Andrographolide induces degradation of mutant p53 via activation of Hsp70.

PubMed

Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

2018-05-22

The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less

A novel P53/POMC/Gαs/SASH1 autoregulatory feedback loop activates mutated SASH1 to cause pathologic hyperpigmentation.

PubMed

Zhou, Ding'an; Wei, Zhiyun; Kuang, Zhongshu; Luo, Huangchao; Ma, Jiangshu; Zeng, Xing; Wang, Ke; Liu, Beizhong; Gong, Fang; Wang, Jing; Lei, Shanchuan; Wang, Dongsheng; Zeng, Jiawei; Wang, Teng; He, Yong; Yuan, Yongqiang; Dai, Hongying; He, Lin; Xing, Qinghe

2017-04-01

p53-Transcriptional-regulated proteins interact with a large number of other signal transduction pathways in the cell, and a number of positive and negative autoregulatory feedback loops act upon the p53 response. P53 directly controls the POMC/α-MSH productions induced by ultraviolet (UV) and is associated with UV-independent pathological pigmentation. When identifying the causative gene of dyschromatosis universalis hereditaria (DUH), we found three mutations encoding amino acid substitutions in the gene SAM and SH3 domain containing 1 (SASH1), and SASH1 was associated with guanine nucleotide-binding protein subunit-alpha isoforms short (Gαs). However, the pathological gene and pathological mechanism of DUH remain unknown for about 90 years. We demonstrate that SASH1 is physiologically induced by p53 upon UV stimulation and SASH and p53 is reciprocally induced at physiological and pathophysiological conditions. SASH1 is regulated by a novel p53/POMC/α-MSH/Gαs/SASH1 cascade to mediate melanogenesis. A novel p53/POMC/Gαs/SASH1 autoregulatory positive feedback loop is regulated by SASH1 mutations to induce pathological hyperpigmentation phenotype. Our study demonstrates that a novel p53/POMC/Gαs/SASH1 autoregulatory positive feedback loop is regulated by SASH1 mutations to induce pathological hyperpigmentation phenotype. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Distinct downstream targets manifest p53-dependent pathologies in mice.

PubMed

Pant, V; Xiong, S; Chau, G; Tsai, K; Shetty, G; Lozano, G

2016-11-03

Mdm2, the principal negative regulator of p53, is critical for survival, a fact clearly demonstrated by the p53-dependent death of germline or conditional mice following deletion of Mdm2. On the other hand, Mdm2 hypomorphic (Mdm2 Puro/Δ7-12 ) or heterozygous (Mdm2 +/- ) mice that express either 30 or 50% of normal Mdm2 levels, respectively, are viable but present distinct phenotypes because of increased p53 activity. Mdm2 levels are also transcriptionally regulated by p53. We evaluated the significance of this reciprocal relationship in a new hypomorphic mouse model inheriting an aberrant Mdm2 allele with insertion of the neomycin cassette and deletion of 184-bp sequence in intron 3. These mice also carry mutations in the Mdm2 P2-promoter and thus express suboptimal levels of Mdm2 entirely encoded from the P1-promoter. Resulting mice exhibit abnormalities in skin pigmentation and reproductive tissue architecture, and are subfertile. Notably, all these phenotypes are rescued on a p53-null background. Furthermore, these phenotypes depend on distinct p53 downstream activities as genetic ablation of the pro-apoptotic gene Puma reverts the reproductive abnormalities but not skin hyperpigmentation, whereas deletion of cell cycle arrest gene p21 does not rescue either phenotype. Moreover, p53-mediated upregulation of Kitl influences skin pigmentation. Altogether, these data emphasize tissue-specific p53 activities that regulate cell fate.

CrpP Is a Novel Ciprofloxacin-Modifying Enzyme Encoded by the Pseudomonas aeruginosa pUM505 Plasmid.

PubMed

Chávez-Jacobo, Víctor M; Hernández-Ramírez, Karen C; Romo-Rodríguez, Pamela; Pérez-Gallardo, Rocío Viridiana; Campos-García, Jesús; Gutiérrez-Corona, J Félix; García-Merinos, Juan Pablo; Meza-Carmen, Víctor; Silva-Sánchez, Jesús; Ramírez-Díaz, Martha I

2018-06-01

The pUM505 plasmid, isolated from a clinical Pseudomonas aeruginosa isolate, confers resistance to ciprofloxacin (CIP) when transferred into the standard P. aeruginosa strain PAO1. CIP is an antibiotic of the quinolone family that is used to treat P. aeruginosa infections. In silico analysis, performed to identify CIP resistance genes, revealed that the 65-amino-acid product encoded by the orf131 gene in pUM505 displays 40% amino acid identity to the Mycobacterium smegmatis aminoglycoside phosphotransferase (an enzyme that phosphorylates and inactivates aminoglycoside antibiotics). We cloned orf131 (renamed crpP , for c iprofloxacin r esistance p rotein, p lasmid encoded) into the pUCP20 shuttle vector. The resulting recombinant plasmid, pUC- crpP , conferred resistance to CIP on Escherichia coli strain J53-3, suggesting that this gene encodes a protein involved in CIP resistance. Using coupled enzymatic analysis, we determined that the activity of CrpP on CIP is ATP dependent, while little activity against norfloxacin was detected, suggesting that CIP may undergo phosphorylation. Using a recombinant His-tagged CrpP protein and liquid chromatography-tandem mass spectrometry, we also showed that CIP was phosphorylated prior to its degradation. Thus, our findings demonstrate that CrpP, encoded on the pUM505 plasmid, represents a new mechanism of CIP resistance in P. aeruginosa , which involves phosphorylation of the antibiotic. Copyright © 2018 American Society for Microbiology.

Chaperone-mediated autophagy degrades mutant p53

PubMed Central

Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

2013-01-01

Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

S-Nitrosylation of parkin as a novel regulator of p53-mediated neuronal cell death in sporadic Parkinson’s disease

PubMed Central

2013-01-01

Background Mutations in the gene encoding parkin, a neuroprotective protein with dual functions as an E3 ubiquitin ligase and transcriptional repressor of p53, are linked to familial forms of Parkinson’s disease (PD). We hypothesized that oxidative posttranslational modification of parkin by environmental toxins may contribute to sporadic PD. Results We first demonstrated that S-nitrosylation of parkin decreased its activity as a repressor of p53 gene expression, leading to upregulation of p53. Chromatin immunoprecipitation as well as gel-shift assays showed that parkin bound to the p53 promoter, and this binding was inhibited by S-nitrosylation of parkin. Additionally, nitrosative stress induced apoptosis in cells expressing parkin, and this death was, at least in part, dependent upon p53. In primary mesencephalic cultures, pesticide-induced apoptosis was prevented by inhibition of nitric oxide synthase (NOS). In a mouse model of pesticide-induced PD, both S-nitrosylated (SNO-)parkin and p53 protein levels were increased, while administration of a NOS inhibitor mitigated neuronal death in these mice. Moreover, the levels of SNO-parkin and p53 were simultaneously elevated in postmortem human PD brain compared to controls. Conclusions Taken together, our data indicate that S-nitrosylation of parkin, leading to p53-mediated neuronal cell death, contributes to the pathophysiology of sporadic PD. PMID:23985028

A comparative intracellular proteomic profiling of Pseudomonas aeruginosa strain ASP-53 grown on pyrene or glucose as sole source of carbon and identification of some key enzymes of pyrene biodegradation pathway.

PubMed

Mukherjee, Ashis K; Bhagowati, Pabitra; Biswa, Bhim Bahadur; Chanda, Abhishek; Kalita, Bhargab

2017-09-07

Pseudomonas aeruginosa strain ASP-53, isolated from a petroleum oil-contaminated soil sample, was found to be an efficient degrader of pyrene. PCR amplification of selected hydrocarbon catabolic genes (alkB gene, which encodes for monooxygenase, and the C12O, C23O, and PAH-RHDα genes encoding for the dioxygenase enzyme) from the genomic DNA of P. aeruginosa strain ASP-53 suggested its hydrocarbon degradation potential. The GC-MS analysis demonstrated 30.1% pyrene degradation by P. aeruginosa strain ASP-53 after 144h of incubation at pH6.5, 37°C. Expressions of 115 and 196 intracellular proteins were unambiguously identified and quantitated by shotgun proteomics analysis when the isolate was grown in medium containing pyrene and glucose, respectively. The pyrene-induced uniquely expressed and up-regulated proteins in P. aeruginosa strain ASP-53 in addition to substrate (pyrene) metabolism are also likely to be associated with different cellular functions for example-related to protein folding (molecular chaperone), stress response, metabolism of carbohydrate, proteins and amino acids, and fatty acids; transport of metabolites, energy generation such as ATP synthesis, electron transport and nitrate assimilation, and other oxidation-reduction reactions. Proteomic analyses identified some important enzymes involved in pyrene degradation by P. aeruginosa ASP-53 which shows that this bacterium follows the salicylate pathway of pyrene degradation. This study is the first report on proteomic analysis of pyrene biodegradation pathway by Pseudomonas aeruginosa, isolated from a petroleum-oil contaminated soil sample. The pathway displays partial similarity with deduced pyrene degradation mechanisms of Mycobacterium vanbaalenii PYR-1. The GC-MS analysis as well as PCR amplification of hydrocarbon catabolic genes substantiated the potency of the bacterium under study to effectively degrade high molecular weight, toxic PAH such as pyrene for its filed scale bioremediation experiments. The proteomics approach (LC-MS/MS analysis) identified the differentially regulated intracellular proteins of the isolate P. aeruginosa ASP-53 when grown in pyrene medium. This study identified some important pyrene biodegradation enzymes in Pseudomonas aeruginosa ASP-53 and highlights that the bacterium follows salicylate pathway for pyrene degradation. Copyright © 2017 Elsevier B.V. All rights reserved.

Retroperitoneal dedifferentiated liposarcoma lacking MDM2 amplification in a patient with a germ line CHEK2 mutation.

PubMed

Sadri, Navid; Surrey, Lea F; Fraker, Douglas L; Zhang, Paul J

2014-04-01

Germ line mutations in genes that encode proteins involved in the DNA damage response predispose patients to a variety of tumors. Checkpoint kinase 2, encoded by the CHEK2 gene, is important in transducing the DNA damage response. Germ line CHEK2 mutations are seen in a subset of patients with a familial breast cancer and sarcoma phenotype. We report a case of retroperitoneal dedifferentiated liposarcoma in a 61-year-old female with germ line CHEK2 mutation. MDM2 gene amplification normally present and used to aid in the diagnosis of retroperitoneal dedifferentiated liposarcoma was absent in this case. Lack of MDM2 overexpression has similarly been reported in liposarcomas arising in patients with germ line TP53 mutations. We propose this case may highlight a nonamplified MDM2 phenotype in well- and dedifferentiated liposarcomas arising in patients with germ line mutations of genes involved in p53-associated DNA damage response pathways.

The Human ARF Cell Cycle Regulatory Gene Promoter Is a CpG Island Which Can Be Silenced by DNA Methylation and Down-Regulated by Wild-Type p53

PubMed Central

Robertson, Keith D.; Jones, Peter A.

1998-01-01

The INK4a/ARF locus encodes two proteins involved in tumor suppression in a manner virtually unique in mammalian cells. Distinct first exons, driven from separate promoters, splice onto a common exon 2 and 3 but utilize different reading frames to produce two completely distinct proteins, both of which play roles in cell cycle control. INK4a, a critical element of the retinoblastoma gene pathway, binds to and inhibits the activities of CDK4 and CDK6, while ARF, a critical element of the p53 pathway, increases the level of functional p53 via interaction with MDM2. Here we clone and characterize the promoter of the human ARF gene and show that it is a CpG island characteristic of a housekeeping gene which contains numerous Sp1 sites. Both ARF and INK4a are coordinately expressed in cells except when their promoter regions become de novo methylated. In one of these situations, ARF transcription could be reactivated by treatment with the DNA methylation inhibitor 5-aza-2′-deoxycytidine, and the reactivation kinetics of ARF and INK4a were found to differ slightly in a cell line in which both genes were silenced by methylation. The ARF promoter was also found to be highly responsive to E2F1 expression, in keeping with previous results at the RNA level. Lastly, transcription from the ARF promoter was down-regulated by wild-type p53 expression, and the magnitude of the effect correlated with the status of the endogenous p53 gene. This finding points to the existence of an autoregulatory feedback loop between p53, MDM2, and ARF, aimed at keeping p53 levels in check. PMID:9774662

Genus Beta Human Papillomavirus E6 Proteins Vary in Their Effects on the Transactivation of p53 Target Genes

PubMed Central

White, Elizabeth A.; Walther, Johanna; Javanbakht, Hassan

2014-01-01

ABSTRACT The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. IMPORTANCE This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the potential connection between some beta HPVs and cancer. PMID:24850740

Molecular Diversity of Plasmids Bearing Genes That Encode Toluene and Xylene Metabolism in Pseudomonas Strains Isolated from Different Contaminated Sites in Belarus

PubMed Central

Sentchilo, Vladimir S.; Perebituk, Alexander N.; Zehnder, Alexander J. B.; van der Meer, Jan Roelof

2000-01-01

Twenty different Pseudomonas strains utilizing m-toluate were isolated from oil-contaminated soil samples near Minsk, Belarus. Seventeen of these isolates carried plasmids ranging in size from 78 to about 200 kb (assigned pSVS plasmids) and encoding the meta cleavage pathway for toluene metabolism. Most plasmids were conjugative but of unknown incompatibility groups, except for one, which belonged to the IncP9 group. The organization of the genes for toluene catabolism was determined by restriction analysis and hybridization with xyl gene probes of pWW0. The majority of the plasmids carried xyl-type genes highly homologous to those of pWW53 and organized in a similar manner (M. T. Gallegos, P. A. Williams, and J. L. Ramos, J. Bacteriol. 179:5024–5029, 1997), with two distinguishable meta pathway operons, one upper pathway operon, and three xylS-homologous regions. All of these plasmids also possessed large areas of homologous DNA outside the catabolic genes, suggesting a common ancestry. Two other pSVS plasmids carried only one meta pathway operon, one upper pathway operon, and one copy each of xylS and xylR. The backbones of these two plasmids differed greatly from those of the others. Whereas these parts of the plasmids, carrying the xyl genes, were mostly conserved between plasmids of each group, the noncatabolic parts had undergone intensive DNA rearrangements. DNA sequencing of specific regions near and within the xylTE and xylA genes of the pSVS plasmids confirmed the strong homologies to the xyl genes of pWW53 and pWW0. However, several recombinations were discovered within the upper pathway operons of the pSVS plasmids and pWW0. The main genetic mechanisms which are thought to have resulted in the present-day configuration of the xyl operons are discussed in light of the diversity analysis carried out on the pSVS plasmids. PMID:10877777

Effect of age on the sensitivity of the rat thyroid gland to ionizing radiation

PubMed Central

Matsuu-Matsuyama, Mutsumi; Shichijo, Kazuko; Okaichi, Kumio; Kurashige, Tomomi; Kondo, Hisayoshi; Miura, Shiro; Nakashima, Masahiro

2015-01-01

Exposure to ionizing radiation during childhood is a well-known risk factor for thyroid cancer. Our study evaluated the effect of age on the radiosensitivity of rat thyroid glands. Four-week-old (4W), 7 -week-old (7W), and 8-month-old (8M) male Wistar rats were exposed to 8 Gy of whole-body X-ray irradiation. Thyroids were removed 3–72 h after irradiation, and non-irradiated thyroids served as controls. Ki67-positivity and p53 binding protein 1 (53BP1) focus formation (a DNA damage response) were evaluated via immunohistochemistry. Amounts of proteins involved in DNA damage response (p53, p53 phosphorylated at serine 15, p21), apoptosis (cleaved caspase-3), and autophagy (LC3, p62) were determined via western blotting. mRNA levels of 84 key autophagy-related genes were quantified using polymerase chain reaction arrays. Ki67-positive cells in 4W (with high proliferative activity) and 7W thyroids significantly decreased in number post-irradiation. The number of 53BP1 foci and amount of p53 phosphorylated at serine 15 increased 3 h after irradiation, regardless of age. No increase in apoptosis or in the levels of p53, p21 or cleaved caspase-3 was detected for any ages. Levels of LC3-II and p62 increased in irradiated 4W but not 8M thyroids, whereas expression of several autophagy-related genes was higher in 4W than 8M irradiated thyroids. Irradiation increased the expression of genes encoding pro-apoptotic proteins in both 4W and 8M thyroids. In summary, no apoptosis or p53 accumulation was noted, despite the expression of some pro-apoptotic genes in immature and adult thyroids. Irradiation induced autophagy in immature, but not in adult, rat thyroids. PMID:25691451

Dissecting the transcriptional phenotype of ribosomal protein deficiency: implications for Diamond-Blackfan Anemia

PubMed Central

Aspesi, Anna; Pavesi, Elisa; Robotti, Elisa; Crescitelli, Rossella; Boria, Ilenia; Avondo, Federica; Moniz, Hélène; Da Costa, Lydie; Mohandas, Narla; Roncaglia, Paola; Ramenghi, Ugo; Ronchi, Antonella; Gustincich, Stefano; Merlin, Simone; Marengo, Emilio; Ellis, Steven R.; Follenzi, Antonia; Santoro, Claudio; Dianzani, Irma

2014-01-01

Defects in genes encoding ribosomal proteins cause Diamond Blackfan Anemia (DBA), a red cell aplasia often associated with physical abnormalities. Other bone marrow failure syndromes have been attributed to defects in ribosomal components but the link between erythropoiesis and the ribosome remains to be fully defined. Several lines of evidence suggest that defects in ribosome synthesis lead to “ribosomal stress” with p53 activation and either cell cycle arrest or induction of apoptosis. Pathways independent of p53 have also been proposed to play a role in DBA pathogenesis. We took an unbiased approach to identify p53-independent pathways activated by defects in ribosome synthesis by analyzing global gene expression in various cellular models of DBA. Ranking-Principal Component Analysis (Ranking-PCA) was applied to the identified datasets to determine whether there are common sets of genes whose expression is altered in these different cellular models. We observed consistent changes in the expression of genes involved in cellular amino acid metabolic process, negative regulation of cell proliferation and cell redox homeostasis. These data indicate that cells respond to defects in ribosome synthesis by changing the level of expression of a limited subset of genes involved in critical cellular processes. Moreover, our data support a role for p53-independent pathways in the pathophysiology of DBA. PMID:24835311

Modeling gene-environment interactions in oral cavity and esophageal cancers demonstrates a role for the p53 R72P polymorphism in modulating susceptibility.

PubMed

Sarkar, Jayanta; Dominguez, Emily; Li, Guojun; Kusewitt, Donna F; Johnson, David G

2014-08-01

A large number of epidemiological studies have linked a common single-nucleotide polymorphism (SNP) in the human p53 gene to risk for developing a variety of cancers. This SNP encodes either an arginine or proline at position 72 (R72P) of the p53 protein, which can alter the apoptotic activity of p53 via transcriptional and non-transcriptional mechanisms. This SNP has also been reported to modulate the development of human papilloma virus (HPV)-driven cancers through differential targeting of the p53 variant proteins by the E6 viral oncoprotein. Mouse models for the p53 R72P polymorphism have recently been developed but a role for this SNP in modifying cancer risk in response to viral and chemical carcinogens has yet to be established experimentally. Here, we demonstrate that the p53 R72P polymorphism modulates the hyperprolferative, apoptotic and inflammatory phenotypes caused by expression of the HPV16 E6 and E7 oncoproteins. Moreover, the R72P SNP also modifies the carcinogenic response to the chemical carcinogen 4NQO, in the presence and absence of the HPV16 transgene. Our findings confirm several human epidemiological studies associating the codon 72 proline variant with increased risk for certain cancers but also suggest that there are tissue-specific differences in how the R72P polymorphism influences the response to environmental carcinogens. © 2013 Wiley Periodicals, Inc.

Heterologous expression of pyrroloquinoline quinone (pqq) gene cluster confers mineral phosphate solubilization ability to Herbaspirillum seropedicae Z67.

PubMed

Wagh, Jitendra; Shah, Sonal; Bhandari, Praveena; Archana, G; Kumar, G Naresh

2014-06-01

Gluconic acid secretion mediated by the direct oxidation of glucose by pyrroloquinoline quinone (PQQ)-dependent glucose dehydrogenase (GDH) is responsible for mineral phosphate solubilization in Gram-negative bacteria. Herbaspirillum seropedicae Z67 (ATCC 35892) genome encodes GDH apoprotein but lacks genes for the biosynthesis of its cofactor PQQ. In this study, pqqE of Erwinia herbicola (in plasmid pJNK1) and pqq gene clusters of Pseudomonas fluorescens B16 (pOK53) and Acinetobacter calcoaceticus (pSS2) were over-expressed in H. seropedicae Z67. Transformants Hs (pSS2) and Hs (pOK53) secreted micromolar levels of PQQ and attained high GDH activity leading to secretion of 33.46 mM gluconic acid when grown on 50 mM glucose while Hs (pJNK1) was ineffective. Hs (pJNK1) failed to solubilize rock phosphate, while Hs (pSS2) and Hs (pOK53) liberated 125.47 μM and 168.07 μM P, respectively, in minimal medium containing 50 mM glucose under aerobic conditions. Moreover, under N-free minimal medium, Hs (pSS2) and Hs (pOK53) not only released significant P but also showed enhanced growth, biofilm formation, and exopolysaccharide (EPS) secretion. However, indole acetic acid (IAA) production was suppressed. Thus, the addition of the pqq gene cluster, but not pqqE alone, is sufficient for engineering phosphate solubilization in H. seropedicae Z67 without compromising growth under nitrogen-fixing conditions.

p53 improves aerobic exercise capacity and augments skeletal muscle mitochondrial DNA content.

PubMed

Park, Joon-Young; Wang, Ping-Yuan; Matsumoto, Takumi; Sung, Ho Joong; Ma, Wenzhe; Choi, Jeong W; Anderson, Stasia A; Leary, Scot C; Balaban, Robert S; Kang, Ju-Gyeong; Hwang, Paul M

2009-09-25

Exercise capacity is a physiological characteristic associated with protection from both cardiovascular and all-cause mortality. p53 regulates mitochondrial function and its deletion markedly diminishes exercise capacity, but the underlying genetic mechanism orchestrating this is unclear. Understanding the biology of how p53 improves exercise capacity may provide useful insights for improving both cardiovascular as well as general health. The purpose of this study was to understand the genetic mechanism by which p53 regulates aerobic exercise capacity. Using a variety of physiological, metabolic, and molecular techniques, we further characterized maximum exercise capacity and the effects of training, measured various nonmitochondrial and mitochondrial determinants of exercise capacity, and examined putative regulators of mitochondrial biogenesis. As p53 did not affect baseline cardiac function or inotropic reserve, we focused on the involvement of skeletal muscle and now report a wider role for p53 in modulating skeletal muscle mitochondrial function. p53 interacts with Mitochondrial Transcription Factor A (TFAM), a nuclear-encoded gene important for mitochondrial DNA (mtDNA) transcription and maintenance, and regulates mtDNA content. The increased mtDNA in p53(+/+) compared to p53(-/-) mice was more marked in aerobic versus glycolytic skeletal muscle groups with no significant changes in cardiac tissue. These in vivo observations were further supported by in vitro studies showing overexpression of p53 in mouse myoblasts increases both TFAM and mtDNA levels whereas depletion of TFAM by shRNA decreases mtDNA content. Our current findings indicate that p53 promotes aerobic metabolism and exercise capacity by using different mitochondrial genes and mechanisms in a tissue-specific manner.

p53 Involvement in the Control of Murine Hair Follicle Regression

PubMed Central

Botchkarev, Vladimir A.; Komarova, Elena A.; Siebenhaar, Frank; Botchkareva, Natalia V.; Sharov, Andrei A.; Komarov, Pavel G.; Maurer, Marcus; Gudkov, Andrei V.; Gilchrest, Barbara A.

2001-01-01

p53 is a transcription factor mediating a variety of biological responses including apoptotic cell death. p53 was recently shown to control apoptosis in the hair follicle induced by ionizing radiation and chemotherapy, but its role in the apoptosis-driven physiological hair follicle regression (catagen) remains to be elucidated. Here, we show that p53 protein is strongly expressed and co-localized with apoptotic markers in the regressing hair follicle compartments during catagen. In contrast to wild-type mice, p53 knockout mice show significant retardation of catagen accompanied by significant decrease in the number of apoptotic cells in the hair matrix. Furthermore, p53 null hair follicles are characterized by alterations in the expression of markers that are encoded by p53 target genes and are implicated in the control of catagen (Bax, Bcl-2, insulin-like growth factor binding protein-3). These data suggest that p53 is involved in the control of apoptosis in the hair follicle during physiological regression and imply that p53 antagonists may be useful for the management of hair growth disorders characterized by premature entry into catagen, such as androgenetic alopecia, alopecia areata, and telogen effluvium. PMID:11395365

Ddx18 is essential for cell-cycle progression in zebrafish hematopoietic cells and is mutated in human AML

PubMed Central

Bolli, Niccolò; Rhodes, Jennifer; Abdel-Wahab, Omar I.; Levine, Ross; Hedvat, Cyrus V.; Stone, Richard; Khanna-Gupta, Arati; Sun, Hong; Kanki, John P.; Gazda, Hanna T.; Beggs, Alan H.; Cotter, Finbarr E.

2011-01-01

In a zebrafish mutagenesis screen to identify genes essential for myelopoiesis, we identified an insertional allele hi1727, which disrupts the gene encoding RNA helicase dead-box 18 (Ddx18). Homozygous Ddx18 mutant embryos exhibit a profound loss of myeloid and erythroid cells along with cardiovascular abnormalities and reduced size. These mutants also display prominent apoptosis and a G1 cell-cycle arrest. Loss of p53, but not Bcl-xl overexpression, rescues myeloid cells to normal levels, suggesting that the hematopoietic defect is because of p53-dependent G1 cell-cycle arrest. We then sequenced primary samples from 262 patients with myeloid malignancies because genes essential for myelopoiesis are often mutated in human leukemias. We identified 4 nonsynonymous sequence variants (NSVs) of DDX18 in acute myeloid leukemia (AML) patient samples. RNA encoding wild-type DDX18 and 3 NSVs rescued the hematopoietic defect, indicating normal DDX18 activity. RNA encoding one mutation, DDX18-E76del, was unable to rescue hematopoiesis, and resulted in reduced myeloid cell numbers in ddx18hi1727/+ embryos, indicating this NSV likely functions as a dominant-negative allele. These studies demonstrate the use of the zebrafish as a robust in vivo system for assessing the function of genes mutated in AML, which will become increasingly important as more sequence variants are identified by next-generation resequencing technologies. PMID:21653321

Relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation in chronic lymphocytic leukemia.

PubMed

Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R

2002-08-15

Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.

Loss of p53-inducible long non-coding RNA LINC01021 increases chemosensitivity

PubMed Central

Kaller, Markus; Götz, Ursula; Hermeking, Heiko

2017-01-01

We have previously identified the long non-coding RNA LINC01021 as a direct p53 target (Hünten et al. Mol Cell Proteomics. 2015; 14:2609-2629). Here, we show that LINC01021 is up-regulated in colorectal cancer (CRC) cell lines upon various p53-activating treatments. The LINC01021 promoter and the p53 binding site lie within a MER61C LTR, which originated from insertion of endogenous retrovirus 1 (ERV1) sequences. Deletion of this MER61C element by a CRISPR/Cas9 approach, as well as siRNA-mediated knockdown of LINC01021 RNA significantly enhanced the sensitivity of the CRC cell line HCT116 towards the chemotherapeutic drugs doxorubicin and 5-FU, suggesting that LINC01021 is an integral part of the p53-mediated response to DNA damage. Inactivation of LINC01021 and also its ectopic expression did not affect p53 protein expression and transcriptional activity, implying that LINC01021 does not feedback to p53. Furthermore, in CRC patient samples LINC01021 expression positively correlated with a wild-type p53-associated gene expression signature. LINC01021 expression was increased in primary colorectal tumors and displayed a bimodal distribution that was particularly pronounced in the mesenchymal CMS4 consensus molecular subtype of CRCs. CMS4 tumors with low LINC01021 expression were associated with poor patient survival. Our results suggest that the genomic redistribution of ERV1-derived p53 response elements and generation of novel p53-inducible lncRNA-encoding genes was selected for during primate evolution as integral part of the cellular response to various forms of genotoxic stress. PMID:29262524

Characterization and role of p53 family members in the symbiont-induced morphogenesis of the Euprymna scolopes light organ.

PubMed

Goodson, Michael S; Crookes-Goodson, Wendy J; Kimbell, Jennifer R; McFall-Ngai, Margaret J

2006-08-01

Within hours of hatching, the squid Euprymna scolopes forms a specific light organ symbiosis with the marine luminous bacterium Vibrio fischeri. Interactions with the symbiont result in the loss of a complex ciliated epithelium dedicated to promoting colonization of host tissue, and some or all of this loss is due to widespread, symbiont-induced apoptosis. Members of the p53 family, including p53, p63, and p73, are conserved across broad phyletic lines and p63 is thought to be the ancestral gene. These proteins have been shown to induce apoptosis and developmental morphogenesis. In this study, we characterized p63-like transcripts from mRNA isolated from the symbiotic tissues of E. scolopes and described their role in symbiont-induced morphogenesis. Using degenerate RT-PCR and RACE PCR, we identified two p63-like transcripts encoding proteins of 431 and 567 amino acids. These transcripts shared identical nucleotides where they overlapped, suggesting that they are splice variants of the same gene. Immunocytochemistry and Western blots using an antibody specific for E. scolopes suggested that the p53 family members are activated in cells of the symbiont-harvesting structures of the symbiotic light organ. We propose that once the symbiosis is initiated, a symbiont-induced signal activates p53 family members, inducing apoptosis and developmental morphogenesis of the light organ.

The organization and expression of the mdm2 gene.

PubMed

de Oca Luna, R M; Tabor, A D; Eberspaecher, H; Hulboy, D L; Worth, L L; Colman, M S; Finlay, C A; Lozano, G

1996-05-01

The mdm2 gene encodes a zinc finger protein that negatively regulates p53 function by binding and masking the p53 transcriptional activation domain. Two different promoters control expression of mdm2, one of which is also transactivated by p53. We cloned and characterized the mdm2 gene from a murine 129 library. It contained at least 12 exons and spanned approximately 25 kb of DNA. Sequencing of the mdm2 gene revealed three nucleotide differences that resulted in amino acid substitutions in the previously published mdm2 sequence. Sequencing of normal BalbC/J DNA and the original cosmid clone isolated from the 3T3DM cell line revealed that they are identical, suggesting that the published sequence is in error at these three positions. In addition, we analyzed the expression pattern of mdm2 and found ubiquitous low-level expression throughout embryo development and in adult tissues. Analysis of mRNA from numerous tissues for several mdm2 spliced variants that had been identified in the transformed 3T3DM cell line revealed that these variants could not be detected in the developing embryo or in adult tissues.

ΔN-P63α and TA-P63α exhibit intrinsic differences in transactivation specificities that depend on distinct features of DNA target sites

PubMed Central

Foggetti, Giorgia; Raimondi, Ivan; Campomenosi, Paola; Menichini, Paola

2014-01-01

TP63 is a member of the TP53 gene family that encodes for up to ten different TA and ΔN isoforms through alternative promoter usage and alternative splicing. Besides being a master regulator of gene expression for squamous epithelial proliferation, differentiation and maintenance, P63, through differential expression of its isoforms, plays important roles in tumorigenesis. All P63 isoforms share an immunoglobulin-like folded DNA binding domain responsible for binding to sequence-specific response elements (REs), whose overall consensus sequence is similar to that of the canonical p53 RE. Using a defined assay in yeast, where P63 isoforms and RE sequences are the only variables, and gene expression assays in human cell lines, we demonstrated that human TA- and ΔN-P63α proteins exhibited differences in transactivation specificity not observed with the corresponding P73 or P53 protein isoforms. These differences 1) were dependent on specific features of the RE sequence, 2) could be related to intrinsic differences in their oligomeric state and cooperative DNA binding, and 3) appeared to be conserved in evolution. Since genotoxic stress can change relative ratio of TA- and ΔN-P63α protein levels, the different transactivation specificity of each P63 isoform could potentially influence cellular responses to specific stresses. PMID:24926492

Smoking, p53 Mutation, and Lung Cancer

PubMed Central

Gibbons, Don L.; Byers, Lauren A.; Kurie, Jonathan M.

2014-01-01

This issue marks the 50th Anniversary of the release of the U.S. Surgeon General’s Report on Smoking and Health. Perhaps no other singular event has done more to highlight the effects of smoking on the development of cancer. Tobacco exposure is the leading cause of cancers involving the oral cavity, conductive airways and the lung. Owing to the many carcinogens in tobacco smoke, smoking-related malignancies have a high genome-wide burden of mutations, including in the gene encoding for p53. The p53 protein is the most frequently mutated tumor suppressor in cancer, responsible for a range of critical cellular functions that are compromised by the presence of a mutation. Herein we review the epidemiologic connection between tobacco exposure and cancer, the molecular basis of p53 mutation in lung cancer, and the normal molecular and cellular roles of p53 that are abrogated during lung tumor development and progression as defined by in vitro and in vivo studies. We also consider the therapeutic potential of targeting mutant p53 in a clinical setting based upon the cellular role of mutant p53 and data from genetic murine models. PMID:24442106

The Role of the DNA Damage Response in Breast Cancer

DTIC Science & Technology

2010-02-01

p53, ATM, Chk2, BRCA1, 53BP1, and MDC1 are mutated or inactivated in many human malignancies including breast cancer [6, 9-15]. ATM nullizygosity...receptor family of receptor tyrosine kinases, is amplified in 20-30% of human breast cancers [32, 33]. The genes encoding ErbB1, ErbB3, and insulin-like...engender a robust DDR that has been previously observed in human breast clinical samples but not in established mouse models of mammary cancer

Induction of differentiation in human promyelocytic HL-60 leukemia cells activates p21, WAF1/CIP1, expression in the absence of p53.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, H.; Lin, J.; Su, Z.-Z.

The melanoma differentiation associated gene, mda-6, which is identical to the P53-inducible gene WAF1/CIP1, encodes an M(r) 21,000 protein (p21) that can directly inhibit cell growth by repressing cyclin dependent kinases. mda-6 was identified using subtraction hybridization by virtue of its enhanced expression in human melanoma cells induced to terminally differentiate by treatment with human fibroblast interferon and the anti-leukemic compound mezerein (Jiang and Fisher, 1993). In the present study, we demonstrate that mda-6 (WAF1/CIP1) is an immediate early response gene induced during differentiation of the promyelocytic HL-60 leukemia cell line along the granulocytic or macrophage/monocyte pathway. mda-6 gene expressionmore » in HL-60 cells is induced within 1 to 3 h during differentiation along the macrophage/monocyte pathway evoked by 12-0-tetradecanoyl phorbol-13-acetate (TPA) or 1,25-dihydroxyvitamin D3 (Vit D3) or the granulocytic pathway produced by retinoic acid (RA) or dimethylsulfoxide (DMSO). Immunoprecipitation analyses using an anti-p21 antibody indicate a temporal induction of p21 protein following treatment with TPA, DMSO or RA. A relationship between rapid induction of mda-6 gene expression and differentiation is indicated by a delay in this expression in an HL-60 cell variant resistant to TPA-induced growth arrest and differentiation. A similar delay in mda-6 gene expression is not observed in Vit D3 treated TPA-resistant variant cells that are also sensitive to induction of monocytic differentiation. Since HL-60 cells have a null-p53 phenotype, these results demonstrate that p21 induction occurs during initiation of terminal differentiation in a p53-independent manner. In this context, p21 may play a more global role in growth control and differentiation than originally envisioned.« less

Wip1 and p53 contribute to HTLV-1 Tax-induced tumorigenesis

PubMed Central

2012-01-01

Background Human T-cell Leukemia Virus type 1 (HTLV-1) infects 20 million individuals world-wide and causes Adult T-cell Leukemia/Lymphoma (ATLL), a highly aggressive T-cell cancer. ATLL is refractory to treatment with conventional chemotherapy and fewer than 10% of afflicted individuals survive more than 5 years after diagnosis. HTLV-1 encodes a viral oncoprotein, Tax, that functions in transforming virus-infected T-cells into leukemic cells. All ATLL cases are believed to have reduced p53 activity although only a minority of ATLLs have genetic mutations in their p53 gene. It has been suggested that p53 function is inactivated by the Tax protein. Results Using genetically altered mice, we report here that Tax expression does not achieve a functional equivalence of p53 inactivation as that seen with genetic mutation of p53 (i.e. a p53−/− genotype). Thus, we find statistically significant differences in tumorigenesis between Tax+p53+/+versus Tax+p53−/− mice. We also find a role contributed by the cellular Wip1 phosphatase protein in tumor formation in Tax transgenic mice. Notably, Tax+Wip1−/− mice show statistically significant reduced prevalence of tumorigenesis compared to Tax+Wip1+/+ counterparts. Conclusions Our findings provide new insights into contributions by p53 and Wip1 in the in vivo oncogenesis of Tax-induced tumors in mice. PMID:23256545

Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells.

PubMed

Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo

2012-04-01

Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

Novel Plasmid-Encoded Ceftazidime-Hydrolyzing CTX-M-53 Extended-Spectrum β-Lactamase from Salmonella enterica Serotypes Westhampton and Senftenberg▿

PubMed Central

Doublet, Benoît; Granier, Sophie A.; Robin, Frédéric; Bonnet, Richard; Fabre, Laëtitia; Brisabois, Anne; Cloeckaert, Axel; Weill, François-Xavier

2009-01-01

We describe the characterization of a novel CTX-M β-lactamase from Salmonella enterica. Four S. enterica isolates (three of serotype Westhampton and one of serotype Senftenberg) resistant to extended-spectrum cephalosporins (cefotaxime and ceftazidime) were recovered in 2004 from living cockles in three supermarkets located in distant geographic areas in France, which got their supplies from the same fishery. The isolates were found to produce a novel extended-spectrum β-lactamase (ESBL) belonging to the CTX-M-1 phylogenetic group and named CTX-M-53. The CTX-M-53 β-lactamase harbored the substitution Asp240Gly, like the CTX-M-15 enzyme, which is specifically implicated in a higher catalytic efficiency against ceftazidime. The blaCTX-M-53 gene was located on a mobilizable 11-kb plasmid, pWES-1. The complete sequence of pWES-1 revealed the presence of a novel insertion sequence, ISSen2, and an IS26 element upstream and downstream of the blaCTX-M-53 gene, respectively; however, transposition assays of the blaCTX-M-53 gene were unsuccessful. IS26 elements may have contributed to the acquisition of the blaCTX-M-53 gene. Interestingly, the mobilization module of the pWES-1 plasmid was similar to that of quinolone resistance plasmids (carrying the qnrS2 gene) from aquatic sources. Although belonging to two serotypes differentiated on the basis of the O-antigen structure (E1 or E4 groups), the isolates were found to be genetically indistinguishable by pulsed-field gel electrophoresis. Multilocus sequence typing showed that the isolates of serotype Westhampton had a sequence type, ST14, common among isolates of serotype Senftenberg. This is the first characterization of the CTX-M-53 ESBL, which represents an additional ceftazidime-hydrolyzing CTX-M enzyme. PMID:19273683

Biallelic inactivation of REV7 is associated with Fanconi anemia.

PubMed

Bluteau, Dominique; Masliah-Planchon, Julien; Clairmont, Connor; Rousseau, Alix; Ceccaldi, Raphael; Dubois d'Enghien, Catherine; Bluteau, Olivier; Cuccuini, Wendy; Gachet, Stéphanie; Peffault de Latour, Régis; Leblanc, Thierry; Socié, Gérard; Baruchel, André; Stoppa-Lyonnet, Dominique; D'Andrea, Alan D; Soulier, Jean

2016-09-01

Fanconi anemia (FA) is a recessive genetic disease characterized by congenital abnormalities, chromosome instability, progressive bone marrow failure (BMF), and a strong predisposition to cancer. Twenty FA genes have been identified, and the FANC proteins they encode cooperate in a common pathway that regulates DNA crosslink repair and replication fork stability. We identified a child with severe BMF who harbored biallelic inactivating mutations of the translesion DNA synthesis (TLS) gene REV7 (also known as MAD2L2), which encodes the mutant REV7 protein REV7-V85E. Patient-derived cells demonstrated an extended FA phenotype, which included increased chromosome breaks and G2/M accumulation upon exposure to DNA crosslinking agents, γH2AX and 53BP1 foci accumulation, and enhanced p53/p21 activation relative to cells derived from healthy patients. Expression of WT REV7 restored normal cellular and functional phenotypes in the patient's cells, and CRISPR/Cas9 inactivation of REV7 in a non-FA human cell line produced an FA phenotype. Finally, silencing Rev7 in primary hematopoietic cells impaired progenitor function, suggesting that the DNA repair defect underlies the development of BMF in FA. Taken together, our genetic and functional analyses identified REV7 as a previously undescribed FA gene, which we term FANCV.

Biallelic inactivation of REV7 is associated with Fanconi anemia

PubMed Central

Masliah-Planchon, Julien; Clairmont, Connor; Rousseau, Alix; Ceccaldi, Raphael; Dubois d’Enghien, Catherine; Bluteau, Olivier; Cuccuini, Wendy; Gachet, Stéphanie; Peffault de Latour, Régis; Leblanc, Thierry; Socié, Gérard; Baruchel, André; Stoppa-Lyonnet, Dominique; D’Andrea, Alan D.

2016-01-01

Fanconi anemia (FA) is a recessive genetic disease characterized by congenital abnormalities, chromosome instability, progressive bone marrow failure (BMF), and a strong predisposition to cancer. Twenty FA genes have been identified, and the FANC proteins they encode cooperate in a common pathway that regulates DNA crosslink repair and replication fork stability. We identified a child with severe BMF who harbored biallelic inactivating mutations of the translesion DNA synthesis (TLS) gene REV7 (also known as MAD2L2), which encodes the mutant REV7 protein REV7-V85E. Patient-derived cells demonstrated an extended FA phenotype, which included increased chromosome breaks and G2/M accumulation upon exposure to DNA crosslinking agents, γH2AX and 53BP1 foci accumulation, and enhanced p53/p21 activation relative to cells derived from healthy patients. Expression of WT REV7 restored normal cellular and functional phenotypes in the patient’s cells, and CRISPR/Cas9 inactivation of REV7 in a non-FA human cell line produced an FA phenotype. Finally, silencing Rev7 in primary hematopoietic cells impaired progenitor function, suggesting that the DNA repair defect underlies the development of BMF in FA. Taken together, our genetic and functional analyses identified REV7 as a previously undescribed FA gene, which we term FANCV. PMID:27500492

Transcription factor FOXA2-centered transcriptional regulation network in non-small cell lung cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jang, Sang-Min; An, Joo-Hee; Kim, Chul-Hong

2015-08-07

Lung cancer is the leading cause of cancer-mediated death. Although various therapeutic approaches are used for lung cancer treatment, these mainly target the tumor suppressor p53 transcription factor, which is involved in apoptosis and cell cycle arrest. However, p53-targeted therapies have limited application in lung cancer, since p53 is found to be mutated in more than half of lung cancers. In this study, we propose tumor suppressor FOXA2 as an alternative target protein for therapies against lung cancer and reveal a possible FOXA2-centered transcriptional regulation network by identifying new target genes and binding partners of FOXA2 by using various screeningmore » techniques. The genes encoding Glu/Asp-rich carboxy-terminal domain 2 (CITED2), nuclear receptor subfamily 0, group B, member 2 (NR0B2), cell adhesion molecule 1 (CADM1) and BCL2-associated X protein (BAX) were identified as putative target genes of FOXA2. Additionally, the proteins including highly similar to heat shock protein HSP 90-beta (HSP90A), heat shock 70 kDa protein 1A variant (HSPA1A), histone deacetylase 1 (HDAC1) and HDAC3 were identified as novel interacting partners of FOXA2. Moreover, we showed that FOXA2-dependent promoter activation of BAX and p21 genes is significantly reduced via physical interactions between the identified binding partners and FOXA2. These results provide opportunities to understand the FOXA2-centered transcriptional regulation network and novel therapeutic targets to modulate this network in p53-deficient lung cancer. - Highlights: • Identification of new target genes of FOXA2. • Identifications of novel interaction proteins of FOXA2. • Construction of FOXA2-centered transcriptional regulatory network in non-small cell lung cancer.« less

Regulation of PI 3-K, PTEN, p53, and mTOR in Malignant and Benign Tumors Deficient in Tuberin

PubMed Central

Yadav, Anamika; Mahimainathan, Lenin; Valente, Anthony J.

2011-01-01

The tuberous sclerosis complex (TSC) is caused by mutation in either of 2 tumor suppressor genes, TSC-1 (encodes hamartin) and TSC-2 (encodes tuberin). In humans, deficiency in TSC1/2 is associated with benign tumors in many organs, including renal angiomyolipoma (AML) but rarely renal cell carcinoma (RCC). In contrast, deficiency of TSC function in the Eker rat is associated with RCC. Here, we have investigated the activity of PI 3-K and the expression of PTEN, p53, tuberin, p-mTOR, and p-p70S6K in both Eker rat RCC and human renal AML. Compared to normal tissue, increased PI 3-K activity was detected in RCC of Eker rats but not in human AML tissue. In contrast, PTEN was highly expressed in AML but significantly reduced in the renal tumors of Eker rats. Phosphorylation on Ser2448 of mTOR and Thr389 of p70S6K were significantly increased in both RCC and AML compared to matching control tissue. Total tuberin was significantly decreased in AML while completely lost in RCC of Eker rats. Our data also show that while p53 protein expression is lost in rat RCC, it was highly elevated in AML. These novel data provide evidence that loss of TSC-2, PTEN, and p53 as well as activation of PI 3-K and mTOR is associated with kidney cancer in the Eker rat, while sustained expression of TSC-2, PTEN, and p53 may prevent progression of kidney cancer in TSC patients. PMID:22737271

An Alternative Nested Reading Frame May Participate in the Stress-Dependent Expression of a Plant Gene

PubMed Central

Sheshukova, Ekaterina V.; Komarova, Tatiana V.; Ershova, Natalia M.; Shindyapina, Anastasia V.; Dorokhov, Yuri L.

2017-01-01

Although plants as sessile organisms are affected by a variety of stressors in the field, the stress factors for the above-ground and underground parts of the plant and their gene expression profiles are not the same. Here, we investigated NbKPILP, a gene encoding a new member of the ubiquitous, pathogenesis-related Kunitz peptidase inhibitor (KPI)-like protein family, that we discovered in the genome of Nicotiana benthamiana and other representatives of the Solanaceae family. The NbKPILP gene encodes a protein that has all the structural elements characteristic of KPI but in contrast to the proven A. thaliana KPI (AtKPI), it does not inhibit serine peptidases. Unlike roots, NbKPILP mRNA and its corresponding protein were not detected in intact leaves, but abiotic and biotic stressors drastically affected NbKPILP mRNA accumulation. In search of the causes of suppressed NbKPILP mRNA accumulation in leaves, we found that the NbKPILP gene is “matryoshka,” containing an alternative nested reading frame (ANRF) encoding a 53-amino acid (aa) polypeptide (53aa-ANRF) which has an amphipathic helix (AH). We confirmed ANRF expression experimentally. A vector containing a GFP-encoding sequence was inserted into the NbKPILP gene in frame with 53aa-ANRF, resulting in a 53aa-GFP fused protein that localized in the membrane fraction of cells. Using the 5′-RACE approach, we have shown that the expression of ANRF was not explained by the existence of a cryptic promoter within the NbKPILP gene but was controlled by the maternal NbKPILP mRNA. We found that insertion of mutations destroying the 53aa-ANRF AH resulted in more than a two-fold increase of the NbKPILP mRNA level. The NbKPILP gene represents the first example of ANRF functioning as a repressor of a maternal gene in an intact plant. We proposed a model where the stress influencing the translation initiation promotes the accumulation of NbKPILP and its mRNA in leaves. PMID:29312392

An Alternative Nested Reading Frame May Participate in the Stress-Dependent Expression of a Plant Gene.

PubMed

Sheshukova, Ekaterina V; Komarova, Tatiana V; Ershova, Natalia M; Shindyapina, Anastasia V; Dorokhov, Yuri L

2017-01-01

Although plants as sessile organisms are affected by a variety of stressors in the field, the stress factors for the above-ground and underground parts of the plant and their gene expression profiles are not the same. Here, we investigated NbKPILP , a gene encoding a new member of the ubiquitous, pathogenesis-related Kunitz peptidase inhibitor (KPI)-like protein family, that we discovered in the genome of Nicotiana benthamiana and other representatives of the Solanaceae family. The NbKPILP gene encodes a protein that has all the structural elements characteristic of KPI but in contrast to the proven A. thaliana KPI (AtKPI), it does not inhibit serine peptidases. Unlike roots, NbKPILP mRNA and its corresponding protein were not detected in intact leaves, but abiotic and biotic stressors drastically affected NbKPILP mRNA accumulation. In search of the causes of suppressed NbKPILP mRNA accumulation in leaves, we found that the NbKPILP gene is "matryoshka," containing an alternative nested reading frame (ANRF) encoding a 53-amino acid (aa) polypeptide (53aa-ANRF) which has an amphipathic helix (AH). We confirmed ANRF expression experimentally. A vector containing a GFP-encoding sequence was inserted into the NbKPILP gene in frame with 53aa-ANRF, resulting in a 53aa-GFP fused protein that localized in the membrane fraction of cells. Using the 5'-RACE approach, we have shown that the expression of ANRF was not explained by the existence of a cryptic promoter within the NbKPILP gene but was controlled by the maternal NbKPILP mRNA. We found that insertion of mutations destroying the 53aa-ANRF AH resulted in more than a two-fold increase of the NbKPILP mRNA level. The NbKPILP gene represents the first example of ANRF functioning as a repressor of a maternal gene in an intact plant. We proposed a model where the stress influencing the translation initiation promotes the accumulation of NbKPILP and its mRNA in leaves.

Mutant p53 expression in fallopian tube epithelium drives cell migration.

PubMed

Quartuccio, Suzanne M; Karthikeyan, Subbulakshmi; Eddie, Sharon L; Lantvit, Daniel D; Ó hAinmhire, Eoghainín; Modi, Dimple A; Wei, Jian-Jun; Burdette, Joanna E

2015-10-01

Ovarian cancer is the fifth leading cause of cancer death among US women. Evidence supports the hypothesis that high-grade serous ovarian cancers (HGSC) may originate in the distal end of the fallopian tube. Although a heterogeneous disease, 96% of HGSC contain mutations in p53. In addition, the "p53 signature," or overexpression of p53 protein (usually associated with mutation), is a potential precursor lesion of fallopian tube derived HGSC suggesting an essential role for p53 mutation in early serous tumorigenesis. To further clarify p53-mutation dependent effects on cells, murine oviductal epithelial cells (MOE) were stably transfected with a construct encoding for the R273H DNA binding domain mutation in p53, the most common mutation in HGSC. Mutation in p53 was not sufficient to transform MOE cells but did significantly increase cell migration. A similar p53 mutation in murine ovarian surface epithelium (MOSE), another potential progenitor cell for serous cancer, was not sufficient to transform the cells nor change migration suggesting tissue specific effects of p53 mutation. Microarray data confirmed expression changes of pro-migratory genes in p53(R273H) MOE compared to parental cells, which could be reversed by suppressing Slug expression. Combining p53(R273H) with KRAS(G12V) activation caused transformation of MOE into high-grade sarcomatoid carcinoma when xenografted into nude mice. Elucidating the specific role of p53(R273H) in the fallopian tube will improve understanding of changes at the earliest stage of transformation. This information can help develop chemopreventative strategies to prevent the accumulation of additional mutations and reverse progression of the "p53 signature" thereby, improving survival rates. © 2015 UICC.

Autophagy is induced through the ROS-TP53-DRAM1 pathway in response to mitochondrial protein synthesis inhibition.

PubMed

Xie, Xiaolei; Le, Li; Fan, Yanxin; Lv, Lin; Zhang, Junjie

2012-07-01

Mitoribosome in mammalian cells is responsible for synthesis of 13 mtDNA-encoded proteins, which are integral parts of four mitochondrial respiratory chain complexes (I, III, IV and V). ERAL1 is a nuclear-encoded GTPase important for the formation of the 28S small mitoribosomal subunit. Here, we demonstrate that knockdown of ERAL1 by RNA interference inhibits mitochondrial protein synthesis and promotes reactive oxygen species (ROS) generation, leading to autophagic vacuolization in HeLa cells. Cells that lack ERAL1 expression showed a significant conversion of LC3-I to LC3-II and an enhanced accumulation of autophagic vacuoles carrying the LC3 marker, all of which were blocked by the autophagy inhibitor 3-MA as well as by the ROS scavenger NAC. Inhibition of mitochondrial protein synthesis either by ERAL1 siRNA or chloramphenicol (CAP), a specific inhibitor of mitoribosomes, induced autophagy in HTC-116 TP53 (+/+) cells, but not in HTC-116 TP53 (-/-) cells, indicating that tumor protein 53 (TP53) is essential for the autophagy induction. The ROS elevation resulting from mitochondrial protein synthesis inhibition induced TP53 expression at transcriptional levels by enhancing TP53 promoter activity, and increased TP53 protein stability by suppressing TP53 ubiquitination through MAPK14/p38 MAPK-mediated TP53 phosphorylation. Upregulation of TP53 and its downstream target gene DRAM1, but not CDKN1A/p21, was required for the autophagy induction in ERAL1 siRNA or CAP-treated cells. Altogether, these data indicate that autophagy is induced through the ROS-TP53-DRAM1 pathway in response to mitochondrial protein synthesis inhibition.

Converting cancer genes into killer genes.

PubMed Central

Da Costa, L T; Jen, J; He, T C; Chan, T A; Kinzler, K W; Vogelstein, B

1996-01-01

Over the past decade, it has become clear that tumorigenesis is driven by alterations in genes that control cell growth or cell death. Theoretically, the proteins encoded by these genes provide excellent targets for new therapeutic agents. Here, we describe a gene therapy approach to specifically kill tumor cells expressing such oncoproteins. In outline, the target oncoprotein binds to exogenously introduced gene products, resulting in transcriptional activation of a toxic gene. As an example, we show that this approach can be used to specifically kill cells overexpressing a mutant p53 gene in cell culture. The strategy may be generally applicable to neoplastic diseases in which the underlying patterns of genetic alterations or abnormal gene expression are known. Images Fig. 1 Fig. 2 Fig. 4 Fig. 5 PMID:8633039

Human pluripotent stem cells recurrently acquire and expand dominant negative P53 mutations

PubMed Central

Kamitaki, Nolan; Mitchell, Jana; Avior, Yishai; Mello, Curtis; Kashin, Seva; Mekhoubad, Shila; Ilic, Dusko; Charlton, Maura; Saphier, Genevieve; Handsaker, Robert E.; Genovese, Giulio; Bar, Shiran; Benvenisty, Nissim; McCarroll, Steven A.; Eggan, Kevin

2017-01-01

Human pluripotent stem cells (hPSCs) can self-renew indefinitely, making them an attractive source for regenerative therapies. This expansion potential has been linked with acquisition of large copy number variants (CNVs) that provide mutant cells with a growth advantage in culture1–3. However, the nature, extent, and functional impact of other acquired genome sequence mutations in cultured hPSCs is not known. Here, we sequenced the protein-coding genes (exomes) of 140 independent human embryonic stem cell (hESC) lines, including 26 lines prepared for potential clinical use4. We then applied computational strategies for identifying mutations present in a subset of cells5. Though such mosaic mutations were generally rare, we identified five unrelated hESC lines that carried six mutations in the TP53 gene that encodes the tumor suppressor P53. Notably, the TP53 mutations we observed are dominant negative and are the mutations most commonly seen in human cancers. We used droplet digital PCR to demonstrate that the TP53 mutant allelic fraction increased with passage number under standard culture conditions, suggesting that P53 mutation confers selective advantage. When we then mined published RNA sequencing data from 117 hPSC lines, we observed another nine TP53 mutations, all resulting in coding changes in the DNA binding domain of P53. Strikingly, in three lines, the allelic fraction exceeded 50%, suggesting additional selective advantage resulting from loss of heterozygosity at the TP53 locus. As the acquisition and favored expansion of cancer-associated mutations in hPSCs may go unnoticed during most applications, we suggest that careful genetic characterization of hPSCs and their differentiated derivatives should be carried out prior to clinical use. PMID:28445466

Pathogenesis of POLR1C-dependent Type 3 Treacher Collins Syndrome revealed by a zebrafish model.

PubMed

Lau, Marco Chi Chung; Kwong, Ernest Man Lok; Lai, Keng Po; Li, Jing-Woei; Ho, Jeff Cheuk Hin; Chan, Ting-Fung; Wong, Chris Kong Chu; Jiang, Yun-Jin; Tse, William Ka Fai

2016-06-01

Treacher Collins Syndrome (TCS) is a rare congenital birth disorder (1 in 50,000 live births) characterized by severe craniofacial defects, including the downward slanting palpebral fissures, hypoplasia of the facial bones, and cleft palate (CP). Over 90% of patients with TCS have a mutation in the TCOF1 gene. However, some patients exhibit mutations in two new causative genes, POLR1C and POLR1D, which encode subunits of RNA polymerases I and III, that affect ribosome biogenesis. In this study, we examine the role of POLR1C in TCS using zebrafish as a model system. Our data confirmed that polr1c is highly expressed in the facial region, and dysfunction of this gene by knockdown or knock-out resulted in mis-expression of neural crest cells during early development that leads to TCS phenotype. Next generation sequencing and bioinformatics analysis of the polr1c mutants further demonstrated the up-regulated p53 pathway and predicted skeletal disorders. Lastly, we partially rescued the TCS facial phenotype in the background of p53 mutants, which supported the hypothesis that POLR1C-dependent type 3 TCS is associated with the p53 pathway. Copyright © 2016 Elsevier B.V. All rights reserved.

Accumulation of p53 in infectious mononucleosis tissues.

PubMed

Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L

2000-11-01

Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company

Suppression of p53-inducible gene 3 is significant for glioblastoma progression and predicts poor patient prognosis.

PubMed

Quan, Jishu; Li, Yong; Jin, Meihua; Chen, Dunfu; Yin, Xuezhe; Jin, Ming

2017-03-01

Glioblastoma is the most malignant and invasive brain tumor with extremely poor prognosis. p53-inducible gene 3, a downstream molecule of the tumor suppressor p53, has been found involved in apoptosis and oxidative stress response. However, the functions of p53-inducible gene 3(PIG3) in cancer are far from clear including glioblastoma. In this study, we found that p53-inducible gene 3 expression was suppressed in glioblastoma tissues compared with normal tissues. And the expression of p53-inducible gene 3 was significantly associated with the World Health Organization grade. Patients with high p53-inducible gene 3 expression have a significantly longer median survival time (15 months) than those with low p53-inducible gene 3 expression (8 months). According to Cox regression analysis, p53-inducible gene 3 was an independent prognostic factor with multivariate hazard ratio of 0.578 (95% confidence interval, 0.352-0.947; p = 0.030) for overall survival. Additionally, gain and loss of function experiments showed that knockdown of p53-inducible gene 3 significantly increased the proliferation and invasion ability of glioblastoma cells while overexpression of p53-inducible gene 3 inhibited the proliferation and invasion ability. The results of in vivo glioblastoma models further confirmed that p53-inducible gene 3 suppression promoted glioblastoma progression. Altogether, our data suggest that high expression of p53-inducible gene 3 is significant for glioblastoma inhibition and p53-inducible gene 3 independently indicates good prognosis in patients, which might be a novel prognostic biomarker or potential therapeutic target in glioblastoma.

Transforming Growth Factor-β Promotes Liver Tumorigenesis in Mice via Up-regulation of Snail.

PubMed

Moon, Hyuk; Ju, Hye-Lim; Chung, Sook In; Cho, Kyung Joo; Eun, Jung Woo; Nam, Suk Woo; Han, Kwang-Hyub; Calvisi, Diego F; Ro, Simon Weonsang

2017-11-01

Transforming growth factor beta (TGF-β) suppresses early stages of tumorigenesis, but also contributes to migration and metastasis of cancer cells. A large number of human tumors contain mutations that inactivate its receptors, or downstream proteins such as Smad transcription factors, indicating that the TGF-β signaling pathway prevents tumor growth. We investigated the effects of TGF-β inhibition on liver tumorigenesis in mice. C57BL/6 mice received hydrodynamic tail-vein injections of transposons encoding HRAS G12V and a short hairpin RNA (shRNA) to down-regulate p53, or those encoding HRAS G12V and MYC, or those encoding HRAS G12V and TAZ S89A , to induce liver tumor formation; mice were also given injections of transposons encoding SMAD7 or shRNA against SMAD2, SMAD3, SMAD4, or SNAI1 (Snail), with or without ectopic expression of Snail. Survival times were compared, and livers were weighted and examined for tumors. Liver tumor tissues were analyzed by quantitative reverse-transcription PCR, RNA sequencing, immunoblots, and immunohistochemistry. We analyzed gene expression levels in human hepatocellular carcinoma samples deposited in The Cancer Genome Atlas. A cell proliferation assay was performed using human liver cancer cell lines (HepG2 and Huh7) stably expressing Snail or shRNA against Snail. TGF-β inhibition via overexpression of SMAD7 (or knockdown of SMAD2, SMAD3, or SMAD4) consistently reduced formation and growth of liver tumors in mice that expressed activated RAS plus shRNA against p53, or in mice that expressed activated RAS and TAZ. TGF-β signaling activated transcription of the Snail gene in liver tumors induced by HRAS G12V and shRNA against p53, and by activated RAS and TAZ. Knockdown of Snail reduced liver tumor formation in both tumor models. Ectopic expression of Snail restored liver tumorigenesis suppressed by disruption of TGF-β signaling. In human hepatocellular carcinoma, Snail expression correlated with TGF-β activation. Ectopic expression of Snail increased cellular proliferation, whereas Snail knockdown led to reduced proliferation in human hepatocellular carcinoma cells. In analyses of transgenic mice, we found TGF-β signaling to be required for formation of liver tumors upon expression of activated RAS and shRNA down-regulating p53, and upon expression of activated RAS and TAZ. Snail is the TGF-β target that is required for hepatic tumorigenesis in these models. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

A Morpholino-based screen to identify novel genes involved in craniofacial morphogenesis

PubMed Central

Melvin, Vida Senkus; Feng, Weiguo; Hernandez-Lagunas, Laura; Artinger, Kristin Bruk; Williams, Trevor

2014-01-01

BACKGROUND The regulatory mechanisms underpinning facial development are conserved between diverse species. Therefore, results from model systems provide insight into the genetic causes of human craniofacial defects. Previously, we generated a comprehensive dataset examining gene expression during development and fusion of the mouse facial prominences. Here, we used this resource to identify genes that have dynamic expression patterns in the facial prominences, but for which only limited information exists concerning developmental function. RESULTS This set of ~80 genes was used for a high throughput functional analysis in the zebrafish system using Morpholino gene knockdown technology. This screen revealed three classes of cranial cartilage phenotypes depending upon whether knockdown of the gene affected the neurocranium, viscerocranium, or both. The targeted genes that produced consistent phenotypes encoded proteins linked to transcription (meis1, meis2a, tshz2, vgll4l), signaling (pkdcc, vlk, macc1, wu:fb16h09), and extracellular matrix function (smoc2). The majority of these phenotypes were not altered by reduction of p53 levels, demonstrating that both p53 dependent and independent mechanisms were involved in the craniofacial abnormalities. CONCLUSIONS This Morpholino-based screen highlights new genes involved in development of the zebrafish craniofacial skeleton with wider relevance to formation of the face in other species, particularly mouse and human. PMID:23559552

The Arf-inducing Transcription Factor Dmp1 Encodes a Transcriptional Activator of Amphiregulin, Thrombospondin-1, JunB and Egr1

PubMed Central

Mallakin, Ali; Sugiyama, Takayuki; Kai, Fumitake; Taneja, Pankaj; Kendig, Robert D.; Frazier, Donna P.; Maglic, Dejan; Matise, Lauren A.; Willingham, Mark C.; Inoue, Kazushi

2009-01-01

Dmp1 (Dmtf1) encodes a Myb-like transcription factor implicated in tumor suppression through direct activation of the Arf-p53 pathway. The human DMP1 gene is frequently deleted in non-small cell lung cancers, especially those that retain wild-type INK4a/ARF and/or p53. To identify novel genes that are regulated by Dmp1, transcriptional profiles of lung tissue from Dmp1-null and wild-type mice were generated using the GeneChip Microarray. Comparative analysis of gene expression changes between the two groups resulted in identification of numerous genes that may be regulated by Dmp1. Notably, amphiregulin (Areg), thrombospondin-1 (Tsp-1), JunB, Egr1, adrenomedullin (Adm), Bcl-3 and methyl-CpG binding domain protein 1 (Mbd1) were downregulated in the lungs from Dmp1-null mice while Gas1 and Ect2 genes were upregulated. These target genes were chosen for further analyses since they are involved in cell proliferation, transcription, angiogenesis/metastasis, apoptosis, or DNA methylation, and thus could account for the tumor suppressor phenotype of Dmp1. Dmp1 directly bound to the genomic loci of Areg, Tsp-1, JunB and Egr1. Significant upregulation or downregulation of the novel Dmp1 target genes was observed upon transient expression of Dmp1 in alveolar epithelial cells, an effect which was nullified by the inhibition of de novo mRNA synthesis. Interestingly, these genes and their protein products were significantly downregulated or upregulated in the lungs from Dmp1-heterozygous mice as well. Identification of novel Dmp1 target genes not only provides insights into the effects of Dmp1 on global gene expression, but also sheds light on the mechanism of haploid insufficiency of Dmp1 in tumor suppression. PMID:19816943

Proline dehydrogenase promotes senescence through the generation of reactive oxygen species.

