area of further investigation and may ultimately prove to be clinically indicated.

Longitudinal Lung Function Decrease in Subjects with Spontaneous Healed Pulmonary Tuberculosis.

PubMed

Lee, Seung Heon; Kwon, Amy M; Yang, Hae-Chung; Lee, Seung Ku; Kim, Young; Choi, Jong Hyun; Kim, Je Hyeong; Shin, Chol

2016-01-01

We compared the longitudinal course of post-bronchodilator Forced Expiratory Volume in 1 second (pFEV1) over a 10-year period in subjects with spontaneous healed pulmonary tuberculosis (SHPTB) with that in normal subjects. We prospectively investigated 339 subjects with SHPTB and 3211 normal subjects. pFEV1 values measured biannually over 10 years were analyzed using mixed effects model. At baseline, there were no differences in gender, smoking amount, and mean height, except mean age (50.0 ± 8.1 VS. 48.1 ± 7.3, P< 0.001) between the SHPTB and normal group. 52% of the 339 participants with SHPTB and 56% of the 3211 normal participants participated till the end of study. According to the final model, the SHPTB group showed significantly larger decrease in the average pFEV1 over the time than the normal group (P< 0.001) adjusted for gender, age, height, smoking pack years, and time effects. Especially, the interaction effect between time and group was statistically significant (P = 0.036). The average lung function in terms of pFEV1 decreases faster in subjects with SHPTB than in normal individuals over time.

The interrelations between verbal working memory and visual selection of emotional faces.

PubMed

Grecucci, Alessandro; Soto, David; Rumiati, Raffaella Ida; Humphreys, Glyn W; Rotshtein, Pia

2010-06-01

Working memory (WM) and visual selection processes interact in a reciprocal fashion based on overlapping representations abstracted from the physical characteristics of stimuli. Here, we assessed the neural basis of this interaction using facial expressions that conveyed emotion information. Participants memorized an emotional word for a later recognition test and then searched for a face of a particular gender presented in a display with two faces that differed in gender and expression. The relation between the emotional word and the expressions of the target and distractor faces was varied. RTs for the memory test were faster when the target face matched the emotional word held in WM (on valid trials) relative to when the emotional word matched the expression of the distractor (on invalid trials). There was also enhanced activation on valid compared with invalid trials in the lateral orbital gyrus, superior frontal polar (BA 10), lateral occipital sulcus, and pulvinar. Re-presentation of the WM stimulus in the search display led to an earlier onset of activity in the superior and inferior frontal gyri and the anterior hippocampus irrespective of the search validity of the re-presented stimulus. The data indicate that the middle temporal and prefrontal cortices are sensitive to the reappearance of stimuli that are held in WM, whereas a fronto-thalamic occipital network is sensitive to the behavioral significance of the match between WM and targets for selection. We conclude that these networks are modulated by high-level matches between the contents of WM, behavioral goals, and current sensory input.

Effects of expertise on football betting.

PubMed

Khazaal, Yasser; Chatton, Anne; Billieux, Joël; Bizzini, Lucio; Monney, Grégoire; Fresard, Emmanuelle; Thorens, Gabriel; Bondolfi, Guido; El-Guebaly, Nady; Zullino, Daniele; Khan, Riaz

2012-05-11

Football (soccer) is one of the most popular sports in the world, including Europe. It is associated with important betting activities. A common belief, widely spread among those who participate in gambling activities, is that knowledge and expertise on football lead to better prediction skills for match outcomes. If unfounded, however, this belief should be considered as a form of "illusion of control." The aim of this study was to examine whether football experts are better than nonexperts at predicting football match scores. Two hundred and fifty-eight persons took part in the study: 21.3% as football experts, 54.3% as laypersons (non-initiated to football), and 24.4% as football amateurs. They predicted the scores of the first 10 matches of the 2008 UEFA European Football Championship. Logistic regressions were carried out to assess the link between the accuracy of the forecasted scores and the expertise of the participants (expert, amateur, layperson), controlling for age and gender. The variables assessed did not predict the accuracy of scoring prognosis (R2 ranged from 1% to 6%). Expertise, age, and gender did not appear to have an impact on the accuracy of the football match prognoses. Therefore, the belief that football expertise improves betting skills is no more than a cognitive distortion called the "illusion of control." Gamblers may benefit from psychological interventions that target the illusion of control related to their believed links between betting skills and football expertise. Public health policies may need to consider the phenomenon in order to prevent problem gambling related to football betting.

Linguistic Deterioration in Alzheimer's Senile Dementia and in Normal Aging.

ERIC Educational Resources Information Center

Emery, Olga Beattie

A study of language patterning as an indicator of higher cortical process focused on three matched comparison groups: normal pre-middle-aged, normal elderly, and elderly adults with senile dementia Alzheimer's type. In addition to tests of memory, level of cognitive function, and organic deficit, the formal aspects of language were analyzed in…

Spatial release of cognitive load measured in a dual-task paradigm in normal-hearing and hearing-impaired listeners.

PubMed

Xia, Jing; Nooraei, Nazanin; Kalluri, Sridhar; Edwards, Brent

2015-04-01

This study investigated whether spatial separation between talkers helps reduce cognitive processing load, and how hearing impairment interacts with the cognitive load of individuals listening in multi-talker environments. A dual-task paradigm was used in which performance on a secondary task (visual tracking) served as a measure of the cognitive load imposed by a speech recognition task. Visual tracking performance was measured under four conditions in which the target and the interferers were distinguished by (1) gender and spatial location, (2) gender only, (3) spatial location only, and (4) neither gender nor spatial location. Results showed that when gender cues were available, a 15° spatial separation between talkers reduced the cognitive load of listening even though it did not provide further improvement in speech recognition (Experiment I). Compared to normal-hearing listeners, large individual variability in spatial release of cognitive load was observed among hearing-impaired listeners. Cognitive load was lower when talkers were spatially separated by 60° than when talkers were of different genders, even though speech recognition was comparable in these two conditions (Experiment II). These results suggest that a measure of cognitive load might provide valuable insight into the benefit of spatial cues in multi-talker environments.

Tachykinin NK2 receptor and functional mechanisms in human colon: changes with indomethacin and in diverticular disease and ulcerative colitis.

PubMed

Burcher, Elizabeth; Shang, Fei; Warner, Fiona J; Du, Qin; Lubowski, David Z; King, Denis W; Liu, Lu

2008-01-01

Neurokinin A (NKA) is an important spasmogen in human colon. We examined inflammatory disease-related changes in the tachykinin NK(2) receptor system in human sigmoid colon circular muscle, using functional, radioligand binding, and quantitative reverse transcription-polymerase chain reaction methods. In circular muscle strips, indomethacin enhanced contractile responses to NKA (p < 0.01) and to the NK(2) receptor-selective agonist [Lys(5),MeLeu(9),Nle(10)]-NKA(4-10) (p < 0.05) in both normal and acute diverticular disease (DD) specimens, indicating NK(2) receptor-mediated release of relaxant prostanoids. Contractile responses to both tachykinins were reduced in strips from DD (p < 0.001) and ulcerative colitis (UC) (p < 0.05) specimens. Responses to acetylcholine were no different in other strips from the same disease patients, demonstrating that the change in responsiveness to tachykinins in disease is specifically mediated by the NK(2) receptor. In membranes from UC specimens, receptor affinity for (125)I-NKA (median K(D) 0.91 nM, n = 16) was lower (p < 0.01) than that in age-matched control specimens (K(D) 0.55 nM, n = 40), whereas K(D) (0.65 nM, n = 28) in DD was no different from control. No disease-related changes in receptor number (B(max)) were found (mean, 2.0-2.5 fmol/mg of wet weight tissue), suggesting that the reduced contractile responses in disease are not due to a loss of receptor number. Different mechanisms may account for the reduced contractility in DD compared with UC. A gender-related difference in receptor density was seen in controls, with B(max) lower in females (1.77 fmol/mg, n = 15) than in males (2.60 fmol/mg, n = 25, p = 0.01). In contrast, no gender-related differences were seen in NK(2) receptor mRNA in control colonic muscle, indicating that the gender difference is a post-translational event.

Gender-Specific Jealousy and Infidelity Norms as Sources of Sexual Health Risk and Violence Among Young Coupled Nicaraguans.

PubMed

Boyce, Sabrina; Zeledón, Perla; Tellez, Ever; Barrington, Clare

2016-04-01

Gender inequity negatively affects health in Central America. In 2011, we conducted 60 semistructured interviews and 12 photovoice focus groups with young coupled men and women in León, Nicaragua, to explore the ways in which social norms around marriage and gender affect sexual health and gender-based violence. Participants' depictions of their experiences revealed gendered norms around infidelity that provided a narrative to justify male expressions of jealousy, which included limiting partner autonomy, sexual coercion, and physical violence against women, and resulted in increased women's risk of sexually transmitted infections, including HIV. By understanding and taking account of these different narratives and normalized beliefs in developing health- and gender-based violence interventions, such programs might be more effective in promoting gender-equitable attitudes and behaviors among young men and women in Nicaragua.

