Sample records for gene encoding outer

  1. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    PubMed Central

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the Asd+ vector pYA292, and the construct was introduced into the avirulent delta cya delta crp delta asd S. typhimurium chi 3987 for oral immunization of birds. The gene encoding the 21-kDa protein was expressed equivalently in B. avium 197, delta asd E. coli chi 6097, and S. typhimurium chi 3987 and was localized primarily in the cytoplasmic membrane and outer membrane. In preliminary studies on oral inoculation of turkey poults with S. typhimurium chi 3987 expressing the gene encoding the B. avium 21-kDa protein, it was determined that a single dose of the recombinant Salmonella vaccine failed to elicit serum antibodies against the 21-kDa protein and challenge with wild-type B. avium 197 resulted in colonization of the trachea and thymus with B. avium 197. Images PMID:1447140

  2. Outer membrane defect and stronger biofilm formation caused by inactivation of a gene encoding for heptosyltransferase I in Cronobacter sakazakii ATCC BAA-894.

    PubMed

    Wang, L; Hu, X; Tao, G; Wang, X

    2012-05-01

    To investigate the role of lipopolysaccharide (LPS) structure in the stability of outer membrane and the ability of biofilm formation in Cronobacter sakazakii. A C. sakazakii mutant strain LWW02 was constructed by inactivating the gene ESA_04107 encoding for heptosyltransferase I. LPS were purified from LWW02, and changes in their structure were confirmed by thin-layer chromatography and electrospray ionization mass spectrometry. Comparing with the wild-type strain BAA-894, slower growth, higher membrane permeability, higher surface hydrophobicity, stronger ability of autoaggregation and biofilm formation were observed for the mutant strain LWW02. The gene ESA_04107 encodes heptosyltransferase I in C. sakazakii ATCC BAA-894. The cleavage of LPS in C. sakazakii could cause its outer membrane defects and increase its ability to form biofilms. The study is important for understanding the pathogenic mechanism and efficient control of C. sakazakii. © 2012 The Authors. Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

  3. [Expression changes of major outer membrane protein antigens in Leptospira interrogans during infection and its mechanism].

    PubMed

    Zheng, Linli; Ge, Yumei; Hu, Weilin; Yan, Jie

    2013-03-01

    To determine expression changes of major outer membrane protein(OMP) antigens of Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai strain Lai during infection of human macrophages and its mechanism. OmpR encoding genes and OmpR-related histidine kinase (HK) encoding gene of L.interrogans strain Lai and their functional domains were predicted using bioinformatics technique. mRNA level changes of the leptospiral major OMP-encoding genes before and after infection of human THP-1 macrophages were detected by real-time fluorescence quantitative RT-PCR. Effects of the OmpR-encoding genes and HK-encoding gene on the expression of leptospiral OMPs during infection were determined by HK-peptide antiserum block assay and closantel inhibitive assays. The bioinformatics analysis indicated that LB015 and LB333 were referred to OmpR-encoding genes of the spirochete, while LB014 might act as a OmpR-related HK-encoding gene. After the spirochete infecting THP-1 cells, mRNA levels of leptospiral lipL21, lipL32 and lipL41 genes were rapidly and persistently down-regulated (P <0.01), whereas mRNA levels of leptospiral groEL, mce, loa22 and ligB genes were rapidly but transiently up-regulated (P<0.01). The treatment with closantel and HK-peptide antiserum partly reversed the infection-based down-regulated mRNA levels of lipL21 and lipL48 genes (P <0.01). Moreover, closantel caused a decrease of the infection-based up-regulated mRNA levels of groEL, mce, loa22 and ligB genes (P <0.01). Expression levels of L.interrogans strain Lai major OMP antigens present notable changes during infection of human macrophages. There is a group of OmpR-and HK-encoding genes which may play a major role in down-regulation of expression levels of partial OMP antigens during infection.

  4. Three copies of a single protein II-encoding sequence in the genome of Neisseria gonorrhoeae JS3: evidence for gene conversion and gene duplication.

    PubMed

    van der Ley, P

    1988-11-01

    Gonococci express a family of related outer membrane proteins designated protein II (P.II). These surface proteins are subject to both phase variation and antigenic variation. The P.II gene repertoire of Neisseria gonorrhoeae strain JS3 was found to consist of at least ten genes, eight of which were cloned. Sequence analysis and DNA hybridization studies revealed that one particular P.II-encoding sequence is present in three distinct, but almost identical, copies in the JS3 genome. These genes encode the P.II protein that was previously identified as P.IIc. Comparison of their sequences shows that the multiple copies of this P.IIc-encoding gene might have been generated by both gene conversion and gene duplication.

  5. Biochemical characterization of an ABC transporter LptBFGC complex required for the outer membrane sorting of lipopolysaccharides.

    PubMed

    Narita, Shin-ichiro; Tokuda, Hajime

    2009-07-07

    Seven Lpt proteins (A through G) are thought to be involved in lipopolysaccharide transport from the inner to outer membrane of Escherichia coli. LptB belongs to the ATP-binding cassette transporter superfamily. Although the lptB gene lacks neighboring genes encoding membrane subunits, bioinformatic analyses recently indicated that two distantly located consecutive genes, lptF and lptG, could encode membrane subunits. To examine this possibility, LptB was expressed with LptF and LptG. We report here that both LptF and LptG formed a complex with LptB. Furthermore, an inner membrane protein, LptC, which had been implicated in lipopolysaccharide transport, was also included in this complex.

  6. A Shigella flexneri Virulence Plasmid Encoded Factor Controls Production of Outer Membrane Vesicles

    PubMed Central

    Sidik, Saima; Kottwitz, Haila; Benjamin, Jeremy; Ryu, Julie; Jarrar, Ameer; Garduno, Rafael; Rohde, John R.

    2014-01-01

    Shigella spp. use a repertoire of virulence plasmid-encoded factors to cause shigellosis. These include components of a Type III Secretion Apparatus (T3SA) that is required for invasion of epithelial cells and many genes of unknown function. We constructed an array of 99 deletion mutants comprising all genes encoded by the virulence plasmid (excluding those known to be required for plasmid maintenance) of Shigella flexneri. We screened these mutants for their ability to bind the dye Congo red: an indicator of T3SA function. This screen focused our attention on an operon encoding genes that modify the cell envelope including virK, a gene of partially characterized function. We discovered that virK is required for controlled release of proteins to the culture supernatant. Mutations in virK result in a temperature-dependent overproduction of outer membrane vesicles (OMVs). The periplasmic chaperone/protease DegP, a known regulator of OMV production in Escherichia coli (encoded by a chromosomal gene), was found to similarly control OMV production in S. flexneri. Both virK and degP show genetic interactions with mxiD, a structural component of the T3SA. Our results are consistent with a model in which VirK and DegP relieve the periplasmic stress that accompanies assembly of the T3SA. PMID:25378474

  7. Brucella ovis PA mutants for outer membrane proteins Omp10, Omp19, SP41, and BepC are not altered in their virulence and outer membrane properties.

    PubMed

    Sidhu-Muñoz, Rebeca S; Sancho, Pilar; Vizcaíno, Nieves

    2016-04-15

    Mutants in several genes have been obtained on the genetic background of virulent rough (lacking O-polysaccharide) Brucella ovis PA. The target genes encode outer membrane proteins previously associated with the virulence of smooth (bearing O-polysaccharide chains in the lipopolysaccharide) Brucella strains. Multiple attempts to delete omp16, coding for a homologue to peptidoglycan-associated lipoproteins, were unsuccessful, which suggests that Omp16 is probably essential for in vitro survival of B. ovis PA. Single deletion of omp10 or omp19-that encode two other outer membrane lipoproteins--was achieved, but the simultaneous removal of both genes failed, suggesting an essential complementary function between both proteins. Two other deletion mutants, defective in the Tol-C-homologue BepC or in the SP41 adhesin, were also obtained. Surprisingly when compared to previous results obtained with smooth Brucella, none of the B. ovis mutants showed attenuation in the virulence, either in the mouse model or in cellular models of professional and non-professional phagocytes. Additionally, and in contrast to the observations reported with smooth Brucella strains, several properties related to the outer membrane remained almost unaltered. These results evidence new distinctive traits between naturally rough B. ovis and smooth brucellae. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Cag3 Is a Novel Essential Component of the Helicobacter pylori Cag Type IV Secretion System Outer Membrane Subcomplex ▿ †

    PubMed Central

    Pinto-Santini, Delia M.; Salama, Nina R.

    2009-01-01

    Helicobacter pylori strains harboring the cag pathogenicity island (PAI) have been associated with more severe gastric disease in infected humans. The cag PAI encodes a type IV secretion (T4S) system required for CagA translocation into host cells as well as induction of proinflammatory cytokines, such as interleukin-8 (IL-8). cag PAI genes sharing sequence similarity with T4S components from other bacteria are essential for Cag T4S function. Other cag PAI-encoded genes are also essential for Cag T4S, but lack of sequence-based or structural similarity with genes in existing databases has precluded a functional assignment for the encoded proteins. We have studied the role of one such protein, Cag3 (HP0522), in Cag T4S and determined Cag3 subcellular localization and protein interactions. Cag3 is membrane associated and copurifies with predicted inner and outer membrane Cag T4S components that are essential for Cag T4S as well as putative accessory factors. Coimmunoprecipitation and cross-linking experiments revealed specific interactions with HpVirB7 and CagM, suggesting Cag3 is a new component of the Cag T4S outer membrane subcomplex. Finally, lack of Cag3 lowers HpVirB7 steady-state levels, further indicating Cag3 makes a subcomplex with this protein. PMID:19801411

  9. Genomic analyses of bacterial porin-cytochrome gene clusters

    DOE PAGES

    Shi, Liang; Fredrickson, James K.; Zachara, John M.

    2014-11-26

    In this study, the porin-cytochrome (Pcc) protein complex is responsible for trans-outer membrane electron transfer during extracellular reduction of Fe(III) by the dissimilatory metal-reducing bacterium Geobacter sulfurreducens PCA. The identified and characterized Pcc complex of G. sulfurreducens PCA consists of a porin-like outer-membrane protein, a periplasmic 8-heme c type cytochrome (c-Cyt) and an outer-membrane 12-heme c-Cyt, and the genes encoding the Pcc proteins are clustered in the same regions of genome (i.e., the pcc gene clusters) of G. sulfurreducens PCA. A survey of additionally microbial genomes has identified the pcc gene clusters in all sequenced Geobacter spp. and other bacteriamore » from six different phyla, including Anaeromyxobacter dehalogenans 2CP-1, A. dehalogenans 2CP-C, Anaeromyxobacter sp. K, Candidatus Kuenenia stuttgartiensis, Denitrovibrio acetiphilus DSM 12809, Desulfurispirillum indicum S5, Desulfurivibrio alkaliphilus AHT2, Desulfurobacterium thermolithotrophum DSM 11699, Desulfuromonas acetoxidans DSM 684, Ignavibacterium album JCM 16511, and Thermovibrio ammonificans HB-1. The numbers of genes in the pcc gene clusters vary, ranging from two to nine. Similar to the metal-reducing (Mtr) gene clusters of other Fe(III)-reducing bacteria, such as Shewanella spp., additional genes that encode putative c-Cyts with predicted cellular localizations at the cytoplasmic membrane, periplasm and outer membrane often associate with the pcc gene clusters. This suggests that the Pcc-associated c-Cyts may be part of the pathways for extracellular electron transfer reactions. The presence of pcc gene clusters in the microorganisms that do not reduce solid-phase Fe(III) and Mn(IV) oxides, such as D. alkaliphilus AHT2 and I. album JCM 16511, also suggests that some of the pcc gene clusters may be involved in extracellular electron transfer reactions with the substrates other than Fe(III) and Mn(IV) oxides.« less

  10. Ovule development: identification of stage-specific and tissue-specific cDNAs.

    PubMed Central

    Nadeau, J A; Zhang, X S; Li, J; O'Neill, S D

    1996-01-01

    A differential screening approach was used to identify seven ovule-specific cDNAs representing genes that are expressed in a stage-specific manner during ovule development. The Phalaenopsis orchid takes 80 days to complete the sequence of ovule developmental events, making it a good system to isolate stage-specific ovule genes. We constructed cDNA libraries from orchid ovule tissue during archesporial cell differentiation, megasporocyte formation, and the transition to meiosis, as well as during the final mitotic divisions of female gametophyte development. RNA gel blot hybridization analysis revealed that four clones were stage specific and expressed solely in ovule tissue, whereas one clone was specific to pollen tubes. Two other clones were not ovule specific. Sequence analysis and in situ hybridization revealed the identities and domain of expression of several of the cDNAs. O39 encodes a putative homeobox transcription factor that is expressed early in the differentiation of the ovule primordium; O40 encodes a cytochrome P450 monooxygenase (CYP78A2) that is pollen tube specific. O108 encodes a protein of unknown function that is expressed exclusively in the outer layer of the outer integument and in the female gametophyte of mature ovules. O126 encodes a glycine-rich protein that is expressed in mature ovules, and O141 encodes a cysteine proteinase that is expressed in the outer integument of ovules during seed formation. Sequences homologous to these ovule clones can now be isolated from other organisms, and this should facilitate their functional characterization. PMID:8742709

  11. Molecular characterization and expression of the M6 gene of grass carp hemorrhage virus (GCHV), an aquareovirus.

    PubMed

    Qiu, T; Lu, R H; Zhang, J; Zhu, Z Y

    2001-07-01

    The complete nucleotide sequence of M6 gene of grass carp hemorrhage virus (GCHV) was determined. It is 2039 nucleotides in length and contains a single large open reading frame that could encode a protein of 648 amino acids with predicted molecular mass of 68.7 kDa. Amino acid sequence comparison revealed that the protein encoded by GCHV M6 is closely related to the protein mu1 of mammalian reovirus. The M6 gene, encoding the major outer-capsid protein, was expressed using the pET fusion protein vector in Escherichia coli and detected by Western blotting using chicken anti-GCHV immunoglobulin (IgY). The result indicates that the protein encoded by M6 may share a putative Asn-42-Pro-43 proteolytic cleavage site with mu1.

  12. Identification and characterization of the gltK gene encoding a membrane-associated glucose transport protein of pseudomonas aeruginosa.

    PubMed

    Adewoye, L O; Worobec, E A

    2000-08-08

    The Pseudomonas aeruginosa oprB gene encodes the carbohydrate-selective OprB porin, which translocates substrate molecules across the outer membrane to the periplasmic glucose-binding protein. We identified and cloned two open reading frames (ORFs) flanking the oprB gene but are not in operonic arrangement with the oprB gene. The downstream ORF encodes a putative polypeptide homologous to members of a family of transcriptional repressors, whereas the oprB gene is preceded by an ORF encoding a putative product, which exhibits strong homology to several carbohydrate transport ATP-binding cassette (ABC) proteins. The genomic copy of the upstream ORF was mutagenized by homologous recombination. Analysis of the deletion mutant in comparison with the wild type revealed a significant reduction in [14C] glucose transport activity in the mutant strain, suggesting that this ORF likely encodes the inner membrane component of the glucose ABC transporter. It is thus designated gltK gene to reflect its homology to the Pseudomona fluorescens mtlK and its involvement in the high-affinity glucose transport system. Multiple alignment analysis revealed that the P. aeruginosa gltK gene product is a member of the MalK subfamily of ABC proteins.

  13. Adaptations Required for Mitochondrial Import following Mitochondrial to Nucleus Gene Transfer of Ribosomal Protein S101[w

    PubMed Central

    Murcha, Monika W.; Rudhe, Charlotta; Elhafez, Dina; Adams, Keith L.; Daley, Daniel O.; Whelan, James

    2005-01-01

    The minimal requirements to support protein import into mitochondria were investigated in the context of the phenomenon of ongoing gene transfer from the mitochondrion to the nucleus in plants. Ribosomal protein 10 of the small subunit is encoded in the mitochondrion in soybean and many other angiosperms, whereas in several other species it is nuclear encoded and thus must be imported into the mitochondrial matrix to function. When encoded by the nuclear genome, it has adopted different strategies for mitochondrial targeting and import. In lettuce (Lactuca sativa) and carrot (Daucus carota), Rps10 independently gained different N-terminal extensions from other genes, following transfer to the nucleus. (The designation of Rps10 follows the following convention. The gene is indicated in italics. If encoded in the mitochondrion, it is rps10; if encoded in the nucleus, it is Rps10.) Here, we show that the N-terminal extensions of Rps10 in lettuce and carrot are both essential for mitochondrial import. In maize (Zea mays), Rps10 has not acquired an extension upon transfer but can be readily imported into mitochondria. Deletion analysis located the mitochondrial targeting region to the first 20 amino acids. Using site directed mutagenesis, we changed residues in the first 20 amino acids of the mitochondrial encoded soybean (Glycine max) rps10 to the corresponding amino acids in the nuclear encoded maize Rps10 until import was achieved. Changes were required that altered charge, hydrophobicity, predicted ability to form an amphiphatic α-helix, and generation of a binding motif for the outer mitochondrial membrane receptor, translocase of the outer membrane 20. In addition to defining the changes required to achieve mitochondrial localization, the results demonstrate that even proteins that do not present barriers to import can require substantial changes to acquire a mitochondrial targeting signal. PMID:16040655

  14. An animal model for Norrie disease (ND): gene targeting of the mouse ND gene.

    PubMed

    Berger, W; van de Pol, D; Bächner, D; Oerlemans, F; Winkens, H; Hameister, H; Wieringa, B; Hendriks, W; Ropers, H H

    1996-01-01

    In order to elucidate the cellular and molecular processes which are involved in Norrie disease (ND), we have used gene targeting technology to generate ND mutant mice. The murine homologue of the ND gene was cloned and shown to encode a polypeptide that shares 94% of the amino acid sequence with its human counterpart. RNA in situ hybridization revealed expression in retina, brain and the olfactory bulb and epithelium of 2 week old mice. Hemizygous mice carrying a replacement mutation in exon 2 of the ND gene developed retrolental structures in the vitreous body and showed an overall disorganization of the retinal ganglion cell layer. The outer plexiform layer disappears occasionally, resulting in a juxtaposed inner and outer nuclear layer. At the same regions, the outer segments of the photoreceptor cell layer are no longer present. These ocular findings are consistent with observations in ND patients and the generated mouse line provides a faithful model for study of early pathogenic events in this severe X-linked recessive neurological disorder.

  15. Detection of Rickettsia and Ehrlichia spp. in Ticks Associated with Exotic Reptiles and Amphibians Imported into Japan.

    PubMed

    Andoh, Masako; Sakata, Akiko; Takano, Ai; Kawabata, Hiroki; Fujita, Hiromi; Une, Yumi; Goka, Koichi; Kishimoto, Toshio; Ando, Shuji

    2015-01-01

    One of the major routes of transmission of rickettsial and ehrlichial diseases is via ticks that infest numerous host species, including humans. Besides mammals, reptiles and amphibians also carry ticks that may harbor Rickettsia and Ehrlichia strains that are pathogenic to humans. Furthermore, reptiles and amphibians are exempt from quarantine in Japan, thus facilitating the entry of parasites and pathogens to the country through import. Accordingly, in the current study, we examined the presence of Rickettsia and Ehrlichia spp. genes in ticks associated with reptiles and amphibians originating from outside Japan. Ninety-three ticks representing nine tick species (genera Amblyomma and Hyalomma) were isolated from at least 28 animals spanning 10 species and originating from 12 countries (Ghana, Jordan, Madagascar, Panama, Russia, Sri Lanka, Sudan, Suriname, Tanzania, Togo, Uzbekistan, and Zambia). None of the nine tick species are indigenous in Japan. The genes encoding the common rickettsial 17-kDa antigen, citrate synthase (gltA), and outer membrane protein A (ompA) were positively detected in 45.2% (42/93), 40.9% (38/93), and 23.7% (22/93) of the ticks, respectively, by polymerase chain reaction (PCR). The genes encoding ehrlichial heat shock protein (groEL) and major outer membrane protein (omp-1) were PCR-positive in 7.5% (7/93) and 2.2% (2/93) of the ticks, respectively. The p44 gene, which encodes the Anaplasma outer membrane protein, was not detected. Phylogenetic analysis showed that several of the rickettsial and ehrlichial sequences isolated in this study were highly similar to human pathogen genes, including agents not previously detected in Japan. These data demonstrate the global transportation of pathogenic Rickettsia and Ehrlichia through reptile- and amphibian-associated ticks. These imported animals have potential to transfer pathogens into human life. These results highlight the need to control the international transportation of known and potential pathogens carried by ticks in reptiles, amphibians, and other animals, in order to improve national and international public health.

  16. A Cluster of Five Genes Essential for the Utilization of Dihydroxamate Xenosiderophores in Synechocystis sp. PCC 6803.

    PubMed

    Obando S, Tobias A; Babykin, Michael M; Zinchenko, Vladislav V

    2018-05-21

    The unicellular freshwater cyanobacterium Synechocystis sp. PCC 6803 is capable of using dihydroxamate xenosiderophores, either ferric schizokinen (FeSK) or a siderophore of the filamentous cyanobacterium Anabaena variabilis ATCC 29413 (SAV), as the sole source of iron in the TonB-dependent manner. The fecCDEB1-schT gene cluster encoding a siderophore transport system that is involved in the utilization of FeSK and SAV in Synechocystis sp. PCC 6803 was identified. The gene schT encodes TonB-dependent outer membrane transporter, whereas the remaining four genes encode the ABC-type transporter FecB1CDE formed by the periplasmic binding protein FecB1, the transmembrane permease proteins FecC and FecD, and the ATPase FecE. Inactivation of any of these genes resulted in the inability of cells to utilize FeSK and SAV. Our data strongly suggest that Synechocystis sp. PCC 6803 can readily internalize Fe-siderophores via the classic TonB-dependent transport system.

  17. Comprehensive Analysis of Transport Proteins Encoded Within the Genome of Bdellovibrio bacteriovorus

    PubMed Central

    Barabote, Ravi D.; Rendulic, Snjezana; Schuster, Stephan C.; Saier, Milton H.

    2012-01-01

    Bdellovibrio bacteriovorus is a bacterial parasite with an unusual lifestyle. It grows and reproduces in the periplasm of a host prey bacterium. The complete genome sequence of B. bacteriovorus has recently been reported. We have reanalyzed the transport proteins encoded within the B. bacteriovorus genome according to the current content of the transporter classification database (TCDB). A comprehensive analysis is given on the types and numbers of transport systems that B. bacteriovorus has. In this regard, the potential protein secretory capabilities of at least 4 types of inner membrane secretion systems and 5 types for outer membrane secretion are described. Surprisingly, B. bacteriovorus has a disproportionate percentage of cytoplasmic membrane channels and outer membrane porins. It has far more TonB/ExbBD-type systems and MotAB-type systems for energizing outer membrane transport and motility than does E. coli. Analysis of probable substrate specificities of its transporters provides clues to its metabolic preferences. Interesting examples of gene fusions and of potentially overlapping genes were also noted. Our analyses provide a comprehensive, detailed appreciation of the transport capabilities of B. bacteriovorus. They should serve as a guide for functional experimental analyses. PMID:17706914

  18. Quantum changes in Helicobacter pylori gene expression accompany host-adaptation

    PubMed Central

    Wise, Michael J.; Khosravi, Yalda; Seow, Shih-Wee; Amoyo, Arlaine A.; Pettersson, Sven; Peters, Fanny; Tay, Chin-Yen; Perkins, Timothy T.; Loke, Mun-Fai; Marshall, Barry J.; Vadivelu, Jamuna

    2017-01-01

    Abstract Helicobacter pylori is a highly successful gastric pathogen. High genomic plasticity allows its adaptation to changing host environments. Complete genomes of H. pylori clinical isolate UM032 and its mice-adapted serial derivatives 298 and 299, generated using both PacBio RS and Illumina MiSeq sequencing technologies, were compared to identify novel elements responsible for host-adaptation. The acquisition of a jhp0562-like allele, which encodes for a galactosyltransferase, was identified in the mice-adapted strains. Our analysis implies a new β-1,4-galactosyltransferase role for this enzyme, essential for Ley antigen expression. Intragenomic recombination between babA and babB genes was also observed. Further, we expanded on the list of candidate genes whose expression patterns have been mediated by upstream homopolymer-length alterations to facilitate host adaption. Importantly, greater than four-fold reduction of mRNA levels was demonstrated in five genes. Among the down-regulated genes, three encode for outer membrane proteins, including BabA, BabB and HopD. As expected, a substantial reduction in BabA protein abundance was detected in mice-adapted strains 298 and 299 via Western analysis. Our results suggest that the expression of Ley antigen and reduced outer membrane protein expressions may facilitate H. pylori colonisation of mouse gastric epithelium. PMID:27803027

  19. Jail fever (epidemic typhus) outbreak in Burundi.

    PubMed

    Raoult, D; Roux, V; Ndihokubwayo, J B; Bise, G; Baudon, D; Marte, G; Birtles, R

    1997-01-01

    We recently investigated a suspected outbreak of epidemic typhus in a jail in Burundi. We tested sera of nine patients by microimmunofluorescence for antibodies to Rickettsia prowazekii and Rickettsia typhi. We also amplified and sequenced from lice gene portions specific for two R. prowazekii proteins: the gene encoding for citrate synthase and the gene encoding for the rickettsial outer membrane protein. All patients exhibited antibodies specific for R. prowazekii. Specific gene sequences were amplified in two lice from one patient. The patients had typical clinical manifestations, and two died. Molecular techniques provided a convenient and reliable means of examining lice and confirming this outbreak. The jail-associated outbreak predates an extensive ongoing outbreak of louse-borne typhus in central eastern Africa after civil war and in refugee camps in Rwanda, Burundi (1), and Zaire.

  20. Jail fever (epidemic typhus) outbreak in Burundi.

    PubMed Central

    Raoult, D.; Roux, V.; Ndihokubwayo, J. B.; Bise, G.; Baudon, D.; Marte, G.; Birtles, R.

    1997-01-01

    We recently investigated a suspected outbreak of epidemic typhus in a jail in Burundi. We tested sera of nine patients by microimmunofluorescence for antibodies to Rickettsia prowazekii and Rickettsia typhi. We also amplified and sequenced from lice gene portions specific for two R. prowazekii proteins: the gene encoding for citrate synthase and the gene encoding for the rickettsial outer membrane protein. All patients exhibited antibodies specific for R. prowazekii. Specific gene sequences were amplified in two lice from one patient. The patients had typical clinical manifestations, and two died. Molecular techniques provided a convenient and reliable means of examining lice and confirming this outbreak. The jail-associated outbreak predates an extensive ongoing outbreak of louse-borne typhus in central eastern Africa after civil war and in refugee camps in Rwanda, Burundi (1), and Zaire. PMID:9284381

  1. Complete genome sequence of Nitrosospira multiformis, an ammonia-oxidizing bacterium from the soil environment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Norton, Jeanette M.; Klotz, Martin G; Stein, Lisa Y

    2008-01-01

    The complete genome of the ammonia-oxidizing bacterium, Nitrosospira multiformis (ATCC 25196T), consists of a circular chromosome and three small plasmids totaling 3,234,309 bp and encoding 2827 putative proteins. Of these, 2026 proteins have predicted functions and 801 are without conserved functional domains, yet 747 of these have similarity to other predicted proteins in databases. Gene homologs from Nitrosomonas europaea and N. eutropha were the best match for 42% of the predicted genes in N. multiformis. The genome contains three nearly identical copies of amo and hao gene clusters as large repeats. Distinguishing features compared to N. europaea include: the presencemore » of gene clusters encoding urease and hydrogenase, a RuBisCO-encoding operon of distinctive structure and phylogeny, and a relatively small complement of genes related to Fe acquisition. Systems for synthesis of a pyoverdine-like siderophore and for acyl-homoserine lactone were unique to N. multiformis among the sequenced AOB genomes. Gene clusters encoding proteins associated with outer membrane and cell envelope functions including transporters, porins, exopolysaccharide synthesis, capsule formation and protein sorting/export were abundant. Numerous sensory transduction and response regulator gene systems directed towards sensing of the extracellular environment are described. Gene clusters for glycogen, polyphosphate and cyanophycin storage and utilization were identified providing mechanisms for meeting energy requirements under substrate-limited conditions. The genome of N. multiformis encodes the core pathways for chemolithoautotrophy along with adaptations for surface growth and survival in soil environments.« less

  2. Transcriptional Profiling of Caulobacter crescentus during Growth on Complex and Minimal Media

    PubMed Central

    Hottes, Alison K.; Meewan, Maliwan; Yang, Desiree; Arana, Naomi; Romero, Pedro; McAdams, Harley H.; Stephens, Craig

    2004-01-01

    Microarray analysis was used to examine gene expression in the freshwater oligotrophic bacterium Caulobacter crescentus during growth on three standard laboratory media, including peptone-yeast extract medium (PYE) and minimal salts medium with glucose or xylose as the carbon source. Nearly 400 genes (approximately 10% of the genome) varied significantly in expression between at least two of these media. The differentially expressed genes included many encoding transport systems, most notably diverse TonB-dependent outer membrane channels of unknown substrate specificity. Amino acid degradation pathways constituted the largest class of genes induced in PYE. In contrast, many of the genes upregulated in minimal media encoded enzymes for synthesis of amino acids, including incorporation of ammonia and sulfate into glutamate and cysteine. Glucose availability induced expression of genes encoding enzymes of the Entner-Doudoroff pathway, which was demonstrated here through mutational analysis to be essential in C. crescentus for growth on glucose. Xylose induced expression of genes encoding several hydrolytic exoenzymes as well as an operon that may encode a novel pathway for xylose catabolism. A conserved DNA motif upstream of many xylose-induced genes was identified and shown to confer xylose-specific expression. Xylose is an abundant component of xylan in plant cell walls, and the microarray data suggest that in addition to serving as a carbon source for growth of C. crescentus, this pentose may be interpreted as a signal to produce enzymes associated with plant polymer degradation. PMID:14973021

  3. Cloning of the Pseudomonas aeruginosa outer membrane porin protein P gene: evidence for a linked region of DNA homology.

    PubMed Central

    Siehnel, R J; Worobec, E A; Hancock, R E

    1988-01-01

    The gene encoding the outer membrane phosphate-selective porin protein P from Pseudomonas aeruginosa was cloned into Escherichia coli. The protein product was expressed and transported to the outer membrane of an E. coli phoE mutant and assembled into functional trimers. Expression of a product of the correct molecular weight was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot (immunoblot) analysis, using polyclonal antibodies to protein P monomer and trimer forms. Protein P trimers were partially purified from the E. coli clone and shown to form channels with the same conductance as those formed by protein P from P. aeruginosa. The location and orientation of the protein P-encoding (oprP) gene on the cloned DNA was identified by three methods: (i) mapping the insertion point of transposon Tn501 in a previously isolated P. aeruginosa protein P-deficient mutant; (ii) hybridization of restriction fragments from the cloned DNA to an oligonucleotide pool synthesized on the basis of the amino-terminal protein sequence of protein P; and (iii) fusion of a PstI fragment of the cloned DNA to the amino terminus of the beta-galactosidase gene of pUC8, producing a fusion protein that contained protein P-antigenic epitopes. Structural analysis of the cloned DNA and P. aeruginosa chromosomal DNA revealed the presence of two adjacent PstI fragments which cross-hybridized, suggesting a possible gene duplication. The P-related (PR) region hybridized to the oligonucleotide pool described above. When the PstI fragment which contained the PR region was fused to the beta-galactosidase gene of pUC8, a fusion protein was produced which reacted with a protein P-specific antiserum. However, the restriction endonuclease patterns of the PR region and the oprP gene differed significantly beyond the amino-terminal one-third of the two genes. Images PMID:2834340

  4. Disruption of the processing alpha-mannosidase gene does not prevent outer chain synthesis in Saccharomyces cerevisiae.

    PubMed

    Puccia, R; Grondin, B; Herscovics, A

    1993-02-15

    Processing of N-linked oligosaccharides in Saccharomyces cerevisiae begins with the removal of glucose and mannose residues from Glc3Man9GlcNAc2 to form a single isomer of Man8GlcNAc2. The importance of mannose removal for subsequent outer chain synthesis was examined in strains of S. cerevisiae disrupted in the MNS1 gene encoding a specific alpha 1,2-mannosidase responsible for Man8GlcNAc2 synthesis [Camirand, Heysen, Grondin and Herscovics (1991) J. Biol. Chem. 266, 15120-15127]. Both MNS1 transcripts of 1.85 kb and 1.7 kb were not observed in Northern blots of mns1 cells (i.e. cells containing the disrupted gene). Analysis on Bio-Gel P-6 of endo-beta-N-acetylglucosaminidase-H-sensitive oligosaccharides following a 10 min pulse with [2-3H]mannose revealed similar amounts of labelled outer chains excluded from the gel in both control and mns1 cells. H.p.l.c. of the included oligosaccharides showed that a Man9GlcNAc, rather than a Man8GlcNAc, intermediate was formed in mns1 cells. Analysis of [3H]mannose-labelled core oligosaccharides from immunoprecipitated CPY and invertase by h.p.l.c. showed a similar size distribution in mns1 and control cells. Invertase immunoprecipitated from [35S]methionine-labelled mns1 cells was highly glycosylated, but migrated slightly faster than that from control cells on denaturing PAGE, indicating a small difference in glycosylation. A similar difference in mobility was observed for invertase activity stain following non-denaturing gel electrophoresis. It is concluded that the alpha-mannosidase encoded by MNS1 is the only enzyme responsible for mannose removal in vivo, and that this processing step is not essential for outer chain synthesis.

  5. Detection of Rickettsia and Ehrlichia spp. in Ticks Associated with Exotic Reptiles and Amphibians Imported into Japan

    PubMed Central

    Andoh, Masako; Sakata, Akiko; Takano, Ai; Kawabata, Hiroki; Fujita, Hiromi; Une, Yumi; Goka, Koichi; Kishimoto, Toshio; Ando, Shuji

    2015-01-01

    One of the major routes of transmission of rickettsial and ehrlichial diseases is via ticks that infest numerous host species, including humans. Besides mammals, reptiles and amphibians also carry ticks that may harbor Rickettsia and Ehrlichia strains that are pathogenic to humans. Furthermore, reptiles and amphibians are exempt from quarantine in Japan, thus facilitating the entry of parasites and pathogens to the country through import. Accordingly, in the current study, we examined the presence of Rickettsia and Ehrlichia spp. genes in ticks associated with reptiles and amphibians originating from outside Japan. Ninety-three ticks representing nine tick species (genera Amblyomma and Hyalomma) were isolated from at least 28 animals spanning 10 species and originating from 12 countries (Ghana, Jordan, Madagascar, Panama, Russia, Sri Lanka, Sudan, Suriname, Tanzania, Togo, Uzbekistan, and Zambia). None of the nine tick species are indigenous in Japan. The genes encoding the common rickettsial 17-kDa antigen, citrate synthase (gltA), and outer membrane protein A (ompA) were positively detected in 45.2% (42/93), 40.9% (38/93), and 23.7% (22/93) of the ticks, respectively, by polymerase chain reaction (PCR). The genes encoding ehrlichial heat shock protein (groEL) and major outer membrane protein (omp-1) were PCR-positive in 7.5% (7/93) and 2.2% (2/93) of the ticks, respectively. The p44 gene, which encodes the Anaplasma outer membrane protein, was not detected. Phylogenetic analysis showed that several of the rickettsial and ehrlichial sequences isolated in this study were highly similar to human pathogen genes, including agents not previously detected in Japan. These data demonstrate the global transportation of pathogenic Rickettsia and Ehrlichia through reptile- and amphibian-associated ticks. These imported animals have potential to transfer pathogens into human life. These results highlight the need to control the international transportation of known and potential pathogens carried by ticks in reptiles, amphibians, and other animals, in order to improve national and international public health. PMID:26207382

  6. Differential Response to Heat Stress in Outer and Inner Onion Bulb Scales.

    PubMed

    Galsurker, Ortal; Doron-Faigenboim, Adi; Teper-Bamnolker, Paula; Daus, Avinoam; Lers, Amnon; Eshel, Dani

    2018-05-18

    Brown protective skin formation in onion bulbs can be induced by rapid postharvest heat treatment. Onions that were peeled to different depths and were exposed to heat stress showed that only the outer scale formed dry brown skin, whereas the inner scales maintained high water content and did not change color. Our results reveal that browning of the outer scale during heat treatment is due to an enzymatic process that is associated with high levels of oxidation components, such as peroxidase and quercetin glucoside. De-novo transcriptome analysis revealed differential molecular responses of the outer and inner scales to the heat stress. Genes involved in lipid metabolism, oxidation pathways and cell-wall modification were highly expressed in the outer scale during heating. Defense-response-related genes such as those encoding heat-shock proteins, antioxidative stress defense or production of osmoprotectant metabolites were mostly induced in the inner scale in response to the heat exposure. These transcriptomic data led to a conceptual model that suggests sequential processes for browning development and desiccation of the outer scales versus processes associated with defense response and heat tolerance in the inner scale. Thus, the observed physiological differences between the outer and inner scales is supported by the identified molecular differences.

  7. A trans-outer membrane porin-cytochrome protein complex for extracellular electron transfer by Geobacter sulfurreducens PCA

    DOE PAGES

    Liu, Yimo; Wang, Zheming; Liu, Juan; ...

    2014-09-24

    The multiheme, outer membrane c-type cytochrome (c-Cyt) OmcB of Geobacter sulfurreducens was previously proposed to mediate electron transfer across the outer membrane. However, the underlying mechanism has remained uncharacterized. In G. sulfurreducens, the omcB gene is part of two tandem four-gene clusters, each is predicted to encode a transcriptional factor (OrfR/OrfS), a porin-like outer membrane protein (OmbB/OmbC), a periplasmic c-type cytochrome (OmaB/OmaC), and an outer membrane c-Cyt (OmcB/OmcC), respectively. Here we showed that OmbB/OmbC, OmaB/OmaC and OmcB/OmcC of G. sulfurreducens PCA formed the porin-cytochrome (Pcc) protein complexes, which were involved in transferring electrons across the outer membrane. The isolated Pccmore » protein complexes reconstituted in proteoliposomes transferred electrons from reduced methyl viologen across the lipid bilayer of liposomes to Fe(III)-citrate and ferrihydrite. The pcc clusters were found in all eight sequenced Geobacter and 11 other bacterial genomes from six different phyla, demonstrating a widespread distribution of Pcc protein complexes in phylogenetically diverse bacteria. Deletion of ombB-omaB-omcB-orfS-ombC-omaC-omcC gene clusters had no impact on the growth of G. sulfurreducens PCA with fumarate, but diminished the ability of G. sulfurreducens PCA to reduce Fe(III)-citrate and ferrihydrite. Finally, complementation with the ombB-omaB-omcB gene cluster restored the ability of G. sulfurreducens PCA to reduce Fe(III)-citrate and ferrihydrite.« less

  8. Mechanisms of Disease and Clinical Features of Mutations of the Gene for Mitofusin 2: An Important Cause of Hereditary Peripheral Neuropathy with Striking Clinical Variability in Children and Adults

    ERIC Educational Resources Information Center

    Ouvrier, Robert; Grew, Simon

    2010-01-01

    Mitofusin 2, a large transmembrane GTPase located in the outer mitochondrial membrane, promotes membrane fusion and is involved in the maintenance of the morphology of axonal mitochondria. Mutations of the gene encoding mitofusin 2 ("MFN2") have recently been identified as the cause of approximately one-third of dominantly inherited cases of the…

  9. Microarray-based comparative genomic profiling of reference strains and selected Canadian field isolates of Actinobacillus pleuropneumoniae

    PubMed Central

    Gouré, Julien; Findlay, Wendy A; Deslandes, Vincent; Bouevitch, Anne; Foote, Simon J; MacInnes, Janet I; Coulton, James W; Nash, John HE; Jacques, Mario

    2009-01-01

    Background Actinobacillus pleuropneumoniae, the causative agent of porcine pleuropneumonia, is a highly contagious respiratory pathogen that causes severe losses to the swine industry worldwide. Current commercially-available vaccines are of limited value because they do not induce cross-serovar immunity and do not prevent development of the carrier state. Microarray-based comparative genomic hybridizations (M-CGH) were used to estimate whole genomic diversity of representative Actinobacillus pleuropneumoniae strains. Our goal was to identify conserved genes, especially those predicted to encode outer membrane proteins and lipoproteins because of their potential for the development of more effective vaccines. Results Using hierarchical clustering, our M-CGH results showed that the majority of the genes in the genome of the serovar 5 A. pleuropneumoniae L20 strain were conserved in the reference strains of all 15 serovars and in representative field isolates. Fifty-eight conserved genes predicted to encode for outer membrane proteins or lipoproteins were identified. As well, there were several clusters of diverged or absent genes including those associated with capsule biosynthesis, toxin production as well as genes typically associated with mobile elements. Conclusion Although A. pleuropneumoniae strains are essentially clonal, M-CGH analysis of the reference strains of the fifteen serovars and representative field isolates revealed several classes of genes that were divergent or absent. Not surprisingly, these included genes associated with capsule biosynthesis as the capsule is associated with sero-specificity. Several of the conserved genes were identified as candidates for vaccine development, and we conclude that M-CGH is a valuable tool for reverse vaccinology. PMID:19239696

  10. Diversity of bacterial dimethylsulfoniopropionate degradation genes in surface seawater of Arctic Kongsfjorden.

    PubMed

    Zeng, Yin-Xin; Qiao, Zong-Yun; Yu, Yong; Li, Hui-Rong; Luo, Wei

    2016-09-08

    Dimethylsulfoniopropionate (DMSP), which is the major source of organic sulfur in the world's oceans, plays a significant role in the global sulfur cycle. This compound is rapidly degraded by marine bacteria either by cleavage to dimethylsulfide (DMS) or demethylation to 3-methylmercaptopropionate (MMPA). The diversity of genes encoding bacterial demethylation (dmdA) and DMS production (dddL and dddP) were measured in Arctic Kongsfjorden. Both dmdA and dddL genes were detected in all stations along a transect from the outer to the inner fjord, while dddP gene was only found in the outer and middle parts of the fjord. The dmdA gene was completely confined to the Roseobacter clade, while the dddL gene was confined to the genus Sulfitobacter. Although the dddP gene pool was also dominated by homologs from the Roseobacter clade, there were a few dddP genes showing close relationships to both Alphaproteobacter and Gammaproteobacter. The results of this study suggest that the Roseobacter clade may play an important role in DMSP catabolism via both demethylation and cleavage pathways in surface waters of Kongsfjorden during summer.

  11. Diversity of bacterial dimethylsulfoniopropionate degradation genes in surface seawater of Arctic Kongsfjorden

    NASA Astrophysics Data System (ADS)

    Zeng, Yin-Xin; Qiao, Zong-Yun; Yu, Yong; Li, Hui-Rong; Luo, Wei

    2016-09-01

    Dimethylsulfoniopropionate (DMSP), which is the major source of organic sulfur in the world’s oceans, plays a significant role in the global sulfur cycle. This compound is rapidly degraded by marine bacteria either by cleavage to dimethylsulfide (DMS) or demethylation to 3-methylmercaptopropionate (MMPA). The diversity of genes encoding bacterial demethylation (dmdA) and DMS production (dddL and dddP) were measured in Arctic Kongsfjorden. Both dmdA and dddL genes were detected in all stations along a transect from the outer to the inner fjord, while dddP gene was only found in the outer and middle parts of the fjord. The dmdA gene was completely confined to the Roseobacter clade, while the dddL gene was confined to the genus Sulfitobacter. Although the dddP gene pool was also dominated by homologs from the Roseobacter clade, there were a few dddP genes showing close relationships to both Alphaproteobacter and Gammaproteobacter. The results of this study suggest that the Roseobacter clade may play an important role in DMSP catabolism via both demethylation and cleavage pathways in surface waters of Kongsfjorden during summer.

  12. Loss-of-Function Mutations in a Human Gene Related to Chlamydomonas reinhardtii Dynein IC78 Result in Primary Ciliary Dyskinesia

    PubMed Central

    Pennarun, Gaëlle; Escudier, Estelle; Chapelin, Catherine; Bridoux, Anne-Marie; Cacheux, Valère; Roger, Gilles; Clément, Annick; Goossens, Michel; Amselem, Serge; Duriez, Bénédicte

    1999-01-01

    Summary Primary ciliary dyskinesia (PCD) is a group of heterogeneous disorders of unknown origin, usually inherited as an autosomal recessive trait. Its phenotype is characterized by axonemal abnormalities of respiratory cilia and sperm tails leading to bronchiectasis and sinusitis, which are sometimes associated with situs inversus (Kartagener syndrome) and male sterility. The main ciliary defect in PCD is an absence of dynein arms. We have isolated the first gene involved in PCD, using a candidate-gene approach developed on the basis of documented abnormalities of immotile strains of Chlamydomonas reinhardtii, which carry axonemal ultrastructural defects reminiscent of PCD. Taking advantage of the evolutionary conservation of genes encoding axonemal proteins, we have isolated a human sequence (DNAI1) related to IC78, a C. reinhardtii gene encoding a dynein intermediate chain in which mutations are associated with the absence of outer dynein arms. DNAI1 is highly expressed in trachea and testis and is composed of 20 exons located at 9p13-p21. Two loss-of-function mutations of DNAI1 have been identified in a patient with PCD characterized by immotile respiratory cilia lacking outer dynein arms. In addition, we excluded linkage between this gene and similar PCD phenotypes in five other affected families, providing a clear demonstration of locus heterogeneity. These data reveal the critical role of DNAI1 in the development of human axonemal structures and open up new means for identification of additional genes involved in related developmental defects. PMID:10577904

  13. Characterization of the response to zinc deficiency in the cyanobacterium Anabaena sp. strain PCC 7120.

    PubMed

    Napolitano, Mauro; Rubio, Miguel Ángel; Santamaría-Gómez, Javier; Olmedo-Verd, Elvira; Robinson, Nigel J; Luque, Ignacio

    2012-05-01

    Zur regulators control zinc homeostasis by repressing target genes under zinc-sufficient conditions in a wide variety of bacteria. This paper describes how part of a survey of duplicated genes led to the identification of the open reading frame all2473 as the gene encoding the Zur regulator of the cyanobacterium Anabaena sp. strain PCC 7120. All2473 binds to DNA in a zinc-dependent manner, and its DNA-binding sequence was characterized, which allowed us to determine the relative contribution of particular nucleotides to Zur binding. A zur mutant was found to be impaired in the regulation of zinc homeostasis, showing sensitivity to elevated concentrations of zinc but not other metals. In an effort to characterize the Zur regulon in Anabaena, 23 genes containing upstream putative Zur-binding sequences were identified and found to be regulated by Zur. These genes are organized in six single transcriptional units and six operons, some of them containing multiple Zur-regulated promoters. The identities of genes of the Zur regulon indicate that Anabaena adapts to conditions of zinc deficiency by replacing zinc metalloproteins with paralogues that fulfill the same function but presumably with a lower zinc demand, and with inducing putative metallochaperones and membrane transport systems likely being involved in the scavenging of extracellular zinc, including plasma membrane ABC transport systems and outer membrane TonB-dependent receptors. Among the Zur-regulated genes, the ones showing the highest induction level encode proteins of the outer membrane, suggesting a primary role for components of this cell compartment in the capture of zinc cations from the extracellular medium.

  14. Effects of bfp Mutations on Biogenesis of Functional Enteropathogenic Escherichia coli Type IV Pili

    PubMed Central

    Anantha, Ravi P.; Stone, Kelly D.; Donnenberg, Michael S.

    2000-01-01

    Enteropathogenic Escherichia coli expresses a type IV fimbria known as the bundle-forming pilus (BFP) that is required for autoaggregation and localized adherence (LA) to host cells. A cluster of 14 genes is sufficient to reconstitute BFP biogenesis in a laboratory strain of E. coli. We have undertaken a systematic mutagenesis of the individual genes to determine the effect of each mutation on BFP biogenesis and LA. Here we report the construction and analysis of nonpolar mutations in six genes of the bfp cluster, bfpG, bfpB, bfpC, bfpD, bfpP, and bfpH, as well as the further analysis of a previously described bfpA mutant strain that is unable to express bundlin, the pilin protein. We found that mutations in bfpB, which encodes an outer membrane protein; bfpD, which encodes a putative nucleotide-binding protein; and bfpG and bfpC, which do not have sequence homologues in other type IV pilus systems, do not affect prebundlin expression or processing but block both BFP biogenesis and LA. The mutation in bfpP, the prepilin peptidase gene, does not affect prebundlin expression but blocks signal sequence cleavage of prebundlin, BFP biogenesis, and LA. The mutation in bfpH, which is predicted to encode a lytic transglycosylase, has no effect on prebundlin expression, prebundlin processing, BFP biogenesis, or LA. For each mutant for which altered phenotypes were detected, complementation with a plasmid containing the corresponding wild-type allele restored the wild-type phenotypes. We also found that association of prebundlin or bundlin with sucrose density flotation gradient fractions containing both inner and outer membrane proteins does not require any accessory proteins. These studies indicate that many bfp gene products are required for biogenesis of functional type IV pili but that mutations in the individual genes do not lead to the identification of new phases of pilus assembly. PMID:10762251

  15. Insertional inactivation of oprD in carbapenem-resistant Pseudomonas aeruginosa strains isolated from burn patients in Tehran, Iran.

    PubMed

    Shariati, A; Azimi, T; Ardebili, A; Chirani, A S; Bahramian, A; Pormohammad, A; Sadredinamin, M; Erfanimanesh, S; Bostanghadiri, N; Shams, S; Hashemi, A

    2018-01-01

    In this study, we report the insertion sequence IS Ppu 21 in the opr D porin gene of carbapenem-resistant Pseudomonas aeruginosa isolates from burn patients in Tehran, Iran. Antibiotic susceptibility tests for P. aeruginosa isolates were determined. Production of metallo-β-lactamases (MBLs) and carbapenemase was evaluated and the β-lactamase-encoding and aminoglycoside-modifying enzyme genes were investigated by PCR and sequencing methods. The mRNA transcription level of oprD and mex efflux pump genes were evaluated by real-time PCR. The outer membrane protein profile was determined by SDS-PAGE. The genetic relationship between the P. aeruginosa isolates was assessed by random amplified polymorphic DNA PCR. In all, 10.52% (10/95) of clinical isolates of P. aeruginosa harboured the IS Ppu 21 insertion element in the opr D gene. The extended-spectrum β-lactamase-encoding gene in IS Ppu 21-carrying isolates was bla TEM . PCR assays targeting MBL and carbapenemase-encoding genes were also negative in all ten isolates. The rmt A, aad A, aad B and arm A genes were positive in all IS Ppu 21 harbouring isolates. The relative expression levels of the mex X, mex B, mex T and mex D genes in ten isolates ranged from 0.1- to 1.4-fold, 1.1- to 3.68-fold, 0.3- to 8.22-fold and 1.7- to 35.17-fold, respectively. The relative expression levels of the oprD in ten isolates ranged from 0.57- to 35.01-fold, which was much higher than those in the control strain P. aeruginosa PAO1. Evaluation of the outer membrane protein by SDS-PAGE suggested that opr D was produced at very low levels by all isolates. Using random amplified polymorphic DNA PCR genotyping, eight of the ten isolates containing IS Ppu 21 were shown to be clonally related. The present study describes a novel molecular mechanism, IS Ppu 21 insertion of the opr D gene, associated with carbapenem resistance in clinical P. aeruginosa isolates.

  16. Revealing genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles under osmotic stress in Escherichia coli K-12 MG1655.

    PubMed

    Seo, Sang Woo; Gao, Ye; Kim, Donghyuk; Szubin, Richard; Yang, Jina; Cho, Byung-Kwan; Palsson, Bernhard O

    2017-05-19

    A transcription factor (TF), OmpR, plays a critical role in transcriptional regulation of the osmotic stress response in bacteria. Here, we reveal a genome-scale OmpR regulon in Escherichia coli K-12 MG1655. Integrative data analysis reveals that a total of 37 genes in 24 transcription units (TUs) belong to OmpR regulon. Among them, 26 genes show more than two-fold changes in expression level in an OmpR knock-out strain. Specifically, we find that: 1) OmpR regulates mostly membrane-located gene products involved in diverse fundamental biological processes, such as narU (encoding nitrate/nitrite transporter), ompX (encoding outer membrane protein X), and nuoN (encoding NADH:ubiquinone oxidoreductase); 2) by investigating co-regulation of entire sets of genes regulated by other stress-response TFs, stresses are surprisingly independently regulated among each other; and, 3) a detailed investigation of the physiological roles of the newly discovered OmpR regulon genes reveals that activation of narU represents a novel strategy to significantly improve osmotic stress tolerance of E. coli. Thus, the genome-scale approach to elucidating regulons comprehensively identifies regulated genes and leads to fundamental discoveries related to stress responses.

  17. IroN, a Novel Outer Membrane Siderophore Receptor Characteristic of Salmonella enterica

    PubMed Central

    Bäumler, Andreas J.; Norris, Tracy L.; Lasco, Todd; Voigt, Wolfgang; Reissbrodt, Rolf; Rabsch, Wolfgang; Heffron, Fred

    1998-01-01

    Speciation in enterobacteria involved horizontal gene transfer. Therefore, analysis of genes acquired by horizontal transfer that are present in one species but not its close relatives is expected to give insights into how new bacterial species were formed. In this study we characterize iroN, a gene located downstream of the iroBC operon in the iroA locus of Salmonella enterica serotype Typhi. Like iroBC, the iroN gene is present in all phylogenetic lineages of S. enterica but is absent from closely related species such as Salmonella bongori or Escherichia coli. Comparison of the deduced amino acid sequence of iroN with other proteins suggested that this gene encodes an outer membrane siderophore receptor protein. Mutational analysis in S. enterica and expression in E. coli identified a 78-kDa outer membrane protein as the iroN gene product. When introduced into an E. coli fepA cir fiu aroB mutant on a cosmid, iroN mediated utilization of structurally related catecholate siderophores, including N-(2,3-dihydroxybenzoyl)-l-serine, myxochelin A, benzaldehyde-2,3-dihydroxybenzhydrazone, 2-N,6-N-bis(2,3-dihydroxybenzoyl)-l-lysine, 2-N,6-N-bis(2,3-dihydroxybenzoyl)-l-lysine amide, and enterochelin. These results suggest that the iroA locus functions in iron acquisition in S. enterica. PMID:9515912

  18. Disruption of the processing alpha-mannosidase gene does not prevent outer chain synthesis in Saccharomyces cerevisiae.

    PubMed Central

    Puccia, R; Grondin, B; Herscovics, A

    1993-01-01

    Processing of N-linked oligosaccharides in Saccharomyces cerevisiae begins with the removal of glucose and mannose residues from Glc3Man9GlcNAc2 to form a single isomer of Man8GlcNAc2. The importance of mannose removal for subsequent outer chain synthesis was examined in strains of S. cerevisiae disrupted in the MNS1 gene encoding a specific alpha 1,2-mannosidase responsible for Man8GlcNAc2 synthesis [Camirand, Heysen, Grondin and Herscovics (1991) J. Biol. Chem. 266, 15120-15127]. Both MNS1 transcripts of 1.85 kb and 1.7 kb were not observed in Northern blots of mns1 cells (i.e. cells containing the disrupted gene). Analysis on Bio-Gel P-6 of endo-beta-N-acetylglucosaminidase-H-sensitive oligosaccharides following a 10 min pulse with [2-3H]mannose revealed similar amounts of labelled outer chains excluded from the gel in both control and mns1 cells. H.p.l.c. of the included oligosaccharides showed that a Man9GlcNAc, rather than a Man8GlcNAc, intermediate was formed in mns1 cells. Analysis of [3H]mannose-labelled core oligosaccharides from immunoprecipitated CPY and invertase by h.p.l.c. showed a similar size distribution in mns1 and control cells. Invertase immunoprecipitated from [35S]methionine-labelled mns1 cells was highly glycosylated, but migrated slightly faster than that from control cells on denaturing PAGE, indicating a small difference in glycosylation. A similar difference in mobility was observed for invertase activity stain following non-denaturing gel electrophoresis. It is concluded that the alpha-mannosidase encoded by MNS1 is the only enzyme responsible for mannose removal in vivo, and that this processing step is not essential for outer chain synthesis. Images Figure 1 Figure 4 PMID:8439291

  19. Imipenem resistance in Klebsiella pneumoniae is associated with the combination of ACT-1, a plasmid-mediated AmpC beta-lactamase, and the foss of an outer membrane protein.

    PubMed Central

    Bradford, P A; Urban, C; Mariano, N; Projan, S J; Rahal, J J; Bush, K

    1997-01-01

    Six Escherichia coli and 12 Klebsiella pneumoniae isolates from a single hospital expressed a common beta-lactamase with a pI of approximately 9.0 and were resistant to cefoxitin and cefotetan (MIC ranges, 64 to > 128 and 16 to > 128 micrograms/ml, respectively). Seventeen of the 18 strains produced multiple beta-lactamases. Most significantly, three K. pneumoniae strains were also resistant to imipenem (MICs, 8 to 32 micrograms/ml). Spectrophotometric beta-lactamase assays with purified enzyme indicated hydrolysis of cephamycins, in addition to cephaloridine and benzylpenicillin. The 4ene encoding the pI 9.0 beta-lactamase (designated ACT-1 for AmpC type) was cloned and sequenced, which revealed an ampC-type beta-lactamase gene that originated from Enterobacter cloacae and that had 86% sequence homology to the P99 beta-lactamase and 94% homology to the partial sequence of MIR-1. Southern blotting revealed that the gene encoding ACT-1 was on a large plasmid in some of the K. pneumoniae strains as well as on the chromosomes of all of the strains, suggesting that the gene is located on an easily mobilized element. Outer membrane protein profiles of the K. pneumoniae strains revealed that the three imipenem-resistant strains were lacking a major outer membrane protein of approximately 42 kDa which was present in the imipenem-susceptible strains. ACT-1 is the first plasmid-mediated AmpC-type beta-lactamase derived from Enterobacter which has been completely sequenced. This work demonstrates that in addition to resistance to cephamycins, imipenem resistance can occur in K. pneumoniae when a high level of the ACT-1 beta-lactamase is produced in combination with the loss of a major outer membrane protein. PMID:9055993

  20. Metagenomic Insights into the Fibrolytic Microbiome in Yak Rumen

    PubMed Central

    Song, Lei; Liu, Di; Liu, Li; Chen, Furong; Wang, Min; Li, Jiabao; Zeng, Xiaowei; Dong, Zhiyang; Hu, Songnian; Li, Lingyan; Xu, Jian; Huang, Li; Dong, Xiuzhu

    2012-01-01

    The rumen hosts one of the most efficient microbial systems for degrading plant cell walls, yet the predominant cellulolytic proteins and fibrolytic mechanism(s) remain elusive. Here we investigated the cellulolytic microbiome of the yak rumen by using a combination of metagenome-based and bacterial artificial chromosome (BAC)-based functional screening approaches. Totally 223 fibrolytic BAC clones were pyrosequenced and 10,070 ORFs were identified. Among them 150 were annotated as the glycoside hydrolase (GH) genes for fibrolytic proteins, and the majority (69%) of them were clustered or linked with genes encoding related functions. Among the 35 fibrolytic contigs of >10 Kb in length, 25 were derived from Bacteroidetes and four from Firmicutes. Coverage analysis indicated that the fibrolytic genes on most Bacteroidetes-contigs were abundantly represented in the metagenomic sequences, and they were frequently linked with genes encoding SusC/SusD-type outer-membrane proteins. GH5, GH9, and GH10 cellulase/hemicellulase genes were predominant, but no GH48 exocellulase gene was found. Most (85%) of the cellulase and hemicellulase proteins possessed a signal peptide; only a few carried carbohydrate-binding modules, and no cellulosomal domains were detected. These findings suggest that the SucC/SucD-involving mechanism, instead of one based on cellulosomes or the free-enzyme system, serves a major role in lignocellulose degradation in yak rumen. Genes encoding an endoglucanase of a novel GH5 subfamily occurred frequently in the metagenome, and the recombinant proteins encoded by the genes displayed moderate Avicelase in addition to endoglucanase activities, suggesting their important contribution to lignocellulose degradation in the exocellulase-scarce rumen. PMID:22808161

  1. The Dynein Gene Family in Chlamydomonas Reinhardtii

    PubMed Central

    Porter, M. E.; Knott, J. A.; Myster, S. H.; Farlow, S. J.

    1996-01-01

    To correlate dynein heavy chain (Dhc) genes with flagellar mutations and gain insight into the function of specific dynein isoforms, we placed eight members of the Dhc gene family on the genetic map of Chlamydomonas. Using a PCR-based strategy, we cloned 11 Dhc genes from Chlamydomonas. Comparisons with other Dhc genes indicate that two clones correspond to genes encoding the alpha and beta heavy chains of the outer dynein arm. Alignment of the predicted amino acid sequences spanning the nucleotide binding site indicates that the remaining nine clones can be subdivided into three groups that are likely to include representatives of the inner-arm Dhc isoforms. Gene-specific probes reveal that each clone represents a single-copy gene that is expressed as a transcript of the appropriate size (>13 kb) sufficient to encode a high molecular weight Dhc polypeptide. The expression of all nine genes is upregulated in response to deflagellation, suggesting a role in axoneme assembly or motility. Restriction fragment length polymorphisms between divergent C. reinhardtii strains have been used to place each Dhc gene on the genetic map of Chlamydomonas. These studies lay the groundwork for correlating defects in different Dhc genes with specific flagellar mutations. PMID:8889521

  2. A Legionella pneumophila collagen-like protein encoded by a gene with a variable number of tandem repeats is involved in the adherence and invasion of host cells.

    PubMed

    Vandersmissen, Liesbeth; De Buck, Emmy; Saels, Veerle; Coil, David A; Anné, Jozef

    2010-05-01

    Legionella pneumophila is a Gram-negative, facultative intracellular pathogen and the causative agent of Legionnaires' disease, a severe pneumonia in humans. Analysis of the Legionella sequenced genomes revealed a gene with a variable number of tandem repeats (VNTRs), whose number varies between strains. We examined the strain distribution of this gene among a collection of 108 clinical, environmental and hot spring serotype I strains. Twelve variants were identified, but no correlation was observed between the number of repeat units and clinical and environmental strains. The encoded protein contains the C-terminal consensus motif of outer membrane proteins and has a large region of collagen-like repeats that is encoded by the VNTR region. We have therefore annotated this protein Lcl for Legionella collagen-like protein. Lcl was shown to contribute to the adherence and invasion of host cells and it was demonstrated that the number of repeat units present in lcl had an influence on these adhesion characteristics.

  3. Recapitulating X-Linked Juvenile Retinoschisis in Mouse Model by Knock-In Patient-Specific Novel Mutation.

    PubMed

    Chen, Ding; Xu, Tao; Tu, Mengjun; Xu, Jinlin; Zhou, Chenchen; Cheng, Lulu; Yang, Ruqing; Yang, Tanchu; Zheng, Weiwei; He, Xiubin; Deng, Ruzhi; Ge, Xianglian; Li, Jin; Song, Zongming; Zhao, Junzhao; Gu, Feng

    2017-01-01

    X-linked juvenile retinoschisis (XLRS) is a retinal disease caused by mutations in the gene encoding retinoschisin (RS1), which leads to a significant proportion of visual impairment and blindness. To develop personalized genome editing based gene therapy, knock-in animal disease models that have the exact mutation identified in the patients is extremely crucial, and that the way which genome editing in knock-in animals could be easily transferred to the patients. Here we recruited a family diagnosed with XLRS and identified the causative mutation ( RS1 , p.Y65X), then a knock-in mouse model harboring this disease-causative mutation was generated via TALEN (transcription activator-like effector nucleases). We found that the b-wave amplitude of the ERG of the RS1 -KI mice was significantly decreased. Moreover, we observed that the structure of retina in RS1 -KI mice has become disordered, including the disarray of inner nuclear layer and outer nuclear layer, chaos of outer plexiform layer, decreased inner segments of photoreceptor and the loss of outer segments. The novel knock-in mice ( RS1 -KI) harboring patient-specific mutation will be valuable for development of treatment via genome editing mediated gene correction.

  4. Phylogenetic Analysis of Mitochondrial Outer Membrane β-Barrel Channels

    PubMed Central

    Wojtkowska, Małgorzata; Jąkalski, Marcin; Pieńkowska, Joanna R.; Stobienia, Olgierd; Karachitos, Andonis; Przytycka, Teresa M.; Weiner, January; Kmita, Hanna; Makałowski, Wojciech

    2012-01-01

    Transport of molecules across mitochondrial outer membrane is pivotal for a proper function of mitochondria. The transport pathways across the membrane are formed by ion channels that participate in metabolite exchange between mitochondria and cytoplasm (voltage-dependent anion-selective channel, VDAC) as well as in import of proteins encoded by nuclear genes (Tom40 and Sam50/Tob55). VDAC, Tom40, and Sam50/Tob55 are present in all eukaryotic organisms, encoded in the nuclear genome, and have β-barrel topology. We have compiled data sets of these protein sequences and studied their phylogenetic relationships with a special focus on the position of Amoebozoa. Additionally, we identified these protein-coding genes in Acanthamoeba castellanii and Dictyostelium discoideum to complement our data set and verify the phylogenetic position of these model organisms. Our analysis show that mitochondrial β-barrel channels from Archaeplastida (plants) and Opisthokonta (animals and fungi) experienced many duplication events that resulted in multiple paralogous isoforms and form well-defined monophyletic clades that match the current model of eukaryotic evolution. However, in representatives of Amoebozoa, Chromalveolata, and Excavata (former Protista), they do not form clearly distinguishable clades, although they locate basally to the plant and algae branches. In most cases, they do not posses paralogs and their sequences appear to have evolved quickly or degenerated. Consequently, the obtained phylogenies of mitochondrial outer membrane β-channels do not entirely reflect the recent eukaryotic classification system involving the six supergroups: Chromalveolata, Excavata, Archaeplastida, Rhizaria, Amoebozoa, and Opisthokonta. PMID:22155732

  5. Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Flores, J.; Sears, J.; Schael, I.P.

    1990-08-01

    We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated frommore » field studies.« less

  6. Usher syndrome type 1–associated cadherins shape the photoreceptor outer segment

    PubMed Central

    Parain, Karine; Aghaie, Asadollah; Picaud, Serge

    2017-01-01

    Usher syndrome type 1 (USH1) causes combined hearing and sight defects, but how mutations in USH1 genes lead to retinal dystrophy in patients remains elusive. The USH1 protein complex is associated with calyceal processes, which are microvilli of unknown function surrounding the base of the photoreceptor outer segment. We show that in Xenopus tropicalis, these processes are connected to the outer-segment membrane by links composed of protocadherin-15 (USH1F protein). Protocadherin-15 deficiency, obtained by a knockdown approach, leads to impaired photoreceptor function and abnormally shaped photoreceptor outer segments. Rod basal outer disks displayed excessive outgrowth, and cone outer segments were curved, with lamellae of heterogeneous sizes, defects also observed upon knockdown of Cdh23, encoding cadherin-23 (USH1D protein). The calyceal processes were virtually absent in cones and displayed markedly reduced F-actin content in rods, suggesting that protocadherin-15–containing links are essential for their development and/or maintenance. We propose that calyceal processes, together with their associated links, control the sizing of rod disks and cone lamellae throughout their daily renewal. PMID:28495838

  7. Usher syndrome type 1-associated cadherins shape the photoreceptor outer segment.

    PubMed

    Schietroma, Cataldo; Parain, Karine; Estivalet, Amrit; Aghaie, Asadollah; Boutet de Monvel, Jacques; Picaud, Serge; Sahel, José-Alain; Perron, Muriel; El-Amraoui, Aziz; Petit, Christine

    2017-06-05

    Usher syndrome type 1 (USH1) causes combined hearing and sight defects, but how mutations in USH1 genes lead to retinal dystrophy in patients remains elusive. The USH1 protein complex is associated with calyceal processes, which are microvilli of unknown function surrounding the base of the photoreceptor outer segment. We show that in Xenopus tropicalis , these processes are connected to the outer-segment membrane by links composed of protocadherin-15 (USH1F protein). Protocadherin-15 deficiency, obtained by a knockdown approach, leads to impaired photoreceptor function and abnormally shaped photoreceptor outer segments. Rod basal outer disks displayed excessive outgrowth, and cone outer segments were curved, with lamellae of heterogeneous sizes, defects also observed upon knockdown of Cdh23 , encoding cadherin-23 (USH1D protein). The calyceal processes were virtually absent in cones and displayed markedly reduced F-actin content in rods, suggesting that protocadherin-15-containing links are essential for their development and/or maintenance. We propose that calyceal processes, together with their associated links, control the sizing of rod disks and cone lamellae throughout their daily renewal. © 2017 Schietroma et al.

  8. Phase-encoded single-voxel magnetic resonance spectroscopy for suppressing outer volume signals at 7 Tesla.

    PubMed

    Li, Ningzhi; An, Li; Johnson, Christopher; Shen, Jun

    2017-01-01

    Due to imperfect slice profiles, unwanted signals from outside the selected voxel may significantly contaminate metabolite signals acquired using in vivo magnetic resonance spectroscopy (MRS). The use of outer volume suppression may exceed the SAR threshold, especially at high field. We propose using phase-encoding gradients after radiofrequency (RF) excitation to spatially encode unwanted signals originating from outside of the selected single voxel. Phase-encoding gradients were added to a standard single voxel point-resolved spectroscopy (PRESS) sequence which selects a 2 × 2 × 2 cm 3 voxel. Subsequent spatial Fourier transform was used to encode outer volume signals. Phantom and in vivo experiments were performed using both phase-encoded PRESS and standard PRESS at 7 Tesla. Quantification was performed using fitting software developed in-house. Both phantom and in vivo studies showed that spectra from the phase-encoded PRESS sequence were relatively immune from contamination by oil signals and have more accurate quantification results than spectra from standard PRESS spectra of the same voxel. The proposed phase-encoded single-voxel PRESS method can significantly suppress outer volume signals that may appear in the spectra of standard PRESS without increasing RF power deposition.

  9. Mechanism of protein import across the chloroplast envelope.

    PubMed

    Chen, K; Chen, X; Schnell, D J

    2000-01-01

    The development and maintenance of chloroplasts relies on the contribution of protein subunits from both plastid and nuclear genomes. Most chloroplast proteins are encoded by nuclear genes and are post-translationally imported into the organelle across the double membrane of the chloroplast envelope. Protein import into the chloroplast consists of two essential elements: the specific recognition of the targeting signals (transit sequences) of cytoplasmic preproteins by receptors at the outer envelope membrane and the subsequent translocation of preproteins simultaneously across the double membrane of the envelope. These processes are mediated via the co-ordinate action of protein translocon complexes in the outer (Toc apparatus) and inner (Tic apparatus) envelope membranes.

  10. Molecular Cloning and Tissue-Specific Expression of an Anionic Peroxidase in Zucchini1

    PubMed Central

    Carpin, Sabine; Crèvecoeur, Michèle; Greppin, Hubert; Penel, Claude

    1999-01-01

    A calcium-pectate-binding anionic isoperoxidase (APRX) from zucchini (Cucurbita pepo) was purified and subjected to N-terminal amino acid microsequencing. The cDNA encoding this enzyme was obtained by reverse transcriptase polymerase chain reaction from a cDNA library. It encoded a mature protein of 309 amino acids exhibiting all of the sequence characteristics of a plant peroxidase. Despite the presence of a C-terminal propeptide, APRX was found in the apoplast. APRX protein and mRNA were found in the root, hypocotyls, and cotyledons. In situ hybridization showed that the APRX-encoding gene was expressed in many different tissues. The strongest expression was observed in root epidermis and in some cells of the stele, in differentiating tracheary elements of hypocotyl, in the lower and upper epidermis, in the palisade parenchyma of cotyledons, and in lateral and adventitious root primordia. In the hypocotyl hook there was an asymmetric expression, with the inner part containing more transcripts than the outer part. Treatment with 2,3,5-triiodobenzoic acid reduced the expression of the APRX-encoding gene in the lower part of the hypocotyl. Our observations suggest that APRX could be involved in lignin formation and that the transcription of its gene was related to auxin level. PMID:10398715

  11. Chromosomal insertion and excision of a 30 kb unstable genetic element is responsible for phase variation of lipopolysaccharide and other virulence determinants in Legionella pneumophila.

    PubMed

    Lüneberg, E; Mayer, B; Daryab, N; Kooistra, O; Zähringer, U; Rohde, M; Swanson, J; Frosch, M

    2001-03-01

    We recently described the phase-variable expression of a virulence-associated lipopolysaccharide (LPS) epitope in Legionella pneumophila. In this study, the molecular mechanism for phase variation was investigated. We identified a 30 kb unstable genetic element as the molecular origin for LPS phase variation. Thirty putative genes were encoded on the 30 kb sequence, organized in two putative opposite transcription units. Some of the open reading frames (ORFs) shared homologies with bacteriophage genes, suggesting that the 30 kb element was of phage origin. In the virulent wild-type strain, the 30 kb element was located on the chromosome, whereas excision from the chromosome and replication as a high-copy plasmid resulted in the mutant phenotype, which is characterized by alteration of an LPS epitope and loss of virulence. Mapping and sequencing of the insertion site in the genome revealed that the chromosomal attachment site was located in an intergenic region flanked by genes of unknown function. As phage release could not be induced by mitomycin C, it is conceivable that the 30 kb element is a non-functional phage remnant. The protein encoded by ORF T on the 30 kb plasmid could be isolated by an outer membrane preparation, indicating that the genes encoded on the 30 kb element are expressed in the mutant phenotype. Therefore, it is conceivable that the phenotypic alterations seen in the mutant depend on high-copy replication of the 30 kb element and expression of the encoded genes. Excision of the 30 kb element from the chromosome was found to occur in a RecA-independent pathway, presumably by the involvement of RecE, RecT and RusA homologues that are encoded on the 30 kb element.

  12. Transcriptome Analysis of the Brucella abortus BvrR/BvrS Two-Component Regulatory System

    PubMed Central

    Viadas, Cristina; Rodríguez, María C.; Sangari, Felix J.; Gorvel, Jean-Pierre; García-Lobo, Juan M.; López-Goñi, Ignacio

    2010-01-01

    Background The two-component BvrR/BvrS system is essential for Brucella abortus virulence. It was shown previously that its dysfunction alters the expression of some major outer membrane proteins and the pattern of lipid A acylation. To determine the genes regulated by BvrR/BvrS, we performed a whole-genome microarray analysis using B. abortus RNA obtained from wild type and bvrR mutant cells grown in the same conditions. Methodology/Principal Findings A total of 127 differentially expressed genes were found: 83 were over expressed and 44 were less expressed in the bvrR mutant. Two operons, the phosphotransferase system and the maltose transport system, were down-regulated. Several genes involved in cell envelope or outer membrane biogenesis were differentially expressed: genes for outer membrane proteins (omp25a, omp25d), lipoproteins, LPS and fatty acid biosynthesis, stress response proteins, chaperones, flagellar genes, and twelve genes encoding ABC transport systems. Ten genes related with carbon metabolism (pckA and fumB among others) were up-regulated in the bvrR mutant, and denitrification genes (nirK, norC and nosZ) were also regulated. Notably, seven transcriptional regulators were affected, including VjbR, ExoR and OmpR that were less expressed in the bvrR mutant. Finally, the expression of eleven genes which have been previously related with Brucella virulence was also altered. Conclusions/Significance All these data corroborate the impact of BvrR/BvrS on cell envelope modulation, confirm that this system controls the carbon and nitrogen metabolism, and suggest a cross-talk among some regulators to adjust the Brucella physiology to the shift expected to occur during the transit from the extracellular to the intracellular niche. PMID:20422049

  13. Concentration of acrylamide in a polyacrylamide gel affects VP4 gene coding assignment of group A equine rotavirus strains with P[12] specificity

    PubMed Central

    2010-01-01

    Background It is universally acknowledged that genome segment 4 of group A rotavirus, the major etiologic agent of severe diarrhea in infants and neonatal farm animals, encodes outer capsid neutralization and protective antigen VP4. Results To determine which genome segment of three group A equine rotavirus strains (H-2, FI-14 and FI-23) with P[12] specificity encodes the VP4, we analyzed dsRNAs of strains H-2, FI-14 and FI-23 as well as their reassortants by polyacrylamide gel electrophoresis (PAGE) at varying concentrations of acrylamide. The relative position of the VP4 gene of the three equine P[12] strains varied (either genome segment 3 or 4) depending upon the concentration of acrylamide. The VP4 gene bearing P[3], P[4], P[6], P[7], P[8] or P[18] specificity did not exhibit this phenomenon when the PAGE running conditions were varied. Conclusions The concentration of acrylamide in a PAGE gel affected VP4 gene coding assignment of equine rotavirus strains bearing P[12] specificity. PMID:20573245

  14. Transcriptional response of Leptospira interrogans to iron limitation and characterization of a PerR homolog.

    PubMed

    Lo, Miranda; Murray, Gerald L; Khoo, Chen Ai; Haake, David A; Zuerner, Richard L; Adler, Ben

    2010-11-01

    Leptospirosis is a globally significant zoonosis caused by Leptospira spp. Iron is essential for growth of most bacterial species. Since iron availability is low in the host, pathogens have evolved complex iron acquisition mechanisms to survive and establish infection. In many bacteria, expression of iron uptake and storage proteins is regulated by Fur. L. interrogans encodes four predicted Fur homologs; we have constructed a mutation in one of these, la1857. We conducted microarray analysis to identify iron-responsive genes and to study the effects of la1857 mutation on gene expression. Under iron-limiting conditions, 43 genes were upregulated and 49 genes were downregulated in the wild type. Genes encoding proteins with predicted involvement in inorganic ion transport and metabolism (including TonB-dependent proteins and outer membrane transport proteins) were overrepresented in the upregulated list, while 54% of differentially expressed genes had no known function. There were 16 upregulated genes of unknown function which are absent from the saprophyte L. biflexa and which therefore may encode virulence-associated factors. Expression of iron-responsive genes was not significantly affected by mutagenesis of la1857, indicating that LA1857 is not a global regulator of iron homeostasis. Upregulation of heme biosynthetic genes and a putative catalase in the mutant suggested that LA1857 is more similar to PerR, a regulator of the oxidative stress response. Indeed, the la1857 mutant was more resistant to peroxide stress than the wild type. Our results provide insights into the role of iron in leptospiral metabolism and regulation of the oxidative stress response, including genes likely to be important for virulence.

  15. Resistant mechanisms and molecular epidemiology of imipenem-resistant Acinetobacter baumannii.

    PubMed

    Xiao, Shu-Zhen; Chu, Hai-Qing; Han, Li-Zhong; Zhang, Zhe-Min; Li, Bing; Zhao, Lan; Xu, Liyun

    2016-09-01

    The aim of the study was to investigate the resistant mechanisms and homology of imipenem-resistant Acinetobacter baumannii (A. baumannii). A total of 46 non-duplicate imipenem‑resistant A. baumannii clinical isolates were collected from three tertiary hospitals between July, 2011 and June, 2012. The minimal inhibitory concentrations (MICs) of antimicrobial agents were determined using the agar dilution method. Phenylalanine‑arginine β-naphthylamide was used to detect the presence of the efflux pump-mediated resistant mechanism. Polymerase chain reaction was employed to amplify genes associated with drug resistance, including β‑lactamase genes, efflux pump genes and outer membrane protein gene CarO. A few amplicons were randomly selected and sequenced. Multilocus sequence analysis (MLST) was employed in typing A. baumanni. A. baumannii was resistant to imipenem, simultaneously showing resistance to several other antimicrobials. In addtition, 13 A. baumannii were found to mediate drug resistance through operation of the efflux pump. Of the various drug resistance genes tested, blaOXA‑51 was present in 46 isolates, blaOXA‑23 gene was present in 44 isolates and blaNDM gene was found in only one strain. Other drug resistant‑associated genes, including blaKPC, blaIMP, blaOXA-24, blaOXA‑58, blaSHV, blaGIM and blaVIM were not detected. Mutation of adeS and outer membrane protein gene CarO were found in a few of the imipenem‑resistant isolates. The MLST analysis revealed that all 46 clinical isolates were clustered into 11 genotypes and the most frequent genotype was ST208. In conclusion, β‑lactamase genes, genes involved in efflux pump and mutation of outer membrane protein encoding gene may be important in mediating imipenem resistance in A. baumannii. Of the 11 different genotypes, ST11 was shared by the majority of A. baumannii, which may be due to horizontal transfer of patients from hospitals.

  16. Biogenesis of the mitochondrial TOM complex: Mim1 promotes insertion and assembly of signal-anchored receptors.

    PubMed

    Becker, Thomas; Pfannschmidt, Sylvia; Guiard, Bernard; Stojanovski, Diana; Milenkovic, Dusanka; Kutik, Stephan; Pfanner, Nikolaus; Meisinger, Chris; Wiedemann, Nils

    2008-01-04

    The translocase of the outer membrane (TOM complex) is the central entry gate for nuclear-encoded mitochondrial precursor proteins. All Tom proteins are also encoded by nuclear genes and synthesized as precursors in the cytosol. The channel-forming beta-barrel protein Tom40 is targeted to mitochondria via Tom receptors and inserted into the outer membrane by the sorting and assembly machinery (SAM complex). A further outer membrane protein, Mim1, plays a less defined role in assembly of Tom40 into the TOM complex. The three receptors Tom20, Tom22, and Tom70 are anchored in the outer membrane by a single transmembrane alpha-helix, located at the N terminus in the case of Tom20 and Tom70 (signal-anchored) or in the C-terminal portion in the case of Tom22 (tail-anchored). Insertion of the precursor of Tom22 into the outer membrane requires pre-existing Tom receptors while the import pathway of the precursors of Tom20 and Tom70 is only poorly understood. We report that Mim1 is required for efficient membrane insertion and assembly of Tom20 and Tom70, but not Tom22. We show that Mim1 associates with SAM(core) components to a large SAM complex, explaining its role in late steps of the assembly pathway of Tom40. We conclude that Mim1 is not only required for biogenesis of the beta-barrel protein Tom40 but also for membrane insertion and assembly of signal-anchored Tom receptors. Thus, Mim1 plays an important role in the efficient assembly of the mitochondrial TOM complex.

  17. Comparative transcriptional and translational analysis of leptospiral outer membrane protein expression in response to temperature.

    PubMed

    Lo, Miranda; Cordwell, Stuart J; Bulach, Dieter M; Adler, Ben

    2009-12-08

    Leptospirosis is a global zoonosis affecting millions of people annually. Transcriptional changes in response to temperature were previously investigated using microarrays to identify genes potentially expressed upon host entry. Past studies found that various leptospiral outer membrane proteins are differentially expressed at different temperatures. However, our microarray studies highlighted a divergence between protein abundance and transcript levels for some proteins. Given the abundance of post-transcriptional expression control mechanisms, this finding highlighted the importance of global protein analysis systems. To complement our previous transcription study, we evaluated differences in the proteins of the leptospiral outer membrane fraction in response to temperature upshift. Outer membrane protein-enriched fractions from Leptospira interrogans grown at 30 degrees C or overnight upshift to 37 degrees C were isolated and the relative abundance of each protein was determined by iTRAQ analysis coupled with two-dimensional liquid chromatography and tandem mass spectrometry (2-DLC/MS-MS). We identified 1026 proteins with 99% confidence; 27 and 66 were present at elevated and reduced abundance respectively. Protein abundance changes were compared with transcriptional differences determined from the microarray studies. While there was some correlation between the microarray and iTRAQ data, a subset of genes that showed no differential expression by microarray was found to encode temperature-regulated proteins. This set of genes is of particular interest as it is likely that regulation of their expression occurs post-transcriptionally, providing an opportunity to develop hypotheses about the molecular dynamics of the outer membrane of Leptospira in response to changing environments. This is the first study to compare transcriptional and translational responses to temperature shift in L. interrogans. The results thus provide an insight into the mechanisms used by L. interrogans to adapt to conditions encountered in the host and to cause disease. Our results suggest down-regulation of protein expression in response to temperature, and decreased expression of outer membrane proteins may facilitate minimal interaction with host immune mechanisms.