PubMed

Nagano, Taiki; Nakashima, Akio; Onishi, Kengo; Kawai, Kosuke; Awai, Yuto; Kinugasa, Mizuki; Iwasaki, Tetsushi; Kikkawa, Ushio; Kamada, Shinji

2017-04-15

Cellular senescence is a complex stress response characterized by permanent loss of proliferative capacity and is implicated in age-related disorders. Although the transcriptional activity of p53 (encoded by TP53 ) is known to be vital for senescence induction, the downstream effector genes critical for senescence remain unsolved. Recently, we have identified the proline dehydrogenase gene ( PRODH ) to be upregulated specifically in senescent cells in a p53-dependent manner, and the functional relevance of this to senescence is yet to be defined. Here, we conducted functional analyses to explore the relationship between PRODH and the senescence program. We found that genetic and pharmacological inhibition of PRODH suppressed senescent phenotypes induced by DNA damage. Furthermore, ectopic expression of wild-type PRODH, but not enzymatically inactive forms, induced senescence associated with the increase in reactive oxygen species (ROS) and the accumulation of DNA damage. Treatment with N-acetyl-L-cysteine, a ROS scavenger, prevented senescence induced by PRODH overexpression. These results indicate that PRODH plays a causative role in DNA damage-induced senescence through the enzymatic generation of ROS. © 2017. Published by The Company of Biologists Ltd.

Mdm2 is required for survival of hematopoietic stem cells/progenitors via dampening of ROS-induced p53 activity

USDA-ARS?s Scientific Manuscript database

Mdm2 is an E3 ubiquitin ligase that targets p53 for degradation. p53(515C) (encoding p53R172P) is a hypomorphic allele of p53 that rescues the embryonic lethality of Mdm2(-/-) mice. Mdm2(-/-) p53(515C/515C) mice, however, die by postnatal day 13 resulting from hematopoietic failure. Hematopoietic st...

Combined radiation and p53 gene therapy of malignant glioma cells.

PubMed

Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A

1999-01-01

More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We conclude that responses to p53 gene therapy are variable among gliomas and most likely depend upon both cellular p53 status and as yet ill-defined downstream pathways involving activation of cell cycle regulatory and apoptotic genes.

The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

PubMed

Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

2009-05-01

Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

Piperlongumine inhibits LMP1/MYC-dependent mouse B-lymphoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Seong-Su; Tompkins, Van S.; Son, Dong-Ju

2013-07-12

Highlights: •Mouse model of human Burkitt lymphoma revealed cancer inhibition by PL. •Treatment with PL led to apoptosis of malignant but not normal B cells. •PL inhibited LMP1–NF-κB–Myc-dependent target genes including p21-encoding Cdkn1a. •PL holds promise for new interventions approaches to hematologic malignancies. -- Abstract: Piperlongumine (PL), isolated from the fruit of Long pepper, Piper longum, is a cancer-inhibiting compound that selectively kills tumor cells while sparing their normal counterparts. Here we evaluated the efficacy with which PL suppresses malignant B cells derived from a newly developed, double-transgenic mouse model of human endemic Burkitt lymphoma (BL), designated mCD40-LMP1/iMyc{sup Eμ}. PLmore » inhibited tumor cell proliferation in a concentration-dependent manner and induced apoptosis of neoplastic but not normal B cells. Treatment with PL resulted in downregulation of EBV-encoded LMP1, cellular Myc, constitutive NF-κB activity, and a host of LMP1-Myc-NF-κB-regulated target genes including Aurka, Bcat1, Bub1b, Ccnb1, Chek1, Fancd2, Tfrc and Xrcc6. Of note, p21{sup Cip1}-encoding Cdkn1a was suppressed independent of changes in Trp53 mRNA levels and p53 DNA-binding activity. Considering the central role of the LMP1–NF-κB–Myc axis in B-lineage neoplasia, these findings further our understanding of the mechanisms by which PL inhibits B-lymphoma and provide a preclinical rationale for the inclusion of PL in new interventions in blood cancers.« less

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Three copies of a single protein II-encoding sequence in the genome of Neisseria gonorrhoeae JS3: evidence for gene conversion and gene duplication.

PubMed

van der Ley, P

1988-11-01

Gonococci express a family of related outer membrane proteins designated protein II (P.II). These surface proteins are subject to both phase variation and antigenic variation. The P.II gene repertoire of Neisseria gonorrhoeae strain JS3 was found to consist of at least ten genes, eight of which were cloned. Sequence analysis and DNA hybridization studies revealed that one particular P.II-encoding sequence is present in three distinct, but almost identical, copies in the JS3 genome. These genes encode the P.II protein that was previously identified as P.IIc. Comparison of their sequences shows that the multiple copies of this P.IIc-encoding gene might have been generated by both gene conversion and gene duplication.

Function of the ING family of PHD proteins in cancer.

PubMed

Gong, Wei; Suzuki, Keiko; Russell, Michael; Riabowol, Karl

2005-05-01

The ING genes encode a family of at least seven proteins with conserved plant homeodomain (PHD)-type zinc fingers in their C-termini. The founding member, ING1, is capable of binding to and affecting the activity of histone acetyltransferase (HAT), histone deacetylase (HDAC), and factor acetyltransferase (FAT) protein complexes. Some ING proteins are involved in transcriptional regulation of genes, such as the p53-inducible genes p21 and Bax. Others have been found to affect post-translational modifications, exemplified by the ING2-induced acetylation of p53 on the same site deacetylated by the Sir2 HDAC. Upon UV irradiation, ING1 causes cell cycle arrest and interacts with proliferating cell nuclear antigen to promote DNA repair or induce apoptosis in cells to prevent tumorigenesis depending upon the severity of DNA damage. It is very likely that, by linking DNA repair, apoptosis and chromatin remodeling to the transcriptional regulation of critical genes, ING1 exerts it tumor suppressor functions by helping maintain genomic stability. Therefore, ING proteins, which are down-regulated in a broad variety of cancer types, are able to restrict cell growth and proliferation, induce apoptosis, and modulate cell cycle progression, which strongly supports the notion that ING family proteins act as class II tumor suppressors.

The RNA surveillance protein SMG1 activates p53 in response to DNA double-strand breaks but not exogenously oxidized mRNA

PubMed Central

Gewandter, Jennifer S; Bambara, Robert A

2011-01-01

DNA damage, stalled replication forks, errors in mRNA splicing and availability of nutrients activate specific phosphatidylinositiol-3-kinase-like kinases (PIKKs) that in turn phosphorylate downstream targets such as p53 on serine 15. While the PIKK proteins ATM and ATR respond to specific DNA lesions, SMG1 responds to errors in mRNA splicing and when cells are exposed to genotoxic stress. Yet, whether genotoxic stress activates SMG1 through specific types of DNA lesions or RNA damage remains poorly understood. Here, we demonstrate that siRNA oligonucleotides targeting the mRNA surveillance proteins SMG1, Upf1, Upf2 or the PIKK protein ATM attenuated p53 (ser15) phosphorylation in cells damaged by high oxygen (hyperoxia), a model of persistent oxidative stress that damages nucleotides. In contrast, loss of SMG1 or ATM, but not Upf1 or Upf2 reduced p53 (ser15) phosphorylation in response to DNA double strand breaks produced by expression of the endonuclease I-PpoI. To determine whether SMG1-dependent activation of p53 was in response to oxidative mRNA damage, mRNA encoding green fluorescence protein (GFP) transcribed in vitro was oxidized by Fenton chemistry and transfected into cells. Although oxidation of GFP mRNA resulted in dose-dependent fragmentation of the mRNA and reduced expression of GFP, it did not stimulate p53 or the p53-target gene p21. These findings establish SMG1 activates p53 in response to DNA double strand breaks independent of the RNA surveillance proteins Upf1 or Upf2; however, these proteins can stimulate p53 in response to oxidative stress but not necessarily oxidized RNA. PMID:21701263

Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

PubMed

Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

2015-11-01

Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

Li-Fraumeni syndrome: cancer risk assessment and clinical management.

PubMed

McBride, Kate A; Ballinger, Mandy L; Killick, Emma; Kirk, Judy; Tattersall, Martin H N; Eeles, Rosalind A; Thomas, David M; Mitchell, Gillian

2014-05-01

Carriers of germline mutations in the TP53 gene, encoding the cell-cycle regulator and tumour suppressor p53, have a markedly increased risk of cancer-related morbidity and mortality during both childhood and adulthood, and thus require appropriate and effective cancer risk management. However, the predisposition of such patients to multiorgan tumorigenesis presents a specific challenge for cancer risk management programmes. Herein, we review the clinical implications of germline mutations in TP53 and the evidence for cancer screening and prevention strategies in individuals carrying such mutations, as well as examining the potential psychosocial implications of lifelong management for a ubiquitous cancer risk. In addition, we propose an evidence-based framework for the clinical management of TP53 mutation carriers and provide a platform for addressing the management of other cancer predisposition syndromes that can affect multiple organs.

Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Zhendong, E-mail: zdyu@hotmail.com; Wang, Hao; Zhang, Libin

CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrugmore » system.« less

p53 Mediates Vast Gene Expression Changes That Contribute to Poor Chemotherapeutic Response in a Mouse Model of Breast Cancer.

PubMed

Tonnessen-Murray, Crystal; Ungerleider, Nathan A; Rao, Sonia G; Wasylishen, Amanda R; Frey, Wesley D; Jackson, James G

2018-05-28

p53 is a transcription factor that regulates expression of genes involved in cell cycle arrest, senescence, and apoptosis. TP53 harbors mutations that inactivate its transcriptional activity in roughly 30% of breast cancers, and these tumors are much more likely to undergo a pathological complete response to chemotherapy. Thus, the gene expression program activated by wild-type p53 contributes to a poor response. We used an in vivo genetic model system to comprehensively define the p53- and p21-dependent genes and pathways modulated in tumors following doxorubicin treatment. We identified genes differentially expressed in spontaneous mammary tumors harvested from treated MMTV-Wnt1 mice that respond poorly (Trp53+/+) or favorably (Trp53-null) and those that lack the critical senescence/arrest p53 target gene Cdkn1a. Trp53 wild-type tumors differentially expressed nearly 10-fold more genes than Trp53-null tumors after treatment. Pathway analyses showed that genes involved in cell cycle, senescence, and inflammation were enriched in treated Trp53 wild-type tumors; however, no genes/pathways were identified that adequately explain the superior cell death/tumor regression observed in Trp53-null tumors. Cdkn1a-null tumors that retained arrest capacity (responded poorly) and those that proliferated (responded well) after treatment had remarkably different gene regulation. For instance, Cdkn1a-null tumors that arrested upregulated Cdkn2a (p16), suggesting an alternative, p21-independent route to arrest. Live animal imaging of longitudinal gene expression of a senescence/inflammation gene reporter in Trp53+/+ tumors showed induction during and after chemotherapy treatment, while tumors were arrested, but expression rapidly diminished immediately upon relapse. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Immunohistochemical Analysis of ATRX, IDH1 and p53 in Glioblastoma and Their Correlations with Patient Survival

PubMed Central

2016-01-01

Glioblastoma (GBM) can be classified into molecular subgroups, on the basis of biomarker expression. Here, we classified our cohort of 163 adult GBMs into molecular subgroups according to the expression of proteins encoded by genes of alpha thalassemia/mental retardation syndrome X-linked (ATRX), isocitrate dehydrogenase (IDH) and TP53. We focused on the survival rate of molecular subgroups, depending on each and various combination of these biomarkers. ATRX, IDH1 and p53 protein expression were evaluated immunohistochemically and Kaplan-Meier analysis were carried out in each group. A total of 15.3% of enrolled GBMs demonstrated loss of ATRX expression (ATRX-), 10.4% expressed an aberrant IDH1 R132H protein (IDH1+), and 48.4% exhibited p53 overexpression (p53+). Survival differences were statistically significant when single protein expression or different combinations of expression of these proteins were analyzed. In conclusion, in the case of single protein expression, the patients with each IDH1+, or ATRX-, or p53- GBMs showed better survival than patients with counterparts protein expressed GBMs. In the case of double protein pairs, the patients with ATRX-/p53-, ATRX-/IDH1+, and IDH1+/p53- GBMs revealed better survival than the patients with GBMs with the remained pairs. In the case of triple protein combinations, the patients with ATRX-/p53-/IDH+ showed statistically significant survival gain than the patients with remained combination of proteins-expression status. Therefore, these three biomarkers, individually and as a combination, can stratify GBMs into prognostically relevant subgroups and have strong prognostic values in adult GBMs. PMID:27478330

Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.

PubMed Central

el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.

1997-01-01

We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405

Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype.

PubMed

Waraya, Mina; Yamashita, Keishi; Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

2015-01-01

A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways.

The Origins and Evolution of the p53 Family of Genes

PubMed Central

Belyi, Vladimir A.; Ak, Prashanth; Markert, Elke; Wang, Haijian; Hu, Wenwei; Puzio-Kuter, Anna; Levine, Arnold J.

2010-01-01

A common ancestor to the three p53 family members of human genes p53, p63, and p73 is first detected in the evolution of modern‐day sea anemones, in which both structurally and functionally it acts to protect the germ line from genomic instabilities in response to stresses. This p63/p73 common ancestor gene is found in almost all invertebrates and first duplicates to produce a p53 gene and a p63/p73 ancestor in cartilaginous fish. Bony fish contain all three genes, p53, p63, and p73, and the functions of these three transcription factors diversify in the higher vertebrates. Thus, this gene family has preserved its structural features and functional activities for over one billion years of evolution. PMID:20516129

Tumor suppressor genes are larger than apoptosis-effector genes and have more regions of active chromatin: Connection to a stochastic paradigm for sequential gene expression programs.

PubMed

Garcia, Marlene; Mauro, James A; Ramsamooj, Michael; Blanck, George

2015-08-03

Apoptosis- and proliferation-effector genes are substantially regulated by the same transactivators, with E2F-1 and Oct-1 being notable examples. The larger proliferation-effector genes have more binding sites for the transactivators that regulate both sets of genes, and proliferation-effector genes have more regions of active chromatin, i.e, DNase I hypersensitive and histone 3, lysine-4 trimethylation sites. Thus, the size differences between the 2 classes of genes suggest a transcriptional regulation paradigm whereby the accumulation of transcription factors that regulate both sets of genes, merely as an aspect of stochastic behavior, accumulate first on the larger proliferation-effector gene "traps," and then accumulate on the apoptosis effector genes, thereby effecting sequential activation of the 2 different gene sets. As IRF-1 and p53 levels increase, tumor suppressor proteins are first activated, followed by the activation of apoptosis-effector genes, for example during S-phase pausing for DNA repair. Tumor suppressor genes are larger than apoptosis-effector genes and have more IRF-1 and p53 binding sites, thereby likewise suggesting a paradigm for transcription sequencing based on stochastic interactions of transcription factors with different gene classes. In this report, using the ENCODE database, we determined that tumor suppressor genes have a greater number of open chromatin regions and histone 3 lysine-4 trimethylation sites, consistent with the idea that a larger gene size can facilitate earlier transcriptional activation via the inclusion of more transactivator binding sites.

Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

PubMed

Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

2009-06-17

P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

The transcription factor p53: Not a repressor, solely an activator

PubMed Central

Fischer, Martin; Steiner, Lydia; Engeland, Kurt

2014-01-01

The predominant function of the tumor suppressor p53 is transcriptional regulation. It is generally accepted that p53-dependent transcriptional activation occurs by binding to a specific recognition site in promoters of target genes. Additionally, several models for p53-dependent transcriptional repression have been postulated. Here, we evaluate these models based on a computational meta-analysis of genome-wide data. Surprisingly, several major models of p53-dependent gene regulation are implausible. Meta-analysis of large-scale data is unable to confirm reports on directly repressed p53 target genes and falsifies models of direct repression. This notion is supported by experimental re-analysis of representative genes reported as directly repressed by p53. Therefore, p53 is not a direct repressor of transcription, but solely activates its target genes. Moreover, models based on interference of p53 with activating transcription factors as well as models based on the function of ncRNAs are also not supported by the meta-analysis. As an alternative to models of direct repression, the meta-analysis leads to the conclusion that p53 represses transcription indirectly by activation of the p53-p21-DREAM/RB pathway. PMID:25486564

Human microcephaly protein RTTN interacts with STIL and is required to build full-length centrioles.

PubMed

Chen, Hsin-Yi; Wu, Chien-Ting; Tang, Chieh-Ju C; Lin, Yi-Nan; Wang, Won-Jing; Tang, Tang K

2017-08-15

Mutations in many centriolar protein-encoding genes cause primary microcephaly. Using super-resolution and electron microscopy, we find that the human microcephaly protein, RTTN, is recruited to the proximal end of the procentriole at early S phase, and is located at the inner luminal walls of centrioles. Further studies demonstrate that RTTN directly interacts with STIL and acts downstream of STIL-mediated centriole assembly. CRISPR/Cas9-mediated RTTN gene knockout in p53-deficient cells induce amplification of primitive procentriole bodies that lack the distal-half centriolar proteins, POC5 and POC1B. Additional analyses show that RTTN serves as an upstream effector of CEP295, which mediates the loading of POC1B and POC5 to the distal-half centrioles. Interestingly, the naturally occurring microcephaly-associated mutant, RTTN (A578P), shows a low affinity for STIL binding and blocks centriole assembly. These findings reveal that RTTN contributes to building full-length centrioles and illuminate the molecular mechanism through which the RTTN (A578P) mutation causes primary microcephaly.Mutations in many centriolar protein-encoding genes cause primary microcephaly. Here the authors show that human microcephaly protein RTTN directly interacts with STIL and acts downstream of STIL-mediated centriole assembly, contributing to building full-length centrioles.

Jmjd5 functions as a regulator of p53 signaling during mouse embryogenesis.

PubMed

Ishimura, Akihiko; Terashima, Minoru; Tange, Shoichiro; Suzuki, Takeshi

2016-03-01

Genetic studies have shown that aberrant activation of p53 signaling leads to embryonic lethality. Maintenance of a fine balance of the p53 protein level is critical for normal development. Previously, we have reported that Jmjd5, a member of the Jumonji C (JmjC) family, regulates embryonic cell proliferation through the control of Cdkn1a expression. Since Cdkn1a is the representative p53-regulated gene, we have examined whether the expression of other p53 target genes is coincidentally upregulated with Cdkn1a in Jmjd5-deficient embryos. The expression of a subset of p53-regulated genes was increased in both Jmjd5 hypomorphic mouse embryonic fibroblasts (MEFs) and Jmjd5-deficient embryos at embryonic day 8.25 without the induced expression of Trp53. Intercrossing of Jmjd5-deficient mice with Trp53 knockout mice showed that the growth defect of Jmjd5 mutant cells was significantly recovered under a Trp53 null genetic background. Chromatin immunoprecipitation analysis in Jmjd5 hypomorphic MEFs indicated the increased recruitment of p53 at several p53 target gene loci, such as Cdkn1a, Pmaip1, and Mdm2. These results suggest that Jmjd5 is involved in the transcriptional regulation of a subset of p53-regulated genes, possibly through the control of p53 recruitment at the gene loci. In Jmjd5-deficient embryos, the enhanced recruitment of p53 might result in the abnormal activation of p53 signaling leading to embryonic lethality.

Heterogeneous distribution of P53 immunoreactivity in human lung adenocarcinoma correlates with MDM2 protein expression, rather than with P53 gene mutation.

PubMed

Koga, T; Hashimoto, S; Sugio, K; Yoshino, I; Nakagawa, K; Yonemitsu, Y; Sugimachi, K; Sueishi, K

2001-07-20

Although the tumor suppressor p53 protein (P53) immunoreactivity and its gene (p53) mutation were reported to be significant prognostic indicators for human lung adenocarcinomas, little is known regarding the relationship between the heterogeneous distribution of P53 and its genetic status in each tumor focus and the clinicopathological significance. To determine how P53 is heterogeneously stabilized in patients, we compared P53 expression to both the p53 allelic mutation in exon 2 approximately 9 by polymerase chain reaction-single strand conformation polymorphism using microdissected DNA fractions, and the immunohistochemical MDM2 expression. Of the 48 positive to P53 in 118 lung adenocarcinomas examined, 10 with heterogeneous P53 expression were closely examined. The higher P53 expression foci in 7 of 10 cases were less differentiated, histologically in respective cases, and were frequently associated with fibrous stroma. Two had genetic mutations in exon 7 of the p53 gene in both the high and low P53 expression foci of cancer tissue indicating no apparent correlation between heterogeneous P53 expression and the occurrence of gene mutation. Immunohistochemical expression of MDM2 was significantly lower in high P53 expression areas (p < 0.05, the mean labeling indices of high and low P53 expression areas being 4.2 +/- 5.4% and 13.6 +/- 12.2%, respectively). In addition, among all the 118 cases examined, MDM2 expression was significantly suppressed in cases of p53 gene mutation, simultaneously with P53 overexpression, as compared with cases without both the p53 mutation and expression (p < 0.001). These findings suggest that the heterogeneous stabilization of P53 in human lung adenocarcinomas could be partly due to suppressed MDM2 expression. The overexpression of non-mutated P53 may afford a protective mechanism in human lung adenocarcinomas. Copyright 2001 Wiley-Liss, Inc.

Analysis of TP53 gene expression and p53 level of human hypopharyngeal FaDu (HTB-43) head and neck cancer cell line after microRNA-181a inhibition.

PubMed

Cheah, Y K; Cheng, R W; Yeap, S K; Khoo, C H; See, H S

2014-03-17

The identification of new biomarkers for early detection of highly recurrent head and neck cancer is urgently needed. MicroRNAs (miRNAs) are small and non-coding RNAs that regulate cancer-related gene expression, such as tumor protein 53 (TP53) gene expression. This study was carried out to analyze TP53 gene expression using real-time PCR and to determine changes in intracellular p53 level by flow cytometry after downregulation of miRNA-181a miRNA inhibitor in the FaDu cell line. TP53 gene expression showed a 3-fold increment and the p53 protein level was also increased in the miRNA-181a-treated cells. In conclusion, miRNA-181a binds to the TP53 gene and inhibits its expression, decreasing the synthesis of p53.

GSTM1 and GSTT1 Genes are Associated With DNA Damage of p53 Gene in Coke-oven Workers.

PubMed

He, Yuefeng; Qi, Jun; He, Fang; Zhang, Yongchang; Wang, Youlian; Zhang, Ruobing; Li, Gang

2017-06-01

This study investigated whether variations in GSTT1 and GSTM1 gene are associated with the DNA damage level of p53 gene. We quantified urinary 1-hydroxypyrene using high-performance liquid chromatography, and examined the DNA damage level of p53 gene by real-time quantitative PCR in 756 coke-oven workers. Multiplex PCR was used to detect the presence or absence of genes. DNA damage levels of p53 gene in the high exposure group and intermediate exposure group were significantly higher than that of p53 gene in the low exposure group (P < 0.01). In coke-oven workers, the DNA damage levels of subjects with non-null genotype in GSTT1 or GSTM1 gene were significantly higher than that of those with the null genotype (P < 0.01). GSTT1 and GSTM1 may modulate DNA damage levels of p53 gene when exposed to polycyclic aromatic hydrocarbons.

Development of Yeast as an In Vivo Test Tube to Characterize a Broad Spectrum of p53 Mutations Associated with Breast Cancer

DTIC Science & Technology

2002-10-01

there is a mutation in the p53 gene itself (4, 5). Interestingly, -80% of p53 mutations are missense changes that lead to single amino acid...substitutions, a feature that distinguishes p53 from other tumor suppressor genes (e.g., APC, NF1, BRCAJ) (6). The incidence of p53 mutations and the types of...intronic promoter is contained within the human mutation hotspot maps of p53: correlation with p53 protein structural and mdm2 gene . Nucleic Acids Res

Epstein-Barr virus/complement fragment C3d receptor (CR2) reacts with p53, a cellular antioncogene-encoded membrane phosphoprotein: detection by polyclonal anti-idiotypic anti-CR2 antibodies.

PubMed Central

Barel, M; Fiandino, A; Lyamani, F; Frade, R

1989-01-01

Epstein-Barr virus and the C3d fragment of the third component of complement are specific extracellular ligands for complement receptor type 2 (CR2). However, intracellular proteins that react specifically with CR2 and are involved in post-membrane signals remain unknown. We recently prepared polyclonal anti-idiotypic anti-CR2 antibodies (Ab2) by using the highly purified CR2 molecule as original immunogen. We showed that Ab2 contained anti-idiotypic specificities that mimicked extracellular domains of CR2 and detected two distinct binding sites on CR2 for its specific extracellular ligands, Epstein-Barr virus and C3d. We postulated that Ab2 might also contain specificities that could mimic intracellular domains of CR2. Here we report that Ab2, which did not react with Raji B-lymphoma cell surface components, detected specifically, among all components solubilized from Raji cell membranes, a single intracellular membrane protein of apparent molecular mass of 53 kDa. This protein was identified as the p53 cellular antioncogene-encoded membrane phosphoprotein by analyzing its antigenic properties with Pab1801, a monoclonal anti-p53 antibody, and by comparing its biochemical properties with those of p53. Additionally, solubilized and purified CR2 bound to solubilized p53 immobilized on Pab1801-Sepharose. p53, like CR2, was localized only in purified plasma membranes and nuclei of Raji cells. These data suggest strongly that p53, a cellular antioncogene-encoded phosphoprotein, reacted specifically with CR2 in Raji membranes. This interaction may represent one of the important steps through which CR2 could be involved in human B-lymphocyte proliferation and transformation. Images PMID:2557614

Mutation analysis of the p53, APC, and p16 genes in the Barrett's oesophagus, dysplasia, and adenocarcinoma.

PubMed Central

González, M V; Artímez, M L; Rodrigo, L; López-Larrea, C; Menéndez, M J; Alvarez, V; Pérez, R; Fresno, M F; Pérez, M J; Sampedro, A; Coto, E

1997-01-01

AIMS: To study the loss of heterozygosity and the presence of mutations at the p53, p16/CDKN2, and APC genes in Barrett's oesophagus, low grade dysplastic oesophageal epithelium, and adenocarcinoma of the oesophagus; to relate the presence of alterations at these genes with the progression from Barrett's oesophagus to adenocarcinoma. METHODS: DNA was extracted from paraffin blocks containing tissue from Barrett's oesophagus (12 samples), low grade dysplasia (15 cases), and adenocarcinoma (14 cases). Loss of heterozygosity (LOH) at the p53, p16, and APC genes was determined by comparing the autoradiographic patterns of several microsatellite markers between the normal tissue and the malignant tissue counterpart. SSCP was used to determine the presence of mutations at p53 (exons 5 to 8), p16 (exon 2), and APC. Homozygous deletion of the p16 gene was defined through polymerase chain reaction followed by Southern blot. RESULTS: LOH at the p53, p16, and APC genes was not observed in Barrett's oesophagus without dysplasia, and increased to 90% (p53), 89% (p16), and 60% (APC) in the adenocarcinomas. The p53 gene was mutated in only two adenocarcinomas (codons 175 and 245). In one case a mutation at the APC gene (codon 1297) was found. No patient had mutation at the second exon of p16. However, this gene was homozygously deleted in three of the 12 adenocarcinomas. CONCLUSIONS: The tumour suppressor genes p53, p16, and APC are often deleted in adenocarcinomas derived from Barrett's oesophagus. Mutations at these genes are also found in the adenocarcinomas, including the homozygous deletion of the p16 gene. However, the absence of genetic alterations in the Barrett's oesophagus and the low grade dysplastic epithelia suggest that mutations at these genes develop later in the progression from Barrett's oesophagus to adenocarcinoma. Images PMID:9155671

p53 genes function to restrain mobile elements

PubMed Central

Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

2016-01-01

Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

Hematopoietic stem cells are acutely sensitive to Acd shelterin gene inactivation

PubMed Central

Jones, Morgan; Osawa, Gail; Regal, Joshua A.; Weinberg, Daniel N.; Taggart, James; Kocak, Hande; Friedman, Ann; Ferguson, David O.; Keegan, Catherine E.; Maillard, Ivan

2013-01-01

The shelterin complex plays dual functions in telomere homeostasis by recruiting telomerase and preventing the activation of a DNA damage response at telomeric ends. Somatic stem cells require telomerase activity, as evidenced by progressive stem cell loss leading to bone marrow failure in hereditary dyskeratosis congenita. Recent work demonstrates that dyskeratosis congenita can also arise from mutations in specific shelterin genes, although little is known about shelterin functions in somatic stem cells. We found that mouse hematopoietic stem cells (HSCs) are acutely sensitive to inactivation of the shelterin gene Acd, encoding TPP1. Homozygosity for a hypomorphic acd allele preserved the emergence and expansion of fetal HSCs but led to profoundly defective function in transplantation assays. Upon complete Acd inactivation, HSCs expressed p53 target genes, underwent cell cycle arrest, and were severely depleted within days, leading to hematopoietic failure. TPP1 loss induced increased telomeric fusion events in bone marrow progenitors. However, unlike in epidermal stem cells, p53 deficiency did not rescue TPP1-deficient HSCs, indicating that shelterin dysfunction has unique effects in different stem cell populations. Because the consequences of telomere shortening are progressive and unsynchronized, acute loss of shelterin function represents an attractive alternative for studying telomere crisis in hematopoietic progenitors. PMID:24316971

The high-mobility-group box protein SSRP1/T160 is essential for cell viability in day 3.5 mouse embryos.

PubMed

Cao, Shang; Bendall, Heather; Hicks, Geoffrey G; Nashabi, Abudi; Sakano, Hitoshi; Shinkai, Yoichi; Gariglio, Marisa; Oltz, Eugene M; Ruley, H Earl

2003-08-01

The high-mobility-group (HMG) SSRP1 protein is a member of a conserved chromatin-remodeling complex (FACT/DUF/CP) implicated in DNA replication, basal and regulated transcription, and DNA repair. To assist in the functional analysis of SSRP1, the Ssrp1 gene was targeted in murine embryonic stem cells, and the mutation was introduced into the germ line. Embryos homozygous for the targeted allele die soon after implantation, and preimplantation blastocysts are defective for cell outgrowth and/or survival in vitro. The Ssrp1 mutation was also crossed into a p53 null background without affecting growth and/or survival defects caused by loss of Ssrp1 function. Thus, Ssrp1 appears to encode nonredundant and p53-independent functions that are essential for cell viability.

Epstein–Barr virus nuclear antigen 3C interact with p73: Interplay between a viral oncoprotein and cellular tumor suppressor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sahu, Sushil Kumar; Mohanty, Suchitra; Kumar, Amit

The p73 protein has structural and functional homology with the tumor suppressor p53, which plays an important role in cell cycle regulation, apoptosis, and DNA repair. The p73 locus encodes both a tumor suppressor (TAp73) and a putative oncogene (ΔNp73). p73 May play a significant role in p53-deficient lymphomas infected with Epstein–Barr virus (EBV). EBV produces an asymptomatic infection in the majority of the global population, but it is associated with several human B-cell malignancies. The EBV-encoded Epstein–Barr virus nuclear antigen 3C (EBNA3C) is thought to disrupt the cell cycle checkpoint by interacting directly with p53 family proteins. Doxorubicin, amore » commonly used chemotherapeutic agent, induces apoptosis through p53 and p73 signaling such that the lowΔNp73 level promotes the p73-mediated intrinsic pathway of apoptosis. In this report, we investigated the mechanism by which EBV infection counters p73α-induced apoptosis through EBNA3C. - Highlights: • EBV-encoded EBNA3C suppresses doxorubicin-induced apoptosis in B-cell lymphomas. • EBNA3C binds to p73 to suppress its apoptotic effect. • EBNA3C maintains latency by regulating downstream mitochondrial pathways.« less

p53 downregulates the Fanconi anaemia DNA repair pathway

PubMed Central

Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

2016-01-01

Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104

p53 downregulates the Fanconi anaemia DNA repair pathway.

PubMed

Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

2016-04-01

Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

Investigating the Molecular Mechanism of TSO1 Function in Arabidopsis cell division and meristem development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhongchi Liu

2004-10-01

Unlike animals, plants are constantly exposed to environmental mutagens including ultraviolet light and reactive oxygen species. Further, plant cells are totipotent with highly plastic developmental programs. An understanding of molecular mechanisms underlying the ability of plants to monitor and repair its DNA and to eliminate damaged cells are of great importance. Previously we have identified two genes, TSO1 and TSO2, from a flowering plant Arabidopsis thaliana. Mutations in these two genes cause callus-like flowers, fasciated shoot apical meristems, and abnormal cell division, indicating that TSO1 and TSO2 may encode important cell cycle regulators. Previous funding from DOE led to themore » molecular cloning of TSO1, which was shown to encode a novel nuclear protein with two CXC domains suspected to bind DNA. This DOE grant has allowed us to characterize and isolate TSO2 that encodes the small subunit of the ribonucleotide reductase (RNR). RNR comprises two large subunits (R1) an d two small subunits (R2), catalyzes a rate-limiting step in the production of deoxyribonucleotides needed for DNA replication and repair. Previous studies in yeast and mammals indicated that defective RNR often led to cell cycle arrest, growth retardation and p53-dependent apoptosis while abnormally elevated RNR activities led to higher mutation rates. Subsequently, we identified two additional R2 genes, R2A and R2B in the Arabidopsis genome. Using reverse genetics, mutations in R2A and R2B were isolated, and double and triple mutants among the three R2 genes (TSO2, R2A and R2B) were constructed and analyzed. We showed that Arabidopsis tso2 mutants, with reduced dNTP levels, were more sensitive to UV-C. While r2a or r2b single mutants did not exhibit any phenotypes, tso2 r2b double mutants were embryonic lethal and tso2 r2a double mutants were seedling lethal indicating redundant functions among the three R2 genes. Furthermore, tso2 r2a double mutants exhibited increased DNA dam age, massive programmed cell death, and the release of transcriptional gene silencing. Our data suggests that plants can initiate programmed cell death to eliminate damaged cells despite the absence of p53 in plant genome.« less

Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

PubMed Central

Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

2012-01-01

During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

PubMed

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

PubMed Central

Polato, Federica; Rusconi, Paolo

2014-01-01

Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santhanam, U.; Ray, A.; Sehgal, P.B.

1991-09-01

The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less

Application of six multiplex PCR's among 200 clinical isolates of Pseudomonas aeruginosa for the detection of 20 drug resistance encoding genes.

PubMed

Murugan, Nandagopal; Malathi, Jambulingam; Therese, K Lily; Madhavan, Hajib NarahariRao

2018-02-01

Pseudomonas aeruginosa (P. aeruginosa) is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA) has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR) to detect the presence of betalactamase genes encoding bla Tem , bla OXA , bla CTX-M-15 , bla Vim , bla Ges , bla Veb , bla DIM , AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5%) nfxB regulator gene, 102 (51%) MexA, 96 (48%) MexC, 93 (46.5%) MexB, 86 (43%) MexD, 81 (40.5%) OprM, 74 (37%) OprJ, 72 (36%) OprD and MexR, 53 (26.5%) Mex X and OprN, 49 (24.5%) MexY gene. Betalactamase genes 145 (72.5%) bla Tem , 67 (33.5%) bla OXA, 35 (17.5%) blaVim, 25(12.50%), 23 (11.50%) blaVeb, 21 (11.5%) blaGes, 14 (7%) Ctx-m and 10 (5%) AmpC and 5 (2.5%) blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19%) and 29 (14.5%) out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection. Copyright © 2017. Published by Elsevier Taiwan.

A rare variant in MYH6 is associated with high risk of sick sinus syndrome

PubMed Central

Holm, Hilma; Gudbjartsson, Daniel F; Sulem, Patrick; Masson, Gisli; Helgadottir, Hafdis Th; Zanon, Carlo; Magnusson, Olafur Th; Helgason, Agnar; Saemundsdottir, Jona; Gylfason, Arnaldur; Stefansdottir, Hrafnhildur; Gretarsdottir, Solveig; Matthiasson, Stefan E; Thorgeirsson, Guðmundur; Jonasdottir, Aslaug; Sigurdsson, Asgeir; Stefansson, Hreinn; Werge, Thomas; Rafnar, Thorunn; Kiemeney, Lambertus A; Parvez, Babar; Muhammad, Raafia; Roden, Dan M; Darbar, Dawood; Thorleifsson, Gudmar; Walters, G Bragi; Kong, Augustine; Thorsteinsdottir, Unnur; Arnar, David O; Stefansson, Kari

2011-01-01

Through complementary application of SNP genotyping, whole-genome sequencing and imputation in 38,384 Icelanders, we have discovered a previously unidentified sick sinus syndrome susceptibility gene, MYH6, encoding the alpha heavy chain subunit of cardiac myosin. A missense variant in this gene, c.2161C>T, results in the conceptual amino acid substitution p.Arg721Trp, has an allelic frequency of 0.38% in Icelanders and associates with sick sinus syndrome with an odds ratio = 1 2.53 and P = 1.5 × 10−29. We show that the lifetime risk of being diagnosed with sick sinus syndrome is around 6% for non-carriers of c.2161C>T but is approximately 50% for carriers of the c.2161C>T variant. PMID:21378987

Adenovirus-Mediated p202 Gene Transfer in Breast Cancer Gene Therapy

DTIC Science & Technology

2005-05-01

transcriptional regulation of genes important for cell cycle control, differentiation, and apoptosis (1, 3, 4). Our previous studies have shown that p202...leads to induction of p53 and activation of p53 target gene (e.g., p21 CIP 1). 10. The positive regulation of p53 by IFIXcd can be observed only in...cancers. Together, our data suggest that both Ad-p202 and IFIX may be further developed into efficient therapeutic agents for human cancer gene

Stimulation of autophagy by the p53 target gene Sestrin2.

PubMed

Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

2009-05-15

The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

PubMed

Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

2016-08-15

Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

Regulatory module involving FGF13, miR-504, and p53 regulates ribosomal biogenesis and supports cancer cell survival

PubMed Central

Bublik, Débora R.; Bursać, Slađana; Sheffer, Michal; Oršolić, Ines; Shalit, Tali; Tarcic, Ohad; Kotler, Eran; Mouhadeb, Odelia; Hoffman, Yonit; Fuchs, Gilad; Levin, Yishai; Volarević, Siniša; Oren, Moshe

2017-01-01

The microRNA miR-504 targets TP53 mRNA encoding the p53 tumor suppressor. miR-504 resides within the fibroblast growth factor 13 (FGF13) gene, which is overexpressed in various cancers. We report that the FGF13 locus, comprising FGF13 and miR-504, is transcriptionally repressed by p53, defining an additional negative feedback loop in the p53 network. Furthermore, we show that FGF13 1A is a nucleolar protein that represses ribosomal RNA transcription and attenuates protein synthesis. Importantly, in cancer cells expressing high levels of FGF13, the depletion of FGF13 elicits increased proteostasis stress, associated with the accumulation of reactive oxygen species and apoptosis. Notably, stepwise neoplastic transformation is accompanied by a gradual increase in FGF13 expression and increased dependence on FGF13 for survival (“nononcogene addiction”). Moreover, FGF13 overexpression enables cells to cope more effectively with the stress elicited by oncogenic Ras protein. We propose that, in cells in which activated oncogenes drive excessive protein synthesis, FGF13 may favor survival by maintaining translation rates at a level compatible with the protein quality-control capacity of the cell. Thus, FGF13 may serve as an enabler, allowing cancer cells to evade proteostasis stress triggered by oncogene activation. PMID:27994142

CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.

PubMed

Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

2017-09-19

Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.

CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation

PubMed Central

Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

2017-01-01

Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14–Cre–ERT2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14–Cre–ERT2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte–stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn. PMID:28878021

A mutation screening of oncogenes, tumor suppressor gene TP53 and nuclear encoded mitochondrial complex I genes in oncocytic thyroid tumors.

PubMed

Evangelisti, Cecilia; de Biase, Dario; Kurelac, Ivana; Ceccarelli, Claudio; Prokisch, Holger; Meitinger, Thomas; Caria, Paola; Vanni, Roberta; Romeo, Giovanni; Tallini, Giovanni; Gasparre, Giuseppe; Bonora, Elena

2015-03-21

Thyroid neoplasias with oncocytic features represent a specific phenotype in non-medullary thyroid cancer, reflecting the unique biological phenomenon of mitochondrial hyperplasia in the cytoplasm. Oncocytic thyroid cells are characterized by a prominent eosinophilia (or oxyphilia) caused by mitochondrial abundance. Although disruptive mutations in the mitochondrial DNA (mtDNA) are the most significant hallmark of such tumors, oncocytomas may be envisioned as heterogeneous neoplasms, characterized by multiple nuclear and mitochondrial gene lesions. We investigated the nuclear mutational profile of oncocytic tumors to pinpoint the mutations that may trigger the early oncogenic hit. Total DNA was extracted from paraffin-embedded tissues from 45 biopsies of oncocytic tumors. High-resolution melting was used for mutation screening of mitochondrial complex I subunits genes. Specific nuclear rearrangements were investigated by RT-PCR (RET/PTC) or on isolated nuclei by interphase FISH (PAX8/PPARγ). Recurrent point mutations were analyzed by direct sequencing. In our oncocytic tumor samples, we identified rare TP53 mutations. The series of analyzed cases did not include poorly- or undifferentiated thyroid carcinomas, and none of the TP53 mutated cases had significant mitotic activity or high-grade features. Thus, the presence of disruptive TP53 mutations was completely unexpected. In addition, novel mutations in nuclear-encoded complex I genes were identified. These findings suggest that nuclear genetic lesions altering the bioenergetics competence of thyroid cells may give rise to an aberrant mitochondria-centered compensatory mechanism and ultimately to the oncocytic phenotype.

Depletion of hepatoma-derived growth factor-related protein-3 induces apoptotic sensitization of radioresistant A549 cells via reactive oxygen species-dependent p53 activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yun, Hong Shik; Hong, Eun-Hee; Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791

2013-09-27

Highlights: •HRP-3 is a radiation- and anticancer drug-responsive protein in A549 cells. •Depletion of HRP-3 induces apoptosis of radio- and chemoresistant A549 cells. •Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. •Depletion of HRP-3 enhances ROS-dependent p53 activation and PUMA expression. -- Abstract: Biomarkers based on functional signaling have the potential to provide greater insight into the pathogenesis of cancer and may offer additional targets for anticancer therapeutics. Here, we identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistance-related gene and characterized the molecular mechanism by which its encoded protein regulates the radio- and chemoresistant phenotypemore » of lung cancer-derived A549 cells. Knockdown of HRP-3 promoted apoptosis of A549 cells and potentiated the apoptosis-inducing action of radio- and chemotherapy. This increase in apoptosis was associated with a substantial generation of reactive oxygen species (ROS) that was attributable to inhibition of the Nrf2/HO-1 antioxidant pathway and resulted in enhanced ROS-dependent p53 activation and p53-dependent expression of PUMA (p53 upregulated modulator of apoptosis). Therefore, the HRP-3/Nrf2/HO-1/ROS/p53/PUMA cascade is an essential feature of the A549 cell phenotype and a potential radiotherapy target, extending the range of targets in multimodal therapies against lung cancer.« less

TP53 mutations, expression and interaction networks in human cancers

PubMed Central

Wang, Xiaosheng; Sun, Qingrong

2017-01-01

Although the associations of p53 dysfunction, p53 interaction networks and oncogenesis have been widely explored, a systematic analysis of TP53 mutations and its related interaction networks in various types of human cancers is lacking. Our study explored the associations of TP53 mutations, gene expression, clinical outcomes, and TP53 interaction networks across 33 cancer types using data from The Cancer Genome Atlas (TCGA). We show that TP53 is the most frequently mutated gene in a number of cancers, and its mutations appear to be early events in cancer initiation. We identified genes potentially repressed by p53, and genes whose expression correlates significantly with TP53 expression. These gene products may be especially important nodes in p53 interaction networks in human cancers. This study shows that while TP53-truncating mutations often result in decreased TP53 expression, other non-truncating TP53 mutations result in increased TP53 expression in some cancers. Survival analyses in a number of cancers show that patients with TP53 mutations are more likely to have worse prognoses than TP53-wildtype patients, and that elevated TP53 expression often leads to poor clinical outcomes. We identified a set of candidate synthetic lethal (SL) genes for TP53, and validated some of these SL interactions using data from the Cancer Cell Line Project. These predicted SL genes are promising candidates for experimental validation and the development of personalized therapeutics for patients with TP53-mutated cancers. PMID:27880943

TP53 mutations, expression and interaction networks in human cancers.

PubMed

Wang, Xiaosheng; Sun, Qingrong

2017-01-03

Although the associations of p53 dysfunction, p53 interaction networks and oncogenesis have been widely explored, a systematic analysis of TP53 mutations and its related interaction networks in various types of human cancers is lacking. Our study explored the associations of TP53 mutations, gene expression, clinical outcomes, and TP53 interaction networks across 33 cancer types using data from The Cancer Genome Atlas (TCGA). We show that TP53 is the most frequently mutated gene in a number of cancers, and its mutations appear to be early events in cancer initiation. We identified genes potentially repressed by p53, and genes whose expression correlates significantly with TP53 expression. These gene products may be especially important nodes in p53 interaction networks in human cancers. This study shows that while TP53-truncating mutations often result in decreased TP53 expression, other non-truncating TP53 mutations result in increased TP53 expression in some cancers. Survival analyses in a number of cancers show that patients with TP53 mutations are more likely to have worse prognoses than TP53-wildtype patients, and that elevated TP53 expression often leads to poor clinical outcomes. We identified a set of candidate synthetic lethal (SL) genes for TP53, and validated some of these SL interactions using data from the Cancer Cell Line Project. These predicted SL genes are promising candidates for experimental validation and the development of personalized therapeutics for patients with TP53-mutated cancers.

Manganese superoxide dismutase: beyond life and death

PubMed Central

Holley, Aaron K.; Dhar, Sanjit Kumar; Xu, Yong

2010-01-01

Manganese superoxide dismutase (MnSOD) is a nuclear-encoded antioxidant enzyme that localizes to the mitochondria. Expression of MnSOD is essential for the survival of aerobic life. Transgenic mice expressing a luciferase reporter gene under the control of the human MnSOD promoter demonstrate that the level of MnSOD is reduced prior to the formation of cancer. Overexpression of MnSOD in transgenic mice reduces the incidences and multiplicity of papillomas in a DMBA/TPA skin carcinogenesis model. However, MnSOD deficiency does not lead to enhanced tumorigenicity of skin tissue similarly treated because MnSOD can modulate both the p53-mediated apoptosis and AP-1-mediated cell proliferation pathways. Apoptosis is associated with an increase in mitochondrial levels of p53 suggesting a link between MnSOD deficiency and mitochondrial-mediated apoptosis. Activation of p53 is preventable by application of a SOD mimetic (MnTE-2-PyP5+). Thus, p53 translocation to mitochondria and subsequent inactivation of MnSOD explain the observed mitochondrial dysfunction that leads to transcription-dependent mechanisms of p53-induced apoptosis. Administration of MnTE-2-PyP5+ following apoptosis but prior to proliferation leads to suppression of protein carbonyls and reduces the activity of AP-1 and the level of the proliferating cellular nuclear antigen, without reducing the activity of p53 or DNA fragmentation following TPA treatment. Remarkably, the incidence and multiplicity of skin tumors are drastically reduced in mice that receive MnTE-2-PyP5+ prior to cell proliferation. The results demonstrate the role of MnSOD beyond its essential role for survival and suggest a novel strategy for an antioxidant approach to cancer intervention. PMID:20454814

Control of G1 arrest after DNA damage.

PubMed Central

Kastan, M B; Kuerbitz, S J

1993-01-01

The temporal relationship between DNA damage and DNA replication may be critical in determining whether the genetic changes necessary for cellular transformation occur after DNA damage. Recent characterization of the mechanisms responsible for alterations in cell-cycle progression after DNA damage in our laboratory have implicated the p53 (tumor suppressor) protein in the G1 arrest that occurs after certain types of DNA damage. In particular, we found that levels of p53 protein increased rapidly and transiently after nonlethal doses of gamma irradiation (XRT) in hematopoietic cells with wild-type, but not mutant, p53 genes. These changes in p53 protein levels were temporally linked to a transient G1 arrest in these cells. Hematopoietic cells with mutant or absent p53 genes did not exhibit this G1 arrest, through they continued to demonstrate a G2 arrest. We recently extended these observations of a tight correlation between the status of the endogenous p53 genes and this G1 arrest after XRT and this cell-cycle alteration after XRT was then established by transfecting cells lacking endogenous p53 genes with a wild-type gene and observing acquisition of the G1 arrest and by transfecting cells processing endogenous wild-type p53 genes with a mutant p53 gene and observing loss of the G1 arrest after XRT. These observations and their significance for our understanding of the mechanisms of DNA damage-induced cellular transformation are discussed. PMID:8013425

Adenovirus-mediated p53 gene delivery potentiates the radiation-induced growth inhibition of experimental brain tumors.

PubMed

Badie, B; Kramar, M H; Lau, R; Boothman, D A; Economou, J S; Black, K L

1998-05-01

Patients with malignant gliomas continue to have very poor prognosis even after surgical resection, radiation and chemotherapy. Because these tumors often have alterations in the p53 tumor suppressor gene, which plays a key role in the cellular response to DNA damaging agents, we investigated the role of p53 gene therapy in conjunction with ionizing radiation in a rat brain tumor model. Exposure of cultured rat 9L gliosarcoma cells, which contain a mutant p53 gene, to a recombinant adenovirus-vector bearing the wild-type p53 gene (Adp53), induced apoptosis within 24 hours. Although ionizing radiation had no additional effect on apoptosis within this time frame, it caused G1 arrest in non-apoptotic cells after Adp53 therapy. In contrast, wild-type 9L cells demonstrated little G1 arrest after X-irradiation. When animals bearing brain tumors were irradiated after intratumoral Adp53 injections, more than 85% reduction in tumor size was noted. Moreover, the group of rats receiving both radiation and Adp53 therapy had a significant increase in survival as compared to animals receiving either therapy alone. These results support the use of p53 gene therapy as an adjunct to radiation in treatment of malignant brain tumors.

Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

PubMed

Loging, W T; Reisman, D

1999-11-01

The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.

PubMed

Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens

2005-04-01

The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.

Prognostic significance of CCND1 (cyclin D1) overexpression in primary resected non-small-cell lung cancer.

PubMed Central

Betticher, D. C.; Heighway, J.; Hasleton, P. S.; Altermatt, H. J.; Ryder, W. D.; Cerny, T.; Thatcher, N.

1996-01-01

Amplification of the CCDN1 gene encoding cyclin D1 was examined by Southern blotting and multiplex polymerase chain reaction (PCR) and occurred in 8 of 53 patients (15%) with primary resected non-small-cell lung cancer (NSCLC). These tumours and 17 additional tumours with a normal gene copy number showed overexpression of cyclin D1 (25/53, 47%), as assessed by immunostaining using a monoclonal antibody. In 22/25 cases, cyclin D1 was localised in the cytoplasm, but some (7/25) had simultaneous nuclear staining. This result is in marked contrast to that reported in breast, hepatocellular and colorectal carcinoma studies where immunostaining was invariably nuclear. Examination of a restriction fragment length polymorphic (RFLP) site within the 3'untranslated region of the cDNA following reverse transcriptase (RT)-PCR (29/53 informative cases) showed a strong association between cytoplasmic staining and imbalance in allele-specific message levels. Cyclin D1 overexpression was associated with a poorly differentiated histology (P = 0.04), less lymphocytic infiltration of the tumour (P = 0.02) and a reduction in local relapse rate (P = 0.01). The relative risk of local relapse was 9.1 in tumours without cyclin D1 overexpression (P = 0.01, Cox regression analysis). We conclude that genetic alteration of cyclin D1 is a key abnormality in lung carcinogenesis and may have diagnostic and prognostic importance in the treatment of resectable NSCLC. Images Figure 1 Figure 2 Figure 3 PMID:8562333

Regulation of p53 Target Gene Expression by Peptidylarginine Deiminase 4 ▿ †

PubMed Central

Li, Pingxin; Yao, Hongjie; Zhang, Zhiqiang; Li, Ming; Luo, Yuan; Thompson, Paul R.; Gilmour, David S.; Wang, Yanming

2008-01-01

Histone Arg methylation has been correlated with transcriptional activation of p53 target genes. However, whether this modification is reversed to repress the expression of p53 target genes is unclear. Here, we report that peptidylarginine deiminase 4, a histone citrullination enzyme, is involved in the repression of p53 target genes. Inhibition or depletion of PAD4 elevated the expression of a subset of p53 target genes, including p21/CIP1/WAF1, leading to cell cycle arrest and apoptosis. Moreover, the induction of p21, cell cycle arrest, and apoptosis by PAD4 depletion is p53 dependent. Protein-protein interaction studies showed an interaction between p53 and PAD4. Chromatin immunoprecipitation assays showed that PAD4 is recruited to the p21 promoter in a p53-dependent manner. RNA polymerase II (Pol II) activities and the association of PAD4 are dynamically regulated at the p21 promoter during UV irradiation. Paused RNA Pol II and high levels of PAD4 were detected before UV treatment. At early time points after UV treatment, an increase of histone Arg methylation and a decrease of citrullination were correlated with a transient activation of p21. At later times after UV irradiation, a loss of RNA Pol II and an increase of PAD4 were detected at the p21 promoter. The dynamics of RNA Pol II activities after UV treatment were further corroborated by permanganate footprinting. Together, these results suggest a role of PAD4 in the regulation of p53 target gene expression. PMID:18505818

Immunohistochemical detection of tumor suppressor gene p53 protein in feline injection site-associated sarcomas.

PubMed

Nambiar, P R; Jackson, M L; Ellis, J A; Chelack, B J; Kidney, B A; Haines, D M

2001-03-01

Sarcomas associated with injection sites are a rare but important problem in cats. Immunohistochemical detection of p53 protein may correlate to mutation of the p53 tumor suppressor gene, a gene known to be important in oncogenesis. The expression of nuclear p53 protein in 40 feline injection site-assocated sarcomas was examined by immunohistochemical staining. In 42.5% (17/40), tumor cell nuclei were stained darkly; in 20% (8/40), tumor cell nuclei were stained palely; and in 37.5% (15/40), tumor cell nuclei were unstained. Immunohistochemical detection of p53 protein in a proportion of injection site-associated sarcomas suggests that mutation of the p53 gene may play a role in the pathogenesis of these tumors.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simoes, Maria L.; Hockley, Sarah L.; Schwerdtle, Tanja

Aristolochic acid (AA) is the causative agent of urothelial tumours associated with aristolochic acid nephropathy. These tumours contain TP53 mutations and over-express TP53. We compared transcriptional and translational responses of two isogenic HCT116 cell lines, one expressing TP53 (p53-WT) and the other with this gene knocked out (p53-null), to treatment with aristolochic acid I (AAI) (50-100 {mu}M) for 6-48 h. Modulation of 118 genes was observed in p53-WT cells and 123 genes in p53-null cells. Some genes, including INSIG1, EGR1, CAV1, LCN2 and CCNG1, were differentially expressed in the two cell lines. CDKN1A was selectively up-regulated in p53-WT cells, leadingmore » to accumulation of TP53 and CDKN1A. Apoptotic signalling, measured by caspase-3 and -7 activity, was TP53-dependent. Both cell types accumulated in S phase, suggesting that AAI-DNA adducts interfere with DNA replication, independently of TP53 status. The oncogene MYC, frequently over-expressed in urothelial tumours, was up-regulated by AAI, whereas FOS was down-regulated. Observed modulation of genes involved in endocytosis, e.g. RAB5A, may be relevant to the known inhibition of receptor-mediated endocytosis, an early sign of AA-mediated proximal tubule injury. AAI-DNA adduct formation was significantly greater in p53-WT cells than in p53-null cells. Collectively, phenotypic anchoring of the AAI-induced expression profiles to DNA adduct formation, cell-cycle parameters, TP53 expression and apoptosis identified several genes linked to these biological outcomes, some of which are TP53-dependent. These results strengthen the importance of TP53 in AA-induced cancer, and indicate that other alterations, e.g. to MYC oncogenic pathways, may also contribute.« less

The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

PubMed

Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

2000-03-01

Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

PubMed

He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

2016-01-01

The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

DNA variation in the genes of the Na,K-adenosine triphosphatase and its relation with resting metabolic rate, respiratory quotient, and body fat.

PubMed

Dériaz, O; Dionne, F; Pérusse, L; Tremblay, A; Vohl, M C; Côté, G; Bouchard, C

1994-02-01

The aim of this study was to investigate in 261 subjects from 58 families the association between DNA variation at the genes coding for the Na,K-ATPase peptides and resting metabolic rate (RMR), respiratory quotient (RQ), and percent body fat (%FAT). Five restriction fragment length polymorphisms (RFLP) at three Na,K-ATPase genes were determined: one at the alpha 1 locus (BglII), and two at the beta locus (beta MspI and beta PvuII). Haplotypes were determined from the two variable sites of the alpha 2 gene (alpha 2 haplotypes) and the beta gene (beta haplotypes). There was a strong trend for %FAT to be related to the RFLP generated by BglII at the alpha 2 exons 21-22 in males (P = 0.06) and females (P = 0.05). RQ was (a) associated with the BglII RFLP at the alpha 2 exon 1 (P = 0.02) and with the alpha 2 8.0 kb/4.3 kb haplotype (P = 0.04) and (b) linked with the beta gene MspI marker (P = 0.04) and with the beta 5.3 kb/5.1 kb haplotype (P = 0.008) based on sib-pair analysis. The present study suggests that the genes encoding Na,K-ATPase may be associated or linked with RQ and perhaps with %FAT but not with RMR.

Diabetes and apoptosis: neural crest cells and neural tube.

PubMed

Chappell, James H; Wang, Xiao Dan; Loeken, Mary R

2009-12-01

Birth defects resulting from diabetic pregnancy are associated with apoptosis of a critical mass of progenitor cells early during the formation of the affected organ(s). Insufficient expression of genes that regulate viability of the progenitor cells is responsible for the apoptosis. In particular, maternal diabetes inhibits expression of a gene, Pax3, that encodes a transcription factor which is expressed in neural crest and neuroepithelial cells. As a result of insufficient Pax3, cardiac neural crest and neuroepithelial cells undergo apoptosis by a process dependent on the p53 tumor suppressor protein. This, then provides a cellular explanation for the cardiac outflow tract and neural tube and defects induced by diabetic pregnancy.

Diabetes and apoptosis: neural crest cells and neural tube

PubMed Central

Chappell, James H.; Dan Wang, Xiao

2016-01-01

Birth defects resulting from diabetic pregnancy are associated with apoptosis of a critical mass of progenitor cells early during the formation of the affected organ(s). Insufficient expression of genes that regulate viability of the progenitor cells is responsible for the apoptosis. In particular, maternal diabetes inhibits expression of a gene, Pax3, that encodes a transcription factor which is expressed in neural crest and neuroepithelial cells. As a result of insufficient Pax3, cardiac neural crest and neuroepithelial cells undergo apoptosis by a process dependent on the p53 tumor suppressor protein. This, then provides a cellular explanation for the cardiac outflow tract and neural tube and defects induced by diabetic pregnancy. PMID:19333760

The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

PubMed

Noda, Takeshi

2011-12-01

I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

Stimulation of mTORC1 with L-leucine Rescues Defects Associated with Roberts Syndrome

PubMed Central

Xu, Baoshan; Lee, Kenneth K.; Zhang, Lily; Gerton, Jennifer L.

2013-01-01

Roberts syndrome (RBS) is a human disease characterized by defects in limb and craniofacial development and growth and mental retardation. RBS is caused by mutations in ESCO2, a gene which encodes an acetyltransferase for the cohesin complex. While the essential role of the cohesin complex in chromosome segregation has been well characterized, it plays additional roles in DNA damage repair, chromosome condensation, and gene expression. The developmental phenotypes of Roberts syndrome and other cohesinopathies suggest that gene expression is impaired during embryogenesis. It was previously reported that ribosomal RNA production and protein translation were impaired in immortalized RBS cells. It was speculated that cohesin binding at the rDNA was important for nucleolar form and function. We have explored the hypothesis that reduced ribosome function contributes to RBS in zebrafish models and human cells. Two key pathways that sense cellular stress are the p53 and mTOR pathways. We report that mTOR signaling is inhibited in human RBS cells based on the reduced phosphorylation of the downstream effectors S6K1, S6 and 4EBP1, and this correlates with p53 activation. Nucleoli, the sites of ribosome production, are highly fragmented in RBS cells. We tested the effect of inhibiting p53 or stimulating mTOR in RBS cells. The rescue provided by mTOR activation was more significant, with activation rescuing both cell division and cell death. To study this cohesinopathy in a whole animal model we used ESCO2-mutant and morphant zebrafish embryos, which have developmental defects mimicking RBS. Consistent with RBS patient cells, the ESCO2 mutant embryos show p53 activation and inhibition of the TOR pathway. Stimulation of the TOR pathway with L-leucine rescued many developmental defects of ESCO2-mutant embryos. Our data support the idea that RBS can be attributed in part to defects in ribosome biogenesis, and stimulation of the TOR pathway has therapeutic potential. PMID:24098154

Stimulation of mTORC1 with L-leucine rescues defects associated with Roberts syndrome.

PubMed

Xu, Baoshan; Lee, Kenneth K; Zhang, Lily; Gerton, Jennifer L

2013-01-01

Roberts syndrome (RBS) is a human disease characterized by defects in limb and craniofacial development and growth and mental retardation. RBS is caused by mutations in ESCO2, a gene which encodes an acetyltransferase for the cohesin complex. While the essential role of the cohesin complex in chromosome segregation has been well characterized, it plays additional roles in DNA damage repair, chromosome condensation, and gene expression. The developmental phenotypes of Roberts syndrome and other cohesinopathies suggest that gene expression is impaired during embryogenesis. It was previously reported that ribosomal RNA production and protein translation were impaired in immortalized RBS cells. It was speculated that cohesin binding at the rDNA was important for nucleolar form and function. We have explored the hypothesis that reduced ribosome function contributes to RBS in zebrafish models and human cells. Two key pathways that sense cellular stress are the p53 and mTOR pathways. We report that mTOR signaling is inhibited in human RBS cells based on the reduced phosphorylation of the downstream effectors S6K1, S6 and 4EBP1, and this correlates with p53 activation. Nucleoli, the sites of ribosome production, are highly fragmented in RBS cells. We tested the effect of inhibiting p53 or stimulating mTOR in RBS cells. The rescue provided by mTOR activation was more significant, with activation rescuing both cell division and cell death. To study this cohesinopathy in a whole animal model we used ESCO2-mutant and morphant zebrafish embryos, which have developmental defects mimicking RBS. Consistent with RBS patient cells, the ESCO2 mutant embryos show p53 activation and inhibition of the TOR pathway. Stimulation of the TOR pathway with L-leucine rescued many developmental defects of ESCO2-mutant embryos. Our data support the idea that RBS can be attributed in part to defects in ribosome biogenesis, and stimulation of the TOR pathway has therapeutic potential.

Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: Implications for therapy

PubMed Central

Tovar, Christian; Rosinski, James; Filipovic, Zoran; Higgins, Brian; Kolinsky, Kenneth; Hilton, Holly; Zhao, Xiaolan; Vu, Binh T.; Qing, Weiguo; Packman, Kathryn; Myklebost, Ola; Heimbrook, David C.; Vassilev, Lyubomir T.