Gender-Specific Jealousy and Infidelity Norms as Sources of Sexual Health Risk and Violence Among Young Coupled Nicaraguans

PubMed Central

Zeledón, Perla; Tellez, Ever; Barrington, Clare

2016-01-01

Gender inequity negatively affects health in Central America. In 2011, we conducted 60 semistructured interviews and 12 photovoice focus groups with young coupled men and women in León, Nicaragua, to explore the ways in which social norms around marriage and gender affect sexual health and gender-based violence. Participants’ depictions of their experiences revealed gendered norms around infidelity that provided a narrative to justify male expressions of jealousy, which included limiting partner autonomy, sexual coercion, and physical violence against women, and resulted in increased women’s risk of sexually transmitted infections, including HIV. By understanding and taking account of these different narratives and normalized beliefs in developing health- and gender-based violence interventions, such programs might be more effective in promoting gender-equitable attitudes and behaviors among young men and women in Nicaragua. PMID:26890184

Beyond Gender Stereotypes in Language Comprehension: Self Sex-Role Descriptions Affect the Brain’s Potentials Associated with Agreement Processing

PubMed Central

Canal, Paolo; Garnham, Alan; Oakhill, Jane

2015-01-01

We recorded Event-Related Potentials to investigate differences in the use of gender information during the processing of reflexive pronouns. Pronouns either matched the gender provided by role nouns (such as “king” or “engineer”) or did not. We compared two types of gender information, definitional information, which is semantic in nature (a mother is female), or stereotypical (a nurse is likely to be female). When they followed definitional role-nouns, gender-mismatching pronouns elicited a P600 effect reflecting a failure in the agreement process. When instead the gender violation occurred after stereotypical role-nouns the Event Related Potential response was biphasic, being positive in parietal electrodes and negative in anterior left electrodes. The use of a correlational approach showed that those participants with more “feminine” or “expressive” self sex-role descriptions showed a P600 response for stereotype violations, suggesting that they experienced the mismatch as an agreement violation; whereas less “expressive” participants showed an Nref effect, indicating more effort spent in linking the pronouns with the possible, although less likely, counter-stereotypical referent. PMID:26779046

Gender-dependence of bone structure and properties in adult osteogenesis imperfecta murine model.

PubMed

Yao, Xiaomei; Carleton, Stephanie M; Kettle, Arin D; Melander, Jennifer; Phillips, Charlotte L; Wang, Yong

2013-06-01

Osteogenesis imperfecta (OI) is a dominant skeletal disorder characterized by bone fragility and deformities. Though the oim mouse model has been the most widely studied of the OI models, it has only recently been suggested to exhibit gender-dependent differences in bone mineralization. To characterize the impact of gender on the morphometry/ultra-structure, mechanical properties, and biochemical composition of oim bone on the congenic C57BL/J6 background, 4-month-old oim/oim, +/oim, and wild-type (wt) female and male tibiae were evaluated using micro-computed tomography, three-point bending, and Raman spectroscopy. Dramatic gender differences were evident in both cortical and trabecular bone morphological and geometric parameters. Male mice had inherently more bone and increased moment of inertia than genotype-matched female counterparts with corresponding increases in bone biomechanical strength. The primary influence of gender was structure/geometry in bone growth and mechanical properties, whereas the mineral/matrix composition and hydroxyproline content of bone were influenced primarily by the oim collagen mutation. This study provides evidence of the importance of gender in the evaluation and interpretation of potential therapeutic strategies when using mouse models of OI.

Gender-dependence of bone structure and properties in adult osteogenesis imperfecta murine model

PubMed Central

Yao, Xiaomei; Carleton, Stephanie M.; Kettle, Arin D; Melander, Jennifer; Phillips, Charlotte L.; Wang, Yong

2013-01-01

Osteogenesis imperfecta (OI) is a dominant skeletal disorder characterized by bone fragility and deformities. Though the oim mouse model has been the most widely studied of the OI models, it has only recently been suggested to exhibit gender-dependent differences in bone mineralization. To characterize the impact of gender on the morphometry/ultra-structure, mechanical properties, and biochemical composition of oim bone on the congenic C57BL/J6 background, 4-month-old oim/oim, +/oim, and wild-type (wt) female and male tibiae were evaluated using micro-computed tomography, three-point bending, and Raman spectroscopy. Dramatic gender differences were evident in both cortical and trabecular bone morphological and geometric parameters. Male mice had inherently more bone and increased moment of inertia than genotype-matched female counterparts with corresponding increases in bone biomechanical strength. The primary influence of gender was structure/geometry in bone growth and mechanical properties, whereas the mineral/matrix composition, hydroxyproline content of bone were influenced primarily by the oim collagen mutation. This study provides evidence of the importance of gender in the evaluation and interpretation of potential therapeutic strategies when using mouse models of OI. PMID:23536112

Neuromuscular trunk activation patterns in back pain patients during one-handed lifting.

PubMed

Mueller, Juliane; Engel, Tilman; Kopinski, Stephan; Mayer, Frank; Mueller, Steffen

2017-02-18

To analyze neuromuscular activity patterns of the trunk in healthy controls (H) and back pain patients (BPP) during one-handed lifting of light to heavy loads. After assessment of back pain (graded chronic pain scale according to von Korff) all subjects ( n = 43) performed a warm-up (treadmill walking). Next, subjects were instructed to lift 3 × a 20 kg weight placed in front of them (with both hand) onto a table (height: 0.75 m). Subsequently, all subjects lifted with one hand (left-side, 3 repetitions) a weight of 1 kg (light), 10 kg (middle) and 20 kg (heavy) in random order from the ground up onto the table left of them. Trunk muscle activity was assessed with a 12-lead EMG (6 ventral/6 dorsal muscles; 4000 Hz). EMG-RMS (%) was averaged over the 3 repetitions and analyzed for the whole one-handed lifting cycle, then normalized to RMS of the two-handed lifting. Additionally, the mean (normalized) EMG-RMS of four trunk areas [right/left ventral area (VR/VL); right/left dorsal area (DR/DL)] was calculated. Data were analyzed descriptively (mean ± SD) followed by student's t -test comparing H and BPP (α = 0.05). With respect to the unequal distribution of subjects in H and BPP, a matched-group analysis was conducted. Seven healthy controls were gender- and age-matched (group H matched ) to the 7 BPP. In addition, task failure was calculated and compared between H/H matched vs BPP using χ 2 . Seven subjects (3m/4f; 32 ± 7 years; 171 ± 7 cm; 65 ± 11 kg) were assigned to BPP (pain grade ≥ 2) and 36 (13m/23f; 28 ± 8 years; 174 ± 10 cm; 71 ± 12 kg) to H (pain grade ≤ 1). H and BPP did not differ significantly in anthropometrics ( P > 0.05). All subjects were able to lift the light and middle loads, but 57% of BPP and 22% of H were not able to lift the heavy load (all women). χ 2 analysis revealed statistically significant differences in task failure between H vs BPP ( P = 0.03). EMG-RMS ranged from 33% ± 10%/30% ± 9% (DL, 1 kg) to 356% ± 148%/283% ± 80% (VR, 20 kg) in H/BPP with no statistical difference between groups regardless of load ( P > 0.05). However, the EMG-RMS of the VR was greatest in all lifting tasks for both groups and increased with heavier loads. Heavier loading leads to an increase (2- to 3-fold) in trunk muscle activity with comparable patterns. Heavy loading (20 kg) leads to task failure, especially in women with back pain.

Gender and practical skill performance in science

NASA Astrophysics Data System (ADS)

Lock, Roger

The performance of 18 boys and 18 girls on four problem-solving tasks set in science contexts was compared. The tasks were administered in a one-to-one testing situation and assessments were made by direct observation, questioning, and by using written records. The tasks were valid and reliable, and the samples of boys and girls were matched for ability and curriculum background. Past studies have identified gender differences in performance on science tasks; however, this study found little evidence to support these findings. Few significant differences in performance were found. No gender differences were detected in observation, reporting, or planning skills, and there was no differential performance on the use of scientific language. Girls performed less well in relation to self-reliance, and performance differences on the interpretation skill approached significance with boys' performance superior.

Implementing feminist theory in engineering: obstacles within the gender studies tradition

NASA Astrophysics Data System (ADS)

Udén, Maria K.

2017-05-01

Scholars have noted that there is hesitation to utilise findings from gender studies in engineering education. Issues within gender studies may be part of the matching problem. Debates concerning two concepts for new engineering paradigms are investigated: care and heterogeneity. Their appeals and the respective complications which they tend to be associated with are revisited. Two examples are explored in detail. The tensions revealed lead to the contents of technical work. More social sciences content in engineering education is sometimes suggested, as a way to support more humane approaches. But, if the calculations that decide how many bolts of what dimension are to be put where are 'masculinist reductionism', it still remains that someone will have to do those calculations. Is emphasis on social issues really what we want from engineers?

Clinical and psychological features of normal-weight women with subthreshold anorexia nervosa: a pilot case-control observational study.

PubMed

Tagliabue, Anna; Ferraris, Cinzia; Martinelli, Valentina; Pinelli, Giovanna; Repossi, Ilaria; Trentani, Claudia

2012-01-01

Weight preoccupations have been frequently reported in normal-weight subjects. Subthreshold anorexia nervosa (s-AN, all DSM IV TR criteria except amenorrhea or underweight) is a form of eating disorder not otherwise specified that has received scarce scientific attention. Under a case-control design we compared the general characteristics, body composition, and psychopathological features of normal-weight patients with s-AN with those of BMI- and sex-matched controls. Participants in this pilot study included 9 normal-weight women who met the DSM IV TR criteria for s-AN and 18 BMI-matched normal-weight controls. The general characteristics of the study participants were collected by questionnaire. Body composition was measured by bioelectrical impedance. Behavioral and psychological measures included the standardized symptom checklist (SCL-90-R) and the eating disorder inventory (EDI-2). There were no differences in age, education, employment status, marital status, and history of previous slimming treatment in the two study groups. In addition, anthropometric measures and body composition of s-AN patients and BMI-matched normal weight controls were not significantly different. In the s-AN subgroup, we found a significant relationship between waist circumference and the SCL-90-R obsessivity-compulsivity scale (n=9, r=-0.69, p<0.05). After multiple regression analysis, the SCL-90-R obsessivity-compulsivity scale (beta = 0.61, t=2.7, p=0.017) was the only independent predictor of the presence s-AN in our study cohort. These pilot results suggest that psychopathological criteria (particularly related to the obsessivity-compulsivity dimension) may be more useful than anthropometric measures for screening of s-AN in normal-weight women.

The Gender Gap in Second Language Acquisition: Gender Differences in the Acquisition of Dutch among Immigrants from 88 Countries with 49 Mother Tongues.