  18. Myxobacterium-Produced Antibiotic TA (Myxovirescin) Inhibits Type II Signal Peptidase

    PubMed Central

    Xiao, Yao; Gerth, Klaus; Müller, Rolf

    2012-01-01

    Antibiotic TA is a macrocyclic secondary metabolite produced by myxobacteria that has broad-spectrum bactericidal activity. The structure of TA is unique, and its molecular target is unknown. Here, we sought to elucidate TA's mode of action (MOA) through two parallel genetic approaches. First, chromosomal Escherichia coli TA-resistant mutants were isolated. One mutant that showed specific resistance toward TA was mapped and resulted from an IS4 insertion in the lpp gene, which encodes an abundant outer membrane (Braun's) lipoprotein. In a second approach, the comprehensive E. coli ASKA plasmid library was screened for overexpressing clones that conferred TAr. This effort resulted in the isolation of the lspA gene, which encodes the type II signal peptidase that cleaves signal sequences from prolipoproteins. In whole cells, TA was shown to inhibit Lpp prolipoprotein processing, similar to the known LspA inhibitor globomycin. Based on genetic evidence and prior globomycin studies, a block in Lpp expression or prevention of Lpp covalent cell wall attachment confers TAr by alleviating a toxic buildup of mislocalized pro-Lpp. Taken together, these data argue that LspA is the molecular target of TA. Strikingly, the giant ta biosynthetic gene cluster encodes two lspA paralogs that we hypothesize play a role in producer strain resistance. PMID:22232277

  19. The host outer membrane proteins OmpA and OmpC are associated with the Shigella phage Sf6 virion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao Haiyan, E-mail: zhaohy@ku.ed; Sequeira, Reuben D., E-mail: sequen@ku.ed; Galeva, Nadezhda A., E-mail: galeva@ku.ed

    2011-01-20

    Assembly of dsDNA bacteriophage is a precisely programmed process. Potential roles of host cell components in phage assembly haven't been well understood. It was previously reported that two unidentified proteins were present in bacteriophage Sf6 virion (Casjens et al, 2004, J.Mol.Biol. 339, 379-394, Fig. 2A). Using tandem mass spectrometry, we have identified the two proteins as outer membrane proteins (OMPs) OmpA and OmpC from its host Shigella flexneri. The transmission electron cryo-microscopy structure of Sf6 shows significant density at specific sites at the phage capsid inner surface. This density fit well with the characteristic beta-barrel domains of OMPs, thus maymore » be due to the two host proteins. Locations of this density suggest a role in Sf6 morphogenesis reminiscent of phage-encoded cementing proteins. These data indicate a new, OMP-related phage:host linkage, adding to previous knowledge that some lambdoid bacteriophage genomes contain OmpC-like genes that express phage-encoded porins in the lysogenic state.« less

  20. Purification, characterization and sequence analysis of Omp50,a new porin isolated from Campylobacter jejuni.

    PubMed Central

    Bolla, J M; Dé, E; Dorez, A; Pagès, J M

    2000-01-01

    A novel pore-forming protein identified in Campylobacter was purified by ion-exchange chromatography and named Omp50 according to both its molecular mass and its outer membrane localization. We observed a pore-forming ability of Omp50 after re-incorporation into artificial membranes. The protein induced cation-selective channels with major conductance values of 50-60 pS in 1 M NaCl. N-terminal sequencing allowed us to identify the predicted coding sequence Cj1170c from the Campylobacter jejuni genome database as the corresponding gene in the NCTC 11168 genome sequence. The gene, designated omp50, consists of a 1425 bp open reading frame encoding a deduced 453-amino acid protein with a calculated pI of 5.81 and a molecular mass of 51169.2 Da. The protein possessed a 20-amino acid leader sequence. No significant similarity was found between Omp50 and porin protein sequences already determined. Moreover, the protein showed only weak sequence identity with the major outer-membrane protein (MOMP) of Campylobacter, correlating with the absence of antigenic cross-reactivity between these two proteins. Omp50 is expressed in C. jejuni and Campylobacter lari but not in Campylobacter coli. The gene, however, was detected in all three species by PCR. According to its conformation and functional properties, the protein would belong to the family of outer-membrane monomeric porins. PMID:11104668

  1. Localization of the Norrie disease gene mRNA by in situ hybridization.

    PubMed

    Hartzer, M K; Cheng, M; Liu, X; Shastry, B S

    1999-07-15

    Norrie disease is a rare X-linked recessive neurodevelopmental disorder. The affected males manifest congenital blindness, which is often associated with hearing loss, mental retardation and psychiatric problems. Genetic linkage studies have localized the gene to the short arm of the X-chromosome and the gene has been isolated recently. The encoded protein is a member of the superfamily of growth factors containing a cystine knot motif and may be involved in cell adhesion and neurodevelopment. Molecular genetic analysis revealed a large number of missense, nonsense, deletion, and splice-site mutations among Norrie patients. In order to further determine the role of the Norrie disease gene, we studied the distribution pattern of its mRNA in the retina and in brain by in situ hybridization. The results show abundant hybridization signals in outer nuclear, inner nuclear, and ganglion cell layers of the retina in all three species (mice, rabbit, and human) examined. There was no significant expression in the vitreous body, lens, and rod outer segment. High expression levels were also observed in the cerebellar granular layer, hippocampus, olfactory bulb, cortex, and epithelium of the rabbit brain. These data suggest that the Norrie disease gene could play a critical role in the differentiation or maintenance of the differentiated state of the retina.

  2. ExbBD-Dependent Transport of Maltodextrins through the Novel MalA Protein across the Outer Membrane of Caulobacter crescentus

    PubMed Central

    Neugebauer, Heidi; Herrmann, Christina; Kammer, Winfried; Schwarz, Gerold; Nordheim, Alfred; Braun, Volkmar

    2005-01-01

    Analysis of the genome sequence of Caulobacter crescentus predicts 67 TonB-dependent outer membrane proteins. To demonstrate that among them are proteins that transport nutrients other than chelated Fe3+ and vitamin B12—the substrates hitherto known to be transported by TonB-dependent transporters—the outer membrane protein profile of cells grown on different substrates was determined by two-dimensional electrophoresis. Maltose induced the synthesis of a hitherto unknown 99.5-kDa protein, designated here as MalA, encoded by the cc2287 genomic locus. MalA mediated growth on maltodextrins and transported [14C]maltodextrins from [14C]maltose to [14C]maltopentaose. [14C]maltose transport showed biphasic kinetics, with a fast initial rate and a slower second rate. The initial transport had a Kd of 0.2 μM, while the second transport had a Kd of 5 μM. It is proposed that the fast rate reflects binding to MalA and the second rate reflects transport into the cells. Energy depletion of cells by 100 μM carbonyl cyanide 3-chlorophenylhydrazone abolished maltose binding and transport. Deletion of the malA gene diminished maltose transport to 1% of the wild-type malA strain and impaired transport of the larger maltodextrins. The malA mutant was unable to grow on maltodextrins larger than maltotetraose. Deletion of two C. crescentus genes homologous to the exbB exbD genes of Escherichia coli abolished [14C]maltodextrin binding and transport and growth on maltodextrins larger than maltotetraose. These mutants also showed impaired growth on Fe3+-rhodotorulate as the sole iron source, which provided evidence of energy-coupled transport. Unexpectedly, a deletion mutant of a tonB homolog transported maltose at the wild-type rate and grew on all maltodextrins tested. Since Fe3+-rhodotorulate served as an iron source for the tonB mutant, an additional gene encoding a protein with a TonB function is postulated. Permeation of maltose and maltotriose through the outer membrane of the C. crescentus malA mutant was slower than permeation through the outer membrane of an E. coli lamB mutant, which suggests a low porin activity in C. crescentus. The pores of the C. crescentus porins are slightly larger than those of E. coli K-12, since maltotetraose supported growth of the C. crescentus malA mutant but failed to support growth of the E. coli lamB mutant. The data are consistent with the proposal that binding of maltodextrins to MalA requires energy and MalA actively transports maltodextrins with Kd values 1,000-fold smaller than those for the LamB porin and 100-fold larger than those for the vitamin B12 and ferric siderophore outer membrane transporters. MalA is the first example of an outer membrane protein for which an ExbB/ExbD-dependent transport of a nutrient other than iron and vitamin B12 has been demonstrated. PMID:16321934

  3. Molecular characterization, genomic arrangement, and expression of bmpD, a new member of the bmp class of genes encoding membrane proteins of Borrelia burgdorferi.

    PubMed Central

    Ramamoorthy, R; Povinelli, L; Philipp M, T

    1996-01-01

    An expression library made with Borrelia burgdorferi DNA in the vector lambda ZapII was screened with serum from a monkey infected with the Lyme disease agent. This serum killed B. burgdorferi in vitro by an antibody-dependent, complement-mediated mechanism and contained antibodies to at least seven spirochetal antigens, none of which were the major outer surface proteins OspA or OspB. Among several positive clones, a clone containing the B. burgdorferi bmpA gene encoding the immunodominant antigen P39 was obtained. Chromosome walking and DNA sequence analysis permitted the identification of two additional upstream genes homologous to the bmpA gene and its related companion, bmpB. The first of these was the recently characterized bmpC gene, and adjacent to it was the fourth and new member of this class, which has been designated bmpD. The gene product encoded by bmpD is 34l residues long, contains a signal sequence with a potential signal peptidase II cleavage site, and has 26% identity with TmpC of Treponema pallidum. Southern blotting confirmed the tandem arrangement of all four bmp genes in the chromosome of B. burgdorferi JD1. However, Northern (RNA) blotting revealed that bmpD is expressed as a monocistronic transcript, which indicates that it is not part of an operon at the bmp locus. The bmpD gene was found to be conserved in representative members of the three species of the B. burgdorferi sensu lato complex, suggesting that it serves an important biological function in the spirochete. PMID:8606088

  4. Virulence characteristics of extraintestinal pathogenic Escherichia coli deletion of gene encoding the outer membrane protein X.

    PubMed

    Meng, Xianrong; Liu, Xueling; Zhang, Liyuan; Hou, Bo; Li, Binyou; Tan, Chen; Li, Zili; Zhou, Rui; Li, Shaowen

    2016-09-01

    Outer membrane protein X (OmpX) and its homologues have been proposed to contribute to the virulence in various bacterial species. But, their role in virulence of extraintestinal pathogenic Escherichia coli (ExPEC) is yet to be determined. This study evaluates the role of OmpX in ExPEC virulence in vitro and in vivo using a clinical strain PPECC42 of porcine origin. The ompX deletion mutant exhibited increased swimming motility and decreased adhesion to, and invasion of pulmonary epithelial A549 cell, compared to the wild-type strain. A mild increase in LD50 and distinct decrease in bacterial load in such organs as heart, liver, spleen, lung and kidney were observed in mice infected with the ompX mutant. Complementation of the complete ompX gene in trans restored the virulence of mutant strain to the level of wild-type strain. Our results reveal that OmpX contributes to ExPEC virulence, but may be not an indispensable virulence determinant.

  5. The presence of OMP inclusion bodies in a Escherichia coli K-12 mutated strain is not related to lipopolysaccharide structure.

    PubMed

    Corsaro, M Michela; Parrilli, Ermenegilda; Lanzetta, Rosa; Naldi, Teresa; Pieretti, Giuseppina; Lindner, Buko; Carpentieri, Andrea; Parrilli, Michelangelo; Tutino, M Luisa

    2009-08-01

    The role of lipopolysaccharides (LPSs) in the biogenesis of outer membrane proteins have been investigated in several studies. Some of these analyses showed that LPS is required for correct and efficient folding of outer membrane proteins; other studies support the idea of independence of outer membrane proteins biogenesis from LPS structure. In this article, we investigated the involvement of LPS structure in the anomalous aggregation of outer membrane proteins in a E. coli mutant strain (S17-1(lambdapir)). To achieve this aim, the LPS structure of the mutant strain was carefully determined and compared with the E. coli K-12 one. It turned out that LPS of these two strains differs in the inner core for the absence of a heptose residue (HepIII). We demonstrated that this difference is due to a mutation in waaQ, a gene encoding the transferase for the branch heptose HepIII residue. The mutation was complemented to find out if the restoration of LPS structure influenced the observed outer membrane proteins aggregation. Data reported in this work demonstrated that, in E. coli S17-1(lambdapir) there is no influence of LPS structure on the outer membrane proteins inclusion bodies formation.

  6. Pea chloroplast DnaJ-J8 and Toc12 are encoded by the same gene and localized in the stroma.

    PubMed

    Chiu, Chi-Chou; Chen, Lih-Jen; Li, Hsou-min

    2010-11-01

    Toc12 is a novel J domain-containing protein identified in pea (Pisum sativum) chloroplasts. It was shown to be an integral outer membrane protein localizing in the intermembrane space of the chloroplast envelope. Furthermore, Toc12 was shown to associate with an intermembrane space Hsp70, suggesting that Toc12 is important for protein translocation across the chloroplast envelope. Toc12 shares a high degree of sequence similarity with Arabidopsis (Arabidopsis thaliana) DnaJ-J8, which has been suggested to be a soluble protein of the chloroplast stroma. Here, we isolated genes encoding DnaJ-J8 from pea and found that Toc12 is a truncated clone of one of the pea DnaJ-J8s. Protein import analyses indicate that Toc12 and DnaJ-J8s possess a cleavable transit peptide and are localized in the stroma. Arabidopsis mutants with T-DNA insertions in the DnaJ-J8 gene show no defect in chloroplast protein import. Implications of these results in the energetics and mechanisms of chloroplast protein import are discussed.

  7. Gene therapy rescues photoreceptor blindness in dogs and paves the way for treating human X-linked retinitis pigmentosa.

    PubMed

    Beltran, William A; Cideciyan, Artur V; Lewin, Alfred S; Iwabe, Simone; Khanna, Hemant; Sumaroka, Alexander; Chiodo, Vince A; Fajardo, Diego S; Román, Alejandro J; Deng, Wen-Tao; Swider, Malgorzata; Alemán, Tomas S; Boye, Sanford L; Genini, Sem; Swaroop, Anand; Hauswirth, William W; Jacobson, Samuel G; Aguirre, Gustavo D

    2012-02-07

    Hereditary retinal blindness is caused by mutations in genes expressed in photoreceptors or retinal pigment epithelium. Gene therapy in mouse and dog models of a primary retinal pigment epithelium disease has already been translated to human clinical trials with encouraging results. Treatment for common primary photoreceptor blindness, however, has not yet moved from proof of concept to the clinic. We evaluated gene augmentation therapy in two blinding canine photoreceptor diseases that model the common X-linked form of retinitis pigmentosa caused by mutations in the retinitis pigmentosa GTPase regulator (RPGR) gene, which encodes a photoreceptor ciliary protein, and provide evidence that the therapy is effective. After subretinal injections of adeno-associated virus-2/5-vectored human RPGR with human IRBP or GRK1 promoters, in vivo imaging showed preserved photoreceptor nuclei and inner/outer segments that were limited to treated areas. Both rod and cone photoreceptor function were greater in treated (three of four) than in control eyes. Histopathology indicated normal photoreceptor structure and reversal of opsin mislocalization in treated areas expressing human RPGR protein in rods and cones. Postreceptoral remodeling was also corrected: there was reversal of bipolar cell dendrite retraction evident with bipolar cell markers and preservation of outer plexiform layer thickness. Efficacy of gene therapy in these large animal models of X-linked retinitis pigmentosa provides a path for translation to human treatment.

  8. Phage as a template to grow bone mineral nanocrystals.

    PubMed

    Cao, Binrui; Xu, Hong; Mao, Chuanbin

    2014-01-01

    Phage display is a biotechnique that fuses functional peptides on the outer surface of filamentous phage by inserting DNA encoding the peptides into the genes of its coat proteins. The resultant peptide-displayed phage particles have been widely used as biotemplates for the synthesis of functional hybrid nanomaterials. Here, we describe the bioengineering of M13 filamentous phage to surface-display bone mineral (hydroxyapatite (HAP))-nucleating peptides derived from dentin matrix protein-1 and using the engineered phage as a biotemplate to grow HAP nanocrystals.

  9. Organization of the Escherichia coli K-12 gene cluster responsible for production of the extracellular polysaccharide colanic acid.

    PubMed Central

    Stevenson, G; Andrianopoulos, K; Hobbs, M; Reeves, P R

    1996-01-01

    Colanic acid (CA) is an extracellular polysaccharide produced by most Escherichia coli strains as well as by other species of the family Enterobacteriaceae. We have determined the sequence of a 23-kb segment of the E. coli K-12 chromosome which includes the cluster of genes necessary for production of CA. The CA cluster comprises 19 genes. Two other sequenced genes (orf1.3 and galF), which are situated between the CA cluster and the O-antigen cluster, were shown to be unnecessary for CA production. The CA cluster includes genes for synthesis of GDP-L-fucose, one of the precursors of CA, and the gene for one of the enzymes in this pathway (GDP-D-mannose 4,6-dehydratase) was identified by biochemical assay. Six of the inferred proteins show sequence similarity to glycosyl transferases, and two others have sequence similarity to acetyl transferases. Another gene (wzx) is predicted to encode a protein with multiple transmembrane segments and may function in export of the CA repeat unit from the cytoplasm into the periplasm in a process analogous to O-unit export. The first three genes of the cluster are predicted to encode an outer membrane lipoprotein, a phosphatase, and an inner membrane protein with an ATP-binding domain. Since homologs of these genes are found in other extracellular polysaccharide gene clusters, they may have a common function, such as export of polysaccharide from the cell. PMID:8759852

  10. Can direct extracellular electron transfer occur in the absence of outer membrane cytochromes in Desulfovibrio vulgaris?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Elias, Dwayne A; Zane, Mr. Grant M.; Auer, Dr. Manfred

    2010-01-01

    Extracellular electron transfer has been investigated over several decades via forms of soluble electron transfer proteins that are exported for extracellular reoxidation. More recently, several organisms have been shown to reduce extracellular metals via the direct transfer of electron through appendages; also known as nanowires. They have been reported most predominantly in Shewanella and Geobacter. While the relevancy and composition of these structures in each genus has been debated, both possess outer membrane cytochrome complexes that could theoretically come into direct contact with solid phase oxidized metals. Members of the genus Desulfovibrio apparently have no such cytochromes although similar appendagesmore » are present, are electrically conductive, and are different from flagella. Upon U(VI)-reduction, the structures in Desulfovibrio become coated with U(IV). Deletion of flagellar genes did not alter soluble or amorphous Fe(III) or U(VI) reduction, or appendage appearance. Removal of the chromosomal pilA gene hampered amorphous Fe(III)-reduction by ca. 25%, but cells lacking the native plasmid, pDV1, reduced soluble Fe(III) and U(VI) at ca. 50% of the wild type rate while amorphous Fe(III)-reduction slowed to ca. 20% of the wild type rate. Appendages were present in all deletions as well as pDV1, except pilA. Gene complementation restored all activities and morphologies to wild type levels. This suggests that pilA encodes the structural component, whereas genes within pDV1 may provide the reactive members. How such appendages function without outer membrane cytochromes is under investigation.« less

  11. Export of Virulence Genes and Shiga Toxin by Membrane Vesicles of Escherichia coli O157:H7

    PubMed Central

    Kolling, Glynis L.; Matthews, Karl R.

    1999-01-01

    Membrane vesicles released by Escherichia coli O157:H7 into culture medium were purified and analyzed for protein and DNA content. Electron micrographs revealed vesicles that are spherical, range in size from 20 to 100 nm, and have a complete bilayer. Analysis of vesicle protein by sodium dodecyl sulfate-polyacrylamide gel electrophoresis demonstrates vesicles that contain many proteins with molecular sizes similar to outer membrane proteins and a number of cellular proteins. Immunoblot (Western) analysis of vesicles suggests the presence of cell antigens. Treatment of vesicles with exogenous DNase hydrolyzed surface-associated DNA; PCR demonstrated that vesicles contain DNA encoding the virulence genes eae, stx1 and stx2, and uidA, which encodes for β-galactosidase. Immunoblot analysis of intact and lysed, proteinase K-treated vesicles demonstrate that Shiga toxins 1 and 2 are contained within vesicles. These results suggest that vesicles contain toxic material and transfer experiments demonstrate that vesicles can deliver genetic material to other gram-negative organisms. PMID:10223967

  12. Towards understanding the biological function of hopanoids (Invited)

    NASA Astrophysics Data System (ADS)

    Doughty, D. M.; Hunter, R.; Summons, R. E.; Newman, D. K.

    2010-12-01

    Rhodopseudomonas palustris TIE-1 expresses bacterial hopanoid lipids that are structurally similar and evolutionarily related to eukaryotic sterols. The genome of R. palustris TIE-1 contains two copies of the hpnN gene (hpnN1 and hpnN2) that are orthologs of genes encoding eukaryotic sterol and lipid transporters. Hopanoid localization to the outer membrane was found to be dependent upon hpnN1. Since the cell cycle of R. palustris TIE-1 is obligately bimodal with each cell division resulting in the generation of one mother and one swarmer cell, evidence was obtained that hopanoids where specifically localized to the outer membrane of mother cells. The sequestration of hopanoids to the mother cells was also disrupted by the deletion of the hpnN1 gene. Mutants lacking the hopanoid transporters were able to grow normally at 30 °C but showed decreased growth at 38 °C. The hopanoid transporter mutant formed cellular filaments when grown at elevated temperature. Because sedimentary steranes and hopanes comprise some of the earliest evidence for the emergence of distinct bacteria and eukaryotic phyla, a better appreciation of the function of hopanoids will improve our ability to interpret the evolution of life on Earth.

  13. Analysis of the outer membrane proteome and secretome of Bacteroides fragilis reveals a multiplicity of secretion mechanisms.

    PubMed

    Wilson, Marlena M; Anderson, D Eric; Bernstein, Harris D

    2015-01-01

    Bacteroides fragilis is a widely distributed member of the human gut microbiome and an opportunistic pathogen. Cell surface molecules produced by this organism likely play important roles in colonization, communication with other microbes, and pathogenicity, but the protein composition of the outer membrane (OM) and the mechanisms used to transport polypeptides into the extracellular space are poorly characterized. Here we used LC-MS/MS to analyze the OM proteome and secretome of B. fragilis NCTC 9343 grown under laboratory conditions. Of the 229 OM proteins that we identified, 108 are predicted to be lipoproteins, and 61 are predicted to be TonB-dependent transporters. Based on their proximity to genes encoding TonB-dependent transporters, many of the lipoprotein genes likely encode proteins involved in nutrient or small molecule uptake. Interestingly, protease accessibility and biotinylation experiments indicated that an unusually large fraction of the lipoproteins are cell-surface exposed. We also identified three proteins that are members of a novel family of autotransporters, multiple potential type I protein secretion systems, and proteins that appear to be components of a type VI secretion apparatus. The secretome consisted of lipoproteins and other proteins that might be substrates of the putative type I or type VI secretion systems. Our proteomic studies show that B. fragilis differs considerably from well-studied Gram-negative bacteria such as Escherichia coli in both the spectrum of OM proteins that it produces and the range of secretion strategies that it utilizes.

  14. Highly repressible expression system for cloning genes that specify potentially toxic proteins.

    PubMed Central

    O'Connor, C D; Timmis, K N

    1987-01-01

    A highly repressible expression vector system that allows the cloning of potentially deleterious genes has been constructed. Undesired expression of a cloned gene was prevented (i) at the level of initiation of transcription, by the presence of the strong but highly repressible leftward promoter of bacteriophage lambda, lambda pL, and (ii) at the level of transcript elongation or translation, through synthesis of antisense RNA complementary to the mRNA of the cloned gene. The system was tested by measuring the inhibition of expression of traT, the gene for the TraT major outer membrane lipoprotein. Direct detection and functional assays indicated that an essentially complete inhibition of traT expression was obtained. As a further test of the system, the gene encoding the EcoRI restriction endonuclease was cloned in the absence of the gene of the corresponding protective EcoRI modification methylase. Transformants harboring this construct were only viable when both repression controls were operational. Images PMID:2443481

  15. A transcriptional approach to unravel the connection between phospholipases A₂ and D and ABA signal in citrus under water stress.

    PubMed

    Romero, Paco; Lafuente, M Teresa; Alférez, Fernando

    2014-07-01

    The effect of water stress on the interplay between phospholipases (PL) A2 and D and ABA signalling was investigated in fruit and leaves from the sweet orange Navelate and its fruit-specific ABA-deficient mutant Pinalate by studying simultaneously expression of 5 PLD and 3 PLA2-encoding genes. In general, expression levels of PLD-encoding genes were higher at harvest in the flavedo (coloured outer part of the peel) from Pinalate. Moreover, a higher and transient increase in expression of CsPLDα, CsPLDβ, CsPLDδ and CsPLDζ was observed in the mutant as compared to Navelate fruit under water stress, which may reflect a mechanism of acclimation to water stress influenced by ABA deficiency. An early induction in CsPLDγ gene expression, when increase in peel damage during fruit storage was most evident, suggested a role for this gene in membrane degradation processes during water stress. Exogenous ABA on mutant fruit modified the expression of all PLD genes and reduced the expression of CsPLDα and CsPLDβ by 1 week to levels similar to those of Navelate, suggesting a repressor role of ABA on these genes. In general, CssPLA2α and β transcript levels were lower in flavedo from Pinalate than from Navelate fruit during the first 3 weeks of storage, suggesting that expression of these genes also depends at least partially on ABA levels. Patterns of expression of PLD and PLA2-encoding genes were very similar in Navelate and Pinalate leaves, which have similar ABA levels, when comparing both RH conditions. Results comparison with other from previous works in the same experimental systems helped to decipher the effect of the stress severity on the differential response of some of these genes under dehydration conditions and pointed out the interplay between PLA2 and PLD families and their connection with ABA signalling in citrus. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  16. A Bacteriophage-Related Chimeric Marine Virus Infecting Abalone

    PubMed Central

    Zhuang, Jun; Cai, Guiqin; Lin, Qiying; Wu, Zujian; Xie, Lianhui

    2010-01-01

    Marine viruses shape microbial communities with the most genetic diversity in the sea by multiple genetic exchanges and infect multiple marine organisms. Here we provide proof from experimental infection that abalone shriveling syndrome-associated virus (AbSV) can cause abalone shriveling syndrome. This malady produces histological necrosis and abnormally modified macromolecules (hemocyanin and ferritin). The AbSV genome is a 34.952-kilobase circular double-stranded DNA, containing putative genes with similarity to bacteriophages, eukaryotic viruses, bacteria and endosymbionts. Of the 28 predicted open reading frames (ORFs), eight ORF-encoded proteins have identifiable functional homologues. The 4 ORF products correspond to a predicted terminase large subunit and an endonuclease in bacteriophage, and both an integrase and an exonuclease from bacteria. The other four proteins are homologous to an endosymbiont-derived helicase, primase, single-stranded binding (SSB) protein, and thymidylate kinase, individually. Additionally, AbSV exhibits a common gene arrangement similar to the majority of bacteriophages. Unique to AbSV, the viral genome also contains genes associated with bacterial outer membrane proteins and may lack the structural protein-encoding ORFs. Genomic characterization of AbSV indicates that it may represent a transitional form of microbial evolution from viruses to bacteria. PMID:21079776

  17. Virulence determinants, drug resistance and mobile genetic elements of Laribacter hongkongensis: a genome-wide analysis

    PubMed Central

    2011-01-01

    Background Laribacter hongkongensis is associated with community-acquired gastroenteritis and traveler's diarrhea. In this study, we performed an in-depth annotation of the genes in its genome related to the various steps in the infective process, drug resistance and mobile genetic elements. Results For acid and bile resistance, L. hongkongensis possessed a urease gene cassette, two arc gene clusters and bile salt efflux systems. For intestinal colonization, it possessed a putative adhesin of the autotransporter family homologous to those of diffusely adherent Escherichia coli (E. coli) and enterotoxigenic E. coli. To evade from host defense, it possessed superoxide dismutase and catalases. For lipopolysaccharide biosynthesis, it possessed the same set of genes that encode enzymes for synthesizing lipid A, two Kdo units and heptose units as E. coli, but different genes for its symmetrical acylation pattern, and nine genes for polysaccharide side chains biosynthesis. It contained a number of CDSs that encode putative cell surface acting (RTX toxin and hemolysins) and intracellular cytotoxins (patatin-like proteins) and enzymes for invasion (outer membrane phospholipase A). It contained a broad variety of antibiotic resistance-related genes, including genes related to β-lactam (n = 10) and multidrug efflux (n = 54). It also contained eight prophages, 17 other phage-related CDSs and 26 CDSs for transposases. Conclusions The L. hongkongensis genome possessed genes for acid and bile resistance, intestinal mucosa colonization, evasion of host defense and cytotoxicity and invasion. A broad variety of antibiotic resistance or multidrug resistance genes, a high number of prophages, other phage-related CDSs and CDSs for transposases, were also identified. PMID:21711902

  18. Many Saccharomyces cerevisiae Cell Wall Protein Encoding Genes Are Coregulated by Mss11, but Cellular Adhesion Phenotypes Appear Only Flo Protein Dependent.

    PubMed

    Bester, Michael C; Jacobson, Dan; Bauer, Florian F

    2012-01-01

    The outer cell wall of the yeast Saccharomyces cerevisiae serves as the interface with the surrounding environment and directly affects cell-cell and cell-surface interactions. Many of these interactions are facilitated by specific adhesins that belong to the Flo protein family. Flo mannoproteins have been implicated in phenotypes such as flocculation, substrate adhesion, biofilm formation, and pseudohyphal growth. Genetic data strongly suggest that individual Flo proteins are responsible for many specific cellular adhesion phenotypes. However, it remains unclear whether such phenotypes are determined solely by the nature of the expressed FLO genes or rather as the result of a combination of FLO gene expression and other cell wall properties and cell wall proteins. Mss11 has been shown to be a central element of FLO1 and FLO11 gene regulation and acts together with the cAMP-PKA-dependent transcription factor Flo8. Here we use genome-wide transcription analysis to identify genes that are directly or indirectly regulated by Mss11. Interestingly, many of these genes encode cell wall mannoproteins, in particular, members of the TIR and DAN families. To examine whether these genes play a role in the adhesion properties associated with Mss11 expression, we assessed deletion mutants of these genes in wild-type and flo11Δ genetic backgrounds. This analysis shows that only FLO genes, in particular FLO1/10/11, appear to significantly impact on such phenotypes. Thus adhesion-related phenotypes are primarily dependent on the balance of FLO gene expression.

  19. FluG affects secretion in colonies of Aspergillus niger.

    PubMed

    Wang, Fengfeng; Krijgsheld, Pauline; Hulsman, Marc; de Bekker, Charissa; Müller, Wally H; Reinders, Marcel; de Vries, Ronald P; Wösten, Han A B

    2015-01-01

    Colonies of Aspergillus niger are characterized by zonal heterogeneity in growth, sporulation, gene expression and secretion. For instance, the glucoamylase gene glaA is more highly expressed at the periphery of colonies when compared to the center. As a consequence, its encoded protein GlaA is mainly secreted at the outer part of the colony. Here, multiple copies of amyR were introduced in A. niger. Most transformants over-expressing this regulatory gene of amylolytic genes still displayed heterogeneous glaA expression and GlaA secretion. However, heterogeneity was abolished in transformant UU-A001.13 by expressing glaA and secreting GlaA throughout the mycelium. Sequencing the genome of UU-A001.13 revealed that transformation had been accompanied by deletion of part of the fluG gene and disrupting its 3' end by integration of a transformation vector. Inactivation of fluG in the wild-type background of A. niger also resulted in breakdown of starch under the whole colony. Asexual development of the ∆fluG strain was not affected, unlike what was previously shown in Aspergillus nidulans. Genes encoding proteins with a signal sequence for secretion, including part of the amylolytic genes, were more often downregulated in the central zone of maltose-grown ∆fluG colonies and upregulated in the intermediate part and periphery when compared to the wild-type. Together, these data indicate that FluG of A. niger is a repressor of secretion.

  20. Analysis of complete genome sequence of Neorickettsia risticii: causative agent of Potomac horse fever

    PubMed Central

    Lin, Mingqun; Zhang, Chunbin; Gibson, Kathryn; Rikihisa, Yasuko

    2009-01-01

    Neorickettsia risticii is an obligate intracellular bacterium of the trematodes and mammals. Horses develop Potomac horse fever (PHF) when they ingest aquatic insects containing encysted N. risticii-infected trematodes. The complete genome sequence of N. risticii Illinois consists of a single circular chromosome of 879 977 bp and encodes 38 RNA species and 898 proteins. Although N. risticii has limited ability to synthesize amino acids and lacks many metabolic pathways, it is capable of making major vitamins, cofactors and nucleotides. Comparison with its closely related human pathogen N. sennetsu showed that 758 (88.2%) of protein-coding genes are conserved between N. risticii and N. sennetsu. Four-way comparison of genes among N. risticii and other Anaplasmataceae showed that most genes are either shared among Anaplasmataceae (525 orthologs that generally associated with housekeeping functions), or specific to each genome (>200 genes that are mostly hypothetical proteins). Genes potentially involved in the pathogenesis of N. risticii were identified, including those encoding putative outer membrane proteins, two-component systems and a type IV secretion system (T4SS). The bipolar localization of T4SS pilus protein VirB2 on the bacterial surface was demonstrated for the first time in obligate intracellular bacteria. These data provide insights toward genomic potential of N. risticii and intracellular parasitism, and facilitate our understanding of PHF pathogenesis. PMID:19661282

  1. Analysis of complete genome sequence of Neorickettsia risticii: causative agent of Potomac horse fever.

    PubMed

    Lin, Mingqun; Zhang, Chunbin; Gibson, Kathryn; Rikihisa, Yasuko

    2009-10-01

    Neorickettsia risticii is an obligate intracellular bacterium of the trematodes and mammals. Horses develop Potomac horse fever (PHF) when they ingest aquatic insects containing encysted N. risticii-infected trematodes. The complete genome sequence of N. risticii Illinois consists of a single circular chromosome of 879 977 bp and encodes 38 RNA species and 898 proteins. Although N. risticii has limited ability to synthesize amino acids and lacks many metabolic pathways, it is capable of making major vitamins, cofactors and nucleotides. Comparison with its closely related human pathogen N. sennetsu showed that 758 (88.2%) of protein-coding genes are conserved between N. risticii and N. sennetsu. Four-way comparison of genes among N. risticii and other Anaplasmataceae showed that most genes are either shared among Anaplasmataceae (525 orthologs that generally associated with housekeeping functions), or specific to each genome (>200 genes that are mostly hypothetical proteins). Genes potentially involved in the pathogenesis of N. risticii were identified, including those encoding putative outer membrane proteins, two-component systems and a type IV secretion system (T4SS). The bipolar localization of T4SS pilus protein VirB2 on the bacterial surface was demonstrated for the first time in obligate intracellular bacteria. These data provide insights toward genomic potential of N. risticii and intracellular parasitism, and facilitate our understanding of PHF pathogenesis.

  2. Role of protein farnesylation events in the ABA-mediated regulation of the Pinoresinol-Lariciresinol Reductase 1 (LuPLR1) gene expression and lignan biosynthesis in flax (Linum usitatissimum L.).

    PubMed

    Corbin, Cyrielle; Decourtil, Cédric; Marosevic, Djurdjica; Bailly, Marlène; Lopez, Tatiana; Renouard, Sullivan; Doussot, Joël; Dutilleul, Christelle; Auguin, Daniel; Giglioli-Guivarc'h, Nathalie; Lainé, Eric; Lamblin, Frédéric; Hano, Christophe

    2013-11-01

    A Linum usitatissimum LuERA1 gene encoding a putative ortholog of the ERA1 (Enhanced Response to ABA 1) gene of Arabidopsis thaliana (encoding the beta subunit of a farnesyltransferase) was analyzed in silico and for its expression in flax. The gene and the protein sequences are highly similar to other sequences already characterized in plants and all the features of a farnesyltransferase were detected. Molecular modeling of LuERA1 protein confirmed its farnesyltransferase nature. LuERA1 is expressed in the vegetative organs and also in the outer seedcoat of the flaxseed, where it could modulate the previously observed regulation operated by ABA on lignan synthesis. This effect could be mediated by the regulation of the transcription of a key gene for lignan synthesis in flax, the LuPLR1 gene, encoding a pinoresinol lariciresinol reductase. The positive effect of manumycin A, a specific inhibitor of farnesyltransferase, on lignan biosynthesis in flax cell suspension systems supports the hypothesis of the involvement of such an enzyme in the negative regulation of ABA action. In Arabidopsis, ERA1 is able to negatively regulate the ABA effects and the mutant era1 has an enhanced sensitivity to ABA. When expressed in an Arabidopsis cell suspension (heterologous system) LuERA1 is able to reverse the effect of the era1 mutation. RNAi experiments in flax targeting the farnesyltransferase β-subunit encoded by the LuERA1 gene led to an increase LuPLR1 expression level associated with an increased content of lignan in transgenic calli. Altogether these results strongly suggest a role of the product of this LuERA1 gene in the ABA-mediated upregulation of lignan biosynthesis in flax cells through the activation of LuPLR1 promoter. This ABA signaling pathway involving ERA1 probably acts through the ABRE box found in the promoter sequence of LuPLR1, a key gene for lignan synthesis in flax, as demonstrated by LuPLR1 gene promoter-reporter experiments in flax cells using wild type and mutated promoter sequences. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  3. Identification and Characterization of a Large Protein Essential for Degradation of the Crystalline Region of Cellulose by Cytophaga hutchinsonii

    PubMed Central

    Wang, Sen; Zhao, Dong; Bai, Xinfeng; Zhang, Weican

    2016-01-01

    ABSTRACT Cytophaga hutchinsonii is a Gram-negative bacterium that can efficiently degrade crystalline cellulose by a unique mechanism different from the free cellulase or cellulosome strategy. In this study, chu_3220, encoding the hypothetical protein CHU_3220 (205 kDa), was identified by insertional mutation and gene deletion as the first gene essential for degradation of the crystalline region but not the amorphous region of cellulose by C. hutchinsonii. A chu_3220 deletion mutant was defective in the degradation of crystalline cellulose and increased the degree of crystallinity of Avicel PH101 but could still degrade amorphous cellulose completely. CHU_3220 was found to be located on the outer surface of the outer membrane and could bind to cellulose. It contains 15 PbH1 domains and a C-terminal domain (CHU_C) that was proved to be critical for the localization of CHU_3220 on the cell surface and the function of CHU_3220 in crystalline cellulose degradation. Moreover, the degradation of crystalline cellulose was intact-cell dependent and inhibited by NaN3. Further study showed that chu_3220 was induced by cellulose and that the endoglucanase activity on the cell surface was significantly reduced without chu_3220. Real-time PCR revealed that the transcription of most genes encoding endoglucanases located on the cell surface was decreased in the chu_3220 deletion mutant, indicating that chu_3220 might also play a role in the regulation of the expression of some endoglucanases. IMPORTANCE Cytophaga hutchinsonii could efficiently degrade crystalline cellulose with a unique mechanism without cellulosomes and free cellulases. It lacks proteins that are thought to play important roles in disruption of the crystalline region of cellulose, including exoglucanases, lytic polysaccharide monooxygenases, expansins, expansin-like proteins, or swollenins, and most of its endoglucanases lack carbohydrate binding modules. The mechanism of the degradation of crystalline cellulose is still unknown. In this study, chu_3220 was identified as the first gene essential for the degradation of the crystalline region but not the amorphous region of cellulose. CHU_3220 is a high-molecular-weight protein located on the outer surface of the outer membrane and could bind to cellulose. We proposed that CHU_3220 might be an essential component of a protein complex on the cell surface in charge of the decrystallization of crystalline cellulose. The degradation of crystalline cellulose by C. hutchinsonii was not only dependent on intact cells but also required the energy supplied by the cells. This was obviously different from other known cellulose depolymerization system. Our study has shed more light on the novel strategy of crystalline cellulose degradation by C. hutchinsonii. PMID:27742681

  4. Molecular Evolution and Mosaicism of Leptospiral Outer Membrane Proteins Involves Horizontal DNA Transfer

    PubMed Central

    Haake, David A.; Suchard, Marc A.; Kelley, Melissa M.; Dundoo, Manjula; Alt, David P.; Zuerner, Richard L.

    2004-01-01

    Leptospires belong to a genus of parasitic bacterial spirochetes that have adapted to a broad range of mammalian hosts. Mechanisms of leptospiral molecular evolution were explored by sequence analysis of four genes shared by 38 strains belonging to the core group of pathogenic Leptospira species: L. interrogans, L. kirschneri, L. noguchii, L. borgpetersenii, L. santarosai, and L. weilii. The 16S rRNA and lipL32 genes were highly conserved, and the lipL41 and ompL1 genes were significantly more variable. Synonymous substitutions are distributed throughout the ompL1 gene, whereas nonsynonymous substitutions are clustered in four variable regions encoding surface loops. While phylogenetic trees for the 16S, lipL32, and lipL41 genes were relatively stable, 8 of 38 (20%) ompL1 sequences had mosaic compositions consistent with horizontal transfer of DNA between related bacterial species. A novel Bayesian multiple change point model was used to identify the most likely sites of recombination and to determine the phylogenetic relatedness of the segments of the mosaic ompL1 genes. Segments of the mosaic ompL1 genes encoding two of the surface-exposed loops were likely acquired by horizontal transfer from a peregrine allele of unknown ancestry. Identification of the most likely sites of recombination with the Bayesian multiple change point model, an approach which has not previously been applied to prokaryotic gene sequence analysis, serves as a model for future studies of recombination in molecular evolution of genes. PMID:15090524

  5. Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

    PubMed

    Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

    2011-05-01

    A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

  6. Protein targeting and integration signal for the chloroplastic outer envelope membrane.

    PubMed Central

    Li, H M; Chen, L J

    1996-01-01

    Most proteins in chloroplasts are encoded by the nuclear genome and synthesized in the cytosol. With the exception of most quter envelope membrane proteins, nuclear-encoded chloroplastic proteins are synthesized with N-terminal extensions that contain the chloroplast targeting information of these proteins. Most outer membrane proteins, however, are synthesized without extensions in the cytosol. Therefore, it is not clear where the chloroplastic outer membrane targeting information resides within these polypeptides. We have analyzed a chloroplastic outer membrane protein, OEP14 (outer envelope membrane protein of 14 kD, previously named OM14), and localized its outer membrane targeting and integration signal to the first 30 amino acids of the protein. This signal consists of a positively charged N-terminal portion followed by a hydrophobic core, bearing resemblance to the signal peptides of proteins targeted to the endoplasmic reticulum. However, a chimeric protein containing this signal fused to a passenger protein did not integrate into the endoplasmic reticulum membrane. Furthermore, membrane topology analysis indicated that the signal inserts into the chloroplastic outer membrane in an orientation opposite to that predicted by the "positive inside" rule. PMID:8953775

  7. Biochemical and molecular characterization of rice (Oryza sativa L.) roots forming a barrier to radial oxygen loss.

    PubMed

    Kulichikhin, Konstantin; Yamauchi, Takaki; Watanabe, Kohtaro; Nakazono, Mikio

    2014-10-01

    The formation of a barrier to radial oxygen (O2 ) loss (ROL) in the root is an important adaptation of plants to root flooding, but the biochemical changes in plant roots where the barrier is formed are unclear. In this study, we analysed metabolic profiles and gene expression profiles in roots of rice (Oryza sativa L.) plants grown under stagnant deoxygenated conditions, which induce suberization in the outer cell layers of the roots and formation of barrier to ROL. Under these conditions, two distinctive biochemical features of the roots were the accumulations of malic acid and very long chain fatty acids (VLCFAs). We also showed that the expressions of some genes encoding plastid-localized enzymes, which convert malic acid to acetyl coenzyme A (AcCoA), were simultaneously up-regulated under stagnant conditions. The expression levels of these genes in specific root tissues isolated by laser microdissection suggested that malic acid is converted to AcCoA predominantly in the plastids in the outer cell layers of rice roots. We propose that the physiological role of malic acid accumulation in rice roots grown under stagnant conditions is to provide a substrate for the biosynthesis of fatty acids, which, in turn, are used in the biosynthesis of suberin. © 2014 John Wiley & Sons Ltd.

  8. A lower size limit exists for export of fragments of an outer membrane protein (OmpA) of Escherichia coli K-12.

    PubMed

    Freudl, R; Schwarz, H; Degen, M; Henning, U

    1989-02-20

    The ompA gene codes for a 346 residue precursor of a 325 residue protein of the outer membrane of Escherichia coli K-12. Internally and/or COOH-terminally deleted genes were constructed that encode 123, 116, 88, 72 or 68 residue precursors. The former three were processed and localized to the periplasmic space; the latter two were not processed and remained cytosolic. These data suggest that the signal sequence has to interact with a component of the export apparatus (the Sec pathway) before translation is finished. Comparison of these results with others obtained for prokaryotic and eukaryotic systems shows that: (1) a very similar lower size limit exists for membrane translocation of the 147 residue chicken prelysozyme or the 229 residue bovine preprolactin; (2) precursors smaller than those reported here can be translocated in both systems; (3) the latter translocation, in contrast to, for example, the ompA gene products, does not depend on the cellular export machinery but most likely requires folding of the precursors into an export-competent conformation. In general, at least two quite different, not necessarily mutually exclusive, mechanisms for translocation of a protein across or assembly into a membrane appear to exist.

  9. Biallelic Mutations in PLA2G5, Encoding Group V Phospholipase A2, Cause Benign Fleck Retina

    PubMed Central

    Sergouniotis, Panagiotis I.; Davidson, Alice E.; Mackay, Donna S.; Lenassi, Eva; Li, Zheng; Robson, Anthony G.; Yang, Xu; Kam, Jaimie Hoh; Isaacs, Timothy W.; Holder, Graham E.; Jeffery, Glen; Beck, Jonathan A.; Moore, Anthony T.; Plagnol, Vincent; Webster, Andrew R.

    2011-01-01

    Flecked-retina syndromes, including fundus flavimaculatus, fundus albipunctatus, and benign fleck retina, comprise a group of disorders with widespread or limited distribution of yellow-white retinal lesions of various sizes and configurations. Three siblings who have benign fleck retina and were born to consanguineous parents are the basis of this report. A combination of homozygosity mapping and exome sequencing helped to identify a homozygous missense mutation, c.133G>T (p.Gly45Cys), in PLA2G5, a gene encoding a secreted phospholipase (group V phospholipase A2). A screen of a further four unrelated individuals with benign fleck retina detected biallelic variants in the same gene in three patients. In contrast, no loss of function or common (minor-allele frequency>0.05%) nonsynonymous PLA2G5 variants have been previously reported (EVS, dbSNP, 1000 Genomes Project) or were detected in an internal database of 224 exomes (from subjects with adult onset neurodegenerative disease and without a diagnosis of ophthalmic disease). All seven affected individuals had fundoscopic features compatible with those previously described in benign fleck retina and no visual or electrophysiological deficits. No medical history of major illness was reported. Levels of low-density lipoprotein were mildly elevated in two patients. Optical coherence tomography and fundus autofluorescence findings suggest that group V phospholipase A2 plays a role in the phagocytosis of photoreceptor outer-segment discs by the retinal pigment epithelium. Surprisingly, immunohistochemical staining of human retinal tissue revealed localization of the protein predominantly in the inner and outer plexiform layers. PMID:22137173

  10. C2orf71a/pcare1 is important for photoreceptor outer segment morphogenesis and visual function in zebrafish.

    PubMed

    Corral-Serrano, Julio C; Messchaert, Muriël; Dona, Margo; Peters, Theo A; Kamminga, Leonie M; van Wijk, Erwin; Collin, Rob W J

    2018-06-26

    Mutations in C2orf71 are causative for autosomal recessive retinitis pigmentosa and occasionally cone-rod dystrophy. We have recently discovered that the protein encoded by this gene is important for modulation of the ciliary membrane through the recruitment of an actin assembly module, and have therefore renamed the gene to PCARE (photoreceptor cilium actin regulator). Here, we report on the identification of two copies of the c2orf71/pcare gene in zebrafish, pcare1 and pcare2. To study the role of the gene most similar to human PCARE, pcare1, we have generated a stable pcare1 mutant zebrafish model (designated pcare1 rmc100/rmc100 ) in which the coding sequence was disrupted using CRISPR/Cas9 technology. Retinas of both embryonic (5 dpf) and adult (6 mpf) pcare1 rmc100/rmc100 zebrafish display a clear disorganization of photoreceptor outer segments, resembling the phenotype observed in Pcare -/- mice. Optokinetic response and visual motor response measurements indicated visual impairment in pcare1 rmc100/rmc100 zebrafish larvae at 5 dpf. In addition, electroretinogram measurements showed decreased b-wave amplitudes in pcare1 rmc100/rmc100 zebrafish as compared to age- and strain-matched wild-type larvae, indicating a defect in the transretinal current. Altogether, our data show that lack of pcare1 causes a retinal phenotype in zebrafish and indicate that the function of the PCARE gene is conserved across species.

  11. Comparative genome analysis reveals genetic adaptation to versatile environmental conditions and importance of biofilm lifestyle in Comamonas testosteroni.

    PubMed

    Wu, Yichao; Arumugam, Krithika; Tay, Martin Qi Xiang; Seshan, Hari; Mohanty, Anee; Cao, Bin

    2015-04-01

    Comamonas testosteroni is an important environmental bacterium capable of degrading a variety of toxic aromatic pollutants and has been demonstrated to be a promising biocatalyst for environmental decontamination. This organism is often found to be among the primary surface colonizers in various natural and engineered ecosystems, suggesting an extraordinary capability of this organism in environmental adaptation and biofilm formation. The goal of this study was to gain genetic insights into the adaption of C. testosteroni to versatile environments and the importance of a biofilm lifestyle. Specifically, a draft genome of C. testosteroni I2 was obtained. The draft genome is 5,778,710 bp in length and comprises 110 contigs. The average G+C content was 61.88 %. A total of 5365 genes with 5263 protein-coding genes were predicted, whereas 4324 (80.60 % of total genes) protein-encoding genes were associated with predicted functions. The catabolic genes responsible for biodegradation of steroid and other aromatic compounds on draft genome were identified. Plasmid pI2 was found to encode a complete pathway for aniline degradation and a partial catabolic pathway for chloroaniline. This organism was found to be equipped with a sophisticated signaling system which helps it find ideal niches and switch between planktonic and biofilm lifestyles. A large number of putative multi-drug-resistant genes coding for abundant outer membrane transporters, chaperones, and heat shock proteins for the protection of cellular function were identified in the genome of strain I2. In addition, the genome of strain I2 was predicted to encode several proteins involved in producing, secreting, and uptaking siderophores under iron-limiting conditions. The genome of strain I2 contains a number of genes responsible for the synthesis and secretion of exopolysaccharides, an extracellular component essential for biofilm formation. Overall, our results reveal the genomic features underlying the adaption of C. testosteroni to versatile environments and highlighting the importance of its biofilm lifestyle.

  12. Cyclotides Associate with Leaf Vasculature and Are the Products of a Novel Precursor in Petunia (Solanaceae)*

    PubMed Central

    Poth, Aaron G.; Mylne, Joshua S.; Grassl, Julia; Lyons, Russell E.; Millar, A. Harvey; Colgrave, Michelle L.; Craik, David J.

    2012-01-01

    Cyclotides are a large family of plant peptides that are structurally defined by their cyclic backbone and a trifecta of disulfide bonds, collectively known as the cyclic cystine knot (CCK) motif. Structurally similar cyclotides have been isolated from plants within the Rubiaceae, Violaceae, and Fabaceae families and share the CCK motif with trypsin-inhibitory knottins from a plant in the Cucurbitaceae family. Cyclotides have previously been reported to be encoded by dedicated genes or as a domain within a knottin-encoding PA1-albumin-like gene. Here we report the discovery of cyclotides and related non-cyclic peptides we called “acyclotides” from petunia of the agronomically important Solanaceae plant family. Transcripts for petunia cyclotides and acyclotides encode the shortest known cyclotide precursors. Despite having a different precursor structure, their sequences suggest that petunia cyclotides mature via the same biosynthetic route as other cyclotides. We assessed the spatial distribution of cyclotides within a petunia leaf section by MALDI imaging and observed that the major cyclotide component Phyb A was non-uniformly distributed. Dissected leaf midvein extracts contained significantly higher concentrations of this cyclotide compared with the lamina and outer margins of leaves. This is the third distinct type of cyclotide precursor, and Solanaceae is the fourth phylogenetically disparate plant family to produce these structurally conserved cyclopeptides, suggesting either convergent evolution upon the CCK structure or movement of cyclotide-encoding sequences within the plant kingdom. PMID:22700981

  13. Surface display of a massively variable lipoprotein by a Legionella diversity-generating retroelement.

    PubMed

    Arambula, Diego; Wong, Wenge; Medhekar, Bob A; Guo, Huatao; Gingery, Mari; Czornyj, Elizabeth; Liu, Minghsun; Dey, Sanghamitra; Ghosh, Partho; Miller, Jeff F

    2013-05-14

    Diversity-generating retroelements (DGRs) are a unique family of retroelements that confer selective advantages to their hosts by facilitating localized DNA sequence evolution through a specialized error-prone reverse transcription process. We characterized a DGR in Legionella pneumophila, an opportunistic human pathogen that causes Legionnaires disease. The L. pneumophila DGR is found within a horizontally acquired genomic island, and it can theoretically generate 10(26) unique nucleotide sequences in its target gene, legionella determinent target A (ldtA), creating a repertoire of 10(19) distinct proteins. Expression of the L. pneumophila DGR resulted in transfer of DNA sequence information from a template repeat to a variable repeat (VR) accompanied by adenine-specific mutagenesis of progeny VRs at the 3'end of ldtA. ldtA encodes a twin-arginine translocated lipoprotein that is anchored in the outer leaflet of the outer membrane, with its C-terminal variable region surface exposed. Related DGRs were identified in L. pneumophila clinical isolates that encode unique target proteins with homologous VRs, demonstrating the adaptability of DGR components. This work characterizes a DGR that diversifies a bacterial protein and confirms the hypothesis that DGR-mediated mutagenic homing occurs through a conserved mechanism. Comparative bioinformatics predicts that surface display of massively variable proteins is a defining feature of a subset of bacterial DGRs.

  14. Leptospiral outer membrane protein LipL41 is not essential for acute leptospirosis but requires a small chaperone protein, lep, for stable expression.

    PubMed

    King, Amy M; Bartpho, Thanatchaporn; Sermswan, Rasana W; Bulach, Dieter M; Eshghi, Azad; Picardeau, Mathieu; Adler, Ben; Murray, Gerald L

    2013-08-01

    Leptospirosis is a worldwide zoonosis caused by pathogenic Leptospira spp., but knowledge of leptospiral pathogenesis remains limited. However, the development of mutagenesis systems has allowed the investigation of putative virulence factors and their involvement in leptospirosis. LipL41 is the third most abundant lipoprotein found in the outer membranes of pathogenic leptospires and has been considered a putative virulence factor. LipL41 is encoded on the large chromosome 28 bp upstream of a small open reading frame encoding a hypothetical protein of unknown function. This gene was named lep, for LipL41 expression partner. In this study, lipL41 was found to be cotranscribed with lep. Two transposon mutants were characterized: a lipL41 mutant and a lep mutant. In the lep mutant, LipL41 protein levels were reduced by approximately 90%. Lep was shown through cross-linking and coexpression experiments to bind to LipL41. Lep is proposed to be a molecular chaperone essential for the stable expression of LipL41. The roles of LipL41 and Lep in the pathogenesis of Leptospira interrogans were investigated; surprisingly, neither of these two unique proteins was essential for acute leptospirosis.

  15. Correction of the retinal dystrophy phenotype of the RCS rat by viral gene transfer of Mertk.

    PubMed

    Vollrath, D; Feng, W; Duncan, J L; Yasumura, D; D'Cruz, P M; Chappelow, A; Matthes, M T; Kay, M A; LaVail, M M

    2001-10-23

    The Royal College of Surgeons (RCS) rat is a widely studied animal model of retinal degeneration in which the inability of the retinal pigment epithelium (RPE) to phagocytize shed photoreceptor outer segments leads to a progressive loss of rod and cone photoreceptors. We recently used positional cloning to demonstrate that the gene Mertk likely corresponds to the retinal dystrophy (rdy) locus of the RCS rat. In the present study, we sought to determine whether gene transfer of Mertk to a RCS rat retina would result in correction of the RPE phagocytosis defect and preservation of photoreceptors. We used subretinal injection of a recombinant replication-deficient adenovirus encoding rat Mertk to deliver the gene to the eyes of young RCS rats. Electrophysiological assessment of animals 30 days after injection revealed an increased sensitivity of treated eyes to low-intensity light. Histologic and ultrastructural assessment demonstrated substantial sparing of photoreceptors, preservation of outer segment structure, and correction of the RPE phagocytosis defect in areas surrounding the injection site. Our results provide definitive evidence that mutation of Mertk underlies the RCS retinal dystrophy phenotype, and that the phenotype can be corrected by treatment of juvenile animals. To our knowledge, this is the first demonstration of complementation of both a functional cellular defect (phagocytosis) and a photoreceptor degeneration by gene transfer to the RPE. These results, together with the recent discovery of MERTK mutations in individuals with retinitis pigmentosa, emphasize the importance of the RCS rat as a model for gene therapy of diseases that arise from RPE dysfunction.

  16. Sub-minimum inhibitory concentrations of colistin and polymyxin B promote Acinetobacter baumannii biofilm formation

    PubMed Central

    Unno, Yuka; Ubagai, Tsuneyuki; Ono, Yasuo

    2018-01-01

    We investigated the numbers of planktonic and biofilm cells and the expression levels of genes encoding efflux pumps and biofilm-related proteins in 10 clinical isolates of multi-drug resistant Acinetobacter baumannii (MDRA) as well as in its standard strain ATCC 19606 in the presence of colistin (CST), polymyxin B (PMB), minomycin (MIN), and tigecycline (TGC) at their respective sub-MICs. The number of planktonic and biofilm cells of ATCC 19606 decreased in the presence of all aforementioned antibiotics in a dose-dependent manner. Cell number also decreased in two representative MDRA strains, R2 and R3, in the presence of MIN and TGC in a dose-dependent manner. In contrast, the number of biofilm cells in these two strains increased in the presence of CST, while they increased significantly in the presence of PMB in R2 only. Pearson correlation analysis revealed that the number of biofilm cells was positively and significantly correlated with the mRNA levels of genes encoding efflux pumps (adeB and adeG) and autoinducer synthase (abaI) in strain R2 and adeB, adeG, adeJ, poly-acetyl-glucosamine-porin (pgaA), and abaI in strain R3 in the presence of CST. It was positively and significantly correlated with the mRNA levels of genes encoding adeB in strain R2 and an outer membrane protein A (ompA) and biofilm-associated protein (bap) in strain R3 in the presence of PMB. These results provide valuable insights into the biofilm formation potency of clinical isolates of MDRA that depends on efflux pumps and biofilm-related genes and its regulation by antibiotics. PMID:29554105

  17. Primary structure and subcellular localization of two fimbrial subunit-like proteins involved in the biosynthesis of K99 fibrillae.

    PubMed

    Roosendaal, E; Jacobs, A A; Rathman, P; Sondermeyer, C; Stegehuis, F; Oudega, B; de Graaf, F K

    1987-09-01

    Analysis of the nucleotide sequence of the distal part of the fan gene cluster encoding the proteins involved in the biosynthesis of the fibrillar adhesin, K99, revealed the presence of two structural genes, fanG and fanH. The amino acid sequence of the gene products (FanG and FanH) showed significant homology to the amino acid sequence of the fibrillar subunit protein (FanC). Introduction of a site-specific frameshift mutation in fanG or fanH resulted in a simultaneous decrease in fibrillae production and adhesive capacity. Analysis of subcellular fractions showed that, in contrast to the K99 fibrillar subunit (FanC), both the FanH and the FanG protein were loosely associated with the outer membrane, possibly on the periplasmic side, but were not components of the fimbriae themselves.

  18. Direct involvement of ombB, omaB, and omcB genes in extracellular reduction of Fe(III) by Geobacter sulfurreducens PCA

    DOE PAGES

    Liu, Yimo; Fredrickson, Jim K.; Zachara, John M.; ...

    2015-10-01

    The tandem gene clusters orfR-ombB-omaB-omcB and orfS-ombC-omaC-omcC of the metal-reducing bacterium Geobacter sulfurreducens PCA are responsible for trans-outer membrane electron transfer during extracellular reduction of Fe(III)-citrate and ferrihydrite [a poorly crystalline Fe(III) oxide]. Each gene cluster encodes a putative transcriptional factor (OrfR/OrfS), a porin-like outer-membrane protein (OmbB/OmbC), a periplasmic c-type cytochrome (c-Cyt, OmaB/OmaC) and an outer-membrane c-Cyt (OmcB/OmcC). The individual roles of OmbB, OmaB and OmcB in extracellular reduction of Fe(III), however, have remained either uninvestigated or controversial. Here, we showed that replacements of ombB, omaB, omcB and ombB-omaB with an antibiotic gene in the presence of ombC-omaC-omcC had nomore » impact on reduction of Fe(III)-citrate by G. sulfurreducens PCA. Disruption of ombB, omaB, omcB and ombB-omaB in the absence of ombC-omaC-omcC, however, severely impaired the bacterial ability to reduce Fe(III)-citrate as well as ferrihydrite. These results unequivocally demonstrate an overlapping role of ombB-omaB-omcB and ombC-omaC-omcC in extracellular Fe(III) reduction by G. sulfurreducens PCA. Involvement of both ombB-omaB-omcB and ombC-omaC-omcC in extracellular Fe(III) reduction reflects the importance of these trans-outer membrane protein complexes in the physiology of this bacterium. Moreover, the kinetics of Fe(III)-citrate and ferrihydrite reduction by these mutants in the absence of ombC-omaC-omcC were nearly identical, which clearly show that OmbB, OmaB and OmcB contribute equally to extracellular Fe(III) reduction. Finally, orfS was found to have a negative impact on the extracellular reduction of Fe(III)-citrate and ferrihydrite in G. sulfurreducens PCA probably by serving as a transcriptional repressor.« less

  19. Novel two-component transmembrane transcription control: regulation of iron dicitrate transport in Escherichia coli K-12.

    PubMed

    Van Hove, B; Staudenmaier, H; Braun, V

    1990-12-01

    Citrate and iron have to enter only the periplasmic space in order to induce the citrate-dependent iron(III) transport system of Escherichia coli. The five transport genes fecABCDE form an operon and are transcribed from fecA to fecE. Two genes, termed fecI and fecR, that mediate induction by iron(III) dicitrate have been identified upstream of fecA. The fecI gene encodes a protein of 173 amino acids (molecular weight, 19,478); the fecR gene encodes a protein of 317 amino acids (molecular weight, 35,529). Chromosomal fecI::Mu d1 mutants were unable to grow with iron(III) dicitrate as the sole iron source and synthesized no FecA outer membrane receptor protein. Growth was restored by transformation with plasmids encoding fecI or fecI and fecR. FecA and beta-galactosidase syntheses under transcription control of the fecB gene (fecB::Mu d1) were constitutive in fecI transformants and were regulated by iron(III) dicitrate in fecI fecR transformants. The amino acid sequence of the FecI protein contains a region close to the carboxy-terminal end for which a helix-turn-helix motif is predicted, which is typical for DNA-binding regulatory proteins. The FecI protein was found in the membrane, and the FecR protein was found in the periplasmic fraction. It is proposed that the FecR protein is the sensor that recognizes iron(III) dicitrate in the periplasm. The FecI protein activates fec gene expression by binding to the fec operator region. In the absence of citrate, FecR inactivates FecI. The lack of sequence homologies to other transmembrane signaling proteins and the location of the two proteins suggest a new type of transmembrane control mechanism.

  20. Molecular Characterization of the S-Layer Gene, sbpA, of Bacillus sphaericus CCM 2177 and Production of a Functional S-Layer Fusion Protein with the Ability To Recrystallize in a Defined Orientation while Presenting the Fused Allergen

    PubMed Central

    Ilk, Nicola; Völlenkle, Christine; Egelseer, Eva M.; Breitwieser, Andreas; Sleytr, Uwe B.; Sára, Margit

    2002-01-01

    The nucleotide sequence encoding the crystalline bacterial cell surface (S-layer) protein SbpA of Bacillus sphaericus CCM 2177 was determined by a PCR-based technique using four overlapping fragments. The entire sbpA sequence indicated one open reading frame of 3,804 bp encoding a protein of 1,268 amino acids with a theoretical molecular mass of 132,062 Da and a calculated isoelectric point of 4.69. The N-terminal part of SbpA, which is involved in anchoring the S-layer subunits via a distinct type of secondary cell wall polymer to the rigid cell wall layer, comprises three S-layer-homologous motifs. For screening of amino acid positions located on the outer surface of the square S-layer lattice, the sequence encoding Strep-tag I, showing affinity to streptavidin, was linked to the 5′ end of the sequence encoding the recombinant S-layer protein (rSbpA) or a C-terminally truncated form (rSbpA31-1068). The deletion of 200 C-terminal amino acids did not interfere with the self-assembly properties of the S-layer protein but significantly increased the accessibility of Strep-tag I. Thus, the sequence encoding the major birch pollen allergen (Bet v1) was fused via a short linker to the sequence encoding the C-terminally truncated form rSpbA31-1068. Labeling of the square S-layer lattice formed by recrystallization of rSbpA31-1068/Bet v1 on peptidoglycan-containing sacculi with a Bet v1-specific monoclonal mouse antibody demonstrated the functionality of the fused protein sequence and its location on the outer surface of the S-layer lattice. The specific interactions between the N-terminal part of SbpA and the secondary cell wall polymer will be exploited for an oriented binding of the S-layer fusion protein on solid supports to generate regularly structured functional protein lattices. PMID:12089001

  1. Long-term preservation of retinal function in the RCS rat model of retinitis pigmentosa following lentivirus-mediated gene therapy.

    PubMed

    Tschernutter, M; Schlichtenbrede, F C; Howe, S; Balaggan, K S; Munro, P M; Bainbridge, J W B; Thrasher, A J; Smith, A J; Ali, R R

    2005-04-01

    The Royal College of Surgeons (RCS) rat is a well-characterized model of autosomal recessive retinitis pigmentosa (RP) due to a defect in the retinal pigment epithelium (RPE). It is homozygous for a null mutation in the gene encoding , a receptor tyrosine kinase found in RPE cells, that is required for phagocytosis of shed photoreceptor outer segments. The absence of Mertk results in accumulation of outer segment debris. This subsequently leads to progressive loss of photoreceptor cells. In order to evaluate the efficacy of lentiviral-mediated gene replacement therapy in the RCS rat, we produced recombinant VSV-G pseudotyped HIV-1-based lentiviruses containing a murine Mertk cDNA driven by a spleen focus forming virus (SFFV) promoter. The vector was subretinally injected into the right eye of 10-day-old RCS rats; the left eye was left untreated as an internal control. Here, we present a detailed assessment of the duration and extent of the morphological rescue and the resulting functional benefits. We examined animals at various time points over a period of 7 months by light and electron microscopy, and electroretinography. We observed correction of the phagocytic defect, slowing of photoreceptor cell loss and preservation of retinal function for up to 7 months. This study demonstrates the potential of gene therapy approaches for the treatment of retinal degenerations caused by defects specific to the RPE and supports the use of lentiviral vectors for the treatment of such disorders.

  2. The pomegranate (Punica granatum L.) genome and the genomics of punicalagin biosynthesis.

    PubMed

    Qin, Gaihua; Xu, Chunyan; Ming, Ray; Tang, Haibao; Guyot, Romain; Kramer, Elena M; Hu, Yudong; Yi, Xingkai; Qi, Yongjie; Xu, Xiangyang; Gao, Zhenghui; Pan, Haifa; Jian, Jianbo; Tian, Yinping; Yue, Zhen; Xu, Yiliu

    2017-09-01

    Pomegranate (Punica granatum L.) is a perennial fruit crop grown since ancient times that has been planted worldwide and is known for its functional metabolites, particularly punicalagins. We have sequenced and assembled the pomegranate genome with 328 Mb anchored into nine pseudo-chromosomes and annotated 29 229 gene models. A Myrtales lineage-specific whole-genome duplication event was detected that occurred in the common ancestor before the divergence of pomegranate and Eucalyptus. Repetitive sequences accounted for 46.1% of the assembled genome. We found that the integument development gene INNER NO OUTER (INO) was under positive selection and potentially contributed to the development of the fleshy outer layer of the seed coat, an edible part of pomegranate fruit. The genes encoding the enzymes for synthesis and degradation of lignin, hemicelluloses and cellulose were also differentially expressed between soft- and hard-seeded varieties, reflecting differences in their accumulation in cultivars differing in seed hardness. Candidate genes for punicalagin biosynthesis were identified and their expression patterns indicated that gallic acid synthesis in tissues could follow different biochemical pathways. The genome sequence of pomegranate provides a valuable resource for the dissection of many biological and biochemical traits and also provides important insights for the acceleration of breeding. Elucidation of the biochemical pathway(s) involved in punicalagin biosynthesis could assist breeding efforts to increase production of this bioactive compound. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  3. Deletion of degQ gene enhances outer membrane vesicle production of Shewanella oneidensis cells.

    PubMed

    Ojima, Yoshihiro; Mohanadas, Thivagaran; Kitamura, Kosei; Nunogami, Shota; Yajima, Reiki; Taya, Masahito

    2017-04-01

    Shewanella oneidensis is a Gram-negative facultative anaerobe that can use a wide variety of terminal electron acceptors for anaerobic respiration. In this study, S. oneidensis degQ gene, encoding a putative periplasmic serine protease, was cloned and expressed. The activity of purified DegQ was inhibited by diisopropyl fluorophosphate, a typical serine protease-specific inhibitor, indicating that DegQ is a serine protease. In-frame deletion and subsequent complementation of the degQ were carried out to examine the effect of envelope stress on the production of outer membrane vesicles (OMVs). Analysis of periplasmic proteins from the resulting S. oneidensis strain showed that deletion of degQ induced protein accumulation and resulted in a significant decrease in protease activity within the periplasmic space. OMVs from the wild-type and mutant strains were purified and observed by transmission electron microscopy. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of the OMVs showed a prominent band at ~37 kDa. Nanoliquid chromatography-tandem mass spectrometry analysis identified three outer membrane porins (SO3896, SO1821, and SO3545) as dominant components of the band, suggesting that these proteins could be used as indices for comparing OMV production by S. oneidensis strains. Quantitative evaluation showed that degQ-deficient cells had a fivefold increase in OMV production compared with wild-type cells. Thus, the increased OMV production following the deletion of DegQ in S. oneidensis may be responsible for the increase in envelope stress.

  4. Comparative Transcriptome Analysis of Desulfovibrio Vulgaris Grown in Planktonic Culture and Mature Biofilm on a Steel Surface

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Weiwen; Culley, David E.; Nie, Lei

    2007-08-01

    The build-up of biofilms of sulphate -reducing bacteria (SRB) on metals surfaces may lead to severe corrosion of iron. To understand the processes at molecular level, in this study, a whole-genome oligonucleotide microarray was used to examine differential expression patterns between planktonic populations and mature biofilm of model SRB species Desulfovibrio vulgaris. Statistical analysis revealed that 472 genes were differentially expressed (1.5 fold or more with a p value less than 0.025) when comparing biofilm to planktonic cells. Among the differentially expressed genes were several that corresponded to biofilm formation genes identified in many aerobic bacterial biofilms (i.e., Pseudomonas speciesmore » and Escherichia coli), such as down-regulation of genes encoding flagellin, flagellar motor switch protein and chemotaxis proteins involved in cell motility and induction of genes encoding sugar transferase and glycogen synthase involved in exopolysaccharide biosynthesis. In addition, D. vulgaris biofilm-bound cells exhibited decreased transcription of genes involved in protein synthesis, energy metabolism and sulfate reduction, as well as genes involved in general stress responses. These findings were all consistent with early suggestion that the average physiology of biofilm cells were similar to planktonic cells of stationary phases. Most notably, up-regulation of large number of outer membrane proteins was observed in D. vulgaris biofilm. Although their function is still unknown, the higher expression of these genes in D. vulgaris biofilm could implicate important roles formation and maintenance of multi-cellular consortium on metal surface. The study provided insights into the metabolic networks associated with D. vulgaris biofilm formation and maintenance on an iron surface.« less

  5. Inactivation of the Carney complex gene 1 (PRKAR1A) alters spatiotemporal regulation of cAMP and cAMP-dependent protein kinase: a study using genetically encoded FRET-based reporters.

    PubMed

    Cazabat, Laure; Ragazzon, Bruno; Varin, Audrey; Potier-Cartereau, Marie; Vandier, Christophe; Vezzosi, Delphine; Risk-Rabin, Marthe; Guellich, Aziz; Schittl, Julia; Lechêne, Patrick; Richter, Wito; Nikolaev, Viacheslav O; Zhang, Jin; Bertherat, Jérôme; Vandecasteele, Grégoire

    2014-03-01

    Carney complex (CNC) is a hereditary disease associating cardiac myxoma, spotty skin pigmentation and endocrine overactivity. CNC is caused by inactivating mutations in the PRKAR1A gene encoding PKA type I alpha regulatory subunit (RIα). Although PKA activity is enhanced in CNC, the mechanisms linking PKA dysregulation to endocrine tumorigenesis are poorly understood. In this study, we used Förster resonance energy transfer (FRET)-based sensors for cAMP and PKA activity to define the role of RIα in the spatiotemporal organization of the cAMP/PKA pathway. RIα knockdown in HEK293 cells increased basal as well as forskolin or prostaglandin E1 (PGE1)-stimulated total cellular PKA activity as reported by western blots of endogenous PKA targets and the FRET-based global PKA activity reporter, AKAR3. Using variants of AKAR3 targeted to subcellular compartments, we identified similar increases in the response to PGE1 in the cytoplasm and at the outer mitochondrial membrane. In contrast, at the plasma membrane, the response to PGE1 was decreased along with an increase in basal FRET ratio. These results were confirmed by western blot analysis of basal and PGE1-induced phosphorylation of membrane-associated vasodilator-stimulated phosphoprotein. Similar differences were observed between the cytoplasm and the plasma membrane in human adrenal cells carrying a RIα inactivating mutation. RIα inactivation also increased cAMP in the cytoplasm, at the outer mitochondrial membrane and at the plasma membrane, as reported by targeted versions of the cAMP indicator Epac1-camps. These results show that RIα inactivation leads to multiple, compartment-specific alterations of the cAMP/PKA pathway revealing new aspects of signaling dysregulation in tumorigenesis.

  6. Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

    PubMed Central

    O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

    1999-01-01

    Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the control of a constitutive promoter resulted in heterologous enterocin A production in both E. faecalis and Lactococcus lactis. PMID:10103244

  7. Global survey of Klebsiella pneumoniae major porins from ertapenem non-susceptible isolates lacking carbapenemases.

    PubMed

    Wise, Mark G; Horvath, Elizabeth; Young, Katherine; Sahm, Daniel F; Kazmierczak, Krystyna M

    2018-03-01

    To understand the diversity of porin disruption in Klebsiella pneumoniae, the major outer membrane protein (OMP) porins, OmpK35 and OmpK36, were examined in a set of isolates that did not harbour traditional carbapenem-hydrolysing enzymes, but nevertheless tested non-susceptible to ertapenem. A world-wide collection of Klebsiella pneumoniae isolates that were part of the Study for Monitoring Antimicrobial Resistance Trends (SMART) surveillance project over the years 2008-2014 were characterised with regard to their β-lactamase gene carriage and potential permeability defects. Four hundred and eighty-seven isolates that did not carry carbapenemase genes, but were non-susceptible to ertapenem, were investigated by sequence analysis of the genes encoding OmpK35 and OmpK36. Isolates without obvious genetic lesions in either major porin gene were further examined by outer membrane protein SDS-PAGE. The majority of isolates, 83.0 % (404/487), exhibited clear genetic disruption in either or both of the ompK35 and ompK36 genes. Among the proportion of the collection with the highest ertapenem MIC value (>4 mg l -1 ), 60.5 % (115/190) showed mutation in both porin genes. Isolates without obvious genetic mutations were examined by SDS-PAGE, and 90.4 % (75/83) were found to lack or show altered expression of at least one of the major OMPs when compared to an ertapenem sensitive control strain. This study illustrates that porin deficiency in Klebsiella pneumoniae is a widespread phenomenon, and in combination with ESBLs and/or AmpC enzymes, likely accounts for the elevated ertapenem MICs observed in this study.

  8. A Fourth KLK4 Mutation Is Associated with Enamel Hypomineralisation and Structural Abnormalities

    PubMed Central

    Smith, Claire E. L.; Kirkham, Jennifer; Day, Peter F.; Soldani, Francesca; McDerra, Esther J.; Poulter, James A.; Inglehearn, Christopher F.; Mighell, Alan J.; Brookes, Steven J.

    2017-01-01

    “Amelogenesis imperfecta” (AI) describes a group of genetic conditions that result in defects in tooth enamel formation. Mutations in many genes are known to cause AI, including the gene encoding the serine protease, kallikrein related peptidase 4 (KLK4), expressed during the maturation stage of amelogenesis. In this study we report the fourth KLK4 mutation to be identified in autosomal recessively-inherited hypomaturation type AI, c.632delT, p.(L211Rfs*37) (NM_004917.4, NP_004908.4). This homozygous variant was identified in five Pakistani AI families and is predicted to result in a transcript with a premature stop codon that escapes nonsense mediated decay. However, the protein may misfold, as three of six disulphide bonds would be disrupted, and may be degraded or non-functional as a result. Primary teeth were obtained from one affected individual. The enamel phenotype was characterized using high-resolution computerized X-ray tomography (CT), scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDX), and microhardness testing (MH). Enamel from the affected individual (referred to as KLK4 enamel) was hypomineralised in comparison with matched control enamel. Furthermore, KLK4 inner enamel was hypomineralised compared with KLK4 outer enamel. SEM showed a clear structural demarcation between KLK4 inner and outer enamel, although enamel structure was similar to control tissue overall. EDX showed that KLK4 inner enamel contained less calcium and phosphorus and more nitrogen than control inner enamel and KLK4 outer enamel. MH testing showed that KLK4 inner enamel was significantly softer than KLK4 outer enamel (p < 0.001). However, the hardness of control inner enamel was not significantly different to that of control outer enamel. Overall, these findings suggest that the KLK4 c.632delT mutation may be a common cause of autosomal recessive AI in the Pakistani population. The phenotype data obtained mirror findings in the Klk4−/− mouse and suggest that KLK4 is required for the hardening and mineralization of the inner enamel layer but is less essential for hardening and mineralization of the outer enamel layer. PMID:28611678

  9. The Fusobacterium nucleatum Outer Membrane Protein RadD Is an Arginine-Inhibitable Adhesin Required for Inter-Species Adherence and the Structured Architecture of Multi-Species Biofilm

    PubMed Central

    Kaplan, Christopher W.; Lux, Renate; Haake, Susan Kinder; Shi, Wenyuan

    2009-01-01

    Summary A defining characteristic of the suspected periodontal pathogen Fusobacterium nucleatum is its ability to adhere to a plethora of oral bacteria. This distinguishing feature is suggested to play an important role in oral biofilm formation and pathogenesis, with fusobacteria proposed to serve as central “bridging organisms” in the architecture of the oral biofilm bringing together species which would not interact otherwise. Previous studies indicate that these bacterial interactions are mediated by galactose- or arginine-inhibitable adhesins although genetic evidence for the role and nature of these proposed adhesins remains elusive. To characterize these adhesins at the molecular level, the genetically transformable F. nucleatum strain ATCC 23726 was screened for adherence properties, and arginine inhibitable adhesion was evident, while galactose-inhibitable adhesion was not detected. Six potential arginine binding proteins were isolated from the membrane fraction of F. nucleatum ATCC 23726 and identified via mass spectroscopy as members of the outer membrane family of proteins in F. nucleatum. Inactivation of the genes encoding these six candidates for arginine-inhibitable adhesion and two additional homologues revealed that only a mutant derivative carrying an insertion in Fn1526 (now designated as radD) demonstrated significantly decreased co-aggregation with representatives of the Gram-positive “early oral colonizers”. Lack of the 350 kDa outer membrane protein encoded by radD resulted in the failure to form the extensive structured biofilm observed with the parent strain when grown in the presence of Streptococcus sanguinis ATCC 10556. These findings indicate that radD is responsible for arginine-inhibitable adherence of F. nucleatum and provides definitive molecular evidence that F. nucleatum adhesins play a vital role in inter-species adherence and multispecies biofilm formation. PMID:19007407

  10. The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

    PubMed

    Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

    2005-05-15

    Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two enterobactin receptors probably illustrates a more general phenomenon of siderophore receptor redundancy in P. aeruginosa.

  11. Mutations in the Histone-like Nucleoid Structuring Regulatory Gene (hns) Decrease the Adherence of Shiga Toxin-producing Escherichia coli 091:H21 Strain B2F1 to Human Colonic Epithelial Cells and Increase the Production of Hemolysin

    DTIC Science & Technology

    1999-10-19

    osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 170:2575-2583. Mobley, H. L., D. M. Green...produced by ETEC organisms is homologous to the toxin encoded by Y: cholerae . These toxins are the primary cause of the watery diarrhea associated with ETEC...Escherichia coli as a cause ofdiarrhea among children in Mexico . J. Clin. Microbiol. 25:1913-1919. Maurelli, A. T., and P. J. Sansonetti. 1988

  12. Identification of putative adhesins of Actinobacillus suis and their homologues in other members of the family Pasteurellaceae.

    PubMed

    Bujold, Adina R; MacInnes, Janet I

    2015-11-14

    Actinobacillus suis disease has been reported in a wide range of vertebrate species, but is most commonly found in swine. A. suis is a commensal of the tonsils of the soft palate of swine, but in the presence of unknown stimuli it can invade the bloodstream, causing septicaemia and sequelae such as meningitis, arthritis, and death. It is genotypically and phenotypically similar to A. pleuropneumoniae, the causative agent of pleuropneumonia, and to other members of the family Pasteurellaceae that colonise tonsils. At present, very little is known about the genes involved in attachment, colonisation, and invasion by A. suis (or related members of the tonsil microbiota). Bioinformatic analyses of the A. suis H91-0380 genome were done using BASys and blastx in GenBank. Forty-seven putative adhesin-associated genes predicted to encode 24 putative adhesins were discovered. Among these are 6 autotransporters, 25 fimbriae-associated genes (encoding 3 adhesins), 12 outer membrane proteins, and 4 additional genes (encoding 3 adhesins). With the exception of 2 autotransporter-encoding genes (aidA and ycgV), both with described roles in virulence in other species, all of the putative adhesin-associated genes had homologues in A. pleuropneumoniae. However, the majority of the closest homologues of the A. suis adhesins are found in A. ureae and A. capsulatus--species not known to infect swine, but both of which can cause systemic infections. A. suis and A. pleuropneumoniae share many of the same putative adhesins, suggesting that the different diseases, tissue tropism, and host range of these pathogens are due to subtle genetic differences, or perhaps differential expression of virulence factors during infection. However, many of the putative adhesins of A. suis share even greater homology with those of other pathogens within the family Pasteurellaceae. Similar to A. suis, these pathogens (A. capsulatus and A. ureae) cause systemic infections and it is tempting to speculate that they employ similar strategies to invade the host, but more work is needed before that assertion can be made. This work begins to examine adhesin-associated factors that allow some members of the family Pasteurellaceae to invade the bloodstream while others cause a more localised infection.