2006-01-01

The p53 tumor suppressor retains its wild-type conformation and transcriptional activity in half of all human tumors, and its activation may offer a therapeutic benefit. However, p53 function could be compromised by defective signaling in the p53 pathway. Using a small-molecule MDM2 antagonist, nutlin-3, to probe downstream p53 signaling we find that the cell-cycle arrest function of the p53 pathway is preserved in multiple tumor-derived cell lines expressing wild-type p53, but many have a reduced ability to undergo p53-dependent apoptosis. Gene array analysis revealed attenuated expression of multiple apoptosis-related genes. Cancer cells with mdm2 gene amplification were most sensitive to nutlin-3 in vitro and in vivo, suggesting that MDM2 overexpression may be the only abnormality in the p53 pathway of these cells. Nutlin-3 also showed good efficacy against tumors with normal MDM2 expression, suggesting that many of the patients with wild-type p53 tumors may benefit from antagonists of the p53–MDM2 interaction. PMID:16443686

p53 is a major component of the transcriptional and apoptotic program regulated by PI 3-kinase/Akt/GSK3 signaling.

PubMed

Nayak, G; Cooper, G M

2012-10-11

The phosphatidylinositol (PI) 3-kinase/Akt signaling pathway has a prominent role in cell survival and proliferation, in part, by regulating gene expression at the transcriptional level. Previous work using global expression profiling identified FOXOs and the E-box-binding transcription factors MITF and USF1 as key targets of PI 3-kinase signaling that lead to the induction of proapoptotic and cell cycle arrest genes in response to inhibition of PI 3-kinase. In this study, we investigated the role of p53 downstream of PI 3-kinase signaling by analyzing the effects of inhibition of PI 3-kinase in Rat-1 cells, which have wild-type p53, compared with Rat-1 cells expressing a dominant-negative p53 mutant. Expression of dominant-negative p53 conferred partial resistance to apoptosis induced by inhibition of PI 3-kinase. Global gene expression profiling combined with computational and experimental analysis of transcription factor binding sites demonstrated that p53, along with FOXO, MITF and USF1, contributed to gene induction in response to PI 3-kinase inhibition. Activation of p53 was mediated by phosphorylation of the histone acetyltransferase Tip60 by glycogen synthase kinase (GSK) 3, leading to activation of p53 by acetylation. Many of the genes targeted by p53 were also targeted by FOXO and E-box-binding transcription factors, indicating that p53 functions coordinately with these factors to regulate gene expression downstream of PI 3-kinase/Akt/GSK3 signaling.

Intraperitoneal dedifferentiated liposarcoma: A case report

PubMed Central

Karaman, Ali; Kabalar, Mehmet Eşref; Özcan, Önder; Koca, Timur; Binici, Doğan Nasır

2008-01-01

Dedifferentiated liposarcoma is a variant of liposarcoma with a more aggressive course. Mutations of the p53 gene have been found in different types of soft tissue sarcoma. It is generally accepted that p53 mutations in human malignant tumors are often related to a poor prognosis. In our case, analysis of p53 gene mutation in tumor samples was performed. p53 gene mutation was observed in dedifferentiated tumor tissue samples but not in well-differentiated tumor tissue samples. It has been reported that p53 gene mutation occurs most commonly in the retroperitoneum and rarely in other anatomic locations. Herein we report a case of dedifferentiated liposarcoma located at intraperitoneum. PMID:18855997

Gene Cluster Responsible for Secretion of and Immunity to Multiple Bacteriocins, the NKR-5-3 Enterocins

PubMed Central

Ishibashi, Naoki; Himeno, Kohei; Masuda, Yoshimitsu; Perez, Rodney Honrada; Iwatani, Shun; Wilaipun, Pongtep; Leelawatcharamas, Vichien; Nakayama, Jiro; Sonomoto, Kenji

2014-01-01

Enterococcus faecium NKR-5-3, isolated from Thai fermented fish, is characterized by the unique ability to produce five bacteriocins, namely, enterocins NKR-5-3A, -B, -C, -D, and -Z (Ent53A, Ent53B, Ent53C, Ent53D, and Ent53Z). Genetic analysis with a genome library revealed that the bacteriocin structural genes (enkA [ent53A], enkC [ent53C], enkD [ent53D], and enkZ [ent53Z]) that encode these peptides (except for Ent53B) are located in close proximity to each other. This NKR-5-3ACDZ (Ent53ACDZ) enterocin gene cluster (approximately 13 kb long) includes certain bacteriocin biosynthetic genes such as an ABC transporter gene (enkT), two immunity genes (enkIaz and enkIc), a response regulator (enkR), and a histidine protein kinase (enkK). Heterologous-expression studies of enkT and ΔenkT mutant strains showed that enkT is responsible for the secretion of Ent53A, Ent53C, Ent53D, and Ent53Z, suggesting that EnkT is a wide-range ABC transporter that contributes to the effective production of these bacteriocins. In addition, EnkIaz and EnkIc were found to confer self-immunity to the respective bacteriocins. Furthermore, bacteriocin induction assays performed with the ΔenkRK mutant strain showed that EnkR and EnkK are regulatory proteins responsible for bacteriocin production and that, together with Ent53D, they constitute a three-component regulatory system. Thus, the Ent53ACDZ gene cluster is essential for the biosynthesis and regulation of NKR-5-3 enterocins, and this is, to our knowledge, the first report that demonstrates the secretion of multiple bacteriocins by an ABC transporter. PMID:25149515

[Interaction between p53 and MDM2 in human lung cancer cells].

PubMed

Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J

2014-01-01

The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo  or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) -  mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and MDM2 positive. In 46 (34%) cases, elevation of p53 was combined with MDM2 negative expression. Other tumor samples were either negative for both proteins (71/ 52%), or p53 negative and MDM2 positive in 10 (7%) tumor samples. Absence of p53 staining in most studies indicates absence of p53 mutation, and on the contrary, positive expression of p53 is a sign of p53 mutations with loss of function. In our study, 34% of cases with extensively high level of p53 without increased level of MDM2 were identified. We suppose that these are tumors with inactivating mutations that stabilize p53. On the other hand, tumors with high level of stabilized wildtype p53 protein and simultaneously with increased MDM2 staining (9 samples/7%) represent group with functional p53. In this group of patients, we could expect better prognosis with regard to function of p53 protein.

Identification of EayjjPB encoding a dicarboxylate transporter important for succinate production under aerobic and anaerobic conditions in Enterobacter aerogenes.

PubMed

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Tokura, Mitsunori; Abe, Keietsu

2018-05-01

Enterobacter aerogenes, a gram-negative, rod-shaped bacterium, is an effective producer of succinate from glucose via the reductive tricarboxylic acid cycle under anaerobic conditions. However, to date, succinate-exporter genes have not been identified in E. aerogenes, although succinate exporters have a large impact on fermentative succinate production. Recently, we genetically identified yjjP and yjjB, as genes encoding a succinate transporter in Escherichia coli. Evaluation of the yjjPB homologs in E. aerogenes (EayjjPB genes) showed that succinate accumulation increased from 4.1 g L -1 to 9.1 g L -1 when the EayjjPB genes were expressed under aerobic conditions. Under anaerobic conditions, succinate yield increased from 53% to 60% by EayjjPB expression and decreased to 48% by deletion of EayjjPB. Furthermore, the production levels of fumarate and malate, which are intermediates of the succinate-biosynthesis pathway, were also increased by EayjjPB expression. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both EaYjjP and EaYjjB are required for the restoration of succinate production. Taken together, these results suggest that EaYjjPB function as a dicarboxylate transporter in E. aerogenes and that the products of both genes are required for dicarboxylate transport. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis

PubMed Central

Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A

2015-01-01

Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829

Molecular and immunohistochemical analysis of P53 in phaeochromocytoma.

PubMed Central

Dahia, P. L.; Aguiar, R. C.; Tsanaclis, A. M.; Bendit, I.; Bydlowski, S. P.; Abelin, N. M.; Toledo, S. P.

1995-01-01

We searched for mutations of the p53 gene in 25 phaeochromocytomas using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis of the entire conserved region of the gene, encompassing exons 4-8; expression of the p53 protein was assessed by immunohistochemistry. No mutations were found, while a polymorphism in codon 72 was observed. Immunohistochemistry revealed nuclear p53 overexpression in one tumour sample. We conclude that mutations of the 'hotspot' region of the p53 gene do not seem to play a role in the pathogenesis of phaeochromocytoma. Images Figure 1 Figure 2 Figure 3 PMID:7577469

INGN 201: Ad-p53, Ad5CMV-p53, adenoviral p53, p53 gene therapy--introgen, RPR/INGN 201.

PubMed

2007-01-01

Introgen and its wholly owned European subsidiary Gendux AB are developing an adenoviral p53 gene therapy as a treatment for cancer in the US and Europe, respectively. Phase III trials in patients with head and neck cancer are ongoing, and a number of clinical trials in other cancer indications have been completed. INGN 201 is being reviewed by the EMEA for approval in Li-Fraumeni syndrome (LFS) under the provisions of exceptional circumstance; the therapy is available on a compassionate use basis to eligible LFS cancer patients under a protocol authorised by the US FDA. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. The p53 protein is one of the most intricate elements in the apoptotic signalling cascade, and a mutation in the gene encoding it is believed to result in a decreased ability of a cell to apoptose. Thus replacing this gene via adenovirally-mediated p53 gene therapy is hoped to result in increased apoptosis where it is administered.INGN 201 is available for licensing, although Introgen favours retaining partial or full rights to the therapy in the US. Introgen entered into a license agreement with The University of Texas System and MD Anderson Cancer Center in 1994. The technologies licenced include p53 and fus1 (INGN 401). The collaboration has yielded exclusive patent and licensing rights to numerous technologies. Introgen entered into a collaboration with Rhône-Poulenc Rorer Pharmaceuticals (now sanofi-aventis) to develop therapeutics based on p53 inhibition in October 1994. However, in June 2001 this relationship was restructured and Introgen assumed responsibility for the worldwide development of all p53 products including INGN 201, and acquired all marketing and commercialisation rights with respect to those products. Introgen initiated two phase III trials in head and neck cancer (in June 2000 and May 2001) at about 80 sites in the US, Canada and Europe; the first is a comparative study of INGN 201 and IV methotrexate in 240 patients with refractory head and neck cancer. The second is for the combination of INGN 201 and standard chemotherapy, compared with standard chemotherapy alone, in 288 patients with recurrent squamous cell carcinoma of the head and neck. Introgen expects to complete regulatory filings for advanced recurrent head and neck cancer in the US and EU within 2007. Favourable phase II data of INGN 201 in a subpopulation of patients with recurrent, unresectable head and neck cancer (SCCHN) prompted Introgen to seek accelerated approval for INGN 201 in December 2004. The company has filed a request with the FDA to accept a 'rolling Biologics License Application', the first regulatory step in the accelerated approval process. Introgen requested immediate initiation of the Accelerated Approval rolling BLA, with completion of the filing process expected before the end of 2005. Introgen had presented combined results from three multicentre (US and Europe) phase II studies of INGN 201 in 217 patients with recurrent squamous cell carcinoma of the head and neck confirming previous safety and efficacy results of the treatment. In April 2004, the Southwest Oncology Group initiated a similar clinical trial using INGN 201 for the treatment of stage III or IV squamous cell carcinoma of the oral cavity, or oropharynx, that is able to be removed surgically. The study assessed the feasibility, efficacy and safety of administering INGN 201 at the time of surgery for suppression of remaining tumour cells, followed by a combination of chemotherapy and radiation therapy. The previous trial was a phase II study that afforded Introgen access to surgical specialists in cancer and complemented the company's ongoing pivotal phase III studies in advanced recurrent disease. Sixty patients with head and neck cancer will undergo surgery at ten US sites and receive INGN 201 intraoperatively (and not postoperatively as used in the former trial) followed by a combination of chemo- and radiotherapy. In September 2003, INGN 201 was granted designation as a Fast Track Drug Product development programme by the FDA for prolonging survival and delaying time to disease progression in patients with recurrent, unresectable squamous cell carcinoma of the head and neck. Previously, in February 2003, INGN 201 received orphan drug designation from the FDA for head and neck cancer. Phase I trials in the US for the treatment of non-small-cell lung cancer have been completed. Sanofi-aventis (formerly Rhône-Poulenc Rorer Gencell) initiated phase II trials in the US, Europe and Canada for non-small-cell lung cancer. Intratumoral injection of RPR/INGN 201 in patients with recurrent glioblastomas was safe and resulted in expression of the p53 protein. Direct administration of RPR/INGN 201 to the lower airways of patients with bronchioalveolar cell lung carcinoma resulted in symptomatic improvement and improved lung function in some patients. In November 2003, according to a Clinical Trials Agreement between the Division of Cancer Treatment and Diagnosis (DCTD) of the National Cancer Institute (NCI) and Introgen, a 6-month phase I/II study with p53 gene therapy administered in the form of an oral rinse or mouthwash for patients with oral premalignancies has been initiated. This is the first trial to investigate the effect of this treatment on oral lesions that are at high risk for developing into full blown cancers. In September 2006, the EMEA granted orphan drug status to INGN 201 for the treatment of LFS, following Gendux's application for the designation. The company intends to provide the therapy on a compassionate use basis to qualifying patients in Europe.INGN 201 has been successfully used in the treatment of a LFS patient on a compassionate use basis under a protocol authorised by the FDA. Based on these interim findings, Introgen has decided to continue making the therapy available through a compassionate use programme to eligible LFS patients who have relapsed after standard treatment as part of physician-sponsored protocols at qualifying institutions in the US.A worldwide, exclusive license to a family of US patents covering a combination therapy comprised of INGN 201 in combination with several inhibitors of epidermal growth factor receptors (EGFr) such as Erbituxtrade mark Vectibixtrade mark and Tarcevatrade mark was granted to Introgen by The University of Texas MD Anderson Cancer Center in November 2006. In February 2006, Introgen exclusively licenced a broad patent (US Patent No. 6 989 375), originally issued to to the Board of Regents of The University of Texas System; the patent covers any therapeutic gene-based therapy when applied in combination with conventional cancer therapy such as radiation or chemotherapy. Introgen Therapeutics was awarded a patent from the US Patent and Trademark Office in June 2005 that directly covers many of the special features of its INGN 201 molecular therapy. US Patent No. 6,905,873 is one of a family of patents that cover INGN 201 that have been issued to the Board of Regents of The University of Texas System and exclusively licensed to Introgen. To date, Introgen controls 30 issued patents relevant to the product covering compositions, therapeutic methods of administering the product in virtually any form, alone and in conjunction with the most widely used chemotherapeutic and radiation treatments, as well as its production, and has a large number of pending patent applications in the US and in foreign countries relating to its ADVEXIN((R)) therapy. In December 2004, the US Patent and Trademark Office issued Patent No. 6,830,749 entitled Recombinant p53 Adenovirus Methods and Compositions. Importantly, the patent is the broadest adenoviral p53 patent to date, covering any adenovirus carrying the p53 gene under the control of any promoter. Previously, Patent No. 6,805,858 covering methods for the administration of INGN 201 to cancer patients including virtually all of those routes currently being used for adenoviral delivery was awarded. In addition, US Patent No. 6,740,320, which broadly covers adenoviral vectors with the tumour suppressor p53 in pharmaceutical compositions, was awarded. This patent extends Introgen's patent coverage for its adenoviral p53 gene therapy product to the year 2021, not taking into account possible patent extensions. In February 2003, the US Patent and Trademark Office issued patent No. 6,511,847, entitled Recombinant p53 Adenovirus Methods and Compositions, covering any adenoviral DNA molecule that encodes the p53 gene positioned under the control of a promoter.US patents issued in 2002 include Patent No. 6,410,010, broadly covering all adenoviral p53 compositions (including ADVEXIN((R))) that express adequate p53 in amounts sufficient to suppress the growth of or kill cancer cells in patients. The patent also covers adenoviral p53, which incorporates a specific type of promoter that helps cells to express the p53 tumour suppressor gene. Introgen has a number of US patents that relate to the clinical use of adenoviral p53 gene therapy in cancer as monotherapy or in combination with one or more chemotherapeutic drugs, radiation therapies or other agents that have a damaging effect on the DNA or survival of (i.e. 2-methoxyestradiol, Patent No. 6,410,029) cancer cells.A patent with broad claims directed to combination therapy with the p53 gene and conventional chemotherapy or radiation was issued in China in August 2005. Patent No. ZL95192776.0, entitled Compositions Comprising DNA Damaging Agents and p53, was issued to the Board of Regents of The University of Texas System and was exclusively licenced to Introgen. (ABSTRACT TRUNCATED)

Methylation, expression, and mutation analysis of the cell cycle control genes in human brain tumors.

PubMed

Yin, Dong; Xie, Dong; Hofmann, Wolf-Karsten; Miller, Carl W; Black, Keith L; Koeffler, H Phillip

2002-11-28

Methylation status of the p15(INK4B), p16(INK4A), p14(ARF) and retinoblastoma (RB) genes was studied using methylation specific polymerase chain reaction (MSP) in 85 human brain tumors of various subtypes and four normal brain samples. These genes play an important role in the control of the cell cycle. Twenty-four out of 85 cases (28%) had at least one of these genes methylated. The frequency of p14(ARF) methylation was 15 out of 85 (18%) cases, and the expression of p14(ARF) in methylated gliomas was significantly lower than in unmethylated gliomas. The incidence of methylation of p15(INK4B), p16(INK4A) and RB gene was 4%, 7%, and 4%, respectively. Samples with p14(ARF) methylation did not have p16(INK4A) methylation even though both genes physically overlap. None of the target genes was methylated in the normal brain samples. In addition, the p53 gene was mutated in 19 out of 85 (22%) samples as determined by single strand conformation polymorphism (SSCP) analysis and DNA sequencing. Thirty out of 85 (35%) brain tumors had either a p53 mutation or methylation of p14(ARF). Also, the p14(ARF) expression in p53 wild-type gliomas was lower than levels in p53 mutated gliomas. This finding is consistent with wild-type p53 being able to autoregulate its levels by down-regulating expression of p14(ARF). In summary, inactivation of the apoptosis pathway that included the p14(ARF) and p53 genes by hypermethylation and mutation, respectively, occurred frequently in human brain tumors. Down-regulation of p14(ARF) in gliomas was associated with hypermethylation of its promoter and the presence of a wild-type p53 in these samples.

Mutation spectrum of hepatocellular carcinoma from eastern-European patients betrays the impact of a complex exposome.

PubMed

Tanase, Anna-Maria; Marchio, Agnès; Dumitrascu, Traian; Dima, Simona; Herlea, Vlad; Oprisan, Gabriela; Dejean, Anne; Popescu, Irinel; Pineau, Pascal

2015-05-01

Genomic analysis of hepatocellular carcinoma (HCC) has been shown to provide clues about local risk factors. In the last decades, the mortality from malignant liver tumors increased sharply in Romania, where both hepatitis viruses and environmental pollutants are known to be highly prevalent. To date, HCC from this country has not been subject to molecular characterization. We analyzed a series of 48 consecutive HCC cases. Point mutations were searched in 9 nuclear genes and the mitochondrial D-loop. Oxidative stress response was monitored through measurement of gene expression (NRF2, KEAP1, SRXN1, and CES1) by qRT-PCR. An atypical mutation spectrum was observed, as more than 40% of DNA changes were oxidative stress-associated T>C or T>G lesions (T>S). These mutations affected primarily genes encoding for β-catenin and NRF2 (P<0.0001). Besides, tumors from patients born in Greater Bucharest carried TP53 mutations more frequently than others (45 vs 10%, P=0.02). Finally, a R249S mutation of TP53, well-known hallmark of aflatoxin B1 exposure, was found. Our findings indicate, therefore, that distinct mutagenic processes affect Romanian patients with HCC. Further analyses are now warranted in order to identify causal lifestyle or environmental factors.

Wt-p53 action in human leukaemia cell lines corresponding to different stages of differentiation.

PubMed

Rizzo, M G; Zepparoni, A; Cristofanelli, B; Scardigli, R; Crescenzi, M; Blandino, G; Giuliacci, S; Ferrari, S; Soddu, S; Sacchi, A

1998-05-01

Recent studies support the potential application of the wt-p53 gene in cancer therapy. Expression of exogenous wt-p53 suppresses a variety of leukaemia phenotypes by acting on cell survival, proliferation and/or differentiation. As for tumour gene therapy, the final fate of the neoplastic cells is one of the most relevant points. We examined the effects of exogenous wt-p53 gene expression in several leukaemia cell lines to identify p53-responsive leukaemia. The temperature-sensitive p53Val135 mutant or the human wt-p53 cDNA was transduced in leukaemia cell lines representative of different acute leukaemia FAB subtypes, including M1 (KG1), M2 (HL-60), M3 (NB4), M5 (U937) and M6 (HEL 92.1.7), as well as blast crisis of chronic myelogenous leukaemia (BC-CML: K562, BV173) showing diverse differentiation features. By morphological, molecular and biochemical analyses, we have shown that exogenous wt-p53 gene expression induces apoptosis only in cells corresponding to M1, M2 and M3 of the FAB classification and in BC-CML showing morphological and cytochemical features of undifferentiated blast cells. In contrast, it promotes differentiation in the others. Interestingly, cell responsiveness was independent of the vector used and the status of the endogenous p53 gene.

p53 as the focus of gene therapy: past, present and future.

PubMed

Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani

2018-01-15

Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

SGK1 (glucose transport), dishevelled2 (wnt signaling), LC3/p62 (autophagy) and p53 (apoptosis) proteins are unaltered in Lafora disease.

PubMed

Wang, Peixiang; Israelian, Lori; Xue, Yunlin; Song, Siyuan; Attisano, Liliana; Minassian, Berge A

2016-01-01

Glycogen forms through the concerted actions of glycogen synthase (GS) which elongates glycogen strands, and glycogen branching enzyme (GBE). Lafora disease (LD) is a fatal neurodegenerative epilepsy that results from neuronal accumulation of hyperphosphorylated glycogen with excessively long strands (called polyglucosans). There is no GBE deficiency in LD. Instead, the disease is caused by loss-of-function mutations in the EPM2A or EPM2B genes, encoding, respectively, a phosphatase, laforin, and an E3 ubiquiting ligase, malin. A number of experimentally derived hypotheses have been published to explain LD, including: The SGK1 hypothesis - Phosphorylated SGK1 (pSGK1) raises cellular glucose uptake and levels, which would activate GS. Based on observing increased pSGK1 in LD mice it was proposed that raised pSGK1 leads to polyglucosan generation through GS hyperactivation. The Dishevelled2 hypothesis - Downregulating malin in cell culture was reported to increase levels of dishevelled2, which through the wnt/glycogen synthase kinase-3 pathway would likewise overactivate GS. The Autophagic defect hypothesis - Polyglucosans may be natural byproducts of normal glycogen metabolism. LD mice were reported to be autophagy-defective. LD would arise from failed autophagy leading to failed polyglucosan clearance. Finally, the p53 hypothesis - laforin and malin were reported to downregulate p53, their absence leading to increased p53, which would activate apoptosis, leading to the neurodegeneration of LD. In the present work we repeat key experiments that underlie these four hypotheses. We are unable to confirm increased pSGK1, dishevelled2, or p53 in LD mice, nor the reported autophagic defects. Our work does not support the above hypotheses in understanding this unique and severe form of epilepsy.

p53 down-regulates SARS coronavirus replication and is targeted by the SARS-unique domain and PLpro via E3 ubiquitin ligase RCHY1.

PubMed

Ma-Lauer, Yue; Carbajo-Lozoya, Javier; Hein, Marco Y; Müller, Marcel A; Deng, Wen; Lei, Jian; Meyer, Benjamin; Kusov, Yuri; von Brunn, Brigitte; Bairad, Dev Raj; Hünten, Sabine; Drosten, Christian; Hermeking, Heiko; Leonhardt, Heinrich; Mann, Matthias; Hilgenfeld, Rolf; von Brunn, Albrecht

2016-08-30

Highly pathogenic severe acute respiratory syndrome coronavirus (SARS-CoV) has developed strategies to inhibit host immune recognition. We identify cellular E3 ubiquitin ligase ring-finger and CHY zinc-finger domain-containing 1 (RCHY1) as an interacting partner of the viral SARS-unique domain (SUD) and papain-like protease (PL(pro)), and, as a consequence, the involvement of cellular p53 as antagonist of coronaviral replication. Residues 95-144 of RCHY1 and 389-652 of SUD (SUD-NM) subdomains are crucial for interaction. Association with SUD increases the stability of RCHY1 and augments RCHY1-mediated ubiquitination as well as degradation of p53. The calcium/calmodulin-dependent protein kinase II delta (CAMK2D), which normally influences RCHY1 stability by phosphorylation, also binds to SUD. In vivo phosphorylation shows that SUD does not regulate phosphorylation of RCHY1 via CAMK2D. Similarly to SUD, the PL(pro)s from SARS-CoV, MERS-CoV, and HCoV-NL63 physically interact with and stabilize RCHY1, and thus trigger degradation of endogenous p53. The SARS-CoV papain-like protease is encoded next to SUD within nonstructural protein 3. A SUD-PL(pro) fusion interacts with RCHY1 more intensively and causes stronger p53 degradation than SARS-CoV PL(pro) alone. We show that p53 inhibits replication of infectious SARS-CoV as well as of replicons and human coronavirus NL63. Hence, human coronaviruses antagonize the viral inhibitor p53 via stabilizing RCHY1 and promoting RCHY1-mediated p53 degradation. SUD functions as an enhancer to strengthen interaction between RCHY1 and nonstructural protein 3, leading to a further increase in in p53 degradation. The significance of these findings is that down-regulation of p53 as a major player in antiviral innate immunity provides a long-sought explanation for delayed activities of respective genes.

p53 down-regulates SARS coronavirus replication and is targeted by the SARS-unique domain and PLpro via E3 ubiquitin ligase RCHY1

PubMed Central

Ma-Lauer, Yue; Carbajo-Lozoya, Javier; Müller, Marcel A.; Deng, Wen; Lei, Jian; Meyer, Benjamin; Kusov, Yuri; von Brunn, Brigitte; Bairad, Dev Raj; Hünten, Sabine; Drosten, Christian; Hermeking, Heiko; Leonhardt, Heinrich; Mann, Matthias; Hilgenfeld, Rolf; von Brunn, Albrecht

2016-01-01

Highly pathogenic severe acute respiratory syndrome coronavirus (SARS-CoV) has developed strategies to inhibit host immune recognition. We identify cellular E3 ubiquitin ligase ring-finger and CHY zinc-finger domain-containing 1 (RCHY1) as an interacting partner of the viral SARS-unique domain (SUD) and papain-like protease (PLpro), and, as a consequence, the involvement of cellular p53 as antagonist of coronaviral replication. Residues 95–144 of RCHY1 and 389–652 of SUD (SUD-NM) subdomains are crucial for interaction. Association with SUD increases the stability of RCHY1 and augments RCHY1-mediated ubiquitination as well as degradation of p53. The calcium/calmodulin-dependent protein kinase II delta (CAMK2D), which normally influences RCHY1 stability by phosphorylation, also binds to SUD. In vivo phosphorylation shows that SUD does not regulate phosphorylation of RCHY1 via CAMK2D. Similarly to SUD, the PLpros from SARS-CoV, MERS-CoV, and HCoV-NL63 physically interact with and stabilize RCHY1, and thus trigger degradation of endogenous p53. The SARS-CoV papain-like protease is encoded next to SUD within nonstructural protein 3. A SUD–PLpro fusion interacts with RCHY1 more intensively and causes stronger p53 degradation than SARS-CoV PLpro alone. We show that p53 inhibits replication of infectious SARS-CoV as well as of replicons and human coronavirus NL63. Hence, human coronaviruses antagonize the viral inhibitor p53 via stabilizing RCHY1 and promoting RCHY1-mediated p53 degradation. SUD functions as an enhancer to strengthen interaction between RCHY1 and nonstructural protein 3, leading to a further increase in in p53 degradation. The significance of these findings is that down-regulation of p53 as a major player in antiviral innate immunity provides a long-sought explanation for delayed activities of respective genes. PMID:27519799

p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells.

PubMed

Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E

1996-09-01

Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

PubMed Central

2010-01-01

Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19Arf and nutlin-3. Conclusions To the best of our knowledge, this is the first study to apply both p19Arf and nutlin-3 for the stimulation of p53 activity. These results support the notion that a p53 responsive vector may prove to be an interesting gene transfer tool, especially when combined with p53-activating agents, for the treatment of tumors that retain wild-type p53. PMID:20569441

Mutant p53 proteins counteract autophagic mechanism sensitizing cancer cells to mTOR inhibition.

PubMed

Cordani, Marco; Oppici, Elisa; Dando, Ilaria; Butturini, Elena; Dalla Pozza, Elisa; Nadal-Serrano, Mercedes; Oliver, Jordi; Roca, Pilar; Mariotto, Sofia; Cellini, Barbara; Blandino, Giovanni; Palmieri, Marta; Di Agostino, Silvia; Donadelli, Massimo

2016-08-01

Mutations in TP53 gene play a pivotal role in tumorigenesis and cancer development. Here, we report that gain-of-function mutant p53 proteins inhibit the autophagic pathway favoring antiapoptotic effects as well as proliferation of pancreas and breast cancer cells. We found that mutant p53 significantly counteracts the formation of autophagic vesicles and their fusion with lysosomes throughout the repression of some key autophagy-related proteins and enzymes as BECN1 (and P-BECN1), DRAM1, ATG12, SESN1/2 and P-AMPK with the concomitant stimulation of mTOR signaling. As a paradigm of this mechanism, we show that atg12 gene repression was mediated by the recruitment of the p50 NF-κB/mutant p53 protein complex onto the atg12 promoter. Either mutant p53 or p50 NF-κB depletion downregulates atg12 gene expression. We further correlated the low expression levels of autophagic genes (atg12, becn1, sesn1, and dram1) with a reduced relapse free survival (RFS) and distant metastasis free survival (DMFS) of breast cancer patients carrying TP53 gene mutations conferring a prognostic value to this mutant p53-and autophagy-related signature. Interestingly, the mutant p53-driven mTOR stimulation sensitized cancer cells to the treatment with the mTOR inhibitor everolimus. All these results reveal a novel mechanism through which mutant p53 proteins promote cancer cell proliferation with the concomitant inhibition of autophagy. Copyright © 2016 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

KDM4B/JMJD2B is a p53 target gene that modulates the amplitude of p53 response after DNA damage

PubMed Central

Moon, Eui Jung; Razorenova, Olga V.; Krieg, Adam J.; von Eyben, Rie

2017-01-01

Abstract The p53 tumor suppressor protein plays a critical role in orchestrating the genomic response to various stress signals by acting as a master transcriptional regulator. Differential gene activity is controlled by transcription factors but also dependent on the underlying chromatin structure, especially on covalent histone modifications. After screening different histone lysine methyltransferases and demethylases, we identified JMJD2B/KDM4B as a p53-inducible gene in response to DNA damage. p53 directly regulates JMJD2B gene expression by binding to a canonical p53-consensus motif in the JMJD2B promoter. JMJD2B induction attenuates the transcription of key p53 transcriptional targets including p21, PIG3 and PUMA, and this modulation is dependent on the catalytic capacity of JMJD2B. Conversely, JMJD2B silencing led to an enhancement of the DNA-damage driven induction of p21 and PIG3. These findings indicate that JMJD2B acts in an auto-regulatory loop by which p53, through JMJD2B activation, is able to influence its own transcriptional program. Functionally, exogenous expression of JMJD2B enhanced subcutaneous tumor growth of colon cancer cells in a p53-dependent manner, and genetic inhibition of JMJD2B impaired tumor growth in vivo. These studies provide new insights into the regulatory effect exerted by JMJD2B on tumor growth through the modulation of p53 target genes. PMID:28073943

Comparison of the QuantiGene 2.0 Assay and Real-Time RT-PCR in the Detection of p53 Isoform mRNA Expression in Formalin-Fixed Paraffin-Embedded Tissues- A Preliminary Study

PubMed Central

Morten, Brianna C.; Scott, Rodney J.; Avery-Kiejda, Kelly A.

2016-01-01

p53 is expressed as multiple smaller isoforms whose functions in cancer are not well understood. The p53 isoforms demonstrate abnormal expression in different cancers, suggesting they are important in modulating the function of full-length p53 (FLp53). The quantification of relative mRNA expression has routinely been performed using real-time PCR (qPCR). However, there are serious limitations when detecting p53 isoforms using this method, particularly for formalin-fixed paraffin-embedded (FFPE) tissues. The use of FFPE tumours would be advantageous to correlate expression of p53 isoforms with important clinical features of cancer. One alternative method of RNA detection is the hybridization-based QuantiGene 2.0 Assay, which has been shown to be advantageous for the detection of RNA from FFPE tissues. In this pilot study, we compared the QuantiGene 2.0 Assay to qPCR for the detection of FLp53 and its isoform Δ40p53 in matched fresh frozen (FF) and FFPE breast tumours. FLp53 mRNA expression was detected using qPCR in FF and FFPE tissues, but Δ40p53 mRNA was only detectable in FF tissues. Similar results were obtained for the QuantiGene 2.0 Assay. FLp53 relative mRNA expression was shown to be strongly correlated between the two methods (R2 = 0.9927, p = 0.0031) in FF tissues, however Δ40p53 was not (R2 = 0.4429, p = 0.3345). When comparing the different methods for the detection of FLp53 mRNA from FFPE and FF samples, no correlation (R2 = 0.0002, p = 0.9863) was shown using the QuantiGene 2.0 Assay, and in contrast, the level of expression was highly correlated between the two tissues using qPCR (R2 = 0.8753, p = 0.0644). These results suggest that both the QuantiGene 2.0 Assay and qPCR methods are inadequate for the quantification of Δ40p53 mRNA in FFPE tissues. Therefore, alternative methods of RNA detection and quantification are required to study the relative expression of Δ40p53 in FFPE samples. PMID:27832134

The Transcription Factor p53 Influences Microglial Activation Phenotype

PubMed Central

Jayadev, Suman; Nesser, Nicole K.; Hopkins, Stephanie; Myers, Scott J.; Case, Amanda; Lee, Rona J.; Seaburg, Luke A.; Uo, Takuma; Murphy, Sean P.; Morrison, Richard S.; Garden, Gwenn A.

2011-01-01

Several neurodegenerative diseases are influenced by the innate immune response in the central nervous system (CNS). Microglia, have pro-inflammatory and subsequently neurotoxic actions as well as anti-inflammatory functions that promote recovery and repair. Very little is known about the transcriptional control of these specific microglial behaviors. We have previously shown that in HIV associated neurocognitive disorders (HAND), the transcription factor p53 accumulates in microglia and that microglial p53 expression is required for the in vitro neurotoxicity of the HIV coat glycoprotein gp120. These findings suggested a novel function for p53 in regulating microglial activation. Here we report that in the absence of p53, microglia demonstrate a blunted response to interferon-γ, failing to increase expression of genes associated with classical macrophage activation or secrete pro-inflammatory cytokines. Microarray analysis of global gene expression profiles revealed increased expression of genes associated with anti-inflammatory functions, phagocytosis and tissue repair in p53 knockout (p53−/−) microglia compared with those cultured from strain matched p53 expressing (p53+/+) mice. We further observed that p53−/− microglia demonstrate increased phagocytic activity in vitro and expression of markers for alternative macrophage activation both in vitro and in vivo. In HAND brain tissue, the alternative activation marker CD163 was expressed in a separate subset of microglia than those demonstrating p53 accumulation. These data suggest that p53 influences microglial behavior, supporting the adoption of a pro-inflammatory phenotype, while p53 deficiency promotes phagocytosis and gene expression associated with alternative activation and anti-inflammatory functions. PMID:21598312

Inhibitory effect of Survivin promoter-regulated oncolytic adenovirus carrying P53 gene against gallbladder cancer.

PubMed

Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing

2011-12-01

Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and other cancers, who are not sensitive to chemotherapy, radiotherapy, or who lost their chance for surgical treatment. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

High-Affinity Rb Binding, p53 Inhibition, Subcellular Localization, and Transformation by Wild-Type or Tumor-Derived Shortened Merkel Cell Polyomavirus Large T Antigens

PubMed Central

Borchert, Sophie; Czech-Sioli, Manja; Neumann, Friederike; Schmidt, Claudia; Wimmer, Peter; Dobner, Thomas

2014-01-01

ABSTRACT Interference with tumor suppressor pathways by polyomavirus-encoded tumor antigens (T-Ags) can result in transformation. Consequently, it is thought that T-Ags encoded by Merkel cell polyomavirus (MCPyV), a virus integrated in ∼90% of all Merkel cell carcinoma (MCC) cases, are major contributors to tumorigenesis. The MCPyV large T-Ag (LT-Ag) has preserved the key functional domains present in all family members but has also acquired unique regions that flank the LxCxE motif. As these regions may mediate unique functions, or may modulate those shared with T-Ags of other polyomaviruses, functional studies of MCPyV T-Ags are required. Here, we have performed a comparative study of full-length or MCC-derived truncated LT-Ags with regard to their biochemical characteristics, their ability to bind to retinoblastoma (Rb) and p53 proteins, and their transforming potential. We provide evidence that full-length MCPyV LT-Ag may not directly bind to p53 but nevertheless can significantly reduce p53-dependent transcription in reporter assays. Although early region expression constructs harboring either full-length or MCC-derived truncated LT-Ag genes can transform primary baby rat kidney cells, truncated LT-Ags do not bind to p53 or reduce p53-dependent transcription. Interestingly, shortened LT-Ags exhibit a very high binding affinity for Rb, as shown by coimmunoprecipitation and in vitro binding studies. Additionally, we show that truncated MCPyV LT-Ag proteins are expressed at higher levels than those for the wild-type protein and are able to partially relocalize Rb to the cytoplasm, indicating that truncated LT proteins may have gained additional features that distinguish them from the full-length protein. IMPORTANCE MCPyV is one of the 12 known polyomaviruses that naturally infect humans. Among these, it is of particular interest since it is the only human polyomavirus known to be involved in tumorigenesis. MCPyV is thought to be causally linked to MCC, a rare skin tumor. In these tumors, viral DNA is monoclonally integrated into the genome of the tumor cells in up to 90% of all MCC cases, and the integrated MCV genomes, furthermore, harbor signature mutations in the so-called early region that selectively abrogate viral replication while preserving cell cycle deregulating functions of the virus. This study describes comparative studies of early region T-Ag protein characteristics, their ability to bind to Rb and p53, and their transforming potential. PMID:24371076

The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.

PubMed

Chen, Y M; Zhu, Y; Lin, E C

1987-12-01

In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans.

[Expression changes of major outer membrane protein antigens in Leptospira interrogans during infection and its mechanism].

PubMed

Zheng, Linli; Ge, Yumei; Hu, Weilin; Yan, Jie

2013-03-01

To determine expression changes of major outer membrane protein(OMP) antigens of Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai strain Lai during infection of human macrophages and its mechanism. OmpR encoding genes and OmpR-related histidine kinase (HK) encoding gene of L.interrogans strain Lai and their functional domains were predicted using bioinformatics technique. mRNA level changes of the leptospiral major OMP-encoding genes before and after infection of human THP-1 macrophages were detected by real-time fluorescence quantitative RT-PCR. Effects of the OmpR-encoding genes and HK-encoding gene on the expression of leptospiral OMPs during infection were determined by HK-peptide antiserum block assay and closantel inhibitive assays. The bioinformatics analysis indicated that LB015 and LB333 were referred to OmpR-encoding genes of the spirochete, while LB014 might act as a OmpR-related HK-encoding gene. After the spirochete infecting THP-1 cells, mRNA levels of leptospiral lipL21, lipL32 and lipL41 genes were rapidly and persistently down-regulated (P <0.01), whereas mRNA levels of leptospiral groEL, mce, loa22 and ligB genes were rapidly but transiently up-regulated (P<0.01). The treatment with closantel and HK-peptide antiserum partly reversed the infection-based down-regulated mRNA levels of lipL21 and lipL48 genes (P <0.01). Moreover, closantel caused a decrease of the infection-based up-regulated mRNA levels of groEL, mce, loa22 and ligB genes (P <0.01). Expression levels of L.interrogans strain Lai major OMP antigens present notable changes during infection of human macrophages. There is a group of OmpR-and HK-encoding genes which may play a major role in down-regulation of expression levels of partial OMP antigens during infection.

Analysis of p53 gene mutations in human gliomas by polymerase chain reaction-based single-strand conformation polymorphism and DNA sequencing.

PubMed

Sarkar, F H; Kupsky, W J; Li, Y W; Sreepathi, P

1994-03-01

Mutations in the p53 gene have been recognized in brain tumors, and clonal expansion of p53 mutant cells has been shown to be associated with glioma progression. However, studies on the p53 gene have been limited by the need for frozen tissues. We have developed a method utilizing polymerase chain reaction (PCR) for the direct analysis of p53 mutation by single-strand conformation polymorphism (SSCP) and by direct DNA sequencing of the p53 gene using a single 10-microns paraffin-embedded tissue section. We applied this method to screen for p53 gene mutations in exons 5-8 in human gliomas utilizing paraffin-embedded tissues. Twenty paraffin blocks containing tumor were selected from surgical specimens from 17 different adult patients. Tumors included six anaplastic astrocytomas (AAs), nine glioblastomas (GBs), and two mixed malignant gliomas (MMGs). The tissue section on the stained glass slide was used to guide microdissection of an unstained adjacent tissue section to ensure > 90% of the tumor cell population for p53 mutational analysis. Simultaneously, microdissection of the tissue was also carried out to obtain normal tissue from adjacent areas as a control. Mutations in the p53 gene were identified in 3 of 17 (18%) patients by PCR-SSCP analysis and subsequently confirmed by PCR-based DNA sequencing. Mutations in exon 5 resulting in amino acid substitution were found in one thalamic AA (codon 158, CGC > CTT: Arg > Leu) and one cerebral hemispheric GB (codon 151, CCG > CTG: Pro > Leu).(ABSTRACT TRUNCATED AT 250 WORDS)

The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.

PubMed

Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna

2018-03-01

Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.

Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

PubMed

Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

2003-12-01

p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

Prognostic and predictive value of TP53 mutations in node-positive breast cancer patients treated with anthracycline- or anthracycline/taxane-based adjuvant therapy: results from the BIG 02-98 phase III trial

PubMed Central

2012-01-01

Abstract Introduction Pre-clinical data suggest p53-dependent anthracycline-induced apoptosis and p53-independent taxane activity. However, dedicated clinical research has not defined a predictive role for TP53 gene mutations. The aim of the current study was to retrospectively explore the prognosis and predictive values of TP53 somatic mutations in the BIG 02-98 randomized phase III trial in which women with node-positive breast cancer were treated with adjuvant doxorubicin-based chemotherapy with or without docetaxel. Methods The prognostic and predictive values of TP53 were analyzed in tumor samples by gene sequencing within exons 5 to 8. Patients were classified according to p53 protein status predicted from TP53 gene sequence, as wild-type (no TP53 variation or TP53 variations which are predicted not to modify p53 protein sequence) or mutant (p53 nonsynonymous mutations). Mutations were subcategorized according to missense or truncating mutations. Survival analyses were performed using the Kaplan-Meier method and log-rank test. Cox-regression analysis was used to identify independent predictors of outcome. Results TP53 gene status was determined for 18% (520 of 2887) of the women enrolled in BIG 02-98. TP53 gene variations were found in 17% (90 of 520). Nonsynonymous p53 mutations, found in 16.3% (85 of 520), were associated with older age, ductal morphology, higher grade and hormone-receptor negativity. Of the nonsynonymous mutations, 12.3% (64 of 520) were missense and 3.6% were truncating (19 of 520). Only truncating mutations showed significant independent prognostic value, with an increased recurrence risk compared to patients with non-modified p53 protein (hazard ratio = 3.21, 95% confidence interval = 1.740 to 5.935, P = 0.0002). p53 status had no significant predictive value for response to docetaxel. Conclusions p53 truncating mutations were uncommon but associated with poor prognosis. No significant predictive role for p53 status was detected. Trial registration ClinicalTrials.gov NCT00174655 PMID:22551440

Colorectal cancer cells display chaperone dependency for the unconventional prefoldin URI1

PubMed Central

Christinat, Yann; Frischknecht, Lukas; Krek, Wilhelm

2016-01-01

Chaperone dependency of cancer cells is an emerging trait that relates to the need of transformed cells to cope with the various stresses associated with the malignant state. URI1 (unconventional prefoldin RPB5 interactor 1) encodes a member of the prefoldin (PFD) family of molecular chaperones that acts as part of a heterohexameric PFD complex, the URI1 complex (URI1C), to promote assembly of multiprotein complexes involved in cell signaling and transcription processes. Here, we report that human colorectal cancer (CRCs) cell lines demonstrate differential dependency on URI1 and on the URI1 partner PFD STAP1 for survival, suggesting that this differential vulnerability of CRC cells is directly linked to URI1C chaperone function. Interestingly, in URI1-dependent CRC cells, URI1 deficiency is associated with non-genotoxic p53 activation and p53-dependent apoptosis. URI1-independent CRC cells do not exhibit such effects even in the context of wildtype p53. Lastly, in tumor xenografts, the conditional depletion of URI1 in URI1-dependent CRC cells was, after tumor establishment, associated with severe inhibition of subsequent tumor growth and activation of p53 target genes. Thus, a subset of CRC cells has acquired a dependency on the URI1 chaperone system for survival, providing an example of ‘non-oncogene addiction’ and vulnerability for therapeutic targeting. PMID:27105489

The prrF-Encoded Small Regulatory RNAs Are Required for Iron Homeostasis and Virulence of Pseudomonas aeruginosa

PubMed Central

Reinhart, Alexandria A.; Powell, Daniel A.; Nguyen, Angela T.; O'Neill, Maura; Djapgne, Louise; Wilks, Angela; Ernst, Robert K.

2014-01-01

Pseudomonas aeruginosa is an opportunistic pathogen that requires iron to cause infection, but it also must regulate the uptake of iron to avoid iron toxicity. The iron-responsive PrrF1 and PrrF2 small regulatory RNAs (sRNAs) are part of P. aeruginosa's iron regulatory network and affect the expression of at least 50 genes encoding iron-containing proteins. The genes encoding the PrrF1 and PrrF2 sRNAs are encoded in tandem in P. aeruginosa, allowing for the expression of a distinct, heme-responsive sRNA named PrrH that appears to regulate genes involved in heme metabolism. Using a combination of growth, mass spectrometry, and gene expression analysis, we showed that the ΔprrF1,2 mutant, which lacks expression of the PrrF and PrrH sRNAs, is defective for both iron and heme homeostasis. We also identified phuS, encoding a heme binding protein involved in heme acquisition, and vreR, encoding a previously identified regulator of P. aeruginosa virulence genes, as novel targets of prrF-mediated heme regulation. Finally, we showed that the prrF locus encoding the PrrF and PrrH sRNAs is required for P. aeruginosa virulence in a murine model of acute lung infection. Moreover, we showed that inoculation with a ΔprrF1,2 deletion mutant protects against future challenge with wild-type P. aeruginosa. Combined, these data demonstrate that the prrF-encoded sRNAs are critical regulators of P. aeruginosa virulence. PMID:25510881

RNA-Binding Protein FXR1 Regulates p21 and TERC RNA to Bypass p53-Mediated Cellular Senescence in OSCC

PubMed Central

Majumder, Mrinmoyee; House, Reniqua; Palanisamy, Nallasivam; Qie, Shuo; Day, Terrence A.; Neskey, David; Diehl, J. Alan

2016-01-01

RNA-binding proteins (RBP) regulate numerous aspects of co- and post-transcriptional gene expression in cancer cells. Here, we demonstrate that RBP, fragile X-related protein 1 (FXR1), plays an essential role in cellular senescence by utilizing mRNA turnover pathway. We report that overexpressed FXR1 in head and neck squamous cell carcinoma targets (G-quadruplex (G4) RNA structure within) both mRNA encoding p21 (Cyclin-Dependent Kinase Inhibitor 1A (CDKN1A, Cip1) and the non-coding RNA Telomerase RNA Component (TERC), and regulates their turnover to avoid senescence. Silencing of FXR1 in cancer cells triggers the activation of Cyclin-Dependent Kinase Inhibitors, p53, increases DNA damage, and ultimately, cellular senescence. Overexpressed FXR1 binds and destabilizes p21 mRNA, subsequently reduces p21 protein expression in oral cancer cells. In addition, FXR1 also binds and stabilizes TERC RNA and suppresses the cellular senescence possibly through telomerase activity. Finally, we report that FXR1-regulated senescence is irreversible and FXR1-depleted cells fail to form colonies to re-enter cellular proliferation. Collectively, FXR1 displays a novel mechanism of controlling the expression of p21 through p53-dependent manner to bypass cellular senescence in oral cancer cells. PMID:27606879

Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

PubMed

Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

2017-08-01

p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

[Molecular mechanisms of lung cancer development at its different stages in nuclear industry workers].

PubMed

Rusinova, G G; Vyazovskaya, N S; Azizova, T V; Revina, V S; Glazkova, I V; Generozov, E V; Zakharzhevskaya, N B; Guryanov, M Yu; Belosokhov, M V; Osovets, S V

2015-01-01

to assess mutational events in exons 5, 7, and 8 of the p53 gene and to reveal mutant p53 protein in verified cases of morphologically altered (proliferative and precancerous changes, lung cancer) and histologically unaltered, lung tissues in workers exposed to occupational radiation. The investigation used formalin-fixed paraffin-embedded unaltered and altered lung tissue blocks (FFPBs) obtained from the human radiobiological tissue repository. The shelf-life of FFPBs was 5-31 years. An immunohistochemical technique using mouse antibodies against p53 protein (, Denmark), stained with diaminobenzidine (DAB) chromogen, was employed to determine p53 protein. DNA was isolated from lung tissue FFPBs with QIAmp DNA FFPE Tissue Kit, (, USA). Polymerase chain reaction (PCR) was performed to amplify the p53 gene exons 5, 7, and 8 selected for examination, by applying the sequences of genes and primers, the specificity of which was checked using the online resource (http://www.ncbi.nlm.nih.gov/blast). PCR products were detected by temporal temperature gradient gel-electrophoresis and the Sanger sequencing method. The obtained DNA fragments were analyzed on a sequencer ABI Prism 3100 Genetic Analizer (, USA). Computer-aided DNA analysis was made using the BLAST program. A package of applied Statistica 6.0 programs was employed for statistical data processing. Results. Immunohistochemical analysis showed that mutant p53 protein was absent in the cells of unaltered lung tissue and the number of cells with mutant p53 protein increased in all the patients with proliferative and precancerous changes and lung cancer, suggesting p53 protein dysfunction. The total number of p53 gene mutations in exons 5, 7, and 8, if there were proliferative and precancerous lung tissue changes and lung cancer, were 25, 20, and 40%, respectively. All the found mutations were transversions (the substitution of purine for pyrimidine or, conversely), indicating the action of exogenous mutagens. The results of this investigation have confirmed other investigators' data showing that p53 gene mutations in lung cancer are observed in 40-70% of cases. The differences in the number of cases of altered lung tissue with mutations in the p53 gene (not more than 40%) and in those of p53 protein expression were found in 100%, suggesting the regulation of p53 gene function in the cell at multiple levels.

MYCN acts as a direct co-regulator of p53 in MYCN amplified neuroblastoma.

PubMed

Agarwal, Saurabh; Milazzo, Giorgio; Rajapakshe, Kimal; Bernardi, Ronald; Chen, Zaowen; Barberi, Eveline; Koster, Jan; Perini, Giovanni; Coarfa, Cristian; Shohet, Jason M

2018-04-17

The MYC oncogenes and p53 have opposing yet interrelated roles in normal development and tumorigenesis. How MYCN expression alters the biology and clinical responsiveness of pediatric neuroblastoma remains poorly defined. Neuroblastoma is p53 wild type at diagnosis and repression of p53 signaling is required for tumorigenesis. Here, we tested the hypothesis that MYCN amplification alters p53 transcriptional activity in neuroblastoma. Interestingly, we found that MYCN directly binds to the tetrameric form of p53 at its C-terminal domain, and this interaction is independent of MYCN/MAX heterodimer formation. Chromatin analysis of MYCN and p53 targets reveals dramatic changes in binding, as well as co-localization of the MYCN-p53 complex at p53-REs and E-boxes of genes critical to DNA damage responses and cell cycle progression. RNA sequencing studies show that MYCN-p53 co-localization significantly modulated the expression of p53 target genes. Furthermore, MYCN-p53 interaction leads to regulation of alternative p53 targets not regulated in the presence of low MYCN levels. These novel targets include a number of genes involved in lipid metabolism, DNA repair, and apoptosis. Taken together, our findings demonstrate a novel oncogenic role of MYCN as a transcriptional co-regulator of p53 in high-risk MYCN amplified neuroblastoma. Targeting this novel oncogenic function of MYCN may enhance p53-mediated responses and sensitize MYCN amplified tumors to chemotherapy.

p53 regulates the mevalonate pathway in human glioblastoma multiforme

PubMed Central

Laezza, C; D'Alessandro, A; Di Croce, L; Picardi, P; Ciaglia, E; Pisanti, S; Malfitano, A M; Comegna, M; Faraonio, R; Gazzerro, P; Bifulco, M

2015-01-01

The mevalonate (MVA) pathway is an important metabolic pathway implicated in multiple aspects of tumorigenesis. In this study, we provided evidence that p53 induces the expression of a group of enzymes of the MVA pathway including 3′-hydroxy-3′-methylglutaryl-coenzyme A reductase, MVA kinase, farnesyl diphosphate synthase and farnesyl diphosphate farnesyl transferase 1, in the human glioblastoma multiforme cell line, U343 cells, and in normal human astrocytes, NHAs. Genetic and pharmacologic perturbation of p53 directly influences the expression of these genes. Furthermore, p53 is recruited to the gene promoters in designated p53-responsive elements, thereby increasing their transcription. Such effect was abolished by site-directed mutagenesis in the p53-responsive element of promoter of the genes. These findings highlight another aspect of p53 functions unrelated to tumor suppression and suggest p53 as a novel regulator of the MVA pathway providing insight into the role of this pathway in cancer progression. PMID:26469958

[Tripeptides slow down aging process in renal cell culture].

PubMed

Khavinson, V Kh; Tarnovskaia, S I; Lin'kova, N S; Poliakova, V O; Durnova, A O; Nichik, T E; Kvetnoĭ, I M; D'iakonov, M M; Iakutseni, P P

2014-01-01

The mechanism of geroprotective effect of peptides AED and EDL was studied in ageing renal cell culture. Peptide AED and EDL increase cell proliferation, decreasing expression of marker of aging p16, p21, p53 and increasing expression of SIRT-6 in young and aged renal cell culture. The reduction of SIRT-6 synthesis in cell is one of the causes of cell senescence. On the basis of experimental data models of interaction of peptides with various sites of DNA were constructed. Both peptides form most energetically favorable complexes with d(ATATATATAT)2 sequences in minor groove of DNA. It is shown that interaction of peptides AED and EDL with DNA is the cause of gene expression, encoded marker of ageing in renal cells.

LincRNA-p21 activates p21 in cis to promote Polycomb target gene expression and to enforce the G1/S checkpoint

PubMed Central

Dimitrova, Nadya; Zamudio, Jesse R.; Jong, Robyn M.; Soukup, Dylan; Resnick, Rebecca; Sarma, Kavitha; Ward, Amanda J.; Raj, Arjun; Lee, Jeannie; Sharp, Phillip A.; Jacks, Tyler

2014-01-01

SUMMARY The p53-regulated long non-coding RNA lincRNA-p21 has been proposed to act in trans via several mechanisms ranging from repressing genes in the p53 transcriptional network to regulating mRNA translation and protein stability. To further examine lincRNA-p21 function we generated a conditional knockout mouse model. We find that lincRNA-p21 predominantly functions in cis to activate expression of its neighboring gene, p21. Mechanistically, we show that lincRNA-p21 acts in concert with hnRNP-K as a co-activator for p53-dependent p21 transcription. Additional phenotypes of lincRNA-p21 deficiency could be attributed to diminished p21 levels, including deregulated expression and altered chromatin state of some Polycomb target genes, defective G1/S checkpoint, increased proliferation rates, and enhanced reprogramming efficiency. These findings indicate that lincRNA-p21 affects global gene expression and influences the p53 tumor suppressor pathway by acting in cis as a locus-restricted co-activator for p53-mediated p21 expression. PMID:24857549

Expression of P53 protein after exposure to ionizing radiation

NASA Astrophysics Data System (ADS)

Salazar, A. M.; Salvador, C.; Ruiz-Trejo, C.; Ostrosky, P.; Brandan, M. E.

2001-10-01

One of the most important tumor suppressor genes is p53 gene, which is involved in apoptotic cell death, cell differentiation and cell cycle arrest. The expression of p53 gene can be evaluated by determining the presence of P53 protein in cells using Western Blot assay with a chemiluminescent method. This technique has shown variabilities that are due to biological factors. Film developing process can influence the quality of the p53 bands obtained. We irradiated tumor cell lines and human peripheral lymphocytes with 137Cs and 60Co gamma rays to standardize irradiation conditions, to compare ionizing radiation with actinomycin D and to reduce the observed variability of P53 protein induction levels. We found that increasing radiation doses increase P53 protein induction while it decreases viability. We also conclude that ionizing radiation could serve as a positive control for Western Blot analysis of protein P53. In addition, our results show that the developing process may play an important role in the quality of P53 protein bands and data interpretation.

Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

PubMed

Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

2003-08-01

Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its effective induction of apoptosis and tumor growth inhibition.

Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mohareer, Krishnaveni; Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046; Sahdev, Sudhir

2011-11-04

Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors,more » which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.« less

[The expression of p53, MDM2 and Ref1 gene in cultured retina neurons of SD rats treated with vitamin B1 and/or elevated pressure].

PubMed

Yang, Zhikuan; Ge, Jian; Yin, Wei; Shen, Huangxuan; Liu, Haiquan; Guo, Yan

2004-12-01

To investigate the expression of p53, MDM2 and Ref1 gene in cultured retina neurons of SD rats treated with Vitamin B1 and (or) elevated pressure. The retinal neuron of postnatal SD rats were cultured in vivo, the elevated pressure was produced after 7 days, and the total RNA was extracted after another 2 days, expression of p53, MDM2 and Ref1 gene were analyzed with RT-PCR. The expression level of p53 and MDM2 gene were increased in elevated pressure group, normal with Ref1 gene expression. But the expression of p53 and MDM2 gene were decreased significantly in elevated pressure group treated with vitamine B1 compare to the elevated group. Apoptosis seem to be a mechanism of cell death in retinal neurons of SD rats with elevated pressure.Vitamine B1 have protect effects against elevated pressure.

DNA variation in the genes of the Na,K-adenosine triphosphatase and its relation with resting metabolic rate, respiratory quotient, and body fat.

PubMed Central

Dériaz, O; Dionne, F; Pérusse, L; Tremblay, A; Vohl, M C; Côté, G; Bouchard, C

1994-01-01

The aim of this study was to investigate in 261 subjects from 58 families the association between DNA variation at the genes coding for the Na,K-ATPase peptides and resting metabolic rate (RMR), respiratory quotient (RQ), and percent body fat (%FAT). Five restriction fragment length polymorphisms (RFLP) at three Na,K-ATPase genes were determined: one at the alpha 1 locus (BglII), and two at the beta locus (beta MspI and beta PvuII). Haplotypes were determined from the two variable sites of the alpha 2 gene (alpha 2 haplotypes) and the beta gene (beta haplotypes). There was a strong trend for %FAT to be related to the RFLP generated by BglII at the alpha 2 exons 21-22 in males (P = 0.06) and females (P = 0.05). RQ was (a) associated with the BglII RFLP at the alpha 2 exon 1 (P = 0.02) and with the alpha 2 8.0 kb/4.3 kb haplotype (P = 0.04) and (b) linked with the beta gene MspI marker (P = 0.04) and with the beta 5.3 kb/5.1 kb haplotype (P = 0.008) based on sib-pair analysis. The present study suggests that the genes encoding Na,K-ATPase may be associated or linked with RQ and perhaps with %FAT but not with RMR. PMID:7509349

PPARγ ligand production is tightly linked to clonal expansion during initiation of adipocyte differentiation[S

PubMed Central

Hallenborg, Philip; Petersen, Rasmus Koefoed; Feddersen, Søren; Sundekilde, Ulrik; Hansen, Jacob B.; Blagoev, Blagoy; Madsen, Lise; Kristiansen, Karsten

2014-01-01

Adipocyte differentiation is orchestrated by the ligand-activated nuclear receptor PPARγ. Endogenous ligands comprise oxidized derivatives of arachidonic acid and structurally similar PUFAs. Although expression of PPARγ peaks in mature adipocytes, ligands are produced primarily at the onset of differentiation. Concomitant with agonist production, murine fibroblasts undergo two rounds of mitosis referred to as mitotic clonal expansion. Here we show that mouse embryonic fibroblasts deficient in either of two cell cycle inhibitors, the transcription factor p53 or its target gene encoding the cyclin-dependent kinase inhibitor p21, exhibit increased adipogenic potential. The antiadipogenic effect of p53 relied on its transcriptional activity and p21 expression but was circumvented by administration of an exogenous PPARγ agonist suggesting a linkage between cell cycling and PPARγ ligand production. Indeed, cell cycle inhibitory compounds decreased PPARγ ligand production in differentiating 3T3-L1 preadipocytes. Furthermore, these inhibitors abolished the release of arachidonic acid induced by the hormonal cocktail initiating adipogenesis. Collectively, our results suggest that murine fibroblasts require clonal expansion for PPARγ ligand production at the onset of adipocyte differentiation. PMID:25312885

Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome

PubMed Central

Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.

2014-01-01

Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269

Integrated High Throughput Analysis Identifies GSK3 as a Crucial Determinant of p53-Mediated Apoptosis in Lung Cancer Cells.

PubMed

Zhang, Yu; Zhu, Chenyang; Sun, Bangyao; Lv, Jiawei; Liu, Zhonghua; Liu, Shengwang; Li, Hai

2017-01-01

p53 dysfunction is frequently observed in lung cancer. Although restoring the tumour suppressor function of p53 is recently approved as a putative strategy for combating cancers, the lack of understanding of the molecular mechanism underlying p53-mediated lung cancer suppression has limited the application of p53-based therapies in lung cancer. Using RNA sequencing, we determined the transcriptional profile of human non-small cell lung carcinoma A549 cells after treatment with two p53-activating chemical compounds, nutlin and RITA, which could induce A549 cell cycle arrest and apoptosis, respectively. Bioinformatics analysis of genome-wide gene expression data showed that distinct transcription profiles were induced by nutlin and RITA and 66 pathways were differentially regulated by these two compounds. However, only two of these pathways, 'Adherens junction' and 'Axon guidance', were found to be synthetic lethal with p53 re-activation, as determined via integrated analysis of genome-wide gene expression profile and short hairpin RNA (shRNA) screening. Further functional protein association analysis of significantly regulated genes associated with these two synthetic lethal pathways indicated that GSK3 played a key role in p53-mediated A549 cell apoptosis, and then gene function study was performed, which revealed that GSK3 inhibition promoted p53-mediated A549 cell apoptosis in a p53 post-translational activity-dependent manner. Our findings provide us with new insights regarding the mechanism by which p53 mediates A549 apoptosis and may cast light on the development of more efficient p53-based strategies for treating lung cancer. © 201 The Author(s). Published by S. Karger AG, Basel.

Effect of antibiotic prophylaxis on Coagulase-negative Staphylococcus virulence factor profiles in patients undergoing cataract surgery.