PubMed

van der Slik, Frans W P; van Hout, Roeland W N M; Schepens, Job J

2015-01-01

Gender differences were analyzed across countries of origin and continents, and across mother tongues and language families, using a large-scale database, containing information on 27,119 adult learners of Dutch as a second language. Female learners consistently outperformed male learners in speaking and writing proficiency in Dutch as a second language. This gender gap remained remarkably robust and constant when other learner characteristics were taken into account, such as education, age of arrival, length of residence and hours studying Dutch. For reading and listening skills in Dutch, no gender gap was found. In addition, we found a general gender by education effect for all four language skills in Dutch for speaking, writing, reading, and listening. Female language learners turned out to profit more from higher educational training than male learners do in adult second language acquisition. These findings do not seem to match nurture-oriented explanatory frameworks based for instance on a human capital approach or gender-specific acculturation processes. Rather, they seem to corroborate a nature-based, gene-environment correlational framework in which language proficiency being a genetically-influenced ability interacting with environmental factors such as motivation, orientation, education, and learner strategies that still mediate between endowment and acquiring language proficiency at an adult stage.

Retrieval and Encoding Interference: Cross-Linguistic Evidence from Anaphor Processing

PubMed Central

Laurinavichyute, Anna; Jäger, Lena A.; Akinina, Yulia; Roß, Jennifer; Dragoy, Olga

2017-01-01

The main goal of this paper was to disentangle encoding and retrieval interference effects in anaphor processing and thus to evaluate the hypothesis predicting that structurally inaccessible nouns (distractors) are not considered to be potential anaphor antecedents during language processing (Nicol and Swinney, 1989). Three self-paced reading experiments were conducted: one in German, comparing gender-unmarked reflexives and gender-marked pronouns, and two in Russian, comparing gender-marked and -unmarked reflexives. In the German experiment, no interference effects were found. In the first experiment in Russian, an unexpected reading times pattern emerged: in the condition where the distractor matched the gender of the reflexive's antecedent, reading of the gender-unmarked, but not the gender-marked reflexives was slowed down. The same reading times pattern was replicated in a second experiment in Russian where the order of the reflexive and the main verb was inverted. We conclude that the results of the two experiments in Russian are inconsistent with the retrieval interference account, but can be explained by encoding interference and additional semantic processing efforts associated with the processing of gender-marked reflexives. In sum, we found no evidence that would allow us to reject the syntax as an early filer account (Nicol and Swinney, 1989). PMID:28649216

Sex/gender differences in the brain and cognition in schizophrenia.

PubMed

Mendrek, Adrianna; Mancini-Marïe, Adham

2016-08-01

The early conceptualizations of schizophrenia have noted some sex/gender differences in epidemiology and clinical expression of the disorder. Over the past few decades, the interest in differences between male and female patients has expanded to encompass brain morphology and neurocognitive function. Despite some variability and methodological shortcomings, a few patterns emerge from the available literature. Most studies of gross neuroanatomy show more enlarged ventricles and smaller frontal lobes in men than in women with schizophrenia; finding reflecting normal sexual dimorphism. In comparison, studies of brain asymmetry and specific corticolimbic structures, suggest a disturbance in normal sexual dimorphism. The neurocognitive findings are somewhat consistent with this picture. Studies of cognitive functions mediated by the lateral frontal network tend to show sex differences in patients which are in the same direction as those observed in the general population, whereas studies of processes mediated by the corticolimbic system more frequently reveal reversal of normal sexual dimorphisms. These trends are faint and future research would need to delineate neurocognitive differences between men and women with various subtypes of schizophrenia (e.g., early versus late onset), while taking into consideration hormonal status and gender of tested participants. Copyright © 2015 Elsevier Ltd. All rights reserved.

Validation of the second version of the LittlEARS® Early Speech Production Questionnaire (LEESPQ) in German-speaking children with normal hearing.

PubMed

Keilmann, Annerose; Friese, Barbara; Lässig, Anne; Hoffmann, Vanessa

2018-04-01

The introduction of neonatal hearing screening and the increasingly early age at which children can receive a cochlear implant has intensified the need for a validated questionnaire to assess the speech production of children aged 0‒18. Such a questionnaire has been created, the LittlEARS ® Early Speech Production Questionnaire (LEESPQ). This study aimed to validate a second, revised edition of the LEESPQ. Questionnaires were returned for 362 children with normal hearing. Completed questionnaires were analysed to determine if the LEESPQ is reliable, prognostically accurate, internally consistent, and if gender or multilingualism affects total scores. Total scores correlated positively with age. The LEESPQ is reliable, accurate, and consistent, and independent of gender or lingual status. A norm curve was created. This second version of the LEESPQ is a valid tool to assess the speech production development of children with normal hearing, aged 0‒18, regardless of their gender. As such, the LEESPQ may be a useful tool to monitor the development of paediatric hearing device users. The second version of the LEESPQ is a valid instrument for assessing early speech production of children aged 0‒18 months.

Neural Responses to Peer Rejection in Anxious Adolescents: Contributions from the Amygdala-Hippocampal Complex

ERIC Educational Resources Information Center

Lau, Jennifer Y. F.; Guyer, Amanda E.; Tone, Erin B.; Jenness, Jessica; Parrish, Jessica M.; Pine, Daniel S.; Nelson, Eric E.

2012-01-01

Peer rejection powerfully predicts adolescent anxiety. While cognitive differences influence anxious responses to social feedback, little is known about neural contributions. Twelve anxious and twelve age-, gender- and IQ-matched, psychiatrically healthy adolescents received "not interested" and "interested" feedback from unknown peers during a…

Cognitive Inhibition in Students with and without Dyslexia and Dyscalculia

ERIC Educational Resources Information Center

Wang, Li-Chih; Tasi, Hung-Ju; Yang, Hsien-Ming

2012-01-01

The present study presents a comparison of the cognitive inhibition abilities of dyslexic, dyscalculic, and control students. The participants were 45 dyslexic students, 45 dyscalculic students, and 45 age-, gender-, and IQ-matched control students. The major evaluation tools included six cognitive inhibition tasks which were restructured during…

7 Reasons for Accommodating Transgender Students at School

ERIC Educational Resources Information Center

Arenas, Alberto; Gunckel, Kristin L.; Smith, William L.

2016-01-01

Schools have become ground zero for clashes over transgender rights, and critics are denouncing academic institutions--and more recently, the Obama administration--for supporting transgender students in their right to use restrooms and locker rooms that match their gender identity. This article responds to the seven most common claims made by…

Refining Behavioral Phenotypes: Personality-Motivation in Williams and Prader-Willi Syndromes.

ERIC Educational Resources Information Center

Dykens, Elisabeth M.; Rosner, Beth A.

1999-01-01

Personality-motivation was compared for age- and gender-matched individuals with Williams (n=35) or Prader-Willi (n=35) syndromes or mental retardation due to nonspecific causes (n=35). Each syndrome featured aberrant motivational profiles and similarities were found across groups in social interaction, anxiety, and orderliness. Recommendations…

Are Special Education Students Happy?

ERIC Educational Resources Information Center

Uusitalo-Malmivaara, Lotta; Kankaanpaa, Paula; Makinen, Tuula; Raeluoto, Tiina; Rauttu, Karoliina; Tarhala, Veera; Lehto, Juhani E.

2012-01-01

This study compared the subjective and school-related happiness of 75 11- to 16-year-old special education students to 77 age- and gender-matched mainstream students using two quantitative measures. Additionally, the respondents chose from a list of 12 putative happy makers what they felt increased their happiness. Ten special education students…

The Effect of Integrated Instructions on Reading Comprehension, Motivation, and Cognitive Variables

ERIC Educational Resources Information Center

Alhabahba, Mohammad Madallh; Pandian, Ambigapathy; Mahfoodh, Omer Hassan Ali

2016-01-01

This quasi-experimental study examined the contribution of concept-oriented reading instruction (CORI) on fifth grade students' reading comprehension, motivation and metacognition. Participants were sixty-six fifth grade female Jordanian students who matched in gender, socioeconomic status, number of years learning English, and school attended.…

Antisocial Behavior and Affiliation With Deviant Peers

ERIC Educational Resources Information Center

Toro, Paul A.; Urberg, Kathryn A.; Heinze, Hillary J.

2004-01-01

We examined the associations among gender, antisocial behavior, and peer-group affiliation in a high-risk sample of 401 homeless and matched housed adolescents (139 boys and 262 girls). The Diagnostic Interview Schedule for Children (Version 2.3, 1991; Costello, Edelbrock, Kalas, Kessler, & Klaric, 1982) yielded 2 measures of adolescent antisocial…

Comparing Relations of Motivation, Engagement, and Achievement among Struggling and Advanced Adolescent Readers

ERIC Educational Resources Information Center

Klauda, Susan Lutz; Guthrie, John T.

2015-01-01

This longitudinal study examined the development of reading motivation, engagement, and achievement in early adolescence by comparing interrelations of these variables in struggling and advanced readers. Participants were 183 pairs of seventh grade students matched in gender, ethnicity, socioeconomic status, and school attended. They completed…

Toxoplasmosis gondii and schizophrenia: a case control study in a low Toxoplasma gondii seroprevalence Mexican population

USDA-ARS?s Scientific Manuscript database

There are conflicting reports concerning the association of T. gondii infection and schizophrenia. Therefore, we determined such association in a Mexican population of Mestizo ethnicity. Through a case-control study design, 50 schizophrenic patients and 150 control subjects matched by gender, age, r...

ERP Study of Pre-Attentive Auditory Processing in Treatment-Refractory Schizophrenia

ERIC Educational Resources Information Center

Milovan, Denise L.; Baribeau, Jacinthe; Roth, Robert M.; Stip, Emmanuel

2004-01-01

Event-related potential (ERP) studies have demonstrated impaired auditory sensory processing in patients with schizophrenia, as reflected in abnormal mismatch negativity (MMN). We sought to extend this finding by evaluating MMN in 13 treatment-refractory patients with schizophrenia, and 14 age- and gender-matched healthy controls. Subjects…

Osteoporosis in Groups with Intellectual Disability.

ERIC Educational Resources Information Center

Center, J. R.; And Others

1994-01-01

Fifty-three adults with intellectual impairment referred to an endocrinology clinic in New South Wales (Australia) were measured for lumbar bone mineral density. Bone mineral density was significantly lower in this group than in an age and sex matched control group. Risk factors included male gender, physical inactivity, small body size,…

Gender Differences in the Learning Status of Diabetic Children.