  13. Tissue-specific thyroid hormone regulation of gene transcripts encoding iodothyronine deiodinases and thyroid hormone receptors in striped parrotfish (Scarus iseri).

    PubMed

    Johnson, Kaitlin M; Lema, Sean C

    2011-07-01

    In fish as in other vertebrates, the diverse functions of thyroid hormones are mediated at the peripheral tissue level through iodothyronine deiodinase (dio) enzymes and thyroid hormone receptor (tr) proteins. In this study, we examined thyroid hormone regulation of mRNAs encoding the three deiodinases dio1, dio2 and dio3 - as well as three thyroid hormone receptors trαA, trαB and trβ - in initial phase striped parrotfish (Scarus iseri). Parrotfish were treated with dissolved phase T(3) (20 nM) or methimazole (3 mM) for 3 days. Treatment with exogenous T(3) elevated circulating T(3), while the methimazole treatment depressed plasma T(4). Experimentally-induced hyperthyroidism increased the relative abundance of transcripts encoding trαA and trβ in the liver and brain, but did not affect trαB mRNA levels in either tissue. In both sexes, methimazole-treated fish exhibited elevated dio2 transcripts in the liver and brain, suggesting enhanced outer-ring deiodination activity in these tissues. Accordingly, systemic hyperthyroidism elevated relative dio3 transcript levels in these same tissues. In the gonad, however, patterns of transcript regulation were distinctly different with elevated T(3) increasing mRNAs encoding dio2 in testicular and ovarian tissues and dio3, trαA and trαB in the testes only. Thyroid hormone status did not affect dio1 transcript abundance in the liver, brain or gonads. Taken as a whole, these results demonstrate that thyroidal status influences relative transcript abundance for dio2 and dio3 in the liver, provide new evidence for similar patterns of dio2 and dio3 mRNA regulation in the brain, and make evident that fish exhibit tr subtype-specific transcript abundance changes to altered thyroid status. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Saccharomyces cerevisiae KTR4, KTR5 and KTR7 encode mannosyltransferases differentially involved in the N- and O-linked glycosylation pathways.

    PubMed

    Hernández, Nahúm V; López-Ramírez, Luz A; Díaz-Jiménez, Diana F; Mellado-Mojica, Erika; Martínez-Duncker, Iván; López, Mercedes G; Mora-Montes, Héctor M

    2017-10-01

    Saccharomyces cerevisiae is a model to understand basic aspects of protein glycosylation pathways. Although these metabolic routes have been thoroughly studied, there are still knowledge gaps; among them, the role of the MNT1/KRE2 gene family. This family is composed of nine members, with only six functionally characterized. The enzymes Ktr1, Ktr3, and Mnt1/Kre2 have overlapping activities in both O-linked and N-linked glycan synthesis; while Ktr2 and Yur1 participate exclusively in the elongation of the N-linked glycan outer chain. KTR6 encodes for a phosphomannosyltransferase that synthesizes the cell wall phosphomannan. Here, we aimed to establish the functional role of KTR4, KTR5 and KTR7 in the protein glycosylation pathways, by using heterologous complementation in Candida albicans null mutants lacking members of the MNT1/KRE2 gene family. The three S. cerevisiae genes restored defects in the C. albicans N-linked glycosylation pathway. KTR5 and KTR7 partially complemented a C. albicans null mutant with defects in the synthesis of O-linked glycans, and only KTR4 fully elongated the O-linked glycans like wild-type cells. Therefore, our results suggest that the three genes have a redundant activity in the S. cerevisiae N-linked glycosylation pathway, but KTR4 plays a major role in O-linked glycan synthesis. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  15. Mutation K42E in dehydrodolichol diphosphate synthase (DHDDS) causes recessive retinitis pigmentosa.

    PubMed

    Lam, Byron L; Züchner, Stephan L; Dallman, Julia; Wen, Rong; Alfonso, Eduardo C; Vance, Jeffery M; Peričak-Vance, Margaret A

    2014-01-01

    A single-nucleotide mutation in the gene that encodes DHDDS has been identified by whole exome sequencing as the cause of the non-syndromic recessive retinitis pigmentosa (RP) in a family of Ashkenazi Jewish origin in which three of the four siblings have early onset retinal degeneration. The peripheral retinal degeneration in the affected siblings was evident in the initial examination in 1992 and only one had detectable electroretinogram (ERG) that suggested cone-rod dysfunction. The pigmentary retinal degeneration subsequently progressed rapidly. The identified mutation changes the highly conserved residue Lys42 to Glu, resulting in lower catalytic efficiency. Patterns of plasma transferrin isoelectric focusing gel were normal in all family members, indicating no significant abnormality in protein glycosylation. Dolichols have been shown to influence the fluidity and of the membrane and promote vesicle fusion. Considering that photoreceptor outer segments contain stacks of membrane discs, we believe that the mutation may lead to low dolichol levels in photoreceptor outer segments, resulting in unstable membrane structure that leads to photoreceptor degeneration.

  16. Novel colicin Fy of Yersinia frederiksenii inhibits pathogenic Yersinia strains via YiuR-mediated reception, TonB import, and cell membrane pore formation.

    PubMed

    Bosák, Juraj; Laiblová, Petra; Smarda, Jan; Dedicová, Daniela; Smajs, David

    2012-04-01

    A novel colicin type, designated colicin Fy, was found to be encoded and produced by the strain Yersinia frederiksenii Y27601. Colicin Fy was active against both pathogenic and nonpathogenic strains of the genus Yersinia. Plasmid YF27601 (5,574 bp) of Y. frederiksenii Y27601 was completely sequenced. The colicin Fy activity gene (cfyA) and the colicin Fy immunity gene (cfyI) were identified. The deduced amino acid sequence of colicin Fy was very similar in its C-terminal pore-forming domain to colicin Ib (69% identity in the last 178 amino acid residues), indicating pore forming as its lethal mode of action. Transposon mutagenesis of the colicin Fy-susceptible strain Yersinia kristensenii Y276 revealed the yiuR gene (ykris001_4440), which encodes the YiuR outer membrane protein with unknown function, as the colicin Fy receptor molecule. Introduction of the yiuR gene into the colicin Fy-resistant strain Y. kristensenii Y104 restored its susceptibility to colicin Fy. In contrast, the colicin Fy-resistant strain Escherichia coli TOP10F' acquired susceptibility to colicin Fy only when both the yiuR and tonB genes from Y. kristensenii Y276 were introduced. Similarities between colicins Fy and Ib, similarities between the Cir and YiuR receptors, and the detected partial cross-immunity of colicin Fy and colicin Ib producers suggest a common evolutionary origin of the colicin Fy-YiuR and colicin Ib-Cir systems.

  17. Novel Colicin FY of Yersinia frederiksenii Inhibits Pathogenic Yersinia Strains via YiuR-Mediated Reception, TonB Import, and Cell Membrane Pore Formation

    PubMed Central

    Bosák, Juraj; Laiblová, Petra; Šmarda, Jan; Dědičová, Daniela

    2012-01-01

    A novel colicin type, designated colicin FY, was found to be encoded and produced by the strain Yersinia frederiksenii Y27601. Colicin FY was active against both pathogenic and nonpathogenic strains of the genus Yersinia. Plasmid YF27601 (5,574 bp) of Y. frederiksenii Y27601 was completely sequenced. The colicin FY activity gene (cfyA) and the colicin FY immunity gene (cfyI) were identified. The deduced amino acid sequence of colicin FY was very similar in its C-terminal pore-forming domain to colicin Ib (69% identity in the last 178 amino acid residues), indicating pore forming as its lethal mode of action. Transposon mutagenesis of the colicin FY-susceptible strain Yersinia kristensenii Y276 revealed the yiuR gene (ykris001_4440), which encodes the YiuR outer membrane protein with unknown function, as the colicin FY receptor molecule. Introduction of the yiuR gene into the colicin FY-resistant strain Y. kristensenii Y104 restored its susceptibility to colicin FY. In contrast, the colicin FY-resistant strain Escherichia coli TOP10F′ acquired susceptibility to colicin FY only when both the yiuR and tonB genes from Y. kristensenii Y276 were introduced. Similarities between colicins FY and Ib, similarities between the Cir and YiuR receptors, and the detected partial cross-immunity of colicin FY and colicin Ib producers suggest a common evolutionary origin of the colicin FY-YiuR and colicin Ib-Cir systems. PMID:22343298

  18. The RNA Chaperone Hfq Promotes Fitness of Actinobacillus pleuropneumoniae during Porcine Pleuropneumonia

    PubMed Central

    Subashchandrabose, Sargurunathan; Leveque, Rhiannon M.; Kirkwood, Roy N.; Kiupel, Matti

    2013-01-01

    Actinobacillus pleuropneumoniae is the etiological agent of porcine pleuropneumonia, an economically important disease of pigs. The hfq gene in A. pleuropneumoniae, encoding the RNA chaperone and posttranscriptional regulator Hfq, is upregulated during infection of porcine lungs. To investigate the role of this in vivo-induced gene in A. pleuropneumoniae, an hfq mutant strain was constructed. The hfq mutant was defective in biofilm formation on abiotic surfaces. The level of pgaC transcript, encoding the biosynthesis of poly-β-1,6-N-acetylglucosamine (PNAG), a major biofilm matrix component, was lower and PNAG content was 10-fold lower in the hfq mutant than in the wild-type strain. When outer membrane proteins were examined, cysteine synthase, implicated in resistance to oxidative stress and tellurite, was not found at detectable levels in the absence of Hfq. The hfq mutant displayed enhanced sensitivity to superoxide generated by methyl viologen and tellurite. These phenotypes were readily reversed by complementation with the hfq gene expressed from its native promoter. The role of Hfq in the fitness of A. pleuropneumoniae was assessed in a natural host infection model. The hfq mutant failed to colonize porcine lungs and was outcompeted by the wild-type strain (median competitive index of 2 × 10−5). Our data demonstrate that the in vivo-induced gene hfq is involved in the regulation of PNAG-dependent biofilm formation, resistance to superoxide stress, and the fitness and virulence of A. pleuropneumoniae in pigs and begin to elucidate the role of an in vivo-induced gene in the pathogenesis of pleuropneumonia. PMID:23732171

  19. VLSI single-chip (255,223) Reed-Solomon encoder with interleaver

    NASA Technical Reports Server (NTRS)

    Hsu, In-Shek (Inventor); Deutsch, Leslie J. (Inventor); Truong, Trieu-Kie (Inventor); Reed, Irving S. (Inventor)

    1990-01-01

    The invention relates to a concatenated Reed-Solomon/convolutional encoding system consisting of a Reed-Solomon outer code and a convolutional inner code for downlink telemetry in space missions, and more particularly to a Reed-Solomon encoder with programmable interleaving of the information symbols and code correction symbols to combat error bursts in the Viterbi decoder.

  20. Identification of a collagen type I adhesin of Bacteroides fragilis.

    PubMed

    Galvão, Bruna P G V; Weber, Brandon W; Rafudeen, Mohamed S; Ferreira, Eliane O; Patrick, Sheila; Abratt, Valerie R

    2014-01-01

    Bacteroides fragilis is an opportunistic pathogen which can cause life threatening infections in humans and animals. The ability to adhere to components of the extracellular matrix, including collagen, is related to bacterial host colonisation. Collagen Far Western analysis of the B. fragilis outer membrane protein (OMP) fraction revealed the presence two collagen adhesin bands of ∼ 31 and ∼ 34 kDa. The collagen adhesins in the OMP fraction were separated and isolated by two-dimensional SDS-PAGE and also purified by collagen affinity chromatography. The collagen binding proteins isolated by both these independent methods were subjected to tandem mass spectroscopy for peptide identification and matched to a single hypothetical protein encoded by B. fragilis NCTC 9343 (BF0586), conserved in YCH46 (BF0662) and 638R (BF0633) and which is designated in this study as cbp1 (collagen binding protein). Functionality of the protein was confirmed by targeted insertional mutagenesis of the cbp1 gene in B. fragilis GSH18 which resulted in the specific loss of both the ∼ 31 kDa and the ∼ 34 kDa adhesin bands. Purified his-tagged Cbp1, expressed in a B. fragilis wild-type and a glycosylation deficient mutant, confirmed that the cbp1 gene encoded the observed collagen adhesin, and showed that the 34 kDa band represents a glycosylated version of the ∼ 31 kDa protein. Glycosylation did not appear to be required for binding collagen. This study is the first to report the presence of collagen type I adhesin proteins in B. fragilis and to functionally identify a gene encoding a collagen binding protein.

  1. Identification of a Collagen Type I Adhesin of Bacteroides fragilis

    PubMed Central

    Galvão, Bruna P. G. V.; Weber, Brandon W.; Rafudeen, Mohamed S.; Ferreira, Eliane O.; Patrick, Sheila; Abratt, Valerie R.

    2014-01-01

    Bacteroides fragilis is an opportunistic pathogen which can cause life threatening infections in humans and animals. The ability to adhere to components of the extracellular matrix, including collagen, is related to bacterial host colonisation. Collagen Far Western analysis of the B. fragilis outer membrane protein (OMP) fraction revealed the presence two collagen adhesin bands of ∼31 and ∼34 kDa. The collagen adhesins in the OMP fraction were separated and isolated by two-dimensional SDS-PAGE and also purified by collagen affinity chromatography. The collagen binding proteins isolated by both these independent methods were subjected to tandem mass spectroscopy for peptide identification and matched to a single hypothetical protein encoded by B. fragilis NCTC 9343 (BF0586), conserved in YCH46 (BF0662) and 638R (BF0633) and which is designated in this study as cbp1 (collagen binding protein). Functionality of the protein was confirmed by targeted insertional mutagenesis of the cbp1 gene in B. fragilis GSH18 which resulted in the specific loss of both the ∼31 kDa and the ∼34 kDa adhesin bands. Purified his-tagged Cbp1, expressed in a B. fragilis wild-type and a glycosylation deficient mutant, confirmed that the cbp1 gene encoded the observed collagen adhesin, and showed that the 34 kDa band represents a glycosylated version of the ∼31 kDa protein. Glycosylation did not appear to be required for binding collagen. This study is the first to report the presence of collagen type I adhesin proteins in B. fragilis and to functionally identify a gene encoding a collagen binding protein. PMID:24618940

  2. Down-regulation of the CSLF6 gene results in decreased (1,3;1,4)-beta-D-glucan in endosperm of wheat.

    PubMed

    Nemeth, Csilla; Freeman, Jackie; Jones, Huw D; Sparks, Caroline; Pellny, Till K; Wilkinson, Mark D; Dunwell, Jim; Andersson, Annica A M; Aman, Per; Guillon, Fabienne; Saulnier, Luc; Mitchell, Rowan A C; Shewry, Peter R

    2010-03-01

    (1,3;1,4)-beta-d-Glucan (beta-glucan) accounts for 20% of the total cell walls in the starchy endosperm of wheat (Triticum aestivum) and is an important source of dietary fiber for human nutrition with potential health benefits. Bioinformatic and array analyses of gene expression profiles in developing caryopses identified the CELLULOSE SYNTHASE-LIKE F6 (CSLF6) gene as encoding a putative beta-glucan synthase. RNA interference constructs were therefore designed to down-regulate CSLF6 gene expression and expressed in transgenic wheat under the control of a starchy endosperm-specific HMW subunit gene promoter. Analysis of wholemeal flours using an enzyme-based kit and by high-performance anion-exchange chromatography after digestion with lichenase showed decreases in total beta-glucan of between 30% and 52% and between 36% and 53%, respectively, in five transgenic lines compared to three control lines. The content of water-extractable beta-glucan was also reduced by about 50% in the transgenic lines, and the M(r) distribution of the fraction was decreased from an average of 79 to 85 x 10(4) g/mol in the controls and 36 to 57 x 10(4) g/mol in the transgenics. Immunolocalization of beta-glucan in semithin sections of mature and developing grains confirmed that the impact of the transgene was confined to the starchy endosperm with little or no effect on the aleurone or outer layers of the grain. The results confirm that the CSLF6 gene of wheat encodes a beta-glucan synthase and indicate that transgenic manipulation can be used to enhance the health benefits of wheat products.

  3. Putative outer membrane proteins of Leptospira interrogans stimulate human umbilical vein endothelial cells (HUVECS) and express during infection.

    PubMed

    Gómez, Ricardo M; Vieira, Monica L; Schattner, Mirta; Malaver, Elisa; Watanabe, Monica M; Barbosa, Angela S; Abreu, Patricia A E; de Morais, Zenaide M; Cifuente, Javier O; Atzingen, Marina V; Oliveira, Tatiane R; Vasconcellos, Silvio A; Nascimento, Ana L T O

    2008-01-01

    Cell adhesion molecules (CAMs) are surface receptors present in eukaryotic cells that mediate cell-cell or cell-extracellular matrix interactions. Vascular endothelium stimulation in vitro that lead to the upregulation of CAMs was reported for the pathogenic spirochaetes, including rLIC10365 of Leptospira interrogans. In this study, we report the cloning of LIC10507, LIC10508, LIC10509 genes of L. interrogans using Escherichia coli as a host system. The rational for selecting these sequences is due to their location in L. interrogans serovar Copenhageni genome that has a potential involvement in pathogenesis. The genes encode for predicted lipoproteins with no assigned functions. The purified recombinant proteins were capable to promote the upregulation of intercellular adhesion molecule 1 (ICAM-1) and E-selectin on monolayers of human umbilical vein endothelial cells (HUVECS). In addition, the coding sequences are expressed in the renal tubules of animal during bacterial experimental infection. The proteins are probably located at the outer membrane of the bacteria since they are detected in detergent-phase of L. interrogans Triton X-114 extract. Altogether our data suggest a possible involvement of these proteins during bacterial infection and provide new insights into the role of this region in the pathogenesis of Leptospira.

  4. ACR4, a putative receptor kinase gene of Arabidopsis thaliana, that is expressed in the outer cell layers of embryos and plants, is involved in proper embryogenesis.

    PubMed

    Tanaka, Hirokazu; Watanabe, Masaru; Watanabe, Daisuke; Tanaka, Toshihiro; Machida, Chiyoko; Machida, Yasunori

    2002-04-01

    The surfaces of higher plants are characterized by epidermis, which usually consists of a single layer of cells. The epidermis is derived from the outer cell layer of the embryo or protoderm, which arises as a result of periclinal cell division. After seed germination, most of the epidermal cells of the aerial parts of plants are derived from the outer cell layer of the shoot apical meristem (the L1 layer). Thus, knowledge of how the protoderm and/or L1 layer is established is fundamental to understanding the morphogenesis of higher plants. Here, we report the isolation of a gene encoding an Arabidopsis homologue (ACR4) of the maize putative receptor kinase CRINKLY4 (CR4), which is involved in epidermal differentiation. The domain organization of the predicted amino acid sequence of ACR4 is essentially identical to that of CR4. ACR4-GFP fusion protein localized to the cell surface when expressed in tobacco cell (BY-2) culture. ACR4 transcripts were detected in all the organs of the Arabidopsis plant. In developing embryos and shoot apices, ACR4 transcripts accumulated in protoderm and epidermis at relatively higher levels than in the inner tissues. Over-expression of antisense ACR4 in Arabidopsis plants resulted in malformation of embryos to varying degrees. These results suggest that ACR4 is, at a minimum, involved in the normal morphogenesis of embryos, most likely through properly differentiating protoderm cells.

  5. Molecular characterization of the Serratia marcescens OmpF porin, and analysis of S. marcescens OmpF and OmpC osmoregulation.

    PubMed

    Hutsul, J A; Worobec, E

    1997-08-01

    Serratia marcescens is a nosocomial pathogen with a high incidence of beta-lactam resistance. Reduced amounts of outer-membrane porins have been correlated with increased resistance to beta-lactams but only one porin, OmpC, has been characterized at the molecular level. In this study we present the molecular characterization of a second porin, OmpF, and an analysis of the expression of S. marcescens porins in response to various environmental changes. Two porins were isolated from the outer membrane using urea-SDS-PAGE and the relative amounts were shown to be influenced by the osmolarity of the medium and the presence of salicylate. From a S. marcescens genomic DNA library an 8 kb EcoRI fragment was isolated that hybridized with an oligonucleotide encoding the published N-terminal amino acid sequence of the S. marcescens 41 kDa porin. A 41 kDa protein was detected in the outer membrane of Escherichia coli NM522 carrying the cloned S. marcescens DNA. The cloned gene was sequenced and shown to code for a protein that shared 60-70% identity with other known OmpF and OmpC sequences. The upstream DNA sequence of the S. marcescens gene was similar to the corresponding E. coli ompF sequence; however, a regulatory element important in repression of E. coli ompF at high osmolarity was absent. The cloned S. marcescens OmpF in E. coli increased in expression in conditions of high osmolarity. The potential involvement of micF in the observed osmoregulation of S. marcescens porins is discussed.

  6. The Iron-Responsive Fur/RyhB Regulatory Cascade Modulates the Shigella Outer Membrane Protease IcsP ▿ †

    PubMed Central

    Africa, Lia A. A.; Murphy, Erin R.; Egan, Nicholas R.; Wigley, Amanda F.; Wing, Helen J.

    2011-01-01

    Actin-based motility is central to the pathogenicity of the intracellular bacterial pathogen Shigella. Two Shigella outer membrane proteins, IcsA and IcsP, are required for efficient actin-based motility in the host cell cytoplasm, and the genes encoding both proteins are carried on the large virulence plasmid. IcsA triggers actin polymerization on the surface of the bacterium, leading to the formation of an actin tail that allows both intra- and intercellular spread. IcsP, an outer membrane protease, modulates the amount and distribution of the IcsA protein on the bacterial surface through proteolytic cleavage of IcsA. Transcription of icsP is increased in the presence of VirB, a DNA-binding protein that positively regulates many genes carried on the large virulence plasmid. In Shigella dysenteriae, the small regulatory RNA RyhB, which is a member of the iron-responsive Fur regulon, suppresses several virulence-associated phenotypes by downregulating levels of virB in response to iron limitation. Here we show that the Fur/RyhB regulatory pathway downregulates IcsP levels in response to low iron concentrations in Shigella flexneri and that this occurs at the level of transcription through the RyhB-dependent regulation of VirB. These observations demonstrate that in Shigella species the Fur/RyhB regulatory pathway provides a mechanism to finely tune the expression of icsP in response to the low concentrations of free iron predicted to be encountered within colonic epithelial cells. PMID:21859852

  7. Contribution of Resistance-Nodulation-Division Efflux Pump Operon smeU1-V-W-U2-X to Multidrug Resistance of Stenotrophomonas maltophilia ▿

    PubMed Central

    Chen, Chao-Hsien; Huang, Chiang-Ching; Chung, Tsao-Chuen; Hu, Rouh-Mei; Huang, Yi-Wei; Yang, Tsuey-Ching

    2011-01-01

    KJ09C, a multidrug-resistant mutant of Stenotrophomonas maltophilia KJ, was generated by in vitro selection with chloramphenicol. The multidrug-resistant phenotype of KJ09C was attributed to overexpression of a resistance nodulation division (RND)-type efflux system encoded by an operon consisting of five genes: smeU1, smeV, smeW, smeU2, and smeX. Proteins encoded by smeV, smeW, and smeX were similar to the membrane fusion protein, RND transporter, and outer membrane protein, respectively, of known RND-type systems. The proteins encoded by smeU1 and smeU2 were found to belong to the family of short-chain dehydrogenases/reductases. Mutant KJ09C exhibited increased resistance to chloramphenicol, quinolones, and tetracyclines and susceptibility to aminoglycosides; susceptibility to β-lactams and erythromycin was not affected. The expression of the smeU1-V-W-U2-X operon was regulated by the divergently transcribed LysR-type regulator gene smeRv. Overexpression of the SmeVWX pump contributed to the acquired resistance to chloramphenicol, quinolones, and tetracyclines. Inactivation of smeV and smeW completely abolished the activity of the SmeVWX pump, whereas inactivation of smeX alone decreased the activity of the SmeVWX pump. The enhanced aminoglycoside susceptibility observed in KJ09C resulted from SmeX overexpression. PMID:21930878

  8. Periplasmic Cytophaga hutchinsonii Endoglucanases Are Required for Use of Crystalline Cellulose as the Sole Source of Carbon and Energy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Yongtao; Han, Lanlan; Hefferon, Kathleen L.

    2016-06-03

    The soil bacteriumCytophaga hutchinsoniiactively digests crystalline cellulose by a poorly understood mechanism. Genome analyses identified nine genes predicted to encode endoglucanases with roles in this process. No predicted cellobiohydrolases, which are usually involved in the utilization of crystalline cellulose, were identified. Chromosomal deletions were performed in eight of the endoglucanase-encoding genes:cel5A,cel5B,cel5C,cel9A,cel9B,cel9C,cel9E, andcel9F. Each mutant retained the ability to digest crystalline cellulose, although the deletion ofcel9Ccaused a modest decrease in cellulose utilization. Strains with multiple deletions were constructed to identify the critical cellulases. Cells of a mutant lacking bothcel5Bandcel9Cwere completely deficient in growth on cellulose. Cell fractionation and biochemical analyses indicatemore » that Cel5B and Cel9C are periplasmic nonprocessive endoglucanases. The requirement of periplasmic endoglucanases for cellulose utilization suggests that cellodextrins are transported across the outer membrane during this process. Bioinformatic analyses predict that Cel5A, Cel9A, Cel9B, Cel9D, and Cel9E are secreted across the outer membrane by the type IX secretion system, which has been linked to cellulose utilization. These secreted endoglucanases may perform the initial digestion within amorphous regions on the cellulose fibers, releasing oligomers that are transported into the periplasm for further digestion by Cel5B and Cel9C. The results suggest that both cell surface and periplasmic endoglucanases are required for the growth ofC. hutchinsoniion cellulose and that novel cell surface proteins may solubilize and transport cellodextrins across the outer membrane. IMPORTANCEThe bacteriumCytophaga hutchinsoniidigests crystalline cellulose by an unknown mechanism. It lacks processive cellobiohydrolases that are often involved in cellulose digestion. Critical cellulolytic enzymes were identified by genetic analyses. Intracellular (periplasmic) nonprocessive endoglucanases performed an important role in cellulose utilization. The results suggest a model involving partial digestion at the cell surface, solubilization and uptake of cellodextrins across the outer membrane by an unknown mechanism, and further digestion within the periplasm. The ability to sequester cellodextrins and digest them intracellularly may limit losses of soluble cellobiose to other organisms.C. hutchinsoniiuses an unusual approach to digest cellulose and is a potential source of novel proteins to increase the efficiency of conversion of cellulose into soluble sugars and biofuels.« less

  9. A multicopper oxidase is essential for manganese oxidation and laccase-like activity in Pedomicrobium sp. ACM 3067.

    PubMed

    Ridge, Justin P; Lin, Marianne; Larsen, Eloise I; Fegan, Mark; McEwan, Alastair G; Sly, Lindsay I

    2007-04-01

    Pedomicrobium sp. ACM 3067 is a budding-hyphal bacterium belonging to the alpha-Proteobacteria which is able to oxidize soluble Mn2+ to insoluble manganese oxide. A cosmid, from a whole-genome library, containing the putative genes responsible for manganese oxidation was identified and a primer-walking approach yielded 4350 bp of novel sequence. Analysis of this sequence showed the presence of a predicted three-gene operon, moxCBA. The moxA gene product showed homology to multicopper oxidases (MCOs) and contained the characteristic four copper-binding motifs (A, B, C and D) common to MCOs. An insertion mutation of moxA showed that this gene was essential for both manganese oxidation and laccase-like activity. The moxB gene product showed homology to a family of outer membrane proteins which are essential for Type I secretion in Gram-negative bacteria. moxBA has not been observed in other manganese-oxidizing bacteria but homologues were identified in the genomes of several bacteria including Sinorhizobium meliloti 1021 and Agrobacterium tumefaciens C58. These results suggest that moxBA and its homologues constitute a family of genes encoding an MCO and a predicted component of the Type I secretion system.

  10. A functional TOC complex contributes to gravity signal transduction in Arabidopsis

    PubMed Central

    Strohm, Allison K.; Barrett-Wilt, Greg A.; Masson, Patrick H.

    2014-01-01

    Although plastid sedimentation has long been recognized as important for a plant's perception of gravity, it was recently shown that plastids play an additional function in gravitropism. The Translocon at the Outer envelope membrane of Chloroplasts (TOC) complex transports nuclear-encoded proteins into plastids, and a receptor of this complex, Toc132, was previously hypothesized to contribute to gravitropism either by directly functioning as a gravity signal transducer or by indirectly mediating the plastid localization of a gravity signal transducer. Here we show that mutations in multiple genes encoding TOC complex components affect gravitropism in a genetically sensitized background and that the cytoplasmic acidic domain of Toc132 is not required for its involvement in this process. Furthermore, mutations in TOC132 enhance the gravitropic defect of a mutant whose amyloplasts lack starch. Finally, we show that the levels of several nuclear-encoded root proteins are altered in toc132 mutants. These data suggest that the TOC complex indirectly mediates gravity signal transduction in Arabidopsis and support the idea that plastids are involved in gravitropism not only through their ability to sediment but also as part of the signal transduction mechanism. PMID:24795735

  11. A functional TOC complex contributes to gravity signal transduction in Arabidopsis.

    PubMed

    Strohm, Allison K; Barrett-Wilt, Greg A; Masson, Patrick H

    2014-01-01

    Although plastid sedimentation has long been recognized as important for a plant's perception of gravity, it was recently shown that plastids play an additional function in gravitropism. The Translocon at the Outer envelope membrane of Chloroplasts (TOC) complex transports nuclear-encoded proteins into plastids, and a receptor of this complex, Toc132, was previously hypothesized to contribute to gravitropism either by directly functioning as a gravity signal transducer or by indirectly mediating the plastid localization of a gravity signal transducer. Here we show that mutations in multiple genes encoding TOC complex components affect gravitropism in a genetically sensitized background and that the cytoplasmic acidic domain of Toc132 is not required for its involvement in this process. Furthermore, mutations in TOC132 enhance the gravitropic defect of a mutant whose amyloplasts lack starch. Finally, we show that the levels of several nuclear-encoded root proteins are altered in toc132 mutants. These data suggest that the TOC complex indirectly mediates gravity signal transduction in Arabidopsis and support the idea that plastids are involved in gravitropism not only through their ability to sediment but also as part of the signal transduction mechanism.

  12. Sensitization with vaccinia virus encoding H5N1 hemagglutinin restores immune potential against H5N1 influenza virus.

    PubMed

    Yasui, Fumihiko; Itoh, Yasushi; Ikejiri, Ai; Kitabatake, Masahiro; Sakaguchi, Nobuo; Munekata, Keisuke; Shichinohe, Shintaro; Hayashi, Yukiko; Ishigaki, Hirohito; Nakayama, Misako; Sakoda, Yoshihiro; Kida, Hiroshi; Ogasawara, Kazumasa; Kohara, Michinori

    2016-11-28

    H5N1 highly pathogenic avian influenza (H5N1 HPAI) virus causes elevated mortality compared with seasonal influenza viruses like H1N1 pandemic influenza (H1N1 pdm) virus. We identified a mechanism associated with the severe symptoms seen with H5N1 HPAI virus infection. H5N1 HPAI virus infection induced a decrease of dendritic cell number in the splenic extrafollicular T-cell zone and impaired formation of the outer layers of B-cell follicles, resulting in insufficient levels of antibody production after infection. However, in animals vaccinated with a live recombinant vaccinia virus expressing the H5 hemagglutinin, infection with H5N1 HPAI virus induced parafollicular dendritic cell accumulation and efficient antibody production. These results indicate that a recombinant vaccinia encoding H5 hemagglutinin gene does not impair dendritic cell recruitment and can be a useful vaccine candidate.

  13. Genetic Determinants of Intrinsic Colistin Tolerance in Acinetobacter baumannii

    PubMed Central

    Hood, M. Indriati; Becker, Kyle W.; Roux, Christelle M.; Dunman, Paul M.

    2013-01-01

    Acinetobacter baumannii is a leading cause of multidrug-resistant infections worldwide. This organism poses a particular challenge due to its ability to acquire resistance to new antibiotics through adaptation or mutation. This study was undertaken to determine the mechanisms governing the adaptability of A. baumannii to the antibiotic colistin. Screening of a transposon mutant library identified over 30 genes involved in inducible colistin resistance in A. baumannii. One of the genes identified was lpsB, which encodes a glycosyltransferase involved in lipopolysaccharide (LPS) synthesis. We demonstrate that loss of LpsB function results in increased sensitivity to both colistin and cationic antimicrobial peptides of the innate immune system. Moreover, LpsB is critical for pathogenesis in a pulmonary model of infection. Taken together, these data define bacterial processes required for intrinsic colistin tolerance in A. baumannii and underscore the importance of outer membrane structure in both antibiotic resistance and the pathogenesis of A. baumannii. PMID:23230287

  14. Growth regulation in tip-growing cells that develop on the epidermis.

    PubMed

    Honkanen, Suvi; Dolan, Liam

    2016-12-01

    Plants develop tip-growing extensions-root hairs and rhizoids-that initiate as swellings on the outer surface of individual epidermal cells. A conserved genetic mechanism controls the earliest stages in the initiation of these swellings. The same mechanism controls the formation of multicellular structures that develop from swellings on epidermal cells in early diverging land plants. Details of the molecular events that regulate the positioning of the swellings involve sterols and phosphatidylinositol phosphates. The final length of root hairs is determined by the intensity of a pulse of transcription factor synthesis. Genes encoding similar transcription factors control root hair development in cereals and are potential targets for crop improvement. Copyright © 2016. Published by Elsevier Ltd.

  15. NagA-dependent uptake of N-acetyl-glucosamine and N-acetyl-chitin oligosaccharides across the outer membrane of Caulobacter crescentus.

    PubMed

    Eisenbeis, Simone; Lohmiller, Stefanie; Valdebenito, Marianne; Leicht, Stefan; Braun, Volkmar

    2008-08-01

    Among the 67 predicted TonB-dependent outer membrane transporters of Caulobacter crescentus, NagA was found to be essential for growth on N-acetyl-beta-D-glucosamine (GlcNAc) and larger chitin oligosaccharides. NagA (93 kDa) has a predicted typical domain structure of an outer membrane transport protein: a signal sequence, the TonB box EQVVIT, a hatch domain of 147 residues, and a beta-barrel composed of 22 antiparallel beta-strands linked by large surface loops and very short periplasmic turns. Mutations in tonB1 and exbBD, known to be required for maltose transport via MalA in C. crescentus, and in two additional predicted tonB genes (open reading frames cc2327 and cc3508) did not affect NagA-mediated GlcNAc uptake. nagA is located in a gene cluster that encodes a predicted PTS sugar transport system and two enzymes that convert GlcNAc-6-P to fructose-6-P. Since a nagA insertion mutant did not grow on and transport GlcNAc, diffusion of GlcNAc through unspecific porins in the outer membrane is excluded. Uptake of GlcNAc into tonB and exbBD mutants and reduction but not abolishment of GlcNAc transport by agents which dissipate the electrochemical potential of the cytoplasmic membrane (0.1 mM carbonyl cyanide 3-chlorophenylhydrazone and 1 mM 2,4-dinitrophenol) suggest diffusion of GlcNAc through a permanently open pore of NagA. Growth on (GlcNAc)(3) and (GlcNAc)(5) requires ExbB and ExbD, indicating energy-coupled transport by NagA. We propose that NagA forms a small pore through which GlcNAc specifically diffuses into the periplasm and functions as an energy-coupled transporter for the larger chitin oligosaccharides.

  16. Evolution of the Kdo2-lipid A Biosynthesis in Bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    S Opiyo; R Pardy; H Moriyama

    BACKGROUND: Lipid A is the highly immunoreactive endotoxic center of lipopolysaccharide (LPS). It anchors the LPS into the outer membrane of most Gram-negative bacteria. Lipid A can be recognized by animal cells, triggers defense-related responses, and causes Gram-negative sepsis. The biosynthesis of Kdo2-lipid A, the LPS substructure, involves with nine enzymatic steps. RESULTS: In order to elucidate the evolutionary pathway of Kdo2-lipid A biosynthesis, we examined the distribution of genes encoding the nine enzymes across bacteria. We found that not all Gram-negative bacteria have all nine enzymes. Some Gram-negative bacteria have no genes encoding these enzymes and others have genesmore » only for the first four enzymes (LpxA, LpxC, LpxD, and LpxB). Among the nine enzymes, five appeared to have arisen from three independent gene duplication events. Two of such events happened within the Proteobacteria lineage, followed by functional specialization of the duplicated genes and pathway optimization in these bacteria. CONCLUSIONS: The nine-enzyme pathway, which was established based on the studies mainly in Escherichia coli K12, appears to be the most derived and optimized form. It is found only in E. coli and related Proteobacteria. Simpler and probably less efficient pathways are found in other bacterial groups, with Kdo2-lipid A variants as the likely end products. The Kdo2-lipid A biosynthetic pathway exemplifies extremely plastic evolution of bacterial genomes, especially those of Proteobacteria, and how these mainly pathogenic bacteria have adapted to their environment.« less

  17. Analysis of membrane protein genes in a Brazilian isolate of Anaplasma marginale.

    PubMed

    G Junior, Daniel S; Araújo, Flábio R; Almeida Junior, Nalvo F; Adi, Said S; Cheung, Luciana M; Fragoso, Stenio P; Ramos, Carlos A N; Oliveira, Renato Henrique M de; Santos, Caroline S; Bacanelli, Gisele; Soares, Cleber O; Rosinha, Grácia M S; Fonseca, Adivaldo H

    2010-11-01

    The sequencing of the complete genome of Anaplasma marginale has enabled the identification of several genes that encode membrane proteins, thereby increasing the chances of identifying candidate immunogens. Little is known regarding the genetic variability of genes that encode membrane proteins in A. marginale isolates. The aim of the present study was to determine the degree of conservation of the predicted amino acid sequences of OMP1, OMP4, OMP5, OMP7, OMP8, OMP10, OMP14, OMP15, SODb, OPAG1, OPAG3, VirB3, VirB9-1, PepA, EF-Tu and AM854 proteins in a Brazilian isolate of A. marginale compared to other isolates. Hence, primers were used to amplify these genes: omp1, omp4, omp5, omp7, omp8, omp10, omp14, omp15, sodb, opag1, opag3, virb3, VirB9-1, pepA, ef-tu and am854. After polimerase chain reaction amplification, the products were cloned and sequenced using the Sanger method and the predicted amino acid sequence were multi-aligned using the CLUSTALW and MEGA 4 programs, comparing the predicted sequences between the Brazilian, Saint Maries, Florida and A. marginale centrale isolates. With the exception of outer membrane protein (OMP) 7, all proteins exhibited 92-100% homology to the other A. marginale isolates. However, only OMP1, OMP5, EF-Tu, VirB3, SODb and VirB9-1 were selected as potential immunogens capable of promoting cross-protection between isolates due to the high degree of homology (over 72%) also found with A. (centrale) marginale.

  18. Identification of BCAP, a new protein associated with basal bodies and centrioles.

    PubMed

    Ponsard, Cecile; Seltzer, Virginie; Perret, Eric; Tournier, Frederic; Middendorp, Sandrine

    2007-05-01

    Cilia exert critical functions in numerous organisms, including that of cell motility, fluid transport and protozoan locomotion. Defects in this organelle can lead to lethal pathologies in humans, including primary ciliary dyskinesia. An understanding of the cilia formation process would lead to better characterization of defects involved in such pathologies. In the present study, we identified a gene encoding a novel human protein, BCAP for Basal body Centriole-Associated Protein, which shares homologies with a previously described protein, Outer Dense Fiber 2 (ODF2). ODF2, a major component of the sperm tail cytoskeleton, is required for the formation of mother centriole distal/subdistal appendages and the generation of primary cilia. Here, we show that the bcap gene contains 18 alternatively spliced exons and encodes five different isoforms, three long and two short ones. BCAP is preferentially expressed in cilia/flagella containing tissues. Moreover, its expression is correlated with cilia formation during mucociliary differentiation of human nasal epithelial cells. Using immunofluorescence analyses, BCAP was localized within basal bodies of ciliated cells and within centrioles of proliferating cells. In light of the several spliced isoforms of BCAP and the particular localization of the protein, BCAP isoforms could play distinct roles in cilia and in centrosomes.

  19. Primary Ciliary Dyskinesia Caused by Homozygous Mutation in DNAL1, Encoding Dynein Light Chain 1

    PubMed Central

    Mazor, Masha; Alkrinawi, Soliman; Chalifa-Caspi, Vered; Manor, Esther; Sheffield, Val C.; Aviram, Micha; Parvari, Ruti

    2011-01-01

    In primary ciliary dyskinesia (PCD), genetic defects affecting motility of cilia and flagella cause chronic destructive airway disease, randomization of left-right body asymmetry, and, frequently, male infertility. The most frequent defects involve outer and inner dynein arms (ODAs and IDAs) that are large multiprotein complexes responsible for cilia-beat generation and regulation, respectively. Although it has long been suspected that mutations in DNAL1 encoding the ODA light chain1 might cause PCD such mutations were not found. We demonstrate here that a homozygous point mutation in this gene is associated with PCD with absent or markedly shortened ODA. The mutation (NM_031427.3: c.449A>G; p.Asn150Ser) changes the Asn at position150, which is critical for the proper tight turn between the β strand and the α helix of the leucine-rich repeat in the hydrophobic face that connects to the dynein heavy chain. The mutation reduces the stability of the axonemal dynein light chain 1 and damages its interactions with dynein heavy chain and with tubulin. This study adds another important component to understanding the types of mutations that cause PCD and provides clinical information regarding a specific mutation in a gene not yet known to be associated with PCD. PMID:21496787

  20. Risk factors for KPC-producing Klebsiella pneumoniae: watch out for surgery.

    PubMed

    da Silva, Kesia Esther; Maciel, Wirlaine Glauce; Sacchi, Flávia Patussi Correia; Carvalhaes, Cecilia Godoy; Rodrigues-Costa, Fernanda; da Silva, Ana Carolina Ramos; Croda, Mariana Garcia; Negrão, Fábio Juliano; Croda, Julio; Gales, Ana Cristina; Simionatto, Simone

    2016-06-01

    This study describes the molecular characteristics and risk factors associated with carbapenem-resistant Klebsiella pneumoniae strains. Risk factors associated with KPC-producing K. pneumoniae strains were investigated in this case-control study from May 2011 to May 2013. Bacterial identification was performed by matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS). Antimicrobial susceptibility was determined by broth microdilution. Carbapenemase production was assessed by both modified Hodge test (MHT) and ertapenem hydrolysis using MALDI-TOF MS. The presence of β-lactamase-encoding genes was evaluated by PCR and DNA sequencing. Alterations in genes encoding K. pneumoniae outer membrane proteins were analysed by PCR and DNA sequencing as well as SDS-PAGE. Genetic relatedness among strains was determined by pulsed-field gel electrophoresis. This study included 94 patients. Longer hospitalisation, mechanical ventilation, catheters, and previous surgery were associated with KPC-producing K. pneumoniae. Sixty-eight strains showed resistance to carbapenems. Carbapenemase production was detected by MHT in 67 K. pneumoniae strains and by MALDI-TOF MS in 57. The presence of the blaKPC-2 gene was identified in 57 strains. The blaKPC-2 gene was not found in 11 carbapenem-resistant K. pneumoniae; instead, the blaCTX-M-1-like, blaCTX-M-2-like, blaCTX-M-8 like, blaCTX-M-14-like and blaSHV- like genes associated with OmpK35 and OmpK36 alterations were observed. Thirty-three KPC-producing K. pneumoniae strains were clonally related, and patients infected with these strains had a higher mortality rate (78.78 %). Our results show that KPC-producing K. pneumoniae was associated with several healthcare-related risk factors, including recent surgery.

  1. Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

    PubMed Central

    Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

    2013-01-01

    Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

  2. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    PubMed

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome triplication analysis in B. oleracea, B. rapa and A. thaliana genomes, our study provides insight into the evolutionary history of NBS-encoding genes after divergence of A. thaliana and the Brassica lineage. These results together with expression pattern analysis of NBS-encoding orthologous genes provide useful resource for functional characterization of these genes and genetic improvement of relevant crops.

  3. The Arabidopsis ppi1 Mutant Is Specifically Defective in the Expression, Chloroplast Import, and Accumulation of Photosynthetic ProteinsW⃞

    PubMed Central

    Kubis, Sybille; Baldwin, Amy; Patel, Ramesh; Razzaq, Azam; Dupree, Paul; Lilley, Kathryn; Kurth, Joachim; Leister, Dario; Jarvis, Paul

    2003-01-01

    The import of nucleus-encoded proteins into chloroplasts is mediated by translocon complexes in the envelope membranes. A component of the translocon in the outer envelope membrane, Toc34, is encoded in Arabidopsis by two homologous genes, atTOC33 and atTOC34. Whereas atTOC34 displays relatively uniform expression throughout development, atTOC33 is strongly upregulated in rapidly growing, photosynthetic tissues. To understand the reason for the existence of these two related genes, we characterized the atTOC33 knockout mutant ppi1. Immunoblotting and proteomics revealed that components of the photosynthetic apparatus are deficient in ppi1 chloroplasts and that nonphotosynthetic chloroplast proteins are unchanged or enriched slightly. Furthermore, DNA array analysis of 3292 transcripts revealed that photosynthetic genes are moderately, but specifically, downregulated in ppi1. Proteome differences in ppi1 could be correlated with protein import rates: ppi1 chloroplasts imported the ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit and 33-kD oxygen-evolving complex precursors at significantly reduced rates, but the import of a 50S ribosomal subunit precursor was largely unaffected. The ppi1 import defect occurred at the level of preprotein binding, which is consistent with a role for atToc33 during preprotein recognition. The data suggest that atToc33 is involved preferentially in the import of photosynthetic proteins and, by extension, that atToc34 is involved in the import of nonphotosynthetic chloroplast proteins. PMID:12897258

  4. The Bordetella bhu Locus Is Required for Heme Iron Utilization

    PubMed Central

    Vanderpool, Carin K.; Armstrong, Sandra K.

    2001-01-01

    Bordetella pertussis and Bordetella bronchiseptica are capable of obtaining iron from hemin and hemoglobin. Genes encoding a putative bacterial heme iron acquisition system (bhu, for Bordetella heme utilization) were identified in a B. pertussis genomic sequence database, and the corresponding DNA was isolated from a virulent strain of B. pertussis. A B. pertussis bhuR mutant, predicted to lack the heme outer membrane receptor, was generated by allelic exchange. In contrast to the wild-type strain, bhuR mutant PM5 was incapable of acquiring iron from hemin and hemoglobin; genetic complementation of PM5 with the cloned bhuRSTUV genes restored heme utilization to wild-type levels. In parallel studies, B. bronchiseptica bhu sequences were also identified and a B. bronchiseptica bhuR mutant was constructed and confirmed to be defective in heme iron acquisition. The wild-type B. bronchiseptica parent strain grown under low-iron conditions produced the presumptive BhuR protein, which was absent in the bhuR mutant. Furthermore, production of BhuR by iron-starved B. bronchiseptica was markedly enhanced by culture in hemin-supplemented medium, suggesting that these organisms sense and respond to heme in the environment. Analysis of the genetic region upstream of the bhu cluster identified open reading frames predicted to encode homologs of the Escherichia coli ferric citrate uptake regulators FecI and FecR. These putative Bordetella regulators may mediate heme-responsive positive transcriptional control of the bhu genes. PMID:11418569

  5. Human Usher 1B/mouse shaker-1: the retinal phenotype discrepancy explained by the presence/absence of myosin VIIA in the photoreceptor cells.

    PubMed

    el-Amraoui, A; Sahly, I; Picaud, S; Sahel, J; Abitbol, M; Petit, C

    1996-08-01

    Usher syndrome type 1 (USH1) associates severe congenital deafness, vestibular dysfunction and progressive retinitis pigmentosa leading to blindness. The gene encoding myosin VIIA is responsible for USH1B. Mutations in the murine orthologous gene lead to the shaker-1 phenotype, which manifests cochlear and vestibular dysfunction, without any retinal defect. To address this phenotypic discrepancy, the expression of myosin VIIA in retinal cells was analyzed in human and mouse during embryonic development and adult life. In the human embryo, myosin VIIA was present first in the pigment epithelium cells, and later in these cells as well as in the photoreceptor cells. In the adult human retina, myosin VIIA was present in both cell types. In contrast, in mouse, only pigment epithelium cells expressed the protein throughout development and adult life. Myosin VIIA was also found to be absent in the photoreceptor cells of other rodents (rat and guinea-pig), whereas these cells expressed the protein in amphibians, avians and primates. These observations suggest that retinitis pigmentosa of USH1B results from a primary rod and cone defect. The USH1B/shaker-1 paradigm illustrates a species-specific cell pattern of gene expression as a possible cause for the discrepancy between phenotypes involving defective orthologous genes in man and mouse. Interestingly, in the photoreceptor cells, myosin VIIA is mainly localized in the inner and base of outer segments as well as in the synaptic ending region where it is co-localized with the synaptic vesicles. Therefore, we suggest that myosin VIIA might play a role in the trafficking of ribbon-synaptic vesicle complexes and the renewal processes of the outer photoreceptor disks.

  6. Topological and organizational properties of the products of house-keeping and tissue-specific genes in protein-protein interaction networks.

    PubMed

    Lin, Wen-Hsien; Liu, Wei-Chung; Hwang, Ming-Jing

    2009-03-11

    Human cells of various tissue types differ greatly in morphology despite having the same set of genetic information. Some genes are expressed in all cell types to perform house-keeping functions, while some are selectively expressed to perform tissue-specific functions. In this study, we wished to elucidate how proteins encoded by human house-keeping genes and tissue-specific genes are organized in human protein-protein interaction networks. We constructed protein-protein interaction networks for different tissue types using two gene expression datasets and one protein-protein interaction database. We then calculated three network indices of topological importance, the degree, closeness, and betweenness centralities, to measure the network position of proteins encoded by house-keeping and tissue-specific genes, and quantified their local connectivity structure. Compared to a random selection of proteins, house-keeping gene-encoded proteins tended to have a greater number of directly interacting neighbors and occupy network positions in several shortest paths of interaction between protein pairs, whereas tissue-specific gene-encoded proteins did not. In addition, house-keeping gene-encoded proteins tended to connect with other house-keeping gene-encoded proteins in all tissue types, whereas tissue-specific gene-encoded proteins also tended to connect with other tissue-specific gene-encoded proteins, but only in approximately half of the tissue types examined. Our analysis showed that house-keeping gene-encoded proteins tend to occupy important network positions, while those encoded by tissue-specific genes do not. The biological implications of our findings were discussed and we proposed a hypothesis regarding how cells organize their protein tools in protein-protein interaction networks. Our results led us to speculate that house-keeping gene-encoded proteins might form a core in human protein-protein interaction networks, while clusters of tissue-specific gene-encoded proteins are attached to the core at more peripheral positions of the networks.

  7. Draft genome sequence of Actinotignum schaalii DSM 15541T: Genetic insights into the lifestyle, cell fitness and virulence.

    PubMed

    Yassin, Atteyet F; Langenberg, Stefan; Huntemann, Marcel; Clum, Alicia; Pillay, Manoj; Palaniappan, Krishnaveni; Varghese, Neha; Mikhailova, Natalia; Mukherjee, Supratim; Reddy, T B K; Daum, Chris; Shapiro, Nicole; Ivanova, Natalia; Woyke, Tanja; Kyrpides, Nikos C

    2017-01-01

    The permanent draft genome sequence of Actinotignum schaalii DSM 15541T is presented. The annotated genome includes 2,130,987 bp, with 1777 protein-coding and 58 rRNA-coding genes. Genome sequence analysis revealed absence of genes encoding for: components of the PTS systems, enzymes of the TCA cycle, glyoxylate shunt and gluconeogensis. Genomic data revealed that A. schaalii is able to oxidize carbohydrates via glycolysis, the nonoxidative pentose phosphate and the Entner-Doudoroff pathways. Besides, the genome harbors genes encoding for enzymes involved in the conversion of pyruvate to lactate, acetate and ethanol, which are found to be the end products of carbohydrate fermentation. The genome contained the gene encoding Type I fatty acid synthase required for de novo FAS biosynthesis. The plsY and plsX genes encoding the acyltransferases necessary for phosphatidic acid biosynthesis were absent from the genome. The genome harbors genes encoding enzymes responsible for isoprene biosynthesis via the mevalonate (MVA) pathway. Genes encoding enzymes that confer resistance to reactive oxygen species (ROS) were identified. In addition, A. schaalii harbors genes that protect the genome against viral infections. These include restriction-modification (RM) systems, type II toxin-antitoxin (TA), CRISPR-Cas and abortive infection system. A. schaalii genome also encodes several virulence factors that contribute to adhesion and internalization of this pathogen such as the tad genes encoding proteins required for pili assembly, the nanI gene encoding exo-alpha-sialidase, genes encoding heat shock proteins and genes encoding type VII secretion system. These features are consistent with anaerobic and pathogenic lifestyles. Finally, resistance to ciprofloxacin occurs by mutation in chromosomal genes that encode the subunits of DNA-gyrase (GyrA) and topisomerase IV (ParC) enzymes, while resistant to metronidazole was due to the frxA gene, which encodes NADPH-flavin oxidoreductase.

  8. The MIA complex is a conserved and novel dynein regulator essential for normal ciliary motility

    PubMed Central

    Yamamoto, Ryosuke; Song, Kangkang; Yanagisawa, Haru-aki; Fox, Laura; Yagi, Toshiki; Wirschell, Maureen; Hirono, Masafumi; Kamiya, Ritsu; Nicastro, Daniela

    2013-01-01

    Axonemal dyneins must be precisely regulated and coordinated to produce ordered ciliary/flagellar motility, but how this is achieved is not understood. We analyzed two Chlamydomonas reinhardtii mutants, mia1 and mia2, which display slow swimming and low flagellar beat frequency. We found that the MIA1 and MIA2 genes encode conserved coiled-coil proteins, FAP100 and FAP73, respectively, which form the modifier of inner arms (MIA) complex in flagella. Cryo–electron tomography of mia mutant axonemes revealed that the MIA complex was located immediately distal to the intermediate/light chain complex of I1 dynein and structurally appeared to connect with the nexin–dynein regulatory complex. In axonemes from mutants that lack both the outer dynein arms and the MIA complex, I1 dynein failed to assemble, suggesting physical interactions between these three axonemal complexes and a role for the MIA complex in the stable assembly of I1 dynein. The MIA complex appears to regulate I1 dynein and possibly outer arm dyneins, which are both essential for normal motility. PMID:23569216

  9. Prestin and the cholinergic receptor of hair cells: positively-selected proteins in mammals

    PubMed Central

    Elgoyhen, Ana Belén; Franchini, Lucía F.

    2010-01-01

    The hair cells of the vertebrate inner ear posses active mechanical processes to amplify their inputs. The stereocilia bundle of various vertebrate animals can produce active movements. Though standard stereocilia-based mechanisms to promote amplification persist in mammals, an additional radically different mechanism evolved: the so called somatic electromotility which refers to the elongation/contraction of the outer hair cells’ (OHC) cylindrical cell body in response to membrane voltage changes. Somatic electromotility in OHCs, as the basis for cochlear amplification, is a mammalian novelty and it is largely dependent upon the properties of the unique motor protein prestin. We review recent literature which has demonstrated that although the gene encoding prestin is present in all vertebrate species, mammalian prestin has been under positive selective pressure to acquire motor properties, probably rendering it fit to serve somatic motility in outer hair cells. Moreover, we discuss data which indicates that a modified α10 nicotinic cholinergic receptor subunit has coevolved in mammals, most likely to give the auditory feedback system the capability to control somatic electromotility. PMID:20056140

  10. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    PubMed

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  11. The Xylella fastidiosa PD1063 Protein Is Secreted in Association with Outer Membrane Vesicles

    PubMed Central

    Pierce, Brittany K.; Voegel, Tanja; Kirkpatrick, Bruce C.

    2014-01-01

    Xylella fastidiosa is a gram-negative, xylem-limited plant pathogenic bacterium that causes disease in a variety of economically important agricultural crops including Pierce's disease of grapevines. Xylella fastidiosa biofilms formed in the xylem vessels of plants play a key role in early colonization and pathogenicity by providing a protected niche and enhanced cell survival. Here we investigate the role of Xylella fastidiosa PD1063, the predicted ortholog of Xanthomonas oryzae pv. oryzae PXO_03968, which encodes an outer membrane protein. To assess the function of the Xylella fastidiosa ortholog, we created Xylella fastidiosa mutants deleted for PD1063 and then assessed biofilm formation, cell-cell aggregation and cell growth in vitro. We also assessed disease severity and pathogen titers in grapevines mechanically inoculated with the Xylella fastidiosa PD1063 mutant. We found a significant decrease in cell-cell aggregation among PD1063 mutants but no differences in cell growth, biofilm formation, disease severity or titers in planta. Based on the demonstration that Xanthomonas oryzae pv. oryzae PXO_03968 encodes an outer membrane protein, secreted in association with outer membrane vesicles, we predicted that PD1063 would also be secreted in a similar manner. Using anti-PD1063 antibodies, we found PD1063 in the supernatant and secreted in association with outer membrane vesicles. PD1063 purified from the supernatant, outer membrane fractions and outer membrane vesicles was 19.2 kD, corresponding to the predicted size of the processed protein. Our findings suggest Xylella fastidiosa PD1063 is not essential for development of Pierce's disease in Vitis vinifera grapevines although further research is required to determine the function of the PD1063 outer membrane protein in Xylella fastidiosa. PMID:25426629

  12. The Xylella fastidiosa PD1063 protein is secreted in association with outer membrane vesicles.

    PubMed

    Pierce, Brittany K; Voegel, Tanja; Kirkpatrick, Bruce C

    2014-01-01

    Xylella fastidiosa is a gram-negative, xylem-limited plant pathogenic bacterium that causes disease in a variety of economically important agricultural crops including Pierce's disease of grapevines. Xylella fastidiosa biofilms formed in the xylem vessels of plants play a key role in early colonization and pathogenicity by providing a protected niche and enhanced cell survival. Here we investigate the role of Xylella fastidiosa PD1063, the predicted ortholog of Xanthomonas oryzae pv. oryzae PXO_03968, which encodes an outer membrane protein. To assess the function of the Xylella fastidiosa ortholog, we created Xylella fastidiosa mutants deleted for PD1063 and then assessed biofilm formation, cell-cell aggregation and cell growth in vitro. We also assessed disease severity and pathogen titers in grapevines mechanically inoculated with the Xylella fastidiosa PD1063 mutant. We found a significant decrease in cell-cell aggregation among PD1063 mutants but no differences in cell growth, biofilm formation, disease severity or titers in planta. Based on the demonstration that Xanthomonas oryzae pv. oryzae PXO_03968 encodes an outer membrane protein, secreted in association with outer membrane vesicles, we predicted that PD1063 would also be secreted in a similar manner. Using anti-PD1063 antibodies, we found PD1063 in the supernatant and secreted in association with outer membrane vesicles. PD1063 purified from the supernatant, outer membrane fractions and outer membrane vesicles was 19.2 kD, corresponding to the predicted size of the processed protein. Our findings suggest Xylella fastidiosa PD1063 is not essential for development of Pierce's disease in Vitis vinifera grapevines although further research is required to determine the function of the PD1063 outer membrane protein in Xylella fastidiosa.

  13. Cephalosporinases associated with outer membrane vesicles released by Bacteroides spp. protect gut pathogens and commensals against β-lactam antibiotics.

    PubMed

    Stentz, Régis; Horn, Nikki; Cross, Kathryn; Salt, Louise; Brearley, Charles; Livermore, David M; Carding, Simon R

    2015-03-01

    To identify β-lactamase genes in gut commensal Bacteroides species and to assess the impact of these enzymes, when carried by outer membrane vesicles (OMVs), in protecting enteric pathogens and commensals. A deletion mutant of the putative class A β-lactamase gene (locus tag BT_4507) found in the genome of the human commensal Bacteroides thetaiotaomicron was constructed and a phenotypic analysis performed. A phylogenetic tree was built from an alignment of nine Bacteroides cephalosporinase protein sequences, using the maximum likelihood method. The rate of cefotaxime degradation after incubation with OMVs produced by different Bacteroides species was quantified using a disc susceptibility test. The resistance of Salmonella Typhimurium and Bifidobacterium breve to cefotaxime in liquid culture in the presence of B. thetaiotaomicron OMVs was evaluated by measuring bacterial growth. The B. thetaiotaomicron BT_4507 gene encodes a β-lactamase related to the CepA cephalosporinase of Bacteroides fragilis. OMVs produced by B. thetaiotaomicron and several other Bacteroides species, except Bacteroides ovatus, carried surface-associated β-lactamases that could degrade cefotaxime. β-Lactamase-harbouring OMVs from B. thetaiotaomicron protected Salmonella Typhimurium and B. breve from an otherwise lethal dose of cefotaxime. The production of membrane vesicles carrying surface-associated β-lactamases by Bacteroides species, which constitute a major part of the human colonic microbiota, may protect commensal bacteria and enteric pathogens, such as Salmonella Typhimurium, against β-lactam antibiotics. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

  14. KCNQ5/Kv7.5 potassium channel expression and subcellular localization in primate retinal pigment epithelium and neural retina

    PubMed Central

    Zhang, Xiaoming; Yang, Dongli

    2011-01-01

    Previous studies identified in retinal pigment epithelial (RPE) cells an M-type K+ current, which in many other cell types is mediated by channels encoded by KCNQ genes. The aim of this study was to assess the expression of KCNQ genes in the monkey RPE and neural retina. Application of the specific KCNQ channel blocker XE991 eliminated the M-type current in freshly isolated monkey RPE cells, indicating that KCNQ subunits contribute to the underlying channels. RT-PCR analysis revealed the expression of KCNQ1, KCNQ4, and KCNQ5 transcripts in the RPE and all five KCNQ transcripts in the neural retina. At the protein level, KCNQ5 was detected in the RPE, whereas both KCNQ4 and KCNQ5 were found in neural retina. In situ hybridization in frozen monkey retinal sections revealed KCNQ5 gene expression in the ganglion cell layer and the inner and outer nuclear layers of the neural retina, but results in the RPE were inconclusive due to the presence of melanin. Immunohistochemistry revealed KCNQ5 in the inner and outer plexiform layers, in cone and rod photoreceptor inner segments, and near the basal membrane of the RPE. The data suggest that KCNQ5 channels contribute to the RPE basal membrane K+ conductance and, thus, likely play an important role in active K+ absorption. The distribution of KCNQ5 in neural retina suggests that these channels may function in the shaping of the photoresponses of cone and rod photoreceptors and the processing of visual information by retinal neurons. PMID:21795522

  15. Roles of the outer membrane protein AsmA of Salmonella enterica in the control of marRAB expression and invasion of epithelial cells.

    PubMed

    Prieto, Ana I; Hernández, Sara B; Cota, Ignacio; Pucciarelli, M Graciela; Orlov, Yuri; Ramos-Morales, Francisco; García-del Portillo, Francisco; Casadesús, Josep

    2009-06-01

    A genetic screen for suppressors of bile sensitivity in DNA adenine methylase (dam) mutants of Salmonella enterica serovar Typhimurium yielded insertions in an uncharacterized locus homologous to the Escherichia coli asmA gene. Disruption of asmA suppressed bile sensitivity also in phoP and wec mutants of S. enterica and increased the MIC of sodium deoxycholate for the parental strain ATCC 14028. Increased levels of marA mRNA were found in asmA, asmA dam, asmA phoP, and asmA wec strains of S. enterica, suggesting that lack of AsmA activates expression of the marRAB operon. Hence, asmA mutations may enhance bile resistance by inducing gene expression changes in the marRAB-controlled Mar regulon. In silico analysis of AsmA structure predicted the existence of one transmembrane domain. Biochemical analysis of subcellular fractions revealed that the asmA gene of S. enterica encodes a protein of approximately 70 kDa located in the outer membrane. Because AsmA is unrelated to known transport and/or efflux systems, we propose that activation of marRAB in asmA mutants may be a consequence of envelope reorganization. Competitive infection of BALB/c mice with asmA(+) and asmA isogenic strains indicated that lack of AsmA attenuates Salmonella virulence by the oral route but not by the intraperitoneal route. Furthermore, asmA mutants showed a reduced ability to invade epithelial cells in vitro.

  16. Nuclear envelopathies: a complex LINC between nuclear envelope and pathology.

    PubMed

    Janin, Alexandre; Bauer, Delphine; Ratti, Francesca; Millat, Gilles; Méjat, Alexandre

    2017-08-30

    Since the identification of the first disease causing mutation in the gene coding for emerin, a transmembrane protein of the inner nuclear membrane, hundreds of mutations and variants have been found in genes encoding for nuclear envelope components. These proteins can be part of the inner nuclear membrane (INM), such as emerin or SUN proteins, outer nuclear membrane (ONM), such as Nesprins, or the nuclear lamina, such as lamins A and C. However, they physically interact with each other to insure the nuclear envelope integrity and mediate the interactions of the nuclear envelope with both the genome, on the inner side, and the cytoskeleton, on the outer side. The core of this complex, called LINC (LInker of Nucleoskeleton to Cytoskeleton) is composed of KASH and SUN homology domain proteins. SUN proteins are INM proteins which interact with lamins by their N-terminal domain and with the KASH domain of nesprins located in the ONM by their C-terminal domain.Although most of these proteins are ubiquitously expressed, their mutations have been associated with a large number of clinically unrelated pathologies affecting specific tissues. Moreover, variants in SUN proteins have been found to modulate the severity of diseases induced by mutations in other LINC components or interactors. For these reasons, the diagnosis and the identification of the molecular explanation of "nuclear envelopathies" is currently challenging.The aim of this review is to summarize the human diseases caused by mutations in genes coding for INM proteins, nuclear lamina, and ONM proteins, and to discuss their potential physiopathological mechanisms that could explain the large spectrum of observed symptoms.

  17. Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters.

    PubMed

    de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H

    2016-01-01

    Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Anchorless surface associated glycolytic enzymes from Lactobacillus plantarum 299v bind to epithelial cells and extracellular matrix proteins.

    PubMed

    Glenting, Jacob; Beck, Hans Christian; Vrang, Astrid; Riemann, Holger; Ravn, Peter; Hansen, Anne Maria; Antonsson, Martin; Ahrné, Siv; Israelsen, Hans; Madsen, Søren

    2013-06-12

    An important criterion for the selection of a probiotic bacterial strain is its ability to adhere to the mucosal surface. Adhesion is usually mediated by proteins or other components located on the outer cell surface of the bacterium. In the present study we characterized the adhesive properties of two classical intracellular enzymes glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and enolase (ENO) isolated from the outer cell surface of the probiotic bacterium Lactobacillus plantarum 299v. None of the genes encoded signal peptides or cell surface anchoring motifs that could explain their extracellular location on the bacterial surface. The presence of the glycolytic enzymes on the outer surface was verified by western blotting using polyclonal antibodies raised against the specific enzymes. GAPDH and ENO showed a highly specific binding to plasminogen and fibronectin whereas GAPDH but not ENO showed weak binding to mucin. Furthermore, a pH dependent and specific binding of GAPDH and ENO to intestinal epithelial Caco-2 cells at pH 5 but not at pH 7 was demonstrated. The results showed that these glycolytic enzymes could play a role in the adhesion of the probiotic bacterium L. plantarum 299v to the gastrointestinal tract of the host. Finally, a number of probiotic as well non-probiotic Lactobacillus strains were analyzed for the presence of GAPDH and ENO on the outer surface, but no correlation between the extracellular location of these enzymes and the probiotic status of the applied strains was demonstrated. Copyright © 2013 Elsevier GmbH. All rights reserved.

  19. Mef2d is essential for the maturation and integrity of retinal photoreceptor and bipolar cells.

    PubMed

    Omori, Yoshihiro; Kitamura, Tamiki; Yoshida, Satoyo; Kuwahara, Ryusuke; Chaya, Taro; Irie, Shoichi; Furukawa, Takahisa

    2015-05-01

    Mef2 transcription factors play a crucial role in cardiac and skeletal muscle differentiation. We found that Mef2d is highly expressed in the mouse retina and its loss causes photoreceptor degeneration similar to that observed in human retinitis pigmentosa patients. Electroretinograms (ERGs) were severely impaired in Mef2d-/- mice. Immunohistochemistry showed that photoreceptor and bipolar cell synapse protein levels severely decreased in the Mef2d-/- retina. Expression profiling by microarray analysis showed that Mef2d is required for the expression of various genes in photoreceptor and bipolar cells, including cone arrestin, Guca1b, Pde6h and Cacna1s, which encode outer segment and synapse proteins. We also observed that Mef2d synergistically activates the cone arrestin (Arr3) promoter with Crx, suggesting that functional cooperation between Mef2d and Crx is important for photoreceptor cell gene regulation. Taken together, our results show that Mef2d is essential for photoreceptor and bipolar cell gene expression, either independently or cooperatively with Crx. © 2015 Institution for Protein Research. Genes to Cells published by Wiley Publishing Asia Pty Ltd and the Molecular Biology Society of Japan.

  20. Characterization of regulatory pathways in Xylella fastidiosa: genes and phenotypes controlled by gacA.

    PubMed

    Shi, Xiang Yang; Dumenyo, C Korsi; Hernandez-Martinez, Rufina; Azad, Hamid; Cooksey, Donald A

    2009-04-01

    The xylem-limited, insect-transmitted bacterium Xylella fastidiosa causes Pierce's disease in grapes through cell aggregation and vascular clogging. GacA controls various physiological processes and pathogenicity factors in many gram-negative bacteria, including biofilm formation in Pseudomonas syringae pv. tomato DC3000. Cloned gacA of X. fastidiosa was found to restore the hypersensitive response and pathogenicity in gacA mutants of P. syringae pv. tomato DC3000 and Erwinia amylovora. A gacA mutant of X. fastidiosa (DAC1984) had significantly reduced abilities to adhere to a glass surface, form biofilm, and incite disease symptoms on grapevines, compared with the parent (A05). cDNA microarray analysis identified 7 genes that were positively regulated by GacA, including xadA and hsf, predicted to encode outer membrane adhesion proteins, and 20 negatively regulated genes, including gumC and an antibacterial polypeptide toxin gene, cvaC. These results suggest that GacA of X. fastidiosa regulates many factors, which contribute to attachment and biofilm formation, as well as some physiological processes that may enhance the adaptation and tolerance of X. fastidiosa to environmental stresses and the competition within the host xylem.

  1. Functional genomics to discover antibiotic resistance genes: The paradigm of resistance to colistin mediated by ethanolamine phosphotransferase in Shewanella algae MARS 14.

    PubMed

    Telke, Amar A; Rolain, Jean-Marc

    2015-12-01

    Shewanella algae MARS 14 is a colistin-resistant clinical isolate retrieved from bronchoalveolar lavage of a hospitalised patient. A functional genomics strategy was employed to discover the molecular support for colistin resistance in S. algae MARS 14. A pZE21 MCS-1 plasmid-based genomic expression library was constructed in Escherichia coli TOP10. The estimated library size was 1.30×10(8) bp. Functional screening of colistin-resistant clones was carried out on Luria-Bertani agar containing 8 mg/L colistin. Five colistin-resistant clones were obtained after complete screening of the genomic expression library. Analysis of DNA sequencing results found a unique gene in all selected clones. Amino acid sequence analysis of this unique gene using the Integrated Microbial Genomes (IMG) and KEGG databases revealed that this gene encodes ethanolamine phosphotransferase (EptA, or so-called PmrC). Reverse transcription PCR analysis indicated that resistance to colistin in S. algae MARS 14 was associated with overexpression of EptA (27-fold increase), which plays a crucial role in the arrangement of outer membrane lipopolysaccharide. Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  2. Solid lipid nanoparticle-based vectors intended for the treatment of X-linked juvenile retinoschisis by gene therapy: In vivo approaches in Rs1h-deficient mouse model.

    PubMed

    Apaolaza, P S; Del Pozo-Rodríguez, A; Torrecilla, J; Rodríguez-Gascón, A; Rodríguez, J M; Friedrich, U; Weber, B H F; Solinís, M A

    2015-11-10

    X-linked juvenile retinoschisis (XLRS), which results from mutations in the gene RS1 that encodes the protein retinoschisin, is a retinal degenerative disease affecting between 1/5000 and 1/25,000 people worldwide. Currently, there is no cure for this disease and the treatment is based on the application of low-vision aids. The aim of the present work was the in vitro and in vivo evaluation of two different non-viral vectors based on solid lipid nanoparticles (SLNs), protamine and two anionic polysaccharides, hyaluronic acid (HA) or dextran (DX), for the treatment of XLRS. First, the vectors containing a plasmid which encodes both the reporter green fluorescent protein (GFP) and the therapeutic protein retinoschisin, under the control of CMV promoters, were characterized in vitro. Then, the vectors were subretinally or intravitreally administrated to C57BL/6 wild type mice. One week later, GFP was detected in all treated mice and in all retinal layers except in the Outer Nuclear Layer (ONL) and the Inner Nuclear Layer (INL), regardless of the administration route and the vector employed. Finally, two weeks after subretinal or intravitreal injection to Rs1h-deficient mice, GFP and retinoschisin expression was detected in all retinal layers, except in the ONL, which was maintained for at least two months after subretinal administration. The structural analysis of the treated Rs1h-deficient eyes showed a partial recovery of the retina related to the production of retinoschisin. This work shows for the first time a successful RS1 gene transfer to Rs1h-deficient animals using non-viral nanocarriers, with promising results that point to non-viral gene therapy as a feasible future therapeutic tool for retinal disorders.

  3. Adaptive mutations and replacements of virulence traits in the Escherichia coli O104:H4 outbreak population.

    PubMed

    Guy, Lionel; Jernberg, Cecilia; Arvén Norling, Jenny; Ivarsson, Sofie; Hedenström, Ingela; Melefors, Öjar; Liljedahl, Ulrika; Engstrand, Lars; Andersson, Siv G E

    2013-01-01

    The sequencing of highly virulent Escherichia coli O104:H4 strains isolated during the outbreak of bloody diarrhea and hemolytic uremic syndrome in Europe in 2011 revealed a genome that contained a Shiga toxin encoding prophage and a plasmid encoding enteroaggregative fimbriae. Here, we present the draft genome sequence of a strain isolated in Sweden from a patient who had travelled to Tunisia in 2010 (E112/10) and was found to differ from the outbreak strains by only 38 SNPs in non-repetitive regions, 16 of which were mapped to the branch to the outbreak strain. We identified putatively adaptive mutations in genes for transporters, outer surface proteins and enzymes involved in the metabolism of carbohydrates. A comparative analysis with other historical strains showed that E112/10 contained Shiga toxin prophage genes of the same genotype as the outbreak strain, while these genes have been replaced by a different genotype in two otherwise very closely related strains isolated in the Republic of Georgia in 2009. We also present the genome sequences of two enteroaggregative E. coli strains affiliated with phylogroup A (C43/90 and C48/93) that contain the agg genes for the AAF/I-type fimbriae characteristic of the outbreak population. Interestingly, C43/90 also contained a tet/mer antibiotic resistance island that was nearly identical in sequence to that of the outbreak strain, while the corresponding island in the Georgian strains was most similar to E. coli strains of other serotypes. We conclude that the pan-genome of the outbreak population is shared with strains of the A phylogroup and that its evolutionary history is littered with gene replacement events, including most recently independent acquisitions of antibiotic resistance genes in the outbreak strains and its nearest neighbors. The results are summarized in a refined evolutionary model for the emergence of the O104:H4 outbreak population.

  4. Adaptive Mutations and Replacements of Virulence Traits in the Escherichia coli O104:H4 Outbreak Population

    PubMed Central

    Guy, Lionel; Jernberg, Cecilia; Arvén Norling, Jenny; Ivarsson, Sofie; Hedenström, Ingela; Melefors, Öjar; Liljedahl, Ulrika; Engstrand, Lars; Andersson, Siv G. E.

    2013-01-01

    The sequencing of highly virulent Escherichia coli O104:H4 strains isolated during the outbreak of bloody diarrhea and hemolytic uremic syndrome in Europe in 2011 revealed a genome that contained a Shiga toxin encoding prophage and a plasmid encoding enteroaggregative fimbriae. Here, we present the draft genome sequence of a strain isolated in Sweden from a patient who had travelled to Tunisia in 2010 (E112/10) and was found to differ from the outbreak strains by only 38 SNPs in non-repetitive regions, 16 of which were mapped to the branch to the outbreak strain. We identified putatively adaptive mutations in genes for transporters, outer surface proteins and enzymes involved in the metabolism of carbohydrates. A comparative analysis with other historical strains showed that E112/10 contained Shiga toxin prophage genes of the same genotype as the outbreak strain, while these genes have been replaced by a different genotype in two otherwise very closely related strains isolated in the Republic of Georgia in 2009. We also present the genome sequences of two enteroaggregative E. coli strains affiliated with phylogroup A (C43/90 and C48/93) that contain the agg genes for the AAF/I-type fimbriae characteristic of the outbreak population. Interestingly, C43/90 also contained a tet/mer antibiotic resistance island that was nearly identical in sequence to that of the outbreak strain, while the corresponding island in the Georgian strains was most similar to E. coli strains of other serotypes. We conclude that the pan-genome of the outbreak population is shared with strains of the A phylogroup and that its evolutionary history is littered with gene replacement events, including most recently independent acquisitions of antibiotic resistance genes in the outbreak strains and its nearest neighbors. The results are summarized in a refined evolutionary model for the emergence of the O104:H4 outbreak population. PMID:23675451

  5. Involvement of two glycoside hydrolase family 19 members in colony morphotype and virulence in Flavobacterium columnare

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaolin; Li, Nan; Qin, Ting; Huang, Bei; Nie, Pin

    2017-11-01

    Flavobacterium columnare is the pathogenic agent of columnaris disease in aquaculture. Using a recently developed gene deletion strategy, two genes that encode the Glyco_hydro_19 domain (GH19 domain) containing proteins, ghd-1 and ghd-2, were deleted separately and together from the F. columnare G4 wild type strain. Surprisingly, the single-, Δ ghd-1 and Δ ghd-2, and double-gene mutants, Δ ghd-1 Δghd -2, all had rhizoid and non-rhizoid colony morphotypes, which we named Δ ghd-1, Δ ghd-2, Δ ghd-1 Δ ghd-2, and NΔ ghd-1, NΔ ghd-2, and NΔ ghd-1 Δ ghd-2. However, chitin utilization was not detected in either these mutants or in the wild type. Instead, skimmed milk degradation was observed for the mutants and the wild type; the non-rhizoid strain NΔ ghd-2 exhibited higher degradation activity as revealed by the larger transparent circle on the skimmed milk plate. Using zebrafish as the model organism, we found that non-rhizoid mutants had higher LD50 values and were less virulent because zebrafish infected with these survived longer. Transcriptome analysis between the non-rhizoid and rhizoid colony morphotypes of each mutant, i.e., NΔ ghd -1 versus (vs) Δ ghd-1, NΔ ghd-2 vs Δ ghd-2, and NΔ ghd-1 Δ ghd-2 vs Δ ghd-1 Δ ghd-2, revealed a large number of differentially expressed genes, among which 39 genes were common in three of the pairs compared. Although most of these genes encode hypothetical proteins, a few molecules such as phage tail protein, rhs element Vgr protein, thiol-activated cytolysin, and TonB-dependent outer membrane receptor precursor, expression of which was down-regulated in non-rhizoid mutants but up-regulated in rhizoid mutants, may play a role F. columnare virulence.

  6. Identification of opsA, a Gene Involved in Solute Stress Mitigation and Survival in Soil, in the Polycyclic Aromatic Hydrocarbon-Degrading Bacterium Novosphingobium sp. Strain LH128

    PubMed Central

    Fida, Tekle Tafese; Breugelmans, Philip; Lavigne, Rob; van der Meer, Jan Roelof; De Mot, René; Vaysse, Pierre-Joseph

    2014-01-01

    The aim of this study was to identify genes involved in solute and matric stress mitigation in the polycyclic aromatic hydrocarbon (PAH)-degrading Novosphingobium sp. strain LH128. The genes were identified using plasposon mutagenesis and by selection of mutants that showed impaired growth in a medium containing 450 mM NaCl as a solute stress or 10% (wt/vol) polyethylene glycol (PEG) 6000 as a matric stress. Eleven and 14 mutants showed growth impairment when exposed to solute and matric stresses, respectively. The disrupted sequences were mapped on a draft genome sequence of strain LH128, and the corresponding gene functions were predicted. None of them were shared between solute and matric stress-impacted mutants. One NaCl-affected mutant (i.e., NA7E1) with a disruption in a gene encoding a putative outer membrane protein (OpsA) was susceptible to lower NaCl concentrations than the other mutants. The growth of NA7E1 was impacted by other ions and nonionic solutes and by sodium dodecyl sulfate (SDS), suggesting that opsA is involved in osmotic stress mitigation and/or outer membrane stability in strain LH128. NA7E1 was also the only mutant that showed reduced growth and less-efficient phenanthrene degradation in soil compared to the wild type. Moreover, the survival of NA7E1 in soil decreased significantly when the moisture content was decreased but was unaffected when soluble solutes from sandy soil were removed by washing. opsA appears to be important for the survival of strain LH128 in soil, especially in the case of reduced moisture content, probably by mitigating the effects of solute stress and retaining membrane stability. PMID:24657861

  7. The Arabidopsis SOS5 Locus Encodes a Putative Cell Surface Adhesion Protein and Is Required for Normal Cell Expansion

    PubMed Central

    Shi, Huazhong; Kim, YongSig; Guo, Yan; Stevenson, Becky; Zhu, Jian-Kang

    2003-01-01

    Cell surface proteoglycans have been implicated in many aspects of plant growth and development, but genetic evidence supporting their function has been lacking. Here, we report that the Salt Overly Sensitive5 (SOS5) gene encodes a putative cell surface adhesion protein and is required for normal cell expansion. The sos5 mutant was isolated in a screen for Arabidopsis salt-hypersensitive mutants. Under salt stress, the root tips of sos5 mutant plants swell and root growth is arrested. The root-swelling phenotype is caused by abnormal expansion of epidermal, cortical, and endodermal cells. The SOS5 gene was isolated through map-based cloning. The predicted SOS5 protein contains an N-terminal signal sequence for plasma membrane localization, two arabinogalactan protein–like domains, two fasciclin-like domains, and a C-terminal glycosylphosphatidylinositol lipid anchor signal sequence. The presence of fasciclin-like domains, which typically are found in animal cell adhesion proteins, suggests a role for SOS5 in cell-to-cell adhesion in plants. The SOS5 protein was present at the outer surface of the plasma membrane. The cell walls are thinner in the sos5 mutant, and those between neighboring epidermal and cortical cells in sos5 roots appear less organized. SOS5 is expressed ubiquitously in all plant organs and tissues, including guard cells in the leaf. PMID:12509519

  8. Primary ciliary dyskinesia caused by homozygous mutation in DNAL1, encoding dynein light chain 1.

    PubMed

    Mazor, Masha; Alkrinawi, Soliman; Chalifa-Caspi, Vered; Manor, Esther; Sheffield, Val C; Aviram, Micha; Parvari, Ruti

    2011-05-13

    In primary ciliary dyskinesia (PCD), genetic defects affecting motility of cilia and flagella cause chronic destructive airway disease, randomization of left-right body asymmetry, and, frequently, male infertility. The most frequent defects involve outer and inner dynein arms (ODAs and IDAs) that are large multiprotein complexes responsible for cilia-beat generation and regulation, respectively. Although it has long been suspected that mutations in DNAL1 encoding the ODA light chain1 might cause PCD such mutations were not found. We demonstrate here that a homozygous point mutation in this gene is associated with PCD with absent or markedly shortened ODA. The mutation (NM_031427.3: c.449A>G; p.Asn150Ser) changes the Asn at position150, which is critical for the proper tight turn between the β strand and the α helix of the leucine-rich repeat in the hydrophobic face that connects to the dynein heavy chain. The mutation reduces the stability of the axonemal dynein light chain 1 and damages its interactions with dynein heavy chain and with tubulin. This study adds another important component to understanding the types of mutations that cause PCD and provides clinical information regarding a specific mutation in a gene not yet known to be associated with PCD. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  9. Organization of K88ac-encoded polypeptides in the Escherichia coli cell envelope: use of minicells and outer membrane protein mutants for studying assembly of pili.