PubMed

López, Yolanda; Samudio, Margarita; Fariña, Norma; Castillo, Verónica; Abente, Sonia; Nentwich, Martin M; González-Britez, Nilsa; Laspina, Florentina; Carron, Agustín; Cibils, Diógenes; de Kaspar, Herminia Miño

2017-08-01

In this prospective study, multiplex polymerase chain reaction (PCR) was used to identify genes encoding virulence factors (ica, atlE and mecA) in Coagulase-negative Staphylococcus (CNS) isolates from the ocular microbiota of patients undergoing cataract surgery and to investigate possible changes in the CNS profile due to antibiotic prophylaxis. Between 09/2011 and 08/2013, patients undergoing cataract surgery were recruited at the Department of Ophthalmology, National University of Asuncion, Paraguay. In the eye to be operated on, patients received moxifloxacin 0.5 % eye drops four times at the day before surgery and a last drop 1 hour before surgery (T1). The other eye remained as control (T0). Conjunctival swabs were taken from both eyes 1 hour after the last drop. The presence of genes encoding biofilm formation (ica and atlE) and methicillin resistance (mecA) was detected by a multiplex PCR. Of the 162 patients (162 study eyes, 162 fellow eye as control group), 87 (53.7 %) eyes were positive for CNS at T0 yielding 96 CNS isolates; 70 eyes (43.2 %) were positive at T1 yielding 77 CNS isolates. For this study, 43 CNS isolates (44.8 %) from T0 and 45 (64.3 %) from T1 were used. Of the total isolates, 81.8 % (72/88) had at least one virulence factor gene (37/43 from T0 and 35/45 from T1) (p = 0.314). Simultaneous detection of ica and atlE genes was higher in T0 (58.0 %) than T1 (46.7 %), but the difference was not significant (p = 0.28). A high frequency of genes encoding virulence factors was observed in the coagulase-negative Staphylococcus isolates. The use of moxifloxacin did not significantly modify the CNS virulence factor profiles.

Complete Sequencing of pNDM-HK Encoding NDM-1 Carbapenemase from a Multidrug-Resistant Escherichia coli Strain Isolated in Hong Kong

PubMed Central

Ho, Pak Leung; Lo, Wai U.; Yeung, Man Kiu; Lin, Chi Ho; Chow, Kin Hung; Ang, Irene; Tong, Amy Hin Yan; Bao, Jessie Yun-Juan; Lok, Si; Lo, Janice Yee Chi

2011-01-01

Background The emergence of plasmid-mediated carbapenemases, such as NDM-1 in Enterobacteriaceae is a major public health issue. Since they mediate resistance to virtually all β-lactam antibiotics and there is often co-resistance to other antibiotic classes, the therapeutic options for infections caused by these organisms are very limited. Methodology We characterized the first NDM-1 producing E. coli isolate recovered in Hong Kong. The plasmid encoding the metallo-β-lactamase gene was sequenced. Principal Findings The plasmid, pNDM-HK readily transferred to E. coli J53 at high frequencies. It belongs to the broad host range IncL/M incompatibility group and is 88803 bp in size. Sequence alignment showed that pNDM-HK has a 55 kb backbone which shared 97% homology with pEL60 originating from the plant pathogen, Erwina amylovora in Lebanon and a 28.9 kb variable region. The plasmid backbone includes the mucAB genes mediating ultraviolet light resistance. The 28.9 kb region has a composite transposon-like structure which includes intact or truncated genes associated with resistance to β-lactams (bla TEM-1, bla NDM-1, Δbla DHA-1), aminoglycosides (aacC2, armA), sulphonamides (sul1) and macrolides (mel, mph2). It also harbors the following mobile elements: IS26, ISCR1, tnpU, tnpAcp2, tnpD, ΔtnpATn1 and insL. Certain blocks within the 28.9 kb variable region had homology with the corresponding sequences in the widely disseminated plasmids, pCTX-M3, pMUR050 and pKP048 originating from bacteria in Poland in 1996, in Spain in 2002 and in China in 2006, respectively. Significance The genetic support of NDM-1 gene suggests that it has evolved through complex pathways. The association with broad host range plasmid and multiple mobile genetic elements explain its observed horizontal mobility in multiple bacterial taxa. PMID:21445317

Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.

PubMed

Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J

2006-04-01

p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.

Roles of the functional loss of p53 and other genes in astrocytoma tumorigenesis and progression.

PubMed Central

Nozaki, M.; Tada, M.; Kobayashi, H.; Zhang, C. L.; Sawamura, Y.; Abe, H.; Ishii, N.; Van Meir, E. G.

1999-01-01

Loss of function of the p53 tumor suppressor gene due to mutation occurs early in astrocytoma tumorigenesis in about 30-40% of cases. This is believed to confer a growth advantage to the cells, allowing them to clonally expand due to loss of the p53-controlled G1 checkpoint and apoptosis. Genetic instability due to the impaired ability of p53 to mediate DNA damage repair further facilitates the acquisition of new genetic abnormalities, leading to malignant progression of an astrocytoma into anaplastic astrocytoma. This is reflected by a high rate of p53 mutation (60-70%) in anaplastic astrocytomas. The cell cycle control gets further compromised in astrocytoma by alterations in one of the G1/S transition control genes, either loss of the p16/CDKN2 or RB genes or amplification of the cyclin D gene. The final progression process leading to glioblastoma multiforme seems to need additional genetic abnormalities in the long arm of chromosome 10; one of which is deletion and/or functional loss of the PTEN/MMAC1 gene. Glioblastomas also occur as primary (de novo) lesions in patients of older age, without p53 gene loss but with amplification of the epidermal growth factor receptor (EGFR) genes. In contrast to the secondary glioblastomas that evolve from astrocytoma cells with p53 mutations in younger patients, primary glioblastomas seem to be resistant to radiation therapy and thus show a poorer prognosis. The evaluation and design of therapeutic modalities aimed at preventing malignant progression of astrocytomas and glioblastomas should now be based on stratifying patients with astrocytic tumors according to their genetic diagnosis. PMID:11550308

p73 coordinates with Δ133p53 to promote DNA double-strand break repair.

PubMed

Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun

2018-03-06

Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.

Friend or Foe: MicroRNAs in the p53 network.

PubMed

Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

2018-04-10

The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.

PubMed

Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K

2005-01-20

Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.

Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ginkel, Paul R. van; Yan, Michael B.; Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792

Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cellsmore » to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP{sub 3} pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca{sup 2+}-dependent pro-apoptotic pathways inhibit cancer cell growth.« less

The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

PubMed

Hale, T K; Braithwaite, A W

1999-08-20

Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

Synthesis of cytochrome C oxidase 2: a p53-dependent metabolic regulator that promotes respiratory function and protects glioma and colon cancer cells from hypoxia-induced cell death.

PubMed

Wanka, C; Brucker, D P; Bähr, O; Ronellenfitsch, M; Weller, M; Steinbach, J P; Rieger, J

2012-08-16

P53 has an important role in the processing of starvation signals. P53-dependent molecular mediators of the Warburg effect reduce glucose consumption and promote mitochondrial function. We therefore hypothesized that the retention of wild-type p53 characteristic of primary glioblastomas limits metabolic demands induced by deregulated signal transduction in the presence of hypoxia and nutrient depletion. Here we report that short hairpin RNA-mediated gene suppression of wild-type p53 or ectopic expression of mutant temperature-sensitive dominant-negative p53(V135A) increased glucose consumption and lactate production, decreased oxygen consumption and enhanced hypoxia-induced cell death in p53 wild-type human glioblastoma cells. Similarly, genetic knockout of p53 in HCT116 colon carcinoma cells resulted in reduced respiration and hypersensitivity towards hypoxia-induced cell death. Further, wild-type p53 gene silencing reduced the expression of synthesis of cytochrome c oxidase 2 (SCO2), an effector necessary for respiratory chain function. An SCO2 transgene reverted the metabolic phenotype and restored resistance towards hypoxia in p53-depleted and p53 mutant glioma cells in a rotenone-sensitive manner, demonstrating that this effect was dependent on intact oxidative phosphorylation. Supplementation with methyl-pyruvate, a mitochondrial substrate, rescued p53 wild-type but not p53 mutant cells from hypoxic cell death, demonstrating a p53-mediated selective aptitude to metabolize mitochondrial substrates. Further, SCO2 gene silencing in p53 wild-type glioma cells sensitized these cells towards hypoxia. Finally, lentiviral gene suppression of SCO2 significantly enhanced tumor necrosis in a subcutaneous HCT116 xenograft tumor model, compatible with impaired energy metabolism in these cells. These findings demonstrate that glioma and colon cancer cells with p53 wild-type status can skew the Warburg effect and thereby reduce their vulnerability towards tumor hypoxia in an SCO2-dependent manner. Targeting SCO2 may therefore represent a valuable strategy to enhance sensitivity towards hypoxia and may complement strategies targeting glucose metabolism.

Construction and Characterization of Human Mammary Epithelial Cell Lines Containing Mutations in the p53 or BRCA1 Genes

DTIC Science & Technology

1999-01-01

development of breast cancers. To study the effects of inactivating mutations in these tumor suppressor genes early in the breast-cancer pathway, we have...the effects of inactivating mutations in these tumor suppressor genes early in the breast-cancer pathway. The consequences of transduction of these...proposed three approaches for constructing p53-deficient cells; i.e., by mutating the p53 gene directly, by abrogating the protein’s normal cellular

Regulation of MDM2 Activity by Nucleolin

DTIC Science & Technology

2005-06-01

tumorigenesis with -50% of human cancers showing mutation of the TP53 gene , often a loss of one gene copy and a point mutation within the second. p53...Sordat B, Gillet M, Schorderet D, Bosman FT, Chaubert P (2001) Methylation silencing and mutations of the p14ARF and pl6INK4a genes in colon cancer. Lab...for the first machinery (for example, see reference 53 and references step of pre-rRNA processing (22). Mutation of the genes en- therein). It is

p53 Regulates insulin-like growth factor-I receptor gene expression in uterine serous carcinoma and predicts responsiveness to an insulin-like growth factor-I receptor-directed targeted therapy.

PubMed

Attias-Geva, Zohar; Bentov, Itay; Kidron, Dvora; Amichay, Keren; Sarfstein, Rive; Fishman, Ami; Bruchim, Ilan; Werner, Haim

2012-07-01

The role of the insulin-like growth factors (IGF) in endometrial cancer has been well established. The IGF-I receptor (IGF-IR), which mediates the biological actions of IGF-I, is usually overexpressed in endometrial tumours. Uterine serous carcinoma (USC) constitutes a defined histological category among endometrial cancers. Mutation of the p53 gene appears early in the course of the disease and is considered a key event in the initiation of USC. The aim of the present study was to evaluate the potential interactions between p53 and the IGF-IR in USC. In addition, we investigated the role of p53 as a biomarker in IGF-IR targeted therapies. Immunohistochemical analysis in a collection of 35 USC specimens revealed that IGF-IR is highly expressed in primary and metastatic USC. Likewise, p53 was expressed in 85.7% of primary tumours and 100% of metastases. A significant negative correlation between p53 expression and survival was noticed. In addition, using USC-derived cell lines we provide evidence that p53 regulates IGF-IR gene expression via a mechanism that involves repression of the IGF-IR promoter. We show that the mechanism of action of p53 involves interaction with zinc finger protein Sp1, a potent transactivator of the IGF-IR gene. Finally, we demonstrate that USC tumours overexpressing p53 are more likely to benefit from anti-IGF-IR therapies. In summary, we provide evidence that p53 regulates IGF-IR gene expression in USC cells via a mechanism that involves repression of the IGF-IR promoter. The interplay between the p53 and IGF-I signalling pathways is of major basic and translational relevance. Copyright © 2011 Elsevier Ltd. All rights reserved.

The expanding universe of p53 targets.

PubMed

Menendez, Daniel; Inga, Alberto; Resnick, Michael A

2009-10-01

The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

PubMed

Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

2014-07-01

Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

[Construction of plant expression plasmid of chimera SBR-CT delta A1].

PubMed

Mai, Sui; Ling, Junqi

2003-08-01

The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

A minimally invasive assay for individual assessment of the ATM/CHEK2/p53 pathway activity.

PubMed

Kabacik, Sylwia; Ortega-Molina, Ana; Efeyan, Alejo; Finnon, Paul; Bouffler, Simon; Serrano, Manuel; Badie, Christophe

2011-04-01

Ionizing radiation induces DNA Double-Strand Breaks (DSBs) which activate the ATM/CHEK2/p53 pathway leading to cell cycle arrest and apoptosis through transcription of genes including CDKN1A (p21) and BBC3 (PUMA). This pathway prevents genomic instability and tumorigenesis as demonstrated in heritable syndromes [e.g. Ataxia Telangiectasia (AT); Li-Fraumeni syndrome (LFS)]. Here, a simple assay based on gene expression in peripheral blood to measure accurately ATM/CHEK2/p53 pathway activity is described. The expression of p21, Puma and Sesn2 was determined in blood from mice with different gene copy numbers of Atm, Trp53 (p53), Chek2 or Arf and in human blood and mitogen stimulated T-lymphocyte (MSTL) cultures from AT, AT carriers, LFS patients, and controls, both before and after ex vivo ionizing irradiation. Mouse Atm/Chek2/p53 activity was highly dependent on the copy number of each gene except Arf. In human MSTL, an AT case, AT carriers and LFS patients showed responses distinct from healthy donors. The relationship between gene copy number and transcriptional induction upon radiation was linear for p21 and Puma and correlated well with cancer incidence in p53 variant mice. This reliable blood test provides an assay to determine ATM/CHEK2/p53 pathway activity and demonstrates the feasibility of assessing the activity of this essential cancer protection pathway in simple assays. These findings may have implications for the individualized prediction of cancer susceptibility.

Transcriptional repression of epithelial cell adhesion molecule (EpCAM) contributes to p53 control of breast cancer invasion

PubMed Central

Sankpal, NV; Willman, MW; Fleming, TP; Mayfield, J; Gillanders, WE

2014-01-01

p53 is a tumor suppressor gene with well-characterized roles in cell cycle regulation, apoptosis and the maintenance of genome stability. Recent evidence suggests that p53 may also contribute to the regulation of migration and invasion. Epithelial cell adhesion molecule (EpCAM) is a transmembrane glycoprotein that is overexpressed in the majority of human epithelial carcinomas, including breast and colorectal carcinomas. We demonstrate by chromatin immunoprecipitation assays that p53 interacts with a candidate p53 binding site within the EpCAM gene. p53-mediated transcriptional repression of EpCAM was confirmed in gain-of-function, and loss-of-function experimental systems. Induction of wildtype p53 was associated with a significant dose-dependent decrease in EpCAM expression; conversely, specific ablation of p53 was associated with a significant increase in EpCAM expression. At the functional level, specific ablation of p53 expression is associated with increased breast cancer invasion, and this effect is abrogated by concomitant specific ablation of EpCAM expression. Taken together, these biochemical and functional data are the first demonstration that (1) wildtype p53 protein binds to a response element within the EpCAM gene and negatively regulates EpCAM expression, and (2) transcriptional repression of EpCAM contributes to p53 control of breast cancer invasion. PMID:19141643

Reverse strand-displacement amplification strategy for rapid detection of p53 gene.

PubMed

Wang, Lisha; Han, Ying; Xiao, Shuai; Lv, Sha; Wang, Cong; Zhang, Nan; Wang, Zhengyong; Tang, Yongqiong; Li, Hongbo; Lyu, Jianxin; Xu, Huo; Shen, Zhifa

2018-09-01

The development of rapid approaches to detect prognostic markers is significant in reducing the morbidity and mortality of cancer. In this paper, we describe a rapid and specific biosensing platform for target DNA (p53 gene as a model) detection based on reverse strand displacement amplification (R-SDA). When the p53 gene is added, multifuctional molecular beacon (MMB) is unfolded via the hybridization with p53 gene. With the assist of Klenow fragment (KF) and Nt.BbvCI (the nicking endonuclease), p53 gene recycling could be initiated and considerable amount of complementary sequences for the MMBs (Nicked fragments, NFs) could be formed, generating enhanced fluorescence signal. Using this amplification strategy, the proposed biosensor displays the detection limit of 1 nM and a wide linear range from 1 to 100 nM, even if only one type of probe is involved. Notably, remarkable detection specificity for single-base mismatched target p53 gene is achieved. Moreover, the described biosensor also exhibited the stability in real biological samples (human serum). The rapid detection strategy can be performed less than 30 min without harsh reaction conditions or expensive nanoparticles. This biosensor shows great potential for application in clinic assay, especially, for early cancer diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines.

PubMed Central

Cheng, J; Haas, M

1990-01-01

Human T-cell leukemia and T-cell acute lymphoblastic leukemia cell lines were studied for alterations in the p53 tumor suppressor gene. Southern blot analysis of 10 leukemic T-cell lines revealed no gross genomic deletions or rearrangements. Reverse transcription-polymerase chain reaction analysis of p53 mRNA indicated that all 10 lines produced p53 mRNA of normal size. By direct sequencing of polymerase chain reaction-amplified cDNA, we detected 11 missense and nonsense point mutations in 5 of the 10 leukemic T-cell lines studied. The mutations are primarily located in the evolutionarily highly conserved regions of the p53 gene. One of the five cell lines in which a mutation was detected possesses a homozygous point mutation in both p53 alleles, while the other four cell lines harbor from two to four different point mutations. An allelic study of two of the lines (CEM, A3/Kawa) shows that the two missense mutations found in each line are located on separate alleles, thus both alleles of the p53 gene may have been functionally inactivated by two different point mutations. Since cultured leukemic T-cell lines represent a late, fully tumorigenic stage of leukemic T cells, mutation of both (or more) alleles of the p53 gene may reflect the selection of cells possessing an increasingly tumorigenic phenotype, whether the selection took place in vivo or in vitro. Previously, we have shown that the HSB-2 T-cell acute lymphoblastic leukemia cell line had lost both alleles of the retinoblastoma tumor suppressor gene. Taken together, our data show that at least 6 of 10 leukemic T-cell lines examined may have lost the normal function of a known tumor suppressor gene, suggesting that this class of genes serves a critical role in the generation of fully tumorigenic leukemic T cells. Images PMID:2144611

Fusagene vectors: a novel strategy for the expression of multiple genes from a single cistron.

PubMed

Gäken, J; Jiang, J; Daniel, K; van Berkel, E; Hughes, C; Kuiper, M; Darling, D; Tavassoli, M; Galea-Lauri, J; Ford, K; Kemeny, M; Russell, S; Farzaneh, F

2000-12-01

Transduction of cells with multiple genes, allowing their stable and co-ordinated expression, is difficult with the available methodologies. A method has been developed for expression of multiple gene products, as fusion proteins, from a single cistron. The encoded proteins are post-synthetically cleaved and processed into each of their constituent proteins as individual, biologically active factors. Specifically, linkers encoding cleavage sites for the Golgi expressed endoprotease, furin, have been incorporated between in-frame cDNA sequences encoding different secreted or membrane bound proteins. With this strategy we have developed expression vectors encoding multiple proteins (IL-2 and B7.1, IL-4 and B7.1, IL-4 and IL-2, IL-12 p40 and p35, and IL-12 p40, p35 and IL-2 ). Transduction and analysis of over 100 individual clones, derived from murine and human tumour cell lines, demonstrate the efficient expression and biological activity of each of the encoded proteins. Fusagene vectors enable the co-ordinated expression of multiple gene products from a single, monocistronic, expression cassette.

Therapeutic Efficacy of Adenoviral-Mediated p53 Gene Transfer Is Synergistically Enhanced by Combined Use of Antisense Oligodeoxynucleotide Targeting Clusterin Gene in a Human Bladder Cancer Model1

PubMed Central

Miyake, Hideaki; Yamanaka, Kazuki; Muramaki, Mototsugu; Hara, Isao; Gleave, Martin E

2005-01-01

Abstract To establish a more effective therapeutic strategy against advanced bladder cancer, we investigated the effects of combined treatment with antisense (AS) oligodeoxynucleotide (ODN) targeting the antiapoptotic gene clusterin and adenoviral-mediated p53 gene transfer (Ad5CMV-p53) using the human bladder cancer KoTCC-1 model. Clusterin expression in KoTCC-1 cells was highly upregulated by Ad5CMV-p53 treatment; however, AS clusterin ODN treatment further suppressed clusterin expression in KoTCC-1 cells after Ad5CMV-p53 treatment. AS clusterin ODN treatment synergistically enhanced the cytotoxic effect of Ad5CMV-p53, and DNA fragmentation characteristic of apoptosis was observed only after combined treatment with AS clusterin ODN and Ad5CMV-p53, but not after treatment with either agent alone. Administration of AS clusterin ODN and Ad5CMV-p53 into nude mice resulted in a significant inhibition of KoTCC-1 tumor growth as well as lymph node metastases compared to administration of either agent alone. Furthermore, combined treatment with AS clusterin ODN, Ad5CMV-p53, and cisplatin completely eradicated KoTCC-1 tumors and lymph node metastases in 60% and 100% of mice, respectively. These findings suggest that combined treatment with AS clusterin ODN and Ad5CMV-p53 could be a novel strategy to inhibit bladder cancer progression, and that further additional use of a chemotherapeutic agent may substantially enhance the efficacy of this combined regimen. PMID:15802022

Segregation of non-p.R132H mutations in IDH1 in distinct molecular subtypes of glioma.

PubMed

Gravendeel, Lonneke A M; Kloosterhof, Nanne K; Bralten, Linda B C; van Marion, Ronald; Dubbink, Hendrikus Jan; Dinjens, Winand; Bleeker, Fonnet E; Hoogenraad, Casper C; Michiels, Erna; Kros, Johan M; van den Bent, Martin; Smitt, Peter A E Sillevis; French, Pim J

2010-03-01

Mutations in the gene encoding the isocitrate dehydrogenase 1 gene (IDH1) occur at a high frequency (up to 80%) in many different subtypes of glioma. In this study, we have screened for IDH1 mutations in a cohort of 496 gliomas. IDH1 mutations were most frequently observed in low grade gliomas with c.395G>A (p.R132H) representing >90% of all IDH1 mutations. Interestingly, non-p.R132H mutations segregate in distinct histological and molecular subtypes of glioma. Histologically, they occur sporadically in classic oligodendrogliomas and at significantly higher frequency in other grade II and III gliomas. Genetically, non-p.R132H mutations occur in tumors with TP53 mutation, are virtually absent in tumors with loss of heterozygosity on 1p and 19q and accumulate in distinct (gene-expression profiling based) intrinsic molecular subtypes. The IDH1 mutation type does not affect patient survival. Our results were validated on an independent sample cohort, indicating that the IDH1 mutation spectrum may aid glioma subtype classification. Functional differences between p.R132H and non-p.R132H mutated IDH1 may explain the segregation in distinct glioma subtypes. (c) 2010 Wiley-Liss, Inc.

MDM4 is a key therapeutic target in cutaneous melanoma

PubMed Central

Gembarska, Agnieszka; Luciani, Flavie; Fedele, Clare; Russell, Elisabeth A; Dewaele, Michael; Villar, Stéphanie; Zwolinska, Aleksandra; Haupt, Sue; de Lange, Job; Yip, Dana; Goydos, James; Haigh, Jody J; Haupt, Ygal; Larue, Lionel; Jochemsen, Aart; Shi, Hubing; Moriceau, Gatien; Lo, Roger S; Ghanem, Ghanem; Shackleton, Mark; Bernal, Federico; Marine, Jean-Christophe

2013-01-01

The inactivation of the p53 tumor suppressor pathway, which often occurs through mutations in TP53 (encoding tumor protein 53) is a common step in human cancer. However, in melanoma—a highly chemotherapy-resistant disease—TP53 mutations are rare, raising the possibility that this cancer uses alternative ways to overcome p53-mediated tumor suppression. Here we show that Mdm4 p53 binding protein homolog (MDM4), a negative regulator of p53, is upregulated in a substantial proportion (∼65%) of stage I–IV human melanomas and that melanocyte-specific Mdm4 overexpression enhanced tumorigenesis in a mouse model of melanoma induced by the oncogene Nras. MDM4 promotes the survival of human metastatic melanoma by antagonizing p53 proapoptotic function. Notably, inhibition of the MDM4-p53 interaction restored p53 function in melanoma cells, resulting in increased sensitivity to cytotoxic chemotherapy and to inhibitors of the BRAF (V600E) oncogene. Our results identify MDM4 as a key determinant of impaired p53 function in human melanoma and designate MDM4 as a promising target for antimelanoma combination therapy. PMID:22820643

Transcriptomic profiling of TK2 deficient human skeletal muscle suggests a role for the p53 signalling pathway and identifies growth and differentiation factor-15 as a potential novel biomarker for mitochondrial myopathies

PubMed Central

2014-01-01

Background Mutations in the gene encoding thymidine kinase 2 (TK2) result in the myopathic form of mitochondrial DNA depletion syndrome which is a mitochondrial encephalomyopathy presenting in children. In order to unveil some of the mechanisms involved in this pathology and to identify potential biomarkers and therapeutic targets we have investigated the gene expression profile of human skeletal muscle deficient for TK2 using cDNA microarrays. Results We have analysed the whole transcriptome of skeletal muscle from patients with TK2 mutations and compared it to normal muscle and to muscle from patients with other mitochondrial myopathies. We have identified a set of over 700 genes which are differentially expressed in TK2 deficient muscle. Bioinformatics analysis reveals important changes in muscle metabolism, in particular, in glucose and glycogen utilisation, and activation of the starvation response which affects aminoacid and lipid metabolism. We have identified those transcriptional regulators which are likely to be responsible for the observed changes in gene expression. Conclusion Our data point towards the tumor suppressor p53 as the regulator at the centre of a network of genes which are responsible for a coordinated response to TK2 mutations which involves inflammation, activation of muscle cell death by apoptosis and induction of growth and differentiation factor 15 (GDF-15) in muscle and serum. We propose that GDF-15 may represent a potential novel biomarker for mitochondrial dysfunction although further studies are required. PMID:24484525

Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms.

PubMed

Malkin, D; Li, F P; Strong, L C; Fraumeni, J F; Nelson, C E; Kim, D H; Kassel, J; Gryka, M A; Bischoff, F Z; Tainsky, M A

1990-11-30

Familial cancer syndromes have helped to define the role of tumor suppressor genes in the development of cancer. The dominantly inherited Li-Fraumeni syndrome (LFS) is of particular interest because of the diversity of childhood and adult tumors that occur in affected individuals. The rarity and high mortality of LFS precluded formal linkage analysis. The alternative approach was to select the most plausible candidate gene. The tumor suppressor gene, p53, was studied because of previous indications that this gene is inactivated in the sporadic (nonfamilial) forms of most cancers that are associated with LFS. Germ line p53 mutations have been detected in all five LFS families analyzed. These mutations do not produce amounts of mutant p53 protein expected to exert a trans-dominant loss of function effect on wild-type p53 protein. The frequency of germ line p53 mutations can now be examined in additional families with LFS, and in other cancer patients and families with clinical features that might be attributed to the mutation.

Gene Expression in Mammalian Cells After Exposure to 95 MeV Argon Ions

NASA Astrophysics Data System (ADS)

Arenz, A.; Hellweg, C. E.; Baumstark-Khan, C.

Cell response to genotoxic agents is complex and involves the participation of different classes of genes (DNA repair, cell cycle control, signal transduction, apoptosis and oncogenesis). The unique feature of the space radiation environment is the dominance of high-energy charged particles (HZE or high LET radiation) which present a significant hazard to space flight crews, and accelerator-based experiments are underway to quantify the health risks due to unavoidable radiation exposure. High linear energy transfer (LET) radiation has an increased relative biological effectiveness (RBE) as compared to X-rays for cell death induction, gene mutation, genomic instability, and carcinogenesis. The tumour suppressor gene p53 plays a crucial role in maintaining the integrity of the genome. The p53 protein acts as a transcription factor that mediates cell cycle arrest and apoptosis by binding to DNA and activating transcription of specific genes. It is also though to be involved in damage repair by transcriptional activation of the newly identified p53 dependent ribonuclease subunit R2 (p53R2) that is directly involved in the p53 cell cycle checkpoint for repair of damaged DNA. In that case it is responsible for nucleotide delivery for DNA repair synthesis. DNA damages of cultured human cells (e.g. MCF-7, AGS, A549) exposed to accelerated argon ions at the French heavy ion facility GANIL were analysed for expression levels of certain damage- and apoptosis-relevant genes. RNA was extracted from cells exposed to different particle fluences after various recovery times. A real-time QRT-PCR assay was applied, which employs both relative and absolute quantification of a candidate mRNA biomarker. The expressions of different DNA damage inducible genes (e.g. p53R2, GADD45, p21) were analysed. A reproducible up-regulation representing a twofold to fourfold change in p53R2 gene expression level was confirmed for X-irradiated and Ar-ion exposed cells dependent on dose. Kinetics of p53R2 gene expression modulations shows a response lasting up to 24 hours after irradiation.

A High-Resolution Gene Map of the Chloroplast Genome of the Red Alga Porphyra purpurea.

PubMed Central

Reith, M; Munholland, J

1993-01-01

Extensive DNA sequencing of the chloroplast genome of the red alga Porphyra purpurea has resulted in the detection of more than 125 genes. Fifty-eight (approximately 46%) of these genes are not found on the chloroplast genomes of land plants. These include genes encoding 17 photosynthetic proteins, three tRNAs, and nine ribosomal proteins. In addition, nine genes encoding proteins related to biosynthetic functions, six genes encoding proteins involved in gene expression, and at least five genes encoding miscellaneous proteins are among those not known to be located on land plant chloroplast genomes. The increased coding capacity of the P. purpurea chloroplast genome, along with other characteristics such as the absence of introns and the conservation of ancestral operons, demonstrate the primitive nature of the P. purpurea chloroplast genome. In addition, evidence for a monophyletic origin of chloroplasts is suggested by the identification of two groups of genes that are clustered in chloroplast genomes but not in cyanobacteria. PMID:12271072

[CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

PubMed

Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

2012-01-01

In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

Identification of a melanosomal membrane protein encoded by the pink-eyed dilution (type II oculocutaneous albinism) gene.

PubMed Central

Rosemblat, S; Durham-Pierre, D; Gardner, J M; Nakatsu, Y; Brilliant, M H; Orlow, S J

1994-01-01

The pink-eyed dilution (p) locus in the mouse is critical to melanogenesis; mutations in the homologous locus in humans, P, are a cause of type II oculocutaneous albinism. Although a cDNA encoded by the p gene has recently been identified, nothing is known about the protein product of this gene. To characterize the protein encoded by the p gene, we performed immunoblot analysis of extracts of melanocytes cultured from wild-type mice with an antiserum from rabbits immunized with a peptide corresponding to amino acids 285-298 of the predicted protein product of the murine p gene. This antiserum recognized a 110-kDa protein. The protein was absent from extracts of melanocytes cultured from mice with two mutations (pcp and p) in which transcripts of the p gene are absent or greatly reduced. Introduction of the cDNA for the p gene into pcp melanocytes by electroporation resulted in expression of the 3.3-kb mRNA and the 110-kDa protein. Upon subcellular fractionation of cultured melanocytes, the 110-kDa protein was found to be present in melanosomes but absent from the vesicular fraction; phase separation performed with the nonionic detergent Triton X-114 confirmed the predicted hydrophobic nature of the protein. These results demonstrate that the p gene encodes a 110-kDa integral melanosomal membrane protein and establish a framework by which mutations at this locus, which diminish pigmentation, can be analyzed at the cellular and biochemical levels. Images PMID:7991586

Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okazaki, Ryuji, E-mail: ryuji-o@med.uoeh-u.ac.j; Ootsuyama, Akira; Kakihara, Hiroyo

2011-01-01

Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situmore » hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.« less

Isolation and characterization of polygalacturonase genes (pecA and pecB) from Aspergillus flavus.

PubMed Central

Whitehead, M P; Shieh, M T; Cleveland, T E; Cary, J W; Dean, R A

1995-01-01

Two genes, pecA and pecB, encoding endopolyglacturonases were cloned from a highly aggressive strain of Aspergillus flavus. The pecA gene consisted of 1,228 bp encoding a protein of 363 amino acids with a predicted molecular mass of 37.6 kDa, interrupted by two introns of 58 and 81 bp in length. Accumulation of pecA mRNA in both pectin- or glucose-grown mycelia in the highly aggressive strain matched the activity profile of a pectinase previously identified as P2c. Transformants of a weakly aggressive strain containing a functional copy of the pecA gene produced P2c in vitro, confirming that pecA encodes P2c. The coding region of pecB was determined to be 1,217 bp in length interrupted by two introns of 65 and 54 bp in length. The predicted protein of 366 amino acids had an estimated molecular mass of 38 kDa. Transcripts of this gene accumulated in mycelia grown in medium containing pectin alone, never in mycelia grown in glucose-containing medium, for both highly and weakly aggressive strains. Thus, pecB encodes the activity previously identified as P1 or P3. pecA and pecB share a high degree of sequence identity with polygalacturonase genes from Aspergillus parasiticus and Aspergillus oryzae, further establishing the close relationships between members of the A. flavus group. Conservation of intron positions in these genes also indicates that they share a common ancestor with genes encoding endopolyglacturonases of Aspergillus niger. PMID:7574642

A Dbf4p BRCA1 C-Terminal-Like Domain Required for the Response to Replication Fork Arrest in Budding Yeast

PubMed Central

Gabrielse, Carrie; Miller, Charles T.; McConnell, Kristopher H.; DeWard, Aaron; Fox, Catherine A.; Weinreich, Michael

2006-01-01

Dbf4p is an essential regulatory subunit of the Cdc7p kinase required for the initiation of DNA replication. Cdc7p and Dbf4p orthologs have also been shown to function in the response to DNA damage. A previous Dbf4p multiple sequence alignment identified a conserved ∼40-residue N-terminal region with similarity to the BRCA1 C-terminal (BRCT) motif called “motif N.” BRCT motifs encode ∼100-amino-acid domains involved in the DNA damage response. We have identified an expanded and conserved ∼100-residue N-terminal region of Dbf4p that includes motif N but is capable of encoding a single BRCT-like domain. Dbf4p orthologs diverge from the BRCT motif at the C terminus but may encode a similar secondary structure in this region. We have therefore called this the BRCT and DBF4 similarity (BRDF) motif. The principal role of this Dbf4p motif was in the response to replication fork (RF) arrest; however, it was not required for cell cycle progression, activation of Cdc7p kinase activity, or interaction with the origin recognition complex (ORC) postulated to recruit Cdc7p–Dbf4p to origins. Rad53p likely directly phosphorylated Dbf4p in response to RF arrest and Dbf4p was required for Rad53p abundance. Rad53p and Dbf4p therefore cooperated to coordinate a robust cellular response to RF arrest. PMID:16547092

Both germ line and somatic genetics of the p53 pathway affect ovarian cancer incidence and survival.

PubMed

Bartel, Frank; Jung, Juliane; Böhnke, Anja; Gradhand, Elise; Zeng, Katharina; Thomssen, Christoph; Hauptmann, Steffen

2008-01-01

Although p53 is one of the most studied genes/proteins in ovarian carcinomas, the predictive value of p53 alterations is still ambiguous. We performed analyses of the TP53 mutational status and its protein expression using immunohistochemistry. Moreover, the single nucleotide polymorphism SNP309 in the P2 promoter of the MDM2 gene was investigated. We correlated the results with age of onset and outcome from 107 patients with ovarian carcinoma. In our study, we identified a large group of patients with p53 overexpression despite having a wild-type gene (49% of all patients with wild-type TP53). This was associated with a significantly shortened overall survival time (P = 0.019). Patients with p53 alterations (especially those with overexpression of wild-type TP53) were also more refractory to chemotherapy compared with patients with normal p53 (P = 0.027). The G-allele of SNP309 is associated with an earlier age of onset in patients with estrogen receptor-overexpressing FIGO stage III disease (P = 0.048). In contrast, in patients with FIGO stage III disease, a weakened p53 pathway (either the G-allele of SNP309 or a TP53 mutation) was correlated with increased overall survival compared with patients whose tumors were wild-type for both TP53 and SNP309 (P = 0.0035). Our study provides evidence that both germ line and somatic alterations of the p53 pathway influence the incidence and survival of ovarian carcinoma, and it underscores the importance of assessing the functionality of p53 in order to predict the sensitivity of platinum-based chemotherapies and patient outcome.

Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.

PubMed

Suppiah, Aravind; Greenman, John

2013-08-07

Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.

Schwann cell hyperplasia and tumors in transgenic mice expressing a naturally occurring mutant NF2 protein

PubMed Central

Giovannini, Marco; Robanus-Maandag, Els; Niwa-Kawakita, Michiko; van der Valk, Martin; Woodruff, James M.; Goutebroze, Laurence; Mérel, Philippe; Berns, Anton; Thomas, Gilles

1999-01-01

Specific mutations in some tumor suppressor genes such as p53 can act in a dominant fashion. We tested whether this mechanism may also apply for the neurofibromatosis type-2 gene (NF2) which, when mutated, leads to schwannoma development. Transgenic mice were generated that express, in Schwann cells, mutant NF2 proteins prototypic of natural mutants observed in humans. Mice expressing a NF2 protein with an interstitial deletion in the amino-terminal domain showed high prevalence of Schwann cell-derived tumors and Schwann cell hyperplasia, whereas those expressing a carboxy-terminally truncated protein were normal. Our results indicate that a subset of mutant NF2 alleles observed in patients may encode products with dominant properties when overexpressed in specific cell lineages. PMID:10215625

PAF53 is essential in mammalian cells: CRISPR/Cas9 fails to eliminate PAF53 expression.

PubMed

Rothblum, Lawrence I; Rothblum, Katrina; Chang, Eugenie

2017-05-15

When mammalian cells are nutrient and/or growth factor deprived, exposed to inhibitors of protein synthesis, stressed by heat shock or grown to confluence, rDNA transcription is essentially shut off. Various mechanisms are available to accomplish this downshift in ribosome biogenesis. Muramatsu's laboratory (Hanada et al., 1996) first demonstrated that mammalian PAF53 was essential for specific rDNA transcription and that PAF53 levels were regulated in response to growth factors. While S. cerevisae A49, the homologue of vertebrate PAF53, is not essential for viability (Liljelund et al., 1992), deletion of yA49 results in colonies that grow at 6% of the wild type rate at 25°C. Experiments described by Wang et al. (2015) identified PAF53 as a gene "essential for optimal proliferation". However, they did not discriminate genes essential for viability. Hence, in order to resolve this question, we designed a series of experiments to determine if PAF53 was essential for cell survival. We set out to delete the gene product from mammalian cells using CRISPR/CAS9 technology. Human 293 cells were transfected with lentiCRISPR v2 carrying genes for various sgRNA that targeted PAF53. In some experiments, the cells were cotransfected in parallel with plasmids encoding FLAG-tagged mouse PAF53. After treating the transfected cells with puromycin (to select for the lentiCRISPR backbone), cells were cloned and analyzed by western blots for PAF53 expression. Genomic DNA was amplified across the "CRISPRd" exon, cloned and sequenced to identify mutated PAF53 genes. We obtained cell lines in which the endogenous PAF53 gene was "knocked out" only when we rescued with FLAG-PAF53. DNA sequencing demonstrated that in the absence of ectopic PAF53 expression, cells demonstrated unique means of surviving; including recombination or the utilization of alternative reading frames. We never observed a clone in which one PAF53 gene is expressed, unless there was also ectopic expression In the absence of ectopic gene expression, the gene products of both endogenous genes were expressed, irrespective of whether they were partially mutant proteins or not. Copyright © 2016 Elsevier B.V. All rights reserved.

Characterization of a gene product (Sec53p) required for protein assembly in the yeast endoplasmic reticulum

PubMed Central

1985-01-01

SEC53, a gene that is required for completion of assembly of proteins in the endoplasmic reticulum in yeast, has been cloned, sequenced, and the product localized by cell fractionation. Complementation of a sec53 mutation is achieved with unique plasmids from genomic or cDNA expression banks. These inserts contain the authentic gene, a cloned copy of which integrates at the sec53 locus. An open reading frame in the insert predicts a 29-kD protein with no significant hydrophobic character. This prediction is confirmed by detection of a 28-kD protein overproduced in cells that carry SEC53 on a multicopy plasmid. To follow Sec53p more directly, a LacZ-SEC53 gene fusion has been constructed which allows the isolation of a hybrid protein for use in production of antibody. With such an antibody, quantitative immune decoration has shown that the sec53-6 mutation decreases the level of Sec53p at 37 degrees C, while levels comparable to wild-type are seen at 24 degrees C. An eightfold overproduction of Sec53p accompanies transformation of cells with a multicopy plasmid containing SEC53. Cell fractionation, performed with conditions that preserve the lumenal content of the endoplasmic reticulum (ER), shows Sec53p highly enriched in the cytosol fraction. We suggest that Sec53p acts indirectly to facilitate assembly in the ER, possibly by interacting with a stable ER component, or by providing a small molecule, other than an oligosaccharide precursor, necessary for the assembly event. PMID:3905826

BmNPV resistance of silkworm larvae resulting from the ingestion of TiO₂ nanoparticles.

PubMed

Li, Bing; Xie, Yi; Cheng, Zhe; Cheng, Jie; Hu, Rengping; Gui, Suxin; Sang, Xuezi; Sun, Qingqing; Zhao, Xiaoyang; Sheng, Lei; Shen, Weide; Hong, Fashui

2012-12-01

Bombyx mori nucleopolyhedrovirus (BmNPV) causes infection in the silkworm that is often lethal. The infection is hard to prevent, partly because of the nature of the virus particles and partly because of the different strains of B. mori. Titanium dioxide nanoparticles (TiO₂ NPs) have been demonstrated to have antimicrobial properties. The present study investigated whether TiO₂ NPs added to an artificial diet can increase the resistance of B. mori larvae to BmNPV and examined the molecular mechanism behind any resistance shown. The results indicated that ingested TiO₂ NPs decreased reactive oxygen species and NO accumulation in B. mori larvae under BmNPV infection, which in turn led to a decrease in their growth inhibition and mortality. In addition, the TiO₂ NPs significantly promoted the expression of resistance-related genes, including those encoding superoxide dismutase, catalase, glutathione peroxidase, acetylcholine esterase, carboxylesterase, heat shock protein 21, glutathione S transferase o1, P53, and transferring and of genes encoding cytochrome p302 and nitric oxide synthase. These findings are a useful addition to the understanding of the mechanism of BmNPV resistance of B. mori larvae in response to TiO₂ NPs addition. Such information also provides a theoretical basis for the use of TiO₂ NPs in sericulture.

Role of p53, Mitochondrial DNA Deletions, and Paternal Age in Autism: A Case-Control Study

PubMed Central

Wong, Sarah; Napoli, Eleonora; Krakowiak, Paula; Tassone, Flora; Hertz-Picciotto, Irva

2016-01-01

BACKGROUND: The tumor suppressor p53 responds to a variety of environmental stressors by regulating cell cycle arrest, apoptosis, senescence, DNA repair, bioenergetics and mitochondrial DNA (mtDNA) copy number maintenance. Developmental abnormalities have been reported in p53-deficient mice, and altered p53 and p53-associated pathways in autism (AU). Furthermore, via the Pten-p53 crosstalk, Pten haploinsufficient-mice have autisticlike behavior accompanied by brain mitochondrial dysfunction with accumulation of mtDNA deletions. METHODS: mtDNA copy number and deletions, and p53 gene copy ratios were evaluated in peripheral blood monocytic cells from children aged 2–5 years with AU (n = 66), race-, gender-, and age-matched typically neurodeveloping children (n = 46), and both parents from each diagnostic group, recruited by the Childhood Autism Risk from Genes and Environment study at the University of California, Davis. RESULTS: mtDNA deletions and higher p53 gene copy ratios were more common in children with AU and their fathers. The incidence of mtDNA deletions in fathers of children with AU was increased 1.9-fold over fathers of typically neurodeveloping children, suggesting a role for deficient DNA repair capacity not driven by paternal age. Deletions in mtDNA and altered p53 gene copy ratios seem to result from genetics (children with severity scores ≥8) and/or act in concert with environmental factors (children with 6–7 severity scores). CONCLUSIONS: Given pro- and antioxidant activities of p53, and associations of genomic instability with disorders other than AU, our study suggests a link between DNA repair capacity, genomic instability in the 17p13.1 region influenced by environmental triggers, and AU diagnosis. PMID:27033107

DOR/Tp53inp2 and Tp53inp1 constitute a metazoan gene family encoding dual regulators of autophagy and transcription.

PubMed

Sancho, Ana; Duran, Jordi; García-España, Antonio; Mauvezin, Caroline; Alemu, Endalkachew A; Lamark, Trond; Macias, Maria J; DeSalle, Rob; Royo, Miriam; Sala, David; Chicote, Javier U; Palacín, Manuel; Johansen, Terje; Zorzano, Antonio

2012-01-01

Human DOR/TP53INP2 displays a unique bifunctional role as a modulator of autophagy and gene transcription. However, the domains or regions of DOR that participate in those functions have not been identified. Here we have performed structure/function analyses of DOR guided by identification of conserved regions in the DOR gene family by phylogenetic reconstructions. We show that DOR is present in metazoan species. Invertebrates harbor only one gene, DOR/Tp53inp2, and in the common ancestor of vertebrates Tp53inp1 may have arisen by gene duplication. In keeping with these data, we show that human TP53INP1 regulates autophagy and that different DOR/TP53INP2 and TP53INP1 proteins display transcriptional activity. The use of molecular evolutionary information has been instrumental to determine the regions that participate in DOR functions. DOR and TP53INP1 proteins share two highly conserved regions (region 1, aa residues 28-42; region 2, 66-112 in human DOR). Mutation of conserved hydrophobic residues in region 1 of DOR (that are part of a nuclear export signal, NES) reduces transcriptional activity, and blocks nuclear exit and autophagic activity under autophagy-activated conditions. We also identify a functional and conserved LC3-interacting motif (LIR) in region 1 of DOR and TP53INP1 proteins. Mutation of conserved acidic residues in region 2 of DOR reduces transcriptional activity, impairs nuclear exit in response to autophagy activation, and disrupts autophagy. Taken together, our data reveal DOR and TP53INP1 as dual regulators of transcription and autophagy, and identify two conserved regions in the DOR family that concentrate multiple functions crucial for autophagy and transcription.

DOR/Tp53inp2 and Tp53inp1 Constitute a Metazoan Gene Family Encoding Dual Regulators of Autophagy and Transcription

PubMed Central

Sancho, Ana; Duran, Jordi; García-España, Antonio; Mauvezin, Caroline; Alemu, Endalkachew A.; Lamark, Trond; Macias, Maria J.; DeSalle, Rob; Royo, Miriam; Sala, David; Chicote, Javier U.; Palacín, Manuel; Johansen, Terje; Zorzano, Antonio

2012-01-01

Human DOR/TP53INP2 displays a unique bifunctional role as a modulator of autophagy and gene transcription. However, the domains or regions of DOR that participate in those functions have not been identified. Here we have performed structure/function analyses of DOR guided by identification of conserved regions in the DOR gene family by phylogenetic reconstructions. We show that DOR is present in metazoan species. Invertebrates harbor only one gene, DOR/Tp53inp2, and in the common ancestor of vertebrates Tp53inp1 may have arisen by gene duplication. In keeping with these data, we show that human TP53INP1 regulates autophagy and that different DOR/TP53INP2 and TP53INP1 proteins display transcriptional activity. The use of molecular evolutionary information has been instrumental to determine the regions that participate in DOR functions. DOR and TP53INP1 proteins share two highly conserved regions (region 1, aa residues 28–42; region 2, 66–112 in human DOR). Mutation of conserved hydrophobic residues in region 1 of DOR (that are part of a nuclear export signal, NES) reduces transcriptional activity, and blocks nuclear exit and autophagic activity under autophagy-activated conditions. We also identify a functional and conserved LC3-interacting motif (LIR) in region 1 of DOR and TP53INP1 proteins. Mutation of conserved acidic residues in region 2 of DOR reduces transcriptional activity, impairs nuclear exit in response to autophagy activation, and disrupts autophagy. Taken together, our data reveal DOR and TP53INP1 as dual regulators of transcription and autophagy, and identify two conserved regions in the DOR family that concentrate multiple functions crucial for autophagy and transcription. PMID:22470510

Evidence that expression of a mutated p53 gene attenuates apoptotic cell death in human gastric intestinal-type carcinomas in vivo.

PubMed

Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H

1997-05-01

To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P < 0.05). Apoptotic cells were identified from routinely stained sections and by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P < 0.05). The proliferating cell nuclear antigen index, defined similarly to the TI, was 56.4 +/- 16.3% in category A, and it was significantly higher than that in category B (P < 0.05). The immunohistochemically detected expression of p21CIP1/WAP1 did not differ between the two categories, while Bax-positive tumor cells were more frequently detected in category A. These results indicate that (1) expression of a mutated p53 gene attenuates apoptotic cell death of gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

NASA Astrophysics Data System (ADS)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Microbubble-assisted p53, RB, and p130 gene transfer in combination with radiation therapy in prostate cancer.

PubMed

Nande, Rounak; Greco, Adelaide; Gossman, Michael S; Lopez, Jeffrey P; Claudio, Luigi; Salvatore, Marco; Brunetti, Arturo; Denvir, James; Howard, Candace M; Claudio, Pier Paolo

2013-06-01

Combining radiation therapy and direct intratumoral (IT) injection of adenoviral vectors has been explored as a means to enhance the therapeutic potential of gene transfer. A major challenge for gene transfer is systemic delivery of nucleic acids directly into an affected tissue. Ultrasound (US) contrast agents (microbubbles) are viable candidates to enhance targeted delivery of systemically administered genes. Here we show that p53, pRB, and p130 gene transfer mediated by US cavitation of microbubbles at the tumor site resulted in targeted gene transduction and increased reduction in tumor growth compared to DU-145 prostate cancer cell xenografts treated intratumorally with adenovirus (Ad) or radiation alone. Microbubble-assisted/US-mediated Ad.p53 and Ad.RB treated tumors showed significant reduction in tumor volume compared to Ad.p130 treated tumors (p<0.05). Additionally, US mediated microbubble delivery of p53 and RB combined with external beam radiation resulted in the most profound tumor reduction in DU-145 xenografted nude mice (p<0.05) compared to radiation alone. These findings highlight the potential therapeutic applications of this novel image-guided gene transfer technology in combination with external beam radiation for prostate cancer patients with therapy resistant disease.

Two new CHEK2 germ-line variants detected in breast cancer/sarcoma families negative for BRCA1, BRCA2, and TP53 gene mutations.

PubMed

Manoukian, Siranoush; Peissel, Bernard; Frigerio, Simona; Lecis, Daniele; Bartkova, Jirina; Roversi, Gaia; Radice, Paolo; Bartek, Jiri; Delia, Domenico

2011-11-01

CHEK2 gene mutations occur in a subset of patients with familial breast cancer, acting as moderate/low penetrance cancer susceptibility alleles. Although CHEK2 is no longer recognized as a major determinant of the Li-Fraumeni syndrome, a hereditary condition predisposing to cancer at multiple sites, it cannot be ruled out that mutations of this gene play a role in malignancies arising in peculiar multi-cancer families. To assess the contribution of CHEK2 to the breast cancer/sarcoma phenotype, we screened for germ-line sequence variations of the gene among 12 probands from hereditary breast/ovarian cancer families with one case of sarcoma that tested wild-type for mutations in the BRCA1, BRCA2, and TP53 genes. Two cases harbored previously unreported mutations in CHEK2, the c.507delT and c.38A>G, leading to protein truncation (p.Phe169LeufsX2) and amino acid substitution (p.His13Arg), respectively. These mutations were not considered common polymorphic variants, as they were undetected in 230 healthy controls of the same ethnic origin. While the c.38A>G encodes a mutant protein that behaves in biochemical assays as the wild-type form, the c.507delT is a loss-of-function mutation. The identification of two previously unreported CHEK2 variants, including a truncating mutation leading to constitutional haploinsufficiency, in individuals belonging to families selected for breast cancer/sarcoma phenotype, supports the hypothesis that the CHEK2 gene may act as a factor contributing to individual tumor development in peculiar familial backgrounds.

40 Years of Research Put p53 in Translation

PubMed Central

Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

2018-01-01

Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

Analysis of full coding sequence of the TP53 gene in invasive vulvar cancers: Implications for therapy.

PubMed

Kashofer, Karl; Regauer, Sigrid

2017-08-01

This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years. DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry. 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas. 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers. Copyright © 2017. Published by Elsevier Inc.

Expressions of p53 and p21 in primary gastric lymphomas.

PubMed Central

Go, J. H.; Yang, W. I.

2001-01-01

The p21 overexpression is thought to be a consequence of the p53 induced activation of the p21 gene. The immunohistochemical evaluation of p53 and p21 can be a valuable means of assessing the functional status of the p53 gene product. We examined the overexpression of p21 and p53 proteins in primary gastric lymphomas and the correlation with prognosis. A total of 32 cases of gastric lymphomas was classified into low-grade lymphomas of mucosa-associated lymphoid tissue type (n=16) and high-grade B-cell lymphomas (n=16). In low-grade lymphomas, only one case showed p53 positivity and all cases were p21-negative. In high-grade lymphomas, seven cases were p53+/p21- (44%), one case was p53+/p21+ (6%), and eight cases were p53-/p21- (50%). The p53+/p21- cases had a much lower percentage of patients sustaining a continuous complete remission state (3/7, 43%) compared with other cases (6/7, 86%). From these results, we concluded that p21 expression is rare in primary gastric lymphomas. Therefore, p53-positive lymphomas can be assumed as having p53 mutation. And combined studies of p53 and p21 may be used as a prognostic indicator in primary gastric high-grade lymphomas. PMID:11748353

Identification of an opd (organophosphate degradation) gene in an Agrobacterium isolate.

PubMed

Horne, Irene; Sutherland, Tara D; Harcourt, Rebecca L; Russell, Robyn J; Oakeshott, John G

2002-07-01

We isolated a bacterial strain, Agrobacterium radiobacter P230, which can hydrolyze a wide range of organophosphate (OP) insecticides. A gene encoding a protein involved in OP hydrolysis was cloned from A. radiobacter P230 and sequenced. This gene (called opdA) had sequence similarity to opd, a gene previously shown to encode an OP-hydrolyzing enzyme in Flavobacterium sp. strain ATCC 27551 and Brevundimonas diminuta MG. Insertional mutation of the opdA gene produced a strain lacking the ability to hydrolyze OPs, suggesting that this is the only gene encoding an OP-hydrolyzing enzyme in A. radiobacter P230. The OPH and OpdA proteins, encoded by opd and opdA, respectively, were overexpressed and purified as maltose-binding proteins, and the maltose-binding protein moiety was cleaved and removed. Neither protein was able to hydrolyze the aliphatic OP malathion. The kinetics of the two proteins for diethyl OPs were comparable. For dimethyl OPs, OpdA had a higher k(cat) than OPH. It was also capable of hydrolyzing the dimethyl OPs phosmet and fenthion, which were not hydrolyzed at detectable levels by OPH.

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

PubMed

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

CRISPR-mediated direct mutation of cancer genes in the mouse liver.

PubMed

Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G; Zhang, Feng; Anderson, Daniel G; Sharp, Phillip A; Jacks, Tyler

2014-10-16

The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem cells. Here we describe a new method of cancer model generation using the CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins) system in vivo in wild-type mice. We used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs) to the liver that directly target the tumour suppressor genes Pten (ref. 5) and p53 (also known as TP53 and Trp53) (ref. 6), alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology. Simultaneous targeting of Pten and p53 induced liver tumours that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumour tissue revealed insertion or deletion mutations of the tumour suppressor genes, including bi-allelic mutations of both Pten and p53 in tumours. Furthermore, co-injection of Cas9 plasmids harbouring sgRNAs targeting the β-catenin gene and a single-stranded DNA oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-catenin. This study demonstrates the feasibility of direct mutation of tumour suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics.

Identical mutations of the p53 tumor suppressor gene in the gliomatous and the sarcomatous components of gliosarcomas suggest a common origin from glial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biernat, W.; Aguzzi, A.; Sure, U.

Gliosarcomas are morphologically heterogeneous tumors of the central nervous system composed of gliomatous and sarcomatous components. The histogenesis of the latter is still a matter of debate. As mutations of the p53 tumor suppressor gene represent an early event in the development of gliomas, we attempted to determine whether both components of gliosarcomas share identical alterations of the p53 gene. Using single-strand conformation analysis (SSCA) and direct DNA sequencing of the p53 gene, we analyzed dissected gliomatous and sarcomatous parts of 12 formalin-fixed, paraffin-embedded gliosarcomas. The two tumors that contained a p53 alteration were found to carry the identical mutationmore » (exon 5; codon 151, CCC {r_arrow} TCC; codon 173, GTG {r_arrow} GTA) in the gliomatous and the sarcomatous components. These findings suggest a common origin of the two cellular components from neoplastic glial cells. 37 refs., 3 figs., 1 tab.« less

TLA-1: a New Plasmid-Mediated Extended-Spectrum β-Lactamase from Escherichia coli

PubMed Central

Silva, J.; Aguilar, C.; Ayala, G.; Estrada, M. A.; Garza-Ramos, U.; Lara-Lemus, R.; Ledezma, L.

2000-01-01

Escherichia coli R170, isolated from the urine of an infected patient, was resistant to expanded-spectrum cephalosporins, aztreonam, ciprofloxacin, and ofloxacin but was susceptible to amikacin, cefotetan, and imipenem. This particular strain contained three different plasmids that encoded two β-lactamases with pIs of 7.0 and 9.0. Resistance to cefotaxime, ceftazidime, aztreonam, trimethoprim, and sulfamethoxazole was transferred by conjugation from E. coli R170 to E. coli J53-2. The transferred plasmid, RZA92, which encoded a single β-lactamase, was 150 kb in length. The cefotaxime resistance gene that encodes the TLA-1 β-lactamase (pI 9.0) was cloned from the transconjugant by transformation to E. coli DH5α. Sequencing of the blaTLA-1 gene revealed an open reading frame of 906 bp, which corresponded to 301 amino acid residues, including motifs common to class A β-lactamases: 70SXXK, 130SDN, and 234KTG. The amino acid sequence of TLA-1 shared 50% identity with the CME-1 chromosomal class A β-lactamase from Chryseobacterium (Flavobacterium) meningosepticum; 48.8% identity with the VEB-1 class A β-lactamase from E. coli; 40 to 42% identity with CblA of Bacteroides uniformis, PER-1 of Pseudomonas aeruginosa, and PER-2 of Salmonella typhimurium; and 39% identity with CepA of Bacteroides fragilis. The partially purified TLA-1 β-lactamase had a molecular mass of 31.4 kDa and a pI of 9.0 and preferentially hydrolyzed cephaloridine, cefotaxime, cephalothin, benzylpenicillin, and ceftazidime. The enzyme was markedly inhibited by sulbactam, tazobactam, and clavulanic acid. TLA-1 is a new extended-spectrum β-lactamase of Ambler class A. PMID:10722503

TLA-1: a new plasmid-mediated extended-spectrum beta-lactamase from Escherichia coli.

PubMed

Silva, J; Aguilar, C; Ayala, G; Estrada, M A; Garza-Ramos, U; Lara-Lemus, R; Ledezma, L

2000-04-01

Escherichia coli R170, isolated from the urine of an infected patient, was resistant to expanded-spectrum cephalosporins, aztreonam, ciprofloxacin, and ofloxacin but was susceptible to amikacin, cefotetan, and imipenem. This particular strain contained three different plasmids that encoded two beta-lactamases with pIs of 7.0 and 9.0. Resistance to cefotaxime, ceftazidime, aztreonam, trimethoprim, and sulfamethoxazole was transferred by conjugation from E. coli R170 to E. coli J53-2. The transferred plasmid, RZA92, which encoded a single beta-lactamase, was 150 kb in length. The cefotaxime resistance gene that encodes the TLA-1 beta-lactamase (pI 9.0) was cloned from the transconjugant by transformation to E. coli DH5alpha. Sequencing of the bla(TLA-1) gene revealed an open reading frame of 906 bp, which corresponded to 301 amino acid residues, including motifs common to class A beta-lactamases: (70)SXXK, (130)SDN, and (234)KTG. The amino acid sequence of TLA-1 shared 50% identity with the CME-1 chromosomal class A beta-lactamase from Chryseobacterium (Flavobacterium) meningosepticum; 48.8% identity with the VEB-1 class A beta-lactamase from E. coli; 40 to 42% identity with CblA of Bacteroides uniformis, PER-1 of Pseudomonas aeruginosa, and PER-2 of Salmonella typhimurium; and 39% identity with CepA of Bacteroides fragilis. The partially purified TLA-1 beta-lactamase had a molecular mass of 31.4 kDa and a pI of 9.0 and preferentially hydrolyzed cephaloridine, cefotaxime, cephalothin, benzylpenicillin, and ceftazidime. The enzyme was markedly inhibited by sulbactam, tazobactam, and clavulanic acid. TLA-1 is a new extended-spectrum beta-lactamase of Ambler class A.

HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

PubMed

Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

2018-03-01

HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

An operon from Lactobacillus helveticus composed of a proline iminopeptidase gene (pepI) and two genes coding for putative members of the ABC transporter family of proteins.

PubMed

Varmanen, P; Rantanen, T; Palva, A

1996-12-01

A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.

Functional Analysis of Genes Involved in the Biosynthesis of Enterocin NKR-5-3B, a Novel Circular Bacteriocin.

PubMed

Perez, Rodney H; Ishibashi, Naoki; Inoue, Tomoko; Himeno, Kohei; Masuda, Yoshimitsu; Sawa, Narukiko; Zendo, Takeshi; Wilaipun, Pongtep; Leelawatcharamas, Vichien; Nakayama, Jiro; Sonomoto, Kenji

2016-01-15

A putative biosynthetic gene cluster of the enterocin NKR-5-3B (Ent53B), a novel circular bacteriocin, was analyzed by sequencing the flanking regions around enkB, the Ent53B structural gene, using a fosmid library. A region approximately 9 kb in length was obtained, and the enkB1, enkB2, enkB3, and enkB4 genes, encoding putative biosynthetic proteins involved in the production, maturation, and secretion of Ent53B, were identified. We also determined the identity of proteins mediating self-immunity against the effects of Ent53B. Heterologous expression systems in various heterologous hosts, such as Enterococcus faecalis and Lactococcus lactis strains, were successfully established. The production and secretion of the mature Ent53B required the cooperative functions of five genes. Ent53B was produced only by those heterologous hosts that expressed protein products of the enkB, enkB1, enkB2, enkB3, and enkB4 genes. Moreover, self-immunity against the antimicrobial action of Ent53B was conferred by at least two independent mechanisms. Heterologous hosts harboring the intact enkB4 gene and/or a combination of intact enkB1 and enkB3 genes were immune to the inhibitory action of Ent53B. In addition to their potential application as food preservatives, circular bacteriocins are now considered possible alternatives to therapeutic antibiotics due to the exceptional stability conferred by their circular structure. The successful practical application of circular bacteriocins will become possible only if the molecular details of their biosynthesis are fully understood. The results of the present study offer a new perspective on the possible mechanism of circular bacteriocin biosynthesis. In addition, since some enterococcal strains are associated with pathogenicity, virulence, and drug resistance, the establishment of the first multigenus host heterologous production of Ent53B has very high practical significance, as it widens the scope of possible Ent53B applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Functional Analysis of Genes Involved in the Biosynthesis of Enterocin NKR-5-3B, a Novel Circular Bacteriocin

PubMed Central

Perez, Rodney H.; Ishibashi, Naoki; Inoue, Tomoko; Himeno, Kohei; Masuda, Yoshimitsu; Sawa, Narukiko; Wilaipun, Pongtep; Leelawatcharamas, Vichien; Nakayama, Jiro; Sonomoto, Kenji

2015-01-01

ABSTRACT A putative biosynthetic gene cluster of the enterocin NKR-5-3B (Ent53B), a novel circular bacteriocin, was analyzed by sequencing the flanking regions around enkB, the Ent53B structural gene, using a fosmid library. A region approximately 9 kb in length was obtained, and the enkB1, enkB2, enkB3, and enkB4 genes, encoding putative biosynthetic proteins involved in the production, maturation, and secretion of Ent53B, were identified. We also determined the identity of proteins mediating self-immunity against the effects of Ent53B. Heterologous expression systems in various heterologous hosts, such as Enterococcus faecalis and Lactococcus lactis strains, were successfully established. The production and secretion of the mature Ent53B required the cooperative functions of five genes. Ent53B was produced only by those heterologous hosts that expressed protein products of the enkB, enkB1, enkB2, enkB3, and enkB4 genes. Moreover, self-immunity against the antimicrobial action of Ent53B was conferred by at least two independent mechanisms. Heterologous hosts harboring the intact enkB4 gene and/or a combination of intact enkB1 and enkB3 genes were immune to the inhibitory action of Ent53B. IMPORTANCE In addition to their potential application as food preservatives, circular bacteriocins are now considered possible alternatives to therapeutic antibiotics due to the exceptional stability conferred by their circular structure. The successful practical application of circular bacteriocins will become possible only if the molecular details of their biosynthesis are fully understood. The results of the present study offer a new perspective on the possible mechanism of circular bacteriocin biosynthesis. In addition, since some enterococcal strains are associated with pathogenicity, virulence, and drug resistance, the establishment of the first multigenus host heterologous production of Ent53B has very high practical significance, as it widens the scope of possible Ent53B applications. PMID:26503847

Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

PubMed

Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

2012-01-20

The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

Clinical utility of anti-p53 auto-antibody: Systematic review and focus on colorectal cancer

PubMed Central

Suppiah, Aravind; Greenman, John

2013-01-01

Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance. PMID:23922463

Space experiment "Rad Gene"-report 1; p53-Dependent gene expression in human cultured cells exposed to space environment

NASA Astrophysics Data System (ADS)

Takahashi, Akihisa; Ohnishi, Takeo; Suzuki, Hiromi; Omori, Katsunori; Seki, Masaya; Hashizume, Toko; Shimazu, Toru; Ishioka, Noriaki

The space environment contains two major biologically significant influences: space radiations and microgravity. A p53 tumor suppressor protein plays a role as a guardian of the genome through the activity of p53-centered signal transduction pathways. The aim of this study was to clarify the biological effects of space radiations, microgravity and a space environment on the gene and protein expression of p53-dependent regulated genes. Space experiments were performed with two human cultured lymphoblastoid cell lines: one cells line (TSCE5) bears a wild-type p53 gene status, and another cells line (WTK1) bears a mutated p53 gene status. Un-der one gravity or microgravity condition, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station (ISS) for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples also were cultured for 8 days in the CBEF on the ground during the same periods as space flight. Gene and protein expression was analyzed by using DNA chip (a 44k whole human genome microarray, Agilent Technologies Inc.) and protein chip (PanoramaTM Ab MicroArray, Sigma-Aldrich Co.), respectively. In addition, we analyzed the gene expression in cultured cells after space flight during 133 days with frozen condition. We report the results and discussion from the viewpoint of the functions of the up-regulated and down-regulated genes after an exposure to space radiations and/or microgravity. The initial goal of this space experiment was completely achieved. It is expected that data from this type of work will be helpful in designing physical protection from the deleterious effects of space radiations during long term stays in space.