ERIC Educational Resources Information Center

Holmes, Clarissa S.; And Others

1992-01-01

Evaluated learning status of 95 diabetic children and 97 matched controls. Results indicated that diabetic boys had significantly lower Freedom from Distractibility scores compared with scores of diabetic girls and controls, and lower Perceptual Organization scores compared with scores of control boys. Diabetic children experienced more learning…

Coping Behaviors of Residence Hall Directors

ERIC Educational Resources Information Center

Wilkes, Ben

2017-01-01

This mixed-methods study examined tertiary-level residence-hall directors' reported coping behaviors for three systems of stress: environmental, personal, and work. It surveyed a convenience sample of 128 respondents using the Brief COPE scale (Carver, 1997). Reported length of service, genders, and hall populations were matched with 28 types of…

How Relevant Are GFAP Autoantibodies in Autism and Tourette Syndrome?

ERIC Educational Resources Information Center

Kirkman, Nikki J.; Libbey, Jane E.; Sweeten, Thayne L.; Coon, Hilary H.; Miller, Judith N.; Stevenson, Edward K.; Lainhart, Janet E.; McMahon, William M.; Fujinami, Robert S.

2008-01-01

Controversy exists over the role of autoantibodies to central nervous system antigens in autism and Tourette Syndrome. We investigated plasma autoantibody titers to glial fibrillary acidic protein (GFAP) in children with classic onset (33) and regressive onset (26) autism, controls (25, healthy age- and gender-matched) and individuals with…

Diagnostic Performance and Utility of Quantitative EEG Analyses in Delirium: Confirmatory Results From a Large Retrospective Case-Control Study.

PubMed

Fleischmann, Robert; Tränkner, Steffi; Bathe-Peters, Rouven; Rönnefarth, Maria; Schmidt, Sein; Schreiber, Stephan J; Brandt, Stephan A

2018-03-01

The lack of objective disease markers is a major cause of misdiagnosis and nonstandardized approaches in delirium. Recent studies conducted in well-selected patients and confined study environments suggest that quantitative electroencephalography (qEEG) can provide such markers. We hypothesize that qEEG helps remedy diagnostic uncertainty not only in well-defined study cohorts but also in a heterogeneous hospital population. In this retrospective case-control study, EEG power spectra of delirious patients and age-/gender-matched controls (n = 31 and n = 345, respectively) were fitted in a linear model to test their performance as binary classifiers. We subsequently evaluated the diagnostic performance of the best classifiers in control samples with normal EEGs (n = 534) and real-world samples including pathologic findings (n = 4294). Test reliability was estimated through split-half analyses. We found that the combination of spectral power at F3-P4 at 2 Hz (area under the curve [AUC] = .994) and C3-O1 at 19 Hz (AUC = .993) provided a sensitivity of 100% and a specificity of 99% to identify delirious patients among normal controls. These classifiers also yielded a false positive rate as low as 5% and increased the pretest probability of being delirious by 57% in an unselected real-world sample. Split-half reliabilities were .98 and .99, respectively. This retrospective study yielded preliminary evidence that qEEG provides excellent diagnostic performance to identify delirious patients even outside confined study environments. It furthermore revealed reduced beta power as a novel specific finding in delirium and that a normal EEG excludes delirium. Prospective studies including parameters of pretest probability and delirium severity are required to elaborate on these promising findings.

Incidence of cardiac arrhythmias in asymptomatic hereditary hemochromatosis subjects with C282Y homozygosity.

PubMed

Shizukuda, Yukitaka; Tripodi, Dorothy J; Zalos, Gloria; Bolan, Charles D; Yau, Yu-Ying; Leitman, Susan F; Waclawiw, Myron A; Rosing, Douglas R

2012-03-15

It is not well known whether systemic iron overload per se in hereditary hemochromatosis (HH) is associated with cardiac arrhythmias before other signs and symptoms of cardiovascular disease occur. In the present study, we examined the incidence of cardiac arrhythmia in cardiac asymptomatic subjects with HH (New York Heart Association functional class I) and compared it to that in age- and gender-matched normal volunteers. The 42 subjects with HH and the 19 normal control subjects were recruited through the National Heart, Lung, and Blood Institute-sponsored "Heart Study of Hemochromatosis." They completed 48-hour Holter electrocardiography ambulatory monitoring at the baseline evaluation. The subjects with HH were classified as newly diagnosed (group A) and chronically treated (group B) subjects. All subjects with HH had C282Y homozygosity, and the normal volunteers lacked any HFE gene mutations known to cause HH. Although statistically insignificant, the incidence of ventricular and supraventricular ectopy tended to be greater in the combined HH groups than in the controls. Supraventricular ectopy was more frequently noted in group B compared to in the controls (ectopy rate per hour 11.1 ± 29.9 vs 1.5 ± 3.5, p < 0.05, using the Kruskal-Wallis test). No examples of heart block, other than first-degree atrioventricular node block, were seen in any of the subjects. The incidence of cardiac arrhythmias was not significantly reduced after 6 months of intensive iron removal therapy in the group A subjects. No life-threatening arrhythmias were observed in our subjects with HH. In conclusion, our data suggest that the incidence of cardiac arrhythmias is, at most, marginally increased in asymptomatic subjects with HH. A larger clinical study is warranted to further clarify our observation. Published by Elsevier Inc.

Voice disorders in children and its relationship with auditory, acoustic and vocal behavior parameters.

PubMed

Simões-Zenari, Marcia; Nemr, Katia; Behlau, Mara

2012-06-01

Parameters to distinguish normal from deviant voices in early childhood have not been established. The current study sought to auditorily and acoustically characterize voices of children, and to study the relationship between vocal behavior reported by teachers and the presence of vocal aberrations. One hundred children between four and 6 years and 11 months, who attended early childhood educational institutions, were included. The sample comprised 50 children with normal voices (NVG) and 50 with deviant voices (DVG) matched by gender and age. All participants were submitted to auditory and acoustic analysis of vocal quality and had their vocal behaviors assessed by teachers through a specific protocol. DVG had a higher incidence of breathiness (p<0.001) and roughness (p<0.001), but not vocal strain (p=0.546), which was similar in both groups. The average F(0) was lower in the DVG and a higher noise component was observed in this group as well. Regarding the protocol used "Aspects Related to Phonotrauma - Children's Protocol", higher means were observed for children from DVG in all analyzed aspects and also on the overall means (DVG=2.15; NVG=1.12, p<0.001). In NVG, a higher incidence of vocal behavior without alterations or with discrete alterations was observed, whereas a higher incidence of moderate, severe or extreme alterations of vocal behavior was observed in DVG. Perceptual assessment of voice, vocal acoustic parameters (F(0), noise and GNE), and aspects related to vocal trauma and vocal behavior differentiated the groups of children with normal voice and deviant voice. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Waist-height ratio in children of 7 to 11 years with high weight at birth and its relationship with gender, age and diet.

PubMed

Rodríguez Vargas, Nuris; Fernandez-Britto, Jose Emilio; Martinez Perez, Tania Paula; Martinez Garcia, Rolando; Castañeda Garcia, Cecilia Margarita; Garriga Reyes, Mailin; Cabrera Estrada, Claudia; Plana Labrada, Rossana; García Niebla, Rosa María; Blanco Aranguren, Fabiola

2018-03-26

Obesity (OB), considered as one of the Non-Transmissible Chronic Diseases, has as its fundamental characteristics that of being prevalent at a global level, increasing in number, affecting developed and developing countries, affecting both genders, and all ages and social groups. To identify if high birth weight is a predictive factor (risk factor) for abdominal obesity in children 7 to 11 years old, and its relationship to gender, age and diet. A case-control descriptive study was carried out with children born between January 1992 and December 1995, in order to identify early risk factors (atherosclerotic accelerators) such as abdominal obesity in children aged 7 to 11, and who have a history of macrosomia or high birth weight, as well as their relationship with gender, age and diet. It was observed that the waist/height value was normal in 60.8% of the study group and in 64.00% in the control group. The difference between groups, gender, and age was not significant (P=.6859). As regards the diet in the study group (macrosomic), there was no significant association between the type of diet and waist circumference/height values, with an χ 2 =0.223 and P=.6373 (not significant). In the control group (with normal weight at birth), it was found that there is a significant statistical association between the type of diet and waist circumference/height values. This means that it can be stated, with 95% reliability, that the type of diet is associated with waist/height values. High birth weight is not a predictive factor (risk factor) for abdominal obesity (increased waist/height index). Gender and age are independent for abdominal obesity (macrosomic and normal weight at birth). The diet in high birth weight children is not related to the index waist-height index, which is not the case in those born with normal weight under the same conditions. The marked increase in abdominal obesity (Waist/height index) in children between 7 and 11 years old in both groups is worrying. Copyright © 2018 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs.

PubMed

Saunders, Christopher T; Wong, Wendy S W; Swamy, Sajani; Becq, Jennifer; Murray, Lisa J; Cheetham, R Keira

2012-07-15

Whole genome and exome sequencing of matched tumor-normal sample pairs is becoming routine in cancer research. The consequent increased demand for somatic variant analysis of paired samples requires methods specialized to model this problem so as to sensitively call variants at any practical level of tumor impurity. We describe Strelka, a method for somatic SNV and small indel detection from sequencing data of matched tumor-normal samples. The method uses a novel Bayesian approach which represents continuous allele frequencies for both tumor and normal samples, while leveraging the expected genotype structure of the normal. This is achieved by representing the normal sample as a mixture of germline variation with noise, and representing the tumor sample as a mixture of the normal sample with somatic variation. A natural consequence of the model structure is that sensitivity can be maintained at high tumor impurity without requiring purity estimates. We demonstrate that the method has superior accuracy and sensitivity on impure samples compared with approaches based on either diploid genotype likelihoods or general allele-frequency tests. The Strelka workflow source code is available at ftp://strelka@ftp.illumina.com/. csaunders@illumina.com

Quantitative RNFL attenuation coefficient measurements by RPE-normalized OCT data

NASA Astrophysics Data System (ADS)

Vermeer, K. A.; van der Schoot, J.; Lemij, H. G.; de Boer, J. F.