    PubMed

    Dougan, G; Dowd, G; Kehoe, M

    1983-01-01

    Escherichia coli K-12 minicells, harboring recombinant plasmids encoding polypeptides involved in the expression of K88ac adhesion pili on the bacterial cell surface, were labeled with [35S]methionine and fractionated by a variety of techniques. A 70,000-dalton polypeptide, the product of the K88ac adhesion cistron adhA, was primarily located in the outer membrane of minicells, although it was less clearly associated with this membrane than the classical outer membrane proteins OmpA and matrix protein. Two polypeptides of molecular weights 26,000 and 17,000 (the products of adhB and adhC, respectively) were located in significant amounts in the periplasmic space. The 29,000-dalton polypeptide was shown to be processed in E. coli minicells. The 23.500-dalton K88ac pilus subunit (the product of adhD) was detected in both inner and outer membrane fractions. E. coli mutants defective in the synthesis of murein lipoprotein or the major outer membrane polypeptide OmpA were found to express normal amounts of K88ac antigen on the cell surface, whereas expression of the K88ac antigen was greatly reduced in perA mutants. The possible functions of the adh cistron products are discussed.

  10. The biochemical properties of the Francisella pathogenicity island (FPI)-encoded proteins IglA, IglB, IglC, PdpB and DotU suggest roles in type VI secretion

    PubMed Central

    de Bruin, Olle M.; Duplantis, Barry N.; Ludu, Jagjit S.; Hare, Rebekah F.; Nix, Eli B.; Schmerk, Crystal L.; Robb, Craig S.; Boraston, Alisdair B.; Hueffer, Karsten

    2011-01-01

    The Francisella pathogenicity island (FPI) encodes proteins thought to compose a type VI secretion system (T6SS) that is required for the intracellular growth of Francisella novicida. In this work we used deletion mutagenesis and genetic complementation to determine that the intracellular growth of F. novicida was dependent on 14 of the 18 genes in the FPI. The products of the iglABCD operon were localized by the biochemical fractionation of F. novicida, and Francisella tularensis LVS. Sucrose gradient separation of water-insoluble material showed that the FPI-encoded proteins IglA, IglB and IglC were found in multiple fractions, especially in a fraction that did not correspond to a known membrane fraction. We interpreted these data to suggest that IglA, IglB and IglC are part of a macromolecular structure. Analysis of published structural data suggested that IglC is an analogue of Hcp, which is thought to form long nano-tubes. Thus the fractionation properties of IglA, IglB and IglC are consistent with the current model of the T6SS apparatus, which supposes that IglA and IglB homologues form an outer tube structure that surrounds an inner tube composed of Hcp (IglC) subunits. Fractionation of F. novicida expressing FLAG-tagged DotU (IcmH homologue) and PdpB (IcmF homologue) showed that these proteins localize to the inner membrane. Deletion of dotU led to the cleavage of PdpB, suggesting an interaction of these two proteins that is consistent with results obtained with other T6SSs. Our results may provide a mechanistic basis for many of the studies that have examined the virulence properties of Francisella mutants in FPI genes, namely that the observed phenotypes of the mutants are the result of the disruption of the FPI-encoded T6SS structure. PMID:21980115

  11. Metatranscriptome Analysis of Fig Flowers Provides Insights into Potential Mechanisms for Mutualism Stability and Gall Induction.

    PubMed

    Martinson, Ellen O; Hackett, Jeremiah D; Machado, Carlos A; Arnold, A Elizabeth

    2015-01-01

    A striking property of the mutualism between figs and their pollinating wasps is that wasps consistently oviposit in the inner flowers of the fig syconium, which develop into galls that house developing larvae. Wasps typically do not use the outer ring of flowers, which develop into seeds. To better understand differences between gall and seed flowers, we used a metatranscriptomic approach to analyze eukaryotic gene expression within fig flowers at the time of oviposition choice and early gall development. Consistent with the unbeatable seed hypothesis, we found significant differences in gene expression between gall- and seed flowers in receptive syconia prior to oviposition. In particular, transcripts assigned to flavonoids and carbohydrate metabolism were significantly up-regulated in gall flowers relative to seed flowers. In response to oviposition, gall flowers significantly up-regulated the expression of chalcone synthase, which previously has been connected to gall formation in other plants. We propose several genes encoding proteins with signal peptides or associations with venom of other Hymenoptera as candidate genes for gall initiation or growth. This study simultaneously evaluates the gene expression profile of both mutualistic partners in a plant-insect mutualism and provides insight into a possible stability mechanism in the ancient fig-fig wasp association.

  12. Metatranscriptome Analysis of Fig Flowers Provides Insights into Potential Mechanisms for Mutualism Stability and Gall Induction

    PubMed Central

    Martinson, Ellen O.; Hackett, Jeremiah D.; Machado, Carlos A.; Arnold, A. Elizabeth

    2015-01-01

    A striking property of the mutualism between figs and their pollinating wasps is that wasps consistently oviposit in the inner flowers of the fig syconium, which develop into galls that house developing larvae. Wasps typically do not use the outer ring of flowers, which develop into seeds. To better understand differences between gall and seed flowers, we used a metatranscriptomic approach to analyze eukaryotic gene expression within fig flowers at the time of oviposition choice and early gall development. Consistent with the unbeatable seed hypothesis, we found significant differences in gene expression between gall- and seed flowers in receptive syconia prior to oviposition. In particular, transcripts assigned to flavonoids and carbohydrate metabolism were significantly up-regulated in gall flowers relative to seed flowers. In response to oviposition, gall flowers significantly up-regulated the expression of chalcone synthase, which previously has been connected to gall formation in other plants. We propose several genes encoding proteins with signal peptides or associations with venom of other Hymenoptera as candidate genes for gall initiation or growth. This study simultaneously evaluates the gene expression profile of both mutualistic partners in a plant-insect mutualism and provides insight into a possible stability mechanism in the ancient fig-fig wasp association. PMID:26090817

  13. ACCUMULATION OF PHOTOSYSTEM ONE1, a Member of a Novel Gene Family, Is Required for Accumulation of [4Fe-4S] Cluster–Containing Chloroplast Complexes and Antenna Proteins

    PubMed Central

    Amann, Katrin; Lezhneva, Lina; Wanner, Gerd; Herrmann, Reinhold G.; Meurer, Jörg

    2004-01-01

    To investigate the nuclear-controlled mechanisms of [4Fe-4S] cluster assembly in chloroplasts, we selected Arabidopsis thaliana mutants with a decreased content of photosystem I (PSI) containing three [4Fe-4S] clusters. One identified gene, ACCUMULATION OF PHOTOSYSTEM ONE1 (APO1), belongs to a previously unknown gene family with four defined groups (APO1 to APO4) only found in nuclear genomes of vascular plants. All homologs contain two related motifs of ∼100 amino acid residues that could potentially provide ligands for [4Fe-4S] clusters. APO1 is essentially required for photoautotrophic growth, and levels of PSI core subunits are below the limit of detection in the apo1 mutant. Unlike other Arabidopsis PSI mutants, apo1 fails to accumulate significant amounts of the outer antenna subunits of PSI and PSII and to form grana stacks. In particular, APO1 is essentially required for stable accumulation of other plastid-encoded and nuclear-encoded [4Fe-4S] cluster complexes within the chloroplast, whereas [2Fe-2S] cluster–containing complexes appear to be unaffected. In vivo labeling experiments and analyses of polysome association suggest that translational elongation of the PSI transcripts psaA and psaB is specifically arrested in the mutant. Taken together, our findings suggest that APO1 is involved in the stable assembly of several [4Fe-4S] cluster–containing complexes of chloroplasts and interferes with translational events probably in association with plastid nucleoids. PMID:15494558

  14. Genomic insights into the iron uptake mechanisms of the biomining microorganism Acidithiobacillus ferrooxidans.

    PubMed

    Quatrini, Raquel; Jedlicki, Eugenia; Holmes, David S

    2005-12-01

    Commercial bioleaching of copper and the biooxidation of gold is a cost-effective and environmentally friendly process for metal recovery. A partial genome sequence of the acidophilic, bioleaching bacterium Acidithiobacillus ferrooxidans is available from two public sources. This information has been used to build preliminary models that describe how this microorganism confronts unusually high iron loads in the extremely acidic conditions (pH 2) found in natural environments and in bioleaching operations. A. ferrooxidans contains candidate genes for iron uptake, sensing, storage, and regulation of iron homeostasis. Predicted proteins exhibit significant amino acid similarity with known proteins from neutrophilic organisms, including conservation of functional motifs, permitting their identification by bioinformatics tools and allowing the recognition of common themes in iron transport across distantly related species. However, significant differences in amino acid sequence were detected in pertinent domains that suggest ways in which the periplasmic and outer membrane proteins of A. ferrooxidans maintain structural integrity and relevant protein-protein contacts at low pH. Unexpectedly, the microorganism also contains candidate genes, organized in operon-like structures that potentially encode at least 11 siderophore systems for the uptake of Fe(III), although it does not exhibit genes that could encode the biosynthesis of the siderophores themselves. The presence of multiple Fe(III) uptake systems suggests that A. ferrooxidans can inhabit aerobic environments where iron is scarce and where siderophore producers are present. It may also help to explain why it cannot tolerate high Fe(III) concentrations in bioleaching operations where it is out-competed by Leptospirillum species.

  15. Pseudomonas aeruginosa uses a cyclic-di-GMP-regulated adhesin to reinforce the biofilm extracellular matrix

    PubMed Central

    Borlee, Bradley R; Goldman, Aaron D; Murakami, Keiji; Samudrala, Ram; Wozniak, Daniel J; Parsek, Matthew R

    2010-01-01

    Pseudomonas aeruginosa, the principal pathogen of cystic fibrosis patients, forms antibiotic-resistant biofilms promoting chronic colonization of the airways. The extracellular (EPS) matrix is a crucial component of biofilms that provides the community multiple benefits. Recent work suggests that the secondary messenger, cyclic-di-GMP, promotes biofilm formation. An analysis of factors specifically expressed in P. aeruginosa under conditions of elevated c-di-GMP, revealed functions involved in the production and maintenance of the biofilm extracellular matrix. We have characterized one of these components, encoded by the PA4625 gene, as a putative adhesin and designated it cdrA. CdrA shares structural similarities to extracellular adhesins that belong to two-partner secretion systems. The cdrA gene is in a two gene operon that also encodes a putative outer membrane transporter, CdrB. The cdrA gene encodes a 220 KDa protein that is predicted to be rod-shaped protein harbouring a β-helix structural motif. Western analysis indicates that the CdrA is produced as a 220 kDa proprotein and processed to 150 kDa before secretion into the extracellular medium. We demonstrated that cdrAB expression is minimal in liquid culture, but is elevated in biofilm cultures. CdrAB expression was found to promote biofilm formation and auto-aggregation in liquid culture. Aggregation mediated by CdrA is dependent on the Psl polysaccharide and can be disrupted by adding mannose, a key structural component of Psl. Immunoprecipitation of Psl present in culture supernatants resulted in co-immunoprecipitation of CdrA, providing additional evidence that CdrA directly binds to Psl. A mutation in cdrA caused a decrease in biofilm biomass and resulted in the formation of biofilms exhibiting decreased structural integrity. Psl-specific lectin staining suggests that CdrA either cross-links Psl polysaccharide polymers and/or tethers Psl to the cells, resulting in increased biofilm structural stability. Thus, this study identifies a key protein structural component of the P. aeruginosa EPS matrix. PMID:20088866

  16. Identification of antigenic regions on VP2 of African horsesickness virus serotype 3 by using phage-displayed epitope libraries.

    PubMed

    Bentley, L; Fehrsen, J; Jordaan, F; Huismans, H; du Plessis, D H

    2000-04-01

    VP2 is an outer capsid protein of African horsesickness virus (AHSV) and is recognized by serotype-discriminatory neutralizing antibodies. With the objective of locating its antigenic regions, a filamentous phage library was constructed that displayed peptides derived from the fragmentation of a cDNA copy of the gene encoding VP2. Peptides ranging in size from approximately 30 to 100 amino acids were fused with pIII, the attachment protein of the display vector, fUSE2. To ensure maximum diversity, the final library consisted of three sub-libraries. The first utilized enzymatically fragmented DNA encoding only the VP2 gene, the second included plasmid sequences, while the third included a PCR step designed to allow different peptide-encoding sequences to recombine before ligation into the vector. The resulting composite library was subjected to immunoaffinity selection with AHSV-specific polyclonal chicken IgY, polyclonal horse immunoglobulins and a monoclonal antibody (MAb) known to neutralize AHSV. Antigenic peptides were located by sequencing the DNA of phages bound by the antibodies. Most antigenic determinants capable of being mapped by this method were located in the N-terminal half of VP2. Important binding areas were mapped with high resolution by identifying the minimum overlapping areas of the selected peptides. The MAb was also used to screen a random 17-mer epitope library. Sequences that may be part of a discontinuous neutralization epitope were identified. The amino acid sequences of the antigenic regions on VP2 of serotype 3 were compared with corresponding regions on three other serotypes, revealing regions with the potential to discriminate AHSV serotypes serologically.

  17. Mollusk genes encoding lysine tRNA (UUU) contain introns.

    PubMed

    Matsuo, M; Abe, Y; Saruta, Y; Okada, N

    1995-11-20

    New intron-containing genes encoding tRNAs were discovered when genomic DNA isolated from various animal species was amplified by the polymerase chain reaction (PCR) with primers based on sequences of rabbit tRNA(Lys). From sequencing analysis of the products of PCR, we found that introns are present in several genes encoding tRNA(Lys) in mollusks, such as Loligo bleekeri (squid) and Octopus vulgaris (octopus). These introns were specific to genes encoding tRNA(Lys)(CUU) and were not present in genes encoding tRNA(Lys)(CUU). In addition, the sequences of the introns were different from one another. To confirm the results of our initial experiments, we isolated and sequenced genes encoding tRNA(Lys)(CUU) and tRNA(Lys)(UUU). The gene for tRNA(Lys)(UUU) from squid contained an intron, whose sequence was the same as that identified by PCR, and the gene formed a cluster with a corresponding pseudogene. Several DNA regions of 2.1 kb containing this cluster appeared to be tandemly arrayed in the squid genome. By contrast, the gene encoding tRNA(Lys)(CUU) did not contain an intron, as shown also by PCR. The tRNA(Lys)(UUU) that corresponded to the analyzed gene was isolated and characterized. The present study provides the first example of an intron-containing gene encoding a tRNA in mollusks and suggests the universality of introns in such genes in higher eukaryotes.

  18. The toxR Gene of Vibrio (Listonella) anguillarum Controls Expression of the Major Outer Membrane Proteins but Not Virulence in a Natural Host Model

    PubMed Central

    Okuda, Jun; Nakai, Toshihiro; Chang, Park Se; Oh, Takanori; Nishino, Takeshi; Koitabashi, Tsutomu; Nishibuchi, Mitsuaki

    2001-01-01

    To examine the hypothesis that the ancestral role of the toxR gene in the family Vibrionaceae is control of the expression of outer membrane protein (OMP)-encoding genes for adaptation to environmental change, we investigated the role of the toxR gene in Vibrio anguillarum, an important fish pathogen. The toxR gene of V. angullarum (Va-toxR) was cloned from strain PT-87050 isolated from diseased ayu (Plecoglossus altivelis), and the sequence was analyzed. The toxR sequence was 63 to 51% identical to those reported for other species of the family Vibrionaceae. Distribution of the Va-toxR gene sequence in V. anguillarum strains of various serotypes was confirmed by using DNA probe and PCR methods. An isogenic toxR mutant of V. anguillarum PT-24, isolated from diseased ayu, was constructed by using an allelic exchange method. The wild-type strain and the toxR mutant did not differ in the ability to produce a protease(s) and a hemolysin(s) or in pathogenicity for ayu when examined by the intramuscular injection and immersion methods. A 35-kDa major OMP was not produced by the toxR mutant. However, a 46-kDa OMP was hardly detected in the wild-type strain but was produced as the major OMP by the toxR mutant. For the toxR mutant, the MICs of two β-lactam antibiotics were higher and the minimum bactericidal concentration of sodium dodecyl sulfate was lower than for the wild-type strain. Analysis of the N-terminal amino acid sequences of the 35- and 46-kDa OMPs indicated that these proteins are the porin-like OMPs and are related to the toxR-regulated major OMPs of the family Vibrionaceae. The results indicate that the toxR gene is not involved in virulence expression in V. anguillarum PT-24 and that toxR regulation of major OMPs is universal in the family Vibrionaceae. These results support the hypothesis that the ancestral role of the toxR gene is regulation of OMP gene expression and that only in some Vibrio species has ToxR been appropriated for the regulation of a virulence gene(s). PMID:11553547

  19. Human AZU-1 gene, variants thereof and expressed gene products

    DOEpatents

    Chen, Huei-Mei; Bissell, Mina

    2004-06-22

    A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

  20. Suppression of the lethal effect of acidic-phospholipid deficiency by defective formation of the major outer membrane lipoprotein in Escherichia coli.

    PubMed Central

    Asai, Y; Katayose, Y; Hikita, C; Ohta, A; Shibuya, I

    1989-01-01

    The Escherichia coli pgsA3 allele encoding a defective phosphatidylglycerophosphate synthase is lethal for all but certain strains. Genetic analysis of such strains has revealed that the lethal effect is fully suppressed by the lack of the major outer membrane lipoprotein that consumes phosphatidylglycerol for its maturation. Images PMID:2556377

  1. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    PubMed Central

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  2. Gene cloning and prokaryotic expression of recombinant outer membrane protein from Vibrio parahaemolyticus

    NASA Astrophysics Data System (ADS)

    Yuan, Ye; Wang, Xiuli; Guo, Sheping; Qiu, Xuemei

    2011-06-01

    Gram-negative Vibrio parahaemolyticus is a common pathogen in humans and marine animals. The outer membrane protein of bacteria plays an important role in the infection and pathogenicity to the host. Thus, the outer membrane proteins are an ideal target for vaccines. We amplified a complete outer membrane protein gene (ompW) from V. parahaemolyticus ATCC 17802. We then cloned and expressed the gene into Escherichia coli BL21 (DE3) cells. The gene coded for a protein that was 42.78 kDa. We purified the protein using Ni-NTA affinity chromatography and Anti-His antibody Western blotting, respectively. Our results provide a basis for future application of the OmpW protein as a vaccine candidate against infection by V. parahaemolyticus. In addition, the purified OmpW protein can be used for further functional and structural studies.

  3. New Insights into the Formation of Viable but Nonculturable Escherichia coli O157:H7 Induced by High-Pressure CO2

    PubMed Central

    Zhao, Feng; Wang, Yongtao; An, Haoran; Hu, Xiaosong

    2016-01-01

    ABSTRACT The formation of viable but nonculturable (VBNC) Escherichia coli O157:H7 induced by high-pressure CO2 (HPCD) was investigated using RNA sequencing (RNA-Seq) transcriptomics and isobaric tag for relative and absolute quantitation (iTRAQ) proteomic methods. The analyses revealed that 97 genes and 56 proteins were significantly changed upon VBNC state entry. Genes and proteins related to membrane transport, central metabolisms, DNA replication, and cell division were mainly downregulated in the VBNC cells. This caused low metabolic activity concurrently with a division arrest in cells, which may be related to VBNC state formation. Cell division repression and outer membrane overexpression were confirmed to be involved in VBNC state formation by homologous expression of z2046 coding for transcriptional repressor and ompF encoding outer membrane protein F. Upon VBNC state entry, pyruvate catabolism in the cells shifted from the tricarboxylic acid (TCA) cycle toward the fermentative route; this led to a low level of ATP. Combating the low energy supply, ATP production in the VBNC cells was compensated by the degradation of l-serine and l-threonine, the increased AMP generation, and the enhanced electron transfer. Furthermore, tolerance of the cells with respect to HPCD-induced acid, oxidation, and high CO2 stresses was enhanced by promoting the production of ammonia and NADPH and by reducing CO2 production during VBNC state formation. Most genes and proteins related to pathogenicity were downregulated in the VBNC cells. This would decrease the cell pathogenicity, which was confirmed by adhesion assays. In conclusion, the decreased metabolic activity, repressed cell division, and enhanced survival ability in E. coli O157:H7 might cause HPCD-induced VBNC state formation. PMID:27578754

  4. Cloning and expression of 3-deoxy-d-manno-oct-2-ulosonic acid α-ketoside hydrolase from oyster hepatopancreas†

    PubMed Central

    Nakagawa, Tetsuto; Shimada, Yoshimi; Pavlova, Nadejda V; Li, Su-Chen; Li, Yu-Teh

    2015-01-01

    We have previously reported that oyster hepatopancreas contained three unusual α-ketoside hydrolases: (i) a 3-deoxy-d-manno-oct-2-ulosonic acid α-ketoside hydrolase (α-Kdo-ase), (ii) a 3-deoxy-d-glycero-d-galacto-non-2-ulosonic acid α-ketoside hydrolase and (iii) a bifunctional ketoside hydrolase capable of cleaving both the α-ketosides of Kdn and Neu5Ac (Kdn-sialidase). After completing the purification of Kdn-sialidase, we proceeded to clone the gene encoding this enzyme. Unexpectedly, we found that instead of expressing Kdn-sialidase, our cloned gene expressed α-Kdo-ase activity. The full-length gene, consisting of 1176-bp (392 amino acids, Mr 44,604), expressed an active recombinant α-Kdo-ase (R-α-Kdo-ase) in yeast and CHO-S cells, but not in various Escherichia coli strains. The deduced amino acid sequence contains two Asp boxes (S277PDDGKTW and S328TDQGKTW) commonly found in sialidases, but is devoid of the signature FRIP-motif of sialidase. The R-α-Kdo-ase effectively hydrolyzed the Kdo in the core-oligosaccharide of the structurally defined lipopolysaccharide (LPS), Re-LPS (Kdo2-Lipid A) from Salmonella minnesota R595 and E. coli D31m4. However, Rd-LPS from S. minnesota R7 that contained an extra outer core phosphorylated heptose was only slowly hydrolyzed. The complex type LPS from Neisseria meningitides A1 and M992 that contained extra 5–6 sugar units at the outer core were refractory to R-α-Kdo-ase. This R-α-Kdo-ase should become useful for studying the structure and function of Kdo-containing glycans. PMID:26362869

  5. Evolution of Mycolic Acid Biosynthesis Genes and Their Regulation during Starvation in Mycobacterium tuberculosis

    PubMed Central

    Jamet, Stevie; Quentin, Yves; Coudray, Coralie; Texier, Pauline; Laval, Françoise; Daffé, Mamadou

    2015-01-01

    ABSTRACT Mycobacterium tuberculosis, the etiological agent of tuberculosis, is a Gram-positive bacterium with a unique cell envelope composed of an essential outer membrane. Mycolic acids, which are very-long-chain (up to C100) fatty acids, are the major components of this mycomembrane. The enzymatic pathways involved in the biosynthesis and transport of mycolates are fairly well documented and are the targets of the major antituberculous drugs. In contrast, only fragmented information is available on the expression and regulation of the biosynthesis genes. In this study, we report that the hadA, hadB, and hadC genes, which code for the mycolate biosynthesis dehydratase enzymes, are coexpressed with three genes that encode proteins of the translational apparatus. Consistent with the well-established control of the translation potential by nutrient availability, starvation leads to downregulation of the hadABC genes along with most of the genes required for the synthesis, modification, and transport of mycolates. The downregulation of a subset of the biosynthesis genes is partially dependent on RelMtb, the key enzyme of the stringent response. We also report the phylogenetic evolution scenario that has shaped the current genetic organization, characterized by the coregulation of the hadABC operon with genes of the translational apparatus and with genes required for the modification of the mycolates. IMPORTANCE Mycobacterium tuberculosis infects one-third of the human population worldwide, and despite the available therapeutic arsenal, it continues to kill millions of people each year. There is therefore an urgent need to identify new targets and develop a better understanding of how the bacterium is adapting itself to host defenses during infection. A prerequisite of this understanding is knowledge of how this adaptive skill has been implanted by evolution. Nutrient scarcity is an environmental condition the bacterium has to cope with during infection. In many bacteria, adaptation to starvation relies partly on the stringent response. M. tuberculosis's unique outer membrane layer, the mycomembrane, is crucial for its viability and virulence. Despite its being the target of the major antituberculosis drugs, only scattered information exists on how the genes required for biosynthesis of the mycomembrane are expressed and regulated during starvation. This work has addressed this issue as a step toward the identification of new targets in the fight against M. tuberculosis. PMID:26416833

  6. The ropAe gene encodes a porin-like protein involved in copper transit in Rhizobium etli CFN42.

    PubMed

    González-Sánchez, Antonio; Cubillas, Ciro A; Miranda, Fabiola; Dávalos, Araceli; García-de Los Santos, Alejandro

    2017-12-27

    Copper (Cu) is an essential micronutrient for all aerobic forms of life. Its oxidation states (Cu + /Cu 2+ ) make this metal an important cofactor of enzymes catalyzing redox reactions in essential biological processes. In gram-negative bacteria, Cu uptake is an unexplored component of a finely regulated trafficking network, mediated by protein-protein interactions that deliver Cu to target proteins and efflux surplus metal to avoid toxicity. Rhizobium etliCFN42 is a facultative symbiotic diazotroph that must ensure its appropriate Cu supply for living either free in the soil or as an intracellular symbiont of leguminous plants. In crop fields, rhizobia have to contend with copper-based fungicides. A detailed deletion analysis of the pRet42e (505 kb) plasmid from an R. etli mutant with enhanced CuCl 2 tolerance led us to the identification of the ropAe gene, predicted to encode an outer membrane protein (OMP) with a β-barrel channel structure that may be involved in Cu transport. In support of this hypothesis, the functional characterization of ropAe revealed that: (I) gene disruption increased copper tolerance of the mutant, and its complementation with the wild-type gene restored its wild-type copper sensitivity; (II) the ropAe gene maintains a low basal transcription level in copper overload, but is upregulated when copper is scarce; (III) disruption of ropAe in an actP (copA) mutant background, defective in copper efflux, partially reduced its copper sensitivity phenotype. Finally, BLASTP comparisons and a maximum likelihood phylogenetic analysis highlight the diversification of four RopA paralogs in members of the Rhizobiaceae family. Orthologs of RopAe are highly conserved in the Rhizobiales order, poorly conserved in other alpha proteobacteria and phylogenetically unrelated to characterized porins involved in Cu or Mn uptake. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  7. The nature of information, required for export and sorting, present within the outer membrane protein OmpA of Escherichia coli K-12.

    PubMed

    Freudl, R; Schwarz, H; Klose, M; Movva, N R; Henning, U

    1985-12-16

    Information, in addition to that provided by signal sequences, for translocation across the plasma membrane is thought to be present in exported proteins of Escherichia coli. Such information must also exist for the localization of such proteins. To determine the nature of this information, overlapping inframe deletions have been constructed in the ompA gene which codes for a 325-residue major outer membrane protein. In addition, one deletion, encoding only the NH2-terminal part of the protein up to residue 160, was prepared. The location of each product was determined by immunoelectron microscopy. Proteins missing residues 4-45, 43-84, 46-227, 86-227 or 160-325 of the mature protein were all efficiently translocated across the plasma membrane. The first two proteins were found in the outer membrane, the others in the periplasmic space. It has been proposed that export and sorting signals consist of relatively small amino acid sequences near the NH2 terminus of an outer membrane protein. On the basis of sequence homologies it has also been suggested that such proteins possess a common sorting signal. The locations of the partially deleted proteins described here show that a unique export signal does not exist in the OmpA protein. The proposed common sorting signal spans residues 1-14 of OmpA. Since this region is not essential for routing the protein, the existence of a common sorting signal is doubtful. It is suggested that information both for export (if existent) and localization lies within protein conformation which for the former process should be present repeatedly in the polypeptide.

  8. The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.

    PubMed

    Chen, Y M; Zhu, Y; Lin, E C

    1987-12-01

    In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans.

  9. Evolutionary Characteristics of Missing Proteins: Insights into the Evolution of Human Chromosomes Related to Missing-Protein-Encoding Genes.

    PubMed

    Xu, Aishi; Li, Guang; Yang, Dong; Wu, Songfeng; Ouyang, Hongsheng; Xu, Ping; He, Fuchu

    2015-12-04

    Although the "missing protein" is a temporary concept in C-HPP, the biological information for their "missing" could be an important clue in evolutionary studies. Here we classified missing-protein-encoding genes into two groups, the genes encoding PE2 proteins (with transcript evidence) and the genes encoding PE3/4 proteins (with no transcript evidence). These missing-protein-encoding genes distribute unevenly among different chromosomes, chromosomal regions, or gene clusters. In the view of evolutionary features, PE3/4 genes tend to be young, spreading at the nonhomology chromosomal regions and evolving at higher rates. Interestingly, there is a higher proportion of singletons in PE3/4 genes than the proportion of singletons in all genes (background) and OTCSGs (organ, tissue, cell type-specific genes). More importantly, most of the paralogous PE3/4 genes belong to the newly duplicated members of the paralogous gene groups, which mainly contribute to special biological functions, such as "smell perception". These functions are heavily restricted into specific type of cells, tissues, or specific developmental stages, acting as the new functional requirements that facilitated the emergence of the missing-protein-encoding genes during evolution. In addition, the criteria for the extremely special physical-chemical proteins were first set up based on the properties of PE2 proteins, and the evolutionary characteristics of those proteins were explored. Overall, the evolutionary analyses of missing-protein-encoding genes are expected to be highly instructive for proteomics and functional studies in the future.

  10. [Genetic instability of probiotic characteristics in the Bifidobacterium longum subsp. longum B379M strain during cultivation and maintenance].

    PubMed

    Averina, O V; Nezametdinova, V Z; Alekseeva, M G; Danilenko, V N

    2012-11-01

    The stability of inheriting several genes in the Russian commercial strain Bifidobacterium longum subsp. longum B379M during cultivation and maintenance under laboratory conditions has been studied. The examined genes code for probiotic characteristics, such as utilization of several sugars (lacA2 gene, encoding beta-galactosidase; ara gene, encoding arabinosidase; and galA gene, encoding arabinogalactan endo-beta-galactosidase); synthesis of bacteriocins (lans gene, encoding lanthionine synthetase); and mobile gene tet(W), conferring resistance to the antibiotic tetracycline. The other gene families studied include the genes responsible for signal transduction and adaptation to stress conditions in the majority of bacteria (serine/threonine protein kinases and the toxin-antitoxin systems of MazEF and RelBE types) and transcription regulators (genes encoding WhiB family proteins). Genomic DNA was analyzed by PCR using specially selected primers. A loss of the genes galA and tet(W) has been shown. It is proposed to expand the requirements on probiotic strains, namely, to control retention of the key probiotic genes using molecular biological methods.

  11. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

    DOEpatents

    Jarvis, Eric E.; Roessler, Paul G.

    1999-01-01

    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities.

  12. Human Genomic Signatures of Brain Oscillations During Memory Encoding.

    PubMed

    Berto, Stefano; Wang, Guang-Zhong; Germi, James; Lega, Bradley C; Konopka, Genevieve

    2018-05-01

    Memory encoding is an essential step for all learning. However, the genetic and molecular mechanisms underlying human memory encoding remain poorly understood, and how this molecular framework permits the emergence of specific patterns of brain oscillations observed during mnemonic processing is unknown. Here, we directly compare intracranial electroencephalography recordings from the neocortex in individuals performing an episodic memory task with human gene expression from the same areas. We identify genes correlated with oscillatory memory effects across 6 frequency bands. These genes are enriched for autism-related genes and have preferential expression in neurons, in particular genes encoding synaptic proteins and ion channels, supporting the idea that the genes regulating voltage gradients are involved in the modulation of oscillatory patterns during successful memory encoding across brain areas. Memory-related genes are distinct from those correlated with other forms of cognitive processing and resting state fMRI. These data are the first to identify correlations between gene expression and active human brain states as well as provide a molecular window into memory encoding oscillations in the human brain.

  13. Structural analysis and cross-protective efficacy of recombinant 87 kDa outer membrane protein (Omp87) of Pasteurella multocida serogroup B:2.

    PubMed

    Kumar, Abhinendra; Yogisharadhya, Revanaiah; Ramakrishnan, Muthannan A; Viswas, K N; Shivachandra, Sathish B

    2013-12-01

    Pasteurella multocida serogroup B:2, a causative agent of haemorrhagic septicaemia (HS) in cattle and buffalo especially in tropical regions of Asian and African countries, is known to possess several outer membrane proteins (OMPs) as immunogenic antigens. In the present study, omp87 gene encoding for 87 kDa OMP (Omp87) protein of P. multocida serogroup B:2 strain P52, has been amplified (∼2304 bp), cloned in to pET32a vector and over-expressed in recombinant Escherichia coli as fusion protein. The recombinant Omp87 protein (∼102 kDa) including N-terminus hexa-histidine tag was purified under denaturing condition. Immunization of mice with rOmp87 resulted in increased antigen specific IgG titres in serum and provided protection of 66.6 and 83.3% following homologous (B:2) and heterologous (A:1) challenge, respectively. A homology model of Omp87 revealed the presence of two distinct domains; N-terminal domain with four POTRA repeats in the periplasmic space and a pore forming C-terminal β-barrel domain (β1- β16) in the outer membrane of P. multocida, which belong to Omp85-TpsB transporter superfamily of OMPs. The study indicated the potential possibilities to use rOmp87 protein along with suitable adjuvant in developing subunit vaccine for haemorrhagic septicaemia and pasteurellosis in livestock. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. The mate recognition protein gene mediates reproductive isolation and speciation in the Brachionus plicatilis cryptic species complex.

    PubMed

    Gribble, Kristin E; Mark Welch, David B

    2012-08-01

    Chemically mediated prezygotic barriers to reproduction likely play an important role in speciation. In facultatively sexual monogonont rotifers from the Brachionus plicatilis cryptic species complex, mate recognition of females by males is mediated by the Mate Recognition Protein (MRP), a globular glycoprotein on the surface of females, encoded by the mmr-b gene family. In this study, we sequenced mmr-b copies from 27 isolates representing 11 phylotypes of the B. plicatilis species complex, examined the mode of evolution and selection of mmr-b, and determined the relationship between mmr-b genetic distance and mate recognition among isolates. Isolates of the B. plicatilis species complex have 1-4 copies of mmr-b, each composed of 2-9 nearly identical tandem repeats. The repeats within a gene copy are generally more similar than are gene copies among phylotypes, suggesting concerted evolution. Compared to housekeeping genes from the same isolates, mmr-b has accumulated only half as many synonymous differences but twice as many non-synonymous differences. Most of the amino acid differences between repeats appear to occur on the outer face of the protein, and these often result in changes in predicted patterns of phosphorylation. However, we found no evidence of positive selection driving these differences. Isolates with the most divergent copies were unable to mate with other isolates and rarely self-crossed. Overall the degree of mate recognition was significantly correlated with the genetic distance of mmr-b. Discrimination of compatible mates in the B. plicatilis species complex is determined by proteins encoded by closely related copies of a single gene, mmr-b. While concerted evolution of the tandem repeats in mmr-b may function to maintain identity, it can also lead to the rapid spread of a mutation through all copies in the genome and thus to reproductive isolation. The mmr-b gene is evolving rapidly, and novel alleles may be maintained and increase in frequency via asexual reproduction. Our analyses indicate that mate recognition, controlled by MMR-B, may drive reproductive isolation and allow saltational sympatric speciation within the B. plicatilis cryptic species complex, and that this process may be largely neutral.

  15. Functional Features of TonB Energy Transduction Systems of Acinetobacter baumannii

    PubMed Central

    Zimbler, Daniel L.; Arivett, Brock A.; Beckett, Amber C.; Menke, Sharon M.

    2013-01-01

    Acinetobacter baumannii is an opportunistic pathogen that causes severe nosocomial infections. Strain ATCC 19606T utilizes the siderophore acinetobactin to acquire iron under iron-limiting conditions encountered in the host. Accordingly, the genome of this strain has three tonB genes encoding proteins for energy transduction functions needed for the active transport of nutrients, including iron, through the outer membrane. Phylogenetic analysis indicates that these tonB genes, which are present in the genomes of all sequenced A. baumannii strains, were acquired from different sources. Two of these genes occur as components of tonB-exbB-exbD operons and one as a monocistronic copy; all are actively transcribed in ATCC 19606T. The abilities of components of these TonB systems to complement the growth defect of Escherichia coli W3110 mutants KP1344 (tonB) and RA1051 (exbBD) under iron-chelated conditions further support the roles of these TonB systems in iron acquisition. Mutagenesis analysis of ATCC 19606T tonB1 (subscripted numbers represent different copies of genes or proteins) and tonB2 supports this hypothesis: their inactivation results in growth defects in iron-chelated media, without affecting acinetobactin biosynthesis or the production of the acinetobactin outer membrane receptor protein BauA. In vivo assays using Galleria mellonella show that each TonB protein is involved in, but not essential for, bacterial virulence in this infection model. Furthermore, we observed that TonB2 plays a role in the ability of bacteria to bind to fibronectin and to adhere to A549 cells by uncharacterized mechanisms. Taken together, these results indicate that A. baumannii ATCC 19606T produces three independent TonB proteins, which appear to provide the energy-transducing functions needed for iron acquisition and cellular processes that play a role in the virulence of this pathogen. PMID:23817614

  16. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

    DOEpatents

    Jarvis, E.E.; Roessler, P.G.

    1999-07-27

    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities. 8 figs.

  17. Evolutionary analysis of hydrophobin gene family in two wood-degrading basidiomycetes, Phlebia brevispora and Heterobasidion annosum s.l.

    PubMed Central

    2013-01-01

    Background Hydrophobins are small secreted cysteine-rich proteins that play diverse roles during different phases of fungal life cycle. In basidiomycetes, hydrophobin-encoding genes often form large multigene families with up to 40 members. The evolutionary forces driving hydrophobin gene expansion and diversification in basidiomycetes are poorly understood. The functional roles of individual genes within such gene families also remain unclear. The relationship between the hydrophobin gene number, the genome size and the lifestyle of respective fungal species has not yet been thoroughly investigated. Here, we present results of our survey of hydrophobin gene families in two species of wood-degrading basidiomycetes, Phlebia brevispora and Heterobasidion annosum s.l. We have also investigated the regulatory pattern of hydrophobin-encoding genes from H. annosum s.s. during saprotrophic growth on pine wood as well as on culture filtrate from Phlebiopsis gigantea using micro-arrays. These data are supplemented by results of the protein structure modeling for a representative set of hydrophobins. Results We have identified hydrophobin genes from the genomes of two wood-degrading species of basidiomycetes, Heterobasidion irregulare, representing one of the microspecies within the aggregate H. annosum s.l., and Phlebia brevispora. Although a high number of hydrophobin-encoding genes were observed in H. irregulare (16 copies), a remarkable expansion of these genes was recorded in P. brevispora (26 copies). A significant expansion of hydrophobin-encoding genes in other analyzed basidiomycetes was also documented (1–40 copies), whereas contraction through gene loss was observed among the analyzed ascomycetes (1–11 copies). Our phylogenetic analysis confirmed the important role of gene duplication events in the evolution of hydrophobins in basidiomycetes. Increased number of hydrophobin-encoding genes appears to have been linked to the species’ ecological strategy, with the non-pathogenic fungi having increased numbers of hydrophobins compared with their pathogenic counterparts. However, there was no significant relationship between the number of hydrophobin-encoding genes and genome size. Furthermore, our results revealed significant differences in the expression levels of the 16 H. annosum s.s. hydrophobin-encoding genes which suggest possible differences in their regulatory patterns. Conclusions A considerable expansion of the hydrophobin-encoding genes in basidiomycetes has been observed. The distribution and number of hydrophobin-encoding genes in the analyzed species may be connected to their ecological preferences. Results of our analysis also have shown that H. annosum s.l. hydrophobin-encoding genes may be under positive selection. Our gene expression analysis revealed differential expression of H. annosum s.s. hydrophobin genes under different growth conditions, indicating their possible functional diversification. PMID:24188142

  18. Glutathione S-transferase-encoding gene as a potential probe for environmental bacterial isolates capable of degrading polycyclic aromatic hydrocarbons.

    PubMed Central

    Lloyd-Jones, G; Lau, P C

    1997-01-01

    Homologs of the glutathione S-transferase (GST)-encoding gene were identified in a collection of aromatic hydrocarbon-degrading Sphingomonas spp. isolated from New Zealand, Antarctica, and the United States by using PCR primers designed from the GST-encoding gene of Sphingomonas paucimobilis EPA505. Sequence analysis of PCR fragments generated from these isolates and of the GST gene amplified from DNA extracted from polycyclic aromatic hydrocarbon (PAH)-contaminated soil revealed a high degree of conservation, which may make the GST-encoding gene a potentially useful marker for PAH-degrading bacteria. PMID:9251217

  19. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk.

    PubMed

    Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B

    2013-02-01

    Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (p<0.05), reinforcing the importance of S. aureus as a potential foodborne agent. However, the potential risk posed by CoNS in goat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates.

  20. Monitoring the Assembly of a Secreted Bacterial Virulence Factor Using Site-specific Crosslinking

    PubMed Central

    Pavlova, Olga; Ieva, Raffaele; Bernstein, Harris D

    2013-01-01

    This article describes a method to detect and analyze dynamic interactions between a protein of interest and other factors in vivo. Our method is based on the amber suppression technology that was originally developed by Peter Schultz and colleagues1. An amber mutation is first introduced at a specific codon of the gene encoding the protein of interest. The amber mutant is then expressed in E. coli together with genes encoding an amber suppressor tRNA and an amino acyl-tRNA synthetase derived from Methanococcus jannaschii. Using this system, the photo activatable amino acid analog p-benzoylphenylalanine (Bpa) is incorporated at the amber codon. Cells are then irradiated with ultraviolet light to covalently link the Bpa residue to proteins that are located within 3-8 Å. Photocrosslinking is performed in combination with pulse-chase labeling and immunoprecipitation of the protein of interest in order to monitor changes in protein-protein interactions that occur over a time scale of seconds to minutes. We optimized the procedure to study the assembly of a bacterial virulence factor that consists of two independent domains, a domain that is integrated into the outer membrane and a domain that is translocated into the extracellular space, but the method can be used to study many different assembly processes and biological pathways in both prokaryotic and eukaryotic cells. In principle interacting factors and even specific residues of interacting factors that bind to a protein of interest can be identified by mass spectrometry. PMID:24378574

  1. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  2. TGMS in Rapeseed (Brassica napus) Resulted in Aberrant Transcriptional Regulation, Asynchronous Microsporocyte Meiosis, Defective Tapetum, and Fused Sexine

    PubMed Central

    Liu, Xi-Qiong; Liu, Zhi-Quan; Yu, Cheng-Yu; Dong, Jun-Gang; Hu, Sheng-Wu; Xu, Ai-Xia

    2017-01-01

    The thermo-sensitive genic male sterility (TGMS) line SP2S is a spontaneous rapeseed mutation with several traits that are favorable for the production of two-line hybrids. To uncover the key cellular events and genetic regulation associated with TGMS expression, a combined study using cytological observation, transcriptome profiling, and gene expression analysis was conducted for SP2S and its near-isogenic line SP2F grown under warm conditions. Asynchronous microsporocyte meiosis and abnormal tapetal plastids and elaioplasts were demonstrated in the anther of SP2S. The tetrad microspore did not undergo mitosis before the cytoplasm degenerated. Delayed degradation of the tetrad wall, which led to tetrad microspore aggregation, resulted in postponement of sexine (outer layer of pollen exine) formation and sexine fusion in the tetrad. The nexine (foot layer of exine) was also absent. The delay of tetrad wall degradation and abnormality of the exine structure suggested that the defective tapetum lost important functions. Based on transcriptomic comparisons between young flower buds of SP2S and SP2F plants, a total of 465 differentially expressed transcripts (DETs) were identified, including 303 up-regulated DETs and 162 down-regulated DETs in SP2S. Several genes encoding small RNA degrading nuclease 2, small RNA 2′-O-methyltransferase, thioredoxin reductase 2, regulatory subunit A alpha isoform of serine/threonine-protein phosphatase 2A, glycine rich protein 1A, transcription factor bHLH25, leucine-rich repeat receptor kinase At3g14840 like, and fasciclin-like arabinogalactan proteins FLA19 and FLA20 were greatly depressed in SP2S. Interestingly, a POLLENLESS3-LIKE 2 gene encoding the Arabidopsis MS5 homologous protein, which is necessary for microsporocyte meiosis, was down-regulated in SP2S. Other genes that were up-regulated in SP2S encoded glucanase A6, ethylene-responsive transcription factor 1A-like, pollen-specific SF3, stress-associated endoplasmic reticulum protein 2, WRKY transcription factors and pentatricopeptide repeat (PPR) protein At1g07590. The tapetum-development-related genes, including BnEMS1, BnDYT1, and BnAMS, were slightly up-regulated in 3-mm-long flower buds or their anthers, and their downstream genes, BnMS1 and BnMYB80, which affect callose dissolution and exine formation, were greatly up-regulated in SP2S. This aberrant genetic regulation corresponded well with the cytological abnormalities. The results suggested that expression of TGMS associates with complex transcriptional regulation. PMID:28775729

  3. Detection of carbapenemases and other mechanisms of enzymatic resistance to β-lactams in Enterobacteriaceae with diminished susceptibility to carbapenems in a tertiary care hospital.

    PubMed

    Gómara, Marta; López-Calleja, Ana Isabel; Iglesia, Berta María Pilar Vela; Cerón, Isabel Ferrer; López, Antonio Rezusta; Pinilla, María José Revillo

    2018-05-01

    Our objective was to characterize the enzymatic β-lactam resistance in clinical Enterobacteriaceae isolates with diminished susceptibility to carbapenems from 2013 to 2014 at Hospital Universitario Miguel Servet. A total of 63 clinical isolates were analyzed for the presence of carbapenemases (KPC, OXA-48 and MBL), ESBLs and AmpC enzymes by combined disk methods and PCR detection of carbapenemase-encoding and beta-lactamase-encoding genes. Fifteen isolates had a phenotypic test compatible with carbapenemase production; two of these were confirmed by PCR as OXA-48 producers. ESBL detection was positive in 27 isolates (43%); plasmid-mediated AmpC was detected in nine isolates (14.2%) and derepressed AmpC β-lactamase was present in 18 isolates (28%). During the study period, the decreased susceptibility to carbapenems in Enterobacteriaceae in our area was not due to true carbapenemases but rather to β-lactamase activity (82.5% were ESBL or AmpC producers), probably in combination with decreased permeability of the outer membrane. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  4. Transcriptomic analysis of Arabidopsis developing stems: a close-up on cell wall genes

    PubMed Central

    Minic, Zoran; Jamet, Elisabeth; San-Clemente, Hélène; Pelletier, Sandra; Renou, Jean-Pierre; Rihouey, Christophe; Okinyo, Denis PO; Proux, Caroline; Lerouge, Patrice; Jouanin, Lise

    2009-01-01

    Background Different strategies (genetics, biochemistry, and proteomics) can be used to study proteins involved in cell biogenesis. The availability of the complete sequences of several plant genomes allowed the development of transcriptomic studies. Although the expression patterns of some Arabidopsis thaliana genes involved in cell wall biogenesis were identified at different physiological stages, detailed microarray analysis of plant cell wall genes has not been performed on any plant tissues. Using transcriptomic and bioinformatic tools, we studied the regulation of cell wall genes in Arabidopsis stems, i.e. genes encoding proteins involved in cell wall biogenesis and genes encoding secreted proteins. Results Transcriptomic analyses of stems were performed at three different developmental stages, i.e., young stems, intermediate stage, and mature stems. Many genes involved in the synthesis of cell wall components such as polysaccharides and monolignols were identified. A total of 345 genes encoding predicted secreted proteins with moderate or high level of transcripts were analyzed in details. The encoded proteins were distributed into 8 classes, based on the presence of predicted functional domains. Proteins acting on carbohydrates and proteins of unknown function constituted the two most abundant classes. Other proteins were proteases, oxido-reductases, proteins with interacting domains, proteins involved in signalling, and structural proteins. Particularly high levels of expression were established for genes encoding pectin methylesterases, germin-like proteins, arabinogalactan proteins, fasciclin-like arabinogalactan proteins, and structural proteins. Finally, the results of this transcriptomic analyses were compared with those obtained through a cell wall proteomic analysis from the same material. Only a small proportion of genes identified by previous proteomic analyses were identified by transcriptomics. Conversely, only a few proteins encoded by genes having moderate or high level of transcripts were identified by proteomics. Conclusion Analysis of the genes predicted to encode cell wall proteins revealed that about 345 genes had moderate or high levels of transcripts. Among them, we identified many new genes possibly involved in cell wall biogenesis. The discrepancies observed between results of this transcriptomic study and a previous proteomic study on the same material revealed post-transcriptional mechanisms of regulation of expression of genes encoding cell wall proteins. PMID:19149885

  5. The Pseudomonas putida peptidoglycan-associated outer membrane lipoprotein is involved in maintenance of the integrity of the cell cell envelope.

    PubMed Central

    Rodríguez-Herva, J J; Ramos-Gonzalez, M I; Ramos, J L

    1996-01-01

    Pseudomonas putida 14G-3, a derivative of the natural soil inhabitant P. putida KT2440, exhibited a chromosomal insertion of a mini-Tn5/'phoA transposon that resulted in reduced ability to colonize soil. In vitro characterization of P. putida 14G-3 revealed that it exhibited an altered cell morphology and envelope, as revealed by electron microscopy. The derived strain was sensitive to sodium dodecyl sulfate, deoxycholate, and EDTA, produced clumps when it reached high cell densities in the late logarithmic growth phase, and did not grow on low-osmolarity medium. The P. putida DNA surrounding the mini-Tn5/'phoA insertion was cloned and used as a probe to rescue the wild-type gene, which was sequenced. Comparison of the deduced peptide sequence with sequences in the Swiss-Prot database allowed the knocked-out gene to be identified as that encoding the peptidoglycan-associated lipoprotein (Pal or OprL) of P. putida. The protein was identified in coupled transcription and translation assays in vitro. PMID:8626299

  6. The Reed-Solomon encoders: Conventional versus Berlekamp's architecture

    NASA Technical Reports Server (NTRS)

    Perlman, M.; Lee, J. J.

    1982-01-01

    Concatenated coding was adopted for interplanetary space missions. Concatenated coding was employed with a convolutional inner code and a Reed-Solomon (RS) outer code for spacecraft telemetry. Conventional RS encoders are compared with those that incorporate two architectural features which approximately halve the number of multiplications of a set of fixed arguments by any RS codeword symbol. The fixed arguments and the RS symbols are taken from a nonbinary finite field. Each set of multiplications is bit-serially performed and completed during one (bit-serial) symbol shift. All firmware employed by conventional RS encoders is eliminated.

  7. Osmotic regulation of expression of two extracellular matrix-binding proteins and a haemolysin of Leptospira interrogans: differential effects on LigA and Sph2 extracellular release.

    PubMed

    Matsunaga, James; Medeiros, Marco A; Sanchez, Yolanda; Werneid, Kristian F; Ko, Albert I

    2007-10-01

    The life cycle of the pathogen Leptospira interrogans involves stages outside and inside the host. Entry of L. interrogans from moist environments into the host is likely to be accompanied by the induction of genes encoding virulence determinants and the concomitant repression of genes encoding products required for survival outside of the host. The expression of the adhesin LigA, the haemolysin Sph2 (Lk73.5) and the outer-membrane lipoprotein LipL36 of pathogenic Leptospira species have been reported to be regulated by mammalian host signals. A previous study demonstrated that raising the osmolarity of the leptospiral growth medium to physiological levels encountered in the host by addition of various salts enhanced the levels of cell-associated LigA and LigB and extracellular LigA. In this study, we systematically examined the effects of osmotic upshift with ionic and non-ionic solutes on expression of the known mammalian host-regulated leptospiral genes. The levels of cell-associated LigA, LigB and Sph2 increased at physiological osmolarity, whereas LipL36 levels decreased, corresponding to changes in specific transcript levels. These changes in expression occurred irrespective of whether sodium chloride or sucrose was used as the solute. The increase of cellular LigA, LigB and Sph2 protein levels occurred within hours of adding sodium chloride. Extracellular Sph2 levels increased when either sodium chloride or sucrose was added to achieve physiological osmolarity. In contrast, enhanced levels of extracellular LigA were observed only with an increase in ionic strength. These results indicate that the mechanisms for release of LigA and Sph2 differ during host infection. Thus, osmolarity not only affects leptospiral gene expression by affecting transcript levels of putative virulence determinants but also affects the release of such proteins into the surroundings.

  8. Genes for all metals--a bacterial view of the periodic table. The 1996 Thom Award Lecture.

    PubMed

    Silver, S

    1998-01-01

    Bacterial chromosomes have genes for transport proteins for inorganic nutrient cations and oxyanions, such as NH4+, K+, Mg2+, Co2+, Fe3+, Mn2+, Zn2+ and other trace cations, and PO4(3-), SO4(2-) and less abundant oxyanions. Together these account for perhaps a few hundred genes in many bacteria. Bacterial plasmids encode resistance systems for toxic metal and metalloid ions including Ag+, AsO2-, AsO4(3-), Cd2+, Co2+, CrO4(2-), Cu2+, Hg2+, Ni2+, Pb2+, TeO3(2-), Tl+ and Zn2+. Most resistance systems function by energy-dependent efflux of toxic ions. A few involve enzymatic (mostly redox) transformations. Some of the efflux resistance systems are ATPases and others are chemiosmotic ion/proton exchangers. The Cd(2+)-resistance cation pump of Gram-positive bacteria is membrane P-type ATPase, which has been labeled with 32P from [gamma-32P]ATP and drives ATP-dependent Cd2+ (and Zn2+) transport by membrane vesicles. The genes defective in the human hereditary diseases of copper metabolism, Menkes syndrome and Wilson's disease, encode P-type ATPases that are similar to bacterial cadmium ATPases. The arsenic resistance system transports arsenite [As(III)], alternatively with the ArsB polypeptide functioning as a chemiosmotic efflux transporter or with two polypeptides, ArsB and ArsA, functioning as an ATPase. The third protein of the arsenic resistance system is an enzyme that reduces intracellular arsenate [As(V)] to arsenite [As(III)], the substrate of the efflux system. In Gram-negative cells, a three polypeptide complex functions as a chemiosmotic cation/protein exchanger to efflux Cd2+, Zn2+ and Co2+. This pump consists of an inner membrane (CzcA), an outer membrane (CzcC) and a membrane-spanning (CzcB) protein that function together.

  9. Trichoderma genes

    DOEpatents

    Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

    2012-06-19

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  10. The rice blast resistance gene Ptr encodes an atypical protein required for broad spectrum disease resistance

    USDA-ARS?s Scientific Manuscript database

    Plant resistance (R) genes typically encode proteins with nucleotide binding site-leucine rich repeat (NLR) domains. We identified a novel, broad-spectrum rice blast R gene, Ptr, encoding a non-NLR protein with four Armadillo repeats. Ptr was originally identified by fast neutron mutagenesis as a ...

  11. Regulation of C. elegans L4 cuticle collagen genes by the heterochronic protein LIN-29.

    PubMed

    Abete-Luzi, Patricia; Eisenmann, David M

    2018-05-01

    The cuticle, the outer covering of the nematode C. elegans, is synthesized five times during the worm's life by the underlying hypodermis. Cuticle collagens, the major cuticle component, are encoded by a large family of col genes and, interestingly, many of these genes express predominantly at a single developmental stage. This temporal preference motivated us to investigate the mechanisms underlying col gene expression and here we focus on a subset of col genes expressed in the L4 stage. We identified minimal promoter regions of <300 bp for col-38, col-49, and col-63. In these regions, we predicted cis-regulatory sequences and evaluated their function in vivo via mutagenesis of a col-38p::yfp reporter. We used RNAi to study the requirement for candidate transcription regulators ELT-1 and ELT-3, LIN-29, and the LIN-29 co-factor MAB-10, and found LIN-29 to be necessary for the expression of four L4-specific genes (col-38, col-49, col-63, and col-138). Temporal misexpression of LIN-29 was also sufficient to activate these genes at a different developmental stage. The LIN-29 DNA-binding domain bound the col-38, col-49, and col-63 minimal promoters in vitro. For col-38 we showed that the LIN-29 sites necessary for reporter expression in vivo are also bound in vitro: this is the first identification of specific binding sites for LIN-29 necessary for in vivo target gene expression. © 2018 Wiley Periodicals, Inc.

  12. Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

    PubMed

    Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

    2018-04-18

    This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P < 0.05) mRNA profiles of 9 inflammation-related genes in cells, while short-time Se pretreatment modestly reversed (P < 0.05) the LPS-induced upregulation of 7 genes (COX-2, ICAM-1, IL-1β, IL-6, IL-10, iNOS, and MCP-1) and further increased (P < 0.05) expression of IFN-β and TNF-α in stressed cells. Meanwhile, LPS decreased (P < 0.05) mRNA levels of 18 selenoprotein encoding genes and upregulated mRNA levels of TXNRD1 and TXNRD3 in cells. Se pretreatment recovered (P < 0.05) expression of 3 selenoprotein encoding genes (GPX1, SELENOH, and SELENOW) in a dose-dependent manner and increased (P < 0.05) expression of another 5 selenoprotein encoding genes (SELENOK, SELENOM, SELENOS, SELENOT, and TXNRD2) only at a high level (2.0 μmol Se/L). Taken together, LPS-induced immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

  13. Disruption of the psbA gene by the copy correction mechanism reveals that the expression of plastid-encoded genes is regulated by photosynthesis activity.

    PubMed

    Khan, Muhammad Sarwar; Hameed, Waqar; Nozoe, Mikio; Shiina, Takashi

    2007-05-01

    The functional analysis of genes encoded by the chloroplast genome of tobacco by reverse genetics is routine. Nevertheless, for a small number of genes their deletion generates heteroplasmic genotypes, complicating their analysis. There is thus the need for additional strategies to develop deletion mutants for these genes. We have developed a homologous copy correction-based strategy for deleting/mutating genes encoded on the chloroplast genome. This system was used to produce psbA knockouts. The resulting plants are homoplasmic and lack photosystem II (PSII) activity. Further, the deletion mutants exhibit a distinct phenotype; young leaves are green, whereas older leaves are bleached, irrespective of light conditions. This suggests that senescence is promoted by the absence of psbA. Analysis of the transcript levels indicates that NEP (nuclear-encoded plastid RNA polymerase)-dependent plastid genes are up regulated in the psbA deletion mutants, whereas the bleached leaves retain plastid-encoded plastid RNA polymerase activity. Hence, the expression of NEP-dependent plastid genes may be regulated by photosynthesis, either directly or indirectly.

  14. Genome-Wide Identification and Mapping of NBS-Encoding Resistance Genes in Solanum tuberosum Group Phureja

    PubMed Central

    Lozano, Roberto; Ponce, Olga; Ramirez, Manuel; Mostajo, Nelly; Orjeda, Gisella

    2012-01-01

    The majority of disease resistance (R) genes identified to date in plants encode a nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domain containing protein. Additional domains such as coiled-coil (CC) and TOLL/interleukin-1 receptor (TIR) domains can also be present. In the recently sequenced Solanum tuberosum group phureja genome we used HMM models and manual curation to annotate 435 NBS-encoding R gene homologs and 142 NBS-derived genes that lack the NBS domain. Highly similar homologs for most previously documented Solanaceae R genes were identified. A surprising ∼41% (179) of the 435 NBS-encoding genes are pseudogenes primarily caused by premature stop codons or frameshift mutations. Alignment of 81.80% of the 577 homologs to S. tuberosum group phureja pseudomolecules revealed non-random distribution of the R-genes; 362 of 470 genes were found in high density clusters on 11 chromosomes. PMID:22493716

  15. Immunoproteomic Analysis To Identify Shiga Toxin-Producing Escherichia coli Outer Membrane Proteins Expressed during Human Infection

    PubMed Central

    Montero, David; Orellana, Paz; Gutiérrez, Daniela; Araya, Daniela; Salazar, Juan Carlos; Prado, Valeria; Oñate, Ángel; del Canto, Felipe

    2014-01-01

    Shiga-toxin producing Escherichia coli (STEC) is the etiologic agent of acute diarrhea, dysentery, and hemolytic-uremic syndrome (HUS). There is no approved vaccine for STEC infection in humans, and antibiotic use is contraindicated, as it promotes Shiga toxin production. In order to identify STEC-associated antigens and immunogenic proteins, outer membrane proteins (OMPs) were extracted from STEC O26:H11, O103, O113:H21, and O157:H7 strains, and commensal E. coli strain HS was used as a control. SDS-PAGE, two-dimensional-PAGE analysis, Western blot assays using sera from pediatric HUS patients and controls, and matrix-assisted laser desorption ionization–tandem time of flight analyses were used to identify 12 immunogenic OMPs, some of which were not reactive with control sera. Importantly, seven of these proteins have not been previously reported to be immunogenic in STEC strains. Among these seven proteins, OmpT and Cah displayed IgG and IgA reactivity with sera from HUS patients. Genes encoding these two proteins were present in a majority of STEC strains. Knowledge of the antigens produced during infection of the host and the immune response to those antigens will be important for future vaccine development. PMID:25156722

  16. Genes responding to water deficit in apple (Malus × domestica Borkh.) roots.

    PubMed

    Bassett, Carole Leavel; Baldo, Angela M; Moore, Jacob T; Jenkins, Ryan M; Soffe, Doug S; Wisniewski, Michael E; Norelli, John L; Farrell, Robert E

    2014-07-08

    Individual plants adapt to their immediate environment using a combination of biochemical, morphological and life cycle strategies. Because woody plants are long-lived perennials, they cannot rely on annual life cycle strategies alone to survive abiotic stresses. In this study we used suppression subtractive hybridization to identify genes both up- and down-regulated in roots during water deficit treatment and recovery. In addition we followed the expression of select genes in the roots, leaves, bark and xylem of 'Royal Gala' apple subjected to a simulated drought and subsequent recovery. In agreement with studies from both herbaceous and woody plants, a number of common drought-responsive genes were identified, as well as a few not previously reported. Three genes were selected for more in depth analysis: a high affinity nitrate transporter (MdNRT2.4), a mitochondrial outer membrane translocase (MdTOM7.1), and a gene encoding an NPR1 homolog (MpNPR1-2). Quantitative expression of these genes in apple roots, bark and leaves was consistent with their roles in nutrition and defense. Additional genes from apple roots responding to drought were identified using suppression subtraction hybridization compared to a previous EST analysis from the same organ. Genes up- and down-regulated during drought recovery in roots were also identified. Elevated levels of a high affinity nitrate transporter were found in roots suggesting that nitrogen uptake shifted from low affinity transport due to the predicted reduction in nitrate concentration in drought-treated roots. Suppression of a NPR1 gene in leaves of drought-treated apple trees may explain in part the increased disease susceptibility of trees subjected to dehydrative conditions.

  17. Adaptive evolution of the myo6 gene in old world fruit bats (family: pteropodidae).

    PubMed

    Shen, Bin; Han, Xiuqun; Jones, Gareth; Rossiter, Stephen J; Zhang, Shuyi

    2013-01-01

    Myosin VI (encoded by the Myo6 gene) is highly expressed in the inner and outer hair cells of the ear, retina, and polarized epithelial cells such as kidney proximal tubule cells and intestinal enterocytes. The Myo6 gene is thought to be involved in a wide range of physiological functions such as hearing, vision, and clathrin-mediated endocytosis. Bats (Chiroptera) represent one of the most fascinating mammal groups for molecular evolutionary studies of the Myo6 gene. A diversity of specialized adaptations occur among different bat lineages, such as echolocation and associated high-frequency hearing in laryngeal echolocating bats, large eyes and a strong dependence on vision in Old World fruit bats (Pteropodidae), and specialized high-carbohydrate but low-nitrogen diets in both Old World and New World fruit bats (Phyllostomidae). To investigate what role(s) the Myo6 gene might fulfill in bats, we sequenced the coding region of the Myo6 gene in 15 bat species and used molecular evolutionary analyses to detect evidence of positive selection in different bat lineages. We also conducted real-time PCR assays to explore the expression levels of Myo6 in a range of tissues from three representative bat species. Molecular evolutionary analyses revealed that the Myo6 gene, which was widely considered as a hearing gene, has undergone adaptive evolution in the Old World fruit bats which lack laryngeal echolocation and associated high-frequency hearing. Real-time PCR showed the highest expression level of the Myo6 gene in the kidney among ten tissues examined in three bat species, indicating an important role for this gene in kidney function. We suggest that Myo6 has undergone adaptive evolution in Old World fruit bats in relation to receptor-mediated endocytosis for the preservation of protein and essential nutrients.

  18. The candidate histocompatibility locus of a Basal chordate encodes two highly polymorphic proteins.

    PubMed

    Nydam, Marie L; Netuschil, Nikolai; Sanders, Erin; Langenbacher, Adam; Lewis, Daniel D; Taketa, Daryl A; Marimuthu, Arumugapradeep; Gracey, Andrew Y; De Tomaso, Anthony W

    2013-01-01

    The basal chordate Botryllus schlosseri undergoes a natural transplantation reaction governed by a single, highly polymorphic locus called the fuhc. Our initial characterization of this locus suggested it encoded a single gene alternatively spliced into two transcripts: a 555 amino acid-secreted form containing the first half of the gene, and a full-length, 1008 amino acid transmembrane form, with polymorphisms throughout the ectodomain determining outcome. We have now found that the locus encodes two highly polymorphic genes which are separated by a 227 bp intergenic region: first, the secreted form as previously described, and a second gene encoding a 531 amino acid membrane-bound gene containing three extracellular immunoglobulin domains. While northern blotting revealed only these two mRNAs, both PCR and mRNA-seq detect a single capped and polyadenylated transcript that encodes processed forms of both genes linked by the intergenic region, as well as other transcripts in which exons of the two genes are spliced together. These results might suggest that the two genes are expressed as an operon, during which both genes are co-transcribed and then trans-spliced into two separate messages. This type of transcriptional regulation has been described in tunicates previously; however, the membrane-bound gene does not encode a typical Splice Leader (SL) sequence at the 5' terminus that usually accompanies trans-splicing. Thus, the presence of stable transcripts encoding both genes may suggest a novel mechanism of regulation, or conversely may be rare but stable transcripts in which the two mRNAs are linked due to a small amount of read-through by RNA polymerase. Both genes are highly polymorphic and co-expressed on tissues involved in histocompatibility. In addition, polymorphisms on both genes correlate with outcome, although we have found a case in which it appears that the secreted form may be major allorecognition determinant.

  19. Development of a gene synthesis platform for the efficient large scale production of small genes encoding animal toxins.

    PubMed

    Sequeira, Ana Filipa; Brás, Joana L A; Guerreiro, Catarina I P D; Vincentelli, Renaud; Fontes, Carlos M G A

    2016-12-01

    Gene synthesis is becoming an important tool in many fields of recombinant DNA technology, including recombinant protein production. De novo gene synthesis is quickly replacing the classical cloning and mutagenesis procedures and allows generating nucleic acids for which no template is available. In addition, when coupled with efficient gene design algorithms that optimize codon usage, it leads to high levels of recombinant protein expression. Here, we describe the development of an optimized gene synthesis platform that was applied to the large scale production of small genes encoding venom peptides. This improved gene synthesis method uses a PCR-based protocol to assemble synthetic DNA from pools of overlapping oligonucleotides and was developed to synthesise multiples genes simultaneously. This technology incorporates an accurate, automated and cost effective ligation independent cloning step to directly integrate the synthetic genes into an effective Escherichia coli expression vector. The robustness of this technology to generate large libraries of dozens to thousands of synthetic nucleic acids was demonstrated through the parallel and simultaneous synthesis of 96 genes encoding animal toxins. An automated platform was developed for the large-scale synthesis of small genes encoding eukaryotic toxins. Large scale recombinant expression of synthetic genes encoding eukaryotic toxins will allow exploring the extraordinary potency and pharmacological diversity of animal venoms, an increasingly valuable but unexplored source of lead molecules for drug discovery.

  20. Comprehensive search for accessory proteins encoded with archaeal and bacterial type III CRISPR-cas gene cassettes reveals 39 new cas gene families.

    PubMed

    Shah, Shiraz A; Alkhnbashi, Omer S; Behler, Juliane; Han, Wenyuan; She, Qunxin; Hess, Wolfgang R; Garrett, Roger A; Backofen, Rolf

    2018-06-19

    A study was undertaken to identify conserved proteins that are encoded adjacent to cas gene cassettes of Type III CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats - CRISPR associated) interference modules. Type III modules have been shown to target and degrade dsDNA, ssDNA and ssRNA and are frequently intertwined with cofunctional accessory genes, including genes encoding CRISPR-associated Rossman Fold (CARF) domains. Using a comparative genomics approach, and defining a Type III association score accounting for coevolution and specificity of flanking genes, we identified and classified 39 new Type III associated gene families. Most archaeal and bacterial Type III modules were seen to be flanked by several accessory genes, around half of which did not encode CARF domains and remain of unknown function. Northern blotting and interference assays in Synechocystis confirmed that one particular non-CARF accessory protein family was involved in crRNA maturation. Non-CARF accessory genes were generally diverse, encoding nuclease, helicase, protease, ATPase, transporter and transmembrane domains with some encoding no known domains. We infer that additional families of non-CARF accessory proteins remain to be found. The method employed is scalable for potential application to metagenomic data once automated pipelines for annotation of CRISPR-Cas systems have been developed. All accessory genes found in this study are presented online in a readily accessible and searchable format for researchers to audit their model organism of choice: http://accessory.crispr.dk .

  1. The unique fold and lability of the [2Fe-2S] clusters of NEET proteins mediate their key functions in health and disease.

    PubMed

    Karmi, Ola; Marjault, Henri-Baptiste; Pesce, Luca; Carloni, Paolo; Onuchic, Jose' N; Jennings, Patricia A; Mittler, Ron; Nechushtai, Rachel

    2018-02-12

    NEET proteins comprise a new class of [2Fe-2S] cluster proteins. In human, three genes encode for NEET proteins: cisd1 encodes mitoNEET (mNT), cisd2 encodes the Nutrient-deprivation autophagy factor-1 (NAF-1) and cisd3 encodes MiNT (Miner2). These recently discovered proteins play key roles in many processes related to normal metabolism and disease. Indeed, NEET proteins are involved in iron, Fe-S, and reactive oxygen homeostasis in cells and play an important role in regulating apoptosis and autophagy. mNT and NAF-1 are homodimeric and reside on the outer mitochondrial membrane. NAF-1 also resides in the membranes of the ER associated mitochondrial membranes (MAM) and the ER. MiNT is a monomer with distinct asymmetry in the molecular surfaces surrounding the clusters. Unlike its paralogs mNT and NAF-1, it resides within the mitochondria. NAF-1 and mNT share similar backbone folds to the plant homodimeric NEET protein (At-NEET), while MiNT's backbone fold resembles a bacterial MiNT protein. Despite the variation of amino acid composition among these proteins, all NEET proteins retained their unique CDGSH domain harboring their unique 3Cys:1His [2Fe-2S] cluster coordination through evolution. The coordinating exposed His was shown to convey the lability to the NEET proteins' [2Fe-2S] clusters. In this minireview, we discuss the NEET fold and its structural elements. Special attention is given to the unique lability of the NEETs' [2Fe-2S] cluster and the implication of the latter to the NEET proteins' cellular and systemic function in health and disease.

  2. Modularity of Plant Metabolic Gene Clusters: A Trio of Linked Genes That Are Collectively Required for Acylation of Triterpenes in Oat[W][OA

    PubMed Central

    Mugford, Sam T.; Louveau, Thomas; Melton, Rachel; Qi, Xiaoquan; Bakht, Saleha; Hill, Lionel; Tsurushima, Tetsu; Honkanen, Suvi; Rosser, Susan J.; Lomonossoff, George P.; Osbourn, Anne

    2013-01-01

    Operon-like gene clusters are an emerging phenomenon in the field of plant natural products. The genes encoding some of the best-characterized plant secondary metabolite biosynthetic pathways are scattered across plant genomes. However, an increasing number of gene clusters encoding the synthesis of diverse natural products have recently been reported in plant genomes. These clusters have arisen through the neo-functionalization and relocation of existing genes within the genome, and not by horizontal gene transfer from microbes. The reasons for clustering are not yet clear, although this form of gene organization is likely to facilitate co-inheritance and co-regulation. Oats (Avena spp) synthesize antimicrobial triterpenoids (avenacins) that provide protection against disease. The synthesis of these compounds is encoded by a gene cluster. Here we show that a module of three adjacent genes within the wider biosynthetic gene cluster is required for avenacin acylation. Through the characterization of these genes and their encoded proteins we present a model of the subcellular organization of triterpenoid biosynthesis. PMID:23532069

  3. Detection with synthetic oligonucleotide probes of nucleotide sequence variations in the genes encoding enterotoxins of Escherichia coli.

    PubMed Central

    Nishibuchi, M; Murakami, A; Arita, M; Jikuya, H; Takano, J; Honda, T; Miwatani, T

    1989-01-01

    We examined variations in the genes encoding heat-stable enterotoxin (ST) and heat-labile enterotoxin (LT) in 88 strains of Escherichia coli isolated from individuals with traveler's diarrhea to find suitable sequences for use as oligonucleotide probes. Four oligonucleotide probes of the gene encoding ST of human origin (STIb or STh), one oligonucleotide probe of the gene encoding ST of porcine origin (STIa or STp), and three oligonucleotide probes of the gene encoding LT of human origin (LTIh) were used in DNA colony hybridization tests. In 15 of 22 strains possessing the STh gene and 28 of 42 strains producing LT, the sequences of all regions tested were identical to the published sequences. One region in the STh gene examined with a 18-mer probe was relatively well conserved and was shown to be closely associated with the enterotoxicity of the E. coli strains in suckling mice. This oligonucleotide, however, hybridized with strains of Vibrio cholerae O1, V. parahaemolyticus, and Yersinia enterocolitica that gave negative results in the suckling mouse assay. PMID:2685027

  4. Emergence of colistin resistance in Enterobacter aerogenes from Croatia.

    PubMed

    Bedenić, Branka; Vranić-Ladavac, Mirna; Venditti, Carolina; Tambić-Andrašević, Arjana; Barišić, Nada; Gužvinec, Marija; Karčić, Natalie; Petrosillo, Nicola; Ladavac, Ranko; di Caro, Antonino

    2018-04-01

    A colistin-resistant Enterobacter aerogenes [study code 12264] was isolated from the tracheal aspirate of a 71-year-old male patient in the General Hospital [GH] in Pula, Croatia. The patient was previously treated in University Hospital Centre in Rijeka with colistin in order to eradicate Acinetobacter baumannii isolate, susceptible only to colistin and tigecycline. Genes encoding ESBLs [bla TEM , bla SHV , bla CTX-M , bla PER-1 ] were screened by PCR. The strain was shown to possess bla CTX-M-15 and bla TEM-1 genes. To asses genes possibly involved in resistance to colistin the chromosomal enconding mgrB gene and the plasmid-mediated mcr-1 and mcr-2 genes were screened as described previously. Mcr-1 and mcr-2 genes were not detected and mgrB gene presented a wild-type sequence. PCR-based Replicon typing method [PBRT] conducted on an E. aerogenes isolate, showed that the strain carried an IncN plasmid. Adaptive mechanisms such as changes of the bacterial cell outer membrane that cause porin decrease or presence of an efflux pump, due to selection pressure exerted by the therapeutic administration of colistin, could be responsible for the development of colistin resistance in our strain, as recently reported in E. aerogenes from France. Due to effective infection control measures, the colistin-resistant strain did not spread to other patients or hospital wards. This is the first report of an ESBL-producing, colistin-resistant E. aerogenes in clinically relevant samples such as endotracheal aspirate and blood culture, showing the presence of this rare resistance profile among Gram-negative bacteria.

  5. Software Communications Architecture (SCA) Compliant Software Defined Radio Design for IEEE 802.16 Wirelessman-OFDMTM Transceiver

    DTIC Science & Technology

    2006-12-01

    Convolutional encoder of rate 1/2 (From [10]). Table 3 shows the puncturing patterns used to derive the different code rates . X precedes Y in the order... convolutional code with puncturing configuration (From [10])......11 Table 4. Mandatory channel coding per modulation (From [10...a concatenation of a Reed– Solomon outer code and a rate -adjustable convolutional inner code . At the transmitter, data shall first be encoded with

  6. Cyclic stretch-induced the cytoskeleton rearrangement and gene expression of cytoskeletal regulators in human periodontal ligament cells.

    PubMed

    Wu, Yaqin; Zhuang, Jiabao; Zhao, Dan; Zhang, Fuqiang; Ma, Jiayin; Xu, Chun

    2017-10-01

    This study aimed to explore the mechanism of the stretch-induced cell realignment and cytoskeletal rearrangement by identifying several mechanoresponsive genes related to cytoskeletal regulators in human PDL cells. After the cells were stretched by 1, 10 and 20% strains for 0.5, 1, 2, 4, 6, 12 or 24 h, the changes of the morphology and content of microfilaments were recorded and calculated. Meanwhile, the expression of 84 key genes encoding cytoskeletal regulators after 6 and 24 h stretches with 20% strain was detected by using real-time PCR array. Western blot was applied to identify the protein expression level of several cytoskeletal regulators encoded by these differentially expressed genes. The confocal fluorescent staining results confirmed that stretch-induced realignment of cells and rearrangement of microfilaments. Among the 84 genes screened, one gene was up-regulated while two genes were down-regulated after 6 h stretch. Meanwhile, three genes were up-regulated while two genes were down-regulated after 24 h stretch. These genes displaying differential expression included genes regulating polymerization/depolymerization of microfilaments (CDC42EP2, FNBP1L, NCK2, PIKFYVE, WASL), polymerization/depolymerization of microtubules (STMN1), interacting between microfilaments and microtubules (MACF1), as well as a phosphatase (PPP1R12B). Among the proteins encoded by these genes, the protein expression level of Cdc42 effector protein-2 (encoded by CDC42EP2) and Stathmin-1 (encoded by STMN1) was down-regulated, while the protein expression level of N-WASP (encoded by WASL) was up-regulated. The present study confirmed the cyclic stretch-induced cellular realignment and rearrangement of microfilaments in the human PDL cells and indicated several force-sensitive genes with regard to cytoskeletal regulators.

  7. A High-Resolution Gene Map of the Chloroplast Genome of the Red Alga Porphyra purpurea.

    PubMed Central

    Reith, M; Munholland, J

    1993-01-01

    Extensive DNA sequencing of the chloroplast genome of the red alga Porphyra purpurea has resulted in the detection of more than 125 genes. Fifty-eight (approximately 46%) of these genes are not found on the chloroplast genomes of land plants. These include genes encoding 17 photosynthetic proteins, three tRNAs, and nine ribosomal proteins. In addition, nine genes encoding proteins related to biosynthetic functions, six genes encoding proteins involved in gene expression, and at least five genes encoding miscellaneous proteins are among those not known to be located on land plant chloroplast genomes. The increased coding capacity of the P. purpurea chloroplast genome, along with other characteristics such as the absence of introns and the conservation of ancestral operons, demonstrate the primitive nature of the P. purpurea chloroplast genome. In addition, evidence for a monophyletic origin of chloroplasts is suggested by the identification of two groups of genes that are clustered in chloroplast genomes but not in cyanobacteria. PMID:12271072

  8. Genome-Wide Architecture of Disease Resistance Genes in Lettuce

    PubMed Central

    Christopoulou, Marilena; Wo, Sebastian Reyes-Chin; Kozik, Alex; McHale, Leah K.; Truco, Maria-Jose; Wroblewski, Tadeusz; Michelmore, Richard W.

    2015-01-01

    Genome-wide motif searches identified 1134 genes in the lettuce reference genome of cv. Salinas that are potentially involved in pathogen recognition, of which 385 were predicted to encode nucleotide binding-leucine rich repeat receptor (NLR) proteins. Using a maximum-likelihood approach, we grouped the NLRs into 25 multigene families and 17 singletons. Forty-one percent of these NLR-encoding genes belong to three families, the largest being RGC16 with 62 genes in cv. Salinas. The majority of NLR-encoding genes are located in five major resistance clusters (MRCs) on chromosomes 1, 2, 3, 4, and 8 and cosegregate with multiple disease resistance phenotypes. Most MRCs contain primarily members of a single NLR gene family but a few are more complex. MRC2 spans 73 Mb and contains 61 NLRs of six different gene families that cosegregate with nine disease resistance phenotypes. MRC3, which is 25 Mb, contains 22 RGC21 genes and colocates with Dm13. A library of 33 transgenic RNA interference tester stocks was generated for functional analysis of NLR-encoding genes that cosegregated with disease resistance phenotypes in each of the MRCs. Members of four NLR-encoding families, RGC1, RGC2, RGC21, and RGC12 were shown to be required for 16 disease resistance phenotypes in lettuce. The general composition of MRCs is conserved across different genotypes; however, the specific repertoire of NLR-encoding genes varied particularly of the rapidly evolving Type I genes. These tester stocks are valuable resources for future analyses of additional resistance phenotypes. PMID:26449254

  9. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    USDA-ARS?s Scientific Manuscript database

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  10. The mitochondrial import gene tomm22 is specifically required for hepatocyte survival and provides a liver regeneration model

    PubMed Central

    Curado, Silvia; Ober, Elke A.; Walsh, Susan; Cortes-Hernandez, Paulina; Verkade, Heather; Koehler, Carla M.; Stainier, Didier Y. R.

    2010-01-01

    SUMMARY Understanding liver development should lead to greater insights into liver diseases and improve therapeutic strategies. In a forward genetic screen for genes regulating liver development in zebrafish, we identified a mutant – oliver – that exhibits liver-specific defects. In oliver mutants, the liver is specified, bile ducts form and hepatocytes differentiate. However, the hepatocytes die shortly after their differentiation, and thus the resulting mutant liver consists mainly of biliary tissue. We identified a mutation in the gene encoding translocase of the outer mitochondrial membrane 22 (Tomm22) as responsible for this phenotype. Mutations in tomm genes have been associated with mitochondrial dysfunction, but most studies on the effect of defective mitochondrial protein translocation have been carried out in cultured cells or unicellular organisms. Therefore, the tomm22 mutant represents an important vertebrate genetic model to study mitochondrial biology and hepatic mitochondrial diseases. We further found that the temporary knockdown of Tomm22 levels by morpholino antisense oligonucleotides causes a specific hepatocyte degeneration phenotype that is reversible: new hepatocytes repopulate the liver as Tomm22 recovers to wild-type levels. The specificity and reversibility of hepatocyte ablation after temporary knockdown of Tomm22 provides an additional model to study liver regeneration, under conditions where most hepatocytes have died. We used this regeneration model to analyze the signaling commonalities between hepatocyte development and regeneration. PMID:20483998

  11. Cytochrome b5 gene and protein of Candida tropicalis and methods relating thereto

    DOEpatents

    Craft, David L.; Madduri, Krishna M.; Loper, John C.