Plasmid-dependent methylotrophy in thermotolerant Bacillus methanolicus.

PubMed

Brautaset, Trygve; Jakobsen M, Øyvind M; Flickinger, Michael C; Valla, Svein; Ellingsen, Trond E

2004-03-01

Bacillus methanolicus can efficiently utilize methanol as a sole carbon source and has an optimum growth temperature of 50 degrees C. With the exception of mannitol, no sugars have been reported to support rapid growth of this organism, which is classified as a restrictive methylotroph. Here we describe the DNA sequence and characterization of a 19,167-bp circular plasmid, designated pBM19, isolated from B. methanolicus MGA3. Sequence analysis of pBM19 demonstrated the presence of the methanol dehydrogenase gene, mdh, which is crucial for methanol consumption in this bacterium. In addition, five genes (pfk, encoding phosphofructokinase; rpe, encoding ribulose-5-phosphate 3-epimerase; tkt, encoding transketolase; glpX, encoding fructose-1,6-bisphosphatase; and fba, encoding fructose-1,6-bisphosphate aldolase) with deduced roles in methanol assimilation via the ribulose monophosphate pathway are encoded by pBM19. A shuttle vector, pTB1.9, harboring the pBM19 minimal replicon (repB and ori) was constructed and used to transform MGA3. Analysis of the resulting recombinant strain demonstrated that it was cured of pBM19 and was not able to grow on methanol. A pTB1.9 derivative harboring the complete mdh gene could not restore growth on methanol when it was introduced into the pBM19-cured strain, suggesting that additional pBM19 genes are required for consumption of this carbon source. Screening of 13 thermotolerant B. methanolicus wild-type strains showed that they all harbor plasmids similar to pBM19, and this is the first report describing plasmid-linked methylotrophy in any microorganism. Our findings should have an effect on future genetic manipulations of this organism, and they contribute to a new understanding of the biology of methylotrophs.

Plasmid-Dependent Methylotrophy in Thermotolerant Bacillus methanolicus

PubMed Central

Brautaset, Trygve; Jakobsen, Øyvind M.; Flickinger, Michael C.; Valla, Svein; Ellingsen, Trond E.

2004-01-01

Bacillus methanolicus can efficiently utilize methanol as a sole carbon source and has an optimum growth temperature of 50°C. With the exception of mannitol, no sugars have been reported to support rapid growth of this organism, which is classified as a restrictive methylotroph. Here we describe the DNA sequence and characterization of a 19,167-bp circular plasmid, designated pBM19, isolated from B. methanolicus MGA3. Sequence analysis of pBM19 demonstrated the presence of the methanol dehydrogenase gene, mdh, which is crucial for methanol consumption in this bacterium. In addition, five genes (pfk, encoding phosphofructokinase; rpe, encoding ribulose-5-phosphate 3-epimerase; tkt, encoding transketolase; glpX, encoding fructose-1,6-bisphosphatase; and fba, encoding fructose-1,6-bisphosphate aldolase) with deduced roles in methanol assimilation via the ribulose monophosphate pathway are encoded by pBM19. A shuttle vector, pTB1.9, harboring the pBM19 minimal replicon (repB and ori) was constructed and used to transform MGA3. Analysis of the resulting recombinant strain demonstrated that it was cured of pBM19 and was not able to grow on methanol. A pTB1.9 derivative harboring the complete mdh gene could not restore growth on methanol when it was introduced into the pBM19-cured strain, suggesting that additional pBM19 genes are required for consumption of this carbon source. Screening of 13 thermotolerant B. methanolicus wild-type strains showed that they all harbor plasmids similar to pBM19, and this is the first report describing plasmid-linked methylotrophy in any microorganism. Our findings should have an effect on future genetic manipulations of this organism, and they contribute to a new understanding of the biology of methylotrophs. PMID:14973041

MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53.

PubMed

Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias

2016-01-07

The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.

Detection of HPV-DNA, p53 alterations, and methylation in penile squamous cell carcinoma in Japanese men.

PubMed

Yanagawa, Naoki; Osakabe, Mitsumasa; Hayashi, Masahiro; Tamura, Gen; Motoyama, Teiichi

2008-08-01

Penile carcinoma is a rare disease, accordingly there are few studies on molecular changes, and these results also vary greatly. A total of 26 penile squamous cell carcinomas in Japanese men were studied with respect to HPV, p53 alterations, and methylation of gene promoter region. HPV-DNA was detected in three of 26 patients (11.5%). Overexpression of p53 was observed in 13 of 26 patients (50%), and p53 gene mutations were detected in four of 26 patients (15.4%). The frequency of methylation was as follows: DAPK, 26.9% (7/26); FHIT, 88.4% (23/26); MGMT, 19.2% (5/26); p14, 3.8% (1/26); p16, 23.1% (6/26); RAR-beta, 23.1% (6/26); RASSF1A, 11.5% (3/26); and RUNX3, 42.3% (11/26). As for correlation between HPV and p53 alterations, and methylation status, mutations of the p53 gene were detected only in HPV-negative patients, and methylation was more frequently found in HPV-negative than in HPV-positive patients. The present results suggest that the majority of penile squamous cell carcinomas in Japanese men are unrelated to HPV, and gene alterations accumulate more frequently in HPV-unrelated penile carcinomas.

RAG-induced DNA lesions activate proapoptotic BIM to suppress lymphomagenesis in p53-deficient mice

PubMed Central

Herold, Marco J.

2016-01-01

Neoplastic transformation is driven by oncogenic lesions that facilitate unrestrained cell expansion and resistance to antiproliferative signals. These oncogenic DNA lesions, acquired through errors in DNA replication, gene recombination, or extrinsically imposed damage, are thought to activate multiple tumor suppressive pathways, particularly apoptotic cell death. DNA damage induces apoptosis through well-described p53-mediated induction of PUMA and NOXA. However, loss of both these mediators (even together with defects in p53-mediated induction of cell cycle arrest and cell senescence) does not recapitulate the tumor susceptibility observed in p53−/− mice. Thus, potentially oncogenic DNA lesions are likely to also trigger apoptosis through additional, p53-independent processes. We found that loss of the BH3-only protein BIM accelerated lymphoma development in p53-deficient mice. This process was negated by concomitant loss of RAG1/2-mediated antigen receptor gene rearrangement. This demonstrates that BIM is critical for the induction of apoptosis caused by potentially oncogenic DNA lesions elicited by RAG1/2-induced gene rearrangement. Furthermore, this highlights the role of a BIM-mediated tumor suppressor pathway that acts in parallel to the p53 pathway and remains active even in the absence of wild-type p53 function, suggesting this may be exploited in the treatment of p53-deficient cancers. PMID:27621418

Immunohistochemical study of p53 and proliferating cell nuclear antigen expression in odontogenic keratocyst and periapical cyst.

PubMed

Sajeevan, Thara Purath; Saraswathi, Tillai Rajasekaran; Ranganathan, Kannan; Joshua, Elizabeth; Rao, Uma Devi K

2014-07-01

p53 protein is a product of p53 gene, which is now classified as a tumor suppressor gene. The gene is a frequent target for mutation, being seen as a common step in the pathogenesis of many human cancers. Proliferating cell nuclear antigen (PCNA) is an auxiliary protein of DNA polymerase delta and plays a critical role in initiation of cell proliferation. The aim of this study is to assess and compare the expression of p53 and PCNA in lining epithelium of odontogenic keratocyst (OKC) and periapical cyst (PA). A total of 20 cases comprising 10 OKC and 10 PA were included in retrospective study. Three paraffin section of 4 μm were cut, one was used for routine hematoxylin and eosin stain, while the other two were used for immunohistochemistry. Statistical analysis was performed using Chi-square test. The level of staining and intensity were assessed in all these cases. OKC showed PCNA expression in all cases (100%), whereas in perapical cyst only 60% of cases exhibited PCNA staining. (1) OKC showed p53 expression in 6 cases (60%) whereas in PA only 10% of the cases exhibited p53 staining. Chi-square test showed PCNA staining intensity was more significant than p53 in OKC. (2) The staining intensity of PA using p53, PCNA revealed that PCNA stating intensity was more significant than p53. OKC shows significant proliferative activity than PA using PCNA and p53. PCNA staining was more intense when compared with p53 in both OKC and PA.

In vivo and in vitro cloning and phenotype characterization of tellurite resistance determinant conferred by plasmid pTE53 of a clinical isolate of Escherichia coli.

PubMed

Burian, J; Tu, N; Kl'ucár, L; Guller, L; Lloyd-Jones, G; Stuchlík, S; Fejdi, P; Siekel, P; Turna, J

1998-01-01

A determinant encoding resistance against potassium tellurite (Te(r)) was discovered in a clinical isolate of Escherichia coli strain KL53. The strain formed typical black colonies on solid LB medium with tellurite. The determinant was located on a large conjugative plasmid designated pTE53. Electron-dense particles were observed in cells harboring pTE53 by electron microscopy. X-Ray identification analysis identified these deposits as elemental tellurium and X-ray diffraction analysis showed patterns typical of crystalline structures. Comparison with JCPDS 4-0554 (Joint Committee on Powder Diffraction Standards) reference data confirmed that these crystals were pure tellurium crystals. In common with other characterized Te(r) determinants, accumulation studies with radioactively labeled tellurite showed that reduced uptake of tellurite did not contribute to the resistance mechanism. Tellurite accumulation rates for E. coli strain AB1157 harboring pTE53 were twice higher than for the plasmid-free host strain. In addition, no efflux mechanism was detected. The potassium tellurite resistance determinant of plasmid pTE53 was cloned using both in vitro and in vivo techniques in low-copy-number vectors pACYC184 and mini-Mu derivative pPR46. Cloning of the functional Te(r) determinant into high-copy cloning vectors pTZ19R and mini-Mu derivatives pBEf and pJT2 was not successful. During in vivo cloning experiments, clones with unusual "white colony" phenotypes were found on solid LB with tellurite. All these clones were Mucts62 lysogens. Their tellurite resistance levels were in the same order as the wild type strains. Clones with the "white" phenotype had a 3.6 times lower content of tellurium than the tellurite-reducing strain. Transformation of a "white" mutant with a recombinant pACYC184 based Te(r) plasmid did not change the phenotype. However, when one clone was cured from Mucts62 the "white" phenotype reverted to the wild-type "black" phenotype. It was suggested that the "white" phenotype was the result of an insertional inactivation of an unknown chromosomal gene by Mucts62, which reduced the tellurite uptake.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stols, L.; Donnelly, M.I.; Kulkarni, G.

The malic enzyme gene of Ascaris suum was cloned into the vector pTRC99a in two forms encoding alternative amino-termini. The resulting plasmids, pMEA1 and pMEA2, were introduced into Escherichia coli NZN111, a strain that is unable to grow fermentatively because of inactivation of the genes encoding pyruvate dissimilation. Induction of pMEA1, which encodes the native animoterminus, gave better overexpression of malic enzyme, approx 12-fold compared to uninduced cells. Under the appropriate culture conditions, expression of malic enzyme allowed the fermentative dissimilation of glucose by NZN111. The major fermentation product formed in induced cultures was succinic acid.

p53 targets chromatin structure alteration to repress alpha-fetoprotein gene expression.

PubMed

Ogden, S K; Lee, K C; Wernke-Dollries, K; Stratton, S A; Aronow, B; Barton, M C

2001-11-09

Many of the functions ascribed to p53 tumor suppressor protein are mediated through transcription regulation. We have shown that p53 represses hepatic-specific alpha-fetoprotein (AFP) gene expression by direct interaction with a composite HNF-3/p53 DNA binding element. Using solid-phase, chromatin-assembled AFP DNA templates and analysis of chromatin structure and transcription in vitro, we find that p53 binds DNA and alters chromatin structure at the AFP core promoter to regulate transcription. Chromatin assembled in the presence of hepatoma extracts is activated for AFP transcription with an open, accessible core promoter structure. Distal (-850) binding of p53 during chromatin assembly, but not post-assembly, reverses transcription activation concomitant with promoter inaccessibility to restriction enzyme digestion. Inhibition of histone deacetylase activity by trichostatin-A (TSA) addition, prior to and during chromatin assembly, activated chromatin transcription in parallel with increased core promoter accessibility. Chromatin immunoprecipitation analyses showed increased H3 and H4 acetylated histones at the core promoter in the presence of TSA, while histone acetylation remained unchanged at the site of distal p53 binding. Our data reveal that p53 targets chromatin structure alteration at the core promoter, independently of effects on histone acetylation, to establish repressed AFP gene expression.

2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

PubMed

Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

2016-09-06

The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

The impact of p53 on the early stage replication of retrovirus.

PubMed

Kinnetz, Michaela; Alghamdi, Faris; Racz, Michael; Hu, Wenwei; Shi, Binshan

2017-08-09

The function of p53 in cancer biology has been studied extensively, but its role in anti-retrovirus infection has been elusive for many years. The restriction of retrovirus early stage replication by p53 was investigated in this study. VSV-G pseudotyped retrovirus with GFP reporter gene was used to infect both HCT116 p53 +/+ cells and its isogenic p53 knockout HCT116 p53 -/- cells. The infection was detected by flow cytometry. Reverse transcription products were quantified by real time PCR. Mutation analysis was performed after 1-LTR cycle and 2-LTR cycle DNA were amplified and PCR products were sequenced. Transcription and translation of cyclin-dependent kinase inhibitor 1 (p21 Cip1 ) and SAM domain and HD domain-containing protein 1 (SAMHD1) were analyzed by TaqMan PCR and Western blot experiments. siRNA experiment was applied to study the role of p53 downstream gene p21 Cip1 in the restriction of retrovirus infection. It was found that the block of retrovirus infection in non-cycling cells was significantly attenuated in HCT116 p53 -/- cells when compared to HCT116 p53 +/+ cells. It was found that both late reverse transcription products and viral 2-LTR cycle DNA were significantly increased in infected non-cycling HCT116 p53 -/- cells. Furthermore, the mutation frequency detected in 1-LTR DNA from HCT116 p53 +/+ cells were significantly decreased in comparison to HCT116 p53 -/- cells. A higher number of insertion and deletion mutations were detected in the joint region of 2-LTR cycle DNA in infected p53 +/+ cells. Cell cycle analysis showed retrovirus infection promoted host cell replication. Higher levels of mRNA and protein of p21 Cip1 were found in HCT116 p53 +/+ cells in comparison to the HCT116 p53 -/- cells. Furthermore, knockdown of p21 Cip1 in non-cycling HCT116 p53 +/+ cells significantly increased the infection. The results of this study showed that p53 is an important restriction factor that interferes with retrovirus infection in its early stage of replication. Our results suggested that p53 mediates the inhibition of retrovirus infection in non-cycling cells through it downstream gene p21 Cip1 , and p53 also functions to influence formation of 1-LTR cycle and 2-LTR cycle DNA.

Csa-19, a radiation-responsive human gene, identified by an unbiased two-gel cDNA library screening method in human cancer cells

NASA Technical Reports Server (NTRS)

Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.

1997-01-01

A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.

p16 gene silencing along with p53 single-nucleotide polymorphism and risk of esophageal cancer in Northeast India.

PubMed

Das, Mandakini; Sharma, Santanu Kumar; Sekhon, Gaganpreet Singh; Mahanta, Jagadish; Phukan, Rup Kumar; Jalan, Bimal Kumar

2017-05-01

The high incidence of esophageal cancer in Northeast India and the unique ethnic background and dietary habits provide a great opportunity to study the molecular genetics behind esophageal squamous cell carcinoma in this part of the region. We hypothesized that in addition to currently known environmental risk factors for esophageal cancer, genetic and epigenetic factors are also involved in esophageal carcinogenesis in Northeast India. Therefore, in this study, we explored the possible association between the two important G1 cell cycle regulatory genes p16 and p53 and environmental risk factors and risk of esophageal carcinogenesis. A total of 100 newly diagnosed esophageal cancer cases along with equal number of age-, sex-, and ethnicity-matched controls were included in this study. Methylation-specific polymerase chain reaction was used to determine the p16 promoter methylation status. Single-nucleotide polymorphism at codon 72 of p53 gene was assessed by the polymerase chain reaction-restriction fragment length polymorphism method. Aberrant methylation of p16 gene was seen in 81% of esophageal cancer cases. Hypermethylation of p16 gene was not found in healthy controls. p53 Pro/Pro genotype was found to be a risk genotype in Northeast India compared with Arg/Pro and Arg/Arg. p53 variant/polymorphism was significantly associated with esophageal cancer risk in the study population under all three genetic models, namely, dominant model (Arg/Pro + Pro/Pro vs Arg/Arg odds ratio = 2.25, confidence interval = 1.19-4.26; p = 0.012), recessive model (Arg/Arg + Arg/Pro vs Pro/Pro odds ratio = 2.35, confidence interval = 1.24-4.44; p = 0.008), and homozygous model (Pro/Pro vs Arg/Arg odds ratio = 3.33, confidence interval = 1.54-7.20; p = 0.002). However, p53 variant/polymorphism was not statistically associated with esophageal cancer risk under the heterozygous model (Pro/Pro vs Arg/Pro). In the case-only analysis based on p16 methylation, the p53 variant/polymorphism (Pro/Pro or Arg/Pro) showed significant association for esophageal cancer risk (odds ratio = 3.33, confidence interval = 1.54-7.20; p = 0.002). Gene-gene and gene-environment interaction using the case-only approach revealed a strong association between p16 methylation, p53 single-nucleotide polymorphism, and environmental factors and esophageal cancer risk. Cases with p16 methylation and p53 variant/polymorphism (Pro/Pro or Arg/Pro) along with both betel quid and tobacco chewing habit (odds ratio = 8.29, confidence interval = 1.14-60.23; p = 0.037) conferred eightfold increased risk toward esophageal cancer development. This study reveals a synergistic interaction between epigenetic, genetic, and environmental factors and risk of esophageal cancer in this high-incidence region of Northeast India. The inactivation of either p16 or p53 in a majority of esophageal cancer cases in this study suggests the possible crosstalk between the important cell cycle genes.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

PubMed Central

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

PubMed

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-07-15

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

Adenovirally mediated p53 overexpression diversely influence the cell cycle of HEp-2 and CAL 27 cell lines upon cisplatin and methotrexate treatment.

PubMed

Kraljević Pavelić, Sandra; Marjanović, Marko; Poznić, Miroslav; Kralj, Marijeta

2009-12-01

p53 gene plays a crucial role in the response to therapy. Since it is inactivated in the majority of human cancers, it is strongly believed that the p53 mutations confer resistance to therapeutics. In this paper we analyzed the influence of two mechanistically diverse antitumor agents--cisplatin and methotrexate on the proliferation and cell cycle of two head and neck squamous cancer cell lines HEp-2 (wild type p53 gene, but HPV 18/E6-inactivated protein) and CAL 27 (mutated p53 gene), along with the influence of adenovirally mediated p53 overexpression in modulation of cisplatin and methoterexate effects, whereby subtoxic vector/compound concentrations were employed. p53 gene was introduced into tumor cells using adenoviral vector (AdCMV-p53). The cell cycle perturbations were measured by two parameter flow cytometry. The expression of p53, p21(WAF1/CIP1) and cyclin B1 proteins was examined using immunocytochemistry and western blot methods. In CAL 27 cells overexpression of p53 completely abrogated high S phase content observed in methotrexate-treated cells into a G1 and slight G2 arrest, while it sustained G2 arrest of the cells treated with cisplatin, along with the reduction of DNA synthesis and cyclin B1 expression. On the other hand, in HEp-2 cell line p53 overexpression slightly slowed down the progression through S phase in cells treated with methotrexate, decreased the cyclin B1 expression only after 24 h, and failed to sustain the G2 arrest after treatment with cisplatin alone. Instead, it increased the population of S phase cells that were not actively synthesizing DNA, sustained cyclin B1 expression and allowed the G2 cells to progress through mitosis. This study demonstrates that adenovirally mediated p53 overexpression at sub-cytotoxic levels enhanced the activity of low doses of cisplatin and methotrexate in HEp-2 and CAL 27 cells through changes in the cell cycle. However, the mechanisms of these effects differ depending on the genetic context and on the chemotherapeutics' modality of action.

Cytoplasmic sequestration of the tumor suppressor p53 by a heat shock protein 70 family member, mortalin, in human colorectal adenocarcinoma cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gestl, Erin E., E-mail: egestl@wcupa.edu; Anne Boettger, S., E-mail: aboettger@wcupa.edu

2012-06-29

Highlights: Black-Right-Pointing-Pointer Eight human colorectal cell lines were evaluated for p53 and mortalin localization. Black-Right-Pointing-Pointer Six cell lines displayed cytoplasmic sequestration of the tumor suppressor p53. Black-Right-Pointing-Pointer Direct interaction between mortalin and p53 was shown in five cell lines. Black-Right-Pointing-Pointer Cell lines positive for p53 sequestration yielded elevated p53 expression levels. Black-Right-Pointing-Pointer This study yields the first evidence of cytoplasmic sequestration p53 by mortalin. -- Abstract: While it is known that cytoplasmic retention of p53 occurs in many solid tumors, the mechanisms responsible for this retention have not been positively identified. Since heatshock proteins like mortalin have been associated withmore » p53 inactivation in other tumors, the current study sought to characterize this potential interaction in never before examined colorectal adenocarcinoma cell lines. Six cell lines, one with 3 different fractions, were examined to determine expression of p53 and mortalin and characterize their cellular localization. Most of these cell lines displayed punctate p53 and mortalin localization in the cell cytoplasm with the exception of HCT-8 and HCT116 379.2 cells, where p53 was not detected. Nuclear p53 was only observed in HCT-116 40-16, LS123, and HT-29 cell lines. Mortalin was only localized in the cytoplasm in all cell lines. Co-immunoprecipitation and immunohistochemistry revealed that p53 and mortalin were bound and co-localized in the cytoplasmic fraction of four cell lines, HCT-116 (40-16 and 386; parental and heterozygous fractions respectively of the same cell line), HT-29, LS123 and LoVo, implying that p53 nuclear function is limited in those cell lines by being restricted to the cytoplasm. Mortalin gene expression levels were higher than gene expression levels of p53 in all cell lines. Cell lines with cytoplasmic sequestration of p53, however, also displayed elevated p53 gene expression levels compared to cell lines without p53 sequestration. Our data reveal the characteristic cytoplasmic sequestration of p53 by the heat shock protein mortalin in human colorectal adenocarcinoma cell lines, as is the case for other cancers, such as glioblastomas and hepatocellular carcinomas.« less

Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma.

PubMed

Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef

2005-07-01

To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

Transposon mutagenesis and cloning analysis of the pathways for degradation of 2,4-dichlorophenoxyacetic acid and 3-chlorobenzoate in Alcaligenes eutrophus JMP134(pJP4).

PubMed Central

Don, R H; Weightman, A J; Knackmuss, H J; Timmis, K N

1985-01-01

Plasmid pJP4 permits its host bacterium, strain JMP134, to degrade and utilize as sole sources of carbon and energy 3-chlorobenzoate and 2,4-dichlorophenoxyacetic acid (R. H. Don and J. M. Pemberton, J. Bacteriol. 145:681-686, 1981). Mutagenesis of pJP4 by transposons Tn5 and Tn1771 enabled localization of five genes for enzymes involved in these catabolic pathways. Four of the genes, tfdB, tfdC, tfdD, and tfdE, encoded 2,4-dichlorophenol hydroxylase, dichlorocatechol 1,2-dioxygenase, chloromuconate cycloisomerase, and chlorodienelactone hydrolase, respectively. No function has been assigned to the fifth gene, tfdF, although it may encode a trans-chlorodiene-lactone isomerase. Inactivation of genes tfdC, tfdD, and tfdE, which encode the transformation of dichlorocatechol to chloromaleylacetic acid, prevented host strain JMP134 from degrading both 3-chlorobenzoate and 2,4-dichlorophenoxyacetic acid, which indicates that the pathways for these two substrates utilize common enzymes for the dissimilation of chlorocatechols. Studies with cloned catabolic genes from pJP4 indicated that whereas all essential steps in the degradation of 2,4-dichlorophenoxyacetic acid are plasmid encoded, the conversion of 3-chlorobenzoate to chlorocatechol is specified by chromosomal genes. PMID:2981813

The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential

PubMed Central

Arsic, Nikola; Gadea, Gilles; Lagerqvist, E. Louise; Busson, Muriel; Cahuzac, Nathalie; Brock, Carsten; Hollande, Frederic; Gire, Veronique; Pannequin, Julie; Roux, Pierre

2015-01-01

Summary Cancer stem cells (CSC) are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform. PMID:25754205

p53-regulated autophagy is controlled by glycolysis and determines cell fate

PubMed Central

Duan, Lei; Perez, Ricardo E.; Davaadelger, Batzaya; Dedkova, Elena N.; Blatter, Lothar A.; Maki, Carl G.

2015-01-01

The tumor suppressor p53 regulates downstream targets that determine cell fate. Canonical p53 functions include inducing apoptosis, growth arrest, and senescence. Non-canonical p53 functions include its ability to promote or inhibit autophagy and its ability to regulate metabolism. The extent to which autophagy and/or metabolic regulation determines cell fate by p53 is unclear. To address this, we compared cells resistant or sensitive to apoptosis by the p53 activator Nutlin-3a. In resistant cells, glycolysis was maintained upon Nutlin-3a treatment, and activated p53 promoted prosurvival autophagy. In contrast, in apoptosis sensitive cells activated p53 increased superoxide levels and inhibited glycolysis through repression of glycolytic pathway genes. Glycolysis inhibition and increased superoxide inhibited autophagy by repressing ATG genes essential for autophagic vesicle maturation. Inhibiting glycolysis increased superoxide and blocked autophagy in apoptosis-resistant cells, causing p62-dependent caspase-8 activation. Finally, treatment with 2-DG or the autophagy inhibitors chloroquine or bafilomycin A1 sensitized resistant cells to Nutlin-3a-induced apoptosis. Together, these findings reveal novel links between glycolysis and autophagy that determine apoptosis-sensitivity in response to p53. Specifically, the findings indicate 1) that glycolysis plays an essential role in autophagy by limiting superoxide levels and maintaining expression of ATG genes required for autophagic vesicle maturation, 2) that p53 can promote or inhibit autophagy depending on the status of glycolysis, and 3) that inhibiting protective autophagy can expand the breadth of cells susceptible to Nutlin-3a induced apoptosis. PMID:26337205

A novel p53 mutational hotspot in skin tumors from UV-irradiated Xpc mutant mice alters transactivation functions.

PubMed

Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A

2002-08-22

A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

NASA Astrophysics Data System (ADS)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Expression of C-terminal deleted p53 isoforms in neuroblastoma

PubMed Central

Goldschneider, David; Horvilleur, Emilie; Plassa, Louis-François; Guillaud-Bataille, Marine; Million, Karine; Wittmer-Dupret, Evelyne; Danglot, Gisèle; de Thé, Hughes; Bénard, Jean; May, Evelyne; Douc-Rasy, Sétha

2006-01-01

The tumor suppressor gene, p53, is rarely mutated in neuroblastomas (NB) at the time of diagnosis, but its dysfunction could result from a nonfunctional conformation or cytoplasmic sequestration of the wild-type p53 protein. However, p53 mutation, when it occurs, is found in NB tumors with drug resistance acquired over the course of chemotherapy. As yet, no study has been devoted to the function of the specific p53 mutants identified in NB cells. This study includes characterization and functional analysis of p53 expressed in eight cell lines: three wild-type cell lines and five cell lines harboring mutations. We identified two transcription-inactive p53 variants truncated in the C-terminus, one of which corresponded to the p53β isoform recently identified in normal tissue by Bourdon et al. [J. C. Bourdon, K. Fernandes, F. Murray-Zmijewski, G. Liu, A. Diot, D. P. Xirodimas, M. K. Saville and D. P. Lane (2005) Genes Dev., 19, 2122–2137]. Our results show, for the first time, that the p53β isoform is the only p53 species to be endogenously expressed in the human NB cell line SK-N-AS, suggesting that the C-terminus truncated p53 isoforms may play an important role in NB tumor development. PMID:17028100

A universal method for the mutational analysis of K-ras and p53 gene in non-small-cell lung cancer using formalin-fixed paraffin-embedded tissue.

PubMed

Sarkar, F H; Valdivieso, M; Borders, J; Yao, K L; Raval, M M; Madan, S K; Sreepathi, P; Shimoyama, R; Steiger, Z; Visscher, D W

1995-12-01

The p53 tumor suppressor gene has been found to be altered in almost all human solid tumors, whereas K-ras gene mutations have been observed in a limited number of human cancers (adenocarcinoma of colon, pancreas, and lung). Studies of mutational inactivation for both genes in the same patient's sample on non-small-cell lung cancer have been limited. In an effort to perform such an analysis, we developed and compared methods (for the mutational detection of p53 and K-ras gene) that represent a modified and universal protocol, in terms of DNA extraction, polymerase chain reaction (PCR) amplification, and nonradioisotopic PCR-single-strand conformation polymorphism (PCR-SSCP) analysis, which is readily applicable to either formalin-fixed, paraffin-embedded tissues or frozen tumor specimens. We applied this method to the evaluation of p53 (exons 5-8) and K-ras (codon 12 and 13) gene mutations in 55 cases of non-small-cell lung cancer. The mutational status in the p53 gene was evaluated by radioisotopic PCR-SSCP and compared with PCR-SSCP utilizing our standardized nonradioisotopic detection system using a single 6-microns tissue section. The mutational patterns observed by PCR-SSCP were subsequently confirmed by PCR-DNA sequencing. The mutational status in the K-ras gene was similarly evaluated by PCR-SSCP, and the specific mutation was confirmed by Southern slot-blot hybridization using 32P-labeled sequence-specific oligonucleotide probes for codons 12 and 13. Mutational changes in K-ras (codon 12) were found in 10 of 55 (18%) of non-small-cell lung cancers. Whereas adenocarcinoma showed K-ras mutation in 33% of the cases at codon 12, only one mutation was found at codon 13. As expected, squamous cell carcinoma samples (25 cases) did not show K-ras mutations. Mutations at exons 5-8 of the p53 gene were documented in 19 of 55 (34.5%) cases. Ten of the 19 mutations were single nucleotide point mutations, leading to amino acid substitution. Six showed insertional mutation, and three showed deletion mutations. Only three samples showed mutations of both K-ras and p53 genes. We conclude that although K-ras and p53 gene mutations are frequent in non-small-cell lung cancer, mutations of both genes in the same patient's samples are not common. We also conclude that this universal nonradioisotopic method is superior to other similar methods and is readily applicable to the rapid screening of large numbers of formalin-fixed, paraffin-embedded or frozen samples for the mutational analysis of multiple genes.

Glutamine reduces myocardial cell apoptosis in a rat model of sepsis by promoting expression of heat shock protein 90.

PubMed

Li, Wanxia; Tao, Shaoyu; Wu, Qinghua; Wu, Tao; Tao, Ran; Fan, Jun

2017-12-01

Myocardial cell injury and cardiac myocyte apoptosis are associated with sepsis. Glutamine (Gln) has been reported to repair myocardial cell injury. The aim of this study was to explore the role of Gln on cardiac myocytes in a cecal ligation and puncture (CLP) model of sepsis in Wistar rats. Following induction of sepsis in a CLP rat model, viral encoding heat shock protein 90 (Hsp90) gene and Hsp90dsDNA were designed to express and knockdown Hsp90, respectively. Rat cardiac tissues were examined histologically, and apoptosis was detected by terminal deoxynucleotidyl transferase dUTP nick end labeling staining. The expression of B-cell lymphoma-2 (Bcl-2), Bcl-2-associated X protein, Hsp90, p53 upregulated modulator of apoptosis, and p53 was measured by western blotting and real-time polymerase chain reaction. Caspase-3, caspase-8, and caspase-9 were detected by enzyme-linked immunosorbent assay. Rat cardiac myocyte damage induced by CLP was reduced by Gln treatment and Hsp90 overexpression, and these changes were reversed by Hsp90 knockdown. Bcl-2 expression, Bcl-2-associated X protein, p53, p53 upregulated modulator of apoptosis, caspase-8, caspase-9, and caspase-3 activities were significantly upregulated in the CLP model, which were reduced by Gln treatment and Hsp90 overexpression. Gln reduced apoptosis of cardiac myocytes in a rat model of sepsis, by promoting Hsp90 expression. Further studies are needed to determine the possible therapeutic action of Gln in sepsis in human tissue. Copyright © 2017 Elsevier Inc. All rights reserved.

Regulation of the expression of the cell-cycle gene ftsZ by DicF antisense RNA. Division does not require a fixed number of FtsZ molecules.

PubMed

Tétart, F; Bouché, J P

1992-03-01

We show that the 53-nucleotide RNA molecule encoded by gene dicF blocks cell division in Escherichia coli by inhibiting the translation of ftsZ mRNA. Such a role for dicF had been predicted on the basis of the complementarity of DicF RNA with the ribosome-binding region of the ftsZ mRNA. An analysis of ftsZ expression at its chromosomal locus, and of an ftsZ-lacZ translational fusion controlled by promoters ftsZ1p and ftsZ2p only, indicates that ftsZ is not autoregulated. Partial inhibition of FtsZ synthesis leads to increased cell size. However, the number of FtsZ molecules per cell can be reduced threefold without affecting the division rate significantly. Our results suggest that septation is not triggered by a fixed number of newly synthesized FtsZ molecules per cell.

Nuclear lamina genetic variants, including a truncated LAP2, in twins and siblings with nonalcoholic fatty liver disease.

PubMed

Brady, Graham F; Kwan, Raymond; Ulintz, Peter J; Nguyen, Phirum; Bassirian, Shirin; Basrur, Venkatesha; Nesvizhskii, Alexey I; Loomba, Rohit; Omary, M Bishr

2018-05-01

Nonalcoholic fatty liver disease (NAFLD) is becoming the major chronic liver disease in many countries. Its pathogenesis is multifactorial, but twin and familial studies indicate significant heritability, which is not fully explained by currently known genetic susceptibility loci. Notably, mutations in genes encoding nuclear lamina proteins, including lamins, cause lipodystrophy syndromes that include NAFLD. We hypothesized that variants in lamina-associated proteins predispose to NAFLD and used a candidate gene-sequencing approach to test for variants in 10 nuclear lamina-related genes in a cohort of 37 twin and sibling pairs: 21 individuals with and 53 without NAFLD. Twelve heterozygous sequence variants were identified in four lamina-related genes (ZMPSTE24, TMPO, SREBF1, SREBF2). The majority of NAFLD patients (>90%) had at least one variant compared to <40% of controls (P < 0.0001). When only insertions/deletions and changes in conserved residues were considered, the difference between the groups was similarly striking (>80% versus <25%; P < 0.0001). Presence of a lamina variant segregated with NAFLD independently of the PNPLA3 I148M polymorphism. Several variants were found in TMPO, which encodes the lamina-associated polypeptide-2 (LAP2) that has not been associated with liver disease. One of these, a frameshift insertion that generates truncated LAP2, abrogated lamin-LAP2 binding, caused LAP2 mislocalization, altered endogenous lamin distribution, increased lipid droplet accumulation after oleic acid treatment in transfected cells, and led to cytoplasmic association with the ubiquitin-binding protein p62/SQSTM1. Several variants in nuclear lamina-related genes were identified in a cohort of twins and siblings with NAFLD; one such variant, which results in a truncated LAP2 protein and a dramatic phenotype in cell culture, represents an association of TMPO/LAP2 variants with NAFLD and underscores the potential importance of the nuclear lamina in NAFLD. (Hepatology 2018;67:1710-1725). © 2017 by the American Association for the Study of Liver Diseases.

Uterine deletion of Trp53 compromises antioxidant responses in mouse decidua

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burnum, Kristin E.; Hirota, Yasushi; Baker, Erin Shammel

2012-09-01

Preterm birth is a global health issue impacting both mothers and children. However, the etiology of preterm birth is not clearly understood. From our recent finding that premature decidual senescence with terminal differentiation is a cause of preterm birth in mice with uterine Trp53 deletion, encoding p53 protein, led us to explore other potential factors that are related to preterm birth. Utilizing proteomics approaches, here we show that 183 candidate proteins cause significant changes in decidua with Trp53 deletion as compared to normal decidua. Functional categorization of these proteins unveiled new pathways that are influenced by p53. In particular, downregulationmore » of a cluster of antioxidant proteins in p53 deficient decidua suggests that increased oxidative stress could be one cause of preterm birth in mice with uterine deletion of Trp53.« less

Uterine Deletion of Trp53 Compromises Antioxidant Responses in the Mouse Decidua

PubMed Central

Burnum, Kristin E.; Hirota, Yasushi; Baker, Erin S.; Yoshie, Mikihiro; Ibrahim, Yehia M.; Monroe, Matthew E.; Anderson, Gordon A.; Smith, Richard D.; Daikoku, Takiko

2012-01-01

Preterm birth is a global health issue impacting millions of mothers and babies. However, the etiology of preterm birth is not clearly understood. Our recent finding that premature decidual senescence with terminal differentiation is a cause of preterm birth in mice with uterine Trp53 deletion, encoding p53 protein, led us to explore other potential factors that are related to preterm birth. Using proteomics approaches, here, we show that 183 candidate proteins show significant changes in deciduae with Trp53 deletion as compared with normal deciduae. Functional categorization of these proteins unveiled new pathways that are influenced by p53. In particular, down-regulation of a cluster of antioxidant enzymes in p53-deficient deciduae suggests that increased oxidative stress could be one cause of preterm birth in mice harboring uterine deletion of Trp53. PMID:22759378

Homozygous missense mutation in the LMAN2L gene segregates with intellectual disability in a large consanguineous Pakistani family.

PubMed

Rafiullah, Rafiullah; Aslamkhan, Muhammad; Paramasivam, Nagarajan; Thiel, Christian; Mustafa, Ghulam; Wiemann, Stefan; Schlesner, Matthias; Wade, Rebecca C; Rappold, Gudrun A; Berkel, Simone

2016-02-01

Intellectual disability (ID) is a neurodevelopmental disorder affecting 1%-3% of the population worldwide. It is characterised by high phenotypic and genetic heterogeneity and in most cases the underlying cause of the disorder is unknown. In our study we investigated a large consanguineous family from Baluchistan, Pakistan, comprising seven affected individuals with a severe form of autosomal recessive ID (ARID) and epilepsy, to elucidate a putative genetic cause. Whole exome sequencing (WES) of a trio, including a child with ID and epilepsy and its healthy parents that were part of this large family, revealed a homozygous missense variant p.R53Q in the lectin mannose-binding 2-like (LMAN2L) gene. This homozygous variant was co-segregating in the family with the phenotype of severe ID and infantile epilepsy; unaffected family members were heterozygous variant carriers. The variant was predicted to be pathogenic by five different in silico programmes and further three-dimensional structure modelling of the protein suggests that variant p.R53Q may impair protein-protein interaction. LMAN2L (OMIM: 609552) encodes for the lectin, mannose-binding 2-like protein which is a cargo receptor in the endoplasmic reticulum important for glycoprotein transport. Genome-wide association studies have identified an association of LMAN2L to different neuropsychiatric disorders. This is the first report linking LMAN2L to a phenotype of severe ARID and seizures, indicating that the deleterious homozygous p.R53Q variant very likely causes the disorder. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

An Efficient Method for Generation of Knockout Human Embryonic Stem Cells Using CRISPR/Cas9 System.

PubMed

Bohaciakova, Dasa; Renzova, Tereza; Fedorova, Veronika; Barak, Martin; Kunova Bosakova, Michaela; Hampl, Ales; Cajanek, Lukas

2017-11-01

Human embryonic stem cells (hESCs) represent a promising tool to study functions of genes during development, to model diseases, and to even develop therapies when combined with gene editing techniques such as CRISPR/CRISPR-associated protein-9 nuclease (Cas9) system. However, the process of disruption of gene expression by generation of null alleles is often inefficient and tedious. To circumvent these limitations, we developed a simple and efficient protocol to permanently downregulate expression of a gene of interest in hESCs using CRISPR/Cas9. We selected p53 for our proof of concept experiments. The methodology is based on series of hESC transfection, which leads to efficient downregulation of p53 expression even in polyclonal population (p53 Low cells), here proven by a loss of regulation of the expression of p53 target gene, microRNA miR-34a. We demonstrate that our approach achieves over 80% efficiency in generating hESC clonal sublines that do not express p53 protein. Importantly, we document by a set of functional experiments that such genetically modified hESCs do retain typical stem cells characteristics. In summary, we provide a simple and robust protocol to efficiently target expression of gene of interest in hESCs that can be useful for laboratories aiming to employ gene editing in their hESC applications/protocols.

Improved, ACMG-Compliant, in silico prediction of pathogenicity for missense substitutions encoded by TP53 variants.

PubMed

Fortuno, Cristina; James, Paul A; Young, Erin L; Feng, Bing; Olivier, Magali; Pesaran, Tina; Tavtigian, Sean V; Spurdle, Amanda B

2018-05-18

Clinical interpretation of germline missense variants represents a major challenge, including those in the TP53 Li-Fraumeni syndrome gene. Bioinformatic prediction is a key part of variant classification strategies. We aimed to optimize the performance of the Align-GVGD tool used for p53 missense variant prediction, and compare its performance to other bioinformatic tools (SIFT, PolyPhen-2) and ensemble methods (REVEL, BayesDel). Reference sets of assumed pathogenic and assumed benign variants were defined using functional and/or clinical data. Area under the curve and Matthews correlation coefficient (MCC) values were used as objective functions to select an optimized protein multi-sequence alignment with best performance for Align-GVGD. MCC comparison of tools using binary categories showed optimized Align-GVGD (C15 cut-off) combined with BayesDel (0.16 cut-off), or with REVEL (0.5 cut-off), to have the best overall performance. Further, a semi-quantitative approach using multiple tiers of bioinformatic prediction, validated using an independent set of non-functional and functional variants, supported use of Align-GVGD and BayesDel prediction for different strength of evidence levels in ACMG/AMP rules. We provide rationale for bioinformatic tool selection for TP53 variant classification, and have also computed relevant bioinformatic predictions for every possible p53 missense variant to facilitate their use by the scientific and medical community. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Zn(II)-curc targets p53 in thyroid cancer cells.

PubMed

Garufi, Alessia; D'Orazi, Valerio; Crispini, Alessandra; D'Orazi, Gabriella

2015-10-01

TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers.

Abrogation of p53 by its antisense in MCF-7 breast carcinoma cells increases cyclin D1 via activation of Akt and promotion of cell proliferation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chhipa, Rishi Raj; Kumari, Ratna; Upadhyay, Ankur Kumar

2007-11-15

The p53 protein has been a subject of intense research interest since its discovery as about 50% of human cancers carry p53 mutations. Mutations in the p53 gene are the most frequent genetic lesions in breast cancers suggesting a critical role of p53 in breast cancer development, growth and chemosensitivity. This report describes the derivation and characterization of MCF-7As53, an isogenic cell line derived from MCF-7 breast carcinoma cells in which p53 was abrogated by antisense p53 cDNA. Similar to MCF-7 and simultaneously selected hygromycin resistant MCF-7H cells, MCF-7As53 cells have consistent basal epithelial phenotype, morphology, and estrogen receptor expressionmore » levels at normal growth conditions. Present work documents investigation of molecular variations, growth kinetics, and cell cycle related studies in relation to absence of wild-type p53 protein and its transactivation potential as well. Even though wild-type tumor suppressor p53 is an activator of cell growth arrest and apoptosis-mediator genes such as p21, Bax, and GADD45 in MCF-7As53 cells, no alterations in expression levels of these genes were detected. The doubling time of these cells decreased due to depletion of G0/G1 cell phase because of constitutive activation of Akt and increase in cyclin D1 protein levels. This proliferative property was abrogated by wortmannin, an inhibitor of PI3-K/Akt signaling pathway. Therefore this p53 null cell line indicates that p53 is an indispensable component of cellular signaling system which is regulated by caveolin-1 expression, involving Akt activation and increase in cyclin D1, thereby promoting proliferation of breast cancer cells.« less

Pathways of Metabolite-related Damage to A Synthetic p53 Gene Exon 7 Oligonucleotide using Magnetic Enzyme Bioreactor Beads and LC-MS/MS Sequencing.

PubMed

Malla, Spundana; Kadimisetty, Karteek; Jiang, Di; Choudhary, Dharamainder; Rusling, James F

2018-05-11

Reactive metabolites of environmental chemicals and drugs can cause site-specific damage to p53 tumor suppressor gene in a major pathway for genotoxicity. We report here a high throughput, cell-free, 96-well plate magnetic bead-enzyme system interfaced with LC-MS/MS sequencing to bioactivate test chemicals and identify resulting adduction sites on genes. Bioactivated aflatoxin B1 was reacted with a 32 bp exon 7 fragment of the p53 gene using 8 microsomal cyt P450 enzymes from different organs coated on magnetic beads. All cyt P450s converted aflatoxin B1 to aflatoxin B1-8,9-epoxide that adducts guanine (G) in codon 249, with subsequent depurination to give abasic sites, then strand breaks. This is the first demonstration in a cell-free medium that aflatoxin B1 metabolite selectively causes abasic site formation and strand breaks at codon 249 of the p53 probe, corresponding to the chemical pathway and mutations of p53 in human liver cells and tumors. Molecular modeling supports the view that binding of aflatoxin B1-8,9-epoxide to G in codon 249 precedes the SN2 adduction reaction. Among a range of metabolic enzymes characteristic of different organs, human liver microsomes and cyt P450 3A5 supersomes showed the highest bioactivation rate for p53 exon 7 damage. This method to identify metabolite-related gene damage sites may facilitate predictions of organ-specific cancers for test chemicals via correlations with mutation sites.

Amino acid substitutions in the VanS sensor of the VanA-type vancomycin-resistant Enterococcus strains result in high-level vancomycin resistance and low-level teicoplanin resistance.

PubMed

Hashimoto, Y; Tanimoto, K; Ozawa, Y; Murata, T; Ike, Y

2000-04-15

The vancomycin-resistant enterococci GV1, GV2 and GV3, which were isolated from droppings from broiler farms in Japan have been characterized as VanA-type VRE, which express high-level vancomycin resistance (256 or 512 microg ml(-1), MIC) and low-level teicoplanin resistance (1 or 2 microg ml(-1), MIC). The vancomycin resistances were encoded on plasmids. The vancomycin resistance conjugative plasmid pMG2 was isolated from the GV2 strain. The VanA determinant of pMG2 showed the same genetic organization as that of the VanA genes encoded on the representative transposon Tn1546, which comprises vanRSHAXYZ. The nucleotide sequences of all the genes, except the gene related to the vanS gene on Tn1546, were completely identical to the genes encoded on Tn1546. Three amino acid substitutions in the N-terminal region of the deduced VanS were detected in the nucleotide sequence of vanS encoded on pMG2. There were also three amino acid substitutions in the vanS gene of the GV1 and GV3 strains in the same positions as in the vanS gene of pMG2. Vancomycin induced the increased teicoplanin resistance in these strains.

Natural Mutations in Streptococcus agalactiae Resulting in Abrogation of β Antigen Production

PubMed Central

Vasilyeva, Anastasia; Santos Sanches, Ilda; Florindo, Carlos; Dmitriev, Alexander

2015-01-01

Streptococcus agalactiae genome encodes 21 two-component systems (TCS) and a variety of regulatory proteins in order to control gene expression. One of the TCS, BgrRS, comprising the BgrR DNA-binding regulatory protein and BgrS sensor histidine kinase, was discovered within a putative virulence island. BgrRS influences cell metabolism and positively control the expression of bac gene, coding for β antigen at transcriptional level. Inactivation of bgrR abrogated bac gene expression and increased virulence properties of S. agalactiae. In this study, a total of 140 strains were screened for the presence of bac gene, and the TCS bgrR and bgrS genes. A total of 53 strains carried the bac, bgrR and bgrS genes. Most of them (48 strains) expressed β antigen, while five strains did not express β antigen. Three strains, in which bac gene sequence was intact, while bgrR and/or bgrS genes had mutations, and expression of β antigen was absent, were complemented with a constructed plasmid pBgrRS(P) encoding functionally active bgrR and bgrS gene alleles. This procedure restored expression of β antigen indicating the crucial regulatory role of TCS BgrRS. The complemented strain A49V/BgrRS demonstrated attenuated virulence in intraperitoneal mice model of S. agalactiae infection compared to parental strain A49V. In conclusion we showed that disruption of β antigen expression is associated with: i) insertion of ISSa4 upstream the bac gene just after the ribosomal binding site; ii) point mutation G342A resulting a stop codon TGA within the bac gene and a truncated form of β antigen; iii) single deletion (G) in position 439 of the bgrR gene resulting in a frameshift and the loss of DNA-binding domain of the BgrR protein, and iv) single base substitutions in bgrR and bgrS genes causing single amino acid substitutions in BgrR (Arg187Lys) and BgrS (Arg252Gln). The fact that BgrRS negatively controls virulent properties of S. agalactiae gives a novel clue for understanding of S. agalactiae adaptation to the human. PMID:26047354

Natural Mutations in Streptococcus agalactiae Resulting in Abrogation of β Antigen Production.

PubMed

Vasilyeva, Anastasia; Santos Sanches, Ilda; Florindo, Carlos; Dmitriev, Alexander

2015-01-01

Streptococcus agalactiae genome encodes 21 two-component systems (TCS) and a variety of regulatory proteins in order to control gene expression. One of the TCS, BgrRS, comprising the BgrR DNA-binding regulatory protein and BgrS sensor histidine kinase, was discovered within a putative virulence island. BgrRS influences cell metabolism and positively control the expression of bac gene, coding for β antigen at transcriptional level. Inactivation of bgrR abrogated bac gene expression and increased virulence properties of S. agalactiae. In this study, a total of 140 strains were screened for the presence of bac gene, and the TCS bgrR and bgrS genes. A total of 53 strains carried the bac, bgrR and bgrS genes. Most of them (48 strains) expressed β antigen, while five strains did not express β antigen. Three strains, in which bac gene sequence was intact, while bgrR and/or bgrS genes had mutations, and expression of β antigen was absent, were complemented with a constructed plasmid pBgrRS(P) encoding functionally active bgrR and bgrS gene alleles. This procedure restored expression of β antigen indicating the crucial regulatory role of TCS BgrRS. The complemented strain A49V/BgrRS demonstrated attenuated virulence in intraperitoneal mice model of S. agalactiae infection compared to parental strain A49V. In conclusion we showed that disruption of β antigen expression is associated with: i) insertion of ISSa4 upstream the bac gene just after the ribosomal binding site; ii) point mutation G342A resulting a stop codon TGA within the bac gene and a truncated form of β antigen; iii) single deletion (G) in position 439 of the bgrR gene resulting in a frameshift and the loss of DNA-binding domain of the BgrR protein, and iv) single base substitutions in bgrR and bgrS genes causing single amino acid substitutions in BgrR (Arg187Lys) and BgrS (Arg252Gln). The fact that BgrRS negatively controls virulent properties of S. agalactiae gives a novel clue for understanding of S. agalactiae adaptation to the human.

The Drosophila pigmentation gene pink (p) encodes a homologue of human Hermansky-Pudlak syndrome 5 (HPS5).

PubMed

Falcón-Pérez, Juan M; Romero-Calderón, Rafael; Brooks, Elizabeth S; Krantz, David E; Dell'Angelica, Esteban C

2007-02-01

Lysosome-related organelles comprise a group of specialized intracellular compartments that include melanosomes and platelet dense granules (in mammals) and eye pigment granules (in insects). In humans, the biogenesis of these organelles is defective in genetic disorders collectively known as Hermansky-Pudlak syndrome (HPS). Patients with HPS-2, and two murine HPS models, carry mutations in genes encoding subunits of adaptor protein (AP)-3. Other genes mutated in rodent models include those encoding VPS33A and Rab38. Orthologs of all of these genes in Drosophila melanogaster belong to the 'granule group' of eye pigmentation genes. Other genes associated with HPS encode subunits of three complexes of unknown function, named biogenesis of lysosome-related organelles complex (BLOC)-1, -2 and -3, for which the Drosophila counterparts had not been characterized. Here, we report that the gene encoding the Drosophila ortholog of the HPS5 subunit of BLOC-2 is identical to the granule group gene pink (p), which was first studied in 1910 but had not been identified at the molecular level. The phenotype of pink mutants was exacerbated by mutations in AP-3 subunits or in the orthologs of VPS33A and Rab38. These results validate D. melanogaster as a genetic model to study the function of the BLOCs.

Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

PubMed Central

Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

2009-01-01

Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma

PubMed Central

Yan, Bin; Yang, Xinping; Lee, Tin-Lap; Friedman, Jay; Tang, Jun; Van Waes, Carter; Chen, Zhong

2007-01-01

Background Differentially expressed gene profiles have previously been observed among pathologically defined cancers by microarray technologies, including head and neck squamous cell carcinomas (HNSCCs). However, the molecular expression signatures and transcriptional regulatory controls that underlie the heterogeneity in HNSCCs are not well defined. Results Genome-wide cDNA microarray profiling of ten HNSCC cell lines revealed novel gene expression signatures that distinguished cancer cell subsets associated with p53 status. Three major clusters of over-expressed genes (A to C) were defined through hierarchical clustering, Gene Ontology, and statistical modeling. The promoters of genes in these clusters exhibited different patterns and prevalence of transcription factor binding sites for p53, nuclear factor-κB (NF-κB), activator protein (AP)-1, signal transducer and activator of transcription (STAT)3 and early growth response (EGR)1, as compared with the frequency in vertebrate promoters. Cluster A genes involved in chromatin structure and function exhibited enrichment for p53 and decreased AP-1 binding sites, whereas clusters B and C, containing cytokine and antiapoptotic genes, exhibited a significant increase in prevalence of NF-κB binding sites. An increase in STAT3 and EGR1 binding sites was distributed among the over-expressed clusters. Novel regulatory modules containing p53 or NF-κB concomitant with other transcription factor binding motifs were identified, and experimental data supported the predicted transcriptional regulation and binding activity. Conclusion The transcription factors p53, NF-κB, and AP-1 may be important determinants of the heterogeneous pattern of gene expression, whereas STAT3 and EGR1 may broadly enhance gene expression in HNSCCs. Defining these novel gene signatures and regulatory mechanisms will be important for establishing new molecular classifications and subtyping, which in turn will promote development of targeted therapeutics for HNSCC. PMID:17498291

TP53 Mutation Status of Tubo-ovarian and Peritoneal High-grade Serous Carcinoma with a Wild-type p53 Immunostaining Pattern.

PubMed

Na, Kiyong; Sung, Ji-Youn; Kim, Hyun-Soo

2017-12-01

Diffuse and strong nuclear p53 immunoreactivity and a complete lack of p53 expression are regarded as indicative of missense and nonsense mutations, respectively, of the TP53 gene. Tubo-ovarian and peritoneal high-grade serous carcinoma (HGSC) is characterized by aberrant p53 expression induced by a TP53 mutation. However, our experience with some HGSC cases with a wild-type p53 immunostaining pattern led us to comprehensively review previous cases and investigate the TP53 mutational status of the exceptional cases. We analyzed the immunophenotype of 153 cases of HGSC and performed TP53 gene sequencing analysis in those with a wild-type p53 immunostaining pattern. Immunostaining revealed that 109 (71.3%) cases displayed diffuse and strong p53 expression (missense mutation pattern), while 39 (25.5%) had no p53 expression (nonsense mutation pattern). The remaining five cases of HGSC showed a wild-type p53 immunostaining pattern. Direct sequencing analysis revealed that three of these cases harbored nonsense TP53 mutations and two had novel splice site deletions. TP53 mutation is almost invariably present in HGSC, and p53 immunostaining can be used as a surrogate marker of TP53 mutation. In cases with a wild-type p53 immunostaining pattern, direct sequencing for TP53 mutational status can be helpful to confirm the presence of a TP53 mutation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Decreased Virus Population Diversity in p53-Null Mice Infected with Weakly Oncogenic Abelson Virus

PubMed Central

Marchlik, Erica; Kalman, Richard; Rosenberg, Naomi

2005-01-01

The Abelson murine leukemia virus (Ab-MLV), like other retroviruses that contain v-onc genes, arose following a recombination event between a replicating retrovirus and a cellular oncogene. Although experimentally validated models have been presented to address the mechanism by which oncogene capture occurs, very little is known about the events that influence emerging viruses following the recombination event that incorporates the cellular sequences. One feature that may play a role is the genetic makeup of the host in which the virus arises; a number of host genes, including oncogenes and tumor suppressor genes, have been shown to affect the pathogenesis of many murine leukemia viruses. To examine how a host gene might affect an emerging v-onc gene-containing retrovirus, we studied the weakly oncogenic Ab-MLV-P90A strain, a mutant that generates highly oncogenic variants in vivo, and compared the viral populations in normal mice and mice lacking the p53 tumor suppressor gene. While variants arose in both p53+/+ and p53−/− tumors, the samples from the wild-type animals contained a more diverse virus population. Differences in virus population diversity were not observed when wild-type and null animals were infected with a highly oncogenic wild-type strain of Ab-MLV. These results indicate that p53, and presumably other host genes, affects the selective forces that operate on virus populations in vivo and likely influences the evolution of oncogenic retroviruses such as Ab-MLV. PMID:16140739

Oncogenic collaboration of the cyclin D1 (PRAD1, bcl-1) gene with a mutated p53 and an activated ras oncogene in neoplastic transformation.

PubMed

Uchimaru, K; Endo, K; Fujinuma, H; Zukerberg, L; Arnold, A; Motokura, T

1996-05-01

Cyclin D1 is one of the key regulators in G1 progression in the cell cycle and is also a candidate oncogene (termed PRAD1 or bcl-1) in several types of human tumors. We report a collaboration of the cyclin D1 gene with ras and a mutated form of p53 (p53-mt) in neoplastic transformation. Transfection of cyclin D1 alone or in combination with ras or with p53-mt was not sufficient for focus formation of rat embryonic fibroblasts. However, focus formation induced by co-transfection of ras and p53-mt was enhanced in the presence of the cyclin D1-expression plasmid. Co-transfection of ras- and p53-mt-transformants with the cyclin D1-expression plasmid resulted in reduced serum dependency in vitro. Furthermore, the transformants expressing exogenous cyclin D1 grew faster than those without the cyclin D1 plasmid when injected into nude mice. These observations strengthen the significance of cyclin D1 overexpression through gene rearrangement or gene amplification observed in human tumors as a step in multistep oncogenesis; deregulated expression of cyclin D1 may reduce the requirement for growth factors and may stimulate in vivo growth.

SIRT1 activation mediates heat-induced survival of UVB damaged Keratinocytes.

PubMed

Calapre, Leslie; Gray, Elin S; Kurdykowski, Sandrine; David, Anthony; Descargues, Pascal; Ziman, Mel

2017-06-10

Exposure to heat stress after UVB irradiation induces a reduction of apoptosis, resulting in survival of DNA damaged human keratinocytes. This heat-mediated evasion of apoptosis appears to be mediated by activation of SIRT1 and inactivation of p53 signalling. In this study, we assessed the role of SIRT1 in the inactivation of p53 signalling and impairment of DNA damage response in UVB plus heat exposed keratinocytes. Activation of SIRT1 after multiple UVB plus heat exposures resulted in increased p53 deacetylation at K382, which is known to affect its binding to specific target genes. Accordingly, we noted decreased apoptosis and down regulation of the p53 targeted pro-apoptotic gene BAX and the DNA repair genes ERCC1 and XPC after UVB plus heat treatments. In addition, UVB plus heat induced increased expression of the cell survival gene Survivin and the proliferation marker Ki67. Notably, keratinocytes exposed to UVB plus heat in the presence of the SIRT1 inhibitor, Ex-527, showed a similar phenotype to those exposed to UV alone; i.e. an increase in p53 acetylation, increased apoptosis and low levels of Survivin. This study demonstrate that heat-induced SIRT1 activation mediates survival of DNA damaged keratinocytes through deacetylation of p53 after exposure to UVB plus heat.

Bcl-2 protein expression associated with resistance to apoptosis in clear cell adenocarcinomas of the vagina and cervix expressing wild-type p53.

PubMed

Waggoner, S E; Baunoch, D A; Anderson, S A; Leigh, F; Zagaja, V G

1998-09-01

Clear cell adenocarcinomas (CCAs) of the vagina and cervix are rare tumors that often overexpress wild-type p53. In vitro, expression of protooncogene bcl-2 can block p53-mediated apoptosis. The objective of this study was to determine if bcl-2 is expressed in CCAs and whether this expression is associated with inhibition of apoptosis. Twenty-one paraffin-embedded clear cell adenocarcinomas were immunohistochemically stained for bcl-2 (antibody M 887, Dako, Carpinteria, CA) and DNA fragmentation (ApopTag, Oncor, Gaithersburg, MD), a marker for apoptosis. Fifteen tumors were associated with in utero exposure to diethylstilbestrol (DES). Prior p53 gene analysis had indicated the presence of wild-type p53 in each tumor. Human lymphoid tissue containing bcl-2-expressing lymphocytes and DNase I-exposed CCA tissue sections were used as positive controls for the bcl-2 and apoptosis assays, respectively. Expression of bcl-2 and DNA fragmentation was classified (0 to 3+) according to percentage of positive cells and intensity of staining. Expression of bcl-2 was identified in each CCA examined, and was strongly positive (2+ to 3+) in 18 of 21 samples. Despite the presence of wild-type p53, only 4 of 21 tumors showed evidence of apoptosis as assessed through DNA fragmentation. DNA damage leads to increased intracellular p53 levels. Overexpression of p53 induces apoptosis as a means of protecting organisms from the development of malignancy. CCAs of the vagina and cervix, which contain wild-type p53 genes and often overexpress p53 protein, presumably have evolved mechanisms to avoid p53-induced apoptosis. Our observations are consistent with the hypothesis that overexpression of bcl-2 can inhibit p53-mediated apoptosis and suggest a mechanism by which these rare tumors can arise without mutation of the p53 gene.

p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.

PubMed

Cox, Darren P

2012-01-01

Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.

CDIP, a novel pro-apoptotic gene, regulates TNFalpha-mediated apoptosis in a p53-dependent manner.

PubMed

Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W

2007-07-25

We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-alpha expression tightly correlates with CDIP expression, and that inhibition of TNF-alpha signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-alpha is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-alpha impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 --> CDIP --> TNF-alpha apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy.