2012-03-01

We demonstrate significantly different scattering coefficients of the retinal nerve fiber layer (RNFL) between normal and glaucoma subjects. In clinical care, SD-OCT is routinely used to assess the RNFL thickness for glaucoma management. In this way, the full OCT data set is conveniently reduced to an easy to interpret output, matching results from older (non- OCT) instruments. However, OCT provides more data, such as the signal strength itself, which is due to backscattering in the retinal layers. For quantitative analysis, this signal should be normalized to adjust for local differences in the intensity of the beam that reaches the retina. In this paper, we introduce a model that relates the OCT signal to the attenuation coefficient of the tissue. The average RNFL signal (within an A-line) was then normalized based on the observed RPE signal, resulting in normalized RNFL attenuation coefficient maps. These maps showed local defects matching those found in thickness data. The average (normalized) RNFL attenuation coefficient of a fixed band around the optic nerve head was significantly lower in glaucomatous eyes than in normal eyes (3.0mm-1 vs. 4.9mm-1, P<0.01, Mann-Whitney test).

The Impact of Listening Condition on Background Noise Acceptance for Young Adults with Normal Hearing

ERIC Educational Resources Information Center

Gordon-Hickey, Susan; Moore, Robert E.; Estis, Julie M.

2012-01-01

Purpose: To evaluate the effect of different speech conditions on background noise acceptance. A total of 23 stimulus pairings, differing in primary talker gender (female, male, conventional), number of background talkers (1, 4, 12), and gender composition of the background noise (female, male, mixed) were used to evaluate background noise…

Brain Correlates of Stuttering and Syllable Production: Gender Comparison and Replication.

ERIC Educational Resources Information Center

Ingham, Roger J.; Fox, Peter T.; Ingham, Janis C.; Xiong, Jinhu; Zamarripa, Frank; Hardies, L. Jean; Lancaster, Jack L.

2004-01-01

This article reports a gender replication study of the P. T. Fox et a. (2000) performance correlation analysis of neural systems that distinguish between normal and stuttered speech in adult males. Positron-emission tomographic (PET) images of cerebral blood flow (CBF) were correlated with speech behavior scores obtained during PET imaging for 10…

Behind the Pay Gap

ERIC Educational Resources Information Center

Dey, Judy Goldberg; Hill, Catherine

2007-01-01

Women have made remarkable gains in education during the past three decades, yet these achievements have resulted in only modest improvements in pay equity. The gender pay gap has become a fixture of the U.S. workplace and is so ubiquitous that many simply view it as normal. "Behind the Pay Gap" examines the gender pay gap for college graduates.…

Gender differences exist in the hip joint moments of healthy older walkers.

PubMed

Boyer, Katherine A; Beaupre, Gary S; Andriacchi, Thomas P

2008-12-05

Gender differences in the incidence of symptomatic hip osteoarthritis (OA), changes in hip cartilage volume and hip joint space and rates hip arthroplasty of older people are reported in the literature. As the rate of progression of OA is in part mechanically modulated it is possible that this gender bias may be related to inherent differences (if they exist) in walking mechanics between older males and females. The purpose of this study was to examine potential mechanisms for gender differences in hip joint mechanics during walking by testing the hypotheses that females would exhibit higher hip flexion, adduction and internal rotation moments but not significantly greater normalized ground reaction forces (GRFs). Forty-two healthy subjects (21 male, 21 female), ages 50-79yr were recruited for gait analysis. In support of the hypotheses, greater external hip adduction and internal rotation along with hip extension moments were found for females compared to males after normalizing for body size for all self-selected walking speeds. Differences in walking style (kinematics) were the main determinants in the joint kinetic differences as no differences in the normalized GRFs were found. As external joint moments are surrogate measures of the joint contact forces, the results of this study suggest the hip joint stress for the female population is higher compared to male population. This is in favor of a hypothesis that the increased joint contact stress in a female population could contribute to a greater joint degeneration at the hip in females as compared with males.

Prevalence of tinea pedis in psoriasis, compared to atopic dermatitis and normal controls--a prospective study.

PubMed

Leibovici, Vera; Ramot, Yuval; Siam, Rula; Siam, Ihab; Hadayer, Noa; Strauss-Liviatan, Nurith; Hochberg, Malka

2014-12-01

There are discrepancies in the literature regarding the prevalence of tinea pedis in psoriasis. The aim of this investigation was to conduct a cross-sectional study of the prevalence of tinea pedis in psoriasis compared to atopic dermatitis patients and normal controls. We enrolled 232 psoriatic patients, 190 atopic dermatitis patients and 202 normal controls, between the years 2010 and 2013. The prevalence of tinea pedis was 13.8% in psoriasis patients, not significantly different from that in atopic dermatitis patients 8.4% (P = 0.092)), but significantly higher than in normal controls 7.4% (P = 0.043). Both gender and age affected the prevalence of tinea pedis in psoriasis and normal controls, while only age affected the prevalence of tinea pedis in atopic dermatitis. Regarding gender, there was higher prevalence of tinea pedis in men: 19.1% (P = 0.019) in psoriasis and 12.1% (P = 0.013) in normal controls. Age affected the prevalence of tinea pedis in normal controls (P < 0.001), psoriasis patients (P = 0.001) and atopic dermatitis patients (P = 0.001), with higher prevalence with increasing age. Trichophyton rubrum was the most common species in psoriasis (71.9%), atopic dermatitis (75.0%) and normal controls (73.3%). Our study found a relatively high prevalence of tinea pedis among psoriasis patients. © 2014 Blackwell Verlag GmbH.

Reimbursed drugs in patients with sleep-disordered breathing: A static-charge-sensitive bed study.

PubMed

Anttalainen, Ulla; Polo, Olli; Vahlberg, Tero; Saaresranta, Tarja

2010-01-01

Co-morbidities in men and women with sleep-disordered breathing (SDB) were compared retrospectively to an age-standardized, general Finnish population. The prevalence of diseases was based on the reimbursement refunds of medications. Two hundred thirty-three age- and BMI-matched male-female pairs and 368 consecutive women identified from our sleep recording database were included. Data on medication were gathered from the National Agency for Medicines and Social Insurance Institution database. Men with SDB had three-fold prevalence of reimbursed medication for diabetes and two-fold prevalence of reimbursed medication for chronic arrhythmia. Women with SDB had three-fold prevalence of reimbursed medication for thyroid insufficiency, and postmenopausal women had two-fold prevalence of reimbursed medication for psychosis. BMI and age did not explain prevalence of reimbursed medications for chronic arrhythmia or psychosis. In both genders with SDB, prevalence of reimbursed medications compared to the general population was two-fold for hypertension and seven-fold for asthma and/or chronic obstructive pulmonary disease (COPD). Partial upper airway obstruction was associated with three-fold prevalence of reimbursed medication for asthma and/or COPD in both genders and 60% reduced prevalence of reimbursed medication for hypertension in females matched for age and BMI. Co-morbidity profile differed between genders. Our results emphasize the importance of diagnosis and treatment of co-morbidities and partial upper airway obstruction. Copyright 2009 Elsevier B.V. All rights reserved.

Food thought suppression: a matched comparison of obese individuals with and without binge eating disorder.

PubMed

Barnes, Rachel D; Masheb, Robin M; Grilo, Carlos M

2011-12-01

Preliminary studies of non-clinical samples suggest that purposely attempting to avoid thoughts of food, referred to as food thought suppression, is related to a number of unwanted eating- and weight-related consequences, particularly in obese individuals. Despite possible implications for the treatment of obesity and eating disorders, little research has examined food thought suppression in obese individuals with binge eating disorder (BED). This study compared food thought suppression in 60 obese patients with BED to an age-, gender-, and body mass index (BMI)-matched group of 59 obese persons who do not binge eat (NBO). In addition, this study examined the associations between food thought suppression and eating disorder psychopathology within the BED and NBO groups and separately by gender. Participants with BED and women endorsed the highest levels of food thought suppression. Food thought suppression was significantly and positively associated with many features of ED psychopathology in NBO women and with eating concerns in men with BED. Among women with BED, higher levels of food thought suppression were associated with higher frequency of binge eating, whereas among men with BED, higher levels of food thought suppression were associated with lower frequency of binge eating. Our findings suggest gender differences in the potential significance of food thought suppression in obese groups with and without co-existing binge eating problems. Copyright © 2011 Elsevier Ltd. All rights reserved.

Ethnic differences in oro-facial somatosensory profiles-quantitative sensory testing in Chinese and Danes.

PubMed

Yang, G; Luo, Y; Baad-Hansen, L; Wang, K; Arendt-Nielsen, L; Xie, Q-F; Svensson, P

2013-11-01

Ethnic differences in pain experiences have been widely assessed in various pathological and experimental conditions. However, limited sensory modalities have been described in previous research, and the affective-motivational factors have so far been estimated to be the main mediator for the ethnic differences. This study aimed to detect the ethnic differences of oro-facial somatosensory profiles related to the sensory-discriminative dimension in healthy volunteers. The standardised quantitative sensory testing battery developed by the German Research Network on Neuropathic Pain was performed bilaterally in the infraorbital and mental regions on age- and gender-matched healthy Chinese and Danes, 29 participants each group. The influences of ethnicity, gender and test site on the somatosensory profile were evaluated by three-way anova. The ethnic disparities were also presented by Z-scores. Compared to Danes, Chinese were more sensitive to thermal detection, thermal pain, mechanical deep pain and mechanical pain rating parameters (P < 0·002) related to small fibre functions. However, the inverse results were observed for mechanical tactile modality related to large fibre function (P < 0·001) and wind-up ratio (P = 0·006). Women presented higher sensitivity compared to men. The mean Z-scores of all the parameters from Chinese group were in the normal zone created by Danish Caucasians' means and SDs. The ethnic disparities in somatosensory profile illustrated the necessity of establishing the reference data for different ethnic groups and possibly individual pain management strategies for the different ethnic groups. © 2013 John Wiley & Sons Ltd.