    2003-01-01

    A novel gene has been isolated which encodes cytochrome b5 (CYTb5) protein of the .omega.-hydroxylase complex of C. tropicalis 20336. Vectors including this gene, and transformed host cells are provided. Methods of increasing the production of a CYTb5 protein are also provided which involve transforming a host cell with a gene encoding this protein and culturing the cells. Methods of increasing the production of a dicarboxylic acid are also provided which involve increasing in the host cell the number of genes encoding this protein.

  12. Dominant suppressor mutation bypasses the sphingolipid requirement for growth of Saccharomyces cells at low pH: role of the CWP2 gene.

    PubMed

    Skrzypek, M; Lester, R L; Spielmann, P; Zingg, N; Shelling, J; Dickson, R C

    2000-11-01

    Strains of Saccharomyces cerevisiae termed sphingolipid compensatory (SLC) do not grow at low pH when the cells lack sphingolipids. To begin to understand why sphingolipids are required for growth at low pH, we isolated derivatives of SLC strains, termed low pH resistant (LprR), carrying the LPR suppressor gene that allows growth at pH 4.1 when cells lack sphingolipids. Suppression is due to mutation of a single nuclear gene. The LPR suppressor gene functions, at least in part, by enhancing the ability of cells lacking sphingolipids to generate a net efflux of protons in suspension fluid with a pH range of 4.0-6.0. The LPR suppressor gene also enables cells lacking sphingolipids to maintain their intracellular pH near neutrality when the pH of the suspension fluid is low, unlike cells lacking the suppressor gene, which cannot maintain their intracellular pH in the face of a low external pH. These results demonstrate that some functions(s) of sphingolipids necessary for growth at low pH can be bypassed by a suppressor mutation. Attempts to clone the LPR suppressor gene were not successful, but they led to the isolation of the CWP2 gene, which encodes a major mannoprotein component of the outer cell wall. It was isolated because an increased copy number has the unusual property of increasing the frequency at which LprR strains arise. As we show here, part of the reason for this effect is that the CWP2 gene is essential for generating a net efflux of protons and for controlling intracellular pH in LprR strains that lack sphingolipids. These results suggest new cellular functions for the Cwp2 protein.

  13. Characterization of leptospiral proteins that afford partial protection in hamsters against lethal challenge with Leptospira interrogans.

    PubMed

    Atzingen, Marina V; Gonçales, Amane P; de Morais, Zenaide M; Araújo, Eduardo R; De Brito, Thales; Vasconcellos, Silvio A; Nascimento, Ana L T O

    2010-09-01

    Leptospirosis is a worldwide zoonosis caused by pathogenic Leptospira. The whole-genome sequence of Leptospira interrogans serovar Copenhageni together with bioinformatic tools allow us to search for novel antigen candidates suitable for improved vaccines against leptospirosis. This study focused on three genes encoding conserved hypothetical proteins predicted to be exported to the outer membrane. The genes were amplified by PCR from six predominant pathogenic serovars in Brazil. The genes were cloned and expressed in Escherichia coli strain BL21-SI using the expression vector pDEST17. The recombinant proteins tagged with N-terminal 6xHis were purified by metal-charged chromatography. The proteins were recognized by antibodies present in sera from hamsters that were experimentally infected. Immunization of hamsters followed by challenge with a lethal dose of a virulent strain of Leptospira showed that the recombinant protein rLIC12730 afforded statistically significant protection to animals (44 %), followed by rLIC10494 (40 %) and rLIC12922 (30 %). Immunization with these proteins produced an increase in antibody titres during subsequent boosters, suggesting the involvement of a T-helper 2 response. Although more studies are needed, these data suggest that rLIC12730 and rLIC10494 are promising candidates for a multivalent vaccine for the prevention of leptospirosis.

  14. External Loops at the C Terminus of Erwinia chrysanthemi Pectate Lyase C Are Required for Species-Specific Secretion through the Out Type II Pathway

    PubMed Central

    Lindeberg, Magdalen; Boyd, Carol M.; Keen, Noel T.; Collmer, Alan

    1998-01-01

    The type II secretion system (main terminal branch of the general secretion pathway) is used by diverse gram-negative bacteria to secrete extracellular proteins. Proteins secreted by this pathway are synthesized with an N-terminal signal peptide which is removed upon translocation across the inner membrane, but the signals which target the mature proteins for secretion across the outer membrane are unknown. The plant pathogens Erwinia chrysanthemi and Erwinia carotovora secrete several isozymes of pectate lyase (Pel) by the out-encoded type II pathway. However, these two bacteria cannot secrete Pels encoded by heterologously expressed pel genes from the other species, suggesting the existence of species-specific secretion signals within these proteins. The functional cluster of E. chrysanthemi out genes carried on cosmid pCPP2006 enables Escherichia coli to secrete E. chrysanthemi, but not E. carotovora, Pels. We exploited the high sequence similarity between E. chrysanthemi PelC and E. carotovora Pel1 to construct 15 hybrid proteins in which different regions of PelC were replaced with homologous sequences from Pel1. The differential secretion of these hybrid proteins by E. coli(pCPP2006) revealed M118 to D175 and V215 to C329 as regions required for species-specific secretion of PelC. We propose that the primary targeting signal is contained within the external loops formed by G274 to C329 but is dependent on residues in M118 to D170 and V215 to G274 for proper positioning. PMID:9515910

  15. NadN and e (P4) are essential for utilization of NAD and nicotinamide mononucleotide but not nicotinamide riboside in Haemophilus influenzae.

    PubMed

    Kemmer, G; Reilly, T J; Schmidt-Brauns, J; Zlotnik, G W; Green, B A; Fiske, M J; Herbert, M; Kraiss, A; Schlör, S; Smith, A; Reidl, J

    2001-07-01

    Haemophilus influenzae has an absolute requirement for NAD (factor V) because it lacks almost all the biosynthetic enzymes necessary for the de novo synthesis of that cofactor. Factor V can be provided as either nicotinamide adenosine dinucleotide (NAD), nicotinamide mononucleotide (NMN), or nicotinamide riboside (NR) in vitro, but little is known about the source or the mechanism of uptake of these substrates in vivo. As shown by us earlier, at least two gene products are involved in the uptake of NAD, the outer membrane lipoprotein e (P4), which has phosphatase activity and is encoded by hel, and a periplasmic NAD nucleotidase, encoded by nadN. It has also been observed that the latter gene product is essential for H. influenzae growth on media supplemented with NAD. In this report, we describe the functions and substrates of these two proteins as they act together in an NAD utilization pathway. Data are provided which indicate that NadN harbors not only NAD pyrophosphatase but also NMN 5'-nucleotidase activity. The e (P4) protein is also shown to have NMN 5'-nucleotidase activity, recognizing NMN as a substrate and releasing NR as its product. Insertion mutants of nadN or deletion and site-directed mutants of hel had attenuated growth and a reduced uptake phenotype when NMN served as substrate. A hel and nadN double mutant was only able to grow in the presence of NR, whereas no uptake of NMN was observed.

  16. NadN and e (P4) Are Essential for Utilization of NAD and Nicotinamide Mononucleotide but Not Nicotinamide Riboside in Haemophilus influenzae

    PubMed Central

    Kemmer, Gabriele; Reilly, Thomas J.; Schmidt-Brauns, Joachim; Zlotnik, Gary W.; Green, Bruce A.; Fiske, Michael J.; Herbert, Mark; Kraiß, Anita; Schlör, Stefan; Smith, Arnold; Reidl, Joachim

    2001-01-01

    Haemophilus influenzae has an absolute requirement for NAD (factor V) because it lacks almost all the biosynthetic enzymes necessary for the de novo synthesis of that cofactor. Factor V can be provided as either nicotinamide adenosine dinucleotide (NAD), nicotinamide mononucleotide (NMN), or nicotinamide riboside (NR) in vitro, but little is known about the source or the mechanism of uptake of these substrates in vivo. As shown by us earlier, at least two gene products are involved in the uptake of NAD, the outer membrane lipoprotein e (P4), which has phosphatase activity and is encoded by hel, and a periplasmic NAD nucleotidase, encoded by nadN. It has also been observed that the latter gene product is essential for H. influenzae growth on media supplemented with NAD. In this report, we describe the functions and substrates of these two proteins as they act together in an NAD utilization pathway. Data are provided which indicate that NadN harbors not only NAD pyrophosphatase but also NMN 5′-nucleotidase activity. The e (P4) protein is also shown to have NMN 5′-nucleotidase activity, recognizing NMN as a substrate and releasing NR as its product. Insertion mutants of nadN or deletion and site-directed mutants of hel had attenuated growth and a reduced uptake phenotype when NMN served as substrate. A hel and nadN double mutant was only able to grow in the presence of NR, whereas no uptake of NMN was observed. PMID:11395461

  17. The prenyl-binding protein PrBP/δ: a chaperone participating in intracellular trafficking

    PubMed Central

    Zhang, Houbin; Constantine, Ryan; Frederick, Jeanne M.; Baehr, Wolfgang

    2012-01-01

    Expressed ubiquitously, PrBP/δ functions as chaperone/co-factor in the transport of a subset of prenylated proteins. PrBP/δ features an immunoglobulin-like β-sandwich fold for lipid binding, and interacts with diverse partners. PrBP/δ binds both C-terminal C15 and C20 prenyl side chains of phototransduction polypeptides and small GTP-binding (G) proteins of the Ras superfamily. PrBP/δ also interacts with the small GTPases, ARL2 and ARL3, which act as release factors (GDFs) for prenylated cargo. Targeted deletion of the mouse Pde6d gene encoding PrBP/δ resulted in impeded trafficking to the outer segments of GRK1 and cone PDE6 which are predicted to be farnesylated and geranylgeranylated, respectively. Rod and cone transducin trafficking was largely unaffected. These trafficking defects produce progressive cone-rod dystrophy in the Pde6d−/− mouse. PMID:22960045

  18. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  19. Arabidopsis STERILE APETALA, a multifunctional gene regulating inflorescence, flower, and ovule development

    PubMed Central

    Byzova, Marina V.; Franken, John; Aarts, Mark G.M.; de Almeida-Engler, Janice; Engler, Gilbert; Mariani, Celestina; Van Lookeren Campagne, Michiel M.; Angenent, Gerco C.

    1999-01-01

    A recessive mutation in the Arabidopsis STERILE APETALA (SAP) causes severe aberrations in inflorescence and flower and ovule development. In sap flowers, sepals are carpelloid, petals are short and narrow or absent, and anthers are degenerated. Megasporogenesis, the process of meiotic divisions preceding the female gametophyte formation, is arrested in sap ovules during or just after the first meiotic division. More severe aberrations were observed in double mutants between sap and mutant alleles of the floral homeotic gene APETALA2 (AP2) suggesting that both genes are involved in the initiation of female gametophyte development. Together with the organ identity gene AGAMOUS (AG) SAP is required for the maintenance of floral identity acting in a manner similar to APETALA1. In contrast to the outer two floral organs in sap mutant flowers, normal sepals and petals develop in ag/sap double mutants, indicating that SAP negatively regulates AG expression in the perianth whorls. This supposed cadastral function of SAP is supported by in situ hybridization experiments showing ectopic expression of AG in the sap mutant. We have cloned the SAP gene by transposon tagging and revealed that it encodes a novel protein with sequence motifs, that are also present in plant and animal transcription regulators. Consistent with the mutant phenotype, SAP is expressed in inflorescence and floral meristems, floral organ primordia, and ovules. Taken together, we propose that SAP belongs to a new class of transcription regulators essential for a number of processes in Arabidopsis flower development. PMID:10215627

  20. Genome complexity in the coelacanth is reflected in its adaptive immune system

    USGS Publications Warehouse

    Saha, Nil Ratan; Ota, Tatsuya; Litman, Gary W.; Hansen, John; Parra, Zuly; Hsu, Ellen; Buonocore, Francesco; Canapa, Adriana; Cheng, Jan-Fang; Amemiya, Chris T.

    2014-01-01

    We have analyzed the available genome and transcriptome resources from the coelacanth in order to characterize genes involved in adaptive immunity. Two highly distinctive IgW-encoding loci have been identified that exhibit a unique genomic organization, including a multiplicity of tandemly repeated constant region exons. The overall organization of the IgW loci precludes typical heavy chain class switching. A locus encoding IgM could not be identified either computationally or by using several different experimental strategies. Four distinct sets of genes encoding Ig light chains were identified. This includes a variant sigma-type Ig light chain previously identified only in cartilaginous fishes and which is now provisionally denoted sigma-2. Genes encoding α/β and γ/δ T-cell receptors, and CD3, CD4, and CD8 co-receptors also were characterized. Ig heavy chain variable region genes and TCR components are interspersed within the TCR α/δ locus; this organization previously was reported only in tetrapods and raises questions regarding evolution and functional cooption of genes encoding variable regions. The composition, organization and syntenic conservation of the major histocompatibility complex locus have been characterized. We also identified large numbers of genes encoding cytokines and their receptors, and other genes associated with adaptive immunity. In terms of sequence identity and organization, the adaptive immune genes of the coelacanth more closely resemble orthologous genes in tetrapods than those in teleost fishes, consistent with current phylogenomic interpretations. Overall, the work reported described herein highlights the complexity inherent in the coelacanth genome and provides a rich catalog of immune genes for future investigations.

  1. The Bacillus subtilis ywjI (glpX) gene encodes a class II fructose-1,6-bisphosphatase, functionally equivalent to the class III Fbp enzyme.

    PubMed

    Jules, Matthieu; Le Chat, Ludovic; Aymerich, Stéphane; Le Coq, Dominique

    2009-05-01

    We present here experimental evidence that the Bacillus subtilis ywjI gene encodes a class II fructose-1,6-bisphosphatase, functionally equivalent to the fbp-encoded class III enzyme, and constitutes with the upstream gene, murAB, an operon transcribed at the same level under glycolytic or gluconeogenic conditions.

  2. The Bacillus subtilis ywjI (glpX) Gene Encodes a Class II Fructose-1,6-Bisphosphatase, Functionally Equivalent to the Class III Fbp Enzyme▿

    PubMed Central

    Jules, Matthieu; Le Chat, Ludovic; Aymerich, Stéphane; Le Coq, Dominique

    2009-01-01

    We present here experimental evidence that the Bacillus subtilis ywjI gene encodes a class II fructose-1,6-bisphosphatase, functionally equivalent to the fbp-encoded class III enzyme, and constitutes with the upstream gene, murAB, an operon transcribed at the same level under glycolytic or gluconeogenic conditions. PMID:19270101

  3. Signal transfer through three compartments: transcription initiation of the Escherichia coli ferric citrate transport system from the cell surface.

    PubMed

    Härle, C; Kim, I; Angerer, A; Braun, V

    1995-04-03

    Transport of ferric citrate into cells of Escherichia coli K-12 involves two energy-coupled transport systems, one across the outer membrane and one across the cytoplasmic membrane. Previously, we have shown that ferric citrate does not have to enter the cytoplasm of E. coli K-12 to induce transcription of the fec ferric citrate transport genes. Here we demonstrate that ferric citrate uptake into the periplasmic space between the outer and the cytoplasmic membranes is not required for fec gene induction. Rather, FecA and the TonB, ExbB and ExbD proteins are involved in induction of the fec transport genes independent of their role in ferric citrate transport across the outer membrane. The uptake of ferric citrate into the periplasmic space of fecA and tonB mutants via diffusion through the porin channels did not induce transcription of fec transport genes. Point mutants in FecA displayed the constitutive expression of fec transport genes in the absence of ferric citrate but still required TonB, with the exception of one FecA mutant which showed a TonB-independent induction. The phenotype of the FecA mutants suggests a signal transduction mechanism across three compartments: the outer membrane, the periplasmic space and the cytoplasmic membrane. The signal is triggered upon the interaction of ferric citrate with FecA protein. It is postulated that FecA, TonB, ExbB and ExbD transfer the signal across the outer membrane, while the regulatory protein FecR transmits the signal across the cytoplasmic membrane to FecI in the cytoplasm. FecI serves as a sigma factor which facilitates binding of the RNA polymerase to the fec transport gene promoter upstream of fecA.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. [Virulence determinant of Chromobacterium violaceum].

    PubMed

    Miki, Tsuyoshi

    2014-01-01

    Chromobacterium violaceum is a Gram-negative bacterium that infects humans and animals with fatal sepsis. The infection with C. violaceum is rare in case of those who are healthy, but once established, C. violaceum causes sever disease accompanied by abscess formation in the lungs, liver and spleen. Furthermore, C. violaceum is resistant to a broad range of antibiotics, which in some cases renders the antimicrobial therapy for this infection difficult. Thus, the infection with C. violaceum displays high mortality rates unless initial proper antimicrobial therapy. In contrast, the infection mechanism had completely remained unknown. To this end, we have tried to identify virulence factors-associated with C. violaceum infection. Two distinct type III secretion systems (TTSSs) were thought to be one of the most important virulence factors, which are encoded by Chromobacterium pathogenicity island 1/1a and 2 (Cpi-1/-1a and -2) respectively. Our results have shown that Cpi-1/-1a-encoded TTSS, but not Cpi-2, is indispensable for the virulence in a mouse infection model. C. violaceum caused fulminant hepatitis in a Cpi-1/-1a-encoded TTSS-dependent manner. We next have identified 16 novel effectors secreted from Cpi-1/-1a-encoded TTS machinery. From these effectors, we found that CopE (Chromobacterium outer protein E) has similarities to a guanine nucleotide exchange factor (GEF) for Rho GTPases. CopE acts as GEF for Rac1 and Cdc42, leading to induction of actin cytoskeletal rearrangement. Interestingly, C. violaceum invades cultured human epithelial cells in a CopE-dependent manner. Finally, an inactivation of CopE by disruption of copE gene or amino acid point mutation leading to loss of GEF activity attenuates significantly the mouse virulence of C. violaceum. These results suggest that Cpi-1/-1a-encoded TTSS is a major virulence determinant for C. violaceum infection, and that CopE contributes to the virulence in part of this pathogen.

  5. The cone-dominant retina and the inner ear of zebrafish express the ortholog of CLRN1, the causative gene of human Usher syndrome type 3A.

    PubMed

    Phillips, Jennifer B; Västinsalo, Hanna; Wegner, Jeremy; Clément, Aurélie; Sankila, Eeva-Marja; Westerfield, Monte

    2013-12-01

    Clarin-1 (CLRN1) is the causative gene in Usher syndrome type 3A, an autosomal recessive disorder characterized by progressive vision and hearing loss. CLRN1 encodes Clarin-1, a glycoprotein with homology to the tetraspanin family of proteins. Previous cell culture studies suggest that Clarin-1 localizes to the plasma membrane and interacts with the cytoskeleton. Mouse models demonstrate a role for the protein in mechanosensory hair bundle integrity, but the function of Clarin-1 in hearing remains unclear. Even less is known of its role in vision, because the Clrn1 knockout mouse does not exhibit a retinal phenotype and expression studies in murine retinas have provided conflicting results. Here, we describe cloning and expression analysis of the zebrafish clrn1 gene, and report protein localization of Clarin-1 in auditory and visual cells from embryonic through adult stages. We detect clrn1 transcripts as early as 24h post-fertilization, and expression is maintained through adulthood. In situ hybridization experiments show clrn1 transcripts enriched in mechanosensory hair cells and supporting cells of the inner ear and lateral line organ, photoreceptors, and cells of the inner retina. In mechanosensory hair cells, Clarin-1 is polarized to the apical cell body and the synapses. In the retina, Clarin-1 localizes to lateral cell contacts between photoreceptors and is associated with the outer limiting membrane and subapical processes emanating from Müller glial cells. We also find Clarin-1 protein in the outer plexiform, inner nuclear and ganglion cell layers of the retina. Given the importance of Clarin-1 function in the human retina, it is imperative to find an animal model with a comparable requirement. Our data provide a foundation for exploring the role of Clarin-1 in retinal cell function and survival in a diurnal, cone-dominant species. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. A Molecular-Genetic Study of the Arabidopsis Toc75 Gene Family1

    PubMed Central

    Baldwin, Amy; Wardle, Anthony; Patel, Ramesh; Dudley, Penny; Park, Soon Ki; Twell, David; Inoue, Kentaro; Jarvis, Paul

    2005-01-01

    Toc75 (translocon at the outer envelope membrane of chloroplasts, 75 kD) is the protein translocation channel at the outer envelope membrane of plastids and was first identified in pea (Pisum sativum) using biochemical approaches. The Arabidopsis (Arabidopsis thaliana) genome contains three Toc75-related sequences, termed atTOC75-I, atTOC75-III, and atTOC75-IV, which we studied using a range of molecular, genetic, and biochemical techniques. Expression of atTOC75-III is strongly regulated and at its highest level in young, rapidly expanding tissues. By contrast, atTOC75-IV is expressed uniformly throughout development and at a much lower level than atTOC75-III. The third sequence, atTOC75-I, is a pseudogene that is not expressed due to a gypsy/Ty3 transposon insertion in exon 1, and numerous nonsense, frame-shift, and splice-junction mutations. The expressed genes, atTOC75-III and atTOC75-IV, both encode integral envelope membrane proteins. Unlike atToc75-III, the smaller atToc75-IV protein is not processed upon targeting to the envelope, and its insertion does not require ATP at high concentrations. The atTOC75-III gene is essential for viability, since homozygous atToc75-III knockout mutants (termed toc75-III) could not be identified, and aborted seeds were observed at a frequency of approximately 25% in the siliques of self-pollinated toc75-III heterozygotes. Homozygous toc75-III embryos were found to abort at the two-cell stage. Homozygous atToc75-IV knockout plants (termed toc75-IV) displayed no obvious visible phenotypes. However, structural abnormalities were observed in the etioplasts of toc75-IV seedlings and atTOC75-IV overexpressing lines, and toc75-IV plants were less efficient at deetiolation than wild type. These results suggest some role for atToc75-IV during growth in the dark. PMID:15908591

  7. The mate recognition protein gene mediates reproductive isolation and speciation in the Brachionus plicatilis cryptic species complex

    PubMed Central

    2012-01-01

    Background Chemically mediated prezygotic barriers to reproduction likely play an important role in speciation. In facultatively sexual monogonont rotifers from the Brachionus plicatilis cryptic species complex, mate recognition of females by males is mediated by the Mate Recognition Protein (MRP), a globular glycoprotein on the surface of females, encoded by the mmr-b gene family. In this study, we sequenced mmr-b copies from 27 isolates representing 11 phylotypes of the B. plicatilis species complex, examined the mode of evolution and selection of mmr-b, and determined the relationship between mmr-b genetic distance and mate recognition among isolates. Results Isolates of the B. plicatilis species complex have 1–4 copies of mmr-b, each composed of 2–9 nearly identical tandem repeats. The repeats within a gene copy are generally more similar than are gene copies among phylotypes, suggesting concerted evolution. Compared to housekeeping genes from the same isolates, mmr-b has accumulated only half as many synonymous differences but twice as many non-synonymous differences. Most of the amino acid differences between repeats appear to occur on the outer face of the protein, and these often result in changes in predicted patterns of phosphorylation. However, we found no evidence of positive selection driving these differences. Isolates with the most divergent copies were unable to mate with other isolates and rarely self-crossed. Overall the degree of mate recognition was significantly correlated with the genetic distance of mmr-b. Conclusions Discrimination of compatible mates in the B. plicatilis species complex is determined by proteins encoded by closely related copies of a single gene, mmr-b. While concerted evolution of the tandem repeats in mmr-b may function to maintain identity, it can also lead to the rapid spread of a mutation through all copies in the genome and thus to reproductive isolation. The mmr-b gene is evolving rapidly, and novel alleles may be maintained and increase in frequency via asexual reproduction. Our analyses indicate that mate recognition, controlled by MMR-B, may drive reproductive isolation and allow saltational sympatric speciation within the B. plicatilis cryptic species complex, and that this process may be largely neutral. PMID:22852831

  8. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    PubMed Central

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  9. Bacillus subtilis 168 Contains Two Differentially Regulated Genes Encoding l-Asparaginase

    PubMed Central

    Fisher, Susan H.; Wray, Lewis V.

    2002-01-01

    Expression of the two Bacillus subtilis genes encoding l-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional l-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second l-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression. PMID:11914346

  10. Bacillus subtilis 168 contains two differentially regulated genes encoding L-asparaginase.

    PubMed

    Fisher, Susan H; Wray, Lewis V

    2002-04-01

    Expression of the two Bacillus subtilis genes encoding L-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional L-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second L-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression.

  11. Recombinant DNA encoding a desulfurization biocatalyst

    DOEpatents

    Rambosek, John; Piddington, Chris S.; Kovacevich, Brian R.; Young, Kevin D.; Denome, Sylvia A.

    1994-01-01

    This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous.

  12. A highly divergent gene cluster in honey bees encodes a novel silk family.

    PubMed

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  13. Photocontrol of the expression of genes encoding chlorophyll a/b binding proteins and small subunit of ribulose-1,5-bisphosphate carboxylase in etiolated seedlings of Lycopersicon esculentum (L. ) and Nicotiana tabacum (L. )

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wehmeyer, B.; Cashmore, A.R.; Schaefer, E.

    Phytochrome and the blue ultraviolet-A photoreceptor control light-induced expression of genes encoding the chlorophyll a/b binding protein of photosystem II and photosystem I and the genes for the small subunit of the ribulose-1,5-bisphosphate carboxylase in etiolated seedlings of Lycopersicon esculentum (tomato) and Nicotiana tabacum (tobacco). A high irradiance response also controls the induction of these genes. Genes encoding photosystem II- and I-associated chlorophyll a/b binding proteins both exhibit a transient rapid increase in expression in response to light pulse or to continuous irradiation. In contrast, genes encoding the small subunit exhibit a continuous increase in expression in response to light.more » These distinct expression characteristics are shown to reflect differences at the level of transcription.« less

  14. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    NASA Astrophysics Data System (ADS)

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.

    2016-06-01

    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

  15. Analysis of the arabinoxylan arabinofuranohydrolase gene family in barley does not support their involvement in the remodelling of endosperm cell walls during development.

    PubMed

    Laidlaw, Hunter K C; Lahnstein, Jelle; Burton, Rachel A; Fincher, Geoffrey B; Jobling, Stephen A

    2012-05-01

    Arabinoxylan arabinofuranohydrolases (AXAHs) are family GH51 enzymes that have been implicated in the removal of arabinofuranosyl residues from the (1,4)-β-xylan backbone of heteroxylans. Five genes encoding barley AXAHs range in size from 4.6 kb to 7.1 kb and each contains 16 introns. The barley HvAXAH genes map to chromosomes 2H, 4H, and 5H. A small cluster of three HvAXAH genes is located on chromosome 4H and there is evidence for gene duplication and the presence of pseudogenes in barley. The cDNAs corresponding to barley and wheat AXAH genes were cloned, and transcript levels of the genes were profiled across a range of tissues at different developmental stages. Two HvAXAH cDNAs that were successfully expressed in Nicotiana benthamiana leaves exhibited similar activities against 4-nitrophenyl α-L-arabinofuranoside, but HvAXAH2 activity was significantly higher against wheat flour arabinoxylan, compared with HvAXAH1. HvAXAH2 also displayed activity against (1,5)-α-L-arabinopentaose and debranched arabinan. Western blotting with an anti-HvAXAH antibody was used to define further the locations of the AXAH enzymes in developing barley grain, where high levels were detected in the outer layers of the grain but little or no protein was detected in the endosperm. The chromosomal locations of the genes do not correspond to any previously identified genomic regions shown to influence heteroxylan structure. The data are therefore consistent with a role for AXAH in depolymerizing arabinoxylans in maternal tissues during grain development, but do not provide compelling evidence for a role in remodelling arabinoxylans during endosperm or coleoptile development in barley as previously proposed.

  16. Positive and negative regulatory regions control the spatial distribution of polygalacturonase transcription in tomato fruit pericarp.

    PubMed Central

    Montgomery, J; Pollard, V; Deikman, J; Fischer, R L

    1993-01-01

    The tomato fruit consists of a thick, fleshy pericarp composed predominantly of highly vacuolated parenchymatous cells, which surrounds the seeds. During ripening, the activation of gene expression results in dramatic biochemical and physiological changes in the pericarp. The polygalacturonase (PG) gene, unlike many fruit ripening-induced genes, is not activated by the increase in ethylene hormone concentration associated with the onset of ripening. To investigate ethylene concentration-independent gene transcription in ripe tomato fruit, we analyzed the expression of chimeric PG promoter-beta-glucuronidase (GUS) reporter gene fusions in transgenic tomato plants. We determined that a 1.4-kb PG promoter directs ripening-regulated transcription in outer pericarp but not in inner pericarp cells, with a sharp boundary of PG promoter activity located midway through the pericarp. Promoter deletion analysis indicated that a minimum of three promoter regions influence the spatial regulation of PG transcription. A positive regulatory region from -231 to -134 promotes gene transcription in the outer pericarp of ripe fruit. A second positive regulatory region from -806 to -443 extends gene activity to the inner pericarp. However, a negative regulatory region from -1411 to -1150 inhibits gene transcription in the inner pericarp. DNase I footprint analysis showed that nuclear proteins in unripe and ripe fruit interact with DNA sequences within each of these three regulatory regions. Thus, temporal and spatial control of PG transcription is mediated by the interaction of negative and positive regulatory promoter elements, resulting in gene activity in the outer pericarp but not the inner pericarp of ripe tomato fruit. The expression pattern of PG suggests that, although they are morphologically similar, there is a fundamental difference between the parenchymatous cells within the inner and outer pericarp. PMID:8400876

  17. Host Defense Peptide Resistance Contributes to Colonization and Maximal Intestinal Pathology by Crohn's Disease-Associated Adherent-Invasive Escherichia coli

    PubMed Central

    McPhee, Joseph B.; Small, Cherrie L.; Reid-Yu, Sarah A.; Brannon, John R.; Le Moual, Hervé

    2014-01-01

    Host defense peptides secreted by colonocytes and Paneth cells play a key role in innate host defenses in the gut. In Crohn's disease, the burden of tissue-associated Escherichia coli commonly increases at epithelial surfaces where host defense peptides concentrate, suggesting that this bacterial population might actively resist this mechanism of bacterial killing. Adherent-invasive E. coli (AIEC) is associated with Crohn's disease; however, the colonization determinants of AIEC in the inflamed gut are undefined. Here, we establish that host defense peptide resistance contributes to host colonization by Crohn's-associated AIEC. We identified a plasmid-encoded genomic island (called PI-6) in AIEC strain NRG857c that confers high-level resistance to α-helical cationic peptides and α- and β-defensins. Deletion of PI-6 sensitized strain NRG857c to these host defense molecules, reduced its competitive fitness in a mouse model of infection, and attenuated its ability to induce cecal pathology. This phenotype is due to two genes in PI-6, arlA, which encodes a Mig-14 family protein implicated in defensin resistance, and arlC, an OmpT family outer membrane protease. Implicit in these findings are new bacterial targets whose inhibition might limit AIEC burden and disease in the gut. PMID:24866805

  18. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    PubMed

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Recombinant DNA encoding a desulfurization biocatalyst

    DOEpatents

    Rambosek, J.; Piddington, C.S.; Kovacevich, B.R.; Young, K.D.; Denome, S.A.

    1994-10-18

    This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous. 13 figs.

  20. Structure, Function, Interaction, Co-evolution of Rice Blast Resistance Genes

    USDA-ARS?s Scientific Manuscript database

    Rice blast disease caused by the fungal pathogen Magnaporthe oryzae is one of the most destructive rice diseases worldwide. Resistance (R) genes to blast encode proteins that detect pathogen signaling molecules encoded by M. oryzae avirulence (AVR) genes. R genes can be a single or a member of clu...

  1. A Homozygous Missense Mutation in TGM5 Abolishes Epidermal Transglutaminase 5 Activity and Causes Acral Peeling Skin Syndrome

    PubMed Central

    Cassidy, Andrew J.; van Steensel, Maurice A. M.; Steijlen, Peter M.; van Geel, Michel; Velden, Jaap van der; Morley, Susan M.; Terrinoni, Alessandro; Melino, Gerry; Candi, Eleonora; McLean, W. H. Irwin

    2005-01-01

    Peeling skin syndrome is an autosomal recessive genodermatosis characterized by the shedding of the outer epidermis. In the acral form, the dorsa of the hands and feet are predominantly affected. Ultrastructural analysis has revealed tissue separation at the junction between the granular cells and the stratum corneum in the outer epidermis. Genomewide linkage analysis in a consanguineous Dutch kindred mapped the gene to 15q15.2 in the interval between markers D15S1040 and D15S1016. Two homozygous missense mutations, T109M and G113C, were found in TGM5, which encodes transglutaminase 5 (TG5), in all affected persons in two unrelated families. The mutation was present on the same haplotype in both kindreds, indicating a probable ancestral mutation. TG5 is strongly expressed in the epidermal granular cells, where it cross-links a variety of structural proteins in the terminal differentiation of the epidermis to form the cornified cell envelope. An established, in vitro, biochemical cross-linking assay revealed that, although T109M is not pathogenic, G113C completely abolishes TG5 activity. Three-dimensional modeling of TG5 showed that G113C lies close to the catalytic domain, and, furthermore, that this glycine residue is conserved in all known transglutaminases, which is consistent with pathogenicity. Other families with more-widespread peeling skin phenotypes lacked TGM5 mutations. This study identifies the first causative gene in this heterogeneous group of skin disorders and demonstrates that the protein cross-linking function performed by TG5 is vital for maintaining cell-cell adhesion between the outermost layers of the epidermis. PMID:16380904

  2. CozE is a member of the MreCD complex that directs cell elongation in Streptococcus pneumoniae.

    PubMed

    Fenton, Andrew K; El Mortaji, Lamya; Lau, Derek T C; Rudner, David Z; Bernhardt, Thomas G

    2016-12-12

    Most bacterial cells are surrounded by a peptidoglycan cell wall that is essential for their integrity. The major synthases of this exoskeleton are called penicillin-binding proteins (PBPs) 1,2 . Surprisingly little is known about how cells control these enzymes, given their importance as drug targets. In the model Gram-negative bacterium Escherichia coli, outer membrane lipoproteins are critical activators of the class A PBPs (aPBPs) 3,4 , bifunctional synthases capable of polymerizing and crosslinking peptidoglycan to build the exoskeletal matrix 1 . Regulators of PBP activity in Gram-positive bacteria have yet to be discovered but are likely to be distinct due to the absence of an outer membrane. To uncover Gram-positive PBP regulatory factors, we used transposon-sequencing (Tn-Seq) 5 to screen for mutations affecting the growth of Streptococcus pneumoniae cells when the aPBP synthase PBP1a was inactivated. Our analysis revealed a set of genes that were essential for growth in wild-type cells yet dispensable when pbp1a was deleted. The proteins encoded by these genes include the conserved cell wall elongation factors MreC and MreD 2,6,7 , as well as a membrane protein of unknown function (SPD_0768) that we have named CozE (coordinator of zonal elongation). Our results indicate that CozE is a member of the MreCD complex of S. pneumoniae that directs the activity of PBP1a to the midcell plane where it promotes zonal cell elongation and normal morphology. CozE homologues are broadly distributed among bacteria, suggesting that they represent a widespread family of morphogenic proteins controlling cell wall biogenesis by the PBPs.

  3. Helicobacter pylori HP1512 Is a Nickel-Responsive NikR-Regulated Outer Membrane Protein▿

    PubMed Central

    Davis, Gregg S.; Flannery, Erika L.; Mobley, Harry L. T.

    2006-01-01

    Helicobacter pylori is dependent upon the production of the highly abundant and active metalloenzyme urease for colonization of the human stomach. Thus, H. pylori has an absolute requirement for the transition metal nickel, a required cofactor for urease. To investigate the contribution of genes that are factors in this process, microarray analysis comparing the transcriptome of wild-type H. pylori 26695 cultured in brucella broth containing fetal calf serum (BBF) alone or supplemented with 100 μM NiCl2 suggested that HP1512 is repressed in the presence of 100 μM supplemental nickel. When measured by comparative real-time quantitative PCR (qPCR), HP1512 transcription was reduced 43-fold relative to the value for the wild type when cultured in BBF supplemented with 10 μM NiCl2. When grown in unsupplemented BBF, urease activity of an HP1512::cat mutant was significantly reduced compared to the wild type, 4.9 ± 0.5 μmol/min/mg of protein (n = 7) and 17.1 ± 4.9 μmol/min/mg of protein (n = 13), respectively (P < 0.0001). In silico analysis of the HP1511-HP1512 (HP1511-1512) intergenic region identified a putative NikR operator upstream of HP1512. Gel shift analysis with purified recombinant NikR verified nickel-dependent binding of H. pylori NikR to the HP1511-1512 intergenic region. Furthermore, comparative real-time qPCR of four nickel-related genes suggests that mutation of HP1512 results in reduced intracellular nickel concentration relative to wild-type H. pylori 26695. Taken together, these data suggest that HP1512 encodes a NikR-nickel-regulated outer membrane protein. PMID:17030579

  4. Ear Deformations Give Bats a Physical Mechanism for Fast Adaptation of Ultrasonic Beam Patterns

    NASA Astrophysics Data System (ADS)

    Gao, Li; Balakrishnan, Sreenath; He, Weikai; Yan, Zhen; Müller, Rolf

    2011-11-01

    A large number of mammals, including humans, have intricate outer ear shapes that diffract incoming sound in a direction- and frequency-specific manner. Through this physical process, the outer ear shapes encode sound-source information into the sensory signals from each ear. Our results show that horseshoe bats could dynamically control these diffraction processes through fast nonrigid ear deformations. The bats’ ear shapes can alter between extreme configurations in about 100 ms and thereby change their acoustic properties in ways that would suit different acoustic sensing tasks.

  5. Molecular genetics of Erwinia amylovora involved in the development of fire blight.

    PubMed

    Oh, Chang-Sik; Beer, Steven V

    2005-12-15

    The bacterial plant pathogen, Erwinia amylovora, causes the devastating disease known as fire blight in some Rosaceous plants like apple, pear, quince, raspberry and several ornamentals. Knowledge of the factors affecting the development of fire blight has mushroomed in the last quarter century. On the molecular level, genes encoding a Hrp type III secretion system, genes encoding enzymes involved in synthesis of extracellular polysaccharides and genes facilitating the growth of E. amylovora in its host plants have been characterized. The Hrp pathogenicity island, delimited by genes suggesting horizontal gene transfer, is composed of four distinct regions, the hrp/hrc region, the HEE (Hrp effectors and elicitors) region, the HAE (Hrp-associated enzymes) region, and the IT (Island transfer) region. The Hrp pathogenicity island encodes a Hrp type III secretion system (TTSS), which delivers several proteins from bacteria to plant apoplasts or cytoplasm. E. amylovora produces two exopolysaccharides, amylovoran and levan, which cause the characteristic fire blight wilting symptom in host plants. In addition, other genes, and their encoded proteins, have been characterized as virulence factors of E. amylovora that encode enzymes facilitating sorbitol metabolism, proteolytic activity and iron harvesting. This review summarizes our understanding of the genes and gene products of E. amylovora that are involved in the development of the fire blight disease.

  6. The Drosophila pigmentation gene pink (p) encodes a homologue of human Hermansky-Pudlak syndrome 5 (HPS5).

    PubMed

    Falcón-Pérez, Juan M; Romero-Calderón, Rafael; Brooks, Elizabeth S; Krantz, David E; Dell'Angelica, Esteban C

    2007-02-01

    Lysosome-related organelles comprise a group of specialized intracellular compartments that include melanosomes and platelet dense granules (in mammals) and eye pigment granules (in insects). In humans, the biogenesis of these organelles is defective in genetic disorders collectively known as Hermansky-Pudlak syndrome (HPS). Patients with HPS-2, and two murine HPS models, carry mutations in genes encoding subunits of adaptor protein (AP)-3. Other genes mutated in rodent models include those encoding VPS33A and Rab38. Orthologs of all of these genes in Drosophila melanogaster belong to the 'granule group' of eye pigmentation genes. Other genes associated with HPS encode subunits of three complexes of unknown function, named biogenesis of lysosome-related organelles complex (BLOC)-1, -2 and -3, for which the Drosophila counterparts had not been characterized. Here, we report that the gene encoding the Drosophila ortholog of the HPS5 subunit of BLOC-2 is identical to the granule group gene pink (p), which was first studied in 1910 but had not been identified at the molecular level. The phenotype of pink mutants was exacerbated by mutations in AP-3 subunits or in the orthologs of VPS33A and Rab38. These results validate D. melanogaster as a genetic model to study the function of the BLOCs.

  7. Chlorella viruses contain genes encoding a complete polyamine biosynthetic pathway

    PubMed Central

    Baumann, Sascha; Sander, Adrianne; Gurnon, James R.; Yanai-Balser, Giane; VanEtten, James L.; Piotrowski, Markus

    2007-01-01

    Two genes encoding the putative polyamine biosynthetic enzymes agmatine iminohydrolase (AIH) and N-carbamoylputrescine amidohydrolase (CPA) were cloned from the chloroviruses PBCV-1, NY-2A and MT325. They were expressed in Escherichia coli to form C-terminal (His)6-tagged proteins and the recombinant proteins were purified by Ni2+- binding affinity chromatography. The biochemical properties of the two enzymes are similar to AIH and CPA enzymes from Arabidopsis thaliana and Pseudomonas aeruginosa. Together with the previously known virus genes encoding ornithine/arginine decarboxlyase (ODC/ADC) and homospermidine synthase, the chloroviruses have genes that encode a complete set of functional enzymes that synthesize the rare polyamine homospermidine from arginine via agmatine, N-carbamoylputrescine and putrescine. The PBCV-1 aih and cpa genes are expressed early during virus infection together with the odc/adc gene, suggesting that biosynthesis of putrescine is important in early stages of viral replication. The aih and cpa genes are widespread in the chlorella viruses. PMID:17101165

  8. A Comprehensive Analysis of Nuclear-Encoded Mitochondrial Genes in Schizophrenia.

    PubMed

    Gonçalves, Vanessa F; Cappi, Carolina; Hagen, Christian M; Sequeira, Adolfo; Vawter, Marquis P; Derkach, Andriy; Zai, Clement C; Hedley, Paula L; Bybjerg-Grauholm, Jonas; Pouget, Jennie G; Cuperfain, Ari B; Sullivan, Patrick F; Christiansen, Michael; Kennedy, James L; Sun, Lei

    2018-05-01

    The genetic risk factors of schizophrenia (SCZ), a severe psychiatric disorder, are not yet fully understood. Multiple lines of evidence suggest that mitochondrial dysfunction may play a role in SCZ, but comprehensive association studies are lacking. We hypothesized that variants in nuclear-encoded mitochondrial genes influence susceptibility to SCZ. We conducted gene-based and gene-set analyses using summary association results from the Psychiatric Genomics Consortium Schizophrenia Phase 2 (PGC-SCZ2) genome-wide association study comprising 35,476 cases and 46,839 control subjects. We applied the MAGMA method to three sets of nuclear-encoded mitochondrial genes: oxidative phosphorylation genes, other nuclear-encoded mitochondrial genes, and genes involved in nucleus-mitochondria crosstalk. Furthermore, we conducted a replication study using the iPSYCH SCZ sample of 2290 cases and 21,621 control subjects. In the PGC-SCZ2 sample, 1186 mitochondrial genes were analyzed, among which 159 had p values < .05 and 19 remained significant after multiple testing correction. A meta-analysis of 818 genes combining the PGC-SCZ2 and iPSYCH samples resulted in 104 nominally significant and nine significant genes, suggesting a polygenic model for the nuclear-encoded mitochondrial genes. Gene-set analysis, however, did not show significant results. In an in silico protein-protein interaction network analysis, 14 mitochondrial genes interacted directly with 158 SCZ risk genes identified in PGC-SCZ2 (permutation p = .02), and aldosterone signaling in epithelial cells and mitochondrial dysfunction pathways appeared to be overrepresented in this network of mitochondrial and SCZ risk genes. This study provides evidence that specific aspects of mitochondrial function may play a role in SCZ, but we did not observe its broad involvement even using a large sample. Copyright © 2018 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  9. The ribosomal protein genes and Minute loci of Drosophila melanogaster

    PubMed Central

    Marygold, Steven J; Roote, John; Reuter, Gunter; Lambertsson, Andrew; Ashburner, Michael; Millburn, Gillian H; Harrison, Paul M; Yu, Zhan; Kenmochi, Naoya; Kaufman, Thomas C; Leevers, Sally J; Cook, Kevin R

    2007-01-01

    Background Mutations in genes encoding ribosomal proteins (RPs) have been shown to cause an array of cellular and developmental defects in a variety of organisms. In Drosophila melanogaster, disruption of RP genes can result in the 'Minute' syndrome of dominant, haploinsufficient phenotypes, which include prolonged development, short and thin bristles, and poor fertility and viability. While more than 50 Minute loci have been defined genetically, only 15 have so far been characterized molecularly and shown to correspond to RP genes. Results We combined bioinformatic and genetic approaches to conduct a systematic analysis of the relationship between RP genes and Minute loci. First, we identified 88 genes encoding 79 different cytoplasmic RPs (CRPs) and 75 genes encoding distinct mitochondrial RPs (MRPs). Interestingly, nine CRP genes are present as duplicates and, while all appear to be functional, one member of each gene pair has relatively limited expression. Next, we defined 65 discrete Minute loci by genetic criteria. Of these, 64 correspond to, or very likely correspond to, CRP genes; the single non-CRP-encoding Minute gene encodes a translation initiation factor subunit. Significantly, MRP genes and more than 20 CRP genes do not correspond to Minute loci. Conclusion This work answers a longstanding question about the molecular nature of Minute loci and suggests that Minute phenotypes arise from suboptimal protein synthesis resulting from reduced levels of cytoribosomes. Furthermore, by identifying the majority of haplolethal and haplosterile loci at the molecular level, our data will directly benefit efforts to attain complete deletion coverage of the D. melanogaster genome. PMID:17927810

  10. BBSome function is required for both the morphogenesis and maintenance of the photoreceptor outer segment

    PubMed Central

    Hsu, Ying; Kim, Gunhee; Zhang, Qihong; Datta, Poppy; Seo, Seongjin

    2017-01-01

    Genetic mutations disrupting the structure and function of primary cilia cause various inherited retinal diseases in humans. Bardet-Biedl syndrome (BBS) is a genetically heterogeneous, pleiotropic ciliopathy characterized by retinal degeneration, obesity, postaxial polydactyly, intellectual disability, and genital and renal abnormalities. To gain insight into the mechanisms of retinal degeneration in BBS, we developed a congenital knockout mouse of Bbs8, as well as conditional mouse models in which function of the BBSome (a protein complex that mediates ciliary trafficking) can be temporally inactivated or restored. We demonstrate that BBS mutant mice have defects in retinal outer segment morphogenesis. We further demonstrate that removal of Bbs8 in adult mice affects photoreceptor function and disrupts the structural integrity of the outer segment. Notably, using a mouse model in which a gene trap inhibiting Bbs8 gene expression can be removed by an inducible FLP recombinase, we show that when BBS8 is restored in immature retinas with malformed outer segments, outer segment extension can resume normally and malformed outer segment discs are displaced distally by normal outer segment structures. Over time, the retinas of the rescued mice become morphologically and functionally normal, indicating that there is a window of plasticity when initial retinal outer segment morphogenesis defects can be ameliorated. PMID:29049287

  11. Identifying metabolic enzymes with multiple types of association evidence

    PubMed Central

    Kharchenko, Peter; Chen, Lifeng; Freund, Yoav; Vitkup, Dennis; Church, George M

    2006-01-01

    Background Existing large-scale metabolic models of sequenced organisms commonly include enzymatic functions which can not be attributed to any gene in that organism. Existing computational strategies for identifying such missing genes rely primarily on sequence homology to known enzyme-encoding genes. Results We present a novel method for identifying genes encoding for a specific metabolic function based on a local structure of metabolic network and multiple types of functional association evidence, including clustering of genes on the chromosome, similarity of phylogenetic profiles, gene expression, protein fusion events and others. Using E. coli and S. cerevisiae metabolic networks, we illustrate predictive ability of each individual type of association evidence and show that significantly better predictions can be obtained based on the combination of all data. In this way our method is able to predict 60% of enzyme-encoding genes of E. coli metabolism within the top 10 (out of 3551) candidates for their enzymatic function, and as a top candidate within 43% of the cases. Conclusion We illustrate that a combination of genome context and other functional association evidence is effective in predicting genes encoding metabolic enzymes. Our approach does not rely on direct sequence homology to known enzyme-encoding genes, and can be used in conjunction with traditional homology-based metabolic reconstruction methods. The method can also be used to target orphan metabolic activities. PMID:16571130

  12. Molecular characterization, light-dependent expression, and cellular localization of a host vacuolar-type H+-ATPase (VHA) subunit A in the giant clam, Tridacna squamosa, indicate the involvement of the host VHA in the uptake of inorganic carbon and its supply to the symbiotic zooxanthellae.

    PubMed

    Ip, Yuen K; Hiong, Kum C; Lim, Leon J Y; Choo, Celine Y L; Boo, Mel V; Wong, Wai P; Neo, Mei L; Chew, Shit F

    2018-06-15

    The giant clam, Tridacna squamosa, represents a clam-zooxanthellae association. In light, the host clam and the symbiotic zooxanthellae conduct light-enhanced calcification and photosynthesis, respectively. We had cloned the cDNA coding sequence of a Vacuolar-type Proton ATPase (VHA) subunit A, ATP6V1A, from T. squamosa, whereby the VHA is an electrogenic transporter that actively 'pumps' H + out of the cell. The ATP6V1A of T. squamosa comprised 1866 bp, encoding a protein of 622 amino acids and 69.9 kDa, and had a host-origin. Its gene expression was strong in the ctenidium and the colorful outer mantle, but weak in the whitish inner mantle, corroborating a previous proposition that VHA might have a trivial role in light-enhanced calcification. Light exposure led to significant increases in the gene and protein expression levels of ATP6V1A/ATP6V1A in the ctenidium and the outer mantle. In the ctenidium, the ATP6V1A was localized in the apical epithelia of the filaments and tertiary water channels, indicating that the VHA could participate in the increased excretion of H + produced during light-enhanced calcification. Additionally, the excreted H + would augment HCO 3 - dehydration in the external medium and facilitate the uptake of CO 2 by the ctenidium during insolation. In the outer mantle, the ATP6V1A was detected in intracellular vesicles in a type of cells, presumably iridocytes, surrounding the zooxanthellal tubules, and in the apical epithelium of zooxanthellal tubules. Hence, the host VHA could participate in the transfer of inorganic carbon from the hemolymph to the luminal fluid of the tubules by increasing the supply of H + for the dehydration of HCO 3 - to CO 2 during insolation to benefit the photosynthesizing zooxanthellae. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    PubMed

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  14. Seedless fruits and the disruption of a conserved genetic pathway in angiosperm ovule development

    PubMed Central

    Lora, Jorge; Hormaza, José I.; Herrero, María; Gasser, Charles S.

    2011-01-01

    Although the biological function of fruiting is the production and dissemination of seeds, humans have developed seedless fruits in a number of plant species to facilitate consumption. Here we describe a unique spontaneous seedless mutant (Thai seedless; Ts) of Annona squamosa (sugar apple), a member of the early-divergent magnoliid angiosperm clade. Ovules (seed precursors) of the mutant lack the outer of two normal integuments, a phenocopy of the inner no outer (ino) mutant of Arabidopsis thaliana. Cloning of the INO ortholog from A. squamosa confirmed conservation of the outer integument-specific expression pattern of this gene between the two species. All regions of the gene were detectable in wild-type A. squamosa and in other members of this genus. However, no region of the INO gene could be detected in Ts plants, indicating apparent deletion of the INO locus. These results provide a case of a candidate gene approach revealing the apparent molecular basis of a useful agronomic trait (seedless fruit) in a crop species, and indicate conservation of the role of a critical regulator of ovule development between eudicots and more ancient lineages of angiosperms. The outer integument is one synapomorphy of angiosperms separating them from other extant seed plants, and the results suggest that the evolution of this structure was contemporaneous with the derivation of INO from ancestral YABBY genes. Thus, a unique lateral structure appears to have coevolved with a novel gene family member essential for the structure's formation. PMID:21402944

  15. Secretion Trap Tagging of Secreted and Membrane-Spanning Proteins Using Arabidopsis Gene Traps

    Treesearch

    Andrew T. Groover; Joseph R. Fontana; Juana M. Arroyo; Cristina Yordan; W. Richard McCombie; Robert A. Martienssen

    2003-01-01

    Secreted and membrane-spanning proteins play fundamental roles in plant development but pose challenges for genetic identification and characterization. We describe a "secretion trap" screen for gene trap insertions in genes encoding proteins routed through the secretory pathway. The gene trap transposon encodes a ß-glucuronidase reporter enzyme...

  16. A deep auto-encoder model for gene expression prediction.

    PubMed

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  17. The FupA/B protein uniquely facilitates transport of ferrous iron and siderophore-associated ferric iron across the outer membrane of Francisella tularensis live vaccine strain

    PubMed Central

    Sen, Bhaswati

    2014-01-01

    Francisella tularensis is a highly infectious Gram-negative pathogen that replicates intracellularly within the mammalian host. One of the factors associated with virulence of F. tularensis is the protein FupA that mediates high-affinity transport of ferrous iron across the outer membrane. Together with its paralogue FslE, a siderophore–ferric iron transporter, FupA supports survival of the pathogen in the host by providing access to the essential nutrient iron. The FupA orthologue in the attenuated live vaccine strain (LVS) is encoded by the hybrid gene fupA/B, the product of an intergenic recombination event that significantly contributes to attenuation of the strain. We used 55Fe transport assays with mutant strains complemented with the different paralogues to show that the FupA/B protein of LVS retains the capacity for high-affinity transport of ferrous iron, albeit less efficiently than FupA of virulent strain Schu S4. 55Fe transport assays using purified siderophore and siderophore-dependent growth assays on iron-limiting agar confirmed previous findings that FupA/B also contributes to siderophore-mediated ferric iron uptake. These assays further demonstrated that the LVS FslE protein is a weaker siderophore–ferric iron transporter than the orthologue from Schu S4, and may be a result of the sequence variation between the two proteins. Our results indicate that iron-uptake mechanisms in LVS differ from those in Schu S4 and that functional differences in the outer membrane iron transporters have distinct effects on growth under iron limitation. PMID:24307666

  18. New insights into the mechanism of chloroplast protein import and its integration with protein quality control, organelle biogenesis and development

    PubMed Central

    Schnell, Danny J.

    2014-01-01

    The translocons at the outer (TOC) and inner (TIC) envelope membranes of chloroplasts mediate the targeting and import of several thousand nuclear encoded preproteins that are required for organelle biogenesis and homeostasis. The cytosolic events in preprotein targeting remain largely unknown, although cytoplasmic chaperones have been proposed to facilitate delivery to the TOC complex. Preprotein recognition is mediated by the TOC GTPase receptors, Toc159 and Toc34. The receptors constitute a GTP-regulated switch, which initiates membrane translocation via Toc75, a member of the OMP85 (Outer Membrane Protein 85)/TpsB (two partner secretion system B) family of bacterial, plastid and mitochondrial β-barrel outer membrane proteins. The TOC receptor systems have diversified to recognize distinct sets of preproteins, thereby maximizing the efficiency of targeting in response to changes in gene expression during developmental and physiological events that impact organelle function. The TOC complex interacts with the TIC translocon to allow simultaneous translocation of preproteins across the envelope. Two inner membrane complexes, the Tic110 and 1 MDa complexes, have both been implicated as constituents of the TIC translocon, and it remains to be determined how they interact to form the TIC channel and assemble the import-associated chaperone network in the stroma that drives import across the envelope membranes. This review will focus on recent developments in our understanding of the mechanisms and diversity of the TOC-TIC systems. Our goal is to incorporate these recent studies with previous work and present updated or revised models for the function of TOC-TIC in protein import. PMID:25174336

  19. Evaluation of protective potential of Yersinia pestis outer membrane protein antigens as possible candidates for a new-generation recombinant plague vaccine.

    PubMed

    Erova, Tatiana E; Rosenzweig, Jason A; Sha, Jian; Suarez, Giovanni; Sierra, Johanna C; Kirtley, Michelle L; van Lier, Christina J; Telepnev, Maxim V; Motin, Vladimir L; Chopra, Ashok K

    2013-02-01

    Plague caused by Yersinia pestis manifests itself in bubonic, septicemic, and pneumonic forms. Although the U.S. Food and Drug Administration recently approved levofloxacin, there is no approved human vaccine against plague. The capsular antigen F1 and the low-calcium-response V antigen (LcrV) of Y. pestis represent excellent vaccine candidates; however, the inability of the immune responses to F1 and LcrV to provide protection against Y. pestis F1(-) strains or those which harbor variants of LcrV is a significant concern. Here, we show that the passive transfer of hyperimmune sera from rats infected with the plague bacterium and rescued by levofloxacin protected naive animals against pneumonic plague. Furthermore, 10 to 12 protein bands from wild-type (WT) Y. pestis CO92 reacted with the aforementioned hyperimmune sera upon Western blot analysis. Based on mass spectrometric analysis, four of these proteins were identified as attachment invasion locus (Ail/OmpX), plasminogen-activating protease (Pla), outer membrane protein A (OmpA), and F1. The genes encoding these proteins were cloned, and the recombinant proteins purified from Escherichia coli for immunization purposes before challenging mice and rats with either the F1(-) mutant or WT CO92 in bubonic and pneumonic plague models. Although antibodies to Ail and OmpA protected mice against bubonic plague when challenged with the F1(-) CO92 strain, Pla antibodies were protective against pneumonic plague. In the rat model, antibodies to Ail provided protection only against pneumonic plague after WT CO92 challenge. Together, the addition of Y. pestis outer membrane proteins to a new-generation recombinant vaccine could provide protection against a wide variety of Y. pestis strains.

  20. The Borrelia afzelii outer membrane protein BAPKO_0422 binds human factor-H and is predicted to form a membrane-spanning β-barrel

    PubMed Central

    Dyer, Adam; Brown, Gemma; Stejskal, Lenka; Laity, Peter R.; Bingham, Richard J.

    2015-01-01

    The deep evolutionary history of the Spirochetes places their branch point early in the evolution of the diderms, before the divergence of the present day Proteobacteria. As a spirochete, the morphology of the Borrelia cell envelope shares characteristics of both Gram-positive and Gram-negative bacteria. A thin layer of peptidoglycan, tightly associated with the cytoplasmic membrane, is surrounded by a more labile outer membrane (OM). This OM is rich in lipoproteins but with few known integral membrane proteins. The outer membrane protein A (OmpA) domain is an eight-stranded membrane-spanning β-barrel, highly conserved among the Proteobacteria but so far unknown in the Spirochetes. In the present work, we describe the identification of four novel OmpA-like β-barrels from Borrelia afzelii, the most common cause of erythema migrans (EM) rash in Europe. Structural characterization of one these proteins (BAPKO_0422) by SAXS and CD indicate a compact globular structure rich in β-strand consistent with a monomeric β-barrel. Ab initio molecular envelopes calculated from the scattering profile are consistent with homology models and demonstrate that BAPKO_0422 adopts a peanut shape with dimensions 25×45 Å (1 Å=0.1 nm). Deviations from the standard C-terminal signature sequence are apparent; in particular the C-terminal phenylalanine residue commonly found in Proteobacterial OM proteins is replaced by isoleucine/leucine or asparagine. BAPKO_0422 is demonstrated to bind human factor H (fH) and therefore may contribute to immune evasion by inhibition of the complement response. Encoded by chromosomal genes, these proteins are highly conserved between Borrelia subspecies and may be of diagnostic or therapeutic value. PMID:26181365

  1. Evaluation of Protective Potential of Yersinia pestis Outer Membrane Protein Antigens as Possible Candidates for a New-Generation Recombinant Plague Vaccine

    PubMed Central

    Erova, Tatiana E.; Rosenzweig, Jason A.; Sha, Jian; Suarez, Giovanni; Sierra, Johanna C.; Kirtley, Michelle L.; van Lier, Christina J.; Telepnev, Maxim V.; Motin, Vladimir L.

    2013-01-01

    Plague caused by Yersinia pestis manifests itself in bubonic, septicemic, and pneumonic forms. Although the U.S. Food and Drug Administration recently approved levofloxacin, there is no approved human vaccine against plague. The capsular antigen F1 and the low-calcium-response V antigen (LcrV) of Y. pestis represent excellent vaccine candidates; however, the inability of the immune responses to F1 and LcrV to provide protection against Y. pestis F1− strains or those which harbor variants of LcrV is a significant concern. Here, we show that the passive transfer of hyperimmune sera from rats infected with the plague bacterium and rescued by levofloxacin protected naive animals against pneumonic plague. Furthermore, 10 to 12 protein bands from wild-type (WT) Y. pestis CO92 reacted with the aforementioned hyperimmune sera upon Western blot analysis. Based on mass spectrometric analysis, four of these proteins were identified as attachment invasion locus (Ail/OmpX), plasminogen-activating protease (Pla), outer membrane protein A (OmpA), and F1. The genes encoding these proteins were cloned, and the recombinant proteins purified from Escherichia coli for immunization purposes before challenging mice and rats with either the F1− mutant or WT CO92 in bubonic and pneumonic plague models. Although antibodies to Ail and OmpA protected mice against bubonic plague when challenged with the F1− CO92 strain, Pla antibodies were protective against pneumonic plague. In the rat model, antibodies to Ail provided protection only against pneumonic plague after WT CO92 challenge. Together, the addition of Y. pestis outer membrane proteins to a new-generation recombinant vaccine could provide protection against a wide variety of Y. pestis strains. PMID:23239803

  2. Involvement of Superoxide Dismutase in Spore Coat Assembly in Bacillus subtilis

    PubMed Central

    Henriques, Adriano O.; Melsen, Lawrence R.; Moran, Charles P.

    1998-01-01

    Endospores of Bacillus subtilis are enclosed in a proteinaceous coat which can be differentiated into a thick, striated outer layer and a thinner, lamellar inner layer. We found that the N-terminal sequence of a 25-kDa protein present in a preparation of spore coat proteins matched that of the Mn-dependent superoxide dismutase (SOD) encoded by the sodA locus. sodA is transcribed throughout the growth and sporulation of a wild-type strain and is responsible for the SOD activity detected in total cell extracts prepared from B. subtilis. Disruption of the sodA locus produced a mutant that lacked any detectable SOD activity during vegetative growth and sporulation. The sodA mutant was not impaired in the ability to form heat- or lysozyme-resistant spores. However, examination of the coat layers of sodA mutant spores revealed increased extractability of the tyrosine-rich outer coat protein CotG. We showed that this condition was not accompanied by augmented transcription of the cotG gene in sporulating cells of the sodA mutant. We conclude that SodA is required for the assembly of CotG into the insoluble matrix of the spore and suggest that CotG is covalently cross-linked into the insoluble matrix by an oxidative reaction dependent on SodA. Ultrastructural analysis revealed that the inner coat formed by a sodA mutant was incomplete. Moreover, the outer coat lacked the characteristic striated appearance of wild-type spores, a pattern that was accentuated in a cotG mutant. These observations suggest that the SodA-dependent formation of the insoluble matrix containing CotG is largely responsible for the striated appearance of this coat layer. PMID:9573176

  3. Analysis and Characterization of Proteins Associated with Outer Membrane Vesicles Secreted by Cronobacter spp.

    PubMed Central

    Kothary, Mahendra H.; Gopinath, Gopal R.; Gangiredla, Jayanthi; Rallabhandi, Prasad V.; Harrison, Lisa M.; Yan, Qiong Q.; Chase, Hannah R.; Lee, Boram; Park, Eunbi; Yoo, YeonJoo; Chung, Taejung; Finkelstein, Samantha B.; Negrete, Flavia J.; Patel, Isha R.; Carter, Laurenda; Sathyamoorthy, Venugopal; Fanning, Séamus; Tall, Ben D.

    2017-01-01

    Little is known about secretion of outer membrane vesicles (OMVs) by Cronobacter. In this study, OMVs isolated from Cronobacter sakazakii, Cronobacter turicensis, and Cronobacter malonaticus were examined by electron microscopy (EM) and their associated outer membrane proteins (OMP) and genes were analyzed by SDS-PAGE, protein sequencing, BLAST, PCR, and DNA microarray. EM of stained cells revealed that the OMVs are secreted as pleomorphic micro-vesicles which cascade from the cell's surface. SDS-PAGE analysis identified protein bands with molecular weights of 18 kDa to >100 kDa which had homologies to OMPs such as GroEL; OmpA, C, E, F, and X; MipA proteins; conjugative plasmid transfer protein; and an outer membrane auto-transporter protein (OMATP). PCR analyses showed that most of the OMP genes were present in all seven Cronobacter species while a few genes (OMATP gene, groEL, ompC, mipA, ctp, and ompX) were absent in some phylogenetically-related species. Microarray analysis demonstrated sequence divergence among the OMP genes that was not captured by PCR. These results support previous findings that OmpA and OmpX may be involved in virulence of Cronobacter, and are packaged within secreted OMVs. These results also suggest that other OMV-packaged OMPs may be involved in roles such as stress response, cell wall and plasmid maintenance, and extracellular transport. PMID:28232819

  4. Sec13 safeguards the integrity of the endoplasmic reticulum and organogenesis of the digestive system in zebrafish.

    PubMed

    Niu, Xubo; Gao, Chuan; Jan Lo, Li; Luo, Yue; Meng, Chunmei; Hong, Jian; Hong, Wanjin; Peng, Jinrong

    2012-07-15

    The Sec13-Sec31 heterotetramer serves as the outer coat in the COPII complex, which mediates protein trafficking from the endoplasmic reticulum (ER) to the Golgi apparatus. Although it has been studied in depth in yeast and cultured cells, the role of COPII in organogenesis in a multicellular organism has not. We report here that a zebrafish sec13(sq198) mutant, which exhibits a phenotype of hypoplastic digestive organs, has a mutation in the sec13 gene. The mutant gene encodes a carboxyl-terminus-truncated Sec13 that loses its affinity to Sec31a, which leads to disintegration of the ER structure in various differentiated cells in sec13(sq198), including chondrocytes, intestinal epithelial cells and hepatocytes. Disruption of the ER structure activates an unfolded protein response that eventually causes the cells to undergo cell-cycle arrest and cell apoptosis, which arrest the growth of developing digestive organs in the mutant. Our data provide the first direct genetic evidence that COPII function is essential for the organogenesis of the digestive system. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Expression of a cloned lipopolysaccharide antigen from Neisseria gonorrhoeae on the surface of Escherichia coli K-12.

    PubMed Central

    Palermo, D A; Evans, T M; Clark, V L

    1987-01-01

    A gonococcal gene bank maintained in Escherichia coli K-12 was screened by colony immunoblotting, and a transformant expressing a surface antigen reactive to anti-gonococcal outer membrane antiserum was isolated. The isolate carried a recombinant plasmid, pTME6, consisting of approximately 9 kilobases of Neisseria gonorrhoeae DNA inserted into the BamHI site of pBR322. Surface labeling of E. coli HB101(pTME6) confirmed that the antigen was expressed on the E. coli cell surface. The antigenic material was resistant to proteinase K digestion and sensitive to periodate oxidation, indicating that the material was carbohydrate. Purified lipopolysaccharide (LPS) from HB101(pTME6) produced a unique band on silver-stained polyacrylamide gels that contained immunoreactive material as seen on Western blots of LPS samples. Only two of three E. coli LPS mutant strains carrying pTME6 reacted with the antigonococcal antiserum, suggesting that a certain E. coli core structure is necessary for antigen expression. We conclude that pTME6 contains one or more gonococcal genes encoding an LPS core biosynthetic enzyme(s) which can modify E. coli core LPS to produce a gonococcuslike epitope(s). Images PMID:3117695

  6. Disulfide Bond Formation and ToxR Activity in Vibrio cholerae

    PubMed Central

    Fengler, Vera H. I.; Boritsch, Eva C.; Tutz, Sarah; Seper, Andrea; Ebner, Hanna; Roier, Sandro; Schild, Stefan; Reidl, Joachim

    2012-01-01

    Virulence factor production in Vibrio cholerae is complex, with ToxRS being an important part of the regulatory cascade. Additionally, ToxR is the transcriptional regulator for the genes encoding the major outer membrane porins OmpU and OmpT. ToxR is a transmembrane protein and contains two cysteine residues in the periplasmic domain. This study addresses the influence of the thiol-disulfide oxidoreductase system DsbAB, ToxR cysteine residues and ToxR/ToxS interaction on ToxR activity. The results show that porin production correlates with ToxR intrachain disulfide bond formation, which depends on DsbAB. In contrast, formation of ToxR intrachain or interchain disulfide bonds is dispensable for virulence factor production and in vivo colonization. This study further reveals that in the absence of ToxS, ToxR interchain disulfide bond formation is facilitated, whereat cysteinyl dependent homo- and oligomerization of ToxR is suppressed if ToxS is coexpressed. In summary, new insights into gene regulation by ToxR are presented, demonstrating a mechanism by which ToxR activity is linked to a DsbAB dependent intrachain disulfide bond formation. PMID:23144706

  7. Molecular evolution of nitrogen assimilatory enzymes in marine prasinophytes.

    PubMed

    Ghoshroy, Sohini; Robertson, Deborah L

    2015-01-01

    Nitrogen assimilation is a highly regulated process requiring metabolic coordination of enzymes and pathways in the cytosol, chloroplast, and mitochondria. Previous studies of prasinophyte genomes revealed that genes encoding nitrate and ammonium transporters have a complex evolutionary history involving both vertical and horizontal transmission. Here we examine the evolutionary history of well-conserved nitrogen-assimilating enzymes to determine if a similar complex history is observed. Phylogenetic analyses suggest that genes encoding glutamine synthetase (GS) III in the prasinophytes evolved by horizontal gene transfer from a member of the heterokonts. In contrast, genes encoding GSIIE, a canonical vascular plant and green algal enzyme, were found in the Micromonas genomes but have been lost from Ostreococcus. Phylogenetic analyses placed the Micromonas GSIIs in a larger chlorophyte/vascular plant clade; a similar topology was observed for ferredoxin-dependent nitrite reductase (Fd-NiR), indicating the genes encoding GSII and Fd-NiR in these prasinophytes evolved via vertical transmission. Our results show that genes encoding the nitrogen-assimilating enzymes in Micromonas and Ostreococcus have been differentially lost and as well as recruited from different evolutionary lineages, suggesting that the regulation of nitrogen assimilation in prasinophytes will differ from other green algae.

  8. Living colors in the gray mold pathogen Botrytis cinerea: codon-optimized genes encoding green fluorescent protein and mCherry, which exhibit bright fluorescence.

    PubMed

    Leroch, Michaela; Mernke, Dennis; Koppenhoefer, Dieter; Schneider, Prisca; Mosbach, Andreas; Doehlemann, Gunther; Hahn, Matthias

    2011-05-01

    The green fluorescent protein (GFP) and its variants have been widely used in modern biology as reporters that allow a variety of live-cell imaging techniques. So far, GFP has rarely been used in the gray mold fungus Botrytis cinerea because of low fluorescence intensity. The codon usage of B. cinerea genes strongly deviates from that of commonly used GFP-encoding genes and reveals a lower GC content than other fungi. In this study, we report the development and use of a codon-optimized version of the B. cinerea enhanced GFP (eGFP)-encoding gene (Bcgfp) for improved expression in B. cinerea. Both the codon optimization and, to a smaller extent, the insertion of an intron resulted in higher mRNA levels and increased fluorescence. Bcgfp was used for localization of nuclei in germinating spores and for visualizing host penetration. We further demonstrate the use of promoter-Bcgfp fusions for quantitative evaluation of various toxic compounds as inducers of the atrB gene encoding an ABC-type drug efflux transporter of B. cinerea. In addition, a codon-optimized mCherry-encoding gene was constructed which yielded bright red fluorescence in B. cinerea.

  9. Meta-omic signatures of microbial metal and nitrogen cycling in marine oxygen minimum zones

    PubMed Central

    Glass, Jennifer B.; Kretz, Cecilia B.; Ganesh, Sangita; Ranjan, Piyush; Seston, Sherry L.; Buck, Kristen N.; Landing, William M.; Morton, Peter L.; Moffett, James W.; Giovannoni, Stephen J.; Vergin, Kevin L.; Stewart, Frank J.

    2015-01-01

    Iron (Fe) and copper (Cu) are essential cofactors for microbial metalloenzymes, but little is known about the metalloenyzme inventory of anaerobic marine microbial communities despite their importance to the nitrogen cycle. We compared dissolved O2, NO3−, NO2−, Fe and Cu concentrations with nucleic acid sequences encoding Fe and Cu-binding proteins in 21 metagenomes and 9 metatranscriptomes from Eastern Tropical North and South Pacific oxygen minimum zones and 7 metagenomes from the Bermuda Atlantic Time-series Station. Dissolved Fe concentrations increased sharply at upper oxic-anoxic transition zones, with the highest Fe:Cu molar ratio (1.8) occurring at the anoxic core of the Eastern Tropical North Pacific oxygen minimum zone and matching the predicted maximum ratio based on data from diverse ocean sites. The relative abundance of genes encoding Fe-binding proteins was negatively correlated with O2, driven by significant increases in genes encoding Fe-proteins involved in dissimilatory nitrogen metabolisms under anoxia. Transcripts encoding cytochrome c oxidase, the Fe- and Cu-containing terminal reductase in aerobic respiration, were positively correlated with O2 content. A comparison of the taxonomy of genes encoding Fe- and Cu-binding vs. bulk proteins in OMZs revealed that Planctomycetes represented a higher percentage of Fe genes while Thaumarchaeota represented a higher percentage of Cu genes, particularly at oxyclines. These results are broadly consistent with higher relative abundance of genes encoding Fe-proteins in the genome of a marine planctomycete vs. higher relative abundance of genes encoding Cu-proteins in the genome of a marine thaumarchaeote. These findings highlight the importance of metalloenzymes for microbial processes in oxygen minimum zones and suggest preferential Cu use in oxic habitats with Cu > Fe vs. preferential Fe use in anoxic niches with Fe > Cu. PMID:26441925

  10. Meta-omic signatures of microbial metal and nitrogen cycling in marine oxygen minimum zones.

    PubMed

    Glass, Jennifer B; Kretz, Cecilia B; Ganesh, Sangita; Ranjan, Piyush; Seston, Sherry L; Buck, Kristen N; Landing, William M; Morton, Peter L; Moffett, James W; Giovannoni, Stephen J; Vergin, Kevin L; Stewart, Frank J

    2015-01-01

    Iron (Fe) and copper (Cu) are essential cofactors for microbial metalloenzymes, but little is known about the metalloenyzme inventory of anaerobic marine microbial communities despite their importance to the nitrogen cycle. We compared dissolved O2, NO[Formula: see text], NO[Formula: see text], Fe and Cu concentrations with nucleic acid sequences encoding Fe and Cu-binding proteins in 21 metagenomes and 9 metatranscriptomes from Eastern Tropical North and South Pacific oxygen minimum zones and 7 metagenomes from the Bermuda Atlantic Time-series Station. Dissolved Fe concentrations increased sharply at upper oxic-anoxic transition zones, with the highest Fe:Cu molar ratio (1.8) occurring at the anoxic core of the Eastern Tropical North Pacific oxygen minimum zone and matching the predicted maximum ratio based on data from diverse ocean sites. The relative abundance of genes encoding Fe-binding proteins was negatively correlated with O2, driven by significant increases in genes encoding Fe-proteins involved in dissimilatory nitrogen metabolisms under anoxia. Transcripts encoding cytochrome c oxidase, the Fe- and Cu-containing terminal reductase in aerobic respiration, were positively correlated with O2 content. A comparison of the taxonomy of genes encoding Fe- and Cu-binding vs. bulk proteins in OMZs revealed that Planctomycetes represented a higher percentage of Fe genes while Thaumarchaeota represented a higher percentage of Cu genes, particularly at oxyclines. These results are broadly consistent with higher relative abundance of genes encoding Fe-proteins in the genome of a marine planctomycete vs. higher relative abundance of genes encoding Cu-proteins in the genome of a marine thaumarchaeote. These findings highlight the importance of metalloenzymes for microbial processes in oxygen minimum zones and suggest preferential Cu use in oxic habitats with Cu > Fe vs. preferential Fe use in anoxic niches with Fe > Cu.

  11. Syntrophic growth of Desulfovibrio alaskensis requires genes for H2 and formate metabolism as well as those for flagellum and biofilm formation.

    PubMed

    Krumholz, Lee R; Bradstock, Peter; Sheik, Cody S; Diao, Yiwei; Gazioglu, Ozcan; Gorby, Yuri; McInerney, Michael J

    2015-04-01

    In anaerobic environments, mutually beneficial metabolic interactions between microorganisms (syntrophy) are essential for oxidation of organic matter to carbon dioxide and methane. Syntrophic interactions typically involve a microorganism degrading an organic compound to primary fermentation by-products and sources of electrons (i.e., formate, hydrogen, or nanowires) and a partner producing methane or respiring the electrons via alternative electron accepting processes. Using a transposon gene mutant library of the sulfate-reducing Desulfovibrio alaskensis G20, we screened for mutants incapable of serving as the electron-accepting partner of the butyrate-oxidizing bacterium, Syntrophomonas wolfei. A total of 17 gene mutants of D. alaskensis were identified as incapable of serving as the electron-accepting partner. The genes identified predominantly fell into three categories: membrane surface assembly, flagellum-pilus synthesis, and energy metabolism. Among these genes required to serve as the electron-accepting partner, the glycosyltransferase, pilus assembly protein (tadC), and flagellar biosynthesis protein showed reduced biofilm formation, suggesting that each of these components is involved in cell-to-cell interactions. Energy metabolism genes encoded proteins primarily involved in H2 uptake and electron cycling, including a rhodanese-containing complex that is phylogenetically conserved among sulfate-reducing Deltaproteobacteria. Utilizing an mRNA sequencing approach, analysis of transcript abundance in wild-type axenic and cocultures confirmed that genes identified as important for serving as the electron-accepting partner were more highly expressed under syntrophic conditions. The results imply that sulfate-reducing microorganisms require flagellar and outer membrane components to effectively couple to their syntrophic partners; furthermore, H2 metabolism is essential for syntrophic growth of D. alaskensis G20. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  12. Syntrophic Growth of Desulfovibrio alaskensis Requires Genes for H2 and Formate Metabolism as Well as Those for Flagellum and Biofilm Formation

    PubMed Central

    Bradstock, Peter; Sheik, Cody S.; Diao, Yiwei; Gazioglu, Ozcan; Gorby, Yuri; McInerney, Michael J.

    2015-01-01

    In anaerobic environments, mutually beneficial metabolic interactions between microorganisms (syntrophy) are essential for oxidation of organic matter to carbon dioxide and methane. Syntrophic interactions typically involve a microorganism degrading an organic compound to primary fermentation by-products and sources of electrons (i.e., formate, hydrogen, or nanowires) and a partner producing methane or respiring the electrons via alternative electron accepting processes. Using a transposon gene mutant library of the sulfate-reducing Desulfovibrio alaskensis G20, we screened for mutants incapable of serving as the electron-accepting partner of the butyrate-oxidizing bacterium, Syntrophomonas wolfei. A total of 17 gene mutants of D. alaskensis were identified as incapable of serving as the electron-accepting partner. The genes identified predominantly fell into three categories: membrane surface assembly, flagellum-pilus synthesis, and energy metabolism. Among these genes required to serve as the electron-accepting partner, the glycosyltransferase, pilus assembly protein (tadC), and flagellar biosynthesis protein showed reduced biofilm formation, suggesting that each of these components is involved in cell-to-cell interactions. Energy metabolism genes encoded proteins primarily involved in H2 uptake and electron cycling, including a rhodanese-containing complex that is phylogenetically conserved among sulfate-reducing Deltaproteobacteria. Utilizing an mRNA sequencing approach, analysis of transcript abundance in wild-type axenic and cocultures confirmed that genes identified as important for serving as the electron-accepting partner were more highly expressed under syntrophic conditions. The results imply that sulfate-reducing microorganisms require flagellar and outer membrane components to effectively couple to their syntrophic partners; furthermore, H2 metabolism is essential for syntrophic growth of D. alaskensis G20. PMID:25616787

  13. The Yersinia pestis gcvB gene encodes two small regulatory RNA molecules

    PubMed Central

    McArthur, Sarah D; Pulvermacher, Sarah C; Stauffer, George V

    2006-01-01

    Background In recent years it has become clear that small non-coding RNAs function as regulatory elements in bacterial virulence and bacterial stress responses. We tested for the presence of the small non-coding GcvB RNAs in Y. pestis as possible regulators of gene expression in this organism. Results In this study, we report that the Yersinia pestis KIM6 gcvB gene encodes two small RNAs. Transcription of gcvB is activated by the GcvA protein and repressed by the GcvR protein. The gcvB-encoded RNAs are required for repression of the Y. pestis dppA gene, encoding the periplasmic-binding protein component of the dipeptide transport system, showing that the GcvB RNAs have regulatory activity. A deletion of the gcvB gene from the Y. pestis KIM6 chromosome results in a decrease in the generation time of the organism as well as a change in colony morphology. Conclusion The results of this study indicate that the Y. pestis gcvB gene encodes two small non-coding regulatory RNAs that repress dppA expression. A gcvB deletion is pleiotropic, suggesting that the sRNAs are likely involved in controlling genes in addition to dppA. PMID:16768793

  14. Drug discovery strategies to outer membrane targets in Gram-negative pathogens.

    PubMed

    Brown, Dean G

    2016-12-15

    This review will cover selected recent examples of drug discovery strategies which target the outer membrane (OM) of Gram-negative bacteria either by disruption of outer membrane function or by inhibition of essential gene products necessary for outer membrane assembly. Significant advances in pathway elucidation, structural biology and molecular inhibitor designs have created new opportunities for drug discovery within this target-class space. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Screening for ATM Mutations in an African-American Population to Identify a Predictor of Breast Cancer Susceptibility

    DTIC Science & Technology

    2006-07-01

    ATM genetic variant identified affects radiosensitivity and levels of the protein encoded by the ATM gene for each mutation examined. 15. SUBJECT...women without breast cancer. An additional objective is to determine the functional impact upon the protein encoded by the ATM gene for each mutation ...each ATM variant identified affects radiosensitivity and levels of the protein encoded by the ATM gene for mutations identified. Body STATEMENT

  16. Isolation of a gene encoding a novel spectinomycin phosphotransferase from Legionella pneumophila.

    PubMed

    Suter, T M; Viswanathan, V K; Cianciotto, N P

    1997-06-01

    A gene capable of conferring spectinomycin resistance was isolated from Legionella pneumophila, the agent of Legionnaires' disease. The gene (aph) encoded a 36-kDa protein which has similarity to aminoglycoside phosphotransferases. Biochemical analysis confirmed that aph encodes a phosphotransferase which modifies spectinomycin but not hygromycin, kanamycin, or streptomycin. The strain that was the source of aph demonstrated resistance to spectinomycin, and Southern hybridizations determined that aph also exists in other legionellae.

  17. Isolation of a gene encoding a novel spectinomycin phosphotransferase from Legionella pneumophila.

    PubMed Central

    Suter, T M; Viswanathan, V K; Cianciotto, N P

    1997-01-01

    A gene capable of conferring spectinomycin resistance was isolated from Legionella pneumophila, the agent of Legionnaires' disease. The gene (aph) encoded a 36-kDa protein which has similarity to aminoglycoside phosphotransferases. Biochemical analysis confirmed that aph encodes a phosphotransferase which modifies spectinomycin but not hygromycin, kanamycin, or streptomycin. The strain that was the source of aph demonstrated resistance to spectinomycin, and Southern hybridizations determined that aph also exists in other legionellae. PMID:9174205

  18. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    PubMed

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  19. Mitrocomin from the jellyfish Mitrocoma cellularia with deleted C-terminal tyrosine reveals a higher bioluminescence activity compared to wild type photoprotein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burakova, Ludmila P.; Natashin, Pavel V.; Markova, Svetlana V.