Expression and Characterization of a Bifidobacterium adolescentis Beta-Mannanase Carrying Mannan-Binding and Cell Association Motifs

PubMed Central

Kulcinskaja, Evelina; Rosengren, Anna; Ibrahim, Romany; Kolenová, Katarína

2013-01-01

The gene encoding β-mannanase (EC 3.2.1.78) BaMan26A from the bacterium Bifidobacterium adolescentis (living in the human gut) was cloned and the gene product characterized. The enzyme was found to be modular and to contain a putative signal peptide. It possesses a catalytic module of the glycoside hydrolase family 26, a predicted immunoglobulin-like module, and two putative carbohydrate-binding modules (CBMs) of family 23. The enzyme is likely cell attached either by the sortase mechanism (LPXTG motif) or via a C-terminal transmembrane helix. The gene was expressed in Escherichia coli without the native signal peptide or the cell anchor. Two variants were made: one containing all four modules, designated BaMan26A-101K, and one truncated before the CBMs, designated BaMan26A-53K. BaMan26A-101K, which contains the CBMs, showed an affinity to carob galactomannan having a dissociation constant of 0.34 μM (8.8 mg/liter), whereas BaMan26A-53K did not bind, showing that at least one of the putative CBMs of family 23 is mannan binding. For BaMan26A-53K, kcat was determined to be 444 s−1 and Km 21.3 g/liter using carob galactomannan as the substrate at the optimal pH of 5.3. Both of the enzyme variants hydrolyzed konjac glucomannan, as well as carob and guar gum galactomannans to a mixture of oligosaccharides. The dominant product from ivory nut mannan was found to be mannotriose. Mannobiose and mannotetraose were produced to a lesser extent, as shown by high-performance anion-exchange chromatography. Mannobiose was not hydrolyzed, and mannotriose was hydrolyzed at a significantly lower rate than the longer oligosaccharides. PMID:23064345

The Coordinated P53 and Estrogen Receptor Cis-Regulation at an FLT1 Promoter SNP Is Specific to Genotoxic Stress and Estrogenic Compound

PubMed Central

Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto

2010-01-01

Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012

Reduction of a 4q35-encoded nuclear envelope protein in muscle differentiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ostlund, Cecilia; Department of Pathology and Cell Biology, College of Physicians and Surgeons, Columbia University, New York, NY 10032; Guan, Tinglu

2009-11-13

Muscular dystrophy and peripheral neuropathy have been linked to mutations in genes encoding nuclear envelope proteins; however, the molecular mechanisms underlying these disorders remain unresolved. Nuclear envelope protein p19A is a protein of unknown function encoded by a gene at chromosome 4q35. p19A levels are significantly reduced in human muscle as cells differentiate from myoblasts to myotubes; however, its levels are not similarly reduced in all differentiation systems tested. Because 4q35 has been linked to facioscapulohumeral muscular dystrophy (FSHD) and some adjacent genes are reportedly misregulated in the disorder, levels of p19A were analyzed in muscle samples from patients withmore » FSHD. Although p19A was increased in most cases, an absolute correlation was not observed. Nonetheless, p19A downregulation in normal muscle differentiation suggests that in the cases where its gene is inappropriately re-activated it could affect muscle differentiation and contribute to disease pathology.« less

Angiomodulin is required for cardiogenesis of embryonic stem cells and is maintained by a feedback loop network of p63 and Activin-A.

PubMed

Wolchinsky, Zohar; Shivtiel, Shoham; Kouwenhoven, Evelyn Nathalie; Putin, Daria; Sprecher, Eli; Zhou, Huiqing; Rouleau, Matthieu; Aberdam, Daniel

2014-01-01

The transcription factor p63, member of the p53 gene family, encodes for two main isoforms, TAp63 and ΔNp63 with distinct functions on epithelial homeostasis and cancer. Recently, we discovered that TAp63 is essential for in vitro cardiogenesis and heart development in vivo. TAp63 is expressed by embryonic endoderm and acts on cardiac progenitors by a cell-non-autonomous manner. In the present study, we search for cardiogenic secreted factors that could be regulated by TAp63 and, by ChIP-seq analysis, identified Angiomodulin (AGM), also named IGFBP7 or IGFBP-rP1. We demonstrate that AGM is necessary for cardiac commitment of embryonic stem cells (ESCs) and its regulation depends on TAp63 isoform. TAp63 directly activates both AGM and Activin-A during ESC cardiogenesis while these secreted factors modulate TAp63 gene expression by a feedback loop mechanism. The molecular circuitry controlled by TAp63 on AGM/Activin-A signaling pathway and thus on cardiogenesis emphasizes the importance of p63 during early cardiac development. © 2013.

The Role of BRCA1/BARD1 Heterodimers in the Mitosis-Interphase Transition

DTIC Science & Technology

2007-05-01

53 4 INTRODUCTION Germ line mutations in the BRCA1 gene predispose to breast and/or ovarian cancer (Miki, et al...Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brca1, Brca2, Brca1/Brca2, Brca1/p53, and Brca2/p53...Ludwig, T., Chapman, D.L., Papaioannou, V.E., and Efstratiadis, A. (1997). Targeted mutations of breast cancer susceptibility gene homo- logs in mice

Insights into Hydrocarbon Assimilation by Eurotialean and Hypocrealean Fungi: Roles for CYP52 and CYP53 Clans of Cytochrome P450 Genes.

PubMed

Huarte-Bonnet, Carla; Kumar, Suresh; Saparrat, Mario C N; Girotti, Juan R; Santana, Marianela; Hallsworth, John E; Pedrini, Nicolás

2018-03-01

Several filamentous fungi are able to concomitantly assimilate both aliphatic and polycyclic aromatic hydrocarbons that are the biogenic by-products of some industrial processes. Cytochrome P450 monooxygenases catalyze the first oxidation reaction for both types of substrate. Among the cytochrome P450 (CYP) genes, the family CYP52 is implicated in the first hydroxylation step in alkane-assimilation processes, while genes belonging to the family CYP53 have been linked with oxidation of aromatic hydrocarbons. Here, we perform a comparative analysis of CYP genes belonging to clans CYP52 and CYP53 in Aspergillus niger, Beauveria bassiana, Metarhizium robertsii (formerly M. anisopliae var. anisopliae), and Penicillium chrysogenum. These species were able to assimilate n-hexadecane, n-octacosane, and phenanthrene, exhibiting a species-dependent modification in pH of the nutrient medium during this process. Modeling of the molecular docking of the hydrocarbons to the cytochrome P450 active site revealed that both phenanthrene and n-octacosane are energetically favored as substrates for the enzymes codified by genes belonging to both CYP52 and CYP53 clans, and thus appear to be involved in this oxidation step. Analyses of gene expression revealed that CYP53 members were significantly induced by phenanthrene in all species studied, but only CYP52X1 and CYP53A11 from B. bassiana were highly induced with n-alkanes. These findings suggest that the set of P450 enzymes involved in hydrocarbon assimilation by fungi is dependent on phylogeny and reveal distinct substrate and expression specificities.

Synergistic effect of p53 on TSA-induced stanniocalcin 1 expression in human nasopharyngeal carcinoma cells, CNE2.

PubMed

Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C

2012-06-01

Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.

Functions of the Magnaporthe oryzae Flb3p and Flb4p transcription factors in the regulation of conidiation.

PubMed

Matheis, S; Yemelin, A; Scheps, D; Andresen, K; Jacob, S; Thines, E; Foster, A J

2017-03-01

The Magnaporthe oryzae genes FLB3 and FLB4, orthologues of the Aspergillus nidulans regulators of conidiation FlbC and FlbD, were inactivated. These genes encode C2H2 zinc finger and Myb-like transcription factors, respectively, in A. nidulans. Analysis of the resultant mutants demonstrated that FLB4 is essential for spore formation and that strains lacking this gene are fluffy in their colony morphology due to an inability to complete conidiophore formation. Meanwhile, FLB3 is required for normal levels of aerial mycelium formation. We identified genes dependent on both transcription factors using microarray analysis. This analysis revealed that the transcription of several genes encoding proteins implicated in sporulation in Magnaporthe oryzae and other filamentous fungi are affected by FLB3 or FLB4 inactivation. Furthermore, the microarray analysis indicates that Flb3p may effectively reprogramme the cell metabolically by repressing transcription of genes encoding biosynthetic enzymes and inducing transcription of genes encoding catabolic enzymes. Additionally, qRT-PCR was employed and showed that FLB3 and FLB4 transcripts are enriched in synchronously sporulating cultures, as were the transcripts of other genes that are necessary for normal conidiation, consistent with a role for their gene products in this process. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

PubMed

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Unusual Genomic Traits Suggest Methylocystis bryophila S285 to Be Well Adapted for Life in Peatlands

PubMed Central

Han, Dongfei; Dedysh, Svetlana N

2018-01-01

Abstract The genus Methylocystis belongs to the class Alphaproteobacteria, the family Methylocystaceae, and encompasses aerobic methanotrophic bacteria with the serine pathway of carbon assimilation. All Methylocystis species are able to fix dinitrogen and several members of this genus are also capable of using acetate or ethanol in the absence of methane, which explains their wide distribution in various habitats. One additional trait that enables their survival in the environment is possession of two methane-oxidizing isozymes, the conventional particulate methane monooxygenase (pMMO) with low-affinity to substrate (pMMO1) and the high-affinity enzyme (pMMO2). Here, we report the finished genome sequence of Methylocystis bryophila S285, a pMMO2-possessing methanotroph from a Sphagnum-dominated wetland, and compare it to the genome of Methylocystis sp. strain SC2, which is the first methanotroph with confirmed high-affinity methane oxidation potential. The complete genome of Methylocystis bryophila S285 consists of a 4.53 Mb chromosome and one plasmid, 175 kb in size. The genome encodes two types of particulate MMO (pMMO1 and pMMO2), soluble MMO and, in addition, contains a pxmABC-like gene cluster similar to that present in some gammaproteobacterial methanotrophs. The full set of genes related to the serine pathway, the tricarboxylic acid cycle as well as the ethylmalonyl-CoA pathway is present. In contrast to most described methanotrophs including Methylocystis sp. strain SC2, two different types of nitrogenases, that is, molybdenum–iron and vanadium–iron types, are encoded in the genome of strain S285. This unique combination of genome-based traits makes Methylocystis bryophila well adapted to the fluctuation of carbon and nitrogen sources in wetlands. PMID:29390143

DOE Office of Scientific and Technical Information (OSTI.GOV)

Das, Amitabh, E-mail: amitabhdas.kn@gmail.com; Chai, Jin Choul, E-mail: jincchai@gmail.com; Jung, Kyoung Hwa, E-mail: khjung2@gmail.com

JMJD2A is a lysine trimethyl-specific histone demethylase that is highly expressed in a variety of tumours. The role of JMJD2A in tumour progression remains unclear. The objectives of this study were to identify JMJD2A-regulated genes and understand the function of JMJD2A in p53-null neuroectodermal stem cells (p53{sup −/−} NE-4Cs). We determined the effect of LPS as a model of inflammation in p53{sup −/−} NE-4Cs and investigated whether the epigenetic modifier JMJD2A alter the expression of tumourigenic inflammatory genes. Global gene expression was measured in JMJD2A knockdown (kd) p53{sup −/−} NE-4Cs and in LPS-stimulated JMJD2A-kd p53{sup −/−} NE-4C cells. JMJD2A attenuationmore » significantly down-regulated genes were Cdca2, Ccnd2, Ccnd1, Crebbp, IL6rα, and Stat3 related with cell cycle, proliferation, and inflammatory-disease responses. Importantly, some tumour-suppressor genes including Dapk3, Timp2 and TFPI were significantly up-regulated but were not affected by silencing of the JMJD2B. Furthermore, we confirmed the attenuation of JMJD2A also down-regulated Cdca2, Ccnd2, Crebbp, and Rest in primary NSCs isolated from the forebrains of E15 embryos of C57/BL6J mice with effective p53 inhibitor pifithrin-α (PFT-α). Transcription factor (TF) motif analysis revealed known binding patterns for CDC5, MYC, and CREB, as well as three novel motifs in JMJD2A-regulated genes. IPA established molecular networks. The molecular network signatures and functional gene-expression profiling data from this study warrants further investigation as an effective therapeutic target, and studies to elucidate the molecular mechanism of JMJD2A-kd-dependent effects in neuroectodermal stem cells should be performed. - Highlights: • Significant up-regulation of epigenetic modifier JMJD2A mRNA upon LPS treatment. • Inhibition of JMJD2A attenuated key inflammatory and tumourigenic genes. • Establishing IPA based functional genomics in JMJD2A-attenuated p53{sup −/−} NE4C cells. • Finding JMJD2A-based molecular targets and crucial pathways in p53{sup −/−} NE4C cells.« less

Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils

PubMed Central

Stegh, Alexander H.

2012-01-01

Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435

p53 mutation, but not in vitro predictor genes of therapeutic efficacy of cisplatin, is clinically relevant in comparing partial and complete responder cases of maxillary squamous cell carcinoma.

PubMed

Kudo, Itsuhiro; Esumi, Mariko; Kida, Akihiro; Ikeda, Minoru

2010-10-01

To predict the efficacy of cisplatin and radiation therapy for maxillary squamous cell carcinoma, we examined the mRNA expression of 14 cisplatin-resistant genes and p53 mutation in specimens biopsied from patients prior to initiation of therapy. Five of 10 patients had mutations in the p53 gene, of whom four had residual tumors pathologically following chemoradiotherapy (p=0.0476). Of 14 genes examined, the mRNA expression of ATP7B was significantly lower in cases that were resistant to chemoradiotherapy. Six genes including multidrug resistance protein 1 (MDR-1), multidrug resistance associated protein 1 (MRP-1), Cu++ transporting, beta polypeptide (ATP7B), xeroderma pigmentosum, complementation group A (XPA), excision repair cross-complementing rodent repair deficiency, complementation group 1 (ERCC-1) and B-cell CLL/lymphoma 2 (BCL2) were down-regulated in cases of recurrent cancers. These results show that the evaluation of p53 mutation provides the most useful predictor of therapeutic effects. In responder cases, the drug-resistant genes that were determined in cell lines by culture do not necessarily translate into clinical relevance.

Molecular epidemiology in environmental health: the potential of tumor suppressor gene p53 as a biomarker.

PubMed Central

Semenza, J C; Weasel, L H

1997-01-01

One of the challenges in environmental health is to attribute a certain health effect to a specific environmental exposure and to establish a cause-effect relationship. Molecular epidemiology offers a new approach to addressing these challenges. Mutations in the tumor suppressor gene p53 can shed light on past environmental exposure, and carcinogenic agents and doses can be distinguished on the basis of mutational spectra and frequency. Mutations in p53 have successfully been used to establish links between dietary aflatoxin exposure and liver cancer, exposure to ultraviolet light and skin cancer, smoking and cancers of the lung and bladder, and vinyl chloride exposure and liver cancer. In lung cancer, carcinogens from tobacco smoke have been shown to form adducts with DNA. The location of these adducts correlates with those positions in the p53 gene that are mutated in lung cancer, confirming a direct etiologic link between exposure and disease. Recent investigations have also explored the use of p53 as a susceptibility marker for cancer. Furthermore, studies in genetic toxicology have taken advantage of animals transgenic for p53 to screen for carcinogens in vivo. In this review, we summarize recent developments in p53 biomarker research and illustrate applications to environmental health. PMID:9114284

UV Radiation Activates Toll-Like Receptor 9 Expression in Primary Human Keratinocytes, an Event Inhibited by Human Papillomavirus 38 E6 and E7 Oncoproteins.

PubMed

Pacini, Laura; Ceraolo, Maria Grazia; Venuti, Assunta; Melita, Giusi; Hasan, Uzma A; Accardi, Rosita; Tommasino, Massimo

2017-10-01

Several lines of evidence indicate that cutaneous human papillomavirus (HPV) types belonging to the beta genus of the HPV phylogenetic tree synergize with UV radiation in the development of skin cancer. Accordingly, the E6 and E7 oncoproteins from some beta HPV types are able to deregulate pathways related to immune response and cellular transformation. Toll-like receptor 9 (TLR9), in addition to playing a role in innate immunity, has been shown to be involved in the cellular stress response. Using primary human keratinocytes as experimental models, we have shown that UV irradiation (and other cellular stresses) activates TLR9 expression. This event is closely linked to p53 activation. Silencing the expression of p53 or deleting its encoding gene affected the activation of TLR9 expression after UV irradiation. Using various strategies, we have also shown that the transcription factors p53 and c-Jun are recruited onto a specific region of the TLR9 promoter after UV irradiation. Importantly, the E6 and E7 oncoproteins from beta HPV38, by inducing the accumulation of the p53 antagonist ΔNp73α, prevent the UV-mediated recruitment of these transcription factors onto the TLR9 promoter, with subsequent impairment of TLR9 gene expression. This study provides new insight into the mechanism that mediates TLR9 upregulation in response to cellular stresses. In addition, we show that HPV38 E6 and E7 are able to interfere with this mechanism, providing another explanation for the possible cooperation of beta HPV types with UV radiation in skin carcinogenesis. IMPORTANCE Beta HPV types have been suggested to act as cofactors in UV-induced skin carcinogenesis by altering several cellular mechanisms activated by UV radiation. We show that the expression of TLR9, a sensor of damage-associated molecular patterns produced during cellular stress, is activated by UV radiation in primary human keratinocytes (PHKs). Two transcription factors known to be activated by UV radiation, p53 and c-Jun, play key roles in UV-activated TLR9 expression. The E6 and E7 oncoproteins from beta HPV38 strongly inhibit UV-activated TLR9 expression by preventing the recruitment of p53 and c-Jun to the TLR9 promoter. Our findings provide additional support for the role that beta HPV types play in skin carcinogenesis by preventing activation of specific pathways upon exposure of PHKs to UV radiation. Copyright © 2017 American Society for Microbiology.

Mutant p53 Promotes Tumor Cell Malignancy by Both Positive and Negative Regulation of the Transforming Growth Factor β (TGF-β) Pathway*

PubMed Central

Ji, Lei; Xu, Jinjin; Liu, Jian; Amjad, Ali; Zhang, Kun; Liu, Qingwu; Zhou, Lei; Xiao, Jianru; Li, Xiaotao

2015-01-01

Specific p53 mutations abrogate tumor-suppressive functions by gaining new abilities to promote tumorigenesis. Inactivation of p53 is known to distort TGF-β signaling, which paradoxically displays both tumor-suppressive and pro-oncogenic functions. The molecular mechanisms of how mutant p53 simultaneously antagonizes the tumor-suppressive and synergizes the tumor-promoting function of the TGF-β pathway remain elusive. Here we demonstrate that mutant p53 differentially regulates subsets of TGF-β target genes by enhanced binding to the MH2 domain in Smad3 upon the integration of ERK signaling, therefore disrupting Smad3/Smad4 complex formation. Silencing Smad2, inhibition of ERK, or introducing a phosphorylation-defective mutation at Ser-392 in p53 abrogates the R175H mutant p53-dependent regulation of these TGF-β target genes. Our study shows a mechanism to reconcile the seemingly contradictory observations that mutant p53 can both attenuate and cooperate with the TGF-β pathway to promote cancer cell malignancy in the same cell type. PMID:25767119

Modulation of p53β and p53γ expression by regulating the alternative splicing of TP53 gene modifies cellular response

PubMed Central

Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C

2014-01-01

In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616

p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

PubMed

Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

2015-03-01

The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

p53 adenoviral vector (Ad-CMV-p53) induced prostatic growth inhibition of primary cultures of human prostate and an experimental rat model.

PubMed

Shirakawa, T; Gotoh, A; Gardner, T A; Kao, C; Zhang, Z J; Matsubara, S; Wada, Y; Hinata, N; Fujisawa, M; Hanioka, K; Matsuo, M; Kamidono, S

2000-01-01

Benign prostatic hyperplasia (BPH) is the most common proliferative disease affecting men. Numerous minimally invasive technologies are being developed or are currently in use to obviate the need for transurethral surgery. The goal of the present study was to develop a novel molecular based approach for the treatment of BPH using recombinant p53 adenoviral vector. The over-expression of wt-p53 can cause cell apoptosis or cell growth arrest, thus preventing the uncontrolled cell proliferation underlying BPH pathophysiology. Ad-CMV-p53, a replication-deficient recombinant adenovirus containing cytomegalovirus promoter driving p53 gene, was used. Human prostate stromal (PS) cells were evaluated for apoptosis (TUNEL assay), mRNA levels of key cell cycle regulators influencing apoptosis (p-53, Bax and Bcl-2) using quantitative RT-PCR and cytotoxicity after Ad-CMV-p53. Ad-CMV-p53 was unilaterally injected into rat ventral prostates and growth inhibition was measured by prostate weight 3 weeks after injection. In vitro exposure to Ad-CMV-p53 significantly inhibited the proliferation of PS cells, induced mRNA over-expression of both wt-p53 and Bax, and increased the proportion of apoptotic cells. A 30% decrease in average prostate weight was demonstrated in rodents after Ad-CMV-p53 injection. The results suggest that further investigation of molecular gene therapy with recombinant wt-p53 adenovirus for the treatment of BPH is warranted.

Characterization of a TOL-like plasmid from Alcaligenes eutrophus that controls expression of a chromosomally encoded p-cresol pathway.

PubMed Central

Hughes, E J; Bayly, R C; Skurray, R A

1984-01-01

Alcaligenes eutrophus wild-type strain 345 metabolizes m- and p-toluate via a catechol meta-cleavage pathway. DNA analysis, curing studies, and transfer of this phenotype by conjugation and transformation showed that the degradative genes are encoded on a self-transmissible 85-kilobase plasmid, pRA1000. HindIII and XhoI restriction endonuclease analysis of pRA1000 showed it to be similar to the archetypal TOL plasmid, pWWO, differing in the case of HindIII only by the absence of fragments B and D present in pWWO. In strain 345, the presence of pRA1000 prevented the expression of chromosomally encoded enzymes required for the degradation of p-cresol, whereas these enzymes were expressed in strains cured of pRA1000. On the basis of studies with an R68.45-pRA1000 cointegrate plasmid, pRA1001, we conclude that the gene(s) responsible for the effect of p-cresol degradation resides within or near the m- and p-toluate degradative region on pRA1000. Images PMID:6325399

NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription.

PubMed

Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

2016-07-19

The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.

Mutations in KEOPS-complex genes cause nephrotic syndrome with primary microcephaly.

PubMed

Braun, Daniela A; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A; Schanze, Denny; Ashraf, Shazia; Ullmann, Jeremy F P; Hoogstraten, Charlotte A; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I Chiara; Sanchez-Ferras, Oraly; Hu, Jennifer F; Boschat, Anne-Claire; Sanquer, Sylvia; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E; Pabst, Werner L; Warejko, Jillian K; Daga, Ankana; Basta, Tamara; Matejas, Verena; Scharmann, Karin; Kienast, Sandra D; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T; Gaffney, Patrick M; Gipson, Patrick E; Hsu, Chyong-Hsin; Kari, Jameela A; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-Ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okashah; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Ozaltin, Fatih; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth R; Rump, Patrick; Schnur, Rhonda E; Shiihara, Takashi; Sinha, Manish D; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A; Tsai, Wen-Hui; Tsai, Jeng-Daw; Topaloglu, Rezan; Vester, Udo; Viskochil, David H; Vatanavicharn, Nithiwat; Waxler, Jessica L; Wierenga, Klaas J; Wolf, Matthias T F; Wong, Sik-Nin; Leidel, Sebastian A; Truglio, Gessica; Dedon, Peter C; Poduri, Annapurna; Mane, Shrikant; Lifton, Richard P; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Callewaert, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm

2017-10-01

Galloway-Mowat syndrome (GAMOS) is an autosomal-recessive disease characterized by the combination of early-onset nephrotic syndrome (SRNS) and microcephaly with brain anomalies. Here we identified recessive mutations in OSGEP, TP53RK, TPRKB, and LAGE3, genes encoding the four subunits of the KEOPS complex, in 37 individuals from 32 families with GAMOS. CRISPR-Cas9 knockout in zebrafish and mice recapitulated the human phenotype of primary microcephaly and resulted in early lethality. Knockdown of OSGEP, TP53RK, or TPRKB inhibited cell proliferation, which human mutations did not rescue. Furthermore, knockdown of these genes impaired protein translation, caused endoplasmic reticulum stress, activated DNA-damage-response signaling, and ultimately induced apoptosis. Knockdown of OSGEP or TP53RK induced defects in the actin cytoskeleton and decreased the migration rate of human podocytes, an established intermediate phenotype of SRNS. We thus identified four new monogenic causes of GAMOS, describe a link between KEOPS function and human disease, and delineate potential pathogenic mechanisms.

The UMD-p53 database: new mutations and analysis tools.

PubMed

Béroud, Christophe; Soussi, Thierry

2003-03-01

The tumor suppressor gene TP53 (p53) is the most extensively studied gene involved in human cancers. More than 1,400 publications have reported mutations of this gene in 150 cancer types for a total of 14,971 mutations. To exploit this huge bulk of data, specific analytic tools were highly warranted. We therefore developed a locus-specific database software called UMD-p53. This database compiles all somatic and germline mutations as well as polymorphisms of the TP53 gene which have been reported in the published literature since 1989, or unpublished data submitted to the database curators. The database is available at www.umd.necker.fr or at http://p53.curie.fr/. In this paper, we describe recent developments of the UMD-p53 database. These developments include new fields and routines. For example, the analysis of putative acceptor or donor splice sites is now automated and gives new insight for the causal role of "silent mutations." Other routines have also been created such as the prescreening module, the UV module, and the cancer distribution module. These new improvements will help users not only for molecular epidemiology and pharmacogenetic studies but also for patient-based studies. To achieve theses purposes we have designed a procedure to check and validate data in order to reach the highest quality data. Copyright 2003 Wiley-Liss, Inc.

Prognostic value of the expression of tumor suppressor genes p53, p21, p16 and prb, and Ki-67 labelling in high grade astrocytomas treated with radiotherapy.

PubMed

Kirla, R; Salminen, E; Huhtala, S; Nuutinen, J; Talve, L; Haapasalo, H; Kalimo, H

2000-01-01

Cumulative inactivation of tumor suppressor genes and/or amplification of oncogenes lead to progressively more malignant astrocytic tumors. We have analyzed the significance of tumor suppressor genes p53, p21, p16 and retinoblastoma protein (pRb) and proliferative activity for survival in 77 high grade astrocytic tumors. After operation, the patients--25 anaplastic astrocytomas (AA) and 52 glioblastomas (GBs)--were treated with similar radiotherapy. The expression of the suppressor genes and the proliferative activity were analyzed immunohistochemically. p53 immunopositivity was found in 44% of AAs and 46% of GBs. Tumors with aberrant p53 expression had lower proliferation indices than p53 immunonegative tumors. Neither p53 expression nor p21 immunonegativity (52% of AAs and 48% of GBs) correlated with survival. p16 immunostaining was negative in 16% of AAs and in 44% of GBs, and it correlated inversely with survival in both uni- and multivariate analyses. pRb immunostaining was negative only in 8% of both AAs and GBs and the absence of p16 and pRb were mutually exclusive. Ki-67 labelling index (LI) was significantly higher in GBs (26.8%) than in AAs (20.3%), and in multivariate analysis it was an independent prognostic factor for survival. In 48% of AAs Ki-67 LI exceeded 20% and this subset of AAs had similar prognosis as GB. In high grade astrocytic tumors p16 immunonegativity was an independent indicator of poor prognosis in addition to the previously established patient's age, histopathology and Ki-67 LI. Furthermore, there was a subset of AAs with a high proliferation rate (> 20%) in which the histopathological hallmarks of GB were lacking, but which had similarly dismal prognosis as GB.

Adiposity is associated with p53 gene mutations in breast cancer.

PubMed

Ochs-Balcom, Heather M; Marian, Catalin; Nie, Jing; Brasky, Theodore M; Goerlitz, David S; Trevisan, Maurizio; Edge, Stephen B; Winston, Janet; Berry, Deborah L; Kallakury, Bhaskar V; Freudenheim, Jo L; Shields, Peter G

2015-10-01

Mutations in the p53 gene are among the most frequent genetic events in human cancer and may be triggered by environmental and occupational exposures. We examined the association of clinical and pathological characteristics of breast tumors and breast cancer risk factors according to the prevalence and type of p53 mutations. Using tumor blocks from incident cases from a case-control study in western New York, we screened for p53 mutations in exons 2-11 using the Affymetrix p53 Gene Chip array and analyzed case-case comparisons using logistic regression. The p53 mutation frequency among cases was 28.1 %; 95 % were point mutations (13 % of which were silent) and the remainder were single base pair deletions. Sixty seven percent of all point mutations were transitions; 24 % of them are G:C>A:T at CpG sites. Positive p53 mutation status was associated with poorer differentiation (OR, 95 % CI 2.29, 1.21-4.32), higher nuclear grade (OR, 95 % CI 1.99, 1.22-3.25), and increased Ki-67 status (OR, 95 % CI 1.81, 1.10-2.98). Cases with P53 mutations were more likely to have a combined ER-positive and PR-negative status (OR, 95 % CI 1.65, 1.01-2.71), and a combined ER-negative and PR-negative status (OR, 95 % CI 2.18, 1.47-3.23). Body mass index >30 kg/m(2), waist circumference >79 cm, and waist-to-hip ratio >0.86 were also associated with p53 status; obese breast cancer cases are more likely to have p53 mutations (OR, 95 % CI 1.78, 1.19-2.68). We confirmed that p53 mutations are associated with less favorable tumor characteristics and identified an association of p53 mutation status and adiposity.

Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fernandez-Fueyo, Elena; Ruiz-Duenas, Francisco J.; Ferreira, Patrica

Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little cellulose degradation. To investigate the basis for selective ligninolysis, we conducted comparative genome analysis of C. subvermispora and P. chrysosporium. Genes encoding manganese peroxidase numbered 13 and five in C. subvermispora and P. chrysosporium, respectively. In addition, the C. subvermispora genome contains at least seven genes predicted to encode laccases, whereas the P. chrysosporium genome contains none. We alsomore » observed expansion of the number of C. subvermispora desaturase-encoding genes putatively involved in lipid metabolism. Microarray-based transcriptome analysis showed substantial up-regulation of several desaturase and MnP genes in wood-containing medium. MS identified MnP proteins in C. subvermispora culture filtrates, but none in P. chrysosporium cultures. These results support the importance of MnP and a lignin degradation mechanism whereby cleavage of the dominant nonphenolic structures is mediated by lipid peroxidation products. Two C. subvermispora genes were predicted to encode peroxidases structurally similar to P. chrysosporium lignin peroxidase and, following heterologous expression in Escherichia coli, the enzymes were shown to oxidize high redox potential substrates, but not Mn2. Apart from oxidative lignin degradation, we also examined cellulolytic and hemicellulolytic systems in both fungi. In summary, the C. subvermispora genetic inventory and expression patterns exhibit increased oxidoreductase potential and diminished cellulolytic capability relative to P. chrysosporium.« less

Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

PubMed Central

Fernandez-Fueyo, Elena; Ruiz-Dueñas, Francisco J.; Ferreira, Patricia; Floudas, Dimitrios; Hibbett, David S.; Canessa, Paulo; Larrondo, Luis F.; James, Tim Y.; Seelenfreund, Daniela; Lobos, Sergio; Polanco, Rubén; Tello, Mario; Honda, Yoichi; Watanabe, Takahito; Watanabe, Takashi; Ryu, Jae San; Kubicek, Christian P.; Schmoll, Monika; Gaskell, Jill; Hammel, Kenneth E.; St. John, Franz J.; Vanden Wymelenberg, Amber; Sabat, Grzegorz; Splinter BonDurant, Sandra; Syed, Khajamohiddin; Yadav, Jagjit S.; Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Lavín, José L.; Oguiza, José A.; Perez, Gumer; Pisabarro, Antonio G.; Ramirez, Lucia; Santoyo, Francisco; Master, Emma; Coutinho, Pedro M.; Henrissat, Bernard; Lombard, Vincent; Magnuson, Jon Karl; Kües, Ursula; Hori, Chiaki; Igarashi, Kiyohiko; Samejima, Masahiro; Held, Benjamin W.; Barry, Kerrie W.; LaButti, Kurt M.; Lapidus, Alla; Lindquist, Erika A.; Lucas, Susan M.; Riley, Robert; Salamov, Asaf A.; Hoffmeister, Dirk; Schwenk, Daniel; Hadar, Yitzhak; Yarden, Oded; de Vries, Ronald P.; Wiebenga, Ad; Stenlid, Jan; Eastwood, Daniel; Grigoriev, Igor V.; Berka, Randy M.; Blanchette, Robert A.; Kersten, Phil; Martinez, Angel T.; Vicuna, Rafael; Cullen, Dan

2012-01-01

Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little cellulose degradation. To investigate the basis for selective ligninolysis, we conducted comparative genome analysis of C. subvermispora and P. chrysosporium. Genes encoding manganese peroxidase numbered 13 and five in C. subvermispora and P. chrysosporium, respectively. In addition, the C. subvermispora genome contains at least seven genes predicted to encode laccases, whereas the P. chrysosporium genome contains none. We also observed expansion of the number of C. subvermispora desaturase-encoding genes putatively involved in lipid metabolism. Microarray-based transcriptome analysis showed substantial up-regulation of several desaturase and MnP genes in wood-containing medium. MS identified MnP proteins in C. subvermispora culture filtrates, but none in P. chrysosporium cultures. These results support the importance of MnP and a lignin degradation mechanism whereby cleavage of the dominant nonphenolic structures is mediated by lipid peroxidation products. Two C. subvermispora genes were predicted to encode peroxidases structurally similar to P. chrysosporium lignin peroxidase and, following heterologous expression in Escherichia coli, the enzymes were shown to oxidize high redox potential substrates, but not Mn2+. Apart from oxidative lignin degradation, we also examined cellulolytic and hemicellulolytic systems in both fungi. In summary, the C. subvermispora genetic inventory and expression patterns exhibit increased oxidoreductase potential and diminished cellulolytic capability relative to P. chrysosporium. PMID:22434909

Identification of novel serine proteinase gene transcripts in the midguts of two tropical insect pests, Scirpophaga incertulas (Wk.) and Helicoverpa armigera (Hb.).

PubMed

Mazumdar-Leighton, S; Babu, C R; Bennett, J

2000-01-01

We have used RT PCR and 3'RACE to identify diverse serine proteinase genes expressed in the midguts of the rice yellow stem borer (Scirpophaga incertulas) and Asian corn borer (Helicoverpa armigera). The RT-PCR primers encoded the conserved regions around the active site histidine57 and serine195 of Drosophila melanogaster alpha trypsin, including aspartate189 of the specificity pocket. These primers amplified three transcripts (SiP1-3) from midguts of S. incertulas, and two transcripts (HaP1-2) from midguts of H. armigera. The five RT PCR products were sequenced to permit design of gene-specific forward primers for use with anchored oligo dT primers in 3'RACE. Sequencing of the 3'RACE products indicated that SiP1, SiP2 and HaP1 encoded trypsin-like serine proteinases, while HaP2 encoded a chymotrypsin-like serine proteinases. The SiP3 transcript proved to be an abundant 960 nt mRNA encoding a trypsin-like protein in which the active site serine195 was replaced by aspartate. The possible functions of this unusual protein are discussed.

A Synthetic Interaction Screen Identifies Factors Selectively Required for Proliferation and TERT Transcription in p53-Deficient Human Cancer Cells

PubMed Central

Park, Sung Mi; Zhu, Lihua J.; Debily, Marie-anne; Kittler, Ellen L. W.; Zapp, Maria L.; Lapointe, David; Gobeil, Stephane; Virbasius, Ching-Man; Green, Michael R.

2012-01-01

Numerous genetic and epigenetic alterations render cancer cells selectively dependent on specific genes and regulatory pathways, and represent potential vulnerabilities that can be therapeutically exploited. Here we describe an RNA interference (RNAi)–based synthetic interaction screen to identify genes preferentially required for proliferation of p53-deficient (p53−) human cancer cells. We find that compared to p53-competent (p53+) human cancer cell lines, diverse p53− human cancer cell lines are preferentially sensitive to loss of the transcription factor ETV1 and the DNA damage kinase ATR. In p53− cells, RNAi–mediated knockdown of ETV1 or ATR results in decreased expression of the telomerase catalytic subunit TERT leading to growth arrest, which can be reversed by ectopic TERT expression. Chromatin immunoprecipitation analysis reveals that ETV1 binds to a region downstream of the TERT transcriptional start-site in p53− but not p53+ cells. We find that the role of ATR is to phosphorylate and thereby stabilize ETV1. Our collective results identify a regulatory pathway involving ETV1, ATR, and TERT that is preferentially important for proliferation of diverse p53− cancer cells. PMID:23284306

Gene Mutation Profiles in Primary Diffuse Large B Cell Lymphoma of Central Nervous System: Next Generation Sequencing Analyses

PubMed Central

Todorovic Balint, Milena; Jelicic, Jelena; Mihaljevic, Biljana; Kostic, Jelena; Stanic, Bojana; Balint, Bela; Pejanovic, Nadja; Lucic, Bojana; Tosic, Natasa; Marjanovic, Irena; Stojiljkovic, Maja; Karan-Djurasevic, Teodora; Perisic, Ognjen; Rakocevic, Goran; Popovic, Milos; Raicevic, Sava; Bila, Jelena; Antic, Darko; Andjelic, Bosko; Pavlovic, Sonja

2016-01-01

The existence of a potential primary central nervous system lymphoma-specific genomic signature that differs from the systemic form of diffuse large B cell lymphoma (DLBCL) has been suggested, but is still controversial. We investigated 19 patients with primary DLBCL of central nervous system (DLBCL CNS) using the TruSeq Amplicon Cancer Panel (TSACP) for 48 cancer-related genes. Next generation sequencing (NGS) analyses have revealed that over 80% of potentially protein-changing mutations were located in eight genes (CTNNB1, PIK3CA, PTEN, ATM, KRAS, PTPN11, TP53 and JAK3), pointing to the potential role of these genes in lymphomagenesis. TP53 was the only gene harboring mutations in all 19 patients. In addition, the presence of mutated TP53 and ATM genes correlated with a higher total number of mutations in other analyzed genes. Furthermore, the presence of mutated ATM correlated with poorer event-free survival (EFS) (p = 0.036). The presence of the mutated SMO gene correlated with earlier disease relapse (p = 0.023), inferior event-free survival (p = 0.011) and overall survival (OS) (p = 0.017), while mutations in the PTEN gene were associated with inferior OS (p = 0.048). Our findings suggest that the TP53 and ATM genes could be involved in the molecular pathophysiology of primary DLBCL CNS, whereas mutations in the PTEN and SMO genes could affect survival regardless of the initial treatment approach. PMID:27164089

Nested polymerase chain reaction study of 53 cases with Turner`s syndrome: Is cytogenetically undetected Y mosaicism common?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Binder, G.; Koch, A.; Ranke, M.B.

1995-12-01

Turner`s syndrome patients with Y mosaicism face a high risk of developing gonadoblastoma. Cytogenetic analysis can fail to detect rare cells bearing a normal or structurally abnormal Y chromosome (low level Y mosaicism). We screened 53 individuals with Turner`s syndrome for presence of sex-determining region Y (SRY), the testis-specific protein, Y encoded, gene, and the Y centromeric DYZ3 repeat using nested polymerase chain reaction (PCR). Thirty girls (57%) had the 45,X karyotype, determined through standard analysis of blood lymphocytes. The remaining 23 girls (43%) were mosaics and/or had structural abnormalities in 1 X-chromosome. Genomic DNA from blood leukocytes was amplifiedmore » using 2 rounds of PCR. This method was sensitive enough to detect 0.0001% male DNA on a female background. None of 53 Turner`s syndrome cases was positive for Y-specific loci after the first round of PCR. After the second round, 2 of 53 Turner`s syndrome cases were positive for SRY mapping to the distal short arm of chromosome Y. In 1 SRY-positive subject, the karyotype was 45,X, and in the other, it was 46,Xi(Xq). None of 53 Turner`s syndrome individuals, including the 2 SRY-positive subjects, were positive for the testis-specific protein, Y encoded, gene on the proximal short arm of chromosome Y or the centromeric DYZ3 repeat. These data exclude low level Y mosaicism in almost all Turner`s syndrome cases tested. 35 refs., 3 figs., 1 tab.« less

Plasmid-Encoded Tetracycline Efflux Pump Protein Alters Bacterial Stress Responses and Ecological Fitness of Acinetobacter oleivorans

PubMed Central

Hong, Hyerim; Jung, Jaejoon; Park, Woojun

2014-01-01

Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment. PMID:25229538

Plasmid-encoded tetracycline efflux pump protein alters bacterial stress responses and ecological fitness of Acinetobacter oleivorans.

PubMed

Hong, Hyerim; Jung, Jaejoon; Park, Woojun

2014-01-01

Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment.

Prevalence of high-risk human papilloma virus types and its association with P53 codon 72 polymorphism in tobacco addicted oral squamous cell carcinoma (OSCC) patients of Eastern India.

PubMed

Nagpal, Jatin K; Patnaik, Srinivas; Das, Bibhu R

2002-02-10

Human papillomavirus (HPV) infects the squamous epithelial cells of oral cavity and cervix leading to formation of warts that develops into the cancer. Human papillomavirus (HPV)-16 and 18 encode E6 oncoprotein, which binds to and induces degradation of the tumour suppressor protein p53. A common polymorphism of p53, encoding either proline (Pro) or arginine (Arg) at position 72, affects the susceptibility of p53 to E6 mediated degradation in vivo. Oral cancer is a pressing problem in India due to the widespread habit of chewing betel quid, which plays an important role in etiology of this disease. In the present study an attempt has been made to analyze the genetic predisposition of the Indian population to HPV infection and oral carcinogenesis. In our study a total of 110 cases of Oral Cancer highly addicted to betel quid and tobacco chewing are analyzed for HPV 16/18 infection and its association with polymorphism at p53 codon 72. Of these a total number of 37 patients (33.6%) have shown the presence of HPV, among which the presence of HPV-16, 18 and 16/18 coinfection is 22.7%, 14.5% and 10%, respectively. Our results also indicate that the p53 codon 72 genotype frequencies in Indian Oral Cancer patients are 0.55 (Arg) and 0.45 (Pro) as per Hardy-Weinberg equilibrium. In our study, striking reduction in Pro/Pro allele frequency has been found in HPV positive cases, indicating Arg/Arg genotype to be more susceptible to HPV infection and oral carcinogenesis. Copyright 2001 Wiley-Liss, Inc.

Human T-cell leukemia virus type-1-encoded protein HBZ represses p53 function by inhibiting the acetyltransferase activity of p300/CBP and HBO1

PubMed Central

Hoang, Kimson; Ankney, John A.; Nguyen, Stephanie T.; Rushing, Amanda W.; Polakowski, Nicholas; Miotto, Benoit; Lemasson, Isabelle

2016-01-01

Adult T-cell leukemia (ATL) is an often fatal malignancy caused by infection with the complex retrovirus, human T-cell Leukemia Virus, type 1 (HTLV-1). In ATL patient samples, the tumor suppressor, p53, is infrequently mutated; however, it has been shown to be inactivated by the viral protein, Tax. Here, we show that another HTLV-1 protein, HBZ, represses p53 activity. In HCT116 p53+/+ cells treated with the DNA-damaging agent, etoposide, HBZ reduced p53-mediated activation of p21/CDKN1A and GADD45A expression, which was associated with a delay in G2 phase-arrest. These effects were attributed to direct inhibition of the histone acetyltransferase (HAT) activity of p300/CBP by HBZ, causing a reduction in p53 acetylation, which has be linked to decreased p53 activity. In addition, HBZ bound to, and inhibited the HAT activity of HBO1. Although HBO1 did not acetylate p53, it acted as a coactivator for p53 at the p21/CDKN1A promoter. Therefore, through interactions with two separate HAT proteins, HBZ impairs the ability of p53 to activate transcription. This mechanism may explain how p53 activity is restricted in ATL cells that do not express Tax due to modifications of the HTLV-1 provirus, which accounts for a majority of patient samples. PMID:26625199

Efficient generation of P53 biallelic knockout Diannan miniature pigs via TALENs and somatic cell nuclear transfer.

PubMed

Shen, Youfeng; Xu, Kaixiang; Yuan, Zaimei; Guo, Jianxiong; Zhao, Heng; Zhang, Xuezeng; Zhao, Lu; Qing, Yubo; Li, Honghui; Pan, Weirong; Jia, Baoyu; Zhao, Hong-Ye; Wei, Hong-Jiang

2017-11-03

Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Transcription activator-like effector nucleases (TALENs) were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO) cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT) for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19) were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean section after 38 days of gestation for genotyping. Finally, six live piglets and one stillborn piglet were collected from two recipients by caesarean section. Sequencing analyses of the target site confirmed the P53 biallelic knockout in all fetuses and piglets, consistent with the genotype of the donor cells. The qPCR analysis showed that the expression of the P53 mRNA had significant reduction in various tissues of the knockout piglets. Furthermore, confocal microscopy and western blotting analyses demonstrated that the fibroblast cells of Diannan miniature piglets with a P53 biallelic knockout were defective in mediating DNA damage when incubated with doxorubicin. TALENs combined with SCNT was successfully used to generate P53 KO Diannan miniature pigs. Although these genetically engineered Diannan miniature pigs had no tumorigenic signs, the P53 gene was dysfunctional. We believe that these pigs will provide powerful new resources for preclinical oncology and basic cancer research.

Cytochrome P450 monooxygenase CYP53 family in fungi: comparative structural and evolutionary analysis and its role as a common alternative anti-fungal drug target.

PubMed

Jawallapersand, Poojah; Mashele, Samson Sitheni; Kovačič, Lidija; Stojan, Jure; Komel, Radovan; Pakala, Suresh Babu; Kraševec, Nada; Syed, Khajamohiddin

2014-01-01

Cytochrome P450 monooxygenases (CYPs/P450s) are heme-thiolate proteins whose role as a drug target against pathogenic microbes has been explored because of their stereo- and regio-specific oxidation activity. We aimed to assess the CYP53 family's role as a common alternative drug target against animal (including human) and plant pathogenic fungi and its role in fungal-mediated wood degradation. Genome-wide analysis of fungal species revealed the presence of CYP53 members in ascomycetes and basidiomycetes. Basidiomycetes had a higher number of CYP53 members in their genomes than ascomycetes. Only two CYP53 subfamilies were found in ascomycetes and six subfamilies in basidiomycetes, suggesting that during the divergence of phyla ascomycetes lost CYP53 P450s. According to phylogenetic and gene-structure analysis, enrichment of CYP53 P450s in basidiomycetes occurred due to the extensive duplication of CYP53 P450s in their genomes. Numerous amino acids (103) were found to be conserved in the ascomycetes CYP53 P450s, against only seven in basidiomycetes CYP53 P450s. 3D-modelling and active-site cavity mapping data revealed that the ascomycetes CYP53 P450s have a highly conserved protein structure whereby 78% amino acids in the active-site cavity were found to be conserved. Because of this rigid nature of ascomycetes CYP53 P450s' active site cavity, any inhibitor directed against this P450 family can serve as a common anti-fungal drug target, particularly toward pathogenic ascomycetes. The dynamic nature of basidiomycetes CYP53 P450s at a gene and protein level indicates that these P450s are destined to acquire novel functions. Functional analysis of CYP53 P450s strongly supported our hypothesis that the ascomycetes CYP53 P450s ability is limited for detoxification of toxic molecules, whereas basidiomycetes CYP53 P450s play an additional role, i.e. involvement in degradation of wood and its derived components. This study is the first report on genome-wide comparative structural (gene and protein structure-level) and evolutionary analysis of a fungal P450 family.

Life science experiments performed in space in the ISS/Kibo facility and future research plans.

PubMed

Ohnishi, Takeo

2016-08-01

Over the past several years, current techniques in molecular biology have been used to perform experiments in space, focusing on the nature and effects of space radiation. In the Japanese 'Kibo' facility in the International Space Station (ISS), the Japan Aerospace Exploration Agency (JAXA) has performed five life science experiments since 2009, and two additional experiments are currently in progress. The first life science experiment in space was the 'Rad Gene' project, which utilized two human cultured lymphoblastoid cell lines containing a mutated P53 : gene (m P53 : ) and a parental wild-type P53 : gene (wt P53 : ) respectively. Four parameters were examined: (i) detecting space radiation-induced DSBs by observing γH2AX foci; (ii) observing P53 : -dependent gene expression during space flight; (iii) observing P53 : -dependent gene expression after space flight; and (iv) observing the adaptive response in the two cell lines containing the mutated and wild type P53 : genes after exposure to space radiation. These observations were completed and have been reported, and this paper is a review of these experiments. In addition, recent new information from space-based experiments involving radiation biology is presented here. These experiments involve human cultured cells, silkworm eggs, mouse embryonic stem cells and mouse eggs in various experiments designed by other principal investigators in the ISS/Kibo. The progress of Japanese science groups involved in these space experiments together with JAXA are also discussed here. The Japanese Society for Biological Sciences in Space (JSBSS), the Utilization Committee of Space Environment Science (UCSES) and the Science Council of Japan (ACJ) have supported these new projects and new experimental facilities in ISS/Kibo. Currently, these organizations are proposing new experiments for the ISS through 2024. © The Author 2016. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

Identification of β-propeller phytase-encoding genes in culturable Paenibacillus and Bacillus spp. from the rhizosphere of pasture plants on volcanic soils.

PubMed

Jorquera, Milko A; Crowley, David E; Marschner, Petra; Greiner, Ralf; Fernández, María Teresa; Romero, Daniela; Menezes-Blackburn, Daniel; De La Luz Mora, María

2011-01-01

Phytate is one of the most abundant sources of organic phosphorus (P) in soils, but must be mineralized by phytase-producing bacteria to release P for plant uptake. Microbial inoculants based on Bacillus spp. have been developed commercially, but few studies have evaluated the ecology of these bacteria in the rhizosphere or the types of enzymes that they produce. Here, we studied the diversity of aerobic endospore-forming bacteria (EFB) with the ability to mineralize phytate in the rhizosphere of pasture plants grown in volcanic soils of southern Chile. PCR methods were used to detect candidate phytase-encoding genes and to identify EFB bacteria that carry these genes. This study revealed that the phytate-degrading EFB populations of pasture plants included species of Paenibacillus and Bacillus, which carried genes encoding β-propeller phytase (BPP). Assays of enzymatic activity confirmed the ability of these rhizosphere isolates to degrade phytate. The phytase-encoding genes described here may prove valuable as molecular markers to evaluate the role of EFB in organic P mobilization in the rhizosphere. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Influence of p53 status on the effects of boron neutron capture therapy in glioblastoma.

PubMed

Seki, Keiko; Kinashi, Yuko; Takahashi, Sentaro

2015-01-01

The tumor suppressor gene p53 is mutated in glioblastoma. We studied the relationship between the p53 gene and the biological effects of boron neutron capture therapy (BNCT). The human glioblastoma cells; A172, expressing wild-type p53, and T98G, with mutant p53, were irradiated by the Kyoto University Research Reactor (KUR). The biological effects after neutron irradiation were evaluated by the cell killing effect, 53BP1 foci assay and apoptosis induction. The survival-fraction data revealed that A172 was more radiosensitive than T98G, but the difference was reduced when boronophenylalanine (BPA) was present. Both cell lines exhibited similar numbers of foci, suggesting that the initial levels of DNA damage did not depend on p53 function. Detection of apoptosis revealed a lower rate of apoptosis in the T98G. BNCT causes cell death in glioblastoma cells, regardless of p53 mutation status. In T98G cells, cell killing and apoptosis occurred effectively following BNCT. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

CDIP, a novel pro-apoptotic gene, regulates TNFα-mediated apoptosis in a p53-dependent manner

PubMed Central

Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W

2007-01-01

We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-α expression tightly correlates with CDIP expression, and that inhibition of TNF-α signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-α is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-α impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 → CDIP → TNF-α apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy. PMID:17599062

Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF).

PubMed

Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O

2015-07-16

p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.

p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

PubMed

Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

2007-10-01

Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

SOX14 activates the p53 signaling pathway and induces apoptosis in a cervical carcinoma cell line

PubMed Central

Stanisavljevic, Danijela; Petrovic, Isidora; Vukovic, Vladanka; Schwirtlich, Marija; Gredic, Marija; Stevanovic, Milena

2017-01-01

SOX14 is a member of the SOX family of transcription factors mainly involved in the regulation of neural development. Recently, it became evident that SOX14 is one of four hypermethylated genes in cervical carcinoma, considered as a tumor suppressor candidate in this type of malignancy. In this paper we elucidated the role of SOX14 in the regulation of malignant properties of cervical carcinoma cells in vitro. Functional analysis performed in HeLa cells revealed that SOX14 overexpression decreased viability and promoted apoptosis through altering the expression of apoptosis related genes. Our results demonstrated that overexpression of SOX14 initiated accumulation of p53, demonstrating potential cross-talk between SOX14 and the p53 signaling pathway. Further analysis unambiguously showed that SOX14 triggered posttranslational modification of p53 protein, as detected by the significantly increased level of phospho-p53 (Ser-15) in SOX14-overexpressing HeLa cells. Moreover, the obtained results revealed that SOX14 activated p53 protein, which was confirmed by elevated p21Waf1/Cip1, a well known target gene of p53. This study advances our understanding about the role of SOX14 and might explain the molecular mechanism by which this transcription factor could exert tumor suppressor properties in cervical carcinoma. PMID:28926586

The expanding regulatory universe of p53 in gastrointestinal cancer.

PubMed

Fesler, Andrew; Zhang, Ning; Ju, Jingfang

2016-01-01

Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

[Study on serum p53 protein in cops in Guangzhou city].

PubMed

Zhu, Wen-Chang; Chen, Qing; Chu, Xin-Wei; Luo, Chen-Ling; Wu, Min; Wang, Ya-Xian; Chen, Si-Dong

2003-10-01

Serum p53 protein overexpression was detected in population exposed to traffic exhaust gas to study the relation between traffic exhaust gas and the increased risk in p53 gene mutation. Serum p53 protein expression was measured by enzyme-linked immunosorbent assay. Relationship between different types of job and serum p53 protein overexpression were studied by pearson Chi-square tests. Results on serum p53 protein overexpression on jobs outside of office (5.74%) were not significantly higher than jobs inside the office. However, it suggested that traffic police men (12.12%) working outside of office, with whose length of service longer than 30 years had a significant overexpression of serum p53 protein than the others (5.36%) whose length of service was less than 30 years (P < 0.05, OR = 2.43, 95% CI: 1.11 - 5.33). Overexpression rate of p53 protein appeared to be 6.89% in the group whose average weekly exposure hours were more than 40 hours, which was significant higher than the group whose exposed hours were less than 40 hours (P < 0.05, OR = 1.71, 95% CI: 1.03 - 2.81). The result suggested that traffic exhaust gas was likely to cause mutation of p53 gene and increasing the incidence of lung cancer.

Expression, purification and characterization of a phyAm-phyCs fusion phytase*

PubMed Central

Zou, Li-kou; Wang, Hong-ning; Pan, Xin; Tian, Guo-bao; Xie, Zi-wen; Wu, Qi; Chen, Hui; Xie, Tao; Yang, Zhi-rong

2008-01-01

The phyAm gene encoding acid phytase and optimized neutral phytase phyCs gene were inserted into expression vector pPIC9K in correct orientation and transformed into Pichia pastoris in order to expand the pH profile of phytase and decrease the cost of production. The fusion phytase phyAm-phyCs gene was successfully overexpressed in P. pastoris as an active and extracellular phytase. The yield of total extracellular fusion phytase activity is (25.4±0.53) U/ml at the flask scale and (159.1±2.92) U/ml for high cell-density fermentation, respectively. Purified fusion phytase exhibits an optimal temperature at 55 °C and an optimal pH at 5.5~6.0 and its relative activity remains at a relatively high level of above 70% in the range of pH 2.0 to 7.0. About 51% to 63% of its original activity remains after incubation at 75 °C to 95 °C for 10 min. Due to heavy glycosylation, the expressed fusion phytase shows a broad and diffuse band in SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). After deglycosylation by endoglycosidase H (EndoHf), the enzyme has an apparent molecular size of 95 kDa. The characterization of the fusion phytase was compared with those of phyCs and phyAm. PMID:18600783

Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakagawa, Yosuke; Takahashi, Akihisa; Kajihara, Atsuhisa

Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggestedmore » that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp53 bearing cancer cells.« less

Capture of a catabolic plasmid that encodes only 2,4-dichlorophenoxyacetic acid:alpha-ketoglutaric acid dioxygenase (TfdA) by genetic complementation.

PubMed Central

Top, E M; Maltseva, O V; Forney, L J

1996-01-01

The modular pathway for the metabolism of 2,4-dichlorophenoxyacetic acid (2,4-D) encoded on plasmid pJP4 of Alcaligenes eutrophus JMP134 appears to be an example in which two genes, tfdA and tfdB, have been recruited during the evolution of a catabolic pathway. The products of these genes act to convert 2,4-D to a chloro-substituted catechol that can be further metabolized by enzymes of a modified ortho-cleavage pathway encoded by tfdCDEF. Given that modified ortho-cleavage pathways are comparatively common and widely distributed among bacteria, we sought to determine if microbial populations in soil carry tfdA on plasmid vectors that lack tfdCDEF or tfdB. To capture such plasmids from soil populations, we used a recipient strain of A. eutrophus that was rifampin resistant and carried a derivative of plasmid pJP4 (called pBH501aE) in which the tfdA had been deleted. Upon mating with mixed bacterial populations from soil treated with 2,4-D, transconjugants that were resistant to rifampin yet able to grow on 2,4-D were obtained. Among the transconjugants obtained were clones that contained a ca. 75-kb plasmid, pEMT8. Bacterial hosts that carried this plasmid in addition to pBH501aE metabolized 2,4-D, whereas strains with only pEMT8 did not. Southern hybridization showed that pEMT8 encoded a gene with a low level of similarity to the tfdA gene from plasmid pJP4. Using oligonucleotide primers based on known tfdA sequences, we amplified a 330-bp fragment of the gene and determined that it was 77% similar to the tfdA gene of plasmid pJP4 and 94% similar to tfdA from Burkholderia sp. strain RASC. Plasmid pEMT8 lacked genes that exhibited significant levels of homology to tfdB and tfdCDEF. Moreover, cell extracts from A. eutrophus(pEMT8) cultures did not exhibit TfdB, TfdC, TfdD, and TfdE activities, whereas cell extracts from A. eutrophus(pEMT8)(pBH501aE) cultures did. These data suggest that pEMT8 encodes only tfdA and that this gene can effectively complement the tfdA deletion mutation of pBH501aE. PMID:8779586

PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage

PubMed Central

Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

2012-01-01

p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments. PMID:23235459

PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

PubMed

Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

2012-12-13

p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

Auxotrophic recombinant Mycobacterium bovis BCG overexpressing Ag85B enhances cytotoxicity on superficial bladder cancer cells in vitro.

PubMed

Begnini, Karine Rech; Rizzi, Caroline; Campos, Vinicius Farias; Borsuk, Sibele; Schultze, Eduarda; Yurgel, Virginia Campello; Nedel, Fernanda; Dellagostin, Odir Antônio; Collares, Tiago; Seixas, Fabiana Kömmling

2013-02-01

BCG therapy remains at the forefront of immunotherapy for treating patients with superficial bladder cancer. The high incidence of local side effects and the presence of non-responder diseases have led to efforts to improve the therapy. Hence, we proposed that an auxotrophic recombinant BCG strain overexpressing Ag85B (BCG ∆leuD/Ag85B), could enhance the cytotoxicity to the human bladder carcinoma cell line 5637. The rBCG was generated using an expression plasmid encoding the mycobacterial antigen Ag85B to transform a BCG ∆leuD strain. The inhibitory effect of BCG ∆leuD/Ag85B on 5637 cells was determined by the MTT method, morphology observation and a LIVE/DEAD assay. Gene expression profiles for apoptotic, cell cycle-related and oxidative stress-related genes were investigated by qRT-PCR. Bax, bcl-2 and p53 induction by BCG ∆leuD/Ag85B treatment was evaluated by Western blotting. BCG ∆leuD/Ag85B revealed a superior cytotoxicity effect compared to the control strains used in this study. The results showed that the expression level of pro-apoptotic and cell cycle-related genes increased after BCG ∆leuD/Ag85B treatment, whereas the mRNA levels of anti-apoptotic genes decreased. Interestingly, BCG ∆leuD/Ag85B also increased the mRNA level of antioxidant enzymes in the bladder cancer cell line. Bax and p53 proteins levels increased following treatment. In conclusion, these results suggest that treatment with BCG ∆leuD/Ag85B enhances cytotoxicity for superficial bladder cancer cells in vitro. Therefore, rBCG therapy may have potential benefits in the treatment of bladder cancer.

A Shigella flexneri Virulence Plasmid Encoded Factor Controls Production of Outer Membrane Vesicles

PubMed Central

Sidik, Saima; Kottwitz, Haila; Benjamin, Jeremy; Ryu, Julie; Jarrar, Ameer; Garduno, Rafael; Rohde, John R.

2014-01-01

Shigella spp. use a repertoire of virulence plasmid-encoded factors to cause shigellosis. These include components of a Type III Secretion Apparatus (T3SA) that is required for invasion of epithelial cells and many genes of unknown function. We constructed an array of 99 deletion mutants comprising all genes encoded by the virulence plasmid (excluding those known to be required for plasmid maintenance) of Shigella flexneri. We screened these mutants for their ability to bind the dye Congo red: an indicator of T3SA function. This screen focused our attention on an operon encoding genes that modify the cell envelope including virK, a gene of partially characterized function. We discovered that virK is required for controlled release of proteins to the culture supernatant. Mutations in virK result in a temperature-dependent overproduction of outer membrane vesicles (OMVs). The periplasmic chaperone/protease DegP, a known regulator of OMV production in Escherichia coli (encoded by a chromosomal gene), was found to similarly control OMV production in S. flexneri. Both virK and degP show genetic interactions with mxiD, a structural component of the T3SA. Our results are consistent with a model in which VirK and DegP relieve the periplasmic stress that accompanies assembly of the T3SA. PMID:25378474

Maternally expressed gene 3, an imprinted noncoding RNA gene, is associated with meningioma pathogenesis and progression.

PubMed

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N; Klibanski, Anne

2010-03-15

Meningiomas are common tumors, representing 15% to 25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. The chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore, it has been proposed that an as yet unidentified tumor suppressor is present at this locus. Maternally expressed gene 3 (MEG3) is an imprinted gene located at 14q32 which encodes a noncoding RNA with an antiproliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in bromodeoxyuridine incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a noncoding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism.

hCLCA2 is a p53-inducible inhibitor of breast cancer cell proliferation

PubMed Central

Walia, Vijay; Ding, Ming; Kumar, Sumit; Nie, Daotai; Premkumar, Louis; Elble, Randolph C.

2009-01-01

hCLCA2 is frequently downregulated in breast cancer and is a candidate tumor suppressor gene. We show here that the hCLCA2 gene is strongly induced by p53 in response to DNA damage. Adenoviral expression of p53 induces hCLCA2 in a variety of breast cell lines. Further, we find that p53 binds to consensus elements in the hCLCA2 promoter and mutation of these sites abolishes p53-responsiveness and induction by DNA damage. Adenoviral transduction of hCLCA2 into immortalized cells induces p53, CDK inhibitors p21 and p27, and cell cycle arrest by 24 hours, and caspase induction and apoptosis by 40 hours post-infection. Transduction of the malignant tumor cell line BT549 on the other hand does not induce p53, p21, or p27 but instead induces apoptosis directly and more rapidly. Knockout and knockdown studies indicate that growth inhibition and apoptosis are signaled via multiple pathways. Conversely, suppression of hCLCA2 by RNA interference enhances proliferation of MCF10A and reduces sensitivity to doxorubicin. Gene expression profiles indicate that hCLCA2 levels are strongly predictive of tumor cell sensitivity to doxorubicin and other chemotherapeutics. Because certain Cl- channels are proposed to promote apoptosis by reducing intracellular pH, we tested whether, and established that, hCLCA2 enhances Cl- current in breast cancer cells and reduces pH to ∼6.7. These results reveal hCLCA2 as a novel p53-inducible growth inhibitor, explain how its downregulation confers a survival advantage to tumor cells, and suggest both prognostic and therapeutic applications. PMID:19654313

Mining of the Uncharacterized Cytochrome P450 Genes Involved in Alkaloid Biosynthesis in California Poppy Using a Draft Genome Sequence

PubMed Central

Hori, Kentaro; Yamada, Yasuyuki; Purwanto, Ratmoyo; Minakuchi, Yohei; Toyoda, Atsushi; Hirakawa, Hideki

2018-01-01

Abstract Land plants produce specialized low molecular weight metabolites to adapt to various environmental stressors, such as UV radiation, pathogen infection, wounding and animal feeding damage. Due to the large variety of stresses, plants produce various chemicals, particularly plant species-specific alkaloids, through specialized biosynthetic pathways. In this study, using a draft genome sequence and querying known biosynthetic cytochrome P450 (P450) enzyme-encoding genes, we characterized the P450 genes involved in benzylisoquinoline alkaloid (BIA) biosynthesis in California poppy (Eschscholzia californica), as P450s are key enzymes involved in the diversification of specialized metabolism. Our in silico studies showed that all identified enzyme-encoding genes involved in BIA biosynthesis were found in the draft genome sequence of approximately 489 Mb, which covered approximately 97% of the whole genome (502 Mb). Further analyses showed that some P450 families involved in BIA biosynthesis, i.e. the CYP80, CYP82 and CYP719 families, were more enriched in the genome of E. californica than in the genome of Arabidopsis thaliana, a plant that does not produce BIAs. CYP82 family genes were highly abundant, so we measured the expression of CYP82 genes with respect to alkaloid accumulation in different plant tissues and two cell lines whose BIA production differs to estimate the functions of the genes. Further characterization revealed two highly homologous P450s (CYP82P2 and CYP82P3) that exhibited 10-hydroxylase activities with different substrate specificities. Here, we discuss the evolution of the P450 genes and the potential for further genome mining of the genes encoding the enzymes involved in BIA biosynthesis. PMID:29301019

Cloning, over-expression and purification of Pseudomonas aeruginosa murC encoding uridine diphosphate N-acetylmuramate: L-alanine ligase.