[Study on the relationship between mental health and overweight, obesity, different sex among junior middle school students].

PubMed

Que, Min; Tao, Fang-biao; He, Chun-yan; Zhang, Li-hua; Zhu, Peng

2007-05-01

To examine the relationships between overweight, obesity and indices as satisfaction of life, trait anxiety, depression, self concept etc. in male and female junior middle school students. A questionnaire survey was administered to 1818 participants in a middle school in Hefei city, Anhui province. This contents of survey would include Multidimensional Students' Life Satisfaction Scale (MSLSS), Center for Epidemiologic Studies Depression Scale (CES-D), Trait Anxiety Inventory (TAI), and Piers-Harris Children's Self Concept Scale (PHSCS). Anthropometric measures were taken together with the calculation of body mass index (BMI). The students were divided into normal-weight, overweight and obesity groups by BMI separate criteria. Gender differences of mental health status and group differences of mental health among normal-weight, overweight obesity students were analyzed. Relationships between BMI and the scores of MSLSS, CES-D, TAI, PHSCS were estimated among boys and girls respectively. The prevalence rates of overweight and obesity of boys (21.5%, 7.7%) were significantly higher than in girls (8.0%, 2.8%). Difference of the MSLSS scores in gender was significant among normal-weight group (P = 0.002). The difference of the CES-D scores in gender was significant among overweight group (P = 0.046). There were significant group differences of the CES-D scores, TAI scores, and PHSCS scores among normal-weight, overweight and obese girls (P < 0.05). Both the CES-D score and TAI score of obese girls were higher than normal-weight girls (P = 0.012 and P = 0.035). The PHSCS score of obese girls was lower than normal-weight girls (P = 0.014) and the group difference of the CES-D score was also significant between overweight and normal-weight girls (P = 0.025). Both prevalence rates of overweight and obesity of boys were higher than that in girls. Nevertheless, level of mental health level among girls with overweight and obesity were lower than that in boys.

The impact of aging and hearing status on verbal short-term memory.

PubMed

Verhaegen, Clémence; Collette, Fabienne; Majerus, Steve

2014-01-01

The aim of this study is to assess the impact of hearing status on age-related decrease in verbal short-term memory (STM) performance. This was done by administering a battery of verbal STM tasks to elderly and young adult participants matched for hearing thresholds, as well as to young normal-hearing control participants. The matching procedure allowed us to assess the importance of hearing loss as an explanatory factor of age-related STM decline. We observed that elderly participants and hearing-matched young participants showed equal levels of performance in all verbal STM tasks, and performed overall lower than the normal-hearing young control participants. This study provides evidence for recent theoretical accounts considering reduced hearing level as an important explanatory factor of poor auditory-verbal STM performance in older adults.

Shadow Areas Robust Matching Among Image Sequence in Planetary Landing

NASA Astrophysics Data System (ADS)

Ruoyan, Wei; Xiaogang, Ruan; Naigong, Yu; Xiaoqing, Zhu; Jia, Lin

2017-01-01

In this paper, an approach for robust matching shadow areas in autonomous visual navigation and planetary landing is proposed. The approach begins with detecting shadow areas, which are extracted by Maximally Stable Extremal Regions (MSER). Then, an affine normalization algorithm is applied to normalize the areas. Thirdly, a descriptor called Multiple Angles-SIFT (MA-SIFT) that coming from SIFT is proposed, the descriptor can extract more features of an area. Finally, for eliminating the influence of outliers, a method of improved RANSAC based on Skinner Operation Condition is proposed to extract inliers. At last, series of experiments are conducted to test the performance of the approach this paper proposed, the results show that the approach can maintain the matching accuracy at a high level even the differences among the images are obvious with no attitude measurements supplied.

Analgesic opioid use in a health-insured epilepsy population during 2012.

PubMed

Wilner, A N; Sharma, B K; Thompson, A R; Krueger, A

2016-04-01

Analgesic opioid use has increased dramatically in the general population. Although opioid analgesics are not indicated for the treatment of epilepsy, frequent opioid use has been reported in the epilepsy population. It is not clear whether comorbid disorders and/or epilepsy-associated injuries due to seizures foster opioid use. Our primary objective was to compare the prevalence of analgesic opioid use in an insured patient population with epilepsy to a matched control population without epilepsy. After observing increased frequency of opioid use in people with epilepsy compared with matched controls, we assessed the contribution of age, gender, pain diagnosis, and psychiatric illness as possible drivers regarding the use of opioids. Health insurance claims and membership data from nine United States (U.S.) health plans for the year 2012 were analyzed. Individuals with epilepsy (n=10,271) were match-paired at a 1:2 ratio to individuals without epilepsy (n=20,542) within each health plan using propensity scores derived from age group, gender, and insurance type. Matched comparison groups had 53% females and 47% males with an average age of 34 years for the group with epilepsy and 33 years for controls. Each matched comparison group included 66% of individuals with commercial insurance, 30% with Medicaid insurance, and 4% with Medicare coverage. Based on prescriptions filled at least once during 2012, prevalence of analgesic opioid use was determined. The percentages of individuals with diagnosis for specific pain conditions and those with psychiatric diagnoses were also determined for the two comparison groups. Analgesic opioids were used by 26% of individuals in the group with epilepsy vs. 18% of matched controls (p<0.001). Compared with matched controls, the group with epilepsy had a significantly higher percentage of individuals with all 16 pain conditions examined: joint pain or stiffness (16% vs. 11%), abdominal pain (14% vs. 9%), headache (14% vs. 5%), pain in limb (12% vs. 7%), chest pain (11% vs. 6%), sprain of different parts (9% vs. 7%), sinusitis (9% vs. 7%), migraine (8% vs. 2%), lumbago (8% vs. 6%), backache (6% vs. 4%), cervicalgia (6% vs. 3%), fracture (5% vs. 3%), fibromyalgia (4% vs. 3%), chronic pain (3% vs. 1%), sciatica (1.4% vs. 1%), and jaw pain (0.4% vs. 0.1%) (all p<0.001). The prevalence of pain diagnosis was 51% in the group with epilepsy and 39% in the matched control group (p<0.0001). The prevalence of 'psychiatric diagnoses' was 27% in the group with epilepsy and 12% in the matched control group (p<0.0001). The prevalences of analgesic opioid use, psychiatric diagnoses, and 16 pain conditions were significantly higher in the patient population with epilepsy than in the control population without epilepsy. Our study also showed how opioid use rate varied by gender, age category, and depression. The reasons for the greater prevalence of opioid use in people with epilepsy are unclear. It seems that increased pain prevalence is an important driver for the higher frequency of opioid use in people with epilepsy. Psychiatric illness and other factors also appear to contribute. Further analysis including more detailed clinical information that cannot be obtained through claims data alone will be required to provide more insight into opioid use in people with epilepsy. If opioid use is higher in people with epilepsy as our results suggest, physicians managing patients with epilepsy need to pay special attention to safe opioid prescribing habits in order to prevent adverse outcomes such as abuse, addiction, diversion, misuse, and overdose. Copyright © 2016 Elsevier Inc. All rights reserved.

An adaptive clustering algorithm for image matching based on corner feature

NASA Astrophysics Data System (ADS)

Wang, Zhe; Dong, Min; Mu, Xiaomin; Wang, Song

2018-04-01

The traditional image matching algorithm always can not balance the real-time and accuracy better, to solve the problem, an adaptive clustering algorithm for image matching based on corner feature is proposed in this paper. The method is based on the similarity of the matching pairs of vector pairs, and the adaptive clustering is performed on the matching point pairs. Harris corner detection is carried out first, the feature points of the reference image and the perceived image are extracted, and the feature points of the two images are first matched by Normalized Cross Correlation (NCC) function. Then, using the improved algorithm proposed in this paper, the matching results are clustered to reduce the ineffective operation and improve the matching speed and robustness. Finally, the Random Sample Consensus (RANSAC) algorithm is used to match the matching points after clustering. The experimental results show that the proposed algorithm can effectively eliminate the most wrong matching points while the correct matching points are retained, and improve the accuracy of RANSAC matching, reduce the computation load of whole matching process at the same time.

DNA methylation markers for diagnosis and prognosis of common cancers

PubMed Central

Hao, Xiaoke; Luo, Huiyan; Krawczyk, Michal; Wei, Wei; Wang, Wenqiu; Wang, Juan; Flagg, Ken; Hou, Jiayi; Zhang, Heng; Yi, Shaohua; Jafari, Maryam; Lin, Danni; Chung, Christopher; Caughey, Bennett A.; Li, Gen; Dhar, Debanjan; Shi, William; Zheng, Lianghong; Hou, Rui; Zhu, Jie; Zhao, Liang; Fu, Xin; Zhang, Edward; Zhang, Charlotte; Zhu, Jian-Kang; Karin, Michael; Xu, Rui-Hua; Zhang, Kang

2017-01-01

The ability to identify a specific cancer using minimally invasive biopsy holds great promise for improving the diagnosis, treatment selection, and prediction of prognosis in cancer. Using whole-genome methylation data from The Cancer Genome Atlas (TCGA) and machine learning methods, we evaluated the utility of DNA methylation for differentiating tumor tissue and normal tissue for four common cancers (breast, colon, liver, and lung). We identified cancer markers in a training cohort of 1,619 tumor samples and 173 matched adjacent normal tissue samples. We replicated our findings in a separate TCGA cohort of 791 tumor samples and 93 matched adjacent normal tissue samples, as well as an independent Chinese cohort of 394 tumor samples and 324 matched adjacent normal tissue samples. The DNA methylation analysis could predict cancer versus normal tissue with more than 95% accuracy in these three cohorts, demonstrating accuracy comparable to typical diagnostic methods. This analysis also correctly identified 29 of 30 colorectal cancer metastases to the liver and 32 of 34 colorectal cancer metastases to the lung. We also found that methylation patterns can predict prognosis and survival. We correlated differential methylation of CpG sites predictive of cancer with expression of associated genes known to be important in cancer biology, showing decreased expression with increased methylation, as expected. We verified gene expression profiles in a mouse model of hepatocellular carcinoma. Taken together, these findings demonstrate the utility of methylation biomarkers for the molecular characterization of cancer, with implications for diagnosis and prognosis. PMID:28652331

Adverse childhood experiences and suicide attempts among those with mental and substance use disorders.