    The full-length cDNA genes encoding five new isoforms of Ca2 +-regulated photoprotein mitrocomin from a small tissue sample of the outer bell margin containing photocytes of only one specimen of the luminous jellyfish Mitrocoma cellularia were cloned, sequenced, and characterized after their expression in Escherichia coli and subsequent purification. The analysis of cDNA nucleotide sequences encoding mitrocomin isoforms allowed suggestion that two isoforms might be the products of two allelic genes differing in one amino acid residue (64R/Q) whereas other isotypes appear as a result of transcriptional mutations. In addition, the crystal structure of mitrocomin was determined at 1.30 Åmore » resolution which expectedly revealed a high similarity with the structures of other hydromedusan photoproteins. Although mitrocomin isoforms reveal a high degree of identity of amino acid sequences, they vary in specific bioluminescence activities. At that, all isotypes displayed the identical bioluminescence spectra (473–474 nm with no shoulder at 400 nm). Fluorescence spectra of Ca2 +-discharged mitrocomins were almost identical to their light emission spectra similar to the case of Ca2 +-discharged aequorin, but different from Ca2 +-discharged obelins and clytin which fluorescence is red-shifted by 25–30 nm from bioluminescence spectra. The main distinction of mitrocomin from other hydromedusan photoproteins is an additional Tyr at the C-terminus. Using site-directed mutagenesis, we showed that this Tyr is not important for bioluminescence because its deletion even increases specific activity and efficiency of apo-mitrocomin conversion into active photoprotein, in contrast to C-terminal Pro of other photoproteins. Since genes in a population generally exist as different isoforms, it makes us anticipate the cloning of even more isoforms of mitrocomin and other hydromedusan photoproteins with different bioluminescence properties.« less

  20. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    PubMed

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  1. Two pheromone precursor genes are transcriptionally expressed in the homothallic ascomycete Sordaria macrospora.

    PubMed

    Pöggeler, S

    2000-06-01

    In order to analyze the involvement of pheromones in cell recognition and mating in a homothallic fungus, two putative pheromone precursor genes, named ppg1 and ppg2, were isolated from a genomic library of Sordaria macrospora. The ppg1 gene is predicted to encode a precursor pheromone that is processed by a Kex2-like protease to yield a pheromone that is structurally similar to the alpha-factor of the yeast Saccharomyces cerevisiae. The ppg2 gene encodes a 24-amino-acid polypeptide that contains a putative farnesylated and carboxy methylated C-terminal cysteine residue. The sequences of the predicted pheromones display strong structural similarity to those encoded by putative pheromones of heterothallic filamentous ascomycetes. Both genes are expressed during the life cycle of S. macrospora. This is the first description of pheromone precursor genes encoded by a homothallic fungus. Southern-hybridization experiments indicated that ppg1 and ppg2 homologues are also present in other homothallic ascomycetes.

  2. Arxula adeninivorans (Blastobotrys adeninivorans) — A Dimorphic Yeast of Great Biotechnological Potential

    NASA Astrophysics Data System (ADS)

    Böer, Erik; Steinborn, Gerhard; Florschütz, Kristina; Körner, Martina; Gellissen, Gerd; Kunze, Gotthard

    The dimorphic ascomycetous yeast Arxula adeninivorans exhibits some unusual properties. Being a thermo- and halotolerant species it is able to assimilate and ferment many compounds as sole carbon and/or nitrogen source. It utilises n-alkanes and is capable of degrading starch. Due to these unusual biochemical properties A. adeninivorans can be exploited as a gene donor for the production of enzymes with attractive biotechnological characteristics. Examples of A. adeninivorans-derived genes that are overexpressed include the ALIP1 gene encoding a secretory lipase, the AINV encoding invertase, the AXDH encoding xylitol dehydrogenase and the APHY encoding a secretory phosphatase with phytase activity.

  3. High levels of retinal membrane docosahexaenoic acid increase susceptibility to stress-induced degenerations⃞

    PubMed Central

    Tanito, Masaki; Brush, Richard S.; Elliott, Michael H.; Wicker, Lea D.; Henry, Kimberly R.; Anderson, Robert E.

    2009-01-01

    The fat-1 gene cloned from C. elegans encodes an n-3 fatty acid desaturase that converts n-6 to n-3 PUFA. Mice carrying the fat-1 transgene and wild-type controls were fed an n-3-deficient/n-6-enriched diet [fat-1- safflower oil (SFO) and wt-SFO, respectively]. Fatty acid profiles of rod outer segments (ROS), cerebellum, plasma, and liver demonstrated significantly lower n-6/n-3 ratios and higher docosahexaenoic acid (DHA) levels in fat-1-SFO compared with wt-SFO. When mice were exposed to light stress: 1) the outer nuclear layer (ONL) thickness was reduced; 2) amplitudes of the electroretinogram (ERG) were lower; 3) the number of apoptotic photoreceptor cells was greater; and 4) modification of retinal proteins by 4-hydroxyhexenal (4-HHE), an end-product of n-3 PUFA oxidation was increased in both fat-1-SFO and wt mice fed a regular lab chow diet compared with wt-SFO. The results indicate a positive correlation between the level of DHA, the degree of n-3 PUFA lipid peroxidation, and the vulnerability of the retina to photooxidative stress. In mice not exposed to intense light, the reduction in DHA resulted in reduced efficacy in phototransduction gain steps, while no differences in the retinal morphology or retinal biochemistry. These results highlight the dual roles of DHA in cellular physiology and pathology. PMID:19023138

  4. Structure of the Elastin-Contractile Units in the Thoracic Aorta and How Genes That Cause Thoracic Aortic Aneurysms and Dissections Disrupt This Structure.

    PubMed

    Karimi, Ashkan; Milewicz, Dianna M

    2016-01-01

    The medial layer of the aorta confers elasticity and strength to the aortic wall and is composed of alternating layers of smooth muscle cells (SMCs) and elastic fibres. The SMC elastin-contractile unit is a structural unit that links the elastin fibres to the SMCs and is characterized by the following: (1) layers of elastin fibres that are surrounded by microfibrils; (2) microfibrils that bind to the integrin receptors in focal adhesions on the cell surface of the SMCs; and (3) SMC contractile filaments that are linked to the focal adhesions on the inner side of the membrane. The genes that are altered to cause thoracic aortic aneurysms and aortic dissections encode proteins involved in the structure or function of the SMC elastin-contractile unit. Included in this gene list are the genes encoding protein that are structural components of elastin fibres and microfibrils, FBN1, MFAP5, ELN, and FBLN4. Also included are genes that encode structural proteins in the SMC contractile unit, including ACTA2, which encodes SMC-specific α-actin and MYH11, which encodes SMC-specific myosin heavy chain, along with MYLK and PRKG1, which encode kinases that control SMC contraction. Finally, mutations in the gene encoding the protein linking integrin receptors to the contractile filaments, FLNA, also predispose to thoracic aortic disease. Thus, these data suggest that functional SMC elastin-contractile units are important for maintaining the structural integrity of the aorta. Copyright © 2016 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.

  5. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds.

    PubMed

    Seabra, Ana R; Vieira, Cristina P; Cullimore, Julie V; Carvalho, Helena G

    2010-08-19

    Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS), occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2) in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate that this gene duplication represents a functional innovation of plastid located GS related to storage protein accumulation exclusive to legume seed metabolism.

  6. Molecular cloning and expression of heteromeric ACCase subunit genes from Jatropha curcas.

    PubMed

    Gu, Keyu; Chiam, Huihui; Tian, Dongsheng; Yin, Zhongchao

    2011-04-01

    Acetyl-CoA carboxylase (ACCase) catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA, which is the essential first step in the biosynthesis of long-chain fatty acids. ACCase exists as a multi-subunit enzyme in most prokaryotes and the chloroplasts of most plants and algae, while it is present as a multi-domain enzyme in the endoplasmic reticulum of most eukaryotes. The heteromeric ACCase of higher plants consists of four subunits: an α-subunit of carboxyltransferase (α-CT, encoded by accA gene), a biotin carboxyl carrier protein (BCCP, encoded by accB gene), a biotin carboxylase (BC, encoded by accC gene) and a β-subunit of carboxyltransferase (β-CT, encoded by accD gene). In this study, we cloned and characterized the genes accA, accB1, accC and accD that encode the subunits of heteromeric ACCase in Jatropha (Jatropha curcas), a potential biofuel plant. The full-length cDNAs of the four subunit genes were isolated from a Jatropha cDNA library and by using 5' RACE, whereas the genomic clones were obtained from a Jatropha BAC library. They encode a 771 amino acid (aa) α-CT, a 286-aa BCCP1, a 537-aa BC and a 494-aa β-CT, respectively. The single-copy accA, accB1 and accC genes are nuclear genes, while the accD gene is located in chloroplast genome. Jatropha α-CT, BCCP1, BC and β-CT show high identity to their homologues in other higher plants at amino acid level and contain all conserved domains for ACCase activity. The accA, accB1, accC and accD genes are temporally and spatially expressed in the leaves and endosperm of Jatropha plants, which are regulated by plant development and environmental factors. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  7. Gene Cluster Encoding Cholate Catabolism in Rhodococcus spp.

    PubMed Central

    Wilbrink, Maarten H.; Casabon, Israël; Stewart, Gordon R.; Liu, Jie; van der Geize, Robert; Eltis, Lindsay D.

    2012-01-01

    Bile acids are highly abundant steroids with important functions in vertebrate digestion. Their catabolism by bacteria is an important component of the carbon cycle, contributes to gut ecology, and has potential commercial applications. We found that Rhodococcus jostii RHA1 grows well on cholate, as well as on its conjugates, taurocholate and glycocholate. The transcriptome of RHA1 growing on cholate revealed 39 genes upregulated on cholate, occurring in a single gene cluster. Reverse transcriptase quantitative PCR confirmed that selected genes in the cluster were upregulated 10-fold on cholate versus on cholesterol. One of these genes, kshA3, encoding a putative 3-ketosteroid-9α-hydroxylase, was deleted and found essential for growth on cholate. Two coenzyme A (CoA) synthetases encoded in the cluster, CasG and CasI, were heterologously expressed. CasG was shown to transform cholate to cholyl-CoA, thus initiating side chain degradation. CasI was shown to form CoA derivatives of steroids with isopropanoyl side chains, likely occurring as degradation intermediates. Orthologous gene clusters were identified in all available Rhodococcus genomes, as well as that of Thermomonospora curvata. Moreover, Rhodococcus equi 103S, Rhodococcus ruber Chol-4 and Rhodococcus erythropolis SQ1 each grew on cholate. In contrast, several mycolic acid bacteria lacking the gene cluster were unable to grow on cholate. Our results demonstrate that the above-mentioned gene cluster encodes cholate catabolism and is distinct from a more widely occurring gene cluster encoding cholesterol catabolism. PMID:23024343

  8. Identification and Characterization of an Immunodominant 28-Kilodalton Coxiella burnetii Outer Membrane Protein Specific to Isolates Associated with Acute Disease

    PubMed Central

    Zhang, Guoquan; To, Ho; Russell, Kasi E.; Hendrix, Laura R.; Yamaguchi, Tsuyoshi; Fukushi, Hideto; Hirai, Katsuya; Samuel, James E.

    2005-01-01

    Coxiella burnetii causes acute Q fever in humans and occasional chronic infections that typically manifest as endocarditis or hepatitis. Isolates associated with acute disease were found to be distinct from a group of chronic disease isolates by a variety of biochemical parameters and in a guinea pig fever model of acute disease, suggesting a difference in virulence potential. We compared antigenic polypeptides among C. burnetii isolates and found an immunodominant 28-kDa protein in acute group isolates but not in chronic group isolates (T. Ho, A. Hotta, G. Q. Zhang, S. V. Nguyen, M. Ogawa, T. Yamaguchi, H. Fukushi, and K. Hirai, Microbiol. Immunol. 42:81-85, 1998). In order to clone the adaA gene, the N-terminal amino acid sequence of adaA was determined and a 59-bp fragment was amplified from Nine Mile phase I DNA by PCR. The putative gene fragment was used to screen a lambda ZAP II genomic DNA library, and an open reading frame expressing a 28-kDa immunoreactive protein was identified. Sequence analysis predicted a gene encoding an ∼28-kDa mature protein with a typical signal sequence. The adaA (acute disease antigen A) gene was detected in acute group C. burnetii isolates but not identified in chronic group isolates by PCR and Southern blotting. A typical signal peptide was predicted in adaA, and specific antibody to adaA reacted with the purified membrane fraction of acute group isolates by Western blotting, suggesting that adaA is exposed on the outer surface of C. burnetii. adaA was overexpressed in pET23a as a fusion protein in Escherichia coli to develop anti-recombinant adaA (anti-radaA) specific antibody, which recognized a ∼28-kDa band in acute group isolates but not in chronic group isolates. In addition, immunoblotting indicates that radaA reacted with sera derived from animals infected with acute group isolates but did not react with sera from animals infected with chronic group isolates. These results support the idea that an adaA gene-targeted PCR assay and an radaA antigen-based serodiagnostic test may be useful for differential diagnosis of acute and chronic Q fever. PMID:15731054

  9. Physiological and transcriptional approaches reveal connection between nitrogen and manganese cycles in Shewanella algae C6G3.

    PubMed

    Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie

    2017-03-20

    To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels.

  10. Physiological and transcriptional approaches reveal connection between nitrogen and manganese cycles in Shewanella algae C6G3

    NASA Astrophysics Data System (ADS)

    Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie

    2017-03-01

    To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels.

  11. Genome-wide screen uncovers novel pathways for tRNA processing and nuclear-cytoplasmic dynamics.

    PubMed

    Wu, Jingyan; Bao, Alicia; Chatterjee, Kunal; Wan, Yao; Hopper, Anita K

    2015-12-15

    Transfer ribonucleic acids (tRNAs) are essential for protein synthesis. However, key gene products involved in tRNA biogenesis and subcellular movement remain to be discovered. We conducted the first comprehensive unbiased analysis of the role of nearly an entire proteome in tRNA biology and describe 162 novel and 12 previously known Saccharomyces cerevisiae gene products that function in tRNA processing, turnover, and subcellular movement. tRNA nuclear export is of particular interest because it is essential, but the known tRNA exporters (Los1 [exportin-t] and Msn5 [exportin-5]) are unessential. We report that mutations of CRM1 (Exportin-1), MEX67/MTR2 (TAP/p15), and five nucleoporins cause accumulation of unspliced tRNA, a hallmark of defective tRNA nuclear export. CRM1 mutation genetically interacts with los1Δ and causes altered tRNA nuclear-cytoplasmic distribution. The data implicate roles for the protein and mRNA nuclear export machineries in tRNA nuclear export. Mutations of genes encoding actin cytoskeleton components and mitochondrial outer membrane proteins also cause accumulation of unspliced tRNA, likely due to defective splicing on mitochondria. Additional gene products, such as chromatin modification enzymes, have unanticipated effects on pre-tRNA end processing. Thus, this genome-wide screen uncovered putative novel pathways for tRNA nuclear export and extensive links between tRNA biology and other aspects of cell physiology. © 2015 Wu et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Genome-wide screen uncovers novel pathways for tRNA processing and nuclear–cytoplasmic dynamics

    PubMed Central

    Wu, Jingyan; Bao, Alicia; Chatterjee, Kunal; Wan, Yao; Hopper, Anita K.

    2015-01-01

    Transfer ribonucleic acids (tRNAs) are essential for protein synthesis. However, key gene products involved in tRNA biogenesis and subcellular movement remain to be discovered. We conducted the first comprehensive unbiased analysis of the role of nearly an entire proteome in tRNA biology and describe 162 novel and 12 previously known Saccharomyces cerevisiae gene products that function in tRNA processing, turnover, and subcellular movement. tRNA nuclear export is of particular interest because it is essential, but the known tRNA exporters (Los1 [exportin-t] and Msn5 [exportin-5]) are unessential. We report that mutations of CRM1 (Exportin-1), MEX67/MTR2 (TAP/p15), and five nucleoporins cause accumulation of unspliced tRNA, a hallmark of defective tRNA nuclear export. CRM1 mutation genetically interacts with los1Δ and causes altered tRNA nuclear–cytoplasmic distribution. The data implicate roles for the protein and mRNA nuclear export machineries in tRNA nuclear export. Mutations of genes encoding actin cytoskeleton components and mitochondrial outer membrane proteins also cause accumulation of unspliced tRNA, likely due to defective splicing on mitochondria. Additional gene products, such as chromatin modification enzymes, have unanticipated effects on pre-tRNA end processing. Thus, this genome-wide screen uncovered putative novel pathways for tRNA nuclear export and extensive links between tRNA biology and other aspects of cell physiology. PMID:26680305

  13. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

    PubMed

    Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

    2016-05-11

    Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

  14. Physiological and transcriptional approaches reveal connection between nitrogen and manganese cycles in Shewanella algae C6G3

    PubMed Central

    Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie

    2017-01-01

    To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels. PMID:28317859

  15. The MrCYP52 Cytochrome P450 Monoxygenase Gene of Metarhizium robertsii Is Important for Utilizing Insect Epicuticular Hydrocarbons

    PubMed Central

    Lin, Liangcai; Fang, Weiguo; Liao, Xinggang; Wang, Fengqing; Wei, Dongzhi; St. Leger, Raymond J.

    2011-01-01

    Fungal pathogens of plants and insects infect their hosts by direct penetration of the cuticle. Plant and insect cuticles are covered by a hydrocarbon-rich waxy outer layer that represents the first barrier against infection. However, the fungal genes that underlie insect waxy layer degradation have received little attention. Here we characterize the single cytochrome P450 monoxygenase family 52 (MrCYP52) gene of the insect pathogen Metarhizium robertsii, and demonstrate that it encodes an enzyme required for efficient utilization of host hydrocarbons. Expressing a green florescent protein gene under control of the MrCYP52 promoter confirmed that MrCYP52 is up regulated on insect cuticle as well as by artificial media containing decane (C10), extracted cuticle hydrocarbons, and to a lesser extent long chain alkanes. Disrupting MrCYP52 resulted in reduced growth on epicuticular hydrocarbons and delayed developmental processes on insect cuticle, including germination and production of appressoria (infection structures). Extraction of alkanes from cuticle prevented induction of MrCYP52 and reduced growth. Insect bioassays against caterpillars (Galleria mellonella) confirmed that disruption of MrCYP52 significantly reduces virulence. However, MrCYP52 was dispensable for normal germination and appressorial formation in vitro when the fungus was supplied with nitrogenous nutrients. We conclude therefore that MrCYP52 mediates degradation of epicuticular hydrocarbons and these are an important nutrient source, but not a source of chemical signals that trigger infection processes. PMID:22194968

  16. The prrF-Encoded Small Regulatory RNAs Are Required for Iron Homeostasis and Virulence of Pseudomonas aeruginosa

    PubMed Central

    Reinhart, Alexandria A.; Powell, Daniel A.; Nguyen, Angela T.; O'Neill, Maura; Djapgne, Louise; Wilks, Angela; Ernst, Robert K.

    2014-01-01

    Pseudomonas aeruginosa is an opportunistic pathogen that requires iron to cause infection, but it also must regulate the uptake of iron to avoid iron toxicity. The iron-responsive PrrF1 and PrrF2 small regulatory RNAs (sRNAs) are part of P. aeruginosa's iron regulatory network and affect the expression of at least 50 genes encoding iron-containing proteins. The genes encoding the PrrF1 and PrrF2 sRNAs are encoded in tandem in P. aeruginosa, allowing for the expression of a distinct, heme-responsive sRNA named PrrH that appears to regulate genes involved in heme metabolism. Using a combination of growth, mass spectrometry, and gene expression analysis, we showed that the ΔprrF1,2 mutant, which lacks expression of the PrrF and PrrH sRNAs, is defective for both iron and heme homeostasis. We also identified phuS, encoding a heme binding protein involved in heme acquisition, and vreR, encoding a previously identified regulator of P. aeruginosa virulence genes, as novel targets of prrF-mediated heme regulation. Finally, we showed that the prrF locus encoding the PrrF and PrrH sRNAs is required for P. aeruginosa virulence in a murine model of acute lung infection. Moreover, we showed that inoculation with a ΔprrF1,2 deletion mutant protects against future challenge with wild-type P. aeruginosa. Combined, these data demonstrate that the prrF-encoded sRNAs are critical regulators of P. aeruginosa virulence. PMID:25510881

  17. Newer systems for bacterial resistances to toxic heavy metals.

    PubMed Central

    Silver, S; Ji, G

    1994-01-01

    Bacterial plasmids contain specific genes for resistances to toxic heavy metal ions including Ag+, AsO2-, AsO4(3-), Cd2+, Co2+, CrO4(2-), Cu2+, Hg2+, Ni2+, Pb2+, Sb3+, and Zn2+. Recent progress with plasmid copper-resistance systems in Escherichia coli and Pseudomonas syringae show a system of four gene products, an inner membrane protein (PcoD), an outer membrane protein (PcoB), and two periplasmic Cu(2+)-binding proteins (PcoA and PcoC). Synthesis of this system is governed by two regulatory proteins (the membrane sensor PcoS and the soluble responder PcoR, probably a DNA-binding protein), homologous to other bacterial two-component regulatory systems. Chromosomally encoded Cu2+ P-type ATPases have recently been recognized in Enterococcus hirae and these are closely homologous to the bacterial cadmium efflux ATPase and the human copper-deficiency disease Menkes gene product. The Cd(2+)-efflux ATPase of gram-positive bacteria is a large P-type ATPase, homologous to the muscle Ca2+ ATPase and the Na+/K+ ATPases of animals. The arsenic-resistance system of gram-negative bacteria functions as an oxyanion efflux ATPase for arsenite and presumably antimonite. However, the structure of the arsenic ATPase is fundamentally different from that of P-type ATPases. The absence of the arsA gene (for the ATPase subunit) in gram-positive bacteria raises questions of energy-coupling for arsenite efflux. The ArsC protein product of the arsenic-resistance operons of both gram-positive and gram-negative bacteria is an intracellular enzyme that reduces arsenate [As(V)] to arsenite [As(III)], the substrate for the transport pump. Newly studied cation efflux systems for Cd2+, Zn2+, and Co2+ (Czc) or Co2+ and Ni2+ resistance (Cnr) lack ATPase motifs in their predicted polypeptide sequences. Therefore, not all plasmid-resistance systems that function through toxic ion efflux are ATPases. The first well-defined bacterial metallothionein was found in the cyanobacterium Synechococcus. Bacterial metallothionein is encoded by the smtA gene and contains 56 amino acids, including nine cysteine residues (fewer than animal metallothioneins). The synthesis of Synechococcus metallothionein is regulated by a repressor protein, the product of the adjacent but separately transcribed smtB gene. Regulation of metallothionein synthesis occurs at different levels; quickly by derepression of repressor activity, or over a longer time by deletion of the repressor gene at fixed positions and by amplification of the metallothionein DNA region leading to multiple copies of the gene. PMID:7843081

  18. Novel Endoxylanases of the Moderately Thermophilic Polysaccharide-Degrading Bacterium Melioribacter roseus.

    PubMed

    Rakitin, Andrey L; Ermakova, Alexandra Y; Ravin, Nikolai V

    2015-09-01

    Three endoxylanase-encoding genes from the moderately themophilic chemoorganotrophic bacterium Melioribacter roseus were cloned and expressed in Escherichia coli. Genes xyl2091 (Mros_2091) and xyl2495 (Mros_2495) encode GH10 family hydrolases, whereas xyl2090 (Mros_2090) represents the GH30 family. In addition to catalytic domains, Xyl2090 and Xyl2091 contain carbohydrate-binding modules that could facilitate their binding to xylans and Por sorting domains associated with the sorting of proteins from the periplasm to the outer membrane, where they are covalently attached. Recombinant endoxylanase Xyl2495 exhibited a high specific activity of 1,920 U/mg on birchwood xylan at 40°C. It is active at low temperatures, exhibiting more than 30% of the maximal activity even at 0°C. Endoxylanases Xyl2090 and Xyl2091 have lower specific activities but higher temperature optima at 80°C and 65°C, respectively. Analysis of xylan hydrolysis products revealed that Xyl2090 generates xylo-oligosaccharides longer than xylopentaose. Xylose and xylobiose are the major products of xylan hydrolysis by the recombinant Xyl2091 and Xyl2495. No activity against cellulose was observed for all enzymes. The presence of three xylanases ensures efficient xylan hydrolysis by M. roseus. The highly processive "free" endoxylanase Xyl2495 could hydrolyze xylan under moderate temperatures. Xylan hydrolysis at elevated temperatures could be accomplished by concerted action of two cell-bound xylanases; Xyl2090 that probably degrades xylans to long xylo-oligosaccharides, and Xyl2091 hydrolyzing them to xylose and xylobiose. The new endoxylanases could be useful for saccharification of lignocellulosic biomass in biofuels production, bleaching of paper pulp, and obtaining low molecular weight xylooligosaccharides.

  19. Identification of Salmonella enterica Serovar Typhimurium Genes Regulated during Biofilm Formation on Cholesterol Gallstone Surfaces

    PubMed Central

    Gonzalez-Escobedo, Geoffrey

    2013-01-01

    Salmonella spp. are able to form biofilms on abiotic and biotic surfaces. In vivo studies in our laboratory have shown that Salmonella can form biofilms on the surfaces of cholesterol gallstones in the gallbladders of mice and human carriers. Biofilm formation on gallstones has been demonstrated to be a mechanism of persistence. The purpose of this work was to identify and evaluate Salmonella sp. cholesterol-dependent biofilm factors. Differential gene expression analysis between biofilms on glass or cholesterol-coated surfaces and subsequent quantitative real-time PCR (qRT-PCR) revealed that type 1 fimbria structural genes and a gene encoding a putative outer membrane protein (ycfR) were specifically upregulated in Salmonella enterica serovar Typhimurium biofilms grown on cholesterol-coated surfaces. Spatiotemporal expression of ycfR and FimA verified their regulation during biofilm development on cholesterol-coated surfaces. Surprisingly, confocal and scanning electron microscopy demonstrated that a mutant of type 1 fimbria structural genes (ΔfimAICDHF) and a ycfR mutant showed increased biofilm formation on cholesterol-coated surfaces. In vivo experiments using Nramp1+/+ mice harboring gallstones showed that only the ΔycfR mutant formed extensive biofilms on mouse gallstones at 7 and 21 days postinfection; ΔfimAICDHF was not observed on gallstone surfaces after the 7-day-postinfection time point. These data suggest that in Salmonella spp., wild-type type 1 fimbriae are important for attachment to and/or persistence on gallstones at later points of chronic infection, whereas YcfR may represent a specific potential natural inhibitor of initial biofilm formation on gallstones. PMID:23897604

  20. Expression of Olfactory Signaling Genes in the Eye

    PubMed Central

    Velmeshev, Dmitry; Faghihi, Mohammad; Shestopalov, Valery I.; Slepak, Vladlen Z.

    2014-01-01

    Purpose To advance our understanding how the outer eye interacts with its environment, we asked which cellular receptors are expressed in the cornea, focusing on G protein-coupled receptors. Methods Total RNA from the mouse cornea was subjected to next-generation sequencing using the Illumina platform. The data was analyzed with TopHat and CuffLinks software packages. Expression of a representative group of genes detected by RNA-seq was further analyzed by RT-PCR and in situ hybridization using RNAscope technology and fluorescent microscopy. Results We generated more than 46 million pair-end reads from mouse corneal RNA. Bioinformatics analysis revealed that the mouse corneal transcriptome reconstructed from these reads represents over 10,000 gene transcripts. We identified 194 GPCR transcripts, of which 96 were putative olfactory receptors. RT-PCR analysis confirmed the presence of several olfactory receptors and related genes, including olfactory marker protein and the G protein associated with olfaction, Gαolf. In situ hybridization showed that mRNA for olfactory marker protein, Gαolf and possibly some olfactory receptors were found in the corneal epithelial cells. In addition to the corneal epithelium, Gαolf was present in the ganglionic and inner nuclear layers of the retina. One of the olfactory receptors, Olfr558, was present primarily in vessels of the eye co-stained with antibodies against alpha-smooth muscle actin, indicating expression in arterioles. Conclusions Several species of mRNA encoding putative olfactory receptors and related genes are expressed in the mouse cornea and other parts of the eye indicating they may play a role in sensing chemicals in the ocular environment. PMID:24789354

  1. CIP1 polypeptides and their uses

    DOEpatents

    Foreman, Pamela [Los Altos, CA; Van Solingen, Pieter [Naaldwijk, NL; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA

    2011-04-12

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  2. Paralogous ALT1 and ALT2 Retention and Diversification Have Generated Catalytically Active and Inactive Aminotransferases in Saccharomyces cerevisiae

    PubMed Central

    Peñalosa-Ruiz, Georgina; Aranda, Cristina; Ongay-Larios, Laura; Colon, Maritrini; Quezada, Hector; Gonzalez, Alicia

    2012-01-01

    Background Gene duplication and the subsequent divergence of paralogous pairs play a central role in the evolution of novel gene functions. S. cerevisiae possesses two paralogous genes (ALT1/ALT2) which presumably encode alanine aminotransferases. It has been previously shown that Alt1 encodes an alanine aminotransferase, involved in alanine metabolism; however the physiological role of Alt2 is not known. Here we investigate whether ALT2 encodes an active alanine aminotransferase. Principal Findings Our results show that although ALT1 and ALT2 encode 65% identical proteins, only Alt1 displays alanine aminotransferase activity; in contrast ALT2 encodes a catalytically inert protein. ALT1 and ALT2 expression is modulated by Nrg1 and by the intracellular alanine pool. ALT1 is alanine-induced showing a regulatory profile of a gene encoding an enzyme involved in amino acid catabolism, in agreement with the fact that Alt1 is the sole pathway for alanine catabolism present in S. cerevisiae. Conversely, ALT2 expression is alanine-repressed, indicating a role in alanine biosynthesis, although the encoded-protein has no alanine aminotransferase enzymatic activity. In the ancestral-like yeast L. kluyveri, the alanine aminotransferase activity was higher in the presence of alanine than in the presence of ammonium, suggesting that as for ALT1, LkALT1 expression could be alanine-induced. ALT2 retention poses the questions of whether the encoded protein plays a particular function, and if this function was present in the ancestral gene. It could be hypotesized that ALT2 diverged after duplication, through neo-functionalization or that ALT2 function was present in the ancestral gene, with a yet undiscovered function. Conclusions ALT1 and ALT2 divergence has resulted in delegation of alanine aminotransferase activity to Alt1. These genes display opposed regulatory profiles: ALT1 is alanine-induced, while ALT2 is alanine repressed. Both genes are negatively regulated by the Nrg1 repressor. Presented results indicate that alanine could act as ALT2 Nrg1-co-repressor. PMID:23049841

  3. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    PubMed

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  4. Rudimentary expression of RYamide in Drosophila melanogaster relative to other Drosophila species points to a functional decline of this neuropeptide gene.

    PubMed

    Veenstra, Jan A; Khammassi, Hela

    2017-04-01

    RYamides are arthropod neuropeptides with unknown function. In 2011 two RYamides were isolated from D. melanogaster as the ligands for the G-protein coupled receptor CG5811. The D. melanogaster gene encoding these neuropeptides is highly unusual, as there are four RYamide encoding exons in the current genome assembly, but an exon encoding a signal peptide is absent. Comparing the D. melanogaster gene structure with those from other species, including D. virilis, suggests that the gene is degenerating. RNAseq data from 1634 short sequence read archives at NCBI containing more than 34 billion spots yielded numerous individual spots that correspond to the RYamide encoding exons, of which a large number include the intron-exon boundary at the start of this exon. Although 72 different sequences have been spliced onto this RYamide encoding exon, none codes for the signal peptide of this gene. Thus, the RNAseq data for this gene reveal only noise and no signal. The very small quantities of peptide recovered during isolation and the absence of credible RNAseq data, indicates that the gene is very little expressed, while the RYamide gene structure in D. melanogaster suggests that it might be evolving into a pseudogene. Yet, the identification of the peptides it encodes clearly shows it is still functional. Using region specific antisera, we could localize numerous neurons and enteroendocrine cells in D. willistoni, D. virilis and D. pseudoobscura, but only two adult abdominal neurons in D. melanogaster. Those two neurons project to and innervate the rectal papillae, suggesting that RYamides may be involved in the regulation of water homeostasis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Analysis and Manipulation of Aspartate Pathway Genes for l-Lysine Overproduction from Methanol by Bacillus methanolicus▿

    PubMed Central

    Nærdal, Ingemar; Netzer, Roman; Ellingsen, Trond E.; Brautaset, Trygve

    2011-01-01

    We investigated the regulation and roles of six aspartate pathway genes in l-lysine overproduction in Bacillus methanolicus: dapG, encoding aspartokinase I (AKI); lysC, encoding AKII; yclM, encoding AKIII; asd, encoding aspartate semialdehyde dehydrogenase; dapA, encoding dihydrodipicolinate synthase; and lysA, encoding meso-diaminopimelate decarboxylase. Analysis of the wild-type strain revealed that in vivo lysC transcription was repressed 5-fold by l-lysine and induced 2-fold by dl-methionine added to the growth medium. Surprisingly, yclM transcription was repressed 5-fold by dl-methionine, while the dapG, asd, dapA, and lysA genes were not significantly repressed by any of the aspartate pathway amino acids. We show that the l-lysine-overproducing classical B. methanolicus mutant NOA2#13A52-8A66 has—in addition to a hom-1 mutation—chromosomal mutations in the dapG coding region and in the lysA promoter region. No mutations were found in its dapA, lysC, asd, and yclM genes. The mutant dapG gene product had abolished feedback inhibition by meso-diaminopimelate in vitro, and the lysA mutation was accompanied by an elevated (6-fold) lysA transcription level in vivo. Moreover, yclM transcription was increased 16-fold in mutant strain NOA2#13A52-8A66 compared to the wild-type strain. Overexpression of wild-type and mutant aspartate pathway genes demonstrated that all six genes are important for l-lysine overproduction as tested in shake flasks, and the effects were dependent on the genetic background tested. Coupled overexpression of up to three genes resulted in additive (above 80-fold) increased l-lysine production levels. PMID:21724876

  6. Analysis and manipulation of aspartate pathway genes for L-lysine overproduction from methanol by Bacillus methanolicus.

    PubMed

    Nærdal, Ingemar; Netzer, Roman; Ellingsen, Trond E; Brautaset, Trygve

    2011-09-01

    We investigated the regulation and roles of six aspartate pathway genes in L-lysine overproduction in Bacillus methanolicus: dapG, encoding aspartokinase I (AKI); lysC, encoding AKII; yclM, encoding AKIII; asd, encoding aspartate semialdehyde dehydrogenase; dapA, encoding dihydrodipicolinate synthase; and lysA, encoding meso-diaminopimelate decarboxylase. Analysis of the wild-type strain revealed that in vivo lysC transcription was repressed 5-fold by L-lysine and induced 2-fold by dl-methionine added to the growth medium. Surprisingly, yclM transcription was repressed 5-fold by dl-methionine, while the dapG, asd, dapA, and lysA genes were not significantly repressed by any of the aspartate pathway amino acids. We show that the L-lysine-overproducing classical B. methanolicus mutant NOA2#13A52-8A66 has-in addition to a hom-1 mutation-chromosomal mutations in the dapG coding region and in the lysA promoter region. No mutations were found in its dapA, lysC, asd, and yclM genes. The mutant dapG gene product had abolished feedback inhibition by meso-diaminopimelate in vitro, and the lysA mutation was accompanied by an elevated (6-fold) lysA transcription level in vivo. Moreover, yclM transcription was increased 16-fold in mutant strain NOA2#13A52-8A66 compared to the wild-type strain. Overexpression of wild-type and mutant aspartate pathway genes demonstrated that all six genes are important for L-lysine overproduction as tested in shake flasks, and the effects were dependent on the genetic background tested. Coupled overexpression of up to three genes resulted in additive (above 80-fold) increased L-lysine production levels.

  7. “Guilt by Association” Is the Exception Rather Than the Rule in Gene Networks

    PubMed Central

    Gillis, Jesse; Pavlidis, Paul

    2012-01-01

    Gene networks are commonly interpreted as encoding functional information in their connections. An extensively validated principle called guilt by association states that genes which are associated or interacting are more likely to share function. Guilt by association provides the central top-down principle for analyzing gene networks in functional terms or assessing their quality in encoding functional information. In this work, we show that functional information within gene networks is typically concentrated in only a very few interactions whose properties cannot be reliably related to the rest of the network. In effect, the apparent encoding of function within networks has been largely driven by outliers whose behaviour cannot even be generalized to individual genes, let alone to the network at large. While experimentalist-driven analysis of interactions may use prior expert knowledge to focus on the small fraction of critically important data, large-scale computational analyses have typically assumed that high-performance cross-validation in a network is due to a generalizable encoding of function. Because we find that gene function is not systemically encoded in networks, but dependent on specific and critical interactions, we conclude it is necessary to focus on the details of how networks encode function and what information computational analyses use to extract functional meaning. We explore a number of consequences of this and find that network structure itself provides clues as to which connections are critical and that systemic properties, such as scale-free-like behaviour, do not map onto the functional connectivity within networks. PMID:22479173

  8. Mobile genetic element-encoded cytolysin connects virulence to methicillin resistance in MRSA.

    PubMed

    Queck, Shu Y; Khan, Burhan A; Wang, Rong; Bach, Thanh-Huy L; Kretschmer, Dorothee; Chen, Liang; Kreiswirth, Barry N; Peschel, Andreas; Deleo, Frank R; Otto, Michael

    2009-07-01

    Bacterial virulence and antibiotic resistance have a significant influence on disease severity and treatment options during bacterial infections. Frequently, the underlying genetic determinants are encoded on mobile genetic elements (MGEs). In the leading human pathogen Staphylococcus aureus, MGEs that contain antibiotic resistance genes commonly do not contain genes for virulence determinants. The phenol-soluble modulins (PSMs) are staphylococcal cytolytic toxins with a crucial role in immune evasion. While all known PSMs are core genome-encoded, we here describe a previously unidentified psm gene, psm-mec, within the staphylococcal methicillin resistance-encoding MGE SCCmec. PSM-mec was strongly expressed in many strains and showed the physico-chemical, pro-inflammatory, and cytolytic characteristics typical of PSMs. Notably, in an S. aureus strain with low production of core genome-encoded PSMs, expression of PSM-mec had a significant impact on immune evasion and disease. In addition to providing high-level resistance to methicillin, acquisition of SCCmec elements encoding PSM-mec by horizontal gene transfer may therefore contribute to staphylococcal virulence by substituting for the lack of expression of core genome-encoded PSMs. Thus, our study reveals a previously unknown role of methicillin resistance clusters in staphylococcal pathogenesis and shows that important virulence and antibiotic resistance determinants may be combined in staphylococcal MGEs.

  9. Embryonic control of epidermal cell patterning in the root and hypocotyl of Arabidopsis.

    PubMed

    Lin, Y; Schiefelbein, J

    2001-10-01

    A position-dependent pattern of epidermal cell types is produced during the development of the Arabidopsis seedling root and hypocotyl. To understand the origin and regulation of this patterning mechanism, we have examined the embryonic expression of the GLABRA2 (GL2) gene, which encodes a cell-type-specific transcription factor. Using in situ RNA hybridization and a sensitive GL2::GFP reporter, we discovered that a position-dependent pattern of GL2 expression is established within protodermal cells at the heart stage and is maintained throughout the remainder of embryogenesis. In addition, we show that an exceptional GL2 expression character and epidermal cell pattern arises during development of the root-hypocotyl junction, which represents an anatomical transition zone. Furthermore, we find that two of the genes regulating seedling epidermal patterning, TRANSPARENT TESTA GLABRA (TTG) and WEREWOLF (WER), also control the embryonic GL2 pattern, whereas the CAPRICE (CPC) and GL2 genes are not required to establish this pattern. These results indicate that position-dependent patterning of epidermal cell types begins at an early stage of embryogenesis, before formation of the apical meristems and shortly after the cellular anatomy of the protoderm and outer ground tissue layer is established. Thus, epidermal cell specification in the Arabidopsis seedling relies on the embryonic establishment of a patterning mechanism that is perpetuated postembryonically.

  10. Divergence of the Floral A-Function between an Asterid and a Rosid Species[OPEN

    PubMed Central

    Heijmans, Klaas; Rozier, Frédérique; Zethof, Jan; Chamot, Sophy

    2017-01-01

    The ABC model is widely used as a genetic framework for understanding floral development and evolution. In this model, the A-function is required for the development of sepals and petals and to antagonize the C-function in the outer floral whorls. In the rosid species Arabidopsis thaliana, the AP2-type AP2 transcription factor represents a major A-function protein, but how the A-function is encoded in other species is not well understood. Here, we show that in the asterid species petunia (Petunia hybrida), AP2B/BLIND ENHANCER (BEN) confines the C-function to the inner petunia floral whorls, in parallel with the microRNA BLIND. BEN belongs to the TOE-type AP2 gene family, members of which control flowering time in Arabidopsis. In turn, we demonstrate that the petunia AP2-type REPRESSOR OF B-FUNCTION (ROB) genes repress the B-function (but not the C-function) in the first floral whorl, together with BEN. We propose a combinatorial model for patterning the B- and C-functions, leading to the homeotic conversion of sepals into petals, carpels, or stamens, depending on the genetic context. Combined with earlier results, our findings suggest that the molecular mechanisms controlling the spatial restriction of the floral organ identity genes are more diverse than the well-conserved B and C floral organ identity functions. PMID:28646074

  11. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    PubMed

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P < 0.05). In Ukraine, S. aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene. We also observed a high prevalence of PVL- and ET- encoding genes among S. aureus nasal carriage strains. A systematic surveillance system can help prevent transmission and spread of drug resistant toxin producing S. aureus strains.

  12. Secretins revealed: structural insights into the giant gated outer membrane portals of bacteria.

    PubMed

    Majewski, Dorothy D; Worrall, Liam J; Strynadka, Natalie Cj

    2018-03-23

    The acquisition and evolution of customized and often highly complex secretion systems allows Gram-negative bacteria to efficiently passage large macromolecules across both inner and outer membranes and, in some cases, that of the infected host. Essential to the virulence and ultimate survival of the many pathogenic species that encode them, secretion systems export a wide variety of effector proteins and DNA as well as the downstream extracellular filaments of the secretion apparatus themselves. Although these customized secretion systems differ in their cytosolic and inner membrane components, several commonly rely on the secretin family of giant pores to allow these large substrates to traverse the outer membrane. Recently, several near-atomic resolution cryo-EM secretin structures have unveiled the first insights into the unique structural motifs required for outer membrane localization, assembly, hallmark ultrastable nature, spontaneous membrane insertion, and mechanism of action-including the requisite central gating needed to prevent deleterious passage of periplasmic contents to the extracellular space. Copyright © 2018. Published by Elsevier Ltd.

  13. Carbohydrate metabolism genes and pathways in insects: insights from the honey bee genome

    PubMed Central

    Kunieda, T; Fujiyuki, T; Kucharski, R; Foret, S; Ament, S A; Toth, A L; Ohashi, K; Takeuchi, H; Kamikouchi, A; Kage, E; Morioka, M; Beye, M; Kubo, T; Robinson, G E; Maleszka, R

    2006-01-01

    Carbohydrate-metabolizing enzymes may have particularly interesting roles in the honey bee, Apis mellifera, because this social insect has an extremely carbohydrate-rich diet, and nutrition plays important roles in caste determination and socially mediated behavioural plasticity. We annotated a total of 174 genes encoding carbohydrate-metabolizing enzymes and 28 genes encoding lipid-metabolizing enzymes, based on orthology to their counterparts in the fly, Drosophila melanogaster, and the mosquito, Anopheles gambiae. We found that the number of genes for carbohydrate metabolism appears to be more evolutionarily labile than for lipid metabolism. In particular, we identified striking changes in gene number or genomic organization for genes encoding glycolytic enzymes, cellulase, glucose oxidase and glucose dehydrogenases, glucose-methanol-choline (GMC) oxidoreductases, fucosyltransferases, and lysozymes. PMID:17069632

  14. Novel Type V Staphylococcal Cassette Chromosome mec Driven by a Novel Cassette Chromosome Recombinase, ccrC

    PubMed Central

    Ito, Teruyo; Ma, Xiao Xue; Takeuchi, Fumihiko; Okuma, Keiko; Yuzawa, Harumi; Hiramatsu, Keiichi

    2004-01-01

    Staphylococcal cassette chromosome mec (SCCmec) is a mobile genetic element composed of the mec gene complex, which encodes methicillin resistance, and the ccr gene complex, which encodes the recombinases responsible for its mobility. The mec gene complex has been classified into four classes, and the ccr gene complex has been classified into three allotypes. Different combinations of mec gene complex classes and ccr gene complex types have so far defined four types of SCCmec elements. Now we introduce the fifth allotype of SCCmec, which was found on the chromosome of a community-acquired methicillin-resistant Staphylococcus aureus strain (strain WIS [WBG8318]) isolated in Australia. The element shared the same chromosomal integration site with the four extant types of SCCmec and the characteristic nucleotide sequences at the chromosome-SCCmec junction regions. The novel SCCmec carried mecA bracketed by IS431 (IS431-mecA-ΔmecR1-IS431), which is designated the class C2 mec gene complex; and instead of ccrA and ccrB genes, it carried a single copy of a gene homologue that encoded cassette chromosome recombinase. Since the open reading frame (ORF) was found to encode an enzyme which catalyzes the precise excision as well as site- and orientation-specific integration of the element, we designated the ORF cassette chromosome recombinase C (ccrC), and we designated the element type V SCCmec. Type V SCCmec is a small SCCmec element (28 kb) and does not carry any antibiotic resistance genes besides mecA. Unlike the extant SCCmec types, it carries a set of foreign genes encoding a restriction-modification system that might play a role in the stabilization of the element on the chromosome. PMID:15215121

  15. Molecular cloning and characterization of alpha - galactosidase gene from Glaciozyma antarctica

    NASA Astrophysics Data System (ADS)

    Moheer, Reyad Qaed Al; Bakar, Farah Diba Abu; Murad, Abdul Munir Abdul

    2015-09-01

    Psychrophilic enzymes are proteins produced by psychrophilic organisms which recently are the limelight for industrial applications. A gene encoding α-galactosidase from a psychrophilic yeast, Glaciozyma antarctica PI12 which belongs to glycoside hydrolase family 27, was isolated and analyzed using several bioinformatic tools. The cDNA of the gene with the size of 1,404-bp encodes a protein with 467 amino acid residues. Predicted molecular weight of protein was 48.59 kDa and hence we name the gene encoding α-galactosidase as GAL48. We found that the predicted protein sequences possessed signal peptide sequence and are highly conserved among other fungal α-galactosidase.

  16. Simian Rotaviruses Possess Divergent Gene Constellations That Originated from Interspecies Transmission and Reassortment▿

    PubMed Central

    Matthijnssens, Jelle; Taraporewala, Zenobia F.; Yang, Hongyan; Rao, Shujing; Yuan, Lijuan; Cao, Dianjun; Hoshino, Yasutaka; Mertens, Peter P. C.; Carner, Gerry R.; McNeal, Monica; Sestak, Karol; Van Ranst, Marc; Patton, John T.

    2010-01-01

    Although few simian rotaviruses (RVs) have been isolated, such strains have been important for basic research and vaccine development. To explore the origins of simian RVs, the complete genome sequences of strains PTRV (G8P[1]), RRV (G3P[3]), and TUCH (G3P[24]) were determined. These data allowed the genotype constellations of each virus to be determined and the phylogenetic relationships of the simian strains with each other and with nonsimian RVs to be elucidated. The results indicate that PTRV was likely transmitted from a bovine or other ruminant into pig-tailed macaques (its host of origin), since its genes have genotypes and encode outer-capsid proteins similar to those of bovine RVs. In contrast, most of the genes of rhesus-macaque strains, RRV and TUCH, have genotypes more typical of canine-feline RVs. However, the sequences of the canine and/or feline (canine/feline)-like genes of RRV and TUCH are only distantly related to those of modern canine/feline RVs, indicating that any potential transmission of a progenitor of these viruses from a canine/feline host to a simian host was not recent. The remaining genes of RRV and TUCH appear to have originated through reassortment with bovine, human, or other RV strains. Finally, comparison of PTRV, RRV, and TUCH genes with those of the vervet-monkey RV SA11-H96 (G3P[2]) indicates that SA11-H96 shares little genetic similarity to other simian strains and likely has evolved independently. Collectively, our data indicate that simian RVs are of diverse ancestry with genome constellations that originated largely by interspecies transmission and reassortment with nonhuman animal RVs. PMID:19939934

  17. Regulation of Serratia marcescens ompF and ompC porin genes in response to osmotic stress, salicylate, temperature and pH.

    PubMed

    Begic, Sanela; Worobec, Elizabeth A

    2006-02-01

    Serratia marcescens is a Gram-negative enterobacterium that has become an important opportunistic pathogen, largely due to its high degree of natural antibiotic resistance. One factor contributing to this natural antibiotic resistance is reduced outer membrane permeability, which is controlled in part by OmpC and OmpF porin proteins. OmpF expression is regulated by micF, an RNA transcript encoded upstream of the ompC gene, which hybridizes with the ompF transcript to inhibit its translation. Regulation of S. marcescens porin gene expression, as well as that of micF, was investigated using beta-galactosidase reporter gene fusions in response to 5, 8 and 10 % sucrose, 1, 5 and 8 mM salicylate, and different pH and temperature values. beta-Galactosidase activity assays revealed that a lower growth temperature (28 degrees C), a more basic pH (pH 8), and an absence of sucrose and salicylate induce the transcription of the ompF gene, whereas the induction of ompC is stimulated at a higher growth temperature (42 degrees C), acidic pH (pH 6), and maximum concentrations of sucrose (10 %) and salicylate (8 mM). In addition, when multiple conditions were tested, temperature had the predominant effect, followed by pH. In this study, it was found that the MicF regulatory mechanism does not play a role in the osmoregulation of the ompF and ompC genes, whereas MicF does repress OmpF expression in the presence of salicylate and high growth temperature, and under low pH conditions.

  18. Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

    PubMed

    Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

    2005-01-01

    We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

  19. Genetic and functional properties of uncultivated thermophilic crenarchaeotes from a subsurface gold mine as revealed by analysis of genome fragments.

    PubMed

    Nunoura, Takuro; Hirayama, Hisako; Takami, Hideto; Oida, Hanako; Nishi, Shinro; Shimamura, Shigeru; Suzuki, Yohey; Inagaki, Fumio; Takai, Ken; Nealson, Kenneth H; Horikoshi, Koki

    2005-12-01

    Within a phylum Crenarchaeota, only some members of the hyperthermophilic class Thermoprotei, have been cultivated and characterized. In this study, we have constructed a metagenomic library from a microbial mat formation in a subsurface hot water stream of the Hishikari gold mine, Japan, and sequenced genome fragments of two different phylogroups of uncultivated thermophilic Crenarchaeota: (i) hot water crenarchaeotic group (HWCG) I (41.2 kb), and (ii) HWCG III (49.3 kb). The genome fragment of HWCG I contained a 16S rRNA gene, two tRNA genes and 35 genes encoding proteins but no 23S rRNA gene. Among the genes encoding proteins, several genes for putative aerobic-type carbon monoxide dehydrogenase represented a potential clue with regard to the yet unknown metabolism of HWCG I Archaea. The genome fragment of HWCG III contained a 16S/23S rRNA operon and 44 genes encoding proteins. In the 23S rRNA gene, we detected a homing-endonuclease encoding a group I intron similar to those detected in hyperthermophilic Crenarchaeota and Bacteria, as well as eukaryotic organelles. The reconstructed phylogenetic tree based on the 23S rRNA gene sequence reinforced the intermediate phylogenetic affiliation of HWCG III bridging the hyperthermophilic and non-thermophilic uncultivated Crenarchaeota.

  20. Adaptive Evolution of the Myo6 Gene in Old World Fruit Bats (Family: Pteropodidae)

    PubMed Central

    Shen, Bin; Han, Xiuqun; Jones, Gareth; Rossiter, Stephen J.; Zhang, Shuyi

    2013-01-01

    Myosin VI (encoded by the Myo6 gene) is highly expressed in the inner and outer hair cells of the ear, retina, and polarized epithelial cells such as kidney proximal tubule cells and intestinal enterocytes. The Myo6 gene is thought to be involved in a wide range of physiological functions such as hearing, vision, and clathrin-mediated endocytosis. Bats (Chiroptera) represent one of the most fascinating mammal groups for molecular evolutionary studies of the Myo6 gene. A diversity of specialized adaptations occur among different bat lineages, such as echolocation and associated high-frequency hearing in laryngeal echolocating bats, large eyes and a strong dependence on vision in Old World fruit bats (Pteropodidae), and specialized high-carbohydrate but low-nitrogen diets in both Old World and New World fruit bats (Phyllostomidae). To investigate what role(s) the Myo6 gene might fulfill in bats, we sequenced the coding region of the Myo6 gene in 15 bat species and used molecular evolutionary analyses to detect evidence of positive selection in different bat lineages. We also conducted real-time PCR assays to explore the expression levels of Myo6 in a range of tissues from three representative bat species. Molecular evolutionary analyses revealed that the Myo6 gene, which was widely considered as a hearing gene, has undergone adaptive evolution in the Old World fruit bats which lack laryngeal echolocation and associated high-frequency hearing. Real-time PCR showed the highest expression level of the Myo6 gene in the kidney among ten tissues examined in three bat species, indicating an important role for this gene in kidney function. We suggest that Myo6 has undergone adaptive evolution in Old World fruit bats in relation to receptor-mediated endocytosis for the preservation of protein and essential nutrients. PMID:23620821

  1. The Sus operon: a model system for starch uptake by the human gut Bacteroidetes

    PubMed Central

    Foley, Matthew H.; Cockburn, Darrell W.; Koropatkin, Nicole M.

    2016-01-01

    Resident bacteria in the densely populated human intestinal tract must efficiently compete for carbohydrate nutrition. The Bacteroidetes, a dominant bacterial phylum in the mammalian gut, encode a plethora of discrete polysaccharide utilization loci (PULs) that are selectively activated to facilitate glycan capture at the cell surface. The most well-studied PUL-encoded glycan-up-take system is the starch utilization system (Sus) of Bacteroides thetaiotaomicron. The Sus includes the requisite proteins for binding and degrading starch at the surface of the cell preceding oligosaccharide transport across the outer membrane for further depolymerization to glucose in the periplasm. All mammalian gut Bacteroidetes possess analogous Sus-like systems that target numerous diverse glycans. In this review, we discuss what is known about the eight Sus proteins of B. thetaiotaomicron that define the Sus-like paradigm of nutrient acquisition that is exclusive to the Gram-negative Bacteroidetes. We emphasize the well-characterized outer membrane proteins SusDEF and the α-amylase SusG, each of which have unique structural features that allow them to interact with starch on the cell surface. Despite the apparent redundancy in starch-binding sites among these proteins, each has a distinct role during starch catabolism. Additionally, we consider what is known about how these proteins dynamically interact and cooperate in the membrane and propose a model for the formation of the Sus outer membrane complex. PMID:27137179

  2. The genomic structure of the human Charcot-Leyden crystal protein gene is analogous to those of the galectin genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dyer, K.D.; Handen, J.S.; Rosenberg, H.F.

    The Charcot-Leyden crystal (CLC) protein, or eosinophil lysophospholipase, is a characteristic protein of human eosinophils and basophils; recent work has demonstrated that the CLC protein is both structurally and functionally related to the galectin family of {beta}-galactoside binding proteins. The galectins as a group share a number of features in common, including a linear ligand binding site encoded on a single exon. In this work, we demonstrate that the intron-exon structure of the gene encoding CLC is analogous to those encoding the galectins. The coding sequence of the CLC gene is divided into four exons, with the entire {beta}-galactoside bindingmore » site encoded by exon III. We have isolated CLC {beta}-galactoside binding sites from both orangutan (Pongo pygmaeus) and murine (Mus musculus) genomic DNAs, both encoded on single exons, and noted conservation of the amino acids shown to interact directly with the {beta}-galactoside ligand. The most likely interpretation of these results suggests the occurrence of one or more exon duplication and insertion events, resulting in the distribution of this lectin domain to CLC as well as to the multiple galectin genes. 35 refs., 3 figs.« less

  3. Recombination and mutation of class II histocompatibility genes in wild mice.

    PubMed

    Wakeland, E K; Darby, B R

    1983-12-01

    We have compared the tryptic peptide fingerprints of the A alpha, A beta, E alpha, and E beta subunits encoded by four wild-derived H-2 complexes expressing A molecules closely related to Ak. The A molecules encoded by these Ak-related mice have A alpha and A beta subunits that differ from A alpha k and A beta k by less than 10% of their tryptic peptides. Comparisons among the four wild-derived A molecules suggested that these contemporary A alpha and A beta alleles arose by sequential mutational events from common ancestor A alpha and A beta alleles. These results suggest that A alpha and A beta may co-evolve as an A beta A alpha gene duplex in wild mice. Tryptic peptide fingerprint comparisons of the E beta gene linked to these Ak-related A beta A alpha gene duplexes indicate that two encode E beta d-like subunits, whereas another encodes an E beta s-like subunit. These results strongly suggest that the A beta A alpha duplex and E beta recombine in wild mouse populations. The significantly different evolutionary patterns exhibited by the class II genes encoding A vs E molecules are discussed.

  4. Multi-functional acetyl-CoA carboxylase from Brassica napus is encoded by a multi-gene family: indication for plastidic localization of at least one isoform.

    PubMed

    Schulte, W; Töpfer, R; Stracke, R; Schell, J; Martini, N

    1997-04-01

    Three genes coding for different multifunctional acetyl-CoA carboxylase (ACCase; EC 6.4.1.2) isoenzymes from Brassica napus were isolated and divided into two major classes according to structural features in their 5' regions: class I comprises two genes with an additional coding exon of approximately 300 bp at the 5' end, and class II is represented by one gene carrying an intron of 586 bp in its 5' untranslated region. Fusion of the peptide sequence encoded by the additional first exon of a class I ACCase gene to the jellyfish Aequorea victoria green fluorescent protein (GFP) and transient expression in tobacco protoplasts targeted GFP to the chloroplasts. In contrast to the deduced primary structure of the biotin carboxylase domain encoded by the class I gene, the corresponding amino acid sequence of the class II ACCase shows higher identity with that of the Arabidopsis ACCase, both lacking a transit peptide. The Arabidopsis ACCase has been proposed to be a cytosolic isoenzyme. These observations indicate that the two classes of ACCase genes encode plastidic and cytosolic isoforms of multi-functional, eukaryotic type, respectively, and that B. napus contains at least one multi-functional ACCase besides the multi-subunit, prokaryotic type located in plastids. Southern blot analysis of genomic DNA from B. napus, Brassica rapa, and Brassica oleracea, the ancestors of amphidiploid rapeseed, using a fragment of a multi-functional ACCase gene as a probe revealed that ACCase is encoded by a multi-gene family of at least five members.

  5. Characterization of GM-CSF-inhibitory factor and Uracil DNA glycosylase encoding genes from camel pseudocowpoxvirus.

    PubMed

    Nagarajan, G; Swami, Shelesh Kumar; Dahiya, Shyam Singh; Narnaware, S D; Mehta, S C; Singh, P K; Singh, Raghvendar; Tuteja, F C; Patil, N V

    2015-06-01

    The present study describes the PCR amplification of GM-CSF-inhibitory factor (GIF) and Uracil DNA glycosylase (UDG) encoding genes of pseudocowpoxvirus (PCPV) from the Indian Dromedaries (Camelus dromedarius) infected with contagious ecthyma using the primers based on the corresponding gene sequences of human PCPV and reindeer PCPV, respectively. The length of GIF gene of PCPV obtained from camel is 795 bp and due to the addition of one cytosine residue at position 374 and one adenine residue at position 516, the open reading frame (ORF) got altered, resulting in the production of truncated polypeptide. The ORF of UDG encoding gene of camel PCPV is 696 bp encoding a polypeptide of 26.0 kDa. Comparison of amino acid sequence homologies of GIF and UDG of camel PCPV revealed that the camel PCPV is closer to ORFV and PCPV (reference stains of both human and reindeer), respectively. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. A mutation in a new gene bglJ, activates the bgl operon in Escherichia coli K-12

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giel, M.; Desnoyer, M.; Lopilato, J.

    1996-06-01

    A new mutation , bglJ4, has been characterized that results in the expression of the silent bgl operon. The bgl operon encodes proteins necessary for the transport and utilization of the aromatic {beta}-glucosides arbutin and salicin. A variety of mutations activate the operon and result in a Bgl{sup +} phenotype. Activating mutations are located upstream of the bgl promoter and in genes located elsewhere on the chromosome. Mutations outside of the bgl operon occur in the genes encoding DNA gyrase and in the gene encoding the nucleoid associated protein H-NS. The mutation described here, bglJ4, has been mapped to amore » new locus at min 99 on the Escherichia coli K-12 genetic map. The putative protein encoded by the bglJ gene has homology to a family of transcriptional activators. Evidence is presented that increased expression of the bglJ product is needed for activation of the bgl operon. 56 refs., 3 figs., 3 tabs.« less

  7. Two Closely Related Genes of Arabidopsis Encode Plastidial Cytidinediphosphate Diacylglycerol Synthases Essential for Photoautotrophic Growth1[C

    PubMed Central

    Haselier, André; Akbari, Hana; Weth, Agnes; Baumgartner, Werner; Frentzen, Margrit

    2010-01-01

    Cytidinediphosphate diacylglycerol synthase (CDS) catalyzes the formation of cytidinediphosphate diacylglycerol, an essential precursor of anionic phosphoglycerolipids like phosphatidylglycerol or -inositol. In plant cells, CDS isozymes are located in plastids, mitochondria, and microsomes. Here, we show that these isozymes are encoded by five genes in Arabidopsis (Arabidopsis thaliana). Alternative translation initiation or alternative splicing of CDS2 and CDS4 transcripts can result in up to 10 isoforms. Most of the cDNAs encoding the various plant isoforms were functionally expressed in yeast and rescued the nonviable phenotype of the mutant strain lacking CDS activity. The closely related genes CDS4 and CDS5 were found to encode plastidial isozymes with similar catalytic properties. Inactivation of both genes was required to obtain Arabidopsis mutant lines with a visible phenotype, suggesting that the genes have redundant functions. Analysis of these Arabidopsis mutants provided further independent evidence for the importance of plastidial phosphatidylglycerol for structure and function of thylakoid membranes and, hence, for photoautotrophic growth. PMID:20442275

  8. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    PubMed

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  9. Identification of an opd (organophosphate degradation) gene in an Agrobacterium isolate.

    PubMed

    Horne, Irene; Sutherland, Tara D; Harcourt, Rebecca L; Russell, Robyn J; Oakeshott, John G

    2002-07-01

    We isolated a bacterial strain, Agrobacterium radiobacter P230, which can hydrolyze a wide range of organophosphate (OP) insecticides. A gene encoding a protein involved in OP hydrolysis was cloned from A. radiobacter P230 and sequenced. This gene (called opdA) had sequence similarity to opd, a gene previously shown to encode an OP-hydrolyzing enzyme in Flavobacterium sp. strain ATCC 27551 and Brevundimonas diminuta MG. Insertional mutation of the opdA gene produced a strain lacking the ability to hydrolyze OPs, suggesting that this is the only gene encoding an OP-hydrolyzing enzyme in A. radiobacter P230. The OPH and OpdA proteins, encoded by opd and opdA, respectively, were overexpressed and purified as maltose-binding proteins, and the maltose-binding protein moiety was cleaved and removed. Neither protein was able to hydrolyze the aliphatic OP malathion. The kinetics of the two proteins for diethyl OPs were comparable. For dimethyl OPs, OpdA had a higher k(cat) than OPH. It was also capable of hydrolyzing the dimethyl OPs phosmet and fenthion, which were not hydrolyzed at detectable levels by OPH.

  10. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    PubMed

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  11. System and method for transferring telemetry data between a ground station and a control center

    NASA Technical Reports Server (NTRS)

    Ray, Timothy J. (Inventor); Ly, Vuong T. (Inventor)

    2012-01-01

    Disclosed herein are systems, computer-implemented methods, and tangible computer-readable media for coordinating communications between a ground station, a control center, and a spacecraft. The method receives a call to a simple, unified application programmer interface implementing communications protocols related to outer space, when instruction relates to receiving a command at the control center for the ground station generate an abstract message by agreeing upon a format for each type of abstract message with the ground station and using a set of message definitions to configure the command in the agreed upon format, encode the abstract message to generate an encoded message, and transfer the encoded message to the ground station, and perform similar actions when the instruction relates to receiving a second command as a second encoded message at the ground station from the control center and when the determined instruction type relates to transmitting information to the control center.

  12. The molecular genetics of Usher syndrome.

    PubMed

    Ahmed, Z M; Riazuddin, S; Riazuddin, S; Wilcox, E R

    2003-06-01

    Association of sensorineural deafness and progressive retinitis pigmentosa with and without a vestibular abnormality is the hallmark of Usher syndrome and involves at least 12 loci among three different clinical subtypes. Genes identified for the more commonly inherited loci are USH2A (encoding usherin), MYO7A (encoding myosin VIIa), CDH23 (encoding cadherin 23), PCDH15 (encoding protocadherin 15), USH1C (encoding harmonin), USH3A (encoding clarin 1), and USH1G (encoding SANS). Transcripts from all these genes are found in many tissues/cell types other than the inner ear and retina, but all are uniquely critical for retinal and cochlear cell function. Many of these protein products have been demonstrated to have direct interactions with each other and perform an essential role in stereocilia homeostasis.

  13. Cloning of the Pichia anomala SEC61 gene and its expression in a Saccharomyces cerevisiae sec61 mutant.

    PubMed

    Ruíz, Teresa; De la Rosa, José M; Domínguez, Angel; Rodríguez, Luis

    2003-05-01

    In several organisms, including Saccharomyces cerevisiae and other yeast species, the product encoded by the SEC61 gene is considered to be the core element of the translocation apparatus within the endoplasmic reticulum membrane through which translocation of secretory and membrane proteins occurs. In this study, we have cloned and characterized the homolog of the SEC61 gene from the yeast Pichia anomala. The cloned gene includes an ORF, interrupted after the first ten nucleotides by an intron of 131 bp, encoding a 479-amino acid putative polypeptide exhibiting homology to the products encoded by different eukaryotic SEC61 genes, particularly to those from other yeast species. We show that the P. anomala SEC61 gene is correctly processed (intron splicing) when expressed in S. cerevisiae and that it is able to complement the thermosensitive phenotype associated with a mutation in the S. cerevisiae SEC61 gene.

  14. Identification of the gene for fly non-muscle myosin heavy chain: Drosophila myosin heavy chains are encoded by a gene family.

    PubMed Central

    Kiehart, D P; Lutz, M S; Chan, D; Ketchum, A S; Laymon, R A; Nguyen, B; Goldstein, L S

    1989-01-01

    In contrast to vertebrate species Drosophila has a single myosin heavy chain gene that apparently encodes all sarcomeric heavy chain polypeptides. Flies also contain a cytoplasmic myosin heavy chain polypeptide that by immunological and peptide mapping criteria is clearly different from the major thoracic muscle isoform. Here, we identify the gene that encodes this cytoplasmic isoform and demonstrate that it is distinct from the muscle myosin heavy chain gene. Thus, fly myosin heavy chains are the products of a gene family. Our data suggest that the contractile function required to power myosin based movement in non-muscle cells requires myosin diversity beyond that available in a single heavy chain gene. In addition, we show, that accumulation of cytoplasmic myosin transcripts is regulated in a developmental stage specific fashion, consistent with a key role for this protein in the movements of early embryogenesis. Images PMID:2498088

  15. A novel chlorophyll a/b binding (Cab) protein gene from petunia which encodes the lower molecular weight Cab precursor protein.

    PubMed

    Stayton, M M; Black, M; Bedbrook, J; Dunsmuir, P

    1986-12-22

    The 16 petunia Cab genes which have been characterized are all closely related at the nucleotide sequence level and they encode Cab precursor polypeptides which are similar in sequence and length. Here we describe a novel petunia Cab gene which encodes a unique Cab precursor protein. This protein is a member of the smallest class of Cab precursor proteins for which no gene has previously been assigned in petunia or any other species. The features of this Cab precursor protein are that it is shorter by 2-3 amino acids than the formerly characterized Cab precursors, its transit peptide sequence is unrelated, and the mature polypeptide is significantly diverged at the functionally important N terminus from other petunia Cab proteins. Gene structure also discriminates this gene which is the only intron containing Cab gene in petunia genomic DNA.

  16. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    NASA Astrophysics Data System (ADS)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  17. Characterization of EhaJ, a New Autotransporter Protein from Enterohemorrhagic and Enteropathogenic Escherichia coli

    PubMed Central

    Easton, Donna M.; Totsika, Makrina; Allsopp, Luke P.; Phan, Minh-Duy; Idris, Adi; Wurpel, Daniël J.; Sherlock, Orla; Zhang, Bing; Venturini, Carola; Beatson, Scott A.; Mahony, Timothy J.; Cobbold, Rowland N.; Schembri, Mark A.

    2011-01-01

    Enterohemorrhagic Escherichia coli (EHEC) and enteropathogenic E. coli (EPEC) are diarrheagenic pathotypes of E. coli that cause gastrointestinal disease with the potential for life-threatening sequelae. While certain EHEC and EPEC virulence mechanisms have been extensively studied, the factors that mediate host colonization remain to be properly defined. Previously, we identified four genes (ehaA, ehaB, ehaC, and ehaD) from the prototypic EHEC strain EDL933 that encode for proteins that belong to the autotransporter (AT) family. Here we have examined the prevalence of these genes, as well as several other AT-encoding genes, in a collection of EHEC and EPEC strains. We show that the complement of AT-encoding genes in EHEC and EPEC strains is variable, with some AT-encoding genes being highly prevalent. One previously uncharacterized AT-encoding gene, which we have termed ehaJ, was identified in 12/44 (27%) of EHEC and 2/20 (10%) of EPEC strains. The ehaJ gene lies immediately adjacent to a gene encoding a putative glycosyltransferase (referred to as egtA). Western blot analysis using an EhaJ-specific antibody indicated that EhaJ is glycosylated by EgtA. Expression of EhaJ in a recombinant E. coli strain, revealed EhaJ is located at the cell surface and in the presence of the egtA glycosyltransferase gene mediates strong biofilm formation in microtiter plate and flow cell assays. EhaJ also mediated adherence to a range of extracellular matrix proteins, however this occurred independent of glycosylation. We also demonstrate that EhaJ is expressed in a wild-type EPEC strain following in vitro growth. However, deletion of ehaJ did not significantly alter its adherence or biofilm properties. In summary, EhaJ is a new glycosylated AT protein from EPEC and EHEC. Further studies are required to elucidate the function of EhaJ in colonization and virulence. PMID:21687429

  18. Targeted next-generation sequencing helps to decipher the genetic and phenotypic heterogeneity of hypertrophic cardiomyopathy

    PubMed Central

    Cecconi, Massimiliano; Parodi, Maria I.; Formisano, Francesco; Spirito, Paolo; Autore, Camillo; Musumeci, Maria B.; Favale, Stefano; Forleo, Cinzia; Rapezzi, Claudio; Biagini, Elena; Davì, Sabrina; Canepa, Elisabetta; Pennese, Loredana; Castagnetta, Mauro; Degiorgio, Dario; Coviello, Domenico A.

    2016-01-01

    Hypertrophic cardiomyopathy (HCM) is mainly associated with myosin, heavy chain 7 (MYH7) and myosin binding protein C, cardiac (MYBPC3) mutations. In order to better explain the clinical and genetic heterogeneity in HCM patients, in this study, we implemented a target-next generation sequencing (NGS) assay. An Ion AmpliSeq™ Custom Panel for the enrichment of 19 genes, of which 9 of these did not encode thick/intermediate and thin myofilament (TTm) proteins and, among them, 3 responsible of HCM phenocopy, was created. Ninety-two DNA samples were analyzed by the Ion Personal Genome Machine: 73 DNA samples (training set), previously genotyped in some of the genes by Sanger sequencing, were used to optimize the NGS strategy, whereas 19 DNA samples (discovery set) allowed the evaluation of NGS performance. In the training set, we identified 72 out of 73 expected mutations and 15 additional mutations: the molecular diagnosis was achieved in one patient with a previously wild-type status and the pre-excitation syndrome was explained in another. In the discovery set, we identified 20 mutations, 5 of which were in genes encoding non-TTm proteins, increasing the diagnostic yield by approximately 20%: a single mutation in genes encoding non-TTm proteins was identified in 2 out of 3 borderline HCM patients, whereas co-occuring mutations in genes encoding TTm and galactosidase alpha (GLA) altered proteins were characterized in a male with HCM and multiorgan dysfunction. Our combined targeted NGS-Sanger sequencing-based strategy allowed the molecular diagnosis of HCM with greater efficiency than using the conventional (Sanger) sequencing alone. Mutant alleles encoding non-TTm proteins may aid in the complete understanding of the genetic and phenotypic heterogeneity of HCM: co-occuring mutations of genes encoding TTm and non-TTm proteins could explain the wide variability of the HCM phenotype, whereas mutations in genes encoding only the non-TTm proteins are identifiable in patients with a milder HCM status. PMID:27600940

  19. Characterization of two genes encoding the Mycobacterium tuberculosis ribonucleotide reductase small subunit.

    PubMed Central

    Yang, F; Curran, S C; Li, L S; Avarbock, D; Graf, J D; Chua, M M; Lu, G; Salem, J; Rubin, H

    1997-01-01

    Two nrdF genes, nrdF1 and nrdF2, encoding the small subunit (R2) of ribonucleotide reductase (RR) from Mycobacterium tuberculosis have 71% identity at the amino acid level and are both highly homologous with Salmonella typhimurium R2F. The calculated molecular masses of R2-1 and R2-2 are 36,588 (322 amino acids [aa]) and 36,957 (324 aa) Da, respectively. Western blot analysis of crude M. tuberculosis extracts indicates that both R2s are expressed in vivo. Recombinant R2-2 is enzymatically active when assayed with pure recombinant M. tuberculosis R1 subunit. Both ATP and dATP are activators for CDP reduction up to 2 and 1 mM, respectively. The gene encoding M. tuberculosis R2-1, nrdF1, is not linked to nrdF2, nor is either gene linked to the gene encoding the large subunit, M. tuberculosis nrdE. The gene encoding MTP64 was found downstream from nrdF1, and the gene encoding alcohol dehydrogenase was found downstream from nrdF2. A nrdA(Ts) strain of E. coli (E101) could be complemented by simultaneous transformation with M. tuberculosis nrdE and nrdF2. An M. tuberculosis nrdF2 variant in which the codon for the catalytically necessary tyrosine was replaced by the phenylalanine codon did not complement E101 when cotransformed with M. tuberculosis nrdE. Similarly, M. tuberculosis nrdF1 and nrdE did not complement E101. Activity of recombinant M. tuberculosis RR was inhibited by incubating the enzyme with a peptide corresponding to the 7 C-terminal amino acid residues of the R2-2 subunit. M. tuberculosis is a species in which a nrdEF system appears to encode the biologically active species of RR and also the only bacterial species identified so far in which class I RR subunits are not arranged on an operon. PMID:9335290

  20. Cloning and sequence analysis of the LEU2 homologue gene from Pichia anomala.

    PubMed

    De la Rosa, J M; Pérez, J A; Gutiérrez, F; González, J M; Ruiz, T; Rodríguez, L

    2001-11-01

    The Pichia anomala LEU2 gene (PaLEU2) was isolated by complementation of a leu2 Saccharomyces cerevisiae mutant. The cloned gene also allowed growth of a Escherichia coli leuB mutant in leucine-lacking medium, indicating that it encodes a product able to complement the beta-isopropylmalate dehydrogenase deficiency of the mutants. The sequenced DNA fragment contains a complete ORF of 1092 bp, and the deduced polypeptide shares significant homologies with the products of the LEU2 genes from S. cerevisiae (84% identity) and other yeast species. A sequence resembling the GC-rich palindrome motif identified in the 5' region of S. cerevisiae LEU2 gene as the binding site for the transcription activating factor encoded by the LEU3 gene was found at the promoter region. In addition, upstream of the PaLEU2 the 3'-terminal half of a gene of the same orientation, encoding a homologue of the S. cerevisiae NFS1/SPL1 gene that encodes a mitochondrial cysteine desulphurase involved in both tRNA processing and mitochondrial metabolism, was found. The genomic organization of the PaNFS1-PaLEU2 gene pair is similar to that found in several other yeast species, including S. cerevisiae and Candida albicans, except that in some of them the LEU2 gene appears in the reverse orientation. Copyright 2001 John Wiley & Sons, Ltd.

  1. Antigenic profiling of Yersinia pestis infection in the Wyoming coyote (Canis latrans)

    USGS Publications Warehouse

    Vernati, G.; Edwards, W.H.; Rocke, T.E.; Little, S.F.; Andrews, G.P.

    2011-01-01

    Although Yersinia pestis is classified as a "high-virulence" pathogen, some host species are variably susceptible to disease. Coyotes (Canis latrans) exhibit mild, if any, symptoms during infection, but antibody production occurs postinfection. This immune response has been reported to be against the F1 capsule, although little subsequent characterization has been conducted. To further define the nature of coyote humoral immunity to plague, qualitative serology was conducted to assess the antiplague antibody repertoire. Humoral responses to six plasmid-encoded Y. pestis virulence factors were first examined. Of 20 individual immune coyotes, 90% were reactive to at least one other antigen in the panel other than F1. The frequency of reactivity to low calcium response plasmid (pLcr)-encoded Yersinia protein kinase A (YpkA) and Yersinia outer protein D (YopD) was significantly greater than that previously observed in a murine model for plague. Additionally, both V antigen and plasminogen activator were reactive with over half of the serum samples tested. Reactivity to F1 was markedly less frequent in coyotes (35%). Twenty previously tested antibody-negative samples were also examined. While the majority were negative across the panel, 15% were positive for 1-3 non-F1 antigens. In vivo-induced antigen technology employed to identify novel chromosomal genes of Y. pestis that are up-regulated during infection resulted in the identification of five proteins, including a flagellar component (FliP) that was uniquely reactive with the coyote serum compared with immune serum from two other host species. Collectively, these data suggest that humoral immunity to pLcr-encoded antigens and the pesticin plasmid (pPst)-encoded Pla antigen may be relevant to plague resistance in coyotes. The serologic profile of Y. pestis chromosomal antigens up-regulated in vivo specific to C. latrans may provide insight into the differences in the pathogen-host responses during Y. pestis infection.

  2. The Role of 4-Hydroxyphenylpyruvate Dioxygenase in Enhancement of Solid-Phase Electron Transfer by Shewanella oneidensis MR-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Turick, Charles E.; Beliaev, Alex S.; Zakrajsek, Brian A.

    2009-05-01

    ABSTRACT - While mechanistic details of dissimilatory metal reduction are far from being understood, it is postulated that the electron transfer to solid metal oxides is mediated by outer membrane associated c-type cytochromes and electron shuttling compounds. This study focuses on the production of homogensitate in Shewanella oneidensis MR-1, an intermediate of the tyrosine degradation pathway, which is a precursor of a redox cycling metabolite, pyomelanin. We determined that two enzymes involved in this pathway, 4-hydroxyphenylpyruvate dioxygenase (4HPPD) and homogentisate 1,2-dioxygenase are responsible for homogentisate production and oxidation, respectively. Inhibition of 4-HPPD activity with the specific inhibitor sulcotrione ([2-(2- chloro-more » 4- methane sulfonylbenzoyl)-1,3-cyclohexanedione), and deletion of melA, a gene encoding 4-HPPD, resulted in no pyomelanin production by S. oneidensis MR-1. Conversely, deletion of hmgA, which encodes the putative homogentisate 1,2-dioxygenase, resulted in pyomelanin overproduction. The efficiency and rates at which MR-1 reduces hydrous ferric oxide were directly linked to the ability of mutant strains to produce pyomelanin. Electrochemical studies with whole cells demonstrated that pyomelanin substantially increases the formal potential (E°') of S. oneidensis MR-1. Based on our findings, environmental production of pyomelanin likely contributes to an increased solid-phase metal reduction capacity in S. oneidensis MR-1.« less

  3. THE ROLE OF 4-HYDROXYPHENYLPYRUVATE DIOXYGENASE IN ENHANCEMENT OF SOLID-PHASE ELECTRON TRANSFER BY SHEWANELLA ONEIDENSIS MR-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Turick, C; Amy Ekechukwu, A

    2007-06-01

    While mechanistic details of dissimilatory metal reduction are far from being understood, it is postulated that the electron transfer to solid metal oxides is mediated by outer membrane-associated c-type cytochromes and redox active electron shuttling compounds. This study focuses on the production of homogensitate in Shewanella oneidensis MR-1, an intermediate of tyrosine degradation pathway, which is a precursor of a redox cycling metabolite, pyomelanin. In this study, we determined that two enzymes involved in this pathway, 4-hydroxyphenylpyruvate dioxygenase (4HPPD) and homogentisate 1,2-dioxygenase are responsible for homogentisate production and oxidation, respectively. Inhibition of 4-HPPD activity with the specific inhibitor sulcotrione (2-(2-chloro-4-methanemore » sulfonylbenzoyl)-1,3-cyclohexanedione), and deletion of melA, a gene encoding 4-HPPD, resulted in no pyomelanin production by S. oneidensis MR-1. Conversely, deletion of hmgA which encodes the putative homogentisate 1,2-dioxygenase, resulted in pyomelanin overproduction. The efficiency and rates, with which MR-1 reduces hydrous ferric oxide, were directly linked to the ability of mutant strains to produce pyomelanin. Electrochemical studies with whole cells demonstrated that pyomelanin substantially increases the formal potential (E{sup o}{prime}) of S. oneidensis MR-1. Based on this work, environmental production of pyomelanin likely contributes to an increased solid-phase metal reduction capacity in Shewanella oneidensis.« less

  4. The interplay between siderophore secretion and coupled iron and copper transport in the heterocyst-forming cyanobacterium Anabaena sp. PCC 7120.

    PubMed

    Nicolaisen, Kerstin; Hahn, Alexander; Valdebenito, Marianne; Moslavac, Suncana; Samborski, Anastazia; Maldener, Iris; Wilken, Corinna; Valladares, Ana; Flores, Enrique; Hantke, Klaus; Schleiff, Enrico

    2010-11-01

    Iron uptake is essential for Gram-negative bacteria including cyanobacteria. In cyanobacteria, however, the iron demand is higher than in proteobacteria due to the function of iron as a cofactor in photosynthesis and nitrogen fixation, but our understanding of iron uptake by cyanobacteria stands behind the knowledge in proteobacteria. Here, two genes involved in this process in the heterocyst-forming cyanobacterium Anabaena sp. PCC 7120 were identified. ORF all4025 encodes SchE, a putative cytoplasmic membrane-localized transporter involved in TolC-dependent siderophore secretion. Inactivation of schE resulted in an enhanced sensitivity to high metal concentrations and decreased secretion of hydroxamate-type siderophores. ORF all4026 encodes a predicted outer membrane-localized TonB-dependent iron transporter, IacT. Inactivation of iacT resulted in decreased sensitivity to elevated iron and copper levels. Expression of iacT from the artificial trc promoter (P(trc)) resulted in sensitization against tested metals. Further analysis showed that iron and copper effects are synergistic because a decreased supply of iron induced a significant decrease of copper levels in the iacT insertion mutant but an increase of those levels in the strain carrying P(trc)-iacT. Our results unravel a link between iron and copper homeostasis in Anabaena sp. PCC 7120. Copyright © 2010 Elsevier B.V. All rights reserved.