PubMed

El Zoeiby, A; Sanschagrin, F; Lamoureux, J; Darveau, A; Levesque, R C

2000-02-15

We cloned and sequenced the murC gene from Pseudomonas aeruginosa encoding a protein of 53 kDa. Multiple alignments with 20 MurC peptide sequences from different bacteria confirmed the presence of highly conserved regions having sequence identities ranging from 22-97% including conserved motifs for ATP-binding and the active site of the enzyme. Genetic complementation was done in Escherichia coli (murCts) suppressing the lethal phenotype. The murC gene was subcloned into the expression vector pET30a and overexpressed in E. coli BL21(lambdaDE3). Three PCR cloning strategies were used to obtain the three recombinant plasmids for expression of the native MurC, MurC His-tagged at N-terminal and at C-terminal, respectively. MurC His-tagged at C-terminal was chosen for large scale production and protein purification in the soluble form. The purification was done in a single chromatographic step on an affinity nickel column and obtained in mg quantities at 95% homogeneity. MurC protein was used to produce monoclonal antibodies for epitope mapping and for assay development in high throughput screenings. Detailed studies of MurC and other genes of the bacterial cell cycle will provide the reagents and strain constructs for high throughput screening and for design of novel antibacterials.

Cardiomyocyte-enriched protein CIP protects against pathophysiological stresses and regulates cardiac homeostasis.

PubMed

Huang, Zhan-Peng; Kataoka, Masaharu; Chen, Jinghai; Wu, Gengze; Ding, Jian; Nie, Mao; Lin, Zhiqiang; Liu, Jianming; Hu, Xiaoyun; Ma, Lixin; Zhou, Bin; Wakimoto, Hiroko; Zeng, Chunyu; Kyselovic, Jan; Deng, Zhong-Liang; Seidman, Christine E; Seidman, J G; Pu, William T; Wang, Da-Zhi

2015-11-02

Cardiomyopathy is a common human disorder that is characterized by contractile dysfunction and cardiac remodeling. Genetic mutations and altered expression of genes encoding many signaling molecules and contractile proteins are associated with cardiomyopathy; however, how cardiomyocytes sense pathophysiological stresses in order to then modulate cardiac remodeling remains poorly understood. Here, we have described a regulator in the heart that harmonizes the progression of cardiac hypertrophy and dilation. We determined that expression of the myocyte-enriched protein cardiac ISL1-interacting protein (CIP, also known as MLIP) is reduced in patients with dilated cardiomyopathy. As CIP is highly conserved between human and mouse, we evaluated the effects of CIP deficiency on cardiac remodeling in mice. Deletion of the CIP-encoding gene accelerated progress from hypertrophy to heart failure in several cardiomyopathy models. Conversely, transgenic and AAV-mediated CIP overexpression prevented pathologic remodeling and preserved cardiac function. CIP deficiency combined with lamin A/C deletion resulted in severe dilated cardiomyopathy and cardiac dysfunction in the absence of stress. Transcriptome analyses of CIP-deficient hearts revealed that the p53- and FOXO1-mediated gene networks related to homeostasis are disturbed upon pressure overload stress. Moreover, FOXO1 overexpression suppressed stress-induced cardiomyocyte hypertrophy in CIP-deficient cardiomyocytes. Our studies identify CIP as a key regulator of cardiomyopathy that has potential as a therapeutic target to attenuate heart failure progression.

Cardiomyocyte-enriched protein CIP protects against pathophysiological stresses and regulates cardiac homeostasis

PubMed Central

Huang, Zhan-Peng; Kataoka, Masaharu; Chen, Jinghai; Wu, Gengze; Ding, Jian; Nie, Mao; Lin, Zhiqiang; Liu, Jianming; Hu, Xiaoyun; Ma, Lixin; Zhou, Bin; Wakimoto, Hiroko; Zeng, Chunyu; Kyselovic, Jan; Deng, Zhong-Liang; Seidman, Christine E.; Seidman, J.G.; Pu, William T.; Wang, Da-Zhi

2015-01-01

Cardiomyopathy is a common human disorder that is characterized by contractile dysfunction and cardiac remodeling. Genetic mutations and altered expression of genes encoding many signaling molecules and contractile proteins are associated with cardiomyopathy; however, how cardiomyocytes sense pathophysiological stresses in order to then modulate cardiac remodeling remains poorly understood. Here, we have described a regulator in the heart that harmonizes the progression of cardiac hypertrophy and dilation. We determined that expression of the myocyte-enriched protein cardiac ISL1-interacting protein (CIP, also known as MLIP) is reduced in patients with dilated cardiomyopathy. As CIP is highly conserved between human and mouse, we evaluated the effects of CIP deficiency on cardiac remodeling in mice. Deletion of the CIP-encoding gene accelerated progress from hypertrophy to heart failure in several cardiomyopathy models. Conversely, transgenic and AAV-mediated CIP overexpression prevented pathologic remodeling and preserved cardiac function. CIP deficiency combined with lamin A/C deletion resulted in severe dilated cardiomyopathy and cardiac dysfunction in the absence of stress. Transcriptome analyses of CIP-deficient hearts revealed that the p53- and FOXO1-mediated gene networks related to homeostasis are disturbed upon pressure overload stress. Moreover, FOXO1 overexpression suppressed stress-induced cardiomyocyte hypertrophy in CIP-deficient cardiomyocytes. Our studies identify CIP as a key regulator of cardiomyopathy that has potential as a therapeutic target to attenuate heart failure progression. PMID:26436652

A Comprehensive Analysis of Nuclear-Encoded Mitochondrial Genes in Schizophrenia.

PubMed

Gonçalves, Vanessa F; Cappi, Carolina; Hagen, Christian M; Sequeira, Adolfo; Vawter, Marquis P; Derkach, Andriy; Zai, Clement C; Hedley, Paula L; Bybjerg-Grauholm, Jonas; Pouget, Jennie G; Cuperfain, Ari B; Sullivan, Patrick F; Christiansen, Michael; Kennedy, James L; Sun, Lei

2018-05-01

The genetic risk factors of schizophrenia (SCZ), a severe psychiatric disorder, are not yet fully understood. Multiple lines of evidence suggest that mitochondrial dysfunction may play a role in SCZ, but comprehensive association studies are lacking. We hypothesized that variants in nuclear-encoded mitochondrial genes influence susceptibility to SCZ. We conducted gene-based and gene-set analyses using summary association results from the Psychiatric Genomics Consortium Schizophrenia Phase 2 (PGC-SCZ2) genome-wide association study comprising 35,476 cases and 46,839 control subjects. We applied the MAGMA method to three sets of nuclear-encoded mitochondrial genes: oxidative phosphorylation genes, other nuclear-encoded mitochondrial genes, and genes involved in nucleus-mitochondria crosstalk. Furthermore, we conducted a replication study using the iPSYCH SCZ sample of 2290 cases and 21,621 control subjects. In the PGC-SCZ2 sample, 1186 mitochondrial genes were analyzed, among which 159 had p values < .05 and 19 remained significant after multiple testing correction. A meta-analysis of 818 genes combining the PGC-SCZ2 and iPSYCH samples resulted in 104 nominally significant and nine significant genes, suggesting a polygenic model for the nuclear-encoded mitochondrial genes. Gene-set analysis, however, did not show significant results. In an in silico protein-protein interaction network analysis, 14 mitochondrial genes interacted directly with 158 SCZ risk genes identified in PGC-SCZ2 (permutation p = .02), and aldosterone signaling in epithelial cells and mitochondrial dysfunction pathways appeared to be overrepresented in this network of mitochondrial and SCZ risk genes. This study provides evidence that specific aspects of mitochondrial function may play a role in SCZ, but we did not observe its broad involvement even using a large sample. Copyright © 2018 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT.

PubMed

Leszczynska, Katarzyna B; Foskolou, Iosifina P; Abraham, Aswin G; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N; O'Neill, Eric E; Buffa, Francesca M; Hammond, Ester M

2015-06-01

Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage-induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain-containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors.

Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

PubMed Central

Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

2015-01-01

Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

Identification, Characterization, and Three-Dimensional Structure of the Novel Circular Bacteriocin, Enterocin NKR-5-3B, from Enterococcus faecium.

PubMed

Himeno, Kohei; Rosengren, K Johan; Inoue, Tomoko; Perez, Rodney H; Colgrave, Michelle L; Lee, Han Siean; Chan, Lai Y; Henriques, Sónia Troeira; Fujita, Koji; Ishibashi, Naoki; Zendo, Takeshi; Wilaipun, Pongtep; Nakayama, Jiro; Leelawatcharamas, Vichien; Jikuya, Hiroyuki; Craik, David J; Sonomoto, Kenji

2015-08-11

Enterocin NKR-5-3B, one of the multiple bacteriocins produced by Enterococcus faecium NKR-5-3, is a 64-amino acid novel circular bacteriocin that displays broad-spectrum antimicrobial activity. Here we report the identification, characterization, and three-dimensional nuclear magnetic resonance solution structure determination of enterocin NKR-5-3B. Enterocin NKR-5-3B is characterized by four helical segments that enclose a compact hydrophobic core, which together with its circular backbone impart high stability and structural integrity. We also report the corresponding structural gene, enkB, that encodes an 87-amino acid precursor peptide that undergoes a yet to be described enzymatic processing that involves adjacent cleavage and ligation of Leu(24) and Trp(87) to yield the mature (circular) enterocin NKR-5-3B.

Modulation of the cyclin-dependent kinase inhibitor p21(WAF1/Cip1) gene by Zac1 through the antagonistic regulators p53 and histone deacetylase 1 in HeLa Cells.

PubMed

Liu, Pei-Yao; Chan, James Yi-Hsin; Lin, Hsiu-Chen; Wang, Sung-Ling; Liu, Shu-Ting; Ho, Ching-Liang; Chang, Li-Chien; Huang, Shih-Ming

2008-07-01

Zac1 is a novel seven-zinc finger protein which possesses the ability to bind specifically to GC-rich DNA elements. Zac1 not only promotes apoptosis and cell cycle arrest but also acts as a transcriptional cofactor for p53 and a number of nuclear receptors. Our previous study indicated that the enhancement of p53 activity by Zac1 is much more pronounced in HeLa cells compared with other cell lines tested. This phenomenon might be due to the coactivator effect of Zac1 on p53 and the ability of Zac1 to reverse E6 inhibition of p53. In the present study, we showed that Zac1 acted synergistically with either p53 or a histone deacetylase inhibitor, trichostatin A, to enhance p21(WAF1/Cip1) promoter activity. We showed that Zac1 physically interacted with some nuclear receptor corepressors such as histone deacetylase 1 (HDAC1) and mSin3a, and the induction of p21(WAF1/Cip1) gene and protein by Zac1 was suppressed by either overexpressing HDAC1 or its deacetylase-dead mutant. In addition, our data suggest that trichostatin A-induced p21(WAF1/Cip1) protein expression might be mediated through a p53-independent and HDAC deacetylase-independent pathway. Taken together, our data suggest that Zac1 might be involved in regulating the p21(WAF1/Cip1) gene and protein expression through its protein-protein interaction with p53 and HDAC1 in HeLa cells.

A homozygous p53 R282W mutant human embryonic stem cell line generated using TALEN-mediated precise gene editing.

PubMed

Zhou, Ruoji; Xu, An; Wang, Donghui; Zhu, Dandan; Mata, Helen; Huo, Zijun; Tu, Jian; Liu, Mo; Mohamed, Alaa M T; Jewell, Brittany E; Gingold, Julian; Xia, Weiya; Rao, Pulivarthi H; Hung, Mien-Chie; Zhao, Ruiying; Lee, Dung-Fang

2018-03-01

The tumor suppressor gene TP53 is the most frequently mutated gene in human cancers. Many hot-spot mutations of TP53 confer novel functions not found in wild-type p53 and contribute to tumor development and progression. We report on the generation of a H1 human embryonic stem cell line carrying a homozygous TP53 R282W mutation using TALEN-mediated genome editing. The generated cell line demonstrates normal karyotype, maintains a pluripotent state, and is capable of generating a teratoma in vivo containing tissues from all three germ layers. Copyright © 2018 The Author(s). Published by Elsevier B.V. All rights reserved.

Growth arrest specific gene 2 in tilapia (Oreochromis niloticus): molecular characterization and functional analysis under low-temperature stress.

PubMed

Yang, ChangGeng; Wu, Fan; Lu, Xing; Jiang, Ming; Liu, Wei; Yu, Lijuan; Tian, Juan; Wen, Hua

2017-07-17

Growth arrest specific 2 (gas2) gene is a component of the microfilament system that plays a major role in the cell cycle, regulation of microfilaments, and cell morphology during apoptotic processes. However, little information is available on fish gas2. In this study, the tilapia (Oreochromis niloticus) gas2 gene was cloned and characterized for the first time. The open reading frame was 1020 bp, encoding 340 amino acids; the 5'-untranslated region (UTR) was 140 bp and the 3'-UTR was 70 bp, with a poly (A) tail. The highest promoter activity occurred in the regulatory region (-3000 to -2400 bp). The Gas2-GFP fusion protein was distributed within the cytoplasm. Quantitative reverse transcription-polymerase chain reaction and western blot analyses revealed that gas2 gene expression levels in the liver, muscle, and brain were clearly affected by low temperature stress. The results of gas2 RNAi showed decreased expression of the gas2 and P53 genes. These results suggest that the tilapia gas2 gene may be involved in low temperature stress-induced apoptosis.

The C-type lectin homologue gene (EP153R) of African swine fever virus inhibits apoptosis both in virus infection and in heterologous expression.

PubMed

Hurtado, Carolina; Granja, Aitor G; Bustos, María J; Nogal, María L; González de Buitrago, Gonzalo; de Yébenes, Virginia G; Salas, María L; Revilla, Yolanda; Carrascosa, Angel L

2004-08-15

The open reading frame EP153R of African swine fever virus (ASFV) encodes a nonessential protein that has been involved in the hemadsorption process induced in virus-infected cells. By the use of a virus deletion mutant lacking the EP153R gene, we have detected, in several virus-sensitive cells, increased levels of caspase-3 and cell death as compared with those obtained after infection with the parental BA71V strain. Both transient and stable expression of the EP153R gene in Vero or COS cells resulted in a partial protection of the transfected lines from the apoptosis induced in response to virus infection or external stimuli. The presence of gene EP153R resulted in a reduction of the transactivating activity of the cellular protein p53 in Vero cell cultures in which apoptosis was induced by virus infection or staurosporine treatment. This is to our knowledge the first description of a viral C-type lectin with anti-apoptotic properties.

Polymorphism at codon 36 of the p53 gene.

PubMed

Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

1994-01-01

A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

P53 Gene Mutagenesis in Breast Cancer

DTIC Science & Technology

2005-03-01

the wild type T peak. 12 Table 1. Sonic ntations dected by SINtA Individual Cell Sequence Amino Acid Species Conservation 3 ID’ ID Change2 Change... differences in the content of toxic substances in the diet (Biggs et al., 1993; Blaszyk et al., 1996). The development of this p53 mutation load...Changes in the P53 Gene in Single Cells Individual Sequence Amino acid Species conservation ’ ID’ Cell ID change’ change Monkey Mouse Rat Chicken

Functional characterization of an apple (Malus x domestica) LysM domain receptor encoding gene for its role in defense response

USDA-ARS?s Scientific Manuscript database

Apple gene MDP0000136494 was identified as the only LysM containing protein encoding gene which was specifically up-regulated in P. ultimum infected apple root by a previous transcriptome analysis. In current study, the functional identity of MDP0000136494 was investigated using combined genomic, tr...

Differential association of S100A9, an inflammatory marker, and p53, a cell cycle marker, expression with epicardial adipocyte size in patients with cardiovascular disease.

PubMed

Agra, Rosa María; Fernández-Trasancos, Ángel; Sierra, Juan; González-Juanatey, José Ramón; Eiras, Sonia

2014-10-01

S100A9 (calgranulin B) has inflammatory and oxidative stress properties and was found to be associated with atherosclerosis and obesity. One of the proteins that can regulate S100A9 transcription is p53, which is involved in cell cycle, apoptosis and adipogenesis. Thus, it triggers adipocyte enlargement and finally obesity. Because epicardial adipose tissue (EAT) volume and thickness is related to coronary artery disease (CAD), we studied the gene expression of this pathway in patients with cardiovascular disease and its association with obesity. Adipocytes and stromal cells from EAT and subcutaneous adipose tissue (SAT) from 48 patients who underwent coronary artery bypass graft and/or valve replacement were obtained after collagenase digestion and differential centrifugation. The expression levels of the involved genes on adipogenesis and cell cycle like fatty acid-binding protein (FABP) 4, retinol-binding protein (RBP)4, p53 and S100A9 were determined by real-time polymerase chain reaction (PCR). Adipocyte diameter was measured by optical microscopy. We found that epicardial adipocytes expressed significantly lower levels of adipogenic genes (FABP4 and RBP4) and cell cycle-related genes (S100A9 and p53) than subcutaneous adipocytes. However, in obese patients, upregulation of adipogenic and cell cycle-related genes in subcutaneous and epicardial adipocytes, respectively, was observed. The enlargement of adipocyte size was related to FABP4, S100A9 and p53 expression levels in stromal cells. But only the p53 association was maintained in epicardial stromal cells from obese patients (p=0.003). The expression of p53, but not S100A9, in epicardial stromal cells is related to adipocyte enlargement in obese patients with cardiovascular disease. These findings suggest new mechanisms for understanding the relationship between epicardial fat thickness, obesity and cardiovascular disease.

Reversion of multidrug resistance in the P-glycoprotein-positive human pancreatic cell line (EPP85-181RDB) by introduction of a hammerhead ribozyme.

PubMed Central

Holm, P. S.; Scanlon, K. J.; Dietel, M.

1994-01-01

A major problem in cytostatic treatment of many tumours is the development of multidrug resistance (MDR4). This is most often accompanied by the overexpression of a membrane transport protein, P-glycoprotein, and its encoding mRNA. In order to reverse the resistant phenotype in cell cultures, we constructed a specific hammerhead ribozyme possessing catalytic activity that cleaves the 3'-end of the GUC sequence in codon 880 of the mdr1 mRNA. We demonstrated that the constructed ribozyme is able to cleave a reduced substrate mdr1 mRNA at the GUC position under physiological conditions in a cell-free system. A DNA sequence encoding the ribozyme gene was then incorporated into a mammalian expression vector (pH beta APr-1 neo) and transfected into the human pancreatic carcinoma cell line EPP85-181RDB, which is resistant to daunorubicin and expresses the MDR phenotype. The expressed ribozyme decreased the level of mdr1 mRNA expression, inhibited the formation of P-glycoprotein and reduced the cell's resistance to daunorubicin dramatically; this means that the resistant cells were 1,600-fold more resistant than the parental cell line (EPP85-181P), whereas those cell clones that showed ribozyme expression were only 5.3-fold more resistant than the parental cell line. Images Figure 1 Figure 3 Figure 2 PMID:7914421

Clinical implications of genomic profiles in metastatic breast cancer with a focus on TP53 and PIK3CA, the most frequently mutated genes.

PubMed

Kim, Ji-Yeon; Lee, Eunjin; Park, Kyunghee; Park, Woong-Yang; Jung, Hae Hyun; Ahn, Jin Seok; Im, Young-Hyuck; Park, Yeon Hee

2017-04-25

Breast cancer (BC) has been genetically profiled through large-scale genome analyses. However, the role and clinical implications of genetic alterations in metastatic BC (MBC) have not been evaluated. Therefore, we conducted whole-exome sequencing (WES) and RNA-Seq of 37 MBC samples and targeted deep sequencing of another 29 MBCs. We evaluated somatic mutations from WES and targeted sequencing and assessed gene expression and performed pathway analysis from RNA-Seq. In this analysis, PIK3CA was the most commonly mutated gene in estrogen receptor (ER)-positive BC, while in ER-negative BC, TP53 was the most commonly mutated gene (p = 0.018 and p < 0.001, respectively). TP53 stopgain/loss and frameshift mutation was related to low expression of TP53 in contrast nonsynonymous mutation was related to high expression. The impact of TP53 mutation on clinical outcome varied with regard to ER status. In ER-positive BCs, wild type TP53 had a better prognosis than mutated TP53 (median overall survival (OS) (wild type vs. mutated): 88.5 ± 54.4 vs. 32.6 ± 10.7 (months), p = 0.002). In contrast, mutated TP53 had a protective effect in ER-negative BCs (median OS: 0.10 vs. 32.6 ± 8.2, p = 0.026). However, PIK3CA mutation did not affect patient survival. In gene expression analysis, CALM1, a potential regulator of AKT, was highly expressed in PIK3CA-mutated BCs. In conclusion, mutation of TP53 was associated with expression status and affect clinical outcome according to ER status in MBC. Although mutation of PIK3CA was not related to survival in this study, mutation of PIK3CA altered the expression of other genes and pathways including CALM1 and may be a potential predictive marker of PI3K inhibitor effectiveness.

p53 Specifically Binds Triplex DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

2016-01-01

Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

PubMed Central

Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

2015-01-01

Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

Hepatic transcriptional changes in critical genes for gluconeogenesis following castration of bulls

PubMed Central

Fassah, Dilla Mareistia; Jeong, Jin Young

2018-01-01

Objective This study was performed to understand transcriptional changes in the genes involved in gluconeogenesis and glycolysis pathways following castration of bulls. Methods Twenty Korean bulls were weaned at average 3 months of age, and castrated at 6 months. Liver tissues were collected from bulls (n = 10) and steers (n = 10) of Korean cattle, and hepatic gene expression levels were measured using quantitative real-time polymerase chain reaction. We examined hepatic transcription levels of genes encoding enzymes for irreversible reactions in both gluconeogenesis and glycolysis as well as genes encoding enzymes for the utilization of several glucogenic substrates. Correlations between hepatic gene expression and carcass characteristics were performed to understand their associations. Results Castration increased the mRNA (3.6 fold; p<0.01) and protein levels (1.4 fold; p< 0.05) of pyruvate carboxylase and mitochondrial phosphoenolpyruvate carboxykinase genes (1.7 fold; p<0.05). Hepatic mRNA levels of genes encoding the glycolysis enzymes were not changed by castration. Castration increased mRNA levels of both lactate dehydrogenase A (1.5 fold; p<0.05) and lactate dehydrogenase B (2.2 fold; p<0.01) genes for lactate utilization. Castration increased mRNA levels of glycerol kinase (2.7 fold; p<0.05) and glycerol-3-phosphate dehydrogenase 1 (1.5 fold; p<0.05) genes for glycerol utilization. Castration also increased mRNA levels of propionyl-CoA carboxylase beta (mitochondrial) (3.5 fold; p<0.01) and acyl-CoA synthetase short chain family member 3 (1.3 fold; p = 0.06) genes for propionate incorporation. Conclusion Castration increases transcription levels of critical genes coding for enzymes involved in irreversible gluconeogenesis reactions from pyruvate to glucose and enzymes responsible for incorporation of glucogenic substrates including lactate, glycerol, and propionate. Hepatic gluconeogenic gene expression levels were associated with intramuscular fat deposition. PMID:29502393

Hepatic transcriptional changes in critical genes for gluconeogenesis following castration of bulls.

PubMed

Fassah, Dilla Mareistia; Jeong, Jin Young; Baik, Myunggi

2018-04-01

This study was performed to understand transcriptional changes in the genes involved in gluconeogenesis and glycolysis pathways following castration of bulls. Twenty Korean bulls were weaned at average 3 months of age, and castrated at 6 months. Liver tissues were collected from bulls (n = 10) and steers (n = 10) of Korean cattle, and hepatic gene expression levels were measured using quantitative real-time polymerase chain reaction. We examined hepatic transcription levels of genes encoding enzymes for irreversible reactions in both gluconeogenesis and glycolysis as well as genes encoding enzymes for the utilization of several glucogenic substrates. Correlations between hepatic gene expression and carcass characteristics were performed to understand their associations. Castration increased the mRNA (3.6 fold; p<0.01) and protein levels (1.4 fold; p< 0.05) of pyruvate carboxylase and mitochondrial phosphoenolpyruvate carboxykinase genes (1.7 fold; p<0.05). Hepatic mRNA levels of genes encoding the glycolysis enzymes were not changed by castration. Castration increased mRNA levels of both lactate dehydrogenase A (1.5 fold; p<0.05) and lactate dehydrogenase B (2.2 fold; p<0.01) genes for lactate utilization. Castration increased mRNA levels of glycerol kinase (2.7 fold; p<0.05) and glycerol-3-phosphate dehydrogenase 1 (1.5 fold; p<0.05) genes for glycerol utilization. Castration also increased mRNA levels of propionyl-CoA carboxylase beta (mitochondrial) (3.5 fold; p<0.01) and acyl-CoA synthetase short chain family member 3 (1.3 fold; p = 0.06) genes for propionate incorporation. Castration increases transcription levels of critical genes coding for enzymes involved in irreversible gluconeogenesis reactions from pyruvate to glucose and enzymes responsible for incorporation of glucogenic substrates including lactate, glycerol, and propionate. Hepatic gluconeogenic gene expression levels were associated with intramuscular fat deposition.

[A preliminary study on p53 gene in lung cancer tissues of workers exposed to silica and welding fumes].

PubMed

Liu, B; Zhou, P; Miao, Q

1997-05-01

Mutations of suppressor gene p53 was studied in 36 cases of silica related lung cancer and 6 cases of welding fume related lung cancer with immunohistochemical and PCR-SSCP methods. Cancer tissues were embedded in paraffin and stored for 13.4 years in average. Results revealed that there was abnormal mobility shift of electrophoresis in 18 cases with 20 point mutations of 42 specimens tested, accounted for 42.9%, and 50% (10/20) of the mutations were clustered in exon 8. This finding differed from mutational spectrum of gene in non-occupational lung cancer, in which mutation frequency of exon 8 ranged from 17.5% to 23.5%. Gene mutation frequency in varied pathological categories of pneumoconiosis related lung cancer also differed from that in common lung cancer. In the latter, the highest one was in small cell lung cancer (70%) and the lowest in adenocarcinoma (33%), but in the former, the highest in adenocarcinoma (53.9%) and the lowest in small cell lung cancer (30.8%). Immunohistochemical observations also showed a very high prevalence of p53 gene mutation expression (46.9%). Sequencing, which was determined in two cases of this study, revealed that two point mutations all occurred in non-hotspot codon 144 of p53 gene. Difference in gene mutation spectrum suggests that there exist specific carcinogens and carcinogenesis in silica and welding fume related lung cancer.

Overlapping Podospora anserina Transcriptional Responses to Bacterial and Fungal Non Self Indicate a Multilayered Innate Immune Response

PubMed Central

Lamacchia, Marina; Dyrka, Witold; Breton, Annick; Saupe, Sven J.; Paoletti, Mathieu

2016-01-01

Recognition and response to non self is essential to development and survival of all organisms. It can occur between individuals of the same species or between different organisms. Fungi are established models for conspecific non self recognition in the form of vegetative incompatibility (VI), a genetically controlled process initiating a programmed cell death (PCD) leading to the rejection of a fusion cell between genetically different isolates of the same species. In Podospora anserina VI is controlled by members of the hnwd gene family encoding for proteins analogous to NOD Like Receptors (NLR) immune receptors in eukaryotes. It was hypothesized that the hnwd controlled VI reaction was derived from the fungal innate immune response. Here we analyze the P. anserina transcriptional responses to two bacterial species, Serratia fonticola to which P. anserina survives and S. marcescens to which P. anserina succumbs, and compare these to the transcriptional response induced under VI conditions. Transcriptional responses to both bacteria largely overlap, however the number of genes regulated and magnitude of regulation is more important when P. anserina survives. Transcriptional responses to bacteria also overlap with the VI reaction for both up or down regulated gene sets. Genes up regulated tend to be clustered in the genome, and display limited phylogenetic distribution. In all three responses we observed genes related to autophagy to be up-regulated. Autophagy contributes to the fungal survival in all three conditions. Genes encoding for secondary metabolites and histidine kinase signaling are also up regulated in all three conditions. Transcriptional responses also display differences. Genes involved in response to oxidative stress, or encoding small secreted proteins are essentially expressed in response to bacteria, while genes encoding NLR proteins are expressed during VI. Most functions encoded in response to bacteria favor survival of the fungus while most functions up regulated during VI would lead to cell death. These differences are discussed in the frame of a multilayered response to non self in fungi. PMID:27148175

Overexpression and optimization of glutamate decarboxylase in Lactobacillus plantarum Taj-Apis362 for high gamma-aminobutyric acid production

PubMed Central

Tajabadi, Naser; Baradaran, Ali; Ebrahimpour, Afshin; Rahim, Raha A; Bakar, Fatimah A; Manap, Mohd Yazid A; Mohammed, Abdulkarim S; Saari, Nazamid

2015-01-01

Gamma-aminobutyric acid (GABA) is an important bioactive compound biosynthesized by microorganisms through decarboxylation of glutamate by glutamate decarboxylase (GAD). In this study, a full-length GAD gene was obtained by cloning the template deoxyribonucleic acid to pTZ57R/T vector. The open reading frame of the GAD gene showed the cloned gene was composed of 1410 nucleotides and encoded a 469 amino acids protein. To improve the GABA-production, the GAD gene was cloned into pMG36e-LbGAD, and then expressed in Lactobacillus plantarum Taj-Apis362 cells. The overexpression was confirmed by SDS-PAGE and GAD activity, showing a 53 KDa protein with the enzyme activity increased by sevenfold compared with the original GAD activity. The optimal fermentation conditions for GABA production established using response surface methodology were at glutamic acid concentration of 497.973 mM, temperature 36°C, pH 5.31 and time 60 h. Under the conditions, maximum GABA concentration obtained (11.09 mM) was comparable with the predicted value by the model at 11.23 mM. To our knowledge, this is the first report of successful cloning (clone-back) and overexpression of the LbGAD gene from L. plantarum to L. plantarum cells. The recombinant Lactobacillus could be used as a starter culture for direct incorporation into a food system during fermentation for production of GABA-rich products. PMID:25757029

Life science experiments performed in space in the ISS/Kibo facility and future research plans

PubMed Central

Ohnishi, Takeo

2016-01-01

Over the past several years, current techniques in molecular biology have been used to perform experiments in space, focusing on the nature and effects of space radiation. In the Japanese ‘Kibo’ facility in the International Space Station (ISS), the Japan Aerospace Exploration Agency (JAXA) has performed five life science experiments since 2009, and two additional experiments are currently in progress. The first life science experiment in space was the ‘Rad Gene’ project, which utilized two human cultured lymphoblastoid cell lines containing a mutated p53 gene (mp53) and a parental wild-type p53 gene (wtp53) respectively. Four parameters were examined: (i) detecting space radiation–induced DSBs by observing γH2AX foci; (ii) observing p53-dependent gene expression during space flight; (iii) observing p53-dependent gene expression after space flight; and (iv) observing the adaptive response in the two cell lines containing the mutated and wild type p53 genes after exposure to space radiation. These observations were completed and have been reported, and this paper is a review of these experiments. In addition, recent new information from space-based experiments involving radiation biology is presented here. These experiments involve human cultured cells, silkworm eggs, mouse embryonic stem cells and mouse eggs in various experiments designed by other principal investigators in the ISS/Kibo. The progress of Japanese science groups involved in these space experiments together with JAXA are also discussed here. The Japanese Society for Biological Sciences in Space (JSBSS), the Utilization Committee of Space Environment Science (UCSES) and the Science Council of Japan (ACJ) have supported these new projects and new experimental facilities in ISS/Kibo. Currently, these organizations are proposing new experiments for the ISS through 2024. PMID:27130692

Novel and recurrent mutations in the C1NH gene of Arab patients affected with hereditary angioedema.

PubMed

Faiyaz-Ul-Haque, Muhammad; Al-Gazlan, Sulaiman; Abalkhail, Halah A; Al-Abdulatif, Ahmad; Toulimat, Mohamed; Peltekova, Iskra; Khaliq, Agha M R; Al-Dayel, Fouad; Zaidi, Syed H E

2010-01-01

Autosomal dominant hereditary angioedema (HAE) results in episodes of subcutaneous edema in any body part and/or submucosal edema of the upper respiratory or gastrointestinal tracts. This disorder is caused by mutations in the C1NH gene, many of which have been described primarily in European patients. However, the genetic cause of HAE in Middle Eastern Arab patients has not yet been determined. Four unrelated Arab families, in which 15 patients were diagnosed with HAE, were studied. DNA from 13 patients was analyzed for mutations in the C1NH gene by DNA sequencing. Three novel and 2 recurrent mutations were identified in the C1NH gene of HAE patients. In family 1, the patient was heterozygous for a novel c.856C>T and a recurrent c.1361T>A missense mutation encoding for p.Arg264Cys and p.Val432Glu, respectively. In patients from family 2, a novel c.509C>T missense mutation encoding for a p.Ser148Phe was identified. In patients from family 3, a novel c.1142delC nonsense mutation encoding for a p.Ala359AlafsX15 was discovered. In family 4, a recurrent c.1397G>A missense mutation encoding for a p.Arg444His was present. This is the first ever report of C1NH gene mutations in Middle Eastern Arab patients. Our study suggests that, despite the numerous existing mutations in the C1NH gene, there are novel and recurrent mutations in HAE patients of non-European origin. We conclude that the spectrum of C1NH gene mutations in HAE patients is wider due to the likely presence of novel and recurrent mutations in patients of other ethnicities. 2009 S. Karger AG, Basel.

Rare MDM4 gene amplification in colorectal cancer: The principle of a mutually exclusive relationship between MDM alteration and TP53 inactivation is not applicable.

PubMed

Suda, Tetsuji; Yoshihara, Mitsuyo; Nakamura, Yoshiyasu; Sekiguchi, Hironobu; Godai, Ten-I; Sugano, Nobuhiro; Tsuchida, Kazuhito; Shiozawa, Manabu; Sakuma, Yuji; Tsuchiya, Eiju; Kameda, Yoichi; Akaike, Makoto; Matsukuma, Shoichi; Miyagi, Yohei

2011-07-01

MDM4, a homolog of MDM2, is considered a key negative regulator of p53. Gene amplification of MDM4 has been identified in a variety of tumors. MDM2 or MDM4 gene amplification is only associated with the wild-type TP53 gene in retinoblastomas, thus the amplification of the two genes is mutually exclusive. Previously, we demonstrated that MDM2 amplification and TP53 alteration were not mutually exclusive in colorectal cancer, and we identified a subset of colorectal cancer patients without alterations in either the TP53 or the MDM2 gene. In this study, we investigated the gene amplification status of MDM4 in the same set of colorectal cancer cases. Unexpectedly, MDM4 amplification was rare, detected in only 1.4% (3 out of 211) of colorectal cancer cases. All the three gene-amplified tumors also harbored TP53-inactivating mutations. This contradicts the simple mutually exclusive relationship observed in retinoblastomas. Surprisingly, two of the three MDM4-amplified tumors also demonstrated MDM2 amplification. Paradoxically, the MDM4 protein levels were decreased in the tumor tissue of the gene-amplified cases compared with levels in the matched normal mucosa. We speculate that MDM4 might play a role in colorectal carcinogenesis that is not limited to negative regulation of p53 in combination with MDM2. The functional significance of MDM4 is still unclear and further studies are needed.

XRCC4 suppresses medulloblastomas with recurrent translocations in p53-deficient mice

PubMed Central

Yan, Catherine T.; Kaushal, Dhruv; Murphy, Michael; Zhang, Yu; Datta, Abhishek; Chen, Changzhong; Monroe, Brianna; Mostoslavsky, Gustavo; Coakley, Kristen; Gao, Yijie; Mills, Kevin D.; Fazeli, Alex P.; Tepsuporn, Suprawee; Hall, Giles; Mulligan, Richard; Fox, Edward; Bronson, Roderick; De Girolami, Umberto; Lee, Charles; Alt, Frederick W.

2006-01-01

Inactivation of the XRCC4 nonhomologous end-joining factor in the mouse germ line leads to embryonic lethality, in association with apoptosis of newly generated, postmitotic neurons. We now show that conditional inactivation of the XRCC4 in nestin-expressing neuronal progenitor cells, although leading to no obvious phenotype in a WT background, leads to early onset of neuronally differentiated medulloblastomas (MBs) in a p53-deficient background. A substantial proportion of the XRCC4/p53-deficient MBs have high-level N-myc gene amplification, often intrachromosomally in the context of complex translocations or other alterations of chromosome 12, on which N-myc resides, or extrachromosomally within double minutes. In addition, most XRCC4/p53-deficient MBs harbor clonal translocations of chromosome 13, which frequently involve chromosome 6 as a partner. One copy of the patched gene (Ptc), which lies on chromosome 13, was deleted in all tested XRCC4/p53-deficient MBs in the context of translocations or interstitial deletions. In addition, Cyclin D2, a chromosome 6 gene, was amplified in a subset of tumors. Notably, amplification of Myc-family or Cyclin D2 genes and deletion of Ptc also have been observed in human MBs. We therefore conclude that, in neuronal cells of mice, the nonhomologous end-joining pathway plays a critical role in suppressing genomic instability that, in a p53-deficient background, routinely contributes to genesis of MBs with recurrent chromosomal alterations. PMID:16670198

Identification of New Single Nucleotide Polymorphism-Based Markers for Inter- and Intraspecies Discrimination of Obligate Bacterial Parasites (Pasteuria spp.) of Invertebrates ▿ †

PubMed Central

Mauchline, Tim H.; Knox, Rachel; Mohan, Sharad; Powers, Stephen J.; Kerry, Brian R.; Davies, Keith G.; Hirsch, Penny R.

2011-01-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of “cryptic” SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms. PMID:21803895

Identification of new single nucleotide polymorphism-based markers for inter- and intraspecies discrimination of obligate bacterial parasites (Pasteuria spp.) of invertebrates.

PubMed

Mauchline, Tim H; Knox, Rachel; Mohan, Sharad; Powers, Stephen J; Kerry, Brian R; Davies, Keith G; Hirsch, Penny R

2011-09-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of "cryptic" SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms.

P53 Suppression of Homologous Recombination and Tumorigenesis

DTIC Science & Technology

2012-01-01

mutation acted on both rad51 dependent gene conversion events and deletion events (6). Willers et al. also showed an increase in recombination...suffer from sarcomas. MEFs from these mice show aneuploidy, allelic loss and gene amplification. Most of these germline mutations are missense...the absence of tumor suppressor gene activity, such as p53, results in increased genomic instability and increased cancer predisposition

Systemic p53 gene therapy of cancer with immunolipoplexes targeted by anti-transferrin receptor scFv.

PubMed Central

Xu, L.; Tang, W. H.; Huang, C. C.; Alexander, W.; Xiang, L. M.; Pirollo, K. F.; Rait, A.; Chang, E. H.

2001-01-01

BACKGROUND: A long-standing goal in genetic therapy for cancer is a systemic gene delivery system that selectively targets tumor cells, including metastases. Here we describe a novel cationic immunolipoplex system that shows high in vivo gene transfer efficiency and anti- tumor efficacy when used for systemic p53 gene therapy of cancer. MATERIALS AND METHODS: A cationic immunolipoplex incorporating a biosynthetically lipid-tagged, anti-transferrin receptor single-chain antibody (TfRscFv), was designed to target tumor cells both in vitro and in vivo. A human breast cancer metastasis model was employed to evaluate the in vivo efficacy of systemically administered, TfRscFv-immunolipoplex-mediated, p53 gene therapy in combination with docetaxel. RESULTS: The TfRscFv-targeting cationic immunolipoplex had a size of 60-100 nm, showed enhanced tumor cell binding, and improved targeted gene delivery and transfection efficiencies, both in vitro and in vivo. The p53 tumor suppressor gene was not only systemically delivered by the immunolipoplex to human tumor xenografts in nude mice but also functionally expressed. In the nude mouse breast cancer metastasis model, the combination of the p53 gene delivered by the systemic administration of the TfRscFv-immunolipoplex and docetaxel resulted in significantly improved efficacy with prolonged survival. CONCLUSIONS: This is the first report using scFv-targeting immunolipoplexes for systemic gene therapy. The TfRscFv has a number of advantages over the transferrin (Tf) molecule itself: (1) scFv has a much smaller size than Tf producing a smaller immunolipoplex giving better penetration into solid tumors; (2) unlike Tf, the scFv is a recombinant protein, not a blood product; (3) large scale production and strict quality control of the recombinant scFv, as well as scFv-immunolipoplex, are feasible. The sensitization of tumors to chemotherapy by this tumor-targeted and efficient p53 gene delivery method could lower the effective dose of the drug, correspondingly lessening the severe side effects, while decreasing the possibility of recurrence. Moreover, this approach is applicable to both primary and recurrent tumors, and more significantly, metastatic disease. The TfRscFv-targeting of cationic immunolipoplexes is a promising method of tumor targeted gene delivery that can be used for systemic gene therapy of cancer with the potential to critically impact the clinical management of cancer. PMID:11713371

Inventory of high-abundance mRNAs in skeletal muscle of normal men.

PubMed

Welle, S; Bhatt, K; Thornton, C A

1999-05-01

G42875rial analysis of gene expression (SAGE) method was used to generate a catalog of 53,875 short (14 base) expressed sequence tags from polyadenylated RNA obtained from vastus lateralis muscle of healthy young men. Over 12,000 unique tags were detected. The frequency of occurrence of each tag reflects the relative abundance of the corresponding mRNA. The mRNA species that were detected 10 or more times, each comprising >/=0.02% of the mRNA population, accounted for 64% of the mRNA mass but <10% of the total number of mRNA species detected. Almost all of the abundant tags matched mRNA or EST sequences cataloged in GenBank. Mitochondrial transcripts accounted for approximately 20% of the polyadenylated RNA. Transcripts encoding proteins of the myofibrils were the most abundant nuclear-encoded mRNAs. Transcripts encoding ribosomal proteins, and those encoding proteins involved in energy metabolism, also were very abundant. The database can be used as a reference for investigations of alterations in gene expression associated with conditions that influence muscle function, such as muscular dystrophies, aging, and exercise.

Increased gene expression noise in human cancers is correlated with low p53 and immune activities as well as late stage cancer.

PubMed

Han, Rongfei; Huang, Guanqun; Wang, Yejun; Xu, Yafei; Hu, Yueming; Jiang, Wenqi; Wang, Tianfu; Xiao, Tian; Zheng, Duo

2016-11-01

Gene expression in metazoans is delicately organized. As genetic information transmits from DNA to RNA and protein, expression noise is inevitably generated. Recent studies begin to unveil the mechanisms of gene expression noise control, but the changes of gene expression precision in pathologic conditions like cancers are unknown. Here we analyzed the transcriptomic data of human breast, liver, lung and colon cancers, and found that the expression noise of more than 74.9% genes was increased in cancer tissues as compared to adjacent normal tissues. This suggested that gene expression precision controlling collapsed during cancer development. A set of 269 genes with noise increased more than 2-fold were identified across different cancer types. These genes were involved in cell adhesion, catalytic and metabolic functions, implying the vulnerability of deregulation of these processes in cancers. We also observed a tendency of increased expression noise in patients with low p53 and immune activity in breast, liver and lung caners but not in colon cancers, which indicated the contributions of p53 signaling and host immune surveillance to gene expression noise in cancers. Moreover, more than 53.7% genes had increased noise in patients with late stage than early stage cancers, suggesting that gene expression precision was associated with cancer outcome. Together, these results provided genomic scale explorations of gene expression noise control in human cancers.

Structure-Based Analysis Reveals Cancer Missense Mutations Target Protein Interaction Interfaces.

PubMed

Engin, H Billur; Kreisberg, Jason F; Carter, Hannah

2016-01-01

Recently it has been shown that cancer mutations selectively target protein-protein interactions. We hypothesized that mutations affecting distinct protein interactions involving established cancer genes could contribute to tumor heterogeneity, and that novel mechanistic insights might be gained into tumorigenesis by investigating protein interactions under positive selection in cancer. To identify protein interactions under positive selection in cancer, we mapped over 1.2 million nonsynonymous somatic cancer mutations onto 4,896 experimentally determined protein structures and analyzed their spatial distribution. In total, 20% of mutations on the surface of known cancer genes perturbed protein-protein interactions (PPIs), and this enrichment for PPI interfaces was observed for both tumor suppressors (Odds Ratio 1.28, P-value < 10(-4)) and oncogenes (Odds Ratio 1.17, P-value < 10(-3)). To study this further, we constructed a bipartite network representing structurally resolved PPIs from all available human complexes in the Protein Data Bank (2,864 proteins, 3,072 PPIs). Analysis of frequently mutated cancer genes within this network revealed that tumor-suppressors, but not oncogenes, are significantly enriched with functional mutations in homo-oligomerization regions (Odds Ratio 3.68, P-Value < 10(-8)). We present two important examples, TP53 and beta-2-microglobulin, for which the patterns of somatic mutations at interfaces provide insights into specifically perturbed biological circuits. In patients with TP53 mutations, patient survival correlated with the specific interactions that were perturbed. Moreover, we investigated mutations at the interface of protein-nucleotide interactions and observed an unexpected number of missense mutations but not silent mutations occurring within DNA and RNA binding sites. Finally, we provide a resource of 3,072 PPI interfaces ranked according to their mutation rates. Analysis of this list highlights 282 novel candidate cancer genes that encode proteins participating in interactions that are perturbed recurrently across tumors. In summary, mutation of specific protein interactions is an important contributor to tumor heterogeneity and may have important implications for clinical outcomes.

Maternally Expressed Gene 3, an imprinted non-coding RNA gene, is associated with meningioma pathogenesis and progression

PubMed Central

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A.; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N.; Klibanski, Anne

2010-01-01

Meningiomas are common tumors, representing 15-25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. Chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore it has been proposed that an as yet unidentified tumor suppressor is present at this locus. MEG3 is an imprinted gene located at 14q32 that encodes a non-coding RNA with an anti-proliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in BrdU incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a non-coding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism. PMID:20179190

Computational Modelling of Dapsone Interaction With Dihydropteroate Synthase in Mycobacterium leprae; Insights Into Molecular Basis of Dapsone Resistance in Leprosy.

PubMed

Chaitanya V, Sundeep; Das, Madhusmita; Bhat, Pritesh; Ebenezer, Mannam

2015-10-01

The molecular basis for determination of resistance to anti-leprosy drugs is the presence of point mutations within the genes of Mycobacterium leprae (M. leprae) that encode active drug targets. The downstream structural and functional implications of these point mutations on drug targets were scarcely studied. In this study, we utilized computational tools to develop native and mutant protein models for 5 point mutations at codon positions 53 and 55 in 6-hydroxymethyl-7, 8-dihydropteroate synthase (DHPS) of M. leprae, an active target for dapsone encoded by folp1 gene, that confer resistance to dapsone. Molecular docking was performed to identify variations in dapsone interaction with mutant DHPS in terms of hydrogen bonding, hydrophobic interactions, and energy changes. Schrodinger Suite 2014-3 was used to build homology models and in performing molecular docking. An increase in volume of the binding cavities of mutant structures was noted when compared to native form indicating a weakening in interaction (60.7 Å(3) in native vs. 233.6 Å(3) in Thr53Ala, 659.9 Å(3) in Thr53Ile, 400 Å(3) for Thr53Val, 385 Å(3) for Pro55Arg, and 210 Å(3) for Pro55Leu). This was also reflected by changes in hydrogen bonds and decrease in hydrophobic interactions in the mutant models. The total binding energy (ΔG) decreased significantly in mutant forms when compared to the native form (-51.92 Kcal/mol for native vs. -35.64, -35.24, -46.47, -47.69, and -41.36 Kcal/mol for mutations Thr53Ala, Thr53Ile, Thr53Val, Pro55Arg, and Pro55Leu, respectively. In brief, this analysis provided structural and mechanistic insights to the degree of dapsone resistance contributed by each of these DHPS mutants in leprosy. © 2015 Wiley Periodicals, Inc.

Inactivation of p53 in pterygium influence miR-200a expression resulting in ZEB1/ZEB2 up-regulation and EMT processing.

PubMed

Wu, Chueh-Wei; Peng, Mei-Ling; Yeh, Ken-Tu; Tsai, Yi-Yu; Chiang, Chun-Chi; Cheng, Ya-Wen

2016-05-01

Loss of p53 function has been linked to progression of pterygium. MiR-200a is known to be controlled by p53. Here, we hypothesize that expression of miR-200a and downstream ZEB1/ZEB2 genes are regulated epithelial-mesenchymal transition (EMT) involved in the pathogenesis and recurrence of pterygium. For this study, 120 primary pterygial samples were collected. Immunohistochemistry and real-time RT-PCR were performed to determine the expression of p53, p53 down-stream EMT associated protein and miR-200a. The molecular correlation of p53, miR-200a and downstream genes were confirmed using primary pterygium cells (PECs). Expression of miR-200a in pterygium tissues was significantly lower than in conjunctiva controls (p = 0.015). Up-regulated miR-200a levels were positively correlated with and p53 protein expression (p < 0.001). The miR-200a downstream ZEB1/ZEB1 protein expression were negative correlated with miR-200a expression. Cell model studies demonstrated that miR-200a controlled the EMT of PECs through up-regulated ZEB1, ZEB2 and Snail gene expression. Our study demonstrated that inactivation of p53 in pterygium may influence miR-200a, resulting in ZEB1/ZEB2 up-regulation and EMT processing of pterygium. Therefore, we suggest that expression of miR-200a play an important role in EMT processing and recurrence of pterygium. Copyright © 2016 Elsevier Ltd. All rights reserved.

Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus

Treesearch

Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds

2016-01-01

The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...

p53 elevation in human cells halt SV40 infection by inhibiting T-ag expression

PubMed Central

Drayman, Nir; Ben-nun-Shaul, Orly; Butin-Israeli, Veronika; Srivastava, Rohit; Rubinstein, Ariel M.; Mock, Caroline S.; Elyada, Ela; Ben-Neriah, Yinon; Lahav, Galit; Oppenheim, Ariella

2016-01-01

SV40 large T-antigen (T-ag) has been known for decades to inactivate the tumor suppressor p53 by sequestration and additional mechanisms. Our present study revealed that the struggle between p53 and T-ag begins very early in the infection cycle. We found that p53 is activated early after SV40 infection and defends the host against the infection. Using live cell imaging and single cell analyses we found that p53 dynamics are variable among individual cells, with only a subset of cells activating p53 immediately after SV40 infection. This cell-to-cell variabilty had clear consequences on the outcome of the infection. None of the cells with elevated p53 at the beginning of the infection proceeded to express T-ag, suggesting a p53-dependent decision between abortive and productive infection. In addition, we show that artificial elevation of p53 levels prior to the infection reduces infection efficiency, supporting a role for p53 in defending against SV40. We further found that the p53-mediated host defense mechanism against SV40 is not facilitated by apoptosis nor via interferon-stimulated genes. Instead p53 binds to the viral DNA at the T-ag promoter region, prevents its transcriptional activation by Sp1, and halts the progress of the infection. These findings shed new light on the long studied struggle between SV40 T-ag and p53, as developed during virus-host coevolution. Our studies indicate that the fate of SV40 infection is determined as soon as the viral DNA enters the nucleus, before the onset of viral gene expression. PMID:27462916

Myc, Aurora Kinase-A, and mutant p53R172H co-operate in a mouse model of metastatic skin carcinoma

PubMed Central

Torchia, Enrique C.; Caulin, Carlos; Acin, Sergio; Terzian, Tamara; Kubick, Bradley J.; Box, Neil F.; Roop, Dennis R.

2015-01-01

Clinical observations, as well as data obtained from the analysis of genetically engineered mouse models, firmly established the gain-of-function (GOF) properties of certain p53 mutations. However, little is known about the underlying mechanisms. We have used two independent microarray platforms to perform a comprehensive and global analysis of tumors arising in a model of metastatic skin cancer progression, which compares the consequences of a GOF p53R172H mutant vs. p53 deficiency. DNA profiling revealed a higher level of genomic instability in GOF vs. loss-of-function (LOF) p53 squamous cell carcinomas (SCCs). Moreover, GOF p53 SCCs showed preferential amplification of Myc with a corresponding increase in its expression and deregulation of Aurora Kinase-A. Fluorescent in situ hybridization confirmed amplification of Myc in primary GOF p53 SCCs and its retention in metastatic tumors. We also identified by RNA profiling distinct gene expression profiles in GOF p53 tumors, which included enriched integrin and Rho signaling, independent of tumor stage. Thus, the progression of GOF p53 papillomas to carcinoma was marked by the acquisition of epithelial to mesenchymal transition and metastatic signatures. In contrast, LOF p53 tumors showed enrichment of genes associated with cancer proliferation and chromosomal instability. Collectively, these observations suggest that genomic instability plays a prominent role in the early stages of GOF p53 tumor progression (i.e., papillomas), while it is implicated at a later stage in LOF p53 tumors (i.e., SCCs). This model will allow us to identify specific targets in mutant p53 SCCs, which may lead to the development of new therapeutic agents for the treatment of metastatic SCCs. PMID:21963848

Identification and molecular characterization of the Choristoneura fumiferana multicapsid nucleopolyhedrovirus genomic region encoding the regulatory genes pkip, p47, lef-12, and gta.

PubMed

Lapointe, R; Back, D W; Ding, Q; Carstens, E B

2000-05-25

Choristoneura fumiferana multicapsid nucleopolyhedrovirus (CfMNPV) is a baculovirus pathogenic to spruce budworm, the most damaging insect pest in Canadian forestry. CfMNPV is less virulent to its host insect and its replication cycle is slower than the baculovirus type species Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) but the basis of these characteristics is not known. We have now identified, localized, and determined the sequence of the region of CfMNPV carrying potentially important regulatory genes including p47, lef-12, gta, and pkip. DNA database searches revealed that this region of CfMNPV is most closely related to the homologous OpMNPV genes. Transcription analysis demonstrated that CfMNPV P47 is encoded by a 1.6-kb transcript, LEF-12 is encoded by a 2.6-kb transcript, and GTA is encoded by a 2.1-kb transcript. Transcripts for these genes were detectable at 6 h postinfection but all of them showed a burst in expression levels between 12 and 24 h postinfection corresponding to the time of initiation of CfMNPV DNA replication. A polyclonal antibody, raised against CfMNPV P47, detected a nuclear 43-kDa polypeptide from 12 to 72 h postinfection, demonstrating that the CfMNPV p47 gene product is first expressed at a time corresponding to the burst of transcriptional activity between the early and the late phases. Both AcMNPV and CfMNPV P47 translocate to the nucleus of infected cells. Copyright 2000 Academic Press.

Pifithrin-α provides neuroprotective effects at the level of mitochondria independently of p53 inhibition.

PubMed

Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten

2014-12-01

Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.

Involvement of the ornithine decarboxylase gene in acid stress response in probiotic Lactobacillus delbrueckii UFV H2b20.

PubMed

Ferreira, A B; Oliveira, M N V de; Freitas, F S; Paiva, A D; Alfenas-Zerbini, P; Silva, D F da; Queiroz, M V de; Borges, A C; Moraes, C A de

2015-01-01

Amino acid decarboxylation is important for the maintenance of intracellular pH under acid stress. This study aims to carry out phylogenetic and expression analysis by real-time PCR of two genes that encode proteins involved in ornithine decarboxylation in Lactobacillus delbrueckii UFV H2b20 exposed to acid stress. Sequencing and phylogeny analysis of genes encoding ornithine decarboxylase and amino acid permease in L. delbrueckii UFV H2b20 showed their high sequence identity (99%) and grouping with those of L. delbrueckii subsp. bulgaricus ATCC 11842. Exposure of L. delbrueckii UFV H2b20 cells in MRS pH 3.5 for 30 and 60 min caused a significant increase in expression of the gene encoding ornithine decarboxylase (up to 8.1 times higher when compared to the control treatment). Increased expression of the ornithine decarboxylase gene demonstrates its involvement in acid stress response in L. delbrueckii UFV H2b20, evidencing that the protein encoded by that gene could be involved in intracellular pH regulation. The results obtained show ornithine decarboxylation as a possible mechanism of adaptation to an acidic environmental condition, a desirable and necessary characteristic for probiotic cultures and certainly important to the survival and persistence of the L. delbrueckii UFV H2b20 in the human gastrointestinal tract.

Prevention of the neurocristopathy Treacher Collins syndrome through inhibition of p53 function.

PubMed

Jones, Natalie C; Lynn, Megan L; Gaudenz, Karin; Sakai, Daisuke; Aoto, Kazushi; Rey, Jean-Phillipe; Glynn, Earl F; Ellington, Lacey; Du, Chunying; Dixon, Jill; Dixon, Michael J; Trainor, Paul A

2008-02-01

Treacher Collins syndrome (TCS) is a congenital disorder of craniofacial development arising from mutations in TCOF1, which encodes the nucleolar phosphoprotein Treacle. Haploinsufficiency of Tcof1 perturbs mature ribosome biogenesis, resulting in stabilization of p53 and the cyclin G1-mediated cell-cycle arrest that underpins the specificity of neuroepithelial apoptosis and neural crest cell hypoplasia characteristic of TCS. Here we show that inhibition of p53 prevents cyclin G1-driven apoptotic elimination of neural crest cells while rescuing the craniofacial abnormalities associated with mutations in Tcof1 and extending life span. These improvements, however, occur independently of the effects on ribosome biogenesis; thus suggesting that it is p53-dependent neuroepithelial apoptosis that is the primary mechanism underlying the pathogenesis of TCS. Our work further implies that neuroepithelial and neural crest cells are particularly sensitive to cellular stress during embryogenesis and that suppression of p53 function provides an attractive avenue for possible clinical prevention of TCS craniofacial birth defects and possibly those of other neurocristopathies.

Molecular Background of Colorectal Tumors From Patients with Lynch Syndrome Associated With Germline Variants in PMS2.

PubMed

Ten Broeke, S W; van Bavel, T C; Jansen, A M L; Gómez-García, E; Hes, F J; van Hest, L P; Letteboer, T G W; Olderode-Berends, M J W; Ruano, D; Spruijt, L; Suerink, M; Tops, C M; van Eijk, R; Morreau, H; van Wezel, T; Nielsen, M

2018-05-11

Germline variants in the mismatch repair genes MLH1, MSH2 (EPCAM), MSH6, or PMS2 cause Lynch syndrome. Patients with these variants have an increased risk of developing colorectal cancers (CRCs) that differ from sporadic CRCs in genetic and histologic features. It has been a challenge to study CRCs associated with PMS2 variants (PMS2-associated CRCs) because these develop less frequently and in patients of older ages than colorectal tumors with variants in the other mismatch repair genes. We analyzed 20 CRCs associated with germline variants in PMS2, 22 sporadic CRCs, 18 CRCs with germline variants in MSH2, and 24 CRCs from patients with germline variants in MLH1. Tumor tissue blocks were collected from Dutch pathology departments in 2017. After extraction of tumor DNA, we used a platform designed to detect approximately 3000 somatic hotspot variants in 55 genes (including KRAS, APC, CTNNB1, and TP53). Somatic variant frequencies were compared using the Fisher's exact test. None of the PMS2-associated CRCs contained any somatic variants in the catenin beta 1 gene (CTNNB1), which encodes β-catenin, whereas 14/24 MLH1-associated CRCs (58%) contained variants in CTNNB1. Half of PMS2-associated CRCs contained KRAS variants, but only 20% of these were in hotspots that encoded G12D or G13D. These hotspot variants occurred more frequently in CRCs associated with variants in MLH1 (37.5%, P=.44) and MSH2 (and 71.4%, P=.035) than with variants in PMS2. In a genetic analysis of 84 colorectal tumors, we found tumors from patients with PMS2-associated Lynch syndrome to be distinct from colorectal tumors associated with defects in other mismatch repair genes. This might account for differences in development and less frequent occurrence. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

PubMed

Kim, K S; Farrand, S K

1996-06-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

PubMed Central

Kim, K S; Farrand, S K

1996-01-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes. PMID:8655509

Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.

PubMed

Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M

2015-12-01

Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.

Mathematical Modeling of E6-p53 interactions in Cervical Cancer

PubMed

Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar

2017-04-01

Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License

Mathematical Modeling of E6-p53 interactions in Cervical Cancer

PubMed Central

Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, AI; Ullah, Mukhtar

2017-01-01

Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. PMID:28547941

Association of P53 gene polymorphism with gastric cancer in Northern Iran as a high-risk region.

PubMed

Hedayatizadeh-Omran, Akbar; Alizadeh-Navaei, Reza; Janbabaei, Ghasem; Omrani-Nava, Versa; Hasheminasab, Yahya; Amjadi, Omolbanin; Tehrani, Mohsen

2018-05-01

Gastric cancer has the fourth highest morbidity rate of all cancers worldwide. Genetic factors including alterations in oncogenes and tumor suppressor genes serve an important role in gastric cancer development and progression. The P53 gene acts as a tumor suppressor gene by regulating the cell cycle, DNA transcription and repair, apoptosis, senescence and genome stability. In addition to somatic P53 mutations in cancer development, germline polymorphisms are also involved in different malignancies. The polymorphism of P53 at codon 72 (Arg72Pro) is established as a common variant that increases susceptibility to various cancers. The present case-control study was conducted to evaluate the possible association between this P53 polymorphism and gastric cancer in the Iranian population. A total of 59 patients with gastric cancer and 59 healthy controls were enrolled in the present study. Genomic DNA was extracted from peripheral blood mononuclear cells and genotype analysis was performed using a polymerase chain reaction-based restriction fragment length polymorphism assay. Genotype frequencies did not differ significantly between the patients and controls (P=0.4); the frequencies of the three genotypes Arg/Arg, Arg/Pro and Pro/Pro in gastric cancer patients were 28.8, 49.2 and 22.0%, and in controls were 37.3, 49.2 and 13.6%. Additionally, there were no differences in genotype frequencies based on tumor location, histological differentiation or tumor stage. Based on these findings, it may be concluded that the P53 codon 72 polymorphism does not contribute to gastric cancer susceptibility in Northern Iran.

A common carcinogen benzo[a]pyrene causes p53 overexpression in mouse cervix via DNA damage.

PubMed

Gao, Meili; Li, Yongfei; Sun, Ying; Long, Jiangang; Kong, Yu; Yang, Shuiyun; Wang, Yili

2011-09-18

Benzo[a]pyrene (BaP) is cytotoxic and/or genotoxic to lung, stomach and skin tissue in the body. However, the effect of BaP on cervical tissue remains unclear. The present study detected DNA damage and the expression of the p53 gene in BaP-induced cervical tissue in female mice. Animals were intraperitoneally injected and orally gavaged with BaP at the doses of 2.5, 5, and 10mg/kg twice a week for 14 weeks. The single-cell gel electrophoresis (SCGE) assay was used to detect the DNA damage. Immunohistochemistry (IHC) and in situ hybridization (ISH) were used to detect the expression of p53 protein and p53 mRNA, respectively. The results showed that BaP induced a significant and dose-dependent increase of the number of cells with DNA damaged and the tail length as well as Comet tail moment in cervical tissue. The expression level of p53 protein and mRNA was increased. The results demonstrate that BaP may show toxic effect on the cervix by increasing DNA damage and the expression of the p53 gene. Copyright © 2011 Elsevier B.V. All rights reserved.