PubMed

Choi, Namkee G; DiNitto, Diana M; Marti, C Nathan; Segal, Steven P

2017-07-01

Using the 2012-2013 National Epidemiologic Survey on Alcohol and Related Conditions data, we examined the associations of ten types of adverse childhood experiences (ACEs) with (1) lifetime suicide attempts and (2) number and age of attempts among U.S. adults aged 18+. In a case-control design, suicide attempters (5.14% of the full sample) were matched with never attempters (matched sample N=3912) on nine mental and substance use disorders. ACE rates were higher among attempters (3.30 [SE=0.07]) than their matched controls (2.19 [SE=0.06]). Results from multivariable logistic regression analyses showed that sexual abuse and parental/other family member's mental illness were associated with increased odds of having attempted suicide among both genders, and emotional neglect was also a factor for men. Population attributable risk fractions for sexual abuse were 25.75% for women and 8.56% for men. Sexual abuse and a higher number of ACEs were also related to repeated suicide attempts. A higher number of ACEs was associated with a younger first attempt age. Gay/bisexual orientation in men and the lack of college education in both genders were significant covariates. In conclusion, this study underscores that ACEs are significantly associated with lifetime suicide attempts even when mental and substance use disorders are controlled. Copyright © 2017 Elsevier Ltd. All rights reserved.

Distribution of copper, iron, and zinc in biological samples (scalp hair, serum, blood, and urine) of Pakistani viral hepatitis (A-E) patients and controls.

PubMed

Kolachi, Nida Fatima; Kazi, Tasneem Gul; Afridi, Hassan Imran; Kazi, Naveed; Kandhro, Ghulam Abbas; Shah, Abdul Qadir; Baig, Jameel Ahmed; Wadhwa, Sham Kumar; Khan, Sumaira; Shah, Faheem; Jamali, Mohammad Khan; Arain, Mohammad Balal

2011-10-01

The aim of the present study was to compare the level of copper (Cu), iron (Fe) and zinc (Zn) in biological samples (serum, blood, urine, and scalp hair) of patients suffering from different viral hepatitis (A, B, C, D, and E; n = 521) of both gender age ranged 31-45 years. For comparative study, 255 age-matched control subjects, of both genders residing in the same city were selected as referents. The elements in the biological samples were analyzed by flame atomic absorption spectrophotometry, prior to microwave-assisted acid digestion. The validity and accuracy of the methodology was checked by using certified reference materials (CRMs) and with those values obtained by conventional wet acid digestion method on same CRMs. The results of this study showed that the mean values of Cu and Fe were higher in blood, sera, and scalp hair samples of hepatitis patients, while Zn level was found to be lower than age-matched control subjects. The urinary levels of these elements were found to be higher in the hepatitis patients than in the age-matched healthy controls (p < 0.05). These results are consistent with literature-reported data, confirming that the deficiency of zinc and hepatic iron and copper overload can directly cause lipid peroxidation and eventually hepatic damage.

Physical activity enhances metabolic fitness independently of cardiorespiratory fitness in marathon runners.

PubMed

Laye, M J; Nielsen, M B; Hansen, L S; Knudsen, T; Pedersen, B K

2015-01-01

High levels of cardiovascular fitness (CRF) and physical activity (PA) are associated with decreased mortality and risk to develop metabolic diseases. The independent contributions of CRF and PA to metabolic disease risk factors are unknown. We tested the hypothesis that runners who run consistently >50 km/wk and/or >2 marathons/yr for the last 5 years have superior metabolic fitness compared to matched sedentary subjects (CRF, age, gender, and BMI). Case-control recruitment of 31 pairs of runner-sedentary subjects identified 10 matched pairs with similar VO2max (mL/min/kg) (similar-VO2max). The similar-VO2max group was compared with a group of age, gender, and BMI matched pairs who had the largest difference in VO2max (different-VO2max). Primary outcomes that defined metabolic fitness including insulin response to an oral glucose tolerance test, fasting lipids, and fasting insulin were superior in runners versus sedentary controls despite similar VO2max. Furthermore, performance (velocity at VO2max, running economy), improved exercise metabolism (lactate threshold), and skeletal muscle levels of mitochondrial proteins were superior in runners versus sedentary controls with similar VO2max. In conclusion subjects with a high amount of PA have more positive metabolic health parameters independent of CRF. PA is thus a good marker against metabolic diseases.

Physical Activity Enhances Metabolic Fitness Independently of Cardiorespiratory Fitness in Marathon Runners

PubMed Central

Laye, M. J.; Nielsen, M. B.; Hansen, L. S.; Knudsen, T.; Pedersen, B. K.

2015-01-01

High levels of cardiovascular fitness (CRF) and physical activity (PA) are associated with decreased mortality and risk to develop metabolic diseases. The independent contributions of CRF and PA to metabolic disease risk factors are unknown. We tested the hypothesis that runners who run consistently >50 km/wk and/or >2 marathons/yr for the last 5 years have superior metabolic fitness compared to matched sedentary subjects (CRF, age, gender, and BMI). Case-control recruitment of 31 pairs of runner-sedentary subjects identified 10 matched pairs with similar VO2max (mL/min/kg) (similar-VO2max). The similar-VO2max group was compared with a group of age, gender, and BMI matched pairs who had the largest difference in VO2max (different-VO2max). Primary outcomes that defined metabolic fitness including insulin response to an oral glucose tolerance test, fasting lipids, and fasting insulin were superior in runners versus sedentary controls despite similar VO2max. Furthermore, performance (velocity at VO2max, running economy), improved exercise metabolism (lactate threshold), and skeletal muscle levels of mitochondrial proteins were superior in runners versus sedentary controls with similar VO2max. In conclusion subjects with a high amount of PA have more positive metabolic health parameters independent of CRF. PA is thus a good marker against metabolic diseases. PMID:25821340

Reversal and Rotation Errors by Normal and Retarded Readers

ERIC Educational Resources Information Center

Black, F. William

1973-01-01

Reports an investigation of the incidence of and relationships among word and letter reversals in writing and Bender-Gestalt rotation errors in matched samples of normal and retarded readers. No significant diffenences were found in the two groups. (TO)

Do trained dogs discriminate individual body odors of women better than those of men?

PubMed

Jezierski, Tadeusz; Sobczyńska, Magdalena; Walczak, Marta; Gorecka-Bruzda, Aleksandra; Ensminger, John

2012-05-01

Scent identification lineups using dogs are a potentially valuable forensic tool, but have been dismissed by some critics because of cases where a false identification was shown to have occurred. It is not known, however, why dogs appear to make more false indications to the odors of some persons than of others. In this study, human genders were compared as to the degree their individual odors are distinguishable or "attractive" to dogs. Six dogs were trained to smell an individual's hand odor sample and then find the matching hand odor sample in a lineup of five odors. Using one-gender lineups and two-gender lineups with different gender ratios, it was found that dogs trained for the study identified individual women's hand odors more accurately than those of men. It is hypothesized that this is either because of differences in chemical compounds making discrimination of women's odors easier, or because of greater "odor attractiveness" of women's scents to dogs. © 2012 American Academy of Forensic Sciences.

Increased Cortical Thickness in Male-to-Female Transsexualism.

PubMed

Luders, Eileen; Sánchez, Francisco J; Tosun, Duygu; Shattuck, David W; Gaser, Christian; Vilain, Eric; Toga, Arthur W

2012-08-01

The degree to which one identifies as male or female has a profound impact on one's life. Yet, there is a limited understanding of what contributes to this important characteristic termed gender identity . In order to reveal factors influencing gender identity, studies have focused on people who report strong feelings of being the opposite sex, such as male-to-female (MTF) transsexuals. To investigate potential neuroanatomical variations associated with transsexualism, we compared the regional thickness of the cerebral cortex between 24 MTF transsexuals who had not yet been treated with cross-sex hormones and 24 age-matched control males. Results revealed thicker cortices in MTF transsexuals, both within regions of the left hemisphere (i.e., frontal and orbito-frontal cortex, central sulcus, perisylvian regions, paracentral gyrus) and right hemisphere (i.e., pre-/post-central gyrus, parietal cortex, temporal cortex, precuneus, fusiform, lingual, and orbito-frontal gyrus). These findings provide further evidence that brain anatomy is associated with gender identity, where measures in MTF transsexuals appear to be shifted away from gender-congruent men.

The effect of an intervention to break the gender bias habit for faculty at one institution: a cluster randomized, controlled trial.

PubMed

Carnes, Molly; Devine, Patricia G; Baier Manwell, Linda; Byars-Winston, Angela; Fine, Eve; Ford, Cecilia E; Forscher, Patrick; Isaac, Carol; Kaatz, Anna; Magua, Wairimu; Palta, Mari; Sheridan, Jennifer

2015-02-01

Despite sincere commitment to egalitarian, meritocratic principles, subtle gender bias persists, constraining women's opportunities for academic advancement. The authors implemented a pair-matched, single-blind, cluster randomized, controlled study of a gender-bias-habit-changing intervention at a large public university. Participants were faculty in 92 departments or divisions at the University of Wisconsin-Madison. Between September 2010 and March 2012, experimental departments were offered a gender-bias-habit-changing intervention as a 2.5-hour workshop. Surveys measured gender bias awareness; motivation, self-efficacy, and outcome expectations to reduce bias; and gender equity action. A timed word categorization task measured implicit gender/leadership bias. Faculty completed a work-life survey before and after all experimental departments received the intervention. Control departments were offered workshops after data were collected. Linear mixed-effects models showed significantly greater changes post intervention for faculty in experimental versus control departments on several outcome measures, including self-efficacy to engage in gender-equity-promoting behaviors (P = .013). When ≥ 25% of a department's faculty attended the workshop (26 of 46 departments), significant increases in self-reported action to promote gender equity occurred at three months (P = .007). Post intervention, faculty in experimental departments expressed greater perceptions of fit (P = .024), valuing of their research (P = .019), and comfort in raising personal and professional conflicts (P = .025). An intervention that facilitates intentional behavioral change can help faculty break the gender bias habit and change department climate in ways that should support the career advancement of women in academic medicine, science, and engineering.