  5. Impaired Dendritic Development and Memory in Sorbs2 Knock-Out Mice

    PubMed Central

    Zhang, Qiangge; Gao, Xian; Li, Chenchen; Feliciano, Catia; Wang, Dongqing; Zhou, Dingxi; Mei, Yuan; Monteiro, Patricia; Anand, Michelle; Itohara, Shigeyoshi; Dong, Xiaowei; Fu, Zhanyan

    2016-01-01

    Intellectual disability is a common neurodevelopmental disorder characterized by impaired intellectual and adaptive functioning. Both environmental insults and genetic defects contribute to the etiology of intellectual disability. Copy number variations of SORBS2 have been linked to intellectual disability. However, the neurobiological function of SORBS2 in the brain is unknown. The SORBS2 gene encodes ArgBP2 (Arg/c-Abl kinase binding protein 2) protein in non-neuronal tissues and is alternatively spliced in the brain to encode nArgBP2 protein. We found nArgBP2 colocalized with F-actin at dendritic spines and growth cones in cultured hippocampal neurons. In the mouse brain, nArgBP2 was highly expressed in the cortex, amygdala, and hippocampus, and enriched in the outer one-third of the molecular layer in dentate gyrus. Genetic deletion of Sorbs2 in mice led to reduced dendritic complexity and decreased frequency of AMPAR-miniature spontaneous EPSCs in dentate gyrus granule cells. Behavioral characterization revealed that Sorbs2 deletion led to a reduced acoustic startle response, and defective long-term object recognition memory and contextual fear memory. Together, our findings demonstrate, for the first time, an important role for nArgBP2 in neuronal dendritic development and excitatory synaptic transmission, which may thus inform exploration of neurobiological basis of SORBS2 deficiency in intellectual disability. SIGNIFICANCE STATEMENT Copy number variations of the SORBS2 gene are linked to intellectual disability, but the neurobiological mechanisms are unknown. We found that nArgBP2, the only neuronal isoform encoded by SORBS2, colocalizes with F-actin at neuronal dendritic growth cones and spines. nArgBP2 is highly expressed in the cortex, amygdala, and dentate gyrus in the mouse brain. Genetic deletion of Sorbs2 in mice leads to impaired dendritic complexity and reduced excitatory synaptic transmission in dentate gyrus granule cells, accompanied by behavioral deficits in acoustic startle response and long-term memory. This is the first study of Sorbs2 function in the brain, and our findings may facilitate the study of neurobiological mechanisms underlying SORBS2 deficiency in the development of intellectual disability. PMID:26888934

  6. Systematic mutagenesis of genes encoding predicted autotransported proteins of Burkholderia pseudomallei identifies factors mediating virulence in mice, net intracellular replication and a novel protein conferring serum resistance.

    PubMed

    Lazar Adler, Natalie R; Stevens, Mark P; Dean, Rachel E; Saint, Richard J; Pankhania, Depesh; Prior, Joann L; Atkins, Timothy P; Kessler, Bianca; Nithichanon, Arnone; Lertmemongkolchai, Ganjana; Galyov, Edouard E

    2015-01-01

    Burkholderia pseudomallei is the causative agent of the severe tropical disease melioidosis, which commonly presents as sepsis. The B. pseudomallei K96243 genome encodes eleven predicted autotransporters, a diverse family of secreted and outer membrane proteins often associated with virulence. In a systematic study of these autotransporters, we constructed insertion mutants in each gene predicted to encode an autotransporter and assessed them for three pathogenesis-associated phenotypes: virulence in the BALB/c intra-peritoneal mouse melioidosis model, net intracellular replication in J774.2 murine macrophage-like cells and survival in 45% (v/v) normal human serum. From the complete repertoire of eleven autotransporter mutants, we identified eight mutants which exhibited an increase in median lethal dose of 1 to 2-log10 compared to the isogenic parent strain (bcaA, boaA, boaB, bpaA, bpaC, bpaE, bpaF and bimA). Four mutants, all demonstrating attenuation for virulence, exhibited reduced net intracellular replication in J774.2 macrophage-like cells (bimA, boaB, bpaC and bpaE). A single mutant (bpaC) was identified that exhibited significantly reduced serum survival compared to wild-type. The bpaC mutant, which demonstrated attenuation for virulence and net intracellular replication, was sensitive to complement-mediated killing via the classical and/or lectin pathway. Serum resistance was rescued by in trans complementation. Subsequently, we expressed recombinant proteins of the passenger domain of four predicted autotransporters representing each of the phenotypic groups identified: those attenuated for virulence (BcaA), those attenuated for virulence and net intracellular replication (BpaE), the BpaC mutant with defects in virulence, net intracellular replication and serum resistance and those displaying wild-type phenotypes (BatA). Only BcaA and BpaE elicited a strong IFN-γ response in a restimulation assay using whole blood from seropositive donors and were recognised by seropositive human sera from the endemic area. To conclude, several predicted autotransporters contribute to B. pseudomallei virulence and BpaC may do so by conferring resistance against complement-mediated killing.

  7. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

    PubMed

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

    2014-04-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

  8. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

    PubMed Central

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

    2014-01-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

  9. The prenyl-binding protein PrBP/δ: a chaperone participating in intracellular trafficking.

    PubMed

    Zhang, Houbin; Constantine, Ryan; Frederick, Jeanne M; Baehr, Wolfgang

    2012-12-15

    Expressed ubiquitously, PrBP/δ functions as chaperone/co-factor in the transport of a subset of prenylated proteins. PrBP/δ features an immunoglobulin-like β-sandwich fold for lipid binding, and interacts with diverse partners. PrBP/δ binds both C-terminal C15 and C20 prenyl side chains of phototransduction polypeptides and small GTP-binding (G) proteins of the Ras superfamily. PrBP/δ also interacts with the small GTPases, ARL2 and ARL3, which act as release factors (GDFs) for prenylated cargo. Targeted deletion of the mouse Pde6d gene encoding PrBP/δ resulted in impeded trafficking to the outer segments of GRK1 and cone PDE6 which are predicted to be farnesylated and geranylgeranylated, respectively. Rod and cone transducin trafficking was largely unaffected. These trafficking defects produce progressive cone-rod dystrophy in the Pde6d(-/-) mouse. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Genetic Characterization of the Tick-Borne Orbiviruses

    PubMed Central

    Belaganahalli, Manjunatha N.; Maan, Sushila; Maan, Narender S.; Brownlie, Joe; Tesh, Robert; Attoui, Houssam; Mertens, Peter P. C.

    2015-01-01

    The International Committee for Taxonomy of Viruses (ICTV) recognizes four species of tick-borne orbiviruses (TBOs): Chenuda virus, Chobar Gorge virus, Wad Medani virus and Great Island virus (genus Orbivirus, family Reoviridae). Nucleotide (nt) and amino acid (aa) sequence comparisons provide a basis for orbivirus detection and classification, however full genome sequence data were only available for the Great Island virus species. We report representative genome-sequences for the three other TBO species (virus isolates: Chenuda virus (CNUV); Chobar Gorge virus (CGV) and Wad Medani virus (WMV)). Phylogenetic comparisons show that TBOs cluster separately from insect-borne orbiviruses (IBOs). CNUV, CGV, WMV and GIV share low level aa/nt identities with other orbiviruses, in ‘conserved’ Pol, T2 and T13 proteins/genes, identifying them as four distinct virus-species. The TBO genome segment encoding cell attachment, outer capsid protein 1 (OC1), is approximately half the size of the equivalent segment from insect-borne orbiviruses, helping to explain why tick-borne orbiviruses have a ~1 kb smaller genome. PMID:25928203

  11. Genetic characterization of the tick-borne orbiviruses.

    PubMed

    Belaganahalli, Manjunatha N; Maan, Sushila; Maan, Narender S; Brownlie, Joe; Tesh, Robert; Attoui, Houssam; Mertens, Peter P C

    2015-04-28

    The International Committee for Taxonomy of Viruses (ICTV) recognizes four species of tick-borne orbiviruses (TBOs): Chenuda virus, Chobar Gorge virus, Wad Medani virus and Great Island virus (genus Orbivirus, family Reoviridae). Nucleotide (nt) and amino acid (aa) sequence comparisons provide a basis for orbivirus detection and classification, however full genome sequence data were only available for the Great Island virus species. We report representative genome-sequences for the three other TBO species (virus isolates: Chenuda virus (CNUV); Chobar Gorge virus (CGV) and Wad Medani virus (WMV)). Phylogenetic comparisons show that TBOs cluster separately from insect-borne orbiviruses (IBOs). CNUV, CGV, WMV and GIV share low level aa/nt identities with other orbiviruses, in 'conserved' Pol, T2 and T13 proteins/genes, identifying them as four distinct virus-species. The TBO genome segment encoding cell attachment, outer capsid protein 1 (OC1), is approximately half the size of the equivalent segment from insect-borne orbiviruses, helping to explain why tick-borne orbiviruses have a ~1 kb smaller genome.

  12. Effects of CuO nanoparticles on insecticidal activity and phytotoxicity in conventional and transgenic cotton.

    PubMed

    Van, Nhan Le; Ma, Chuanxin; Shang, Jianying; Rui, Yukui; Liu, Shutong; Xing, Baoshan

    2016-02-01

    Nanoparticles and transgenic plants are recent scientific developments that require systematic study to understand their potential risks to human health. The effects of CuO nanoparticles (NPs) on Bt-transgenic cotton and conventional cotton are reported here. CuO NPs inhibited the growth, development, nutrient content, and indole-3-acetic acid (IAA) and abscisic acid (ABA) concentrations of transgenic and conventional cotton. Transmission electron microscopy (TEM) images showed CuO NPs aggregated on the epidermis of conventional cotton leaves, whereas it had reached into the cells of transgenic cotton leaves by endocytosis. Most CuO NPs aggregates were found on the root outer epidermis and the rest were located in intercellular spaces of both conventional and Bt-transgenic cottons. CuO NPs enhanced the expression of the exogenous gene encoding of Bt toxin protein in leaves and roots, especially at low CuO NP concentrations, providing an important benefit for Bt cotton insect resistance. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Unique activity spectrum of colicin FY: all 110 characterized Yersinia enterocolitica isolates were colicin FY susceptible.

    PubMed

    Bosák, Juraj; Micenková, Lenka; Vrba, Martin; Ševčíková, Alena; Dědičová, Daniela; Garzetti, Debora; Šmajs, David

    2013-01-01

    Colicin FY is a plasmid encoded toxin that recognizes a yersinia-specific outer membrane protein (YiuR) as a receptor molecule. We have previously shown that the activity spectrum of colicin FY comprises strains of the genus Yersinia. In this study, we analyzed the activity of colicin FY against 110 Yersinia enterocolitica isolates differing in geographical origin and source. All isolates were characterized through analysis of 16S rRNA genes, serotyping, biotyping, restriction profiling of genomic DNA, detection of virulence markers and susceptibility to antibiotics. This confirmed the broad variability of the collection, in which all 110 Y. enterocolitica isolates, representing 77 various strains, were inhibited by colicin FY. Although isolates showed variable levels of susceptibility to colicin FY, it was not associated with any strain characteristic. The universal susceptibility of Y. enterocolitica strains to colicin FY together with the absence of activity towards strains outside the Yersinia genus suggests potential therapeutic applications for colicin FY.

  14. Unique Activity Spectrum of Colicin FY: All 110 Characterized Yersinia enterocolitica Isolates Were Colicin FY Susceptible

    PubMed Central

    Bosák, Juraj; Micenková, Lenka; Vrba, Martin; Ševčíková, Alena; Dědičová, Daniela; Garzetti, Debora; Šmajs, David

    2013-01-01

    Colicin FY is a plasmid encoded toxin that recognizes a yersinia-specific outer membrane protein (YiuR) as a receptor molecule. We have previously shown that the activity spectrum of colicin FY comprises strains of the genus Yersinia. In this study, we analyzed the activity of colicin FY against 110 Yersinia enterocolitica isolates differing in geographical origin and source. All isolates were characterized through analysis of 16S rRNA genes, serotyping, biotyping, restriction profiling of genomic DNA, detection of virulence markers and susceptibility to antibiotics. This confirmed the broad variability of the collection, in which all 110 Y. enterocolitica isolates, representing 77 various strains, were inhibited by colicin FY. Although isolates showed variable levels of susceptibility to colicin FY, it was not associated with any strain characteristic. The universal susceptibility of Y. enterocolitica strains to colicin FY together with the absence of activity towards strains outside the Yersinia genus suggests potential therapeutic applications for colicin FY. PMID:24339971

  15. CCDC103 mutations cause primary ciliary dyskinesia by disrupting assembly of ciliary dynein arms

    PubMed Central

    Panizzi, Jennifer R.; Becker-Heck, Anita; Castleman, Victoria H.; Al-Mutairi, Dalal; Liu, Yan; Loges, Niki T.; Pathak, Narendra; Austin-Tse, Christina; Sheridan, Eamonn; Schmidts, Miriam; Olbrich, Heike; Werner, Claudius; Häffner, Karsten; Hellman, Nathan; Chodhari, Rahul; Gupta, Amar; Kramer-Zucker, Albrecht; Olale, Felix; Burdine, Rebecca D.; Schier, Alexander F.; O’Callaghan, Christopher; Chung, Eddie MK; Reinhardt, Richard; Mitchison, Hannah M.; King, Stephen M.; Omran, Heymut; Drummond, Iain A.

    2012-01-01

    Cilia are essential for fertilization, respiratory clearance, cerebrospinal fluid circulation, and to establish laterality1. Cilia motility defects cause Primary Ciliary Dyskinesia (PCD, MIM 242650), a disorder affecting 1:15-30,000 births. Cilia motility requires the assembly of multisubunit dynein arms that drive cilia bending2. Despite progress in understanding the genetic basis of PCD, mutations remain to be identified for several PCD linked loci3. Here we show that the zebrafish cilia paralysis mutant schmalhanstn222 (smh) mutant encodes the coiled-coil domain containing 103 protein (Ccdc103), a foxj1a regulated gene. Screening 146 unrelated PCD families identified patients in six families with reduced outer dynein arms, carrying mutations in CCDC103. Dynein arm assembly in smh mutant zebrafish was rescued by wild-type but not mutant human CCDC103. Chlamydomonas Ccdc103 functions as a tightly bound, axoneme-associated protein. The results identify Ccdc103 as a novel dynein arm attachment factor that when mutated causes Primary Ciliary Dyskinesia. PMID:22581229

  16. A Different Microbiome Gene Repertoire in the Airways of Cystic Fibrosis Patients with Severe Lung Disease

    PubMed Central

    Bacci, Giovanni; Fiscarelli, Ersilia; Taccetti, Giovanni; Dolce, Daniela; Paganin, Patrizia; Morelli, Patrizia; Tuccio, Vanessa; De Alessandri, Alessandra; Lucidi, Vincenzina

    2017-01-01

    In recent years, next-generation sequencing (NGS) was employed to decipher the structure and composition of the microbiota of the airways in cystic fibrosis (CF) patients. However, little is still known about the overall gene functions harbored by the resident microbial populations and which specific genes are associated with various stages of CF lung disease. In the present study, we aimed to identify the microbial gene repertoire of CF microbiota in twelve patients with severe and normal/mild lung disease by performing sputum shotgun metagenome sequencing. The abundance of metabolic pathways encoded by microbes inhabiting CF airways was reconstructed from the metagenome. We identified a set of metabolic pathways differently distributed in patients with different pulmonary function; namely, pathways related to bacterial chemotaxis and flagellar assembly, as well as genes encoding efflux-mediated antibiotic resistance mechanisms and virulence-related genes. The results indicated that the microbiome of CF patients with low pulmonary function is enriched in virulence-related genes and in genes encoding efflux-mediated antibiotic resistance mechanisms. Overall, the microbiome of severely affected adults with CF seems to encode different mechanisms for the facilitation of microbial colonization and persistence in the lung, consistent with the characteristics of multidrug-resistant microbial communities that are commonly observed in patients with severe lung disease. PMID:28758937

  17. Activation of Pathogenesis-related Genes by the Rhizobacterium, Bacillus sp. JS, Which Induces Systemic Resistance in Tobacco Plants.

    PubMed

    Kim, Ji-Seong; Lee, Jeongeun; Lee, Chan-Hui; Woo, Su Young; Kang, Hoduck; Seo, Sang-Gyu; Kim, Sun-Hyung

    2015-06-01

    Plant growth promoting rhizobacteria (PGPR) are known to confer disease resistance to plants. Bacillus sp. JS demonstrated antifungal activities against five fungal pathogens in in vitro assays. To verify whether the volatiles of Bacillus sp. JS confer disease resistance, tobacco leaves pre-treated with the volatiles were damaged by the fungal pathogen, Rhizoctonia solani and oomycete Phytophthora nicotianae. Pre-treated tobacco leaves had smaller lesion than the control plant leaves. In pathogenesis-related (PR) gene expression analysis, volatiles of Bacillus sp. JS caused the up-regulation of PR-2 encoding β-1,3-glucanase and acidic PR-3 encoding chitinase. Expression of acidic PR-4 encoding chitinase and acidic PR-9 encoding peroxidase increased gradually after exposure of the volatiles to Bacillus sp. JS. Basic PR-14 encoding lipid transfer protein was also increased. However, PR-1 genes, as markers of salicylic acid (SA) induced resistance, were not expressed. These results suggested that the volatiles of Bacillus sp. JS confer disease resistance against fungal and oomycete pathogens through PR genes expression.

  18. Fusagene vectors: a novel strategy for the expression of multiple genes from a single cistron.

    PubMed

    Gäken, J; Jiang, J; Daniel, K; van Berkel, E; Hughes, C; Kuiper, M; Darling, D; Tavassoli, M; Galea-Lauri, J; Ford, K; Kemeny, M; Russell, S; Farzaneh, F

    2000-12-01

    Transduction of cells with multiple genes, allowing their stable and co-ordinated expression, is difficult with the available methodologies. A method has been developed for expression of multiple gene products, as fusion proteins, from a single cistron. The encoded proteins are post-synthetically cleaved and processed into each of their constituent proteins as individual, biologically active factors. Specifically, linkers encoding cleavage sites for the Golgi expressed endoprotease, furin, have been incorporated between in-frame cDNA sequences encoding different secreted or membrane bound proteins. With this strategy we have developed expression vectors encoding multiple proteins (IL-2 and B7.1, IL-4 and B7.1, IL-4 and IL-2, IL-12 p40 and p35, and IL-12 p40, p35 and IL-2 ). Transduction and analysis of over 100 individual clones, derived from murine and human tumour cell lines, demonstrate the efficient expression and biological activity of each of the encoded proteins. Fusagene vectors enable the co-ordinated expression of multiple gene products from a single, monocistronic, expression cassette.

  19. Structure, Expression, Chromosomal Location and Product of the Gene Encoding Adh2 in Petunia

    PubMed Central

    Gregerson, R. G.; Cameron, L.; McLean, M.; Dennis, P.; Strommer, J.

    1993-01-01

    In most higher plants the genes encoding alcohol dehydrogenase comprise a small gene family, usually with two members. The Adh1 gene of Petunia has been cloned and analyzed, but a second identifiable gene was not recovered from any of three genomic libraries. We have therefore employed the polymerase chain reaction to obtain the major portion of a second Adh gene. From sequence, mapping and northern data we conclude this gene encodes ADH2, the major anaerobically inducible Adh gene of Petunia. The availability of both Adh1 and Adh2 from Petunia has permitted us to compare their structures and patterns of expression to those of the well-studied Adh genes of maize, of which one is highly expressed developmentally, while both are induced in response to hypoxia. Despite their evolutionary distance, evidenced by deduced amino acid sequence as well as taxonomic classification, the pairs of genes are regulated in strikingly similar ways in maize and Petunia. Our findings suggest a significant biological basis for the regulatory strategy employed by these distant species for differential expression of multiple Adh genes. PMID:8096485

  20. Regulation of Bacteriocin Production in Streptococcus mutans by the Quorum-Sensing System Required for Development of Genetic Competence

    PubMed Central

    van der Ploeg, Jan R.

    2005-01-01

    In Streptococcus mutans, competence for genetic transformation and biofilm formation are dependent on the two-component signal transduction system ComDE together with the inducer peptide pheromone competence-stimulating peptide (CSP) (encoded by comC). Here, it is shown that the same system is also required for expression of the nlmAB genes, which encode a two-peptide nonlantibiotic bacteriocin. Expression from a transcriptional nlmAB′-lacZ fusion was highest at high cell density and was increased up to 60-fold following addition of CSP, but it was abolished when the comDE genes were interrupted. Two more genes, encoding another putative bacteriocin and a putative bacteriocin immunity protein, were also regulated by this system. The regions upstream of these genes and of two further putative bacteriocin-encoding genes and a gene encoding a putative bacteriocin immunity protein contained a conserved 9-bp repeat element just upstream of the transcription start, which suggests that expression of these genes is also dependent on the ComCDE regulatory system. Mutations in the repeat element of the nlmAB promoter region led to a decrease in CSP-dependent expression of nlmAB′-lacZ. In agreement with these results, a comDE mutant and mutants unable to synthesize or export CSP did not produce bacteriocins. It is speculated that, at high cell density, bacteriocin production is induced to liberate DNA from competing streptococci. PMID:15937160

  1. Functional characterization of an apple (Malus x domestica) LysM domain receptor encoding gene for its role in defense response

    USDA-ARS?s Scientific Manuscript database

    Apple gene MDP0000136494 was identified as the only LysM containing protein encoding gene which was specifically up-regulated in P. ultimum infected apple root by a previous transcriptome analysis. In current study, the functional identity of MDP0000136494 was investigated using combined genomic, tr...

  2. Cloning and sequencing the genes encoding goldfish and carp ependymin.

    PubMed

    Adams, D S; Shashoua, V E

    1994-04-20

    Ependymins (EPNs) are brain glycoproteins thought to function in optic nerve regeneration and long-term memory consolidation. To date, epn genes have been characterized in two orders of teleost fish. In this study, polymerase chain reactions (PCR) were used to amplify the complete 1.6-kb epn genes, gf-I and cc-I, from genomic DNA of Cypriniformes, goldfish and carp, respectively. Amplified bands were cloned and sequenced. Each gene consists of six exons and five introns. The exon portion of gf-I encodes a predicted 215-amino-acid (aa) protein previously characterized as GF-I, while cc-I encodes a predicted 215-aa protein 95% homologous to GF-I.

  3. The complete mitochondrial genome sequence of Eimeria innocua (Eimeriidae, Coccidia, Apicomplexa).

    PubMed

    Hafeez, Mian Abdul; Vrba, Vladimir; Barta, John Robert

    2016-07-01

    The complete mitochondrial genome of Eimeria innocua KR strain (Eimeriidae, Coccidia, Apicomplexa) was sequenced. This coccidium infects turkeys (Meleagris gallopavo), Bobwhite quails (Colinus virginianus), and Grey partridges (Perdix perdix). Genome organization and gene contents were comparable with other Eimeria spp. infecting galliform birds. The circular-mapping mt genome of E. innocua is 6247 bp in length with three protein-coding genes (cox1, cox3, and cytb), 19 gene fragments encoding large subunit (LSU) rRNA and 14 gene fragments encoding small subunit (SSU) rRNA. Like other Apicomplexa, no tRNA was encoded. The mitochondrial genome of E. innocua confirms its close phylogenetic affinities to Eimeria dispersa.

  4. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  5. Isolation and characterization of polygalacturonase genes (pecA and pecB) from Aspergillus flavus.

    PubMed Central

    Whitehead, M P; Shieh, M T; Cleveland, T E; Cary, J W; Dean, R A

    1995-01-01

    Two genes, pecA and pecB, encoding endopolyglacturonases were cloned from a highly aggressive strain of Aspergillus flavus. The pecA gene consisted of 1,228 bp encoding a protein of 363 amino acids with a predicted molecular mass of 37.6 kDa, interrupted by two introns of 58 and 81 bp in length. Accumulation of pecA mRNA in both pectin- or glucose-grown mycelia in the highly aggressive strain matched the activity profile of a pectinase previously identified as P2c. Transformants of a weakly aggressive strain containing a functional copy of the pecA gene produced P2c in vitro, confirming that pecA encodes P2c. The coding region of pecB was determined to be 1,217 bp in length interrupted by two introns of 65 and 54 bp in length. The predicted protein of 366 amino acids had an estimated molecular mass of 38 kDa. Transcripts of this gene accumulated in mycelia grown in medium containing pectin alone, never in mycelia grown in glucose-containing medium, for both highly and weakly aggressive strains. Thus, pecB encodes the activity previously identified as P1 or P3. pecA and pecB share a high degree of sequence identity with polygalacturonase genes from Aspergillus parasiticus and Aspergillus oryzae, further establishing the close relationships between members of the A. flavus group. Conservation of intron positions in these genes also indicates that they share a common ancestor with genes encoding endopolyglacturonases of Aspergillus niger. PMID:7574642

  6. Draft Genome Sequence of Ezakiella peruensis Strain M6.X2, a Human Gut Gram-Positive Anaerobic Coccus.

    PubMed

    Diop, Awa; Diop, Khoudia; Tomei, Enora; Raoult, Didier; Fenollar, Florence; Fournier, Pierre-Edouard

    2018-03-01

    We report here the draft genome sequence of Ezakiella peruensis strain M6.X2 T The draft genome is 1,672,788 bp long and harbors 1,589 predicted protein-encoding genes, including 26 antibiotic resistance genes with 1 gene encoding vancomycin resistance. The genome also exhibits 1 clustered regularly interspaced short palindromic repeat region and 333 genes acquired by horizontal gene transfer. Copyright © 2018 Diop et al.

  7. Natural Hypolignification Is Associated with Extensive Oligolignol Accumulation in Flax Stems1[C][W

    PubMed Central

    Huis, Rudy; Morreel, Kris; Fliniaux, Ophélie; Lucau-Danila, Anca; Fénart, Stéphane; Grec, Sébastien; Neutelings, Godfrey; Chabbert, Brigitte; Mesnard, François; Boerjan, Wout; Hawkins, Simon

    2012-01-01

    Flax (Linum usitatissimum) stems contain cells showing contrasting cell wall structure: lignified in inner stem xylem tissue and hypolignified in outer stem bast fibers. We hypothesized that stem hypolignification should be associated with extensive phenolic accumulation and used metabolomics and transcriptomics to characterize these two tissues. 1H nuclear magnetic resonance clearly distinguished inner and outer stem tissues and identified different primary and secondary metabolites, including coniferin and p-coumaryl alcohol glucoside. Ultrahigh-performance liquid chromatography-Fourier transform ion cyclotron resonance-mass spectrometry aromatic profiling (lignomics) identified 81 phenolic compounds, of which 65 were identified, to our knowledge, for the first time in flax and 11 for the first time in higher plants. Both aglycone forms and glycosides of monolignols, lignin oligomers, and (neo)lignans were identified in both inner and outer stem tissues, with a preponderance of glycosides in the hypolignified outer stem, indicating the existence of a complex monolignol metabolism. The presence of coniferin-containing secondary metabolites suggested that coniferyl alcohol, in addition to being used in lignin and (neo)lignan formation, was also utilized in a third, partially uncharacterized metabolic pathway. Hypolignification of bast fibers in outer stem tissues was correlated with the low transcript abundance of monolignol biosynthetic genes, laccase genes, and certain peroxidase genes, suggesting that flax hypolignification is transcriptionally regulated. Transcripts of the key lignan genes Pinoresinol-Lariciresinol Reductase and Phenylcoumaran Benzylic Ether Reductase were also highly abundant in flax inner stem tissues. Expression profiling allowed the identification of NAC (NAM, ATAF1/2, CUC2) and MYB transcription factors that are likely involved in regulating both monolignol production and polymerization as well as (neo)lignan production. PMID:22331411

  8. Deregulation of Rab and Rab Effector Genes in Bladder Cancer

    PubMed Central

    Ho, Joel R.; Chapeaublanc, Elodie; Kirkwood, Lisa; Nicolle, Remy; Benhamou, Simone; Lebret, Thierry; Allory, Yves; Southgate, Jennifer; Radvanyi, François; Goud, Bruno

    2012-01-01

    Growing evidence indicates that Rab GTPases, key regulators of intracellular transport in eukaryotic cells, play an important role in cancer. We analysed the deregulation at the transcriptional level of the genes encoding Rab proteins and Rab-interacting proteins in bladder cancer pathogenesis, distinguishing between the two main progression pathways so far identified in bladder cancer: the Ta pathway characterized by a high frequency of FGFR3 mutation and the carcinoma in situ pathway where no or infrequent FGFR3 mutations have been identified. A systematic literature search identified 61 genes encoding Rab proteins and 223 genes encoding Rab-interacting proteins. Transcriptomic data were obtained for normal urothelium samples and for two independent bladder cancer data sets corresponding to 152 and 75 tumors. Gene deregulation was analysed with the SAM (significant analysis of microarray) test or the binomial test. Overall, 30 genes were down-regulated, and 13 were up-regulated in the tumor samples. Five of these deregulated genes (LEPRE1, MICAL2, RAB23, STXBP1, SYTL1) were specifically deregulated in FGFR3-non-mutated muscle-invasive tumors. No gene encoding a Rab or Rab-interacting protein was found to be specifically deregulated in FGFR3-mutated tumors. Cluster analysis showed that the RAB27 gene cluster (comprising the genes encoding RAB27 and its interacting partners) was deregulated and that this deregulation was associated with both pathways of bladder cancer pathogenesis. Finally, we found that the expression of KIF20A and ZWINT was associated with that of proliferation markers and that the expression of MLPH, MYO5B, RAB11A, RAB11FIP1, RAB20 and SYTL2 was associated with that of urothelial cell differentiation markers. This systematic analysis of Rab and Rab effector gene deregulation in bladder cancer, taking relevant tumor subgroups into account, provides insight into the possible roles of Rab proteins and their effectors in bladder cancer pathogenesis. This approach is applicable to other group of genes and types of cancer. PMID:22724020

  9. Tissue-specific roles of Tbx1 in the development of the outer, middle and inner ear, defective in 22q11DS patients

    PubMed Central

    Arnold, Jelena S.; Braunstein, Evan M.; Ohyama, Takahiro; Groves, Andrew K.; Adams, Joe C.; Brown, M. Christian; Morrow, Bernice E.

    2007-01-01

    Most 22q11.2 deletion syndrome (22q11DS) patients have middle and outer ear anomalies, whereas some have inner ear malformations. Tbx1, a gene hemizygously deleted in 22q11DS patients and required for ear development, is expressed in multiple tissues during embryogenesis. To determine the role of Tbx1 in the first pharyngeal pouch (PPI) in forming outer and middle ears, we tissue-specifically inactivated the gene using Foxg1-Cre. In the conditional mutants, PPI failed to outgrow, preventing the middle ear bone condensations from forming. Tbx1 was also inactivated in the otic vesicle (OV), resulting in the failure of inner ear sensory organ formation, and in duplication of the cochleovestibular ganglion (CVG). Consistent with the anatomical defects, the sensory genes, Otx1 and Bmp4 were downregulated, whereas the CVG genes, Fgf3 and NeuroD, were upregulated. To delineate Tbx1 cell-autonomous roles, a more selective ablation, exclusively in the OV, was performed using Pax2-Cre. In contrast to the Foxg1-Cre mutants, Pax2-Cre conditional mutant mice survived to adulthood and had normal outer and middle ears but had the same inner ear defects as the Tbx1 null mice, with the same gene expression changes. These results demonstrate that Tbx1 has non-cell autonomous roles in PPI in the formation of outer and middle ears and cell-autonomous roles in the OV. Periotic mesenchymal markers, Prx2 and Brn4 were normal in both conditional mutants, whereas they were diminished in Tbx1−/− embryos. Thus, Tbx1 in the surrounding mesenchyme in both sets of conditional mutants cannot suppress the defects in the OV that occur in the null mutants. PMID:16600992

  10. Differences in virulence genes and genome patterns of mastitis-associated Staphylococcus aureus among goat, cow, and human isolates in Taiwan.

    PubMed

    Chu, Chishih; Wei, Yajiun; Chuang, Shih-Te; Yu, Changyou; Changchien, Chih-Hsuan; Su, Yaochi

    2013-03-01

    A total of 117 mastitis-associated Staphylococcus aureus isolates from cow, goat, and human patients were analyzed for differences in antibiotic susceptibility, virulence genes, and genotypes using accessory gene regulator (agr) typing, pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Multidrug-resistant (MDR) S. aureus were commonly found in all sources, though they were predominantly found in human and goat isolates. Almost 70% of the isolates were resistant to ampicillin and penicillin. Host-associated virulence genes were identified as follows: tst, a gene encoding toxic shock syndrome toxin, was found in goat isolates; lukED and lukM, genes encoding leukocidin, found in cow isolates; lukPV, a gene encoding leukocidin, found in human isolates; and eta, a gene encoding for exfoliative toxin, found in both human and cow isolates. All four types of hemolysin, α, β, γ, and δ, were identified in human isolates, three types (α, γ, and δ), were identified in cow isolates, and two types (α and δ) were identified in goat isolates. Agr-typing determined agr1 to be the main subtype in human and cow isolates. PFGE and MLST analysis revealed the presence of diverse genotypes among the three sources. In conclusion, mastitis-associated, genetically diverse strains of MDR S. aureus differed in virulence genes among human, cow, and goat isolates.

  11. Functions of the Magnaporthe oryzae Flb3p and Flb4p transcription factors in the regulation of conidiation.

    PubMed

    Matheis, S; Yemelin, A; Scheps, D; Andresen, K; Jacob, S; Thines, E; Foster, A J

    2017-03-01

    The Magnaporthe oryzae genes FLB3 and FLB4, orthologues of the Aspergillus nidulans regulators of conidiation FlbC and FlbD, were inactivated. These genes encode C2H2 zinc finger and Myb-like transcription factors, respectively, in A. nidulans. Analysis of the resultant mutants demonstrated that FLB4 is essential for spore formation and that strains lacking this gene are fluffy in their colony morphology due to an inability to complete conidiophore formation. Meanwhile, FLB3 is required for normal levels of aerial mycelium formation. We identified genes dependent on both transcription factors using microarray analysis. This analysis revealed that the transcription of several genes encoding proteins implicated in sporulation in Magnaporthe oryzae and other filamentous fungi are affected by FLB3 or FLB4 inactivation. Furthermore, the microarray analysis indicates that Flb3p may effectively reprogramme the cell metabolically by repressing transcription of genes encoding biosynthetic enzymes and inducing transcription of genes encoding catabolic enzymes. Additionally, qRT-PCR was employed and showed that FLB3 and FLB4 transcripts are enriched in synchronously sporulating cultures, as were the transcripts of other genes that are necessary for normal conidiation, consistent with a role for their gene products in this process. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

  12. Ornithorhynchus anatinus (platypus) links the evolution of immunoglobulin genes in eutherian mammals and nonmammalian tetrapods.

    PubMed

    Zhao, Yaofeng; Cui, Huiting; Whittington, Camilla M; Wei, Zhiguo; Zhang, Xiaofeng; Zhang, Ziding; Yu, Li; Ren, Liming; Hu, Xiaoxiang; Zhang, Yaping; Hellman, Lars; Belov, Katherine; Li, Ning; Hammarström, Lennart

    2009-09-01

    The evolutionary origins of mammalian immunoglobulin H chain isotypes (IgM, IgD, IgG, IgE, and IgA) are still incompletely understood as these isotypes differ considerably in structure and number from their counterparts in nonmammalian tetrapods. We report in this study that the platypus (Ornithorhynchus anatinus) Ig H chain constant region gene locus contains eight Ig encoding genes, which are arranged in an mu-delta-omicron-gamma2-gamma1-alpha1-epsilon-alpha2 order, spanning a total of approximately 200 kb DNA, encoding six distinct isotypes. The omicron (omicron for Ornithorhynchus) gene encodes a novel Ig H chain isotype that consists of four constant region domains and a hinge, and is structurally different from any of the five known mammalian Ig classes. This gene is phylogenetically related to upsilon (epsilon) and gamma, and thus appears to be a structural intermediate between these two genes. The platypus delta gene encodes ten heavy chain constant region domains, lacks a hinge region and is similar to IgD in amphibians and fish, but strikingly different from that in eutherian mammals. The platypus Ig H chain isotype repertoire thus shows a unique combination of genes that share similarity both to those of nonmammalian tetrapods and eutherian animals and demonstrates how phylogenetically informative species can be used to reconstruct the evolutionary history of functionally important genes.

  13. A comparative transcriptomic approach to understanding the formation of cork.

    PubMed

    Boher, Pau; Soler, Marçal; Sánchez, Anna; Hoede, Claire; Noirot, Céline; Paiva, Jorge Almiro Pinto; Serra, Olga; Figueras, Mercè

    2018-01-01

    The transcriptome comparison of two oak species reveals possible candidates accounting for the exceptionally thick and pure cork oak phellem, such as those involved in secondary metabolism and phellogen activity. Cork oak, Quercus suber, differs from other Mediterranean oaks such as holm oak (Quercus ilex) by the thickness and organization of the external bark. While holm oak outer bark contains sequential periderms interspersed with dead secondary phloem (rhytidome), the cork oak outer bark only contains thick layers of phellem (cork rings) that accumulate until reaching a thickness that allows industrial uses. Here we compare the cork oak outer bark transcriptome with that of holm oak. Both transcriptomes present similitudes in their complexity, but whereas cork oak external bark is enriched with upregulated genes related to suberin, which is the main polymer responsible for the protective function of periderm, the upregulated categories of holm oak are enriched in abiotic stress and chromatin assembly. Concomitantly with the upregulation of suberin-related genes, there is also induction of regulatory and meristematic genes, whose predicted activities agree with the increased number of phellem layers found in the cork oak sample. Further transcript profiling among different cork oak tissues and conditions suggests that cork and wood share many regulatory mechanisms, probably reflecting similar ontogeny. Moreover, the analysis of transcripts accumulation during the cork growth season showed that most regulatory genes are upregulated early in the season when the cork cambium becomes active. Altogether our work provides the first transcriptome comparison between cork oak and holm oak outer bark, which unveils new regulatory candidate genes of phellem development.

  14. Highly precise and compact ultrahigh vacuum rotary feedthrough.

    PubMed

    Aiura, Y; Kitano, K

    2012-03-01

    The precision and rigidity of compact ultrahigh vacuum (UHV) rotary feedthroughs were substantially improved by preparing and installing an optimal crossed roller bearing with mounting holes. Since there are mounting holes on both the outer and inner races, the bearing can be mounted directly to rotary and stationary stages without any fixing plates and housing. As a result, it is possible to increase the thickness of the bearing or the size of the rolling elements in the bearing without increasing the distance between the rotating and fixing International Conflat flanges of the UHV rotary feedthrough. Larger rolling elements enhance the rigidity of the UHV rotary feedthrough. Moreover, owing to the structure having integrated inner and outer races and mounting holes, the performance is almost entirely unaffected by the installation of the bearing, allowing for a precise optical encoder to be installed in the compact UHV rotary feedthrough. Using position feedback via a worm gear system driven by a stepper motor and a precise rotary encoder, the actual angle of the compact UHV rotary feedthrough can be controlled with extremely high precision.

  15. Highly precise and compact ultrahigh vacuum rotary feedthrough

    NASA Astrophysics Data System (ADS)

    Aiura, Y.; Kitano, K.

    2012-03-01

    The precision and rigidity of compact ultrahigh vacuum (UHV) rotary feedthroughs were substantially improved by preparing and installing an optimal crossed roller bearing with mounting holes. Since there are mounting holes on both the outer and inner races, the bearing can be mounted directly to rotary and stationary stages without any fixing plates and housing. As a result, it is possible to increase the thickness of the bearing or the size of the rolling elements in the bearing without increasing the distance between the rotating and fixing International Conflat flanges of the UHV rotary feedthrough. Larger rolling elements enhance the rigidity of the UHV rotary feedthrough. Moreover, owing to the structure having integrated inner and outer races and mounting holes, the performance is almost entirely unaffected by the installation of the bearing, allowing for a precise optical encoder to be installed in the compact UHV rotary feedthrough. Using position feedback via a worm gear system driven by a stepper motor and a precise rotary encoder, the actual angle of the compact UHV rotary feedthrough can be controlled with extremely high precision.

  16. Immunomodulatory Yersinia outer proteins (Yops)–useful tools for bacteria and humans alike

    PubMed Central

    Grabowski, Benjamin; Schmidt, M. Alexander; Rüter, Christian

    2017-01-01

    ABSTRACT Human-pathogenic Yersinia produce plasmid-encoded Yersinia outer proteins (Yops), which are necessary to down-regulate anti-bacterial responses that constrict bacterial survival in the host. These Yops are effectively translocated directly from the bacterial into the target cell cytosol by the type III secretion system (T3SS). Cell-penetrating peptides (CPPs) in contrast are characterized by their ability to autonomously cross cell membranes and to transport cargo – independent of additional translocation systems. The recent discovery of bacterial cell-penetrating effector proteins (CPEs) – with the prototype being the T3SS effector protein YopM – established a new class of autonomously translocating immunomodulatory proteins. CPEs represent a vast source of potential self-delivering, anti-inflammatory therapeutics. In this review, we give an update on the characteristic features of the plasmid-encoded Yops and, based on recent findings, propose the further development of these proteins for potential therapeutic applications as natural or artificial cell-penetrating forms of Yops might be of value as bacteria-derived biologics. PMID:28296562

  17. The bglA Gene of Aspergillus kawachii Encodes Both Extracellular and Cell Wall-Bound β-Glucosidases

    PubMed Central

    Iwashita, Kazuhiro; Nagahara, Tatsuya; Kimura, Hitoshi; Takano, Makoto; Shimoi, Hitoshi; Ito, Kiyoshi

    1999-01-01

    We cloned the genomic DNA and cDNA of bglA, which encodes β-glucosidase in Aspergillus kawachii, based on a partial amino acid sequence of purified cell wall-bound β-glucosidase CB-1. The nucleotide sequence of the cloned bglA gene revealed a 2,933-bp open reading frame with six introns that encodes an 860-amino-acid protein. Based on the deduced amino acid sequence, we concluded that the bglA gene encodes cell wall-bound β-glucosidase CB-1. The amino acid sequence exhibited high levels of homology with the amino acid sequences of fungal β-glucosidases classified in subfamily B. We expressed the bglA cDNA in Saccharomyces cerevisiae and detected the recombinant β-glucosidase in the periplasm fraction of the recombinant yeast. A. kawachii can produce two extracellular β-glucosidases (EX-1 and EX-2) in addition to the cell wall-bound β-glucosidase. A. kawachii in which the bglA gene was disrupted produced none of the three β-glucosidases, as determined by enzyme assays and a Western blot analysis. Thus, we concluded that the bglA gene encodes both extracellular and cell wall-bound β-glucosidases in A. kawachii. PMID:10584016

  18. Microarray analysis of toxicogenomic effects of Ortho-phenylphenol in Staphylococcus aureus

    PubMed Central

    Jang, Hyeung-Jin; Nde, Chantal; Toghrol, Freshteh; Bentley, William E

    2008-01-01

    Background Staphylococcus aureus (S. aureus), is responsible for many infectious diseases, ranging from benign skin infections to life-threatening endocarditis and toxic shock syndrome. Ortho-phenylphenol (OPP) is an antimicrobial agent and an active ingredient of EPA-registered disinfectants with wide human exposure in various agricultural, hospital and veterinary disinfectant products. Despite many uses, an understanding of a cellular response to OPP and it's mechanism of action, targeted genes, and the connectivity between targeted genes and the rest of cell metabolism remains obscure. Results Herein, we performed a genome-wide transcriptome analysis of the cellular responses of S. aureus when exposed to 0.82 mM of OPP for 20 and 60 min. Our data indicated that OPP downregulated the biosynthesis of many amino acids, which are required for protein synthesis. In particular, the genes encoding the enzymes of the diaminopimelate (DAP) pathway which results in lysine biosynthesis were significantly downregualted. Intriguingly, we revealed that the transcription of genes encoding ribosomal proteins was upregulated by OPP and at the same time, the genes encoding iron acquisition and transport were downregulated. The genes encoding virulence factors were upregulated and genes encoding phospholipids were downregulated upon 20 min exposure to OPP. Conclusion By using microarray analysis that enables us to simultaneously and globally examine the complete transcriptome during cellular responses, we have revealed novel information regarding the mode of action of OPP on Staphylococcus: OPP inhibits anabolism of many amino acids and highly downregulates the genes that encode the enzymes involved in the DAP pathway. Lysine and DAP are essential for building up the peptidoglycan cell wall. It was concluded that the mode of action of OPP is similar to the mechanism of action of some antibiotics. The discovery of this phenomenon provides useful information that will benefit further antimicrobial research on S. aureus. PMID:18793396

  19. Degradation of triglycerides by a pseudomonad isolated from milk: molecular analysis of a lipase-encoding gene and its expression in Escherichia coli.

    PubMed Central

    Johnson, L A; Beacham, I R; MacRae, I C; Free, M L

    1992-01-01

    Psychrotrophic lipolytic bacteria represent a significant problem in the storage of refrigerated dairy products. A lipase-encoding gene has been cloned and characterized from a highly lipolytic strain of Pseudomonas. The nucleotide sequence of the gene predicts a polypeptide of M(r) 49,905, which was identified when the gene was expressed in Escherichia coli. Images PMID:1622251

  20. Genes encoding giant danio and golden shiner ependymin.

    PubMed

    Adams, D S; Kiyokawa, M; Getman, M E; Shashoua, V E

    1996-03-01

    Ependymin (EPN) is a brain glycoprotein that functions as a neurotrophic factor in optic nerve regeneration and long-term memory consolidation in goldfish. To date, true epn genes have been characterized in one order of teleost fish, Cypriniformes. In the study presented here, polymerase chain reactions were used to analyze the complete epn genes, gd (1480 bp), and sh (2071 bp), from Cypriniformes giant danio and shiner, respectively. Southern hybridizations demonstrated the existence of one copy of each gene per corresponding haploid genome. Each gene was found to contain six exons and five introns. Gene gd encodes a predicted 218-amino acid (aa) protein GD 93 percent conserved to goldfish EPN, while sh encodes a predicted 214-aa protein SH 91 percent homologous to goldfish. Evidence is presented classifying proteins previously termed "EPNs" into two major categories: true EPNs and non-EPN cerebrospinal fluid glycoproteins. Proteins GD and SH contain all the hallmark, features of true EPNs.

  1. Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

    PubMed

    Kim, K S; Farrand, S K

    1996-06-01

    Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

  2. Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

    PubMed Central

    Kim, K S; Farrand, S K

    1996-01-01

    Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes. PMID:8655509

  3. Systematic Identification and Characterization of Novel Human Skin-Associated Genes Encoding Membrane and Secreted Proteins

    PubMed Central

    Buhren, Bettina Alexandra; Martinez, Cynthia; Schrumpf, Holger; Gasis, Marcia; Grether-Beck, Susanne; Krutmann, Jean

    2013-01-01

    Through bioinformatics analyses of a human gene expression database representing 105 different tissues and cell types, we identified 687 skin-associated genes that are selectively and highly expressed in human skin. Over 50 of these represent uncharacterized genes not previously associated with skin and include a subset that encode novel secreted and plasma membrane proteins. The high levels of skin-associated expression for eight of these novel therapeutic target genes were confirmed by semi-quantitative real time PCR, western blot and immunohistochemical analyses of normal skin and skin-derived cell lines. Four of these are expressed specifically by epidermal keratinocytes; two that encode G-protein-coupled receptors (GPR87 and GPR115), and two that encode secreted proteins (WFDC5 and SERPINB7). Further analyses using cytokine-activated and terminally differentiated human primary keratinocytes or a panel of common inflammatory, autoimmune or malignant skin diseases revealed distinct patterns of regulation as well as disease associations that point to important roles in cutaneous homeostasis and disease. Some of these novel uncharacterized skin genes may represent potential biomarkers or drug targets for the development of future diagnostics or therapeutics. PMID:23840300

  4. Transgenic tomatoes express an antigenic polypeptide containing epitopes of the diphtheria, pertussis and tetanus exotoxins, encoded by a synthetic gene.

    PubMed

    Soria-Guerra, Ruth Elena; Rosales-Mendoza, Sergio; Márquez-Mercado, Crisóforo; López-Revilla, Rubén; Castillo-Collazo, Rosalba; Alpuche-Solís, Angel Gabriel

    2007-07-01

    A current priority of vaccinology is the development of multicomponent vaccines that protect against several pathogens. The diphtheria-pertussis-tetanus (DPT) vaccine prevents the symptoms of three serious and often fatal diseases due to the exotoxins produced by Corynebacterium diphteriae, Bordetella pertussis and Clostridium tetani. We are attempting to develop an edible DPT multicomponent vaccine in plants, based on the fusion of protective exotoxin epitopes encoded by synthetic genes. By means of Agrobacterium mediated transformation we generated transgenic tomatoes with a plant-optimised synthetic gene encoding a novel polypeptide containing two adjuvant and six DPT immunoprotective exotoxin epitopes joined by peptide linkers. In transformed tomato plants, integration of the synthetic DPT (sDPT) gene detected by PCR was confirmed by Southern blot, and specific transcripts of the expected molecular size were detected by RT-PCR. Expression of the putative polypeptide encoded by the sDPT gene was detected by immunoassay with specific antibodies to the diphtheria, pertussis and tetanus exotoxins. The sDPT gene is therefore integrated, transcribed and translated as the expected recombinant sDPT multiepitope polypeptide in transgenic tomatoes that constitute a potential edible vaccine.

  5. Ubiquitin--conserved protein or selfish gene?

    PubMed

    Catic, André; Ploegh, Hidde L

    2005-11-01

    The posttranslational modifier ubiquitin is encoded by a multigene family containing three primary members, which yield the precursor protein polyubiquitin and two ubiquitin moieties, Ub(L40) and Ub(S27), that are fused to the ribosomal proteins L40 and S27, respectively. The gene encoding polyubiquitin is highly conserved and, until now, those encoding Ub(L40) and Ub(S27) have been generally considered to be equally invariant. The evolution of the ribosomal ubiquitin moieties is, however, proving to be more dynamic. It seems that the genes encoding Ub(L40) and Ub(S27) are actively maintained by homologous recombination with the invariant polyubiquitin locus. Failure to recombine leads to deterioration of the sequence of the ribosomal ubiquitin moieties in several phyla, although this deterioration is evidently constrained by the structural requirements of the ubiquitin fold. Only a few amino acids in ubiquitin are vital for its function, and we propose that conservation of all three ubiquitin genes is driven not only by functional properties of the ubiquitin protein, but also by the propensity of the polyubiquitin locus to act as a 'selfish gene'.

  6. Characterization of novel virulent broad-host-range phages of Xylella fastidiosa and Xanthomonas.

    PubMed

    Ahern, Stephen J; Das, Mayukh; Bhowmick, Tushar Suvra; Young, Ry; Gonzalez, Carlos F

    2014-01-01

    The xylem-limited bacterium Xylella fastidiosa is the causal agent of several plant diseases, most notably Pierce's disease of grape and citrus variegated chlorosis. We report the isolation and characterization of the first virulent phages for X. fastidiosa, siphophages Sano and Salvo and podophages Prado and Paz, with a host range that includes Xanthomonas spp. Phages propagated on homologous hosts had observed adsorption rate constants of ~4 × 10(-12) ml cell(-1) min(-1) for X. fastidiosa strain Temecula 1 and ~5 × 10(-10) to 7 × 10(-10) ml cell(-1) min(-1) for Xanthomonas strain EC-12. Sano and Salvo exhibit >80% nucleotide identity to each other in aligned regions and are syntenic to phage BcepNazgul. We propose that phage BcepNazgul is the founding member of a novel phage type, to which Sano and Salvo belong. The lysis genes of the Nazgul-like phage type include a gene that encodes an outer membrane lipoprotein endolysin and also spanin gene families that provide insight into the evolution of the lysis pathway for phages of Gram-negative hosts. Prado and Paz, although exhibiting no significant DNA homology to each other, are new members of the phiKMV-like phage type, based on the position of the single-subunit RNA polymerase gene. The four phages are type IV pilus dependent for infection of both X. fastidiosa and Xanthomonas. The phages may be useful as agents for an effective and environmentally responsible strategy for the control of diseases caused by X. fastidiosa.

  7. Characterization of Novel Virulent Broad-Host-Range Phages of Xylella fastidiosa and Xanthomonas

    PubMed Central

    Ahern, Stephen J.; Das, Mayukh; Bhowmick, Tushar Suvra; Young, Ry

    2014-01-01

    The xylem-limited bacterium Xylella fastidiosa is the causal agent of several plant diseases, most notably Pierce's disease of grape and citrus variegated chlorosis. We report the isolation and characterization of the first virulent phages for X. fastidiosa, siphophages Sano and Salvo and podophages Prado and Paz, with a host range that includes Xanthomonas spp. Phages propagated on homologous hosts had observed adsorption rate constants of ∼4 × 10−12 ml cell−1 min−1 for X. fastidiosa strain Temecula 1 and ∼5 × 10−10 to 7 × 10−10 ml cell−1 min−1 for Xanthomonas strain EC-12. Sano and Salvo exhibit >80% nucleotide identity to each other in aligned regions and are syntenic to phage BcepNazgul. We propose that phage BcepNazgul is the founding member of a novel phage type, to which Sano and Salvo belong. The lysis genes of the Nazgul-like phage type include a gene that encodes an outer membrane lipoprotein endolysin and also spanin gene families that provide insight into the evolution of the lysis pathway for phages of Gram-negative hosts. Prado and Paz, although exhibiting no significant DNA homology to each other, are new members of the phiKMV-like phage type, based on the position of the single-subunit RNA polymerase gene. The four phages are type IV pilus dependent for infection of both X. fastidiosa and Xanthomonas. The phages may be useful as agents for an effective and environmentally responsible strategy for the control of diseases caused by X. fastidiosa. PMID:24214944

  8. Alternative intronic promoters in development and disease.

    PubMed

    Vacik, Tomas; Raska, Ivan

    2017-05-01

    Approximately 20,000 mammalian genes are estimated to encode between 250 thousand and 1 million different proteins. This enormous diversity of the mammalian proteome is caused by the ability of a single-gene locus to encode multiple protein isoforms. Protein isoforms encoded by one gene locus can be functionally distinct, and they can even have antagonistic functions. One of the mechanisms involved in creating this proteome complexity is alternative promoter usage. Alternative intronic promoters are located downstream from their canonical counterparts and drive the expression of alternative RNA isoforms that lack upstream exons. These upstream exons can encode some important functional domains, and proteins encoded by alternative mRNA isoforms can be thus functionally distinct from the full-length protein encoded by canonical mRNA isoforms. Since any misbalance of functionally distinct protein isoforms is likely to have detrimental consequences for the cell and the whole organism, their expression must be precisely regulated. Misregulation of alternative intronic promoters is frequently associated with various developmental defects and diseases including cancer, and it is becoming increasingly clear that this phenomenon deserves more attention.

  9. Amplification of Chromosome 1q Genes Encoding the Phosphoinositide Signalling Enzymes PI4KB, AKT3, PIP5K1A and PI3KC2B in Breast Cancer

    PubMed Central

    Waugh, Mark G.

    2014-01-01

    Little is known about the possible oncogenic roles of genes encoding for the phosphatidylinositol 4-kinases, a family of enzymes that regulate an early step in phosphoinositide signalling. To address this issue, the mutational status of all four human phosphatidylinositol 4-kinases genes was analyzed across 852 breast cancer samples using the COSMIC data resource. Point mutations in the phosphatidylinositol 4-kinase genes were uncommon and appeared in less than 1% of the patient samples however, 62% of the tumours had increases in gene copy number for PI4KB which encodes the phosphatidylinositol 4-kinase IIIbeta isozyme. Extending this analysis to subsequent enzymes in the phosphoinositide signalling cascades revealed that the only PIP5K1A, PI3KC2B and AKT3 genes exhibited similar patterns of gene copy number variation. By comparison, gene copy number increases for established oncogenes such as EGFR and HER2/Neu were only evident in 20% of the samples. The PI4KB, PIP5K1A, PI3KC2B and AKT3 genes are related in that they all localize to chromosome 1q which is often structurally and numerically abnormal in breast cancer. These results demonstrate that a gene quartet encoding a potential phosphoinositide signalling pathway is amplified in a subset of breast cancers. PMID:25368680

  10. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    NASA Astrophysics Data System (ADS)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  11. Role and Regulation of the Flp/Tad Pilus in the Virulence of Pectobacterium atrosepticum SCRI1043 and Pectobacterium wasabiae SCC3193

    PubMed Central

    Nykyri, Johanna; Mattinen, Laura; Niemi, Outi; Adhikari, Satish; Kõiv, Viia; Somervuo, Panu; Fang, Xin; Auvinen, Petri; Mäe, Andres; Palva, E. Tapio; Pirhonen, Minna

    2013-01-01

    In this study, we characterized a putative Flp/Tad pilus-encoding gene cluster, and we examined its regulation at the transcriptional level and its role in the virulence of potato pathogenic enterobacteria of the genus Pectobacterium. The Flp/Tad pilus-encoding gene clusters in Pectobacterium atrosepticum, Pectobacterium wasabiae and Pectobacterium aroidearum were compared to previously characterized flp/tad gene clusters, including that of the well-studied Flp/Tad pilus model organism Aggregatibacter actinomycetemcomitans, in which this pilus is a major virulence determinant. Comparative analyses revealed substantial protein sequence similarity and open reading frame synteny between the previously characterized flp/tad gene clusters and the cluster in Pectobacterium, suggesting that the predicted flp/tad gene cluster in Pectobacterium encodes a Flp/Tad pilus-like structure. We detected genes for a novel two-component system adjacent to the flp/tad gene cluster in Pectobacterium, and mutant analysis demonstrated that this system has a positive effect on the transcription of selected Flp/Tad pilus biogenesis genes, suggesting that this response regulator regulate the flp/tad gene cluster. Mutagenesis of either the predicted regulator gene or selected Flp/Tad pilus biogenesis genes had a significant impact on the maceration ability of the bacterial strains in potato tubers, indicating that the Flp/Tad pilus-encoding gene cluster represents a novel virulence determinant in Pectobacterium. Soft-rot enterobacteria in the genera Pectobacterium and Dickeya are of great agricultural importance, and an investigation of the virulence of these pathogens could facilitate improvements in agricultural practices, thus benefiting farmers, the potato industry and consumers. PMID:24040039

  12. Role and regulation of the Flp/Tad pilus in the virulence of Pectobacterium atrosepticum SCRI1043 and Pectobacterium wasabiae SCC3193.

    PubMed

    Nykyri, Johanna; Mattinen, Laura; Niemi, Outi; Adhikari, Satish; Kõiv, Viia; Somervuo, Panu; Fang, Xin; Auvinen, Petri; Mäe, Andres; Palva, E Tapio; Pirhonen, Minna

    2013-01-01

    In this study, we characterized a putative Flp/Tad pilus-encoding gene cluster, and we examined its regulation at the transcriptional level and its role in the virulence of potato pathogenic enterobacteria of the genus Pectobacterium. The Flp/Tad pilus-encoding gene clusters in Pectobacterium atrosepticum, Pectobacterium wasabiae and Pectobacterium aroidearum were compared to previously characterized flp/tad gene clusters, including that of the well-studied Flp/Tad pilus model organism Aggregatibacter actinomycetemcomitans, in which this pilus is a major virulence determinant. Comparative analyses revealed substantial protein sequence similarity and open reading frame synteny between the previously characterized flp/tad gene clusters and the cluster in Pectobacterium, suggesting that the predicted flp/tad gene cluster in Pectobacterium encodes a Flp/Tad pilus-like structure. We detected genes for a novel two-component system adjacent to the flp/tad gene cluster in Pectobacterium, and mutant analysis demonstrated that this system has a positive effect on the transcription of selected Flp/Tad pilus biogenesis genes, suggesting that this response regulator regulate the flp/tad gene cluster. Mutagenesis of either the predicted regulator gene or selected Flp/Tad pilus biogenesis genes had a significant impact on the maceration ability of the bacterial strains in potato tubers, indicating that the Flp/Tad pilus-encoding gene cluster represents a novel virulence determinant in Pectobacterium. Soft-rot enterobacteria in the genera Pectobacterium and Dickeya are of great agricultural importance, and an investigation of the virulence of these pathogens could facilitate improvements in agricultural practices, thus benefiting farmers, the potato industry and consumers.

  13. Distribution and Evolution of Yersinia Leucine-Rich Repeat Proteins

    PubMed Central

    Hu, Yueming; Huang, He; Hui, Xinjie; Cheng, Xi; White, Aaron P.

    2016-01-01

    Leucine-rich repeat (LRR) proteins are widely distributed in bacteria, playing important roles in various protein-protein interaction processes. In Yersinia, the well-characterized type III secreted effector YopM also belongs to the LRR protein family and is encoded by virulence plasmids. However, little has been known about other LRR members encoded by Yersinia genomes or their evolution. In this study, the Yersinia LRR proteins were comprehensively screened, categorized, and compared. The LRR proteins encoded by chromosomes (LRR1 proteins) appeared to be more similar to each other and different from those encoded by plasmids (LRR2 proteins) with regard to repeat-unit length, amino acid composition profile, and gene expression regulation circuits. LRR1 proteins were also different from LRR2 proteins in that the LRR1 proteins contained an E3 ligase domain (NEL domain) in the C-terminal region or an NEL domain-encoding nucleotide relic in flanking genomic sequences. The LRR1 protein-encoding genes (LRR1 genes) varied dramatically and were categorized into 4 subgroups (a to d), with the LRR1a to -c genes evolving from the same ancestor and LRR1d genes evolving from another ancestor. The consensus and ancestor repeat-unit sequences were inferred for different LRR1 protein subgroups by use of a maximum parsimony modeling strategy. Structural modeling disclosed very similar repeat-unit structures between LRR1 and LRR2 proteins despite the different unit lengths and amino acid compositions. Structural constraints may serve as the driving force to explain the observed mutations in the LRR regions. This study suggests that there may be functional variation and lays the foundation for future experiments investigating the functions of the chromosomally encoded LRR proteins of Yersinia. PMID:27217422

  14. Characterization of the Genes Encoding the Cytosolic and Plastidial Forms of ADP-Glucose Pyrophosphorylase in Wheat Endosperm1

    PubMed Central

    Burton, Rachel A.; Johnson, Philip E.; Beckles, Diane M.; Fincher, Geoffrey B.; Jenner, Helen L.; Naldrett, Mike J.; Denyer, Kay

    2002-01-01

    In most species, the synthesis of ADP-glucose (Glc) by the enzyme ADP-Glc pyrophosphorylase (AGPase) occurs entirely within the plastids in all tissues so far examined. However, in the endosperm of many, if not all grasses, a second form of AGPase synthesizes ADP-Glc outside the plastid, presumably in the cytosol. In this paper, we show that in the endosperm of wheat (Triticum aestivum), the cytosolic form accounts for most of the AGPase activity. Using a combination of molecular and biochemical approaches to identify the cytosolic and plastidial protein components of wheat endosperm AGPase we show that the large and small subunits of the cytosolic enzyme are encoded by genes previously thought to encode plastidial subunits, and that a gene, Ta.AGP.S.1, which encodes the small subunit of the cytosolic form of AGPase, also gives rise to a second transcript by the use of an alternate first exon. This second transcript encodes an AGPase small subunit with a transit peptide. However, we could not find a plastidial small subunit protein corresponding to this transcript. The protein sequence of the purified plastidial small subunit does not match precisely to that encoded by Ta.AGP.S.1 or to the predicted sequences of any other known gene from wheat or barley (Hordeum vulgare). Instead, the protein sequence is most similar to those of the plastidial small subunits from chickpea (Cicer arietinum) and maize (Zea mays) and rice (Oryza sativa) seeds. These data suggest that the gene encoding the major plastidial small subunit of AGPase in wheat endosperm has yet to be identified. PMID:12428011

  15. Acquisition of haemoglobin-bound iron by strains of the Actinobacillus minor/"porcitonsillarum" complex.

    PubMed

    Arya, Gitanjali; Niven, Donald F

    2011-03-24

    Members of the Actinobacillus minor/"porcitonsillarum" complex are common inhabitants of the swine respiratory tract. Although avirulent or of low virulence for pigs, these organisms, like pathogens, do grow in vivo and must, therefore, be able to acquire iron within the host. Here, we investigated the abilities of six members of the A. minor/"porcitonsillarum" complex to acquire iron from transferrin and various haemoglobins. Using growth assays, all six strains were shown to acquire iron from porcine, bovine and human haemoglobins but not from porcine transferrin. Analyses of whole genome sequences revealed that A. minor strains NM305(T) and 202, unlike the swine-pathogenic actinobacilli, A. pleuropneumoniae and A. suis, lack not only the transferrin-binding protein genes, tbpA and tbpB, but also the haemoglobin-binding protein gene, hgbA. Strains NM305(T) and 202, however, were found to possess other putative haemin/haemoglobin-binding protein genes that were predicted to encode mature proteins of ∼ 72 and ∼ 75 kDa, respectively. An affinity procedure based on haemin-agarose allowed the isolation of ∼ 65 and ∼ 67 kDa iron-repressible outer membrane polypeptides from membranes derived from strains NM305(T) and 202, respectively, and mass spectrometry revealed that these polypeptides were the products of the putative haemin/haemoglobin-binding protein genes. PCR approaches allowed the amplification and sequencing of homologues of both haemin/haemoglobin-binding protein genes from each of the other four strains, strains 33PN and 7ATS of the A. minor/"porcitonsillarum" complex and "A. porcitonsillarum" strains 9953L55 and 0347, suggesting that such proteins are involved in the utilization of haemoglobin-bound iron, presumably as surface receptors, by all six strains investigated. Copyright © 2010 Elsevier B.V. All rights reserved.

  16. Host-Nonspecific Iron Acquisition Systems and Virulence in the Zoonotic Serovar of Vibrio vulnificus

    PubMed Central

    Pajuelo, David; Lee, Chung-Te; Roig, Francisco J.; Lemos, Manuel L.; Hor, Lien-I

    2014-01-01

    The zoonotic serovar of Vibrio vulnificus (known as biotype 2 serovar E) is the etiological agent of human and fish vibriosis. The aim of the present work was to discover the role of the vulnibactin- and hemin-dependent iron acquisition systems in the pathogenicity of this zoonotic serovar under the hypothesis that both are host-nonspecific virulence factors. To this end, we selected three genes for three outer membrane receptors (vuuA, a receptor for ferric vulnibactin, and hupA and hutR, two hemin receptors), obtained single and multiple mutants as well as complemented strains, and tested them in a series of in vitro and in vivo assays, using eels and mice as animal models. The overall results confirm that hupA and vuuA, but not hutR, are host-nonspecific virulence genes and suggest that a third undescribed host-specific plasmid-encoded system could also be used by the zoonotic serovar in fish. hupA and vuuA were expressed in the internal organs of the animals in the first 24 h of infection, suggesting that they may be needed to achieve the population size required to trigger fatal septicemia. vuuA and hupA were sequenced in strains representative of the genetic diversity of this species, and their phylogenies were reconstructed by multilocus sequence analysis of selected housekeeping and virulence genes as a reference. Given the overall results, we suggest that both genes might form part of the core genes essential not only for disease development but also for the survival of this species in its natural reservoir, the aquatic environment. PMID:24478087

  17. Comparison of the Genome Sequence of the Poultry Pathogen Bordetella avium with Those of B. bronchiseptica, B. pertussis, and B. parapertussis Reveals Extensive Diversity in Surface Structures Associated with Host Interaction

    PubMed Central

    Sebaihia, Mohammed; Preston, Andrew; Maskell, Duncan J.; Kuzmiak, Holly; Connell, Terry D.; King, Natalie D.; Orndorff, Paul E.; Miyamoto, David M.; Thomson, Nicholas R.; Harris, David; Goble, Arlette; Lord, Angela; Murphy, Lee; Quail, Michael A.; Rutter, Simon; Squares, Robert; Squares, Steven; Woodward, John; Parkhill, Julian; Temple, Louise M.

    2006-01-01

    Bordetella avium is a pathogen of poultry and is phylogenetically distinct from Bordetella bronchiseptica, Bordetella pertussis, and Bordetella parapertussis, which are other species in the Bordetella genus that infect mammals. In order to understand the evolutionary relatedness of Bordetella species and further the understanding of pathogenesis, we obtained the complete genome sequence of B. avium strain 197N, a pathogenic strain that has been extensively studied. With 3,732,255 base pairs of DNA and 3,417 predicted coding sequences, it has the smallest genome and gene complement of the sequenced bordetellae. In this study, the presence or absence of previously reported virulence factors from B. avium was confirmed, and the genetic bases for growth characteristics were elucidated. Over 1,100 genes present in B. avium but not in B. bronchiseptica were identified, and most were predicted to encode surface or secreted proteins that are likely to define an organism adapted to the avian rather than the mammalian respiratory tracts. These include genes coding for the synthesis of a polysaccharide capsule, hemagglutinins, a type I secretion system adjacent to two very large genes for secreted proteins, and unique genes for both lipopolysaccharide and fimbrial biogenesis. Three apparently complete prophages are also present. The BvgAS virulence regulatory system appears to have polymorphisms at a poly(C) tract that is involved in phase variation in other bordetellae. A number of putative iron-regulated outer membrane proteins were predicted from the sequence, and this regulation was confirmed experimentally for five of these. PMID:16885469

  18. Carbapenemases in Enterobacteriaceae: types and molecular epidemiology.

    PubMed

    Martínez-Martínez, Luis; González-López, Juan José

    2014-12-01

    The most important mechanism of carbapenem resistance in Enterobacteriaceae is the production of carbapenemases, although resistance can also result from the synergistic activity between AmpC-type or (to a lesser extent) extended-spectrum beta-lactamases combined with decreased outer membrane permeability. Three major molecular classes of carbapenemases are recognized: A, B and D. Classes A and D are serine-beta-lactamases, whereas class B are metallo-beta-lactamases (their hydrolytic activity depends on the presence of zinc). In addition to carbapenems, carbapenemases also hydrolyze other beta-lactams, but the concrete substrate profile depends on the enzyme type. In general terms, class A enzymes are to some extent inhibited by clavulanic acid, and class B enzymes do not affect monobactams and are inhibited by zinc chelators. Given Enterobacteriaceae producing carbapenemases usually also contain gene coding for other mechanisms of resistance to beta-lactams, it is not unusual for the organisms to present complex beta-lactam resistance phenotypes. Additionally, these organisms frequently contain other genes that confer resistance to quinolones, aminoglycosides, tetracyclines, sulphonamides and other families of antimicrobial agents, which cause multiresistance or even panresistance. Currently, the most important type of class A carbapenemases are KPC enzymes, whereas VIM, IMP and (particularly) NDM in class B and OXA-48 (and related) in class D are the more relevant enzymes. Whereas some enzymes are encoded by chromosomal genes, most carbapenemases are plasmid-mediated (with genes frequently located in integrons), which favors the dissemination of the enzymes. Detailed information of the genetic platforms and the context of the genes coding for the most relevant enzymes will be presented in this review. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.

  19. Adhesive Properties of YapV and Paralogous Autotransporter Proteins of Yersinia pestis

    PubMed Central

    Nair, Manoj K. M.; De Masi, Leon; Yue, Min; Galván, Estela M.; Chen, Huaiqing; Wang, Fang

    2015-01-01

    Yersinia pestis is the causative agent of plague. This bacterium evolved from an ancestral enteroinvasive Yersinia pseudotuberculosis strain by gene loss and acquisition of new genes, allowing it to use fleas as transmission vectors. Infection frequently leads to a rapidly lethal outcome in humans, a variety of rodents, and cats. This study focuses on the Y. pestis KIM yapV gene and its product, recognized as an autotransporter protein by its typical sequence, outer membrane localization, and amino-terminal surface exposure. Comparison of Yersinia genomes revealed that DNA encoding YapV or each of three individual paralogous proteins (YapK, YapJ, and YapX) was present as a gene or pseudogene in a strain-specific manner and only in Y. pestis and Y. pseudotuberculosis. YapV acted as an adhesin for alveolar epithelial cells and specific extracellular matrix (ECM) proteins, as shown with recombinant Escherichia coli, Y. pestis, or purified passenger domains. Like YapV, YapK and YapJ demonstrated adhesive properties, suggesting that their previously related in vivo activity is due to their capacity to modulate binding properties of Y. pestis in its hosts, in conjunction with other adhesins. A differential host-specific type of binding to ECM proteins by YapV, YapK, and YapJ suggested that these proteins participate in broadening the host range of Y. pestis. A phylogenic tree including 36 Y. pestis strains highlighted an association between the gene profile for the four paralogous proteins and the geographic location of the corresponding isolated strains, suggesting an evolutionary adaption of Y. pestis to specific local animal hosts or reservoirs. PMID:25690102

  20. The complete general secretory pathway in gram-negative bacteria.

    PubMed Central

    Pugsley, A P

    1993-01-01

    The unifying feature of all proteins that are transported out of the cytoplasm of gram-negative bacteria by the general secretory pathway (GSP) is the presence of a long stretch of predominantly hydrophobic amino acids, the signal sequence. The interaction between signal sequence-bearing proteins and the cytoplasmic membrane may be a spontaneous event driven by the electrochemical energy potential across the cytoplasmic membrane, leading to membrane integration. The translocation of large, hydrophilic polypeptide segments to the periplasmic side of this membrane almost always requires at least six different proteins encoded by the sec genes and is dependent on both ATP hydrolysis and the electrochemical energy potential. Signal peptidases process precursors with a single, amino-terminal signal sequence, allowing them to be released into the periplasm, where they may remain or whence they may be inserted into the outer membrane. Selected proteins may also be transported across this membrane for assembly into cell surface appendages or for release into the extracellular medium. Many bacteria secrete a variety of structurally different proteins by a common pathway, referred to here as the main terminal branch of the GSP. This recently discovered branch pathway comprises at least 14 gene products. Other, simpler terminal branches of the GSP are also used by gram-negative bacteria to secrete a more limited range of extracellular proteins. PMID:8096622

  1. Regulation of a maize HD-ZIP IV transcription factor by a non-conventional RDR2-dependent small RNA.

    PubMed

    Klein-Cosson, Catherine; Chambrier, Pierre; Rogowsky, Peter M; Vernoud, Vanessa

    2015-03-01

    Small non-coding RNAs are versatile riboregulators that control gene expression at the transcriptional or post-transcriptional level, governing many facets of plant development. Here we present evidence for the existence of a 24 nt small RNA (named small1) that is complementary to the 3' UTR of OCL1 (Outer Cell Layer1), the founding member of the maize HD-ZIP IV gene family encoding plant-specific transcription factors that are mainly involved in epidermis differentiation and specialization. The biogenesis of small1 depends on DICER-like 3 (DCL3), RNA-dependent RNA polymerase 2 (RDR2) and RNA polymerase IV, components that are usually required for RNA-dependent DNA-methylation. Unexpectedly, GFP sensor experiments in transient and stable transformation systems revealed that small1 may regulate its target at the post-transcriptional level, mainly through translational repression. This translational repression is attenuated in an rdr2 mutant background in which small1 does not accumulate. Our experiments further showed the possible involvement of a secondary stem-loop structure present in the 3' UTR of OCL1 for efficient target repression, suggesting the existence of several regulatory mechanisms affecting OCL1 mRNA stability and translation. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  2. Inhibition of intracellular bacterial replication in fibroblasts is dependent on the perforin-like protein (Perforin-2) encoded by macrophage expressed gene 1

    PubMed Central

    McCormack, Ryan; de Armas, Lesley R.; Shiratsuchi, Motoaki; Ramos, Jay; Podack, Eckhard R.

    2013-01-01

    Fibroblasts are known to eliminate intracellular bacteria, but the lethal hit of the bactericidal mechanism has not been defined. We show that primary embryonic and established fibroblasts can be induced by interferons or by intracellular bacterial infection to express a perforin-like mRNA previously described as macrophage expressed gene 1 (mpeg1). The presence and level of the perforin-like mRNA correlate with the ability of primary mouse embryonic fibroblasts (MEF) to eliminate intracellular bacteria. In addition, siRNA knock-down of the perforin-like molecule abolishes bactericidal activity and allows intracellular bacterial replication. Complementation of MEF in which the endogenous perforin-like molecule has been knocked down with an RFP-tagged version restores bactericidal activity. The perforin-like molecule has broad bactericidal specificity for pathogenic and non-pathogenic bacteria including Gram positive, Gram negative and acid fast bacteria. The perforin-like molecule renders previously lysozyme-resistant bacteria sensitive to lysis by lysozyme suggesting physical damage of the outer cell wall by the perforin-like protein. MEFs damage cell walls of intracellular bacteria by insertion, polymerization and pore-formation of the perforin-like protein, analogous to pore-formers of complement and Perforin-1 of cytolytic lymphocytes. We propose the name Perforin-2. PMID:23257510

  3. Multianode cylindrical proportional counter for high count rates

    DOEpatents

    Hanson, J.A.; Kopp, M.K.

    1980-05-23

    A cylindrical, multiple-anode proportional counter is provided for counting of low-energy photons (< 60 keV) at count rates of greater than 10/sup 5/ counts/sec. A gas-filled proportional counter cylinder forming an outer cathode is provided with a central coaxially disposed inner cathode and a plurality of anode wires disposed in a cylindrical array in coaxial alignment with and between the inner and outer cathodes to form a virtual cylindrical anode coaxial with the inner and outer cathodes. The virtual cylindrical anode configuration improves the electron drift velocity by providing a more uniform field strength throughout the counter gas volume, thus decreasing the electron collection time following the detection of an ionizing event. This avoids pulse pile-up and coincidence losses at these high count rates. Conventional RC position encoding detection circuitry may be employed to extract the spatial information from the counter anodes.

  4. Multianode cylindrical proportional counter for high count rates

    DOEpatents

    Hanson, James A.; Kopp, Manfred K.

    1981-01-01

    A cylindrical, multiple-anode proportional counter is provided for counting of low-energy photons (<60 keV) at count rates of greater than 10.sup.5 counts/sec. A gas-filled proportional counter cylinder forming an outer cathode is provided with a central coaxially disposed inner cathode and a plurality of anode wires disposed in a cylindrical array in coaxial alignment with and between the inner and outer cathodes to form a virtual cylindrical anode coaxial with the inner and outer cathodes. The virtual cylindrical anode configuration improves the electron drift velocity by providing a more uniform field strength throughout the counter gas volume, thus decreasing the electron collection time following the detection of an ionizing event. This avoids pulse pile-up and coincidence losses at these high count rates. Conventional RC position encoding detection circuitry may be employed to extract the spatial information from the counter anodes.

  5. Legionella dumoffii Utilizes Exogenous Choline for Phosphatidylcholine Synthesis

    PubMed Central

    Palusinska-Szysz, Marta; Szuster-Ciesielska, Agnieszka; Kania, Magdalena; Janczarek, Monika; Chmiel, Elżbieta; Danikiewicz, Witold

    2014-01-01

    Phosphatidycholine (PC) is the major membrane-forming phospholipid in eukaryotes but it has been found in only a limited number of prokaryotes. Bacteria synthesize PC via the phospholipid N-methylation pathway (Pmt) or via the phosphatidylcholine synthase pathway (Pcs) or both. Here, we demonstrated that Legionella dumoffii has the ability to utilize exogenous choline for phosphatidylcholine (PC) synthesis when bacteria grow in the presence of choline. The Pcs seems to be a primary pathway for synthesis of this phospholipid in L. dumoffii. Structurally different PC species were distributed in the outer and inner membranes. As shown by the LC/ESI-MS analyses, PC15:0/15:0, PC16:0/15:0, and PC17:0/17:1 were identified in the outer membrane and PC14:0/16:0, PC16:0/17:1, and PC20:0/15:0 in the inner membrane. L. dumoffii pcsA gene encoding phosphatidylcholine synthase revealed the highest sequence identity to pcsA of L. bozemanae (82%) and L. longbeachae (81%) and lower identity to pcsA of L. drancourtii (78%) and L. pneumophila (71%). The level of TNF-α in THP1-differentiated cells induced by live and temperature-killed L. dumoffii cultured on a medium supplemented with choline was assessed. Live L. dumoffii bacteria cultured on the choline-supplemented medium induced TNF-α three-fold less efficiently than cells grown on the non-supplemented medium. There is an evident effect of PC modification, which impairs the macrophage inflammatory response. PMID:24821544

  6. Functional Characterization of LcpA, a Surface-Exposed Protein of Leptospira spp. That Binds the Human Complement Regulator C4BP▿

    PubMed Central

    Barbosa, Angela S.; Monaris, Denize; Silva, Ludmila B.; Morais, Zenaide M.; Vasconcellos, Sílvio A.; Cianciarullo, Aurora M.; Isaac, Lourdes; Abreu, Patricia A. E.

    2010-01-01

    We have previously shown that pathogenic leptospiral strains are able to bind C4b binding protein (C4BP). Surface-bound C4BP retains its cofactor activity, indicating that acquisition of this complement regulator may contribute to leptospiral serum resistance. In the present study, the abilities of seven recombinant putative leptospiral outer membrane proteins to interact with C4BP were evaluated. The protein encoded by LIC11947 interacted with this human complement regulator in a dose-dependent manner. The cofactor activity of C4BP bound to immobilized recombinant LIC11947 (rLIC11947) was confirmed by detecting factor I-mediated cleavage of C4b. rLIC11947 was therefore named LcpA (for leptospiral complement regulator-acquiring protein A). LcpA was shown to be an outer membrane protein by using immunoelectron microscopy, cell surface proteolysis, and Triton X-114 fractionation. The gene coding for LcpA is conserved among pathogenic leptospiral strains. This is the first characterization of a Leptospira surface protein that binds to the human complement regulator C4BP in a manner that allows this important regulator to control complement system activation mediated either by the classical pathway or by the lectin pathway. This newly identified protein may play a role in immune evasion by Leptospira spp. and may therefore represent a target for the development of a human vaccine against leptospirosis. PMID:20404075

  7. Structural and transcriptional characterization of a novel member of the soybean urease gene family.

    PubMed

    Wiebke-Strohm, Beatriz; Ligabue-Braun, Rodrigo; Rechenmacher, Ciliana; De Oliveira-Busatto, Luisa Abruzzi; Carlini, Célia Regina; Bodanese-Zanettini, Maria Helena

    2016-04-01

    In plants, ureases have been related to urea degradation, to defense against pathogenic fungi and phytophagous insects, and to the soybean-Bradyrhizobium japonicum symbiosis. Two urease isoforms have been described for soybean: the embryo-specific, encoded by Eu1 gene, and the ubiquitous urease, encoded by Eu4. A third urease-encoding locus exists in the completed soybean genome. The gene was designated Eu5 and the putative product of its ORF as SBU-III. Phylogenetic analysis shows that 41 plant, moss and algal ureases have diverged from a common ancestor protein, but ureases from monocots, eudicots and ancient species have evolved independently. Genomes of ancient organisms present a single urease-encoding gene and urease-encoding gene duplication has occurred independently along the evolution of some eudicot species. SBU-III has a shorter amino acid sequence, since many gaps are found when compared to other sequences. A mutation in a highly conserved amino acid residue suggests absence of ureolytic activity, but the overall protein architecture remains very similar to the other ureases. The expression profile of urease-encoding genes in different organs and developmental stages was determined by RT-qPCR. Eu5 transcripts were detected in seeds one day after dormancy break, roots of young plants and embryos of developing seeds. Eu1 and Eu4 transcripts were found in all analyzed organs, but Eu4 expression was more prominent in seeds one day after dormancy break whereas Eu1 predominated in developing seeds. The evidence suggests that SBU-III may not be involved in nitrogen availability to plants, but it could be involved in other biological role(s). Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  8. Systems-level analysis of risk genes reveals the modular nature of schizophrenia.