Do students' and authors' genders affect evaluations? A linguistic analysis of Medical Student Performance Evaluations.

PubMed

Isaac, Carol; Chertoff, Jocelyn; Lee, Barbara; Carnes, Molly

2011-01-01

Recent guidelines for the Medical Student Performance Evaluation (MSPE) have standardized the "dean's letter." The authors examined MSPEs for linguistic differences according to student or author gender. This 2009 study analyzed 297 MSPEs for 227 male and 70 female medical students applying to a diagnostic radiology residency program. Text analysis software identified word counts, categories, frequencies, and contexts; factor analysis detected patterns of word categories in student-author gender pairings. Analyses showed a main effect for student gender (P=.046) and a group difference for the author-student gender combinations (P=.048). Female authors of male student MSPEs used the fewest "positive emotion" words (P=.006). MSPEs by male authors were shorter than those by females (P=.014). MSPEs for students ranked in the National Resident Matching Program contained more "standout" (P=.002) and "positive emotion" (P=.001) words. There were no differences in the author-gender pairs in the proportion of students ranked, although predominant word categories differed by author and student gender. Factor analysis revealed differences among the author-student groups in patterns of correlations among word categories. MSPEs differed slightly but significantly by student and author gender. These differences may derive from societal norms for male and female behaviors and the subsequent linguistic interpretation of these behaviors, which itself may be colored by the observer's gender. Although the differences in MSPEs did not seem to influence students' rankings, this work underscores the need for awareness of the complex effects of gender in evaluating students and guiding their specialty choices.

Regional cerebral blood flow correlates of the severity of writer's cramp symptoms.

PubMed

Lerner, Alicja; Shill, Holly; Hanakawa, Takashi; Bushara, Khalaf; Goldfine, Andrew; Hallett, Mark

2004-03-01

Writer's cramp is a type of idiopathic focal dystonia with incompletely understood pathophysiology. Recent studies provide evidence that one element might be a sensory processing defect. We performed a PET study with O(15) H(2)O to find out in which brain areas activity correlates with the severity of writer's cramp symptoms. We studied 10 patients with writer's cramp and 10 age- and gender-matched control subjects. There were seven conditions, each repeated twice: rest, writing, tapping with index finger for 2, 3, 4, and 5 min. For each scan, we obtained EMG recordings from the flexor digitorum superficialis (FDS), extensor indicis proprius (EIP) muscles, and a subjective score of severity of dystonia. Scans were realigned, normalized, smoothed, and analyzed using SPM99. Analysis included both intra- and intergroup comparisons and a correlation analysis where we used EMG recordings and subjective dystonia score as covariates. Random effect analysis of the writing task showed overactivity of the primary sensory cortex and no significant underactivity. Correlation analysis of dystonia patients showed activation of SI when we used the subjective dystonia score as a covariate, and activation of both the SI and primary motor cortex when the normalized EMG score of FDS was used. While some overactivity of MI is not surprising, overactivity of SI is more dramatic and suggests a primary deficit in processing sensory feedback. Writer's cramp may arise in part as a dysfunction of sensory circuits, which causes defective sensorimotor integration resulting in co-contractions of muscles and overflow phenomena.

Estimation and comparison of salivary immunoglobulin A levels in tobacco chewers, tobacco smokers and normal subjects.

PubMed

Doni, Bharati R; Patil, Santosh; Peerapur, Basavaraj V; Kadaganchi, Harish; Bhat, Kishore G

2013-06-01

To estimate the salivary immunoglobulin A (IgA) levels in tobacco chewers, tobacco smokers and normal subjects and to compare the salivary IgA levels among tobacco chewers and tobacco smokers. The study group consisted of 80 subjects (tobacco users), 40 tobacco chewers and 40 tobacco smokers. Unstimulated whole saliva was collected from all tobacco users and 40 healthy age- and gender-matched non-tobacco users as control group. The study and control groups were divided into four subgroups based on age range. Salivary IgA levels were estimated by single radial immunodiffusion assay (SRID). All data were analysed using statistical software and to compare the results in three groups, single-factor analysis of variance was applied. The mean salivary IgA level in control group was 16.76 ± 1.37 mg/dl (SD); in tobacco chewers it was 7.89 ± 0.61 mg/dl (SD) and in tobacco smokers it was 6.55 ± 0.99 mg/dl (SD). The salivary IgA levels were decreased in tobacco chewers and tobacco smokers compared with the controls. Among the tobacco users, tobacco smokers had much reduced salivary IgA levels compared to tobacco chewers. All of these results were highly significant (P<0.001). The present study showed that tobacco chewers and tobacco smokers had decreased salivary IgA levels and among tobacco users, tobacco smokers had much reduced salivary IgA levels compared to tobacco chewers in unstimulated whole saliva.

Scale-free dynamics of the synchronization between sleep EEG power bands and the high frequency component of heart rate variability in normal men and patients with sleep apnea-hypopnea syndrome.

PubMed

Dumont, Martine; Jurysta, Fabrice; Lanquart, Jean-Pol; Noseda, André; van de Borne, Philippe; Linkowski, Paul

2007-12-01

To investigate the dynamics of the synchronization between heart rate variability and sleep electroencephalogram power spectra and the effect of sleep apnea-hypopnea syndrome. Heart rate and sleep electroencephalogram signals were recorded in controls and patients with sleep apnea-hypopnea syndrome that were matched for age, gender, sleep parameters, and blood pressure. Spectral analysis was applied to electrocardiogram and electroencephalogram sleep recordings to obtain power values every 20s. Synchronization likelihood was computed between time series of the normalized high frequency spectral component of RR-intervals and all electroencephalographic frequency bands. Detrended fluctuation analysis was applied to the synchronizations in order to qualify their dynamic behaviors. For all sleep bands, the fluctuations of the synchronization between sleep EEG and heart activity appear scale free and the scaling exponent is close to one as for 1/f noise. We could not detect any effect due to sleep apnea-hypopnea syndrome. The synchronizations between the high frequency component of heart rate variability and all sleep power bands exhibited robust fluctuations characterized by self-similar temporal behavior of 1/f noise type. No effects of sleep apnea-hypopnea syndrome were observed in these synchronizations. Sleep apnea-hypopnea syndrome does not affect the interdependence between the high frequency component of heart rate variability and all sleep power bands as measured by synchronization likelihood.

Role of Paraoxonase 1 Activity and Oxidative/Antioxidative Stress Markers in Patients with Acute Cerebral Infarction.

PubMed

Zhu, Hui; Zhao, Teng; Liu, Jingyao

2018-06-01

Paraoxonase1 (PON1) is an antioxidant which confers antioxidant properties to high-density lipoprotein (HDL) and prevents low-density lipoprotein (LDL) oxidation. The purpose of this study was to evaluate the activities of PON1 and oxidative/antioxidative stress markers in acute cerebral infarction. In this study, 161 patients diagnosed with acute cerebral infarction and 161 gender- and age-matched healthy controls were recruited. Based on the clinicoradiological profiles, the patients were further classified into two groups: lacunar infarction group and large-artery atherosclerosis group. We measured the individual lipid status parameters, oxidative and antioxidative stress status parameters, and PON1 activity. Serum total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and oxidative stress parameters in patients with acute cerebral infarction were significantly higher than those in the normal controls (p < 0.05). High-density lipoprotein cholesterol (HDL-C) level, PON1 activity, superoxide dismutase (SOD) activity, and antioxidative stress parameters in patients were lower than in the normal controls (p < 0.05). Superoxide anion (O2-), malondialdehyde (MDA), and PON1 levels in the lacunar infarction group were lower than in the large-artery atherosclerosis group (p < 0.05). Oxidative stress markers and PON1 activity are sensitive indicators of acute cerebral infarction. Our findings suggest a severely impaired antioxidative protection mechanism in these patients. Our study provides new insights into the pathophysiological mechanisms of acute cerebral infarction, which may also provide new therapeutic targets for ischemic cerebrovascular diseases.

Alterations in regional homogeneity of baseline brain activity in pediatric temporal lobe epilepsy.

PubMed

Mankinen, Katariina; Long, Xiang-Yu; Paakki, Jyri-Johan; Harila, Marika; Rytky, Seppo; Tervonen, Osmo; Nikkinen, Juha; Starck, Tuomo; Remes, Jukka; Rantala, Heikki; Zang, Yu-Feng; Kiviniemi, Vesa

2011-02-10

Recent findings on intracortical EEG measurements show that the synchrony of localized neuronal networks is altered in epileptogenesis, leading to generalized seizure activity via connector hubs in the neuronal networks. Regional homogeneity (ReHo) analysis of blood oxygen level-dependent (BOLD) signals has demonstrated localized signal synchrony and disease-related alterations in a number of instances. We wanted to find out whether the ReHo of resting-state activity can be used to detect regional signal synchrony alterations in children with non-lesional temporal lobe epilepsy (TLE). Twenty-one TLE patients were compared with age and gender-matched healthy controls. Significantly increased ReHo was discovered in the posterior cingulate gyrus and the right medial temporal lobe of the patients, and they also had significantly decreased ReHo in the cerebellum compared with the healthy controls. However, the alterations in ReHo differed between the patients with normal and abnormal interictal EEGs, the latter showing significantly increased ReHo in the right fusiform gyrus and significantly decreased ReHo in the right medial frontal gyrus relative to the controls, while those with normal EEGs had significantly increased ReHo in the right inferior temporal gyrus and the left posterior cingulate gyrus. We conclude that altered BOLD signal synchrony can be detected in the cerebral and cerebellar cortices of children with TLE even in the absence of interictal EEG abnormalities. Copyright © 2010 Elsevier B.V. All rights reserved.