    PubMed

    Liu, Jiewei; Li, Ming; Luo, Xiong-Jian; Su, Bing

    2018-05-19

    Schizophrenia (SCZ) is a complex mental disorder with high heritability. Genetic studies (especially recent genome-wide association studies) have identified many risk genes for schizophrenia. However, the physical interactions among the proteins encoded by schizophrenia risk genes remain elusive and it is not known whether the identified risk genes converge on common molecular networks or pathways. Here we systematically investigated the network characteristics of schizophrenia risk genes using the high-confidence protein-protein interactions (PPI) from the human interactome. We found that schizophrenia risk genes encode a densely interconnected PPI network (P = 4.15 × 10 -31 ). Compared with the background genes, the schizophrenia risk genes in the interactome have significantly higher degree (P = 5.39 × 10 -11 ), closeness centrality (P = 7.56 × 10 -11 ), betweeness centrality (P = 1.29 × 10 -11 ), clustering coefficient (P = 2.22 × 10 -2 ), and shorter average shortest path length (P = 7.56 × 10 -11 ). Based on the densely interconnected PPI network, we identified 48 hub genes and 4 modules formed by highly interconnected schizophrenia genes. We showed that the proteins encoded by schizophrenia hub genes have significantly more direct physical interactions. Gene ontology (GO) analysis revealed that cell adhesion, cell cycle, immune system response, and GABR-receptor complex categories were enriched in the modules formed by highly interconnected schizophrenia risk genes. Our study reveals that schizophrenia risk genes encode a densely interconnected molecular network and demonstrates the modular nature of schizophrenia. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Identification and characterization of a novel outer membrane protein receptor required for hemin utilization in Vibrio vulnificus

    PubMed Central

    Datta, Shreya

    2011-01-01

    Vibrio vulnificus, the cause of septicemia and serious wound infection in humans and fishes, require iron for its pathogenesis. Hemin uptake through the outer membrane receptor, HupA, is one of its many mechanisms by which it acquires iron. We report here the identification of an additional TonB-dependent hemin receptor HvtA, that is needed in conjunction with the HupA protein for optimal hemin utilization. The HvtA protein is significantly homologous to other outer membrane hemin receptors and its expression in trans restored the uptake of hemin and hemoglobin, the latter to a weaker extent, in a mutant strain that was defective in both receptors. Quantitative RT-PCR suggested that transcription of the hvtA gene was iron regulated. The operon containing the hvtA gene is homologous to the operon in V. cholerae containing the hemin receptor gene hutR suggesting a vertical transmission of the hvtA cluster from V. cholerae to V. vulnificus. PMID:22015545

  10. Cloning and expression of prion protein encoding gene of flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    Zhang, Zhiwen; Sun, Xiuqin; Zhang, Jinxing; Zan, Jindong

    2008-02-01

    The prion protein (PrP) encoding gene of flounder ( Paralichthys olivaceus) was cloned. It was not interrupted by an intron. This gene has two promoters in its 5' upstream, indicating that its transcription may be intensive, and should have an important function. It was expressed in all 14 tissues tested, demonstrating that it is a house-keeping gene. Its expression in digestion and reproduction systems implies that the possible prions of fish may transfer horizontally.

  11. Physiological roles of pyruvate ferredoxin oxidoreductase and pyruvate formate-lyase in Thermoanaerobacterium saccharolyticum JW/SL-YS485

    DOE PAGES

    Zhou, Jilai; Olson, Daniel G.; Lanahan, Anthony A.; ...

    2015-09-15

    We report that Thermoanaerobacter saccharolyticum is a thermophilic microorganism that has been engineered to produce ethanol at high titer (30–70 g/L) and greater than 90 % theoretical yield. However, few genes involved in pyruvate to ethanol production pathway have been unambiguously identified. In T. saccharolyticum, the products of six putative pfor gene clusters and one pfl gene may be responsible for the conversion of pyruvate to acetyl-CoA. To gain insights into the physiological roles of PFOR and PFL, we studied the effect of deletions of several genes thought to encode these activities. We found that that pyruvate ferredoxin oxidoreductase enzymemore » (PFOR) is encoded by the pforA gene and plays a key role in pyruvate dissimilation. We further demonstrated that pyruvate formate-lyase activity (PFL) is encoded by the pfl gene. Although the pfl gene is normally expressed at low levels, it is crucial for biosynthesis in T. saccharolyticum. In pforA deletion strains, pfl expression increased and was able to partially compensate for the loss of PFOR activity. Deletion of both pforA and pfl resulted in a strain that required acetate and formate for growth and produced lactate as the primary fermentation product, achieving 88 % theoretical lactate yield. PFOR encoded by Tsac_0046 and PFL encoded by Tsac_0628 are only two routes for converting pyruvate to acetyl-CoA in T. saccharolyticum. The physiological role of PFOR is pyruvate dissimilation, whereas that of PFL is supplying C1 units for biosynthesis.« less

  12. Identification and Characterization of Three Differentially Expressed Genes, Encoding S-Adenosylhomocysteine Hydrolase, Methionine Aminopeptidase, and a Histone-Like Protein, in the Toxic Dinoflagellate Alexandrium fundyense†

    PubMed Central

    Taroncher-Oldenburg, Gaspar; Anderson, Donald M.

    2000-01-01

    Genes showing differential expression related to the early G1 phase of the cell cycle during synchronized circadian growth of the toxic dinoflagellate Alexandrium fundyense were identified and characterized by differential display (DD). The determination in our previous work that toxin production in Alexandrium is relegated to a narrow time frame in early G1 led to the hypothesis that transcriptionally up- or downregulated genes during this subphase of the cell cycle might be related to toxin biosynthesis. Three genes, encoding S-adenosylhomocysteine hydrolase (Sahh), methionine aminopeptidase (Map), and a histone-like protein (HAf), were isolated. Sahh was downregulated, while Map and HAf were upregulated, during the early G1 phase of the cell cycle. Sahh and Map encoded amino acid sequences with about 90 and 70% similarity to those encoded by several eukaryotic and prokaryotic Sahh and Map genes, respectively. The partial Map sequence also contained three cobalt binding motifs characteristic of all Map genes. HAf encoded an amino acid sequence with 60% similarity to those of two histone-like proteins from the dinoflagellate Crypthecodinium cohnii Biecheler. This study documents the potential of applying DD to the identification of genes that are related to physiological processes or cell cycle events in phytoplankton under conditions where small sample volumes represent an experimental constraint. The identification of an additional 21 genes with various cell cycle-related DD patterns also provides evidence for the importance of pretranslational or transcriptional regulation in dinoflagellates, contrary to previous reports suggesting the possibility that translational mechanisms are the primary means of circadian regulation in this group of organisms. PMID:10788388

  13. Identification of a Novel Dioxygenase Involved in Metabolism of o-Xylene, Toluene, and Ethylbenzene by Rhodococcus sp. Strain DK17

    PubMed Central

    Kim, Dockyu; Chae, Jong-Chan; Zylstra, Gerben J.; Kim, Young-Soo; Kim, Seong-Ki; Nam, Myung Hee; Kim, Young Min; Kim, Eungbin

    2004-01-01

    Rhodococcus sp. strain DK17 is able to grow on o-xylene, benzene, toluene, and ethylbenzene. DK17 harbors at least two megaplasmids, and the genes encoding the initial steps in alkylbenzene metabolism are present on the 330-kb pDK2. The genes encoding alkylbenzene degradation were cloned in a cosmid clone and sequenced completely to reveal 35 open reading frames (ORFs). Among the ORFs, we identified two nearly exact copies (one base difference) of genes encoding large and small subunits of an iron sulfur protein terminal oxygenase that are 6 kb apart from each other. Immediately downstream of one copy of the dioxygenase genes (akbA1a and akbA2a) is a gene encoding a dioxygenase ferredoxin component (akbA3), and downstream of the other copy (akbA1b and akbA2b) are genes putatively encoding a meta-cleavage pathway. RT-PCR experiments show that the two copies of the dioxygenase genes are operonic with the downstream putative catabolic genes and that both operons are induced by o-xylene. When expressed in Escherichia coli, AkbA1a-AkbA2a-AkbA3 transformed o-xylene into 2,3- and 3,4-dimethylphenol. These were apparently derived from an unstable o-xylene cis-3,4-dihydrodiol, which readily dehydrates. This indicates a single point of attack of the dioxygenase on the aromatic ring. In contrast, attack of AkbA1a-AkbA2a-AkbA3 on ethylbenzene resulted in the formation of two different cis-dihydrodiols resulting from an oxidation at the 2,3 and the 3,4 positions on the aromatic ring, respectively. PMID:15574904

  14. Discovery of Herpes B Virus-Encoded MicroRNAs▿

    PubMed Central

    Besecker, Michael I.; Harden, Mallory E.; Li, Guanglin; Wang, Xiu-Jie; Griffiths, Anthony

    2009-01-01

    Herpes B virus (BV) naturally infects macaque monkeys and is a close relative of herpes simplex virus. BV can zoonotically infect humans to cause a rapidly ascending encephalitis with ∼80% mortality. Therefore, BV is a serious danger to those who come into contact with these monkeys or their tissues and cells. MicroRNAs are regulators of gene expression, and there have been reports of virus-encoded microRNAs. We hypothesize that BV-encoded microRNAs are important for the regulation of viral and cellular genes. Herein, we report the discovery of three herpes B virus-encoded microRNAs. PMID:19144716

  15. Targeting and assembly of components of the TOC protein import complex at the chloroplast outer envelope membrane

    PubMed Central

    Richardson, Lynn G. L.; Paila, Yamuna D.; Siman, Steven R.; Chen, Yi; Smith, Matthew D.; Schnell, Danny J.

    2014-01-01

    The translocon at the outer envelope membrane of chloroplasts (TOC) initiates the import of thousands of nuclear encoded preproteins required for chloroplast biogenesis and function. The multimeric TOC complex contains two GTP-regulated receptors, Toc34 and Toc159, which recognize the transit peptides of preproteins and initiate protein import through a β–barrel membrane channel, Toc75. Different isoforms of Toc34 and Toc159 assemble with Toc75 to form structurally and functionally diverse translocons, and the composition and levels of TOC translocons is required for the import of specific subsets of coordinately expressed proteins during plant growth and development. Consequently, the proper assembly of the TOC complexes is key to ensuring organelle homeostasis. This review will focus on our current knowledge of the targeting and assembly of TOC components to form functional translocons at the outer membrane. Our analyses reveal that the targeting of TOC components involves elements common to the targeting of other outer membrane proteins, but also include unique features that appear to have evolved to specifically facilitate assembly of the import apparatus. PMID:24966864

  16. Targeting and assembly of components of the TOC protein import complex at the chloroplast outer envelope membrane.

    PubMed

    Richardson, Lynn G L; Paila, Yamuna D; Siman, Steven R; Chen, Yi; Smith, Matthew D; Schnell, Danny J

    2014-01-01

    The translocon at the outer envelope membrane of chloroplasts (TOC) initiates the import of thousands of nuclear encoded preproteins required for chloroplast biogenesis and function. The multimeric TOC complex contains two GTP-regulated receptors, Toc34 and Toc159, which recognize the transit peptides of preproteins and initiate protein import through a β-barrel membrane channel, Toc75. Different isoforms of Toc34 and Toc159 assemble with Toc75 to form structurally and functionally diverse translocons, and the composition and levels of TOC translocons is required for the import of specific subsets of coordinately expressed proteins during plant growth and development. Consequently, the proper assembly of the TOC complexes is key to ensuring organelle homeostasis. This review will focus on our current knowledge of the targeting and assembly of TOC components to form functional translocons at the outer membrane. Our analyses reveal that the targeting of TOC components involves elements common to the targeting of other outer membrane proteins, but also include unique features that appear to have evolved to specifically facilitate assembly of the import apparatus.

  17. Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dunn, J.J.; Barbour, A.G.

    1996-11-05

    A method is provided for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface proteinmore » A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed. 38 figs.« less

  18. Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7

    DOEpatents

    Dunn, John J.; Barbour, Alan G.

    1996-11-05

    A method is provided herein for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface protein A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed.

  19. Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7

    DOEpatents

    Dunn, J.J.; Barbour, A.G.

    1996-11-05

    A method is provided for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface protein A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed. 38 figs.

  20. Gene encoding acetyl-coenzyme A carboxylase

    DOEpatents

    Roessler, Paul G.; Ohlrogge, John B.

    1996-01-01

    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives thereof which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides.

  1. Oxidative dearomatisation: the key step of sorbicillinoid biosynthesis† †Electronic supplementary information (ESI) available: Containing all experimental details. See DOI: 10.1039/c3sc52911h Click here for additional data file.

    PubMed Central

    Fahad, Ahmed al; Abood, Amira; Fisch, Katja M.; Osipow, Anna; Davison, Jack; Avramović, Marija; Butts, Craig P.; Piel, Jörn; Simpson, Thomas J.

    2014-01-01

    An FAD-dependent monooxygenase encoding gene (SorbC) was cloned from Penicillium chrysogenum E01-10/3 and expressed as a soluble protein in Escherichia coli. The enzyme efficiently performed the oxidative dearomatisation of sorbicillin and dihydrosorbicillin to give sorbicillinol and dihydrosorbicillinol respectively. Bioinformatic examination of the gene cluster surrounding SorbC indicated the presence of two polyketide synthase (PKS) encoding genes designated sorbA and sorbB. The gene sorbA-encodes a highly reducing iterative PKS while SorbB encodes a non-reducing iterative PKS which features a reductive release domain usually involved in the production of polyketide aldehydes. Using these observations and previously reported results from isotopic feeding experiments a new and simpler biosynthetic route to the sorbicillin class of secondary metabolites is proposed which is consistent with all reported experimental results. PMID:25580210

  2. A gene encoding the plant-like alternative oxidase is present in Phytomonas but absent in Leishmania spp.

    PubMed

    Van Hellemond, J J; Simons, B; Millenaar, F F; Tielens, A G

    1998-01-01

    The constituents of the respiratory chain are believed to differ among the trypanosomatids; bloodstream stages of African trypanosomes and Phytomonas promastigotes oxidize ubiquinol by a ubiquinol:oxygen oxidoreductase, also known as alternative oxidase, whereas Leishmania spp. oxidize ubiquinol via a classic cytochrome-containing respiratory chain. The molecular basis for this elementary difference in ubiquinol oxidation by the mitochondrial electron-transport chain in distinct trypanosomatids was investigated. The presence of a gene encoding the plant-like alternative oxidase could be demonstrated in Phytomonas and Trypanosoma brucei, trypanosomatids that are known to contain alternative oxidase activity. Our results further demonstrated that Leishmania spp. lack a gene encoding the plant-like alternative oxidase, and therefore, all stages of Leishmania spp. will lack the alternative oxidase protein. The observed fundamental differences between the respiratory chains of distinct members of the trypanosomatid family are thus caused by the presence or absence of a gene encoding the plant-like alternative oxidase.

  3. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    NASA Astrophysics Data System (ADS)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  4. Cloning and sequencing of a gene encoding a novel extracellular neutral proteinase from Streptomyces sp. strain C5 and expression of the gene in Streptomyces lividans 1326.

    PubMed Central

    Lampel, J S; Aphale, J S; Lampel, K A; Strohl, W R

    1992-01-01

    The gene encoding a novel milk protein-hydrolyzing proteinase was cloned on a 6.56-kb SstI fragment from Streptomyces sp. strain C5 genomic DNA into Streptomyces lividans 1326 by using the plasmid vector pIJ702. The gene encoding the small neutral proteinase (snpA) was located within a 2.6-kb BamHI-SstI restriction fragment that was partially sequenced. The molecular mass of the deduced amino acid sequence of the mature protein was determined to be 15,740, which corresponds very closely with the relative molecular mass of the purified protein (15,500) determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The N-terminal amino acid sequence of the purified neutral proteinase was determined, and the DNA encoding this sequence was found to be located within the sequenced DNA. The deduced amino acid sequence contains a conserved zinc binding site, although secondary ligand binding and active sites typical of thermolysinlike metalloproteinases are absent. The combination of its small size, deduced amino acid sequence, and substrate and inhibition profile indicate that snpA encodes a novel neutral proteinase. Images PMID:1569011

  5. Structure of a gene encoding a murine thymus leukemia antigen, and organization of Tla genes in the BALB/c mouse

    PubMed Central

    1985-01-01

    We have determined the DNA sequence of a gene encoding a thymus leukemia (TL) antigen in the BALB/c mouse, and have more definitively mapped the cloned BALB/c Tla-region class I gene clusters. Analysis of the sequence shows that the Tla gene is less closely related to the H-2 genes than H-2 genes are to one another or to a Qa-2,3-region genes. The Tla gene, 17.3A, contains an apparent gene conversion. Comparison of the BALB/c Tla genes with those from C57BL shows that BALB/c has more Tla-region class I genes, and that one of the genes absent in C57BL is gene 17.3A. PMID:3894562

  6. Molecular basis for photoreceptor outer segment architecture

    PubMed Central

    Goldberg, Andrew F. X.; Moritz, Orson L.; Williams, David S.

    2016-01-01

    To serve vision, vertebrate rod and cone photoreceptors must detect photons, convert the light stimuli into cellular signals, and then convey the encoded information to downstream neurons. Rods and cones are sensory neurons that each rely on specialized ciliary organelles to detect light. These organelles, called outer segments, possess elaborate architectures that include many hundreds of light-sensitive membranous disks arrayed one atop another in precise register. These stacked disks capture light and initiate the chain of molecular and cellular events that underlie normal vision. Outer segment organization is challenged by an inherently dynamic nature; these organelles are subject to a renewal process that replaces a significant fraction of their disks (up to ~10%) on a daily basis. In addition, a broad range of environmental and genetic insults can disrupt outer segment morphology to impair photoreceptor function and viability. In this chapter, we survey the major progress that has been made for understanding the molecular basis of outer segment architecture. We also discuss key aspects of organelle lipid and protein composition, and highlight distributions, interactions, and potential structural functions of key OS-resident molecules, including: kinesin-2, actin, RP1, prominin-1, protocadherin 21, peripherin-2/rds, rom-1, glutamic acid-rich proteins, and rhodopsin. Finally, we identify key knowledge gaps and challenges that remain for understanding how normal outer segment architecture is established and maintained. PMID:27260426

  7. Genome-Wide Identification and Expression Analysis of Homeodomain Leucine Zipper Subfamily IV (HDZ IV) Gene Family from Musa accuminata

    PubMed Central

    Pandey, Ashutosh; Misra, Prashant; Alok, Anshu; Kaur, Navneet; Sharma, Shivani; Lakhwani, Deepika; Asif, Mehar H.; Tiwari, Siddharth; Trivedi, Prabodh K.

    2016-01-01

    The homeodomain zipper family (HD-ZIP) of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV) has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV encoding genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana, and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV encoding genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV encoding genes and for their possible use in the banana improvement programs. PMID:26870050

  8. Microarray Analyses of Gene Expression during Adventitious Root Development in Pinus contorta1[w

    PubMed Central

    Brinker, Monika; van Zyl, Leonel; Liu, Wenbin; Craig, Deborah; Sederoff, Ronald R.; Clapham, David H.; von Arnold, Sara

    2004-01-01

    In order to investigate the gene expression pattern during adventitious root development, RNA of Pinus contorta hypocotyls, pulse-treated with the auxin indole-3-butyric acid and harvested at distinct developmental time points of root development, was hybridized to microarrays containing 2,178 cDNAs from Pinus taeda. Over the period of observation of root development, the transcript levels of 220 genes changed significantly. During the root initiation phase, genes involved in cell replication and cell wall weakening and a transcript encoding a PINHEAD/ZWILLE-like protein were up-regulated, while genes related to auxin transport, photosynthesis, and cell wall synthesis were down-regulated. In addition, there were changes in transcript abundance of genes related to water stress. During the root meristem formation phase the transcript abundances of genes involved in auxin transport, auxin responsive transcription, and cell wall synthesis, and of a gene encoding a B-box zinc finger-like protein, increased, while those encoding proteins involved in cell wall weakening decreased. Changes of transcript abundance of genes related to water stress during the root meristem formation and root formation phase indicate that the plant roots had become functional in water transport. Simultaneously, genes involved in auxin transport were up-regulated, while genes related to cell wall modification were down-regulated. Finally, during the root elongation phase down-regulation of transcripts encoding proteins involved in cell replication and stress occurred. Based on the observed changes in transcript abundances, we suggest hypotheses about the relative importance of various physiological processes during the auxin-induced development of roots in P. contorta. PMID:15247392

  9. Identification of a Linked Set of Genes in Serpulina hyodysenteriae (B204) Predicted To Encode Closely Related 39-Kilodalton Extracytoplasmic Proteins

    PubMed Central

    Gabe, Jeffrey D.; Dragon, Elizabeth; Chang, Ray-Jen; McCaman, Michael T.

    1998-01-01

    A tandem pair of nearly identical genes from Serpulina hyodysenteriae (B204) were cloned and sequenced. The full open reading frame of one gene and the partial open reading frame of the neighboring gene appear to encode secreted proteins which are homologous to, yet distinct from, the 39-kDa extracytoplasmic protein purified from the membrane fraction of S. hyodysenteriae. We have designated these newly identified genes vspA and vspB (for variable surface protein). PMID:9440540

  10. Direct cloning of the trxB gene that encodes thioredoxin reductase.

    PubMed Central

    Russel, M; Model, P

    1985-01-01

    A strain was constructed which contains mutations in the genes encoding thioredoxin (trxA) and thioredoxin reductase (trxB) such that filamentous phage f1 cannot grow. The complementation of either mutation with its wild-type allele permits phage growth. We used this strain to select f1 phage which contain a cloned trxB gene. The location of the gene on the cloned fragment was determined, and its protein product was identified. Plasmid subclones that contain this gene overproduce thioredoxin reductase. Images PMID:2989245

  11. Wound induced Beta vulgaris polygalacturonase-inhibiting protein genes encode a longer leucine-rich repeat domain and inhibit fungal polygalacturonases

    USDA-ARS?s Scientific Manuscript database

    Polygalacturonase-inhibiting proteins (PGIPs) are leucine-rich repeat (LRR) proteins involved in plant defense. Sugar beet (Beta vulgaris L.) PGIP genes, BvPGIP1, BvPGIP2 and BvPGIP3, were isolated from two breeding lines, F1016 and F1010. Full-length cDNA sequences of the three BvPGIP genes encod...

  12. Innate responses to gene knockouts impact overlapping gene networks and vary with respect to resistance to viral infection.

    PubMed

    Liu, Yonghong; Liu, Yuanyuan; Wu, Jiaming; Roizman, Bernard; Zhou, Grace Guoying

    2018-04-03

    Analyses of the levels of mRNAs encoding IFIT1, IFI16, RIG-1, MDA5, CXCL10, LGP2, PUM1, LSD1, STING, and IFNβ in cell lines from which the gene encoding LGP2, LSD1, PML, HDAC4, IFI16, PUM1, STING, MDA5, IRF3, or HDAC 1 had been knocked out, as well as the ability of these cell lines to support the replication of HSV-1, revealed the following: ( i ) Cell lines lacking the gene encoding LGP2, PML, or HDAC4 (cluster 1) exhibited increased levels of expression of partially overlapping gene networks. Concurrently, these cell lines produced from 5 fold to 12 fold lower yields of HSV-1 than the parental cells. ( ii ) Cell lines lacking the genes encoding STING, LSD1, MDA5, IRF3, or HDAC 1 (cluster 2) exhibited decreased levels of mRNAs of partially overlapping gene networks. Concurrently, these cell lines produced virus yields that did not differ from those produced by the parental cell line. The genes up-regulated in cell lines forming cluster 1, overlapped in part with genes down-regulated in cluster 2. The key conclusions are that gene knockouts and subsequent selection for growth causes changes in expression of multiple genes, and hence the phenotype of the cell lines cannot be ascribed to a single gene; the patterns of gene expression may be shared by multiple knockouts; and the enhanced immunity to viral replication by cluster 1 knockout cell lines but not by cluster 2 cell lines suggests that in parental cells, the expression of innate resistance to infection is specifically repressed.

  13. Genomic characterization of an extensively-drug resistance Salmonella enterica serotype Indiana strain harboring blaNDM-1 gene isolated from a chicken carcass in China.

    PubMed

    Wang, Wei; Peng, Zixin; Baloch, Zulqarnain; Hu, Yujie; Xu, Jin; Zhang, Wenhui; Fanning, Séamus; Li, Fengqin

    2017-11-01

    The objective of this study was to genetically characterize the antimicrobial resistance mechanisms of Salmonella enterica serotype Indiana C629 isolated from a chicken carcass in China in 2014. Antimicrobial susceptibility against a panel of 23 antimicrobial agents was carried out on Salmonella enterica serotype Indiana C629 and assessed according to CLSI standards. Whole-genome sequencing of this isolate was conducted to obtain the complete genome of S. Indiana. Salmonella Indiana C629 expressed an XDR phenotype being resistant to more than 20 antimicrobial agents, including imipenem and meropenem. From the analysis of the resistance mechanisms, two mutations were identified in subunit A of DNA gyrase within the quinolone resistance determining region, in addition to the acquisition of mobile efflux pumps encoding oqxA/B/R. Additionally, four beta-lactamases resistance genes (bla CTX-M-65 , bla TEM-1 , bla OXA-1 , and bla NDM-1 ), five aminoglycosides resistance genes (aac(3)-IV, aac(6')-Ib-cr, aadA2, aadA5, and aph(4)-Ia), two phenicol resistance genes (catB3 and floR), and five trimethoprim/sulfamethoxazole resistance genes (sul1/2/3 and dfrA12/17) were also identified. A total of 191 virulence genes were identified. Among them, 57 belonged to type-three secretion system (T3SS) encoding genes, 55 belonged to fimbrial adherence encoding genes, and 39 belonged to flagella-encoding genes CONCLUSIONS: This study demonstrated that multi-resistance mechanisms consistent with an XDR-phenotype, along with various virulence encoding genes of a S. Indiana strain in China These findings highlight the importance of cooperation among different sectors in order to monitor the spread of resistant pathogens among food animal, foods of animal origin and human beings that might further take measures to protect consumers' health. Copyright © 2017 Elsevier GmbH. All rights reserved.

  14. Molecular and functional characterization of novel fructosyltransferases and invertases from Agave tequilana.

    PubMed

    Cortés-Romero, Celso; Martínez-Hernández, Aída; Mellado-Mojica, Erika; López, Mercedes G; Simpson, June

    2012-01-01

    Fructans are the main storage polysaccharides found in Agave species. The synthesis of these complex carbohydrates relies on the activities of specific fructosyltransferase enzymes closely related to the hydrolytic invertases. Analysis of Agave tequilana transcriptome data led to the identification of ESTs encoding putative fructosyltransferases and invertases. Based on sequence alignments and structure/function relationships, two different genes were predicted to encode 1-SST and 6G-FFT type fructosyltransferases, in addition, 4 genes encoding putative cell wall invertases and 4 genes encoding putative vacuolar invertases were also identified. Probable functions for each gene, were assigned based on conserved amino acid sequences and confirmed for 2 fructosyltransferases and one invertase by analyzing the enzymatic activity of recombinant Agave protein s expressed and purified from Pichia pastoris. The genome organization of the fructosyltransferase/invertase genes, for which the corresponding cDNA contained the complete open reading frame, was found to be well conserved since all genes were shown to carry a 9 bp mini-exon and all showed a similar structure of 8 exons/7 introns with the exception of a cell wall invertase gene which has 7 exons and 6 introns. Fructosyltransferase genes were strongly expressed in the storage organs of the plants, especially in vegetative stages of development and to lower levels in photosynthetic tissues, in contrast to the invertase genes where higher levels of expression were observed in leaf tissues and in mature plants.

  15. Molecular and Functional Characterization of Novel Fructosyltransferases and Invertases from Agave tequilana

    PubMed Central

    Cortés-Romero, Celso; Martínez-Hernández, Aída; Mellado-Mojica, Erika; López, Mercedes G.; Simpson, June

    2012-01-01

    Fructans are the main storage polysaccharides found in Agave species. The synthesis of these complex carbohydrates relies on the activities of specific fructosyltransferase enzymes closely related to the hydrolytic invertases. Analysis of Agave tequilana transcriptome data led to the identification of ESTs encoding putative fructosyltransferases and invertases. Based on sequence alignments and structure/function relationships, two different genes were predicted to encode 1-SST and 6G-FFT type fructosyltransferases, in addition, 4 genes encoding putative cell wall invertases and 4 genes encoding putative vacuolar invertases were also identified. Probable functions for each gene, were assigned based on conserved amino acid sequences and confirmed for 2 fructosyltransferases and one invertase by analyzing the enzymatic activity of recombinant Agave protein s expressed and purified from Pichia pastoris. The genome organization of the fructosyltransferase/invertase genes, for which the corresponding cDNA contained the complete open reading frame, was found to be well conserved since all genes were shown to carry a 9 bp mini-exon and all showed a similar structure of 8 exons/7 introns with the exception of a cell wall invertase gene which has 7 exons and 6 introns. Fructosyltransferase genes were strongly expressed in the storage organs of the plants, especially in vegetative stages of development and to lower levels in photosynthetic tissues, in contrast to the invertase genes where higher levels of expression were observed in leaf tissues and in mature plants. PMID:22558253

  16. The formation of the light-sensing compartment of cone photoreceptors coincides with a transcriptional switch

    PubMed Central

    Daum, Janine M; Keles, Özkan; Holwerda, Sjoerd JB; Kohler, Hubertus; Rijli, Filippo M

    2017-01-01

    High-resolution daylight vision is mediated by cone photoreceptors. The molecular program responsible for the formation of their light sensor, the outer segment, is not well understood. We correlated daily changes in ultrastructure and gene expression in postmitotic mouse cones, between birth and eye opening, using serial block-face electron microscopy (EM) and RNA sequencing. Outer segments appeared rapidly at postnatal day six and their appearance coincided with a switch in gene expression. The switch affected over 14% of all expressed genes. Genes that switched off were rich in transcription factors and neurogenic genes. Those that switched on contained genes relevant for cone function. Chromatin rearrangements in enhancer regions occurred before the switch was completed, but not after. We provide a resource comprised of correlated EM, RNAseq, and ATACseq data, showing that the growth of a key compartment of a postmitotic cell involves an extensive switch in gene expression and chromatin accessibility. PMID:29106373

  17. Impact assessment of bisphenol A on lignin-modifying enzymes by basidiomycete Trametes versicolor.

    PubMed

    Takamiya, Minako; Magan, Naresh; Warner, Philip J

    2008-06-15

    The impact of different concentrations of bisphenol A (BPA) was evaluated on growth of the white-rot basidiomycete, Trametes versicolor, and on the expression of genes encoding lignin-modifying enzyme (LME) activities. Effective doses (EDs) were obtained from fungal growth rate to monitor LME activities and the expression levels of their encoding genes. The fungus showed mycelial growth at concentrations of up to 300 microg ml(-1) of BPA with an ED50 value of 185 microg ml(-1). The LME activities were stimulated by BPA concentrations up to 300 microg ml(-1). The lignin peroxidase (LIP) encoding gene may be sensitive to BPA stress.

  18. Divergence of the Floral A-Function between an Asterid and a Rosid Species.

    PubMed

    Morel, Patrice; Heijmans, Klaas; Rozier, Frédérique; Zethof, Jan; Chamot, Sophy; Bento, Suzanne Rodrigues; Vialette-Guiraud, Aurélie; Chambrier, Pierre; Trehin, Christophe; Vandenbussche, Michiel

    2017-07-01

    The ABC model is widely used as a genetic framework for understanding floral development and evolution. In this model, the A-function is required for the development of sepals and petals and to antagonize the C-function in the outer floral whorls. In the rosid species Arabidopsis thaliana , the AP2-type AP2 transcription factor represents a major A-function protein, but how the A-function is encoded in other species is not well understood. Here, we show that in the asterid species petunia ( Petunia hybrida ), AP2B/BLIND ENHANCER ( BEN ) confines the C-function to the inner petunia floral whorls, in parallel with the microRNA BLIND BEN belongs to the TOE-type AP2 gene family, members of which control flowering time in Arabidopsis. In turn, we demonstrate that the petunia AP2-type REPRESSOR OF B-FUNCTION ( ROB ) genes repress the B-function (but not the C-function) in the first floral whorl, together with BEN We propose a combinatorial model for patterning the B- and C-functions, leading to the homeotic conversion of sepals into petals, carpels, or stamens, depending on the genetic context. Combined with earlier results, our findings suggest that the molecular mechanisms controlling the spatial restriction of the floral organ identity genes are more diverse than the well-conserved B and C floral organ identity functions. © 2017 American Society of Plant Biologists. All rights reserved.

  19. Mechanism of quinolone resistance in anaerobic bacteria.

    PubMed

    Oh, H; Edlund, C

    2003-06-01

    Several recently developed quinolones have excellent activity against a broad range of aerobic and anaerobic bacteria and are thus potential drugs for the treatment of serious anaerobic and mixed infections. Resistance to quinolones is increasing worldwide, but is still relatively infrequent among anaerobes. Two main mechanisms, alteration of target enzymes (gyrase and topoisomerase IV) caused by chromosomal mutations in encoding genes, or reduced intracellular accumulation due to increased efflux of the drug, are associated with quinolone resistance. These mechanisms have also been found in anaerobic species. High-level resistance to the newer broad-spectrum quinolones often requires stepwise mutations in target genes. The increasing emergence of resistance among anaerobes may be a consequence of previous widespread use of quinolones, which may have enriched first-step mutants in the intestinal tract. Quinolone resistance in the Bacteroides fragilis group strains is strongly correlated with amino acid substitutions at positions 82 and 86 in GyrA (equivalent to positions 83 and 87 of Escherichia coli). Several studies have indicated that B. fragilis group strains possess efflux pump systems that actively expel quinolones, leading to resistance. DNA gyrase seems also to be the primary target for quinolones in Clostridium difficile, since amino acid substitutions in GyrA and GyrB have been detected in resistant strains. To what extent other mechanisms, such as mutational events in other target genes or alterations in outer-membrane proteins, contribute to resistance among anaerobes needs to be further investigated.

  20. Evaluation of the effects of sdiA, a luxR homologue, on adherence and motility of Escherichia coli O157 : H7.

    PubMed

    Sharma, Vijay K; Bearson, Shawn M D; Bearson, Bradley L

    2010-05-01

    Quorum-sensing (QS) signalling pathways are important regulatory networks for controlling the expression of genes promoting adherence of enterohaemorrhagic Escherichia coli (EHEC) O157 : H7 to epithelial cells. A recent study has shown that EHEC O157 : H7 encodes a luxR homologue, called sdiA, which upon overexpression reduces the expression of genes encoding flagellar and locus of enterocyte effacement (LEE) proteins, thus negatively impacting on the motility and intimate adherence phenotypes, respectively. Here, we show that the deletion of sdiA from EHEC O157 : H7 strain 86-24, and from a hha (a negative regulator of ler) mutant of this strain, enhanced bacterial adherence to HEp-2 epithelial cells of the sdiA mutant strains relative to the strains containing a wild-type copy of sdiA. Quantitative reverse transcription PCR showed that the expression of LEE-encoded genes ler, espA and eae in strains with the sdiA deletions was not significantly different from that of the strains wild-type for sdiA. Similarly, no additional increases in the expression of LEE genes were observed in a sdiA hha double mutant strain relative to that observed in the hha deletion mutant. While the expression of fliC, which encodes flagellin, was enhanced in the sdiA mutant strain, the expression of fliC was reduced by several fold in the hha mutant strain, irrespective of the presence or absence of sdiA, indicating that the genes sdiA and hha exert opposing effects on the expression of fliC. The strains with deletions in sdiA or hha showed enhanced expression of csgA, encoding curlin of the curli fimbriae, with the expression of csgA highest in the sdiA hha double mutant, suggesting an additive effect of these two gene deletions on the expression of csgA. No significant differences were observed in the expression of the genes lpfA and fimA of the operons encoding long polar and type 1 fimbriae in the sdiA mutant strain. These data indicate that SdiA has no significant effect on the expression of LEE genes, but that it appears to act as a strong repressor of genes encoding flagella and curli fimbriae, and the alleviation of the SdiA-mediated repression of these genes in an EHEC O157 : H7 sdiA mutant strain contributes to enhanced bacterial motility and increased adherence to HEp-2 epithelial cells.

  1. A [Cu]rious Ribosomal Profiling Pattern Leads to the Discovery of Ribosomal Frameshifting in the Synthesis of a Copper Chaperone.

    PubMed

    Atkins, John F; Loughran, Gary; Baranov, Pavel V

    2017-01-19

    In many bacteria, separate genes encode a copper binding chaperone and a copper efflux pump, but in some the chaperone encoding gene has been elusive. In this issue of Molecular Cell, Meydan et al. (2017) report that ribosomes translating the ORF that encodes the copper pump frequently frameshift and terminate to produce the copper chaperone. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Transcriptome analysis of Neisseria meningitidis in human whole blood and mutagenesis studies identify virulence factors involved in blood survival.

    PubMed

    Echenique-Rivera, Hebert; Muzzi, Alessandro; Del Tordello, Elena; Seib, Kate L; Francois, Patrice; Rappuoli, Rino; Pizza, Mariagrazia; Serruto, Davide

    2011-05-01

    During infection Neisseria meningitidis (Nm) encounters multiple environments within the host, which makes rapid adaptation a crucial factor for meningococcal survival. Despite the importance of invasion into the bloodstream in the meningococcal disease process, little is known about how Nm adapts to permit survival and growth in blood. To address this, we performed a time-course transcriptome analysis using an ex vivo model of human whole blood infection. We observed that Nm alters the expression of ≈30% of ORFs of the genome and major dynamic changes were observed in the expression of transcriptional regulators, transport and binding proteins, energy metabolism, and surface-exposed virulence factors. In particular, we found that the gene encoding the regulator Fur, as well as all genes encoding iron uptake systems, were significantly up-regulated. Analysis of regulated genes encoding for surface-exposed proteins involved in Nm pathogenesis allowed us to better understand mechanisms used to circumvent host defenses. During blood infection, Nm activates genes encoding for the factor H binding proteins, fHbp and NspA, genes encoding for detoxifying enzymes such as SodC, Kat and AniA, as well as several less characterized surface-exposed proteins that might have a role in blood survival. Through mutagenesis studies of a subset of up-regulated genes we were able to identify new proteins important for survival in human blood and also to identify additional roles of previously known virulence factors in aiding survival in blood. Nm mutant strains lacking the genes encoding the hypothetical protein NMB1483 and the surface-exposed proteins NalP, Mip and NspA, the Fur regulator, the transferrin binding protein TbpB, and the L-lactate permease LctP were sensitive to killing by human blood. This increased knowledge of how Nm responds to adaptation in blood could also be helpful to develop diagnostic and therapeutic strategies to control the devastating disease cause by this microorganism.

  3. Transcriptome Analysis of Neisseria meningitidis in Human Whole Blood and Mutagenesis Studies Identify Virulence Factors Involved in Blood Survival

    PubMed Central

    Del Tordello, Elena; Seib, Kate L.; Francois, Patrice; Rappuoli, Rino; Pizza, Mariagrazia; Serruto, Davide

    2011-01-01

    During infection Neisseria meningitidis (Nm) encounters multiple environments within the host, which makes rapid adaptation a crucial factor for meningococcal survival. Despite the importance of invasion into the bloodstream in the meningococcal disease process, little is known about how Nm adapts to permit survival and growth in blood. To address this, we performed a time-course transcriptome analysis using an ex vivo model of human whole blood infection. We observed that Nm alters the expression of ≈30% of ORFs of the genome and major dynamic changes were observed in the expression of transcriptional regulators, transport and binding proteins, energy metabolism, and surface-exposed virulence factors. In particular, we found that the gene encoding the regulator Fur, as well as all genes encoding iron uptake systems, were significantly up-regulated. Analysis of regulated genes encoding for surface-exposed proteins involved in Nm pathogenesis allowed us to better understand mechanisms used to circumvent host defenses. During blood infection, Nm activates genes encoding for the factor H binding proteins, fHbp and NspA, genes encoding for detoxifying enzymes such as SodC, Kat and AniA, as well as several less characterized surface-exposed proteins that might have a role in blood survival. Through mutagenesis studies of a subset of up-regulated genes we were able to identify new proteins important for survival in human blood and also to identify additional roles of previously known virulence factors in aiding survival in blood. Nm mutant strains lacking the genes encoding the hypothetical protein NMB1483 and the surface-exposed proteins NalP, Mip and NspA, the Fur regulator, the transferrin binding protein TbpB, and the L-lactate permease LctP were sensitive to killing by human blood. This increased knowledge of how Nm responds to adaptation in blood could also be helpful to develop diagnostic and therapeutic strategies to control the devastating disease cause by this microorganism. PMID:21589640

  4. Gene encoding acetyl-coenzyme A carboxylase

    DOEpatents

    Roessler, P.G.; Ohlrogge, J.B.

    1996-09-24

    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives are disclosed which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides. 5 figs.

  5. Mutations in iron-sulfur cluster proteins that improve xylose utilization

    DOEpatents

    Froehlich, Allan; Henningsen, Brooks; Covalla, Sean; Zelle, Rintze M.

    2018-03-20

    There is provided an engineered host cells comprising (a) one or more mutations in one or more endogenous genes encoding a protein associated with iron metabolism; and (b) at least one gene encoding a polypeptide having xylose isomerase activity, and methods of their use thereof.

  6. Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus

    Treesearch

    Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds

    2016-01-01

    The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...

  7. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    PubMed Central

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  8. Functional differentiation and spatial-temporal co-expression networks of the NBS-encoding gene family in Jilin ginseng, Panax ginseng C.A. Meyer.

    PubMed

    Yin, Rui; Zhao, Mingzhu; Wang, Kangyu; Lin, Yanping; Wang, Yanfang; Sun, Chunyu; Wang, Yi; Zhang, Meiping

    2017-01-01

    Ginseng, Panax ginseng C.A. Meyer, is one of the most important medicinal plants for human health and medicine. It has been documented that over 80% of genes conferring resistance to bacteria, viruses, fungi and nematodes are contributed by the nucleotide binding site (NBS)-encoding gene family. Therefore, identification and characterization of NBS genes expressed in ginseng are paramount to its genetic improvement and breeding. However, little is known about the NBS-encoding genes in ginseng. Here we report genome-wide identification and systems analysis of the NBS genes actively expressed in ginseng (PgNBS genes). Four hundred twelve PgNBS gene transcripts, derived from 284 gene models, were identified from the transcriptomes of 14 ginseng tissues. These genes were classified into eight types, including TNL, TN, CNL, CN, NL, N, RPW8-NL and RPW8-N. Seven conserved motifs were identified in both the Toll/interleukine-1 receptor (TIR) and coiled-coil (CC) typed genes whereas six were identified in the RPW8 typed genes. Phylogenetic analysis showed that the PgNBS gene family is an ancient family, with a vast majority of its genes originated before ginseng originated. In spite of their belonging to a family, the PgNBS genes have functionally dramatically differentiated and been categorized into numerous functional categories. The expressions of the across tissues, different aged roots and the roots of different genotypes. However, they are coordinating in expression, forming a single co-expression network. These results provide a deeper understanding of the origin, evolution and functional differentiation and expression dynamics of the NBS-encoding gene family in plants in general and in ginseng particularly, and a NBS gene toolkit useful for isolation and characterization of disease resistance genes and for enhanced disease resistance breeding in ginseng and related species.

  9. Functional differentiation and spatial-temporal co-expression networks of the NBS-encoding gene family in Jilin ginseng, Panax ginseng C.A. Meyer

    PubMed Central

    Wang, Kangyu; Lin, Yanping; Wang, Yanfang; Sun, Chunyu; Wang, Yi

    2017-01-01

    Ginseng, Panax ginseng C.A. Meyer, is one of the most important medicinal plants for human health and medicine. It has been documented that over 80% of genes conferring resistance to bacteria, viruses, fungi and nematodes are contributed by the nucleotide binding site (NBS)-encoding gene family. Therefore, identification and characterization of NBS genes expressed in ginseng are paramount to its genetic improvement and breeding. However, little is known about the NBS-encoding genes in ginseng. Here we report genome-wide identification and systems analysis of the NBS genes actively expressed in ginseng (PgNBS genes). Four hundred twelve PgNBS gene transcripts, derived from 284 gene models, were identified from the transcriptomes of 14 ginseng tissues. These genes were classified into eight types, including TNL, TN, CNL, CN, NL, N, RPW8-NL and RPW8-N. Seven conserved motifs were identified in both the Toll/interleukine-1 receptor (TIR) and coiled-coil (CC) typed genes whereas six were identified in the RPW8 typed genes. Phylogenetic analysis showed that the PgNBS gene family is an ancient family, with a vast majority of its genes originated before ginseng originated. In spite of their belonging to a family, the PgNBS genes have functionally dramatically differentiated and been categorized into numerous functional categories. The expressions of the across tissues, different aged roots and the roots of different genotypes. However, they are coordinating in expression, forming a single co-expression network. These results provide a deeper understanding of the origin, evolution and functional differentiation and expression dynamics of the NBS-encoding gene family in plants in general and in ginseng particularly, and a NBS gene toolkit useful for isolation and characterization of disease resistance genes and for enhanced disease resistance breeding in ginseng and related species. PMID:28727829

  10. Studying the organization of genes encoding plant cell wall degrading enzymes in Chrysomela tremula provides insights into a leaf beetle genome.

    PubMed

    Pauchet, Y; Saski, C A; Feltus, F A; Luyten, I; Quesneville, H; Heckel, D G

    2014-06-01

    The ability of herbivorous beetles from the superfamilies Chrysomeloidea and Curculionoidea to degrade plant cell wall polysaccharides has only recently begun to be appreciated. The presence of plant cell wall degrading enzymes (PCWDEs) in the beetle's digestive tract makes this degradation possible. Sequences encoding these beetle-derived PCWDEs were originally identified from transcriptomes and strikingly resemble those of saprophytic and phytopathogenic microorganisms, raising questions about their origin; e.g. are they insect- or microorganism-derived? To demonstrate unambiguously that the genes encoding PCWDEs found in beetle transcriptomes are indeed of insect origin, we generated a bacterial artificial chromosome library from the genome of the leaf beetle Chrysomela tremula, containing 18 432 clones with an average size of 143 kb. After hybridizing this library with probes derived from 12 C. tremula PCWDE-encoding genes and sequencing the positive clones, we demonstrated that the latter genes are encoded by the insect's genome and are surrounded by genes possessing orthologues in the genome of Tribolium castaneum as well as in three other beetle genomes. Our analyses showed that although the level of overall synteny between C. tremula and T. castaneum seems high, the degree of microsynteny between both species is relatively low, in contrast to the more closely related Colorado potato beetle. © 2014 The Royal Entomological Society.

  11. Identification of a Polymorphic Gene, BCL2A1, Encoding Two Novel Hematopoietic Lineage-specific Minor Histocompatibility Antigens

    PubMed Central

    Akatsuka, Yoshiki; Nishida, Tetsuya; Kondo, Eisei; Miyazaki, Mikinori; Taji, Hirohumi; Iida, Hiroatsu; Tsujimura, Kunio; Yazaki, Makoto; Naoe, Tomoki; Morishima, Yasuo; Kodera, Yoshihisa; Kuzushima, Kiyotaka; Takahashi, Toshitada

    2003-01-01

    We report the identification of two novel minor histocompatibility antigens (mHAgs), encoded by two separate single nucleotide polymorphisms on a single gene, BCL2A1, and restricted by human histocompatibility leukocyte antigen (HLA)-A*2402 (the most common HLA-A allele in Japanese) and B*4403, respectively. Two cytotoxic T lymphocyte (CTL) clones specific for these mHAgs were first isolated from two distinct recipients after hematopoietic cell transplantation. Both clones lyse only normal and malignant cells within the hematopoietic lineage. To localize the gene encoding the mHAgs, two-point linkage analysis was performed on the CTL lytic patterns of restricting HLA-transfected B lymphoblastoid cell lines obtained from Centre d'Etude du Polymorphisme Humain. Both CTL clones showed a completely identical lytic pattern for 4 pedigrees and the gene was localized within a 3.6-cM interval of 15q24.3–25.1 region that encodes at least 46 genes. Of those, only BCL2A1 has been reported to be expressed in hematopoietic cells and possess three nonsynonymous nucleotide changes. Minigene transfection and epitope reconstitution assays with synthetic peptides identified both HLA-A*2402– and B*4403-restricted mHAg epitopes to be encoded by distinct polymorphisms within BCL2A1. PMID:12771180

  12. A novel family of integrases associated with prophages and genomic islands integrated within the tRNA-dihydrouridine synthase A (dusA) gene

    PubMed Central

    Farrugia, Daniel N.; Elbourne, Liam D. H.; Mabbutt, Bridget C.; Paulsen, Ian T.

    2015-01-01

    Genomic islands play a key role in prokaryotic genome plasticity. Genomic islands integrate into chromosomal loci such as transfer RNA genes and protein coding genes, whilst retaining various cargo genes that potentially bestow novel functions on the host organism. A gene encoding a putative integrase was identified at a single site within the 5′ end of the dusA gene in the genomes of over 200 bacteria. This integrase was discovered to be a component of numerous genomic islands, which appear to share a target site within the dusA gene. dusA encodes the tRNA-dihydrouridine synthase A enzyme, which catalyses the post-transcriptional reduction of uridine to dihydrouridine in tRNA. Genomic islands encoding homologous dusA-associated integrases were found at a much lower frequency within the related dusB and dusC genes, and non-dus genes. Excision of these dusA-associated islands from the chromosome as circularized intermediates was confirmed by polymerase chain reaction. Analysis of the dusA-associated islands indicated that they were highly diverse, with the integrase gene representing the only universal common feature. PMID:25883135

  13. Gene disruption in Trichoderma atroviride via Agrobacterium-mediated transformation.

    PubMed

    Zeilinger, Susanne

    2004-02-01

    A modified Agrobacterium-mediated transformation method for the efficient disruption of two genes encoding signaling compounds of the mycoparasite Trichoderma atroviride is described, using the hph gene of Escherichia coli as selection marker. The transformation vectors contained about 1 kb of 5' and 3' non-coding regions from the tmk1 (encoding a MAP kinase) or tga3 (encoding an alpha-subunit of a heterotrimeric G protein) target loci flanking a selection marker. Transformation of fungal conidia and selection on hygromycin-containing media applying an overlay-based procedure, which overcomes the lack of formation of distinct single colonies by the fungus, led to stable clones for both disruption constructs. Southern and PCR analyses proved gene disruption by single-copy homologous integration with a frequency of approximately 60% for both genes; and the loss of tmk1 and tga3 transcript formation in the disruptants was demonstrated by RT-PCR.

  14. Overexpression of the gene encoding HMG-CoA reductase in Saccharomyces cerevisiae for production of prenyl alcohols.

    PubMed

    Ohto, Chikara; Muramatsu, Masayoshi; Obata, Shusei; Sakuradani, Eiji; Shimizu, Sakayu

    2009-04-01

    To develop microbial production method for prenyl alcohols (e.g., (E,E)-farnesol (FOH), (E)-nerolidol (NOH), and (E,E,E)-geranylgeraniol (GGOH)), the genes encoding enzymes in the mevalonate and prenyl diphosphate pathways were overexpressed in Saccharomyces cerevisiae, and the resultant transformants were evaluated as to the production of these alcohols. Overexpression of the gene encoding hydroxymethylglutaryl (HMG)-CoA reductase was most effective among the genes tested. A derivative of S. cerevisiae ATCC 200589, which was selected through screening, was found to be the most suitable host for the production. On cultivation of the resultant transformant, in which the HMG-CoA reductase gene was overexpressed, in a 5-liter bench-scale jar fermenter for 7 d, the production of FOH, NOH, and GGOH reached 145.7, 98.8, and 2.46 mg/l, respectively.

  15. prtH2, Not prtH, Is the Ubiquitous Cell Wall Proteinase Gene in Lactobacillus helveticus▿

    PubMed Central

    Genay, M.; Sadat, L.; Gagnaire, V.; Lortal, S.

    2009-01-01

    Lactobacillus helveticus strains possess an efficient proteolytic system that releases peptides which are essential for lactobacillus growth in various fermented dairy products and also affect textural properties or biological activities. Cell envelope proteinases (CEPs) are bacterial enzymes that hydrolyze milk proteins. In the case of L. helveticus, two CEPs with low percentages of amino acid identity have been described, i.e., PrtH and PrtH2. However, the distribution of the genes that encode CEPs still remains unclear, rendering it difficult to further control the formation of particular peptides. This study evaluated the diversity of genes that encode CEPs in a collection of strains of L. helveticus isolated from various biotopes, both in terms of the presence or absence of these genes and in terms of nucleotide sequence, and studied their transcription in dairy matrices. After defining three sets of primers for both the prtH and prtH2 genes, we studied the distribution of the genes by using PCR and Southern blotting experiments. The prtH2 gene was ubiquitous in the 29 strains of L. helveticus studied, whereas only 18 of them also exhibited the prtH gene. Sequencing of a 350-bp internal fragment of these genes revealed the existence of intraspecific diversity. Finally, expression of these two CEP-encoding genes was followed during the growth in dairy matrices of two strains, ITG LH77 and CNRZ32, which possess one and two CEP-encoding genes, respectively. Both genes were shown to be expressed by L. helveticus at each stage of growth in milk and at different stages of mini-Swiss-type cheese making and ripening. PMID:19286786

  16. The Arabidopsis thaliana ortholog of a purported maize cholinesterase gene encodes a GDSL-lipase

    PubMed Central

    Muralidharan, Mrinalini; Buss, Kristina; Larrimore, Katherine E.; Segerson, Nicholas A.; Kannan, Latha

    2013-01-01

    Acetylcholinesterase is an enzyme that is intimately associated with regulation of synaptic transmission in the cholinergic nervous system and in neuromuscular junctions of animals. However the presence of cholinesterase activity has been described also in non-metazoan organisms such as slime molds, fungi and plants. More recently, a gene purportedly encoding for acetylcholinesterase was cloned from maize. We have cloned the Arabidopsis thaliana homolog of the Zea mays gene, At3g26430, and studied its biochemical properties. Our results indicate that the protein encoded by the gene exhibited lipase activity with preference to long chain substrates but did not hydrolyze choline esters. The At3g26430 protein belongs to the SGNH clan of serine hydrolases, and more specifically to the GDS(L) lipase family. PMID:23430565

  17. Genetic analysis reveals the identity of the photoreceptor for phototaxis in hormogonium filaments of Nostoc punctiforme.

    PubMed

    Campbell, Elsie L; Hagen, Kari D; Chen, Rui; Risser, Douglas D; Ferreira, Daniela P; Meeks, John C

    2015-02-15

    In cyanobacterial Nostoc species, substratum-dependent gliding motility is confined to specialized nongrowing filaments called hormogonia, which differentiate from vegetative filaments as part of a conditional life cycle and function as dispersal units. Here we confirm that Nostoc punctiforme hormogonia are positively phototactic to white light over a wide range of intensities. N. punctiforme contains two gene clusters (clusters 2 and 2i), each of which encodes modular cyanobacteriochrome-methyl-accepting chemotaxis proteins (MCPs) and other proteins that putatively constitute a basic chemotaxis-like signal transduction complex. Transcriptional analysis established that all genes in clusters 2 and 2i, plus two additional clusters (clusters 1 and 3) with genes encoding MCPs lacking cyanobacteriochrome sensory domains, are upregulated during the differentiation of hormogonia. Mutational analysis determined that only genes in cluster 2i are essential for positive phototaxis in N. punctiforme hormogonia; here these genes are designated ptx (for phototaxis) genes. The cluster is unusual in containing complete or partial duplicates of genes encoding proteins homologous to the well-described chemotaxis elements CheY, CheW, MCP, and CheA. The cyanobacteriochrome-MCP gene (ptxD) lacks transmembrane domains and has 7 potential binding sites for bilins. The transcriptional start site of the ptx genes does not resemble a sigma 70 consensus recognition sequence; moreover, it is upstream of two genes encoding gas vesicle proteins (gvpA and gvpC), which also are expressed only in the hormogonium filaments of N. punctiforme. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Identification of an Amino Acid Domain Encoded by the Capsid Protein Gene of Porcine Circovirus Type 2 that Modulates Viral Protein Distribution During Replication

    USDA-ARS?s Scientific Manuscript database

    Previous work showed that distinct amino acid motifs are encoded by the Rep, Cap and ORF3 genes of two subgroups of porcine circoviruses (PCV), PCV2a and PCV2b. At a specific location of the gene, a certain amino acid residue or sequence is preferred. Specifically, two amino acid domains located in ...

  19. Generation of α1,3-galactosyltransferase and cytidine monophospho-N-acetylneuraminic acid hydroxylase gene double-knockout pigs

    PubMed Central

    MIYAGAWA, Shuji; MATSUNARI, Hitomi; WATANABE, Masahito; NAKANO, Kazuaki; UMEYAMA, Kazuhiro; SAKAI, Rieko; TAKAYANAGI, Shuko; TAKEISHI, Toki; FUKUDA, Tooru; YASHIMA, Sayaka; MAEDA, Akira; EGUCHI, Hiroshi; OKUYAMA, Hiroomi; NAGAYA, Masaki; NAGASHIMA, Hiroshi

    2015-01-01

    Zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) are new tools for producing gene knockout (KO) animals. The current study reports produced genetically modified pigs, in which two endogenous genes were knocked out. Porcine fibroblast cell lines were derived from homozygous α1,3-galactosyltransferase (GalT) KO pigs. These cells were subjected to an additional KO for the cytidine monophospho-N-acetylneuraminic acid hydroxylase (CMAH) gene. A pair of ZFN-encoding mRNAs targeting exon 8 of the CMAH gene was used to generate the heterozygous CMAH KO cells, from which cloned pigs were produced by somatic cell nuclear transfer (SCNT). One of the cloned pigs obtained was re-cloned after additional KO of the remaining CMAH allele using the same ZFN-encoding mRNAs to generate GalT/CMAH-double homozygous KO pigs. On the other hand, the use of TALEN-encoding mRNAs targeting exon 7 of the CMAH gene resulted in efficient generation of homozygous CMAH KO cells. These cells were used for SCNT to produce cloned pigs homozygous for a double GalT/CMAH KO. These results demonstrate that the combination of TALEN-encoding mRNA, in vitro selection of the nuclear donor cells and SCNT provides a robust method for generating KO pigs. PMID:26227017

  20. Generation of α1,3-galactosyltransferase and cytidine monophospho-N-acetylneuraminic acid hydroxylase gene double-knockout pigs.

    PubMed

    Miyagawa, Shuji; Matsunari, Hitomi; Watanabe, Masahito; Nakano, Kazuaki; Umeyama, Kazuhiro; Sakai, Rieko; Takayanagi, Shuko; Takeishi, Toki; Fukuda, Tooru; Yashima, Sayaka; Maeda, Akira; Eguchi, Hiroshi; Okuyama, Hiroomi; Nagaya, Masaki; Nagashima, Hiroshi

    2015-01-01

    Zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) are new tools for producing gene knockout (KO) animals. The current study reports produced genetically modified pigs, in which two endogenous genes were knocked out. Porcine fibroblast cell lines were derived from homozygous α1,3-galactosyltransferase (GalT) KO pigs. These cells were subjected to an additional KO for the cytidine monophospho-N-acetylneuraminic acid hydroxylase (CMAH) gene. A pair of ZFN-encoding mRNAs targeting exon 8 of the CMAH gene was used to generate the heterozygous CMAH KO cells, from which cloned pigs were produced by somatic cell nuclear transfer (SCNT). One of the cloned pigs obtained was re-cloned after additional KO of the remaining CMAH allele using the same ZFN-encoding mRNAs to generate GalT/CMAH-double homozygous KO pigs. On the other hand, the use of TALEN-encoding mRNAs targeting exon 7 of the CMAH gene resulted in efficient generation of homozygous CMAH KO cells. These cells were used for SCNT to produce cloned pigs homozygous for a double GalT/CMAH KO. These results demonstrate that the combination of TALEN-encoding mRNA, in vitro selection of the nuclear donor cells and SCNT provides a robust method for generating KO pigs.

  1. Effect of sypQ gene on poly-N-acetylglucosamine biosynthesis in Vibrio parahaemolyticus and its role in infection process.

    PubMed

    Ye, Libin; Zheng, Xiaolin; Zheng, Hongjian

    2014-04-01

    The syp locus includes four genes encoding putative regulators, six genes encoding glycosyltransferases, two encoding export proteins, and six other genes encoding unidentified functional proteins associated with biofilm formation and symbiotic colonization. However, the individual functions of the respective genes remain unclear. Amino acid alignment indicates that sypQ is presumably involved in biosynthesizing poly-N-acetylglucosamine (PNAG), which is proposed to be a critical virulence factor in pathogen infection and is regarded as a target for protective immunity against a variety of Gram-negative/positive pathogens. However, no evidence showing that Vibrio parahaemolyticus also produces PNAG has been reported. Herein, the V. parahaemolyticus is confirmed to possess potential for producing PNAG for the first time. Our results indicated that gene sypQ is associated with PNAG biosynthesis and PNAG is involved in pathogen colonization. We propose that the function of pgaC in Escherichia coli could be taken over by sypQ from V. parahaemolyticus. We also tested whether PNAG can be used as a target against V. parahaemolyticus when it infects Pseudosciaena crocea. Our results showed that PNAG isolated from V. parahaemolyticus is an effective agent for decreasing V. parahaemolyticus invasion, implying that PNAG could be used to develop an effective vaccine against V. parahaemolyticus infection.

  2. Development of a polymerase chain reaction to distinguish monocellate cobra (Naja khouthia) bites from other common Thai snake species, using both venom extracts and bite-site swabs.

    PubMed

    Suntrarachun, S; Pakmanee, N; Tirawatnapong, T; Chanhome, L; Sitprija, V

    2001-07-01

    A PCR technique was used in this study to identify and distinguish monocellate cobra snake bites using snake venoms and swab specimens from snake bite-sites in mice from bites by other common Thai snakes. The sequences of nucleotide primers were selected for the cobrotoxin-encoding gene from the Chinese cobra (Naja atra) since the sequences of monocellate cobra (Naja kaouthia) venom are still unknown. However, the 113-bp fragment of cDNA of the cobrotoxin-encoding gene was detected in the monocellate cobra venom using RT-PCR. This gene was not found in the venoms of Ophiophagus hannah (king cobra), Bungarus fasciatus (banded krait), Daboia russelii siamensis (Siamese Russell's Viper, and Calloselasma rhodostoma (Malayan pit viper). Moreover, direct PCR could detect a 665-bp fragment of the cobrotoxin-encoding gene in the monocellate cobra venom but not the other snake venoms. Likewise, this gene was only observed in swab specimens from cobra snake bite-sites in mice. This is the first report demonstrating the ability of PCR to detect the cobrotoxin-encoding gene from snake venoms and swab specimens. Further studies are required for identification of this and other snakes from the bite-sites on human skin.

  3. Transposon mutagenesis and cloning analysis of the pathways for degradation of 2,4-dichlorophenoxyacetic acid and 3-chlorobenzoate in Alcaligenes eutrophus JMP134(pJP4).

    PubMed Central

    Don, R H; Weightman, A J; Knackmuss, H J; Timmis, K N

    1985-01-01

    Plasmid pJP4 permits its host bacterium, strain JMP134, to degrade and utilize as sole sources of carbon and energy 3-chlorobenzoate and 2,4-dichlorophenoxyacetic acid (R. H. Don and J. M. Pemberton, J. Bacteriol. 145:681-686, 1981). Mutagenesis of pJP4 by transposons Tn5 and Tn1771 enabled localization of five genes for enzymes involved in these catabolic pathways. Four of the genes, tfdB, tfdC, tfdD, and tfdE, encoded 2,4-dichlorophenol hydroxylase, dichlorocatechol 1,2-dioxygenase, chloromuconate cycloisomerase, and chlorodienelactone hydrolase, respectively. No function has been assigned to the fifth gene, tfdF, although it may encode a trans-chlorodiene-lactone isomerase. Inactivation of genes tfdC, tfdD, and tfdE, which encode the transformation of dichlorocatechol to chloromaleylacetic acid, prevented host strain JMP134 from degrading both 3-chlorobenzoate and 2,4-dichlorophenoxyacetic acid, which indicates that the pathways for these two substrates utilize common enzymes for the dissimilation of chlorocatechols. Studies with cloned catabolic genes from pJP4 indicated that whereas all essential steps in the degradation of 2,4-dichlorophenoxyacetic acid are plasmid encoded, the conversion of 3-chlorobenzoate to chlorocatechol is specified by chromosomal genes. PMID:2981813

  4. Parallel loss of nuclear-encoded mitochondrial aminoacyl-tRNA synthetases and mtDNA-encoded tRNAs in Cnidaria.

    PubMed

    Haen, Karri M; Pett, Walker; Lavrov, Dennis V

    2010-10-01

    Unlike most animal mitochondrial (mt) genomes, which encode a set of 22 transfer RNAs (tRNAs) sufficient for mt protein synthesis, those of cnidarians have only retained one or two tRNA genes. Whether the missing cnidarian mt-tRNA genes relocated outside the main mt chromosome or were lost remains unclear. It is also unknown what impact the loss of tRNA genes had on other components of the mt translational machinery. Here, we explored the nuclear genome of the cnidarian Nematostella vectensis for the presence of mt-tRNA genes and their corresponding mt aminoacyl-tRNA synthetases (mt-aaRS). We detected no candidates for mt-tRNA genes and only two mt-aaRS orthologs. At the same time, we found that all but one cytosolic aaRS appear to be targeted to mitochondria. These results indicate that the loss of mt-tRNAs in Cnidaria is genuine and occurred in parallel with the loss of nuclear-encoded mt-aaRS. Our phylogenetic analyses of individual aaRS revealed that although the nearly total loss of mt-aaRS is rare, aaRS gene deletion and replacement have occurred throughout the evolution of Metazoa.

  5. Expression and characterization of hyperthermostable exo-polygalacturonase RmGH28 from Rhodothermus marinus

    USDA-ARS?s Scientific Manuscript database

    The gene RmGH28 from the organism Rhodothermus marinus putatively encoding a glycosyl hydrolase family 28 polygalacturonase was expressed in E. coli, and the enzyme purified and biochemically characterized. The gene was found to encode an exo- polygalacturonase, with galacturonic acid monomer and th...

  6. Genome-wide comparative analysis of NBS-encoding genes in four Gossypium species

    USDA-ARS?s Scientific Manuscript database

    Nucleotide binding site (NBS) genes encode a large family of disease resistance (R) proteins in plants. The availability of genomic data of the two diploid cotton species, Gossypium arboreum and Gossypium raimondii, and the two allotetraploid cotton species, Gossypium hirsutum (TM-1) and Gossypium ...

  7. The pine Pschi4 promoter directs wound-induced transcription

    Treesearch

    Haiguo Wu; Charles H. Michler; Liborio LaRussa; John M. Davis

    1999-01-01

    Mechanical wounding stimulates the accumulation of Pschi4 transcripts (encoding a putative extracellular chitinase) in pine trees. To gain insight into the transcriptional regulatory region(s) in this gymnosperm defense gene, the 5'-flanking region of Pschi4 was fused to the uidA reporter gene encoding -...

  8. Distinct Pathways Mediate the Sorting of Tail-anchored Mitochondrial Outer Membrane Proteins

    USDA-ARS?s Scientific Manuscript database

    Little is known about the biogenesis of tail-anchored (TA) proteins localized to the mitochondrial outer membrane in plant cells. To address this issue, we screened all of the (>500) known and predicted TA proteins in Arabidopsis for those annotated, based on Gene Ontology, to possess mitochondrial...

  9. Amino acid substitutions in the VanS sensor of the VanA-type vancomycin-resistant Enterococcus strains result in high-level vancomycin resistance and low-level teicoplanin resistance.

    PubMed

    Hashimoto, Y; Tanimoto, K; Ozawa, Y; Murata, T; Ike, Y

    2000-04-15

    The vancomycin-resistant enterococci GV1, GV2 and GV3, which were isolated from droppings from broiler farms in Japan have been characterized as VanA-type VRE, which express high-level vancomycin resistance (256 or 512 microg ml(-1), MIC) and low-level teicoplanin resistance (1 or 2 microg ml(-1), MIC). The vancomycin resistances were encoded on plasmids. The vancomycin resistance conjugative plasmid pMG2 was isolated from the GV2 strain. The VanA determinant of pMG2 showed the same genetic organization as that of the VanA genes encoded on the representative transposon Tn1546, which comprises vanRSHAXYZ. The nucleotide sequences of all the genes, except the gene related to the vanS gene on Tn1546, were completely identical to the genes encoded on Tn1546. Three amino acid substitutions in the N-terminal region of the deduced VanS were detected in the nucleotide sequence of vanS encoded on pMG2. There were also three amino acid substitutions in the vanS gene of the GV1 and GV3 strains in the same positions as in the vanS gene of pMG2. Vancomycin induced the increased teicoplanin resistance in these strains.

  10. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    PubMed

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  11. Molecular characterization and analysis of the acrB gene of Aspergillus nidulans: a gene identified by genetic interaction as a component of the regulatory network that includes the CreB deubiquitination enzyme.

    PubMed Central

    Boase, Natasha A; Lockington, Robin A; Adams, Julian R J; Rodbourn, Louise; Kelly, Joan M

    2003-01-01

    Mutations in the acrB gene, which were originally selected through their resistance to acriflavine, also result in reduced growth on a range of sole carbon sources, including fructose, cellobiose, raffinose, and starch, and reduced utilization of omega-amino acids, including GABA and beta-alanine, as sole carbon and nitrogen sources. The acrB2 mutation suppresses the phenotypic effects of mutations in the creB gene that encodes a regulatory deubiquitinating enzyme, and in the creC gene that encodes a WD40-repeat-containing protein. Thus AcrB interacts with a regulatory network controlling carbon source utilization that involves ubiquitination and deubiquitination. The acrB gene was cloned and physically analyzed, and it encodes a novel protein that contains three putative transmembrane domains and a coiled-coil region. AcrB may play a role in the ubiquitination aspect of this regulatory network. PMID:12750323

  12. Cloning and characterization of the nagA gene that encodes beta-n-acetylglucosaminidase from Aspergillus nidulans and its expression in Aspergillus oryzae.

    PubMed

    Kim, Sunhwa; Matsuo, Ichiro; Ajisaka, Katsumi; Nakajima, Harushi; Kitamoto, Katsuhiko

    2002-10-01

    We isolated a beta-N-acetylglucosaminidase encoding gene and its cDNA from the filamentous fungus Aspergillus nidulans, and designated it nagA. The nagA gene contained no intron and encoded a polypeptide of 603 amino acids with a putative 19-amino acid signal sequence. The deduced amino acid sequence was very similar to the sequence of Candida albicans Hex1 and Trichoderma harzianum Nag1. Yeast cells containing the nagA cDNA under the control of the GAL1 promoter expressed beta-N-acetylglucosaminidase activity. The chromosomal nagA gene of A. nidulans was disrupted by replacement with the argB marker gene. The disruptant strains expressed low levels of beta-N-acetylglucosaminidase activity and showed poor growth on a medium containing chitobiose as a carbon source. Aspergillus oryzae strain carrying the nagA gene under the control of the improved glaA promoter produced large amounts of beta-N-acetylglucosaminidase in a wheat bran solid culture.

  13. Cloning and heterologous expression of the antibiotic peptide (ABP) genes from Rhizopus oligosporus NBRC 8631.

    PubMed

    Yamada, Osamu; Sakamoto, Kazutoshi; Tominaga, Mihoko; Nakayama, Tasuku; Koseki, Takuya; Fujita, Akiko; Akita, Osamu

    2005-03-01

    We carried out protein sequencing of purified Antibiotic Peptide (ABP), and cloned two genes encoding this peptide as abp1 and abp2, from Rhizopus oligosporus NBRC 8631. Both genes contain an almost identical 231-bp segment, with only 3 nucleotide substitutions, encoding a 77 amino acid peptide. The abp gene product comprises a 28 amino acid signal sequence and a 49 amino acid mature peptide. Northern blot analysis showed that at least one of the abp genes is transcribed in R. oligosporus NBRC 8631. A truncated form of abp1 encoding only the mature peptide was fused with the alpha-factor signal peptide and engineered for expression in Pichia pastoris SMD1168H. Culture broth of the recombinant Pichia displayed ABP activity against Bacillus subtilis NBRC 3335 after induction of heterologous gene expression. This result indicates that mature ABP formed the active structure without the aid of other factors from R. oligosporus, and was secreted.

  14. Capturing novel mouse genes encoding chromosomal and other nuclear proteins.

    PubMed

    Tate, P; Lee, M; Tweedie, S; Skarnes, W C; Bickmore, W A

    1998-09-01

    The burgeoning wealth of gene sequences contrasts with our ignorance of gene function. One route to assigning function is by determining the sub-cellular location of proteins. We describe the identification of mouse genes encoding proteins that are confined to nuclear compartments by splicing endogeneous gene sequences to a promoterless betageo reporter, using a gene trap approach. Mouse ES (embryonic stem) cell lines were identified that express betageo fusions located within sub-nuclear compartments, including chromosomes, the nucleolus and foci containing splicing factors. The sequences of 11 trapped genes were ascertained, and characterisation of endogenous protein distribution in two cases confirmed the validity of the approach. Three novel proteins concentrated within distinct chromosomal domains were identified, one of which appears to be a serine/threonine kinase. The sequence of a gene whose product co-localises with splicesome components suggests that this protein may be an E3 ubiquitin-protein ligase. The majority of the other genes isolated represent novel genes. This approach is shown to be a powerful tool for identifying genes encoding novel proteins with specific sub-nuclear localisations and exposes our ignorance of the protein composition of the nucleus. Motifs in two of the isolated genes suggest new links between cellular regulatory mechanisms (ubiquitination and phosphorylation) and mRNA splicing and chromosome structure/function.

  15. Many nonuniversal archaeal ribosomal proteins are found in conserved gene clusters

    PubMed Central

    WANG, JIACHEN; DASGUPTA, INDRANI; FOX, GEORGE E.

    2009-01-01

    The genomic associations of the archaeal ribosomal proteins, (r-proteins), were examined in detail. The archaeal versions of the universal r-protein genes are typically in clusters similar or identical and to those found in bacteria. Of the 35 nonuniversal archaeal r-protein genes examined, the gene encoding L18e was found to be associated with the conserved L13 cluster, whereas the genes for S4e, L32e and L19e were found in the archaeal version of the spc operon. Eleven nonuniversal protein genes were not associated with any common genomic context. Of the remaining 19 protein genes, 17 were convincingly assigned to one of 10 previously unrecognized gene clusters. Examination of the gene content of these clusters revealed multiple associations with genes involved in the initiation of protein synthesis, transcription or other cellular processes. The lack of such associations in the universal clusters suggests that initially the ribosome evolved largely independently of other processes. More recently it likely has evolved in concert with other cellular systems. It was also verified that a second copy of the gene encoding L7ae found in some bacteria is actually a homolog of the gene encoding L30e and should be annotated as such. PMID:19478915

  16. Self-calibrated correlation imaging with k-space variant correlation functions.

    PubMed

    Li, Yu; Edalati, Masoud; Du, Xingfu; Wang, Hui; Cao, Jie J

    2018-03-01

    Correlation imaging is a previously developed high-speed MRI framework that converts parallel imaging reconstruction into the estimate of correlation functions. The presented work aims to demonstrate this framework can provide a speed gain over parallel imaging by estimating k-space variant correlation functions. Because of Fourier encoding with gradients, outer k-space data contain higher spatial-frequency image components arising primarily from tissue boundaries. As a result of tissue-boundary sparsity in the human anatomy, neighboring k-space data correlation varies from the central to the outer k-space. By estimating k-space variant correlation functions with an iterative self-calibration method, correlation imaging can benefit from neighboring k-space data correlation associated with both coil sensitivity encoding and tissue-boundary sparsity, thereby providing a speed gain over parallel imaging that relies only on coil sensitivity encoding. This new approach is investigated in brain imaging and free-breathing neonatal cardiac imaging. Correlation imaging performs better than existing parallel imaging techniques in simulated brain imaging acceleration experiments. The higher speed enables real-time data acquisition for neonatal cardiac imaging in which physiological motion is fast and non-periodic. With k-space variant correlation functions, correlation imaging gives a higher speed than parallel imaging and offers the potential to image physiological motion in real-time. Magn Reson Med 79:1483-1494, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

  17. Carbonic anhydrase 2-like in the giant clam, Tridacna squamosa: characterization, localization, response to light, and possible role in the transport of inorganic carbon from the host to its symbionts.

    PubMed

    Ip, Yuen K; Koh, Clarissa Z Y; Hiong, Kum C; Choo, Celine Y L; Boo, Mel V; Wong, Wai P; Neo, Mei L; Chew, Shit F

    2017-12-01

    The fluted giant clam, Tridacna squamosa , lives in symbiosis with zooxanthellae which reside extracellularly inside a tubular system. Zooxanthellae fix inorganic carbon (C i ) during insolation and donate photosynthate to the host. Carbonic anhydrases catalyze the interconversion of CO 2 and HCO3-, of which carbonic anhydrase 2 (CA2) is the most ubiquitous and involved in many biological processes. This study aimed to clone a CA2 homolog ( CA2-like ) from the fleshy and colorful outer mantle as well as the thin and whitish inner mantle of T. squamosa , to determine its cellular and subcellular localization, and to examine the effects of light exposure on its gene and protein expression levels. The cDNA coding sequence of CA2-like from T. squamosa comprised 789 bp, encoding 263 amino acids with an estimated molecular mass of 29.6 kDa. A phenogramic analysis of the deduced CA2-like sequence denoted an animal origin. CA2-like was not detectable in the shell-facing epithelium of the inner mantle adjacent to the extrapallial fluid. Hence, CA2-like is unlikely to participate directly in light-enhanced calcification. By contrast, the outer mantle, which contains the highest density of tertiary tubules and zooxanthellae, displayed high level of CA2-like expression, and CA2-like was localized to the tubule epithelial cells. More importantly, exposure to light induced significant increases in the protein abundance of CA2-like in the outer mantle. Hence, CA2-like could probably take part in the increased supply of inorganic carbon (C i ) from the host clam to the symbiotic zooxanthellae when the latter conduct photosynthesis to fix C i during light exposure. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  18. Reversible synthesis of colanic acid and O-antigen polysaccharides in Salmonella Typhimurium enhances induction of cross-immune responses and provides protection against heterologous Salmonella challenge.

    PubMed

    Li, Pei; Liu, Qing; Huang, Chun; Zhao, Xinxin; Roland, Kenneth L; Kong, Qingke

    2017-05-15

    Colanic Acid (CA) and lipopolysaccharide (LPS) are two major mannose-containing extracellular polysaccharides of Salmonella. Their presence on the bacterial surface can mask conserved protective outer membrane proteins (OMPs) from the host immune system. The mannose moiety in these molecules is derived from GDP-mannose, which is synthesized in several steps. The first two steps require the action of phosphomannose isomerase, encoded by pmi (manA), followed by phosphomannomutase, encoded by manB. There are two copies of manB present in the Salmonella chromosome, one located in the cps gene cluster (cpsG) responsible for CA synthesis, and the other in the rfb gene cluster (rfbK) involved in LPS O-antigen synthesis. In this study, it was demonstrated that the products of cpsG and rfbK are isozymes. To evaluate the impact of these genes on O-antigen synthesis, virulence and immunogenicity, single mutations (Δpmi, ΔrfbK or ΔcpsG) and a double mutation (ΔrfbK ΔcpsG) were introduced into both wild-type Salmonella enterica and an attenuated Δcya Δcrp vaccine strain. The Δpmi, ΔrfbK and ΔcpsG ΔrfbK mutants were defective in LPS synthesis and attenuated for virulence. In orally inoculated mice, strain S122 (Δcrp Δcya ΔcpsG ΔrfbK) and its parent S738 (Δcrp Δcya) were both avirulent and colonized internal tissues. Strain S122 elicited higher levels of anti-S. Typhimurium OMP serum IgG than its parent strain. Mice immunized with S122 were completely protected against challenge with wild-type virulent S. Typhimurium and partially protected against challenge with either wild-type virulent S. Choleraesuis or S. Enteritidis. These data indicate that deletions in rfbK and cpsG are useful mutations for inclusion in future attenuated Salmonella vaccine strains to induce cross-protective immunity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Identification of candidate transmission-blocking antigen genes in Theileria annulata and related vector-borne apicomplexan parasites.

    PubMed

    Lempereur, Laetitia; Larcombe, Stephen D; Durrani, Zeeshan; Karagenc, Tulin; Bilgic, Huseyin Bilgin; Bakirci, Serkan; Hacilarlioglu, Selin; Kinnaird, Jane; Thompson, Joanne; Weir, William; Shiels, Brian

    2017-06-05

    Vector-borne apicomplexan parasites are a major cause of mortality and morbidity to humans and livestock globally. The most important disease syndromes caused by these parasites are malaria, babesiosis and theileriosis. Strategies for control often target parasite stages in the mammalian host that cause disease, but this can result in reservoir infections that promote pathogen transmission and generate economic loss. Optimal control strategies should protect against clinical disease, block transmission and be applicable across related genera of parasites. We have used bioinformatics and transcriptomics to screen for transmission-blocking candidate antigens in the tick-borne apicomplexan parasite, Theileria annulata. A number of candidate antigen genes were identified which encoded amino acid domains that are conserved across vector-borne Apicomplexa (Babesia, Plasmodium and Theileria), including the Pfs48/45 6-cys domain and a novel cysteine-rich domain. Expression profiling confirmed that selected candidate genes are expressed by life cycle stages within infected ticks. Additionally, putative B cell epitopes were identified in the T. annulata gene sequences encoding the 6-cys and cysteine rich domains, in a gene encoding a putative papain-family cysteine peptidase, with similarity to the Plasmodium SERA family, and the gene encoding the T. annulata major merozoite/piroplasm surface antigen, Tams1. Candidate genes were identified that encode proteins with similarity to known transmission blocking candidates in related parasites, while one is a novel candidate conserved across vector-borne apicomplexans and has a potential role in the sexual phase of the life cycle. The results indicate that a 'One Health' approach could be utilised to develop a transmission-blocking strategy effective against vector-borne apicomplexan parasites of animals and humans.

  20. Identification of β-propeller phytase-encoding genes in culturable Paenibacillus and Bacillus spp. from the rhizosphere of pasture plants on volcanic soils.

    PubMed

    Jorquera, Milko A; Crowley, David E; Marschner, Petra; Greiner, Ralf; Fernández, María Teresa; Romero, Daniela; Menezes-Blackburn, Daniel; De La Luz Mora, María

    2011-01-01

    Phytate is one of the most abundant sources of organic phosphorus (P) in soils, but must be mineralized by phytase-producing bacteria to release P for plant uptake. Microbial inoculants based on Bacillus spp. have been developed commercially, but few studies have evaluated the ecology of these bacteria in the rhizosphere or the types of enzymes that they produce. Here, we studied the diversity of aerobic endospore-forming bacteria (EFB) with the ability to mineralize phytate in the rhizosphere of pasture plants grown in volcanic soils of southern Chile. PCR methods were used to detect candidate phytase-encoding genes and to identify EFB bacteria that carry these genes. This study revealed that the phytate-degrading EFB populations of pasture plants included species of Paenibacillus and Bacillus, which carried genes encoding β-propeller phytase (BPP). Assays of enzymatic activity confirmed the ability of these rhizosphere isolates to degrade phytate. The phytase-encoding genes described here may prove valuable as molecular markers to evaluate the role of EFB in organic P mobilization in the rhizosphere. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Top