Enterococcus faecalis utilizes maltose by connecting two incompatible metabolic routes via a novel maltose-6’-phosphate phosphatase (MapP)

PubMed Central

Mokhtari, Abdelhamid; Blancato, Víctor S.; Repizo, Guillermo; Henry, Céline; Pikis, Andreas; Bourand, Alexa; de Fátima Álvarez, María; Immel, Stefan; Mechakra-Maza, Aicha; Hartke, Axel; Thompson, John; Magni, Christian; Deutscher, Josef

2013-01-01

Summary Similar to Bacillus subtilis, Enterococcus faecalis transports and phosphorylates maltose via a phosphoenolpyruvate (PEP):maltose phosphotransferase system (PTS). The maltose-specific PTS permease is encoded by the malT gene. However, E. faecalis lacks a malA gene encoding a 6-phospho-α-glucosidase which in B. subtilis hydrolyses maltose-6’-P into glucose and glucose-6-P. Instead, an operon encoding a maltose phosphorylase (MalP), a phosphoglucomutase and a mutarotase starts upstream from malT. MalP was suggested to split maltose-6-P into glucose-1-P and glucose-6-P. However, purified MalP phosphorolyses maltose but not maltose-6’-P. We discovered that the gene downstream from malT encodes a novel enzyme (MapP) that dephosphorylates maltose-6’-P formed by the PTS. The resulting intracellular maltose is cleaved by MalP into glucose and glucose-1-P. Slow uptake of maltose probably via a maltodextrin ABC transporter allows poor growth for the mapP but not the malP mutant. Synthesis of MapP in a B. subtilis mutant accumulating maltose-6’-P restored growth on maltose. MapP catalyzes the dephosphorylation of intracellular maltose-6’-P, and the resulting maltose is converted by the B. subtilis maltose phosphorylase into glucose and glucose-1-P. MapP therefore connects PTS-mediated maltose uptake to maltose phosphorylase-catalyzed metabolism. Dephosphorylation assays with a wide variety of phospho-substrates revealed that MapP preferably dephosphorylates disaccharides containing an O-α-glycosyl linkage. PMID:23490043

Cloning and expression of a CYP720B orthologue involved in the biosynthesis of diterpene resin acids in Pinus brutia.

PubMed

Semiz, Asli; Sen, Alaattin

2015-03-01

Cytochrome P450 monooxygenases mediate a broad range of oxidative reactions involved in the biosynthesis of both primary and secondary metabolites in plants. Until now, only two P450 genes, CYP720B1 from Pinus taeda and CYP720B4 from Picea sitchensis, have been functionally characterised and described in the literature. The purpose of this study was to describe the cloning and expression of CYP720B from Pinus brutia due to its suggested role in the synthesis of bioactive compounds used for chemical defence against insects. A PCR product of the P. brutia CYP720B gene was cloned into the pCR8/GW/TOPO cloning vector. After optimising the sequence for codon usage in yeast, it was transferred into the inducible expression vector pYES-DEST52 and transfected into the S. cerevisiae INVSc1 strain. Sequence analysis showed that the P. brutia CYP720B gene contains an open reading frame of 1,464 nucleotides, which encodes a 53,570 Da putative protein of 487 amino acid residues. The putative protein contains the classic heme-binding sequence motif that is conserved in all P450 enzymes. It shares 99 and 61% identity with the deduced amino acid sequences of CYP720B1 from Pinus taeda and CYP720B4 from Picea sitchensis, respectively. Recombinant CYP720B protein expression was confirmed using western blot analysis. Furthermore, recombinant CYP720B was functionally active, showing a Soret peak at approximately 448 nm in the reduced CO difference spectra. These data suggest that the cloned gene is an orthologue of CYP720B in P. brutia and might be involved in DRA biosynthesis.

Differential expression of the nuclear-encoded mitochondrial transcriptome in pediatric septic shock.

PubMed

Weiss, Scott L; Cvijanovich, Natalie Z; Allen, Geoffrey L; Thomas, Neal J; Freishtat, Robert J; Anas, Nick; Meyer, Keith; Checchia, Paul A; Shanley, Thomas P; Bigham, Michael T; Fitzgerald, Julie; Banschbach, Sharon; Beckman, Eileen; Howard, Kelli; Frank, Erin; Harmon, Kelli; Wong, Hector R

2014-11-19

Increasing evidence supports a role for mitochondrial dysfunction in organ injury and immune dysregulation in sepsis. Although differential expression of mitochondrial genes in blood cells has been reported for several diseases in which bioenergetic failure is a postulated mechanism, there are no data about the blood cell mitochondrial transcriptome in pediatric sepsis. We conducted a focused analysis using a multicenter genome-wide expression database of 180 children ≤ 10 years of age with septic shock and 53 healthy controls. Using total RNA isolated from whole blood within 24 hours of PICU admission for septic shock, we evaluated 296 nuclear-encoded mitochondrial genes using a false discovery rate of 1%. A series of bioinformatic approaches were applied to compare differentially expressed genes across previously validated gene expression-based subclasses (groups A, B, and C) of pediatric septic shock. In total, 118 genes were differentially regulated in subjects with septic shock compared to healthy controls, including 48 genes that were upregulated and 70 that were downregulated. The top scoring canonical pathway was oxidative phosphorylation, with general downregulation of the 51 genes corresponding to the electron transport system (ETS). The top two gene networks were composed primarily of mitochondrial ribosomal proteins highly connected to ETS complex I, and genes encoding for ETS complexes I, II, and IV that were highly connected to the peroxisome proliferator activated receptor (PPAR) family. There were 162 mitochondrial genes differentially regulated between groups A, B, and C. Group A, which had the highest maximum number of organ failures and mortality, exhibited a greater downregulation of mitochondrial genes compared to groups B and C. Based on a focused analysis of a pediatric septic shock transcriptomic database, nuclear-encoded mitochondrial genes were differentially regulated early in pediatric septic shock compared to healthy controls, as well as across genotypic and phenotypic distinct pediatric septic shock subclasses. The nuclear genome may be an important mechanism contributing to alterations in mitochondrial bioenergetic function and outcomes in pediatric sepsis.

Two co-existing germline mutations P53 V157D and PMS2 R20Q promote tumorigenesis in a familial cancer syndrome.

PubMed

Wang, Zuoyun; Sun, Yihua; Gao, Bin; Lu, Yi; Fang, Rong; Gao, Yijun; Xiao, Tian; Liu, Xin-Yuan; Pao, William; Zhao, Yun; Chen, Haiquan; Ji, Hongbin

2014-01-01

Germline mutations are responsible for familial cancer syndromes which account for approximately 5-10% of all types of cancers. These mutations mainly occur at tumor suppressor genes or genome stability genes, such as DNA repair genes. Here we have identified a cancer predisposition family, in which eight members were inflicted with a wide spectrum of cancer including one diagnosed with lung cancer at 22years old. Sequencing analysis of tumor samples as well as histologically normal specimens identified two germline mutations co-existing in the familial cancer syndrome, the mutation of tumor suppressor gene P53 V157D and mismatch repair gene PMS2 R20Q. We further demonstrate that P53 V157D and/or PMS2 R20Q mutant promotes lung cancer cell proliferation. These two mutants are capable of promoting colony formation in soft agar as well as tumor formation in transgenic drosophila system. Collectively, these data have uncovered the important role of co-existing germline P53 and PMS2 mutations in the familial cancer syndrome development. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Two co-existing germline mutations P53 V157D and PMS2 R20Q promote tumorigenesis in a familial cancer syndrome

PubMed Central

Wang, Zuoyun; Sun, Yihua; Gao, Bin; Lu, Yi; Fang, Rong; Gao, Yijun; Xiao, Tian; Liu, Xin-Yuan; Pao, William; Zhao, Yun; Chen, Haiquan; Ji, Hongbin

2014-01-01

Germline mutations are responsible for familial cancer syndromes which account for approximately 5–10% of all types of cancers. These mutations mainly occur at tumor suppressor genes or genome stability genes, such as DNA repair genes. Here we have identified a cancer predisposition family, in which eight members were inflicted with a wide spectrum of cancer including one diagnosed with lung cancer at 22 years old. Sequencing analysis of tumor samples as well as histologically normal specimens identified two germline mutations co-existing in the familial cancer syndrome, the mutation of tumor suppressor gene P53 V157D and mismatch repair gene PMS2 R20Q. We further demonstrate that P53 V157D and/or PMS2 R20Q mutant promotes lung cancer cell proliferation. These two mutants are capable of promoting colony formation in soft agar as well as tumor formation in transgenic drosophila system. Collectively, these data have uncovered the important role of co-existing germline P53 and PMS2 mutations in the familial cancer syndrome development. PMID:23981578

Loss of p53 protein during radiation transformation of primary human mammary epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wazer, D.E.; Chu, Qiuming; Liu, Xiao Long

1994-04-01

The causative factors leading to breast cancer are largely unknown. Increased incidence of breast cancer following diagnostic or therapeutic radiation suggests that radiation may contribute to mammary oncogenesis. This report describes the in vitro neoplastic transformation of a normal human mammary epithelial cell strain, 76N, by fractionated [gamma]-irradiation at a clinically used dose (30 Gy). The transformed cells (76R-30) were immortal, had reduced growth factor requirements, and produced tumors in nude mice. Remarkably, the 76R-30 cells completely lacked the p53 tumor suppressor protein. Loss of p53 was due to deletion of the gene on one allele and a 26-bp deletionmore » within the third intron on the second allele which resulted in abnormal splicing out of either the third or fourth exon from the mRNA. PCR with a mutation-specific primer showed that intron 3 mutation was present in irradiated cells before selection for immortal phenotype. 76R-30 cells did not exhibit G[sub 1] arrest in response to radiation, indicating a loss of p53-mediated function. Expression of the wild-type p53 gene in 76R-30 cells led to their growth inhibition. Thus, loss of p53 protein appears to have contributed to neoplastic transformation of these cells. This unique model should facilitate analyses of molecular mechanisms of radiation-induced breast cancer and allow identification of p53-regulated cellular genes in breast cells. 44 refs., 8 figs., 1 tab.« less

Immunohistochemical analysis of P53 protein in odontogenic cysts

PubMed Central

Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

2010-01-01

The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

MDM2 phenotypic and genotypic profiling, respective to TP53 genetic status, in diffuse large B-cell lymphoma patients treated with rituximab-CHOP immunochemotherapy: a report from the International DLBCL Rituximab-CHOP Consortium Program

PubMed Central

Xu-Monette, Zijun Y.; Møller, Michael B.; Tzankov, Alexander; Montes-Moreno, Santiago; Hu, Wenwei; Manyam, Ganiraju C.; Kristensen, Louise; Fan, Lei; Visco, Carlo; Dybkær, Karen; Chiu, April; Tam, Wayne; Zu, Youli; Bhagat, Govind; Richards, Kristy L.; Hsi, Eric D.; Choi, William W. L.; van Krieken, J. Han; Huang, Qin; Huh, Jooryung; Ai, Weiyun; Ponzoni, Maurilio; Ferreri, Andrés J. M.; Wu, Lin; Zhao, Xiaoying; Bueso-Ramos, Carlos E.; Wang, Sa A.; Go, Ronald S.; Li, Yong; Winter, Jane N.; Medeiros, L. Jeffrey

2013-01-01

MDM2 is a key negative regulator of the tumor suppressor p53, however, the prognostic significance of MDM2 overexpression in diffuse large B-cell lymphoma (DLBCL) has not been defined convincingly. In a p53 genetically–defined large cohort of de novo DLBCL patients treated with rituximab, cyclophosphamide, hydroxydaunorubicin, vincristine, and prednisone (R-CHOP) chemotherapy, we assessed MDM2 and p53 expression by immunohistochemistry (n = 478), MDM2 gene amplification by fluorescence in situ hybridization (n = 364), and a single nucleotide polymorphism in the MDM2 promoter, SNP309, by SNP genotyping assay (n = 108). Our results show that MDM2 overexpression, unlike p53 overexpression, is not a significant prognostic factor in overall DLBCL. Both MDM2 and p53 overexpression do not predict for an adverse clinical outcome in patients with wild-type p53 but predicts for significantly poorer survival in patients with mutated p53. Variable p53 activities may ultimately determine the survival differences, as suggested by the gene expression profiling analysis. MDM2 amplification was observed in 3 of 364 (0.8%) patients with high MDM2 expression. The presence of SNP309 did not correlate with MDM2 expression and survival. This study indicates that evaluation of MDM2 and p53 expression correlating with TP53 genetic status is essential to assess their prognostic significance and is important for designing therapeutic strategies that target the MDM2-p53 interaction. PMID:23982177

P16 UV mutations in human skin epithelial tumors.

PubMed

Soufir, N; Molès, J P; Vilmer, C; Moch, C; Verola, O; Rivet, J; Tesniere, A; Dubertret, L; Basset-Seguin, N

1999-09-23

The p16 gene expresses two alternative transcripts (p16alpha and p16beta) involved in tumor suppression via the retinoblastoma (Rb) or p53 pathways. Disruption of these pathways can occur through inactivation of p16 or p53, or activating mutations of cyclin dependant kinase 4 gene (Cdk4). We searched for p16, Cdk4 and p53 gene mutations in 20 squamous cell carcinomas (SSCs), 1 actinic keratosis (AK), and 28 basal cell carcinomas (BCCs), using PCR-SSCP. A deletion and methylation analysis of p16 was also performed. Six different mutations (12%) were detected in exon 2 of p16 (common to p16alpha and p16beta), in five out of 21 squamous lesions (24%) (one AK and four SCCs) and one out of 28 BCCs (3.5%). These included four (66%) ultraviolet (UV)-type mutations (two tandems CC : GG to TT : AA transitions and two C : G to T : A transitions at dipyrimidic site) and two transversions. P53 mutations were present in 18 samples (37%), mostly of UV type. Of these, only two (one BCC and one AK) harboured simultaneously mutations of p16, but with no consequence on p16beta transcript. Our data demonstrate for the first time the presence of p16 UV induced mutations in non melanoma skin cancer, particularly in the most aggressive SCC type, and support that p16 and p53 are involved in two independent pathways in skin carcinogenesis.

Cloning and expression in Escherichia coli of isopenicillin N synthetase genes from Streptomyces lipmanii and Aspergillus nidulans.

PubMed Central

Weigel, B J; Burgett, S G; Chen, V J; Skatrud, P L; Frolik, C A; Queener, S W; Ingolia, T D

1988-01-01

beta-Lactam antibiotics such as penicillins and cephalosporins are synthesized by a wide variety of microbes, including procaryotes and eucaryotes. Isopenicillin N synthetase catalyzes a key reaction in the biosynthetic pathway of penicillins and cephalosporins. The genes encoding this protein have previously been cloned from the filamentous fungi Cephalosporium acremonium and Penicillium chrysogenum and characterized. We have extended our analysis to the isopenicillin N synthetase genes from the fungus Aspergillus nidulans and the gram-positive procaryote Streptomyces lipmanii. The isopenicillin N synthetase genes from these organisms have been cloned and sequenced, and the proteins encoded by the open reading frames were expressed in Escherichia coli. Active isopenicillin N synthetase enzyme was recovered from extracts of E. coli cells prepared from cells containing each of the genes in expression vectors. The four isopenicillin N synthetase genes studied are closely related. Pairwise comparison of the DNA sequences showed between 62.5 and 75.7% identity; comparison of the predicted amino acid sequences showed between 53.9 and 80.6% identity. The close homology of the procaryotic and eucaryotic isopenicillin N synthetase genes suggests horizontal transfer of the genes during evolution. Images PMID:3045077

Microbial Metabolic Potential for Carbon Degradation and Nutrient (Nitrogen and Phosphorus) Acquisition in an Ombrotrophic Peatland

PubMed Central

Tfaily, Malak M.; Green, Stefan J.; Steinweg, J. Megan; Chanton, Patrick; Imvittaya, Aopeau; Chanton, Jeffrey P.; Cooper, William; Schadt, Christopher

2014-01-01

This study integrated metagenomic and nuclear magnetic resonance (NMR) spectroscopic approaches to investigate microbial metabolic potential for organic matter decomposition and nitrogen (N) and phosphorus (P) acquisition in soils of an ombrotrophic peatland in the Marcell Experimental Forest (MEF), Minnesota, USA. This analysis revealed vertical stratification in key enzymatic pathways and taxa containing these pathways. Metagenomic analyses revealed that genes encoding laccases and dioxygenases, involved in aromatic compound degradation, declined in relative abundance with depth, while the relative abundance of genes encoding metabolism of amino sugars and all four saccharide groups increased with depth in parallel with a 50% reduction in carbohydrate content. Most Cu-oxidases were closely related to genes from Proteobacteria and Acidobacteria, and type 4 laccase-like Cu-oxidase genes were >8 times more abundant than type 3 genes, suggesting an important and overlooked role for type 4 Cu-oxidase in phenolic compound degradation. Genes associated with sulfate reduction and methanogenesis were the most abundant anaerobic respiration genes in these systems, with low levels of detection observed for genes of denitrification and Fe(III) reduction. Fermentation genes increased in relative abundance with depth and were largely affiliated with Syntrophobacter. Methylocystaceae-like small-subunit (SSU) rRNA genes, pmoA, and mmoX genes were more abundant among methanotrophs. Genes encoding N2 fixation, P uptake, and P regulons were significantly enriched in the surface peat and in comparison to other ecosystems, indicating N and P limitation. Persistence of inorganic orthophosphate throughout the peat profile in this P-limiting environment indicates that P may be bound to recalcitrant organic compounds, thus limiting P bioavailability in the subsurface. Comparative metagenomic analysis revealed a high metabolic potential for P transport and starvation, N2 fixation, and oligosaccharide degradation at MEF relative to other wetland and soil environments, consistent with the nutrient-poor and carbohydrate-rich conditions found in this Sphagnum-dominated boreal peatland. PMID:24682299

Microbial metabolic potential for carbon degradation and nutrient (nitrogen and phosphorus) acquisition in an ombrotrophic peatland.

PubMed

Lin, Xueju; Tfaily, Malak M; Green, Stefan J; Steinweg, J Megan; Chanton, Patrick; Imvittaya, Aopeau; Chanton, Jeffrey P; Cooper, William; Schadt, Christopher; Kostka, Joel E

2014-06-01

This study integrated metagenomic and nuclear magnetic resonance (NMR) spectroscopic approaches to investigate microbial metabolic potential for organic matter decomposition and nitrogen (N) and phosphorus (P) acquisition in soils of an ombrotrophic peatland in the Marcell Experimental Forest (MEF), Minnesota, USA. This analysis revealed vertical stratification in key enzymatic pathways and taxa containing these pathways. Metagenomic analyses revealed that genes encoding laccases and dioxygenases, involved in aromatic compound degradation, declined in relative abundance with depth, while the relative abundance of genes encoding metabolism of amino sugars and all four saccharide groups increased with depth in parallel with a 50% reduction in carbohydrate content. Most Cu-oxidases were closely related to genes from Proteobacteria and Acidobacteria, and type 4 laccase-like Cu-oxidase genes were >8 times more abundant than type 3 genes, suggesting an important and overlooked role for type 4 Cu-oxidase in phenolic compound degradation. Genes associated with sulfate reduction and methanogenesis were the most abundant anaerobic respiration genes in these systems, with low levels of detection observed for genes of denitrification and Fe(III) reduction. Fermentation genes increased in relative abundance with depth and were largely affiliated with Syntrophobacter. Methylocystaceae-like small-subunit (SSU) rRNA genes, pmoA, and mmoX genes were more abundant among methanotrophs. Genes encoding N2 fixation, P uptake, and P regulons were significantly enriched in the surface peat and in comparison to other ecosystems, indicating N and P limitation. Persistence of inorganic orthophosphate throughout the peat profile in this P-limiting environment indicates that P may be bound to recalcitrant organic compounds, thus limiting P bioavailability in the subsurface. Comparative metagenomic analysis revealed a high metabolic potential for P transport and starvation, N2 fixation, and oligosaccharide degradation at MEF relative to other wetland and soil environments, consistent with the nutrient-poor and carbohydrate-rich conditions found in this Sphagnum-dominated boreal peatland.

Characterization of the Tupaia rhabdovirus genome reveals a long open reading frame overlapping with P and a novel gene encoding a small hydrophobic protein.

PubMed

Springfeld, Christoph; Darai, Gholamreza; Cattaneo, Roberto

2005-06-01

Rhabdoviruses are negative-stranded RNA viruses of the order Mononegavirales and have been isolated from vertebrates, insects, and plants. Members of the genus Lyssavirus cause the invariably fatal disease rabies, and a member of the genus Vesiculovirus, Chandipura virus, has recently been associated with acute encephalitis in children. We present here the complete genome sequence and transcription map of a rhabdovirus isolated from cultivated cells of hepatocellular carcinoma tissue from a moribund tree shrew. The negative-strand genome of tupaia rhabdovirus is composed of 11,440 nucleotides and encodes six genes that are separated by one or two intergenic nucleotides. In addition to the typical rhabdovirus genes in the order N-P-M-G-L, a gene encoding a small hydrophobic putative type I transmembrane protein of approximately 11 kDa was identified between the M and G genes, and the corresponding transcript was detected in infected cells. Similar to some Vesiculoviruses and many Paramyxovirinae, the P gene has a second overlapping reading frame that can be accessed by ribosomal choice and encodes a protein of 26 kDa, predicted to be the largest C protein of these virus families. Phylogenetic analyses of the tupaia rhabdovirus N and L genes show that the virus is distantly related to the Vesiculoviruses, Ephemeroviruses, and the recently characterized Flanders virus and Oita virus and further extends the sequence territory occupied by animal rhabdoviruses.

Characterization of the Tupaia Rhabdovirus Genome Reveals a Long Open Reading Frame Overlapping with P and a Novel Gene Encoding a Small Hydrophobic Protein

PubMed Central

Springfeld, Christoph; Darai, Gholamreza; Cattaneo, Roberto

2005-01-01

Rhabdoviruses are negative-stranded RNA viruses of the order Mononegavirales and have been isolated from vertebrates, insects, and plants. Members of the genus Lyssavirus cause the invariably fatal disease rabies, and a member of the genus Vesiculovirus, Chandipura virus, has recently been associated with acute encephalitis in children. We present here the complete genome sequence and transcription map of a rhabdovirus isolated from cultivated cells of hepatocellular carcinoma tissue from a moribund tree shrew. The negative-strand genome of tupaia rhabdovirus is composed of 11,440 nucleotides and encodes six genes that are separated by one or two intergenic nucleotides. In addition to the typical rhabdovirus genes in the order N-P-M-G-L, a gene encoding a small hydrophobic putative type I transmembrane protein of approximately 11 kDa was identified between the M and G genes, and the corresponding transcript was detected in infected cells. Similar to some Vesiculoviruses and many Paramyxovirinae, the P gene has a second overlapping reading frame that can be accessed by ribosomal choice and encodes a protein of 26 kDa, predicted to be the largest C protein of these virus families. Phylogenetic analyses of the tupaia rhabdovirus N and L genes show that the virus is distantly related to the Vesiculoviruses, Ephemeroviruses, and the recently characterized Flanders virus and Oita virus and further extends the sequence territory occupied by animal rhabdoviruses. PMID:15890917

Genome-wide CRISPR screen for PARKIN regulators reveals transcriptional repression as a determinant of mitophagy.

PubMed

Potting, Christoph; Crochemore, Christophe; Moretti, Francesca; Nigsch, Florian; Schmidt, Isabel; Manneville, Carole; Carbone, Walter; Knehr, Judith; DeJesus, Rowena; Lindeman, Alicia; Maher, Rob; Russ, Carsten; McAllister, Gregory; Reece-Hoyes, John S; Hoffman, Gregory R; Roma, Guglielmo; Müller, Matthias; Sailer, Andreas W; Helliwell, Stephen B

2018-01-09

PARKIN, an E3 ligase mutated in familial Parkinson's disease, promotes mitophagy by ubiquitinating mitochondrial proteins for efficient engagement of the autophagy machinery. Specifically, PARKIN-synthesized ubiquitin chains represent targets for the PINK1 kinase generating phosphoS65-ubiquitin (pUb), which constitutes the mitophagy signal. Physiological regulation of PARKIN abundance, however, and the impact on pUb accumulation are poorly understood. Using cells designed to discover physiological regulators of PARKIN abundance, we performed a pooled genome-wide CRISPR/Cas9 knockout screen. Testing identified genes individually resulted in a list of 53 positive and negative regulators. A transcriptional repressor network including THAP11 was identified and negatively regulates endogenous PARKIN abundance. RNAseq analysis revealed the PARKIN-encoding locus as a prime THAP11 target, and THAP11 CRISPR knockout in multiple cell types enhanced pUb accumulation. Thus, our work demonstrates the critical role of PARKIN abundance, identifies regulating genes, and reveals a link between transcriptional repression and mitophagy, which is also apparent in human induced pluripotent stem cell-derived neurons, a disease-relevant cell type. Copyright © 2018 the Author(s). Published by PNAS.

Nuclear Interaction between ADR-Induced p65 and p53 Mediates Cardiac Injury in iNOS (−/−) Mice

PubMed Central

Cole, Marsha P.; Tangpong, Jitbanjong; Oberley, Terry D.; Chaiswing, Luksana; Kiningham, Kinsley K.; St. Clair, Daret K.

2014-01-01

Adriamycin (ADR) treatment causes an imbalance in the levels of nitric oxide (•NO) and superoxide (O2 •−) production leading to cardiac injury. Previously we demonstrated that mice lacking inducible nitric oxide synthase (iNOS) have increased oxidative stress and mitochondrial injury. The molecular events leading to increased mitochondrial injury in iNOS deficient mice is unknown. ADR in the absence of iNOS preferentially activates a proapoptotic pathway without a concurrent increase in prosurvival pathways. Treatment with ADR leads to an increase in DNA binding activity of nuclear factor kappa B (NFκB) and p53 in wildtype mice. Following ADR treatment, p53, but not NFκB DNA binding activity, as well as the level of Bax, a p53 target gene, was increased in iNOS (−/−) mice. This apoptotic signaling effect in iNOS (−/−) is alleviated by overexpression of manganese superoxide dismutase (MnSOD). Increases in NFκB and p53 in ADR-treated wildtype mice did not lead to increases in target genes such as MnSOD, bcl-xL, or Bax. Moreover, co-immunoprecipitation analysis revealed that p65, a prominent member of the NFκB family, interacts with p53 in the nucleus. These results suggest that NFκB and p53 may counter act one another's actions in ADR-treated wildtype (WT) mice. Further, these results identify a novel mechanism by which oxidative stress may regulate transcription of proapoptotic genes. PMID:24586632

Mutation screening of the USH2A gene in retinitis pigmentosa and USHER patients in a Han Chinese population.

PubMed

Huang, Lulin; Mao, Yao; Yang, Jiyun; Li, Yuanfeng; Li, Yang; Yang, Zhenglin

2018-06-13

USH2A encodes for usherin, a basement membrane protein in the inner ear and retina. USH2A can cause retinitis pigmentosa (RP) with or without hearing loss. The aim of this study was to detect USH2A mutations in a Chinese cohort of 75 small RP families and 10 Usher syndrome families. We performed a direct Sanger sequencing analysis of the USH2A gene to identify mutations for this cohort. We identified a total of eight mutations in four of the 75 small RP families (5.3%) and two mutations in one of the 10 Usher families (10%); all families were detected to have compound heterozygous mutations. In families with nonsyndromic RP, we identified the compound heterozygous mutations p.Pro4818Leuand p.Leu2395Hisfs*19 in family No. 19114, p.Arg4493His and p.His1677Glnfs*15 in family No.19162, c.8559-2A > G and p.Arg1549* in family No.19123 and p.Ser5060Pro and p.Arg34Leufs*41 in family No.19178. We also identified the heterozygous mutations p.Arg3719His and p.Cys934Trp in family No.19124, which was the Usher syndrome family. These mutations were predicted to be harmful by SIFT, PROVEAN, Mutation Taster or PolyPhen-2. Our results revealed six novel mutations in the USH2A gene in a Chinese population, which is beneficial for the clinical use of genetic testing of USH2A in patients with autosomal-recessive or sporadic RP and Usher syndrome.

Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life

DOE Office of Scientific and Technical Information (OSTI.GOV)

Finlay, C.A.; Hinds, P.W.; Tan, T.H.

1988-02-01

The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less

MicroRNA-145 is regulated by DNA methylation and p53 gene mutation in prostate cancer

PubMed Central

Suh, Seong O.; Chen, Yi; Zaman, Mohd Saif; Hirata, Hiroshi; Yamamura, Soichiro; Shahryari, Varahram; Liu, Jan; Tabatabai, Z.Laura; Kakar, Sanjay; Deng, Guoren; Tanaka, Yuichiro; Dahiya, Rajvir

2011-01-01

MiR-145 is downregulated in various cancers including prostate cancer. However, the underlying mechanisms of miR-145 downregulation are not fully understood. Here, we reported that miR-145 was silenced through DNA hypermethylation and p53 mutation status in laser capture microdissected (LCM) prostate cancer and matched adjacent normal tissues. In 22 of 27 (81%) prostate tissues, miR-145 was significantly downregulated in the cancer compared with the normal tissues. Further studies on miR-145 downregulation mechanism showed that miR-145 is methylated at the promoter region in both prostate cancer tissues and 50 different types of cancer cell lines. In seven cancer cell lines with miR-145 hypermethylation, 5-aza-2′-deoxycytidine treatment dramatically induced miR-145 expression. Interestingly, we also found a significant correlation between miR-145 expression and the status of p53 gene in both LCM prostate tissues and 47 cancer cell lines. In 29 cell lines with mutant p53, miR-145 levels were downregulated in 28 lines (97%), whereas in 18 cell lines with wild-type p53 (WT p53), miR-145 levels were downregulated in only 6 lines (33%, P < 0.001). Electrophoretic mobility shift assay showed that p53 binds to the p53 response element upstream of miR-145, but the binding was inhibited by hypermethylation. To further confirm that p53 binding to miR-145 could regulate miR-145 expression, we transfected WT p53 and MUT p53 into PC-3 cells and found that miR-145 is upregulated by WT p53 but not with MUTp53. The apoptotic cells are increased after WT p53 transfection. In summary, this is the first report documenting that downregulation of miR-145 is through DNA methylation and p53 mutation pathways in prostate cancer. PMID:21349819

Molecular Pathology of Anaplastic Thyroid Carcinomas: A Retrospective Study of 144 Cases.

PubMed

Bonhomme, Benjamin; Godbert, Yann; Perot, Gaelle; Al Ghuzlan, Abir; Bardet, Stéphane; Belleannée, Geneviève; Crinière, Lise; Do Cao, Christine; Fouilloux, Geneviève; Guyetant, Serge; Kelly, Antony; Leboulleux, Sophie; Buffet, Camille; Leteurtre, Emmanuelle; Michels, Jean-Jacques; Tissier, Frédérique; Toubert, Marie-Elisabeth; Wassef, Michel; Pinard, Clémence; Hostein, Isabelle; Soubeyran, Isabelle

2017-05-01

Anaplastic thyroid carcinoma (ATC) is a rare tumor, with poorly defined oncogenic molecular mechanisms and limited therapeutic options contributing to its poor prognosis. The aims of this retrospective study were to determine the frequency of anaplastic lymphoma kinase (ALK) translocations and to identify the mutational profile of ATC including TERT promoter mutations. One hundred and forty-four ATC cases were collected from 10 centers that are a part of the national French network for management of refractory thyroid tumors. Fluorescence in situ hybridization analysis for ALK rearrangement was performed on tissue microarrays. A panel of 50 genes using next-generation sequencing and TERT promoter mutations using Sanger sequencing were also screened. Fluorescence in situ hybridization was interpretable for 90 (62.5%) cases. One (1.1%) case was positive for an ALK rearrangement with a borderline threshold (15% positive cells). Next-generation sequencing results were interpretable for 94 (65.3%) cases, and Sanger sequencing (TERT) for 98 (68.1%) cases. A total of 210 mutations (intronic and exonic) were identified. TP53 alterations were the most frequent (54.4%). Forty-three percent harbored a mutation in the (H-K-N)RAS genes, 13.8% a mutation in the BRAF gene (essentially p.V600E), 17% a PI3K-AKT pathway mutation, 6.4% both RAS and PI3K pathway mutations, and 4.3% both TP53 and PTEN mutations. Nearly 10% of the cases showed no mutations of the RAS, PI3K-AKT pathways, or TP53, with mutations of ALK, ATM, APC, CDKN2A, ERBB2, RET, or SMAD4, including mutations not yet described in thyroid tumors. Genes encoding potentially druggable targets included: mutations in the ATM gene in four (4.3%) cases, in ERBB2 in one (1.1%) case, in MET in one (1.1%) case, and in ALK in one (1.1%) case. A TERT promoter alteration was found in 53 (54.0%) cases, including 43 C228T and 10 C250T mutations. Three out of our cases did not harbor mutations in the panel of genes with therapeutic interest. This study confirms that ALK rearrangements in ATC are rare and that the mutational landscape of ATC is heterogeneous, with many genes implicated in the follicular epithelial cell dedifferentiation process. This may explain the limited effectiveness of targeted therapeutic options tested so far.

Conserved Regulation of p53 Network Dosage by MicroRNA–125b Occurs through Evolving miRNA–Target Gene Pairs

PubMed Central

Khaw, Swea Ling; Chin, Lingzi; Teh, Cathleen; Tay, Junliang; O'Day, Elizabeth; Korzh, Vladimir; Yang, Henry; Lal, Ashish; Lieberman, Judy; Lodish, Harvey F.; Lim, Bing

2011-01-01

MicroRNAs regulate networks of genes to orchestrate cellular functions. MiR-125b, the vertebrate homologue of the Caenorhabditis elegans microRNA lin-4, has been implicated in the regulation of neural and hematopoietic stem cell homeostasis, analogous to how lin-4 regulates stem cells in C. elegans. Depending on the cell context, miR-125b has been proposed to regulate both apoptosis and proliferation. Because the p53 network is a central regulator of both apoptosis and proliferation, the dual roles of miR-125b raise the question of what genes in the p53 network might be regulated by miR-125b. By using a gain- and loss-of-function screen for miR-125b targets in humans, mice, and zebrafish and by validating these targets with the luciferase assay and a novel miRNA pull-down assay, we demonstrate that miR-125b directly represses 20 novel targets in the p53 network. These targets include both apoptosis regulators like Bak1, Igfbp3, Itch, Puma, Prkra, Tp53inp1, Tp53, Zac1, and also cell-cycle regulators like cyclin C, Cdc25c, Cdkn2c, Edn1, Ppp1ca, Sel1l, in the p53 network. We found that, although each miRNA–target pair was seldom conserved, miR-125b regulation of the p53 pathway is conserved at the network level. Our results lead us to propose that miR-125b buffers and fine-tunes p53 network activity by regulating the dose of both proliferative and apoptotic regulators, with implications for tissue stem cell homeostasis and oncogenesis. PMID:21935352

p53 regulates mesenchymal stem cell-mediated tumor suppression in a tumor microenvironment through immune modulation.

PubMed

Huang, Y; Yu, P; Li, W; Ren, G; Roberts, A I; Cao, W; Zhang, X; Su, J; Chen, X; Chen, Q; Shou, P; Xu, C; Du, L; Lin, L; Xie, N; Zhang, L; Wang, Y; Shi, Y

2014-07-17

p53 is one of the most studied genes in cancer biology, and mutations in this gene may be predictive for the development of many types of cancer in humans and in animals. However, whether p53 mutations in non-tumor stromal cells can affect tumor development has received very little attention. In this study, we show that B16F0 melanoma cells form much larger tumors in p53-deficient mice than in wild-type mice, indicating a potential role of p53 deficiency in non-tumor cells of the microenvironment. As mesenchymal stem cells (MSCs) are attracted to tumors and form a major component of the tumor microenvironment, we examined the potential role of p53 status in MSCs in tumor development. We found that larger tumors resulted when B16F0 melanoma cells were co-injected with bone marrow MSCs derived from p53-deficient mice rather than MSCs from wild-type mice. Interestingly, this tumor-promoting effect by p53-deficient MSCs was not observed in non-obese diabetic/severe combined immunodeficiency mice, indicating the immune response has a critical role. Indeed, in the presence of inflammatory cytokines, p53-deficient MSCs expressed more inducible nitric oxide synthase (iNOS) and exhibited greater immunosuppressive capacity. Importantly, tumor promotion by p53-deficient MSCs was abolished by administration of S-methylisothiourea, an iNOS inhibitor. Therefore, our data demonstrate that p53 status in tumor stromal cells has a key role in tumor development by modulating immune responses.

p21WAF1 immunohistochemical expression in breast carcinoma: correlations with clinicopathological data, oestrogen receptor status, MIB1 expression, p53 gene and protein alterations and relapse-free survival.

PubMed Central

Barbareschi, M.; Caffo, O.; Doglioni, C.; Fina, P.; Marchetti, A.; Buttitta, F.; Leek, R.; Morelli, L.; Leonardi, E.; Bevilacqua, G.; Dalla Palma, P.; Harris, A. L.

1996-01-01

p21 protein (p21) inhibitor of cyclin-dependent kinases is a critical downstream effector in the p53-specific pathway of growth control. p21 can also be induced by p53-independent pathways in relation to terminal differentiation. We investigated p21 immunoreactivity in normal breast and in 91 breast carcinomas [three in situ ductal carcinomas (DCIS) with microinfiltration and 88 infiltrating carcinomas, 17 of which with an associated DCIS; 57 node negative and 34 node positive] with long-term follow-up (median = 58 months). Seven additional breast carcinomas with known p53 gene mutations were investigated. In normal breast p21 expression was seen in the nuclei of rare luminal cells of acinar structures, and in occasional myoepithelial cells. Poorly differentiated DCIS showed high p21 expression, whereas well-differentiated DCIS tumours showed few p21-reactive cells. p21 was seen in 82 (90%) infiltrating tumours; staining was heterogeneous; the percentage of reactive nuclei ranged from 1% to 35%. High p21 expression (more than 10% of reactive cells) was seen in 24 (26%) cases, and was associated with high tumour grade (P = 0.032); no associations were seen with tumour size, metastases, oestrogen receptor status, MIB1 expression and p53 expression. p21 expression in cases with p53 gene mutations was low in six cases and high in one. High p21 expression was associated with short relapse-free survival (P = 0.003). Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:8688323

Possible relevance of tumor-related genes mutation to malignant transformation of endometriosis.

PubMed

Ma, X; Hui, Y; Lin, L; Wu, Y; Zhang, X; Qin, X

2016-01-01

Despite studies have suggested that endometriosis has malignant potential, the molecular mechanism underlying the malignant transformation of endometriosis is poorly understood so far. Endometriosis-associated ovarian cancer (EAOC) or ovarian cancer arising from endometriosis (OCEM) may provide an ideal model for genetic studies. To investigate the genetic alterations during transformation of ovarian endometriosis into cancer, the authors analysed mutations of tumour-related genes (PTEN and p53) in EAOC cases (n=23, group 1), including 19 cases which were detected co-existence of endometriosis and cancer and four cases which fulfilled the histological criteria in malignant transformation of endometriosis (OCEMs), and in atypical hyperplasia ovarian endometriosis (aEMs) (n = 10, group 2), as well as in solitary ovarian endometriosis (EMs) (n = 20, group 3), simultaneously, to study the correlation of the two genes in the development and progression of the ovarian endometriosis malignancy. Each paraffin block was sliced into serial ten-µm-thick sections. Extracted DNA was amplified by nested PCR. Mutations of PTEN and p53 were examined by bidirectional DNA sequencing. It was acknowledged by experiments that the PTEN and p53 mutation frequency in EAOCs were significantly higher than that in aEMs and EMs. There was significant difference to compare EAOCs with EMs (p < 0.01, p < 0.05), and converse to compare with aEMs (p > 0.05), respectively. No definite involvement between the frequency of PTEN and p53 mutations in EAOCs and age difference, histological type, clinical stage, pathological grade, and whether accompanied by metastasis (p > 0.05); however, a decreasing trend of PTEN mutation with the increased age, decreased clinical stage and pathological grade, and when accompanied by metastasis was detected. Adversely, an increasing trend of p53 mutation was represented. In EAOCs group, the authors detected eight PTEN and four p53 mutation events, respectively. Moreover, one case occurred PTEN and p53 mutation simultaneously. With 23 EAOCs, two cases which fulfilled the histological criteria in malignant transformation of endometriosis, which may be a specific entity distinct from non-endometriosis-associated ovarian cancer, the authors named them the OCEMs, occurred PTEN or p53 mutation, respectively. The present study suggested that the mutation and functional incapacitation of certain tumor-related genes may be involved in malignant transformation of endometriosis. PTEN mutation is the pristine event, but p53 mutation is the late.

Phosphorylated Hsp27 activates ATM-dependent p53 signaling and mediates the resistance of MCF-7 cells to doxorubicin-induced apoptosis.

PubMed

Xu, Yimiao; Diao, Ying; Qi, Shimei; Pan, Xiaolong; Wang, Qi; Xin, Yinqiang; Cao, Xiang; Ruan, Jie; Zhao, Zhihui; Luo, Lan; Liu, Chang; Yin, Zhimin

2013-05-01

DNA damage activates p53 and its downstream target genes, which further leads to apoptosis or survival either by the cell cycle arrest or by DNA repair. In many tumors, the heat shock protein 27 (Hsp27) is expressed at high levels to provide protection against anticancer drugs. However, the roles of Hsp27 in p53-mediated cellular responses to DNA damage are controversial. Here, we investigated the interplay between the phosphorylation status of Hsp27 and p53 in kidney 293A (HEK293A) cells and found that over-expressing phosphorylated Hsp27 mimics (Hsp27-3D) activated p53/p21 in an ATM-dependent manner. In addition, incubation with doxorubicin (Dox), an anticancer drug, induced Hsp27 phosphorylation in human adenocarcinoma cells (MCF-7). In contrast, inhibition of Hsp27 phosphorylation retarded both p53 induction and p21 accumulation, and led to cell apoptosis. Furthermore, phosphorylated Hsp27 increased p53 nuclear importing and its downstream target gene expression such as p21 and MDM2, while de-phosphorylated Hsp27 impeded this procession. Taken together, our data suggest that Hsp27, in its phosphorylated or de-phosphorylated status, plays different roles in regulating p53 pathway and cell survival. Copyright © 2013 Elsevier Inc. All rights reserved.

Differential involvement of the related DNA helicases Pif1p and Rrm3p in mtDNA point mutagenesis and stability.

PubMed

O'Rourke, Thomas W; Doudican, Nicole A; Zhang, Hong; Eaton, Jana S; Doetsch, Paul W; Shadel, Gerald S

2005-07-18

With the exception of base excision repair, conserved pathways and mechanisms that maintain mitochondrial genome stability have remained largely undelineated. In the budding yeast, Saccharomyces cerevisiae, Pif1p is a unique DNA helicase that is localized both to the nucleus and mitochondria, where it is involved in maintaining DNA integrity. We previously elucidated a role for Pif1p in oxidative mtDNA damage resistance that appears to be distinct from its postulated function in mtDNA recombination. Strains lacking Pif1p (pif1Delta) exhibit an increased rate of formation of petite mutants (an indicator of mtDNA instability) and elevated mtDNA point mutagenesis. Here we show that deletion of the RRM3 gene, which encodes a DNA helicase closely related to Pif1p, significantly rescues the petite-induction phenotype of a pif1Delta strain. However, suppression of this phenotype was not accompanied by a corresponding decrease in mtDNA point mutagenesis. Instead, deletion of RRM3 alone resulted in an increase in mtDNA point mutagenesis that was synergistic with that caused by a pif1Delta mutation. In addition, we found that over-expression of RNR1, encoding a large subunit of ribonucleotide reductase (RNR), rescued the petite-induction phenotype of a pif1Delta mutation to a similar extent as deletion of RRM3. This, coupled to our finding that the Rad53p protein kinase is phosphorylated in the rrm3Delta pif1Delta double-mutant strain, leads us to conclude that one mechanism whereby deletion of RRM3 influences mtDNA stability is by modulating mitochondrial deoxynucleoside triphosphate pools. We propose that this is accomplished by signaling through the conserved Mec1/Rad53, S-phase checkpoint pathway to induce the expression and activity of RNR. Altogether, our results define a novel role for Rrm3p in mitochondrial function and indicate that Pif1p and Rrm3p influence a common process (or processes) involved in mtDNA replication, repair, or stability.

Methyl-Cytosine-Driven Structural Changes Enhance Adduction Kinetics of an Exon 7 fragment of the p53 Gene

NASA Astrophysics Data System (ADS)

Malla, Spundana; Kadimisetty, Karteek; Fu, You-Jun; Choudhary, Dharamainder; Schenkman, John B.; Rusling, James F.

2017-01-01

Methylation of cytosine (C) at C-phosphate-guanine (CpG) sites enhances reactivity of DNA towards electrophiles. Mutations at CpG sites on the p53 tumor suppressor gene that can result from these adductions are in turn correlated with specific cancers. Here we describe the first restriction-enzyme-assisted LC-MS/MS sequencing study of the influence of methyl cytosines (MeC) on kinetics of p53 gene adduction by model metabolite benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), using methodology applicable to correlate gene damage sites for drug and pollutant metabolites with mutation sites. This method allows direct kinetic measurements by LC-MS/MS sequencing for oligonucleotides longer than 20 base pairs (bp). We used MeC and non-MeC (C) versions of a 32 bp exon 7 fragment of the p53 gene. Methylation of 19 cytosines increased the rate constant 3-fold for adduction on G at the major reactive CpG in codon 248 vs. the non-MeC fragment. Rate constants for non-CpG codons 244 and 243 were not influenced significantly by MeC. Conformational and hydrophobicity changes in the MeC-p53 exon 7 fragment revealed by CD spectra and molecular modeling increase the BPDE binding constant to G in codon 248 consistent with a pathway in which preceding reactant binding greatly facilitates the rate of covalent SN2 coupling.

Complete Genomic Structure of the Cultivated Rice Endophyte Azospirillum sp. B510

PubMed Central

Kaneko, Takakazu; Minamisawa, Kiwamu; Isawa, Tsuyoshi; Nakatsukasa, Hiroki; Mitsui, Hisayuki; Kawaharada, Yasuyuki; Nakamura, Yasukazu; Watanabe, Akiko; Kawashima, Kumiko; Ono, Akiko; Shimizu, Yoshimi; Takahashi, Chika; Minami, Chiharu; Fujishiro, Tsunakazu; Kohara, Mitsuyo; Katoh, Midori; Nakazaki, Naomi; Nakayama, Shinobu; Yamada, Manabu; Tabata, Satoshi; Sato, Shusei

2010-01-01

We determined the nucleotide sequence of the entire genome of a diazotrophic endophyte, Azospirillum sp. B510. Strain B510 is an endophytic bacterium isolated from stems of rice plants (Oryza sativa cv. Nipponbare). The genome of B510 consisted of a single chromosome (3 311 395 bp) and six plasmids, designated as pAB510a (1 455 109 bp), pAB510b (723 779 bp), pAB510c (681 723 bp), pAB510d (628 837 bp), pAB510e (537 299 bp), and pAB510f (261 596 bp). The chromosome bears 2893 potential protein-encoding genes, two sets of rRNA gene clusters (rrns), and 45 tRNA genes representing 37 tRNA species. The genomes of the six plasmids contained a total of 3416 protein-encoding genes, seven sets of rrns, and 34 tRNAs representing 19 tRNA species. Eight genes for plasmid-specific tRNA species are located on either pAB510a or pAB510d. Two out of eight genomic islands are inserted in the plasmids, pAB510b and pAB510e, and one of the islands is inserted into trnfM-CAU in the rrn located on pAB510e. Genes other than the nif gene cluster that are involved in N2 fixation and are homologues of Bradyrhizobium japonicum USDA110 include fixABCX, fixNOQP, fixHIS, fixG, and fixLJK. Three putative plant hormone-related genes encoding tryptophan 2-monooxytenase (iaaM) and indole-3-acetaldehyde hydrolase (iaaH), which are involved in IAA biosynthesis, and ACC deaminase (acdS), which reduces ethylene levels, were identified. Multiple gene-clusters for tripartite ATP-independent periplasmic-transport systems and a diverse set of malic enzymes were identified, suggesting that B510 utilizes C4-dicarboxylate during its symbiotic relationship with the host plant. PMID:20047946

TP53-based interaction analysis identifies cis-eQTL variants for TP53BP2, FBXO28, and FAM53A that associate with survival and treatment outcome in breast cancer

PubMed Central

Fagerholm, Rainer; Khan, Sofia; Schmidt, Marjanka K.; GarcClosas, Montserrat; Heikkilä, Päivi; Saarela, Jani; Beesley, Jonathan; Jamshidi, Maral; Aittomäki, Kristiina; Liu, Jianjun; Raza Ali, H.; Andrulis, Irene L.; Beckmann, Matthias W.; Behrens, Sabine; Blows, Fiona M.; Brenner, Hermann; Chang-Claude, Jenny; Couch, Fergus J.; Czene, Kamila; Fasching, Peter A.; Figueroa, Jonine; Floris, Giuseppe; Glendon, Gord; Guo, Qi; Hall, Per; Hallberg, Emily; Hamann, Ute; Holleczek, Bernd; Hooning, Maartje J.; Hopper, John L.; Jager, Agnes; Kabisch, Maria; Investigators, kConFab/AOCS; Keeman, Renske; Kosma, Veli-Matti; Lambrechts, Diether; Lindblom, Annika; Mannermaa, Arto; Margolin, Sara; Provenzano, Elena; Shah, Mitul; Southey, Melissa C.; Dennis, Joe; Lush, Michael; Michailidou, Kyriaki; Wang, Qin; Bolla, Manjeet K.; Dunning, Alison M.; Easton, Douglas F.; Pharoah, Paul D.P .; Chenevix-Trench, Georgia; Blomqvist, Carl; Nevanlinna, Heli

2017-01-01

TP53 overexpression is indicative of somatic TP53 mutations and associates with aggressive tumors and poor prognosis in breast cancer. We utilized a two-stage SNP association study to detect variants associated with breast cancer survival in a TP53-dependent manner. Initially, a genome-wide study (n = 575 cases) was conducted to discover candidate SNPs for genotyping and validation in the Breast Cancer Association Consortium (BCAC). The SNPs were then tested for interaction with tumor TP53 status (n = 4,610) and anthracycline treatment (n = 17,828). For SNPs interacting with anthracycline treatment, siRNA knockdown experiments were carried out to validate candidate genes. In the test for interaction between SNP genotype and TP53 status, we identified one locus, represented by rs10916264 (p(interaction) = 3.44 05E010-5; FDR-adjusted p = 0.0011) in estrogen receptor (ER) positive cases. The rs10916264 AA genotype associated with worse survival among cases with ER-positive, TP53-positive tumors (hazard ratio [HR] 2.36, 95% confidence interval [C.I] 1.45 - 3.82). This is a cis-eQTL locus for FBXO28 and TP53BP2; expression levels of these genes were associated with patient survival specifically in ER-positive, TP53-mutated tumors. Additionally, the SNP rs798755 was associated with survival in interaction with anthracycline treatment (p(interaction) = 9.57 05E010-5, FDR-adjusted p = 0.0130). RNAi-based depletion of a predicted regulatory target gene, FAM53A, indicated that this gene can modulate doxorubicin sensitivity in breast cancer cell lines. If confirmed in independent data sets, these results may be of clinical relevance in the development of prognostic and predictive marker panels for breast cancer. PMID:28179588

Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish

PubMed Central

Kim, Seok-Hyung; Kowalski, Marie L.; Carson, Robert P.; Bridges, L. Richard; Ess, Kevin C.

2013-01-01

SUMMARY Tuberous sclerosis complex (TSC) is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1) kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors. PMID:23580196

Using yeast to determine the functional consequences of mutations in the human p53 tumor suppressor gene: An introductory course-based undergraduate research experience in molecular and cell biology.

PubMed

Hekmat-Scafe, Daria S; Brownell, Sara E; Seawell, Patricia Chandler; Malladi, Shyamala; Imam, Jamie F Conklin; Singla, Veena; Bradon, Nicole; Cyert, Martha S; Stearns, Tim

2017-03-04

The opportunity to engage in scientific research is an important, but often neglected, component of undergraduate training in biology. We describe the curriculum for an innovative, course-based undergraduate research experience (CURE) appropriate for a large, introductory cell and molecular biology laboratory class that leverages students' high level of interest in cancer. The course is highly collaborative and emphasizes the analysis and interpretation of original scientific data. During the course, students work in teams to characterize a collection of mutations in the human p53 tumor suppressor gene via expression and analysis in yeast. Initially, student pairs use both qualitative and quantitative assays to assess the ability of their p53 mutant to activate expression of reporter genes, and they localize their mutation within the p53 structure. Through facilitated discussion, students suggest possible molecular explanations for the transactivation defects displayed by their p53 mutants and propose experiments to test these hypotheses that they execute during the second part of the course. They use a western blot to determine whether mutant p53 levels are reduced, a DNA-binding assay to test whether recognition of any of three p53 target sequences is compromised, and fluorescence microscopy to assay nuclear localization. Students studying the same p53 mutant periodically convene to discuss and interpret their combined data. The course culminates in a poster session during which students present their findings to peers, instructors, and the greater biosciences community. Based on our experience, we provide recommendations for the development of similar large introductory lab courses. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(2):161-178, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

Using yeast to determine the functional consequences of mutations in the human p53 tumor suppressor gene: An introductory course‐based undergraduate research experience in molecular and cell biology

PubMed Central

Brownell, Sara E.; Seawell, Patricia Chandler; Malladi, Shyamala; Imam, Jamie F. Conklin; Singla, Veena; Bradon, Nicole; Cyert, Martha S.; Stearns, Tim

2016-01-01

Abstract The opportunity to engage in scientific research is an important, but often neglected, component of undergraduate training in biology. We describe the curriculum for an innovative, course‐based undergraduate research experience (CURE) appropriate for a large, introductory cell and molecular biology laboratory class that leverages students′ high level of interest in cancer. The course is highly collaborative and emphasizes the analysis and interpretation of original scientific data. During the course, students work in teams to characterize a collection of mutations in the human p53 tumor suppressor gene via expression and analysis in yeast. Initially, student pairs use both qualitative and quantitative assays to assess the ability of their p53 mutant to activate expression of reporter genes, and they localize their mutation within the p53 structure. Through facilitated discussion, students suggest possible molecular explanations for the transactivation defects displayed by their p53 mutants and propose experiments to test these hypotheses that they execute during the second part of the course. They use a western blot to determine whether mutant p53 levels are reduced, a DNA‐binding assay to test whether recognition of any of three p53 target sequences is compromised, and fluorescence microscopy to assay nuclear localization. Students studying the same p53 mutant periodically convene to discuss and interpret their combined data. The course culminates in a poster session during which students present their findings to peers, instructors, and the greater biosciences community. Based on our experience, we provide recommendations for the development of similar large introductory lab courses. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(2):161–178, 2017. PMID:27873457

Antiproliferative and Apoptotic Effect of Dendrosomal Curcumin Nanoformulation in P53 Mutant and Wide-Type Cancer Cell Lines.

PubMed

Montazeri, Maryam; Pilehvar-Soltanahmadi, Younes; Mohaghegh, Mina; Panahi, Alireza; Khodi, Samaneh; Zarghami, Nosratollah; Sadeghizadeh, Majid

2017-01-01

The aim of this paper is to investigate the effect of dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3/SW480 and p53 wild-type MCF7/HCT116 in both RNA and protein levels. Curcumin, derived from Curcumin longa, is recently considered in cancer related researches for its cell growth inhibition properties. p53 is a common tumor-suppressor gene involved in cancers and its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Here, p53 mutant/Wild-type cells were employed to study the toxicity of DNC using MTT assay, Flow cytometry and Annexin-V, Real-time PCR and Western blot were used to analyze p53, BAX, Bcl-2, p21 and Noxa changes after treatment. During the time, DNC increased the SubG1 cells and decreased G1, S and G2/M cells, early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR assay showed an increased mRNA of BAX, Noxa and p21 during the time with decreased Bcl-2. The expression of p53 mutant decreased in SKBR3/SW480, and the expression of p53 wild-type increased in MCF7/HCT116. Consequently, p53 plays an important role in mediating the survival by DNC, which can prevent tumor cell growth by modulating the expression of genes involved in apoptosis and proliferation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Ablation of XP-V gene causes adipose tissue senescence and metabolic abnormalities

PubMed Central

Chen, Yih-Wen; Harris, Robert A.; Hatahet, Zafer; Chou, Kai-ming

2015-01-01

Obesity and the metabolic syndrome have evolved to be major health issues throughout the world. Whether loss of genome integrity contributes to this epidemic is an open question. DNA polymerase η (pol η), encoded by the xeroderma pigmentosum (XP-V) gene, plays an essential role in preventing cutaneous cancer caused by UV radiation-induced DNA damage. Herein, we demonstrate that pol η deficiency in mice (pol η−/−) causes obesity with visceral fat accumulation, hepatic steatosis, hyperleptinemia, hyperinsulinemia, and glucose intolerance. In comparison to WT mice, adipose tissue from pol η−/− mice exhibits increased DNA damage and a greater DNA damage response, indicated by up-regulation and/or phosphorylation of ataxia telangiectasia mutated (ATM), phosphorylated H2AX (γH2AX), and poly[ADP-ribose] polymerase 1 (PARP-1). Concomitantly, increased cellular senescence in the adipose tissue from pol η−/− mice was observed and measured by up-regulation of senescence markers, including p53, p16Ink4a, p21, senescence-associated (SA) β-gal activity, and SA secretion of proinflammatory cytokines interleukin 6 (IL-6) and tumor necrosis factor α (TNF-α) as early as 4 wk of age. Treatment of pol η−/− mice with a p53 inhibitor, pifithrin-α, reduced adipocyte senescence and attenuated the metabolic abnormalities. Furthermore, elevation of adipocyte DNA damage with a high-fat diet or sodium arsenite exacerbated adipocyte senescence and metabolic abnormalities in pol η−/− mice. In contrast, reduction of adipose DNA damage with N-acetylcysteine or metformin ameliorated cellular senescence and metabolic abnormalities. These studies indicate that elevated DNA damage is a root cause of adipocyte senescence, which plays a determining role in the development of obesity and insulin resistance. PMID:26240351

Clonal Ordering of 17p and 5q Allelic Losses in Barrett Dysplasia and Adenocarcinoma

NASA Astrophysics Data System (ADS)

Blount, Patricia L.; Meltzer, Stephen J.; Yin, Jing; Huang, Ying; Krasna, Mark J.; Reid, Brian J.

1993-04-01

Both 17p and 5q allelic losses appear to be involved in the pathogenesis or progression of many human solid tumors. In colon carcinogenesis, there is strong evidence that the targets of the 17p and 5q allelic losses are TP53, the gene encoding p53, and APC, respectively. It is widely accepted that 5q allelic losses precede 17p allelic losses in the progression to colonic carcinoma. The data, however, supporting this proposed order are largely based on the prevalence of 17p and 5q allelic losses in adenomas and unrelated adenocarcinomas from different patients. We investigated the order in which 17p and 5q allelic losses developed during neoplastic progression in Barrett esophagus by evaluating multiple aneuploid cell populations from the same patient. Using DNA content flow cytometric cell sorting and polymerase chain reaction, 38 aneuploid cell populations from 14 patients with Barrett esophagus who had high grade dysplasia, cancer or both were evaluated for 17p and 5q allelic losses. 17p allelic losses preceded 5q allelic losses in 7 patients, both 17p and 5q allelic losses were present in all aneuploid populations of 4 patients, and only 17p (without 5q) allelic losses were present in the aneuploid populations of 3 patients. In no patient did we find that a 5q allelic loss preceded a 17p allelic loss. Our data suggest that 17p allelic losses typically occur before 5q allelic losses during neoplastic progression in Barrett esophagus.

The critical role of catalase in prooxidant and antioxidant function of p53

PubMed Central

Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

2013-01-01

The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

Assessing the resistance and bioremediation ability of selected bacterial and protozoan species to heavy metals in metal-rich industrial wastewater.

PubMed

Kamika, Ilunga; Momba, Maggy N B

2013-02-06

Heavy-metals exert considerable stress on the environment worldwide. This study assessed the resistance to and bioremediation of heavy-metals by selected protozoan and bacterial species in highly polluted industrial-wastewater. Specific variables (i.e. chemical oxygen demand, pH, dissolved oxygen) and the growth/die-off-rates of test organisms were measured using standard methods. Heavy-metal removals were determined in biomass and supernatant by the Inductively Couple Plasma Optical Emission Spectrometer. A parallel experiment was performed with dead microbial cells to assess the biosorption ability of test isolates. The results revealed that the industrial-wastewater samples were highly polluted with heavy-metal concentrations exceeding by far the maximum limits (in mg/l) of 0.05-Co, 0.2-Ni, 0.1-Mn, 0.1-V, 0.01-Pb, 0.01-Cu, 0.1-Zn and 0.005-Cd, prescribed by the UN-FAO. Industrial-wastewater had no major effects on Pseudomonas putida, Bacillus licheniformis and Peranema sp. (growth rates up to 1.81, 1.45 and 1.43 d-1, respectively) compared to other test isolates. This was also revealed with significant COD increases (p < 0.05) in culture media inoculated with living bacterial isolates (over 100%) compared to protozoan isolates (up to 24% increase). Living Pseudomonas putida demonstrated the highest removal rates of heavy metals (Co-71%, Ni-51%, Mn-45%, V-83%, Pb-96%, Ti-100% and Cu-49%) followed by Bacillus licheniformis (Al-23% and Zn-53%) and Peranema sp. (Cd-42%). None of the dead cells were able to remove more than 25% of the heavy metals. Bacterial isolates contained the genes copC, chrB, cnrA3 and nccA encoding the resistance to Cu, Cr, Co-Ni and Cd-Ni-Co, respectively. Protozoan isolates contained only the genes encoding Cu and Cr resistance (copC and chrB genes). Peranema sp. was the only protozoan isolate which had an additional resistant gene cnrA3 encoding Co-Ni resistance. Significant differences (p < 0.05) observed between dead and living microbial cells for metal-removal and the presence of certain metal-resistant genes indicated that the selected microbial isolates used both passive (biosorptive) and active (bioaccumulation) mechanisms to remove heavy metals from industrial wastewater. This study advocates the use of Peranema sp. as a potential candidate for the bioremediation of heavy-metals in wastewater treatment, in addition to Pseudomonas putida and Bacillus licheniformis.

Characterization of the biosynthetic gene cluster of rebeccamycin from Lechevalieria aerocolonigenes ATCC 39243.

PubMed

Onaka, Hiroyasu; Taniguchi, Shin-ichi; Igarashi, Yasuhiro; Furumai, Tamotsu

2003-01-01

The biosynthetic gene cluster for rebeccamycin, an indolocarbazole antibiotic, from Lechevalieria aerocolonigenes ATCC 39243 has 11 ORFs. To clarify their functions, mutants with rebG, rebD, rebC, rebP, rebM, rebR, rebH, rebT, or orfD2 disrupted were constructed, and the gene products were examined. rebP disruptants produced 11,11'-dichlorochromopyrrolic acid, found to be a biosynthetic intermediate by a bioconversion experiment. Other genes encoded N-glycosyltransferase (rebG), monooxygenase (rebC), methyltransferase (rebM), a transcriptional activator (rebR), and halogenase (rebH). rebT disruptants produced rebeccamycin as much as the wild strain, so rebT was probably not involved in rebeccamycin production. Biosynthetic genes of staurosporine, an another indolocarbazole antibiotic, were cloned from Streptomyces sp. TP-A0274. staO, staD, and staP were similar to rebO, rebD, and rebP, respectively, all of which are responsible for indolocarbazole biosynthesis, But a rebC homolog, encoding a putative enzyme oxidizing the C-7 site of pyrrole rings, was not found in the staurosporine biosynthetic gene cluster. These results suggest that indolocarbazole is constructed by oxidative decarboxylation of chromopyrrolic acid (11,11'-dichlorochromopyrrolic acid in rebeccamycin) generated from two molecules of tryptophan by coupling and that the oxidation state at the C-7 position depends on the additional enzyme(s) encoded by the biosynthetic genes.

The Finding of a Group IIE Phospholipase A2 Gene in a Specified Segment of Protobothrops flavoviridis Genome and Its Possible Evolutionary Relationship to Group IIA Phospholipase A2 Genes

PubMed Central

Yamaguchi, Kazuaki; Chijiwa, Takahito; Ikeda, Naoki; Shibata, Hiroki; Fukumaki, Yasuyuki; Oda-Ueda, Naoko; Hattori, Shosaku; Ohno, Motonori

2014-01-01

The genes encoding group IIE phospholipase A2, abbreviated as IIE PLA2, and its 5' and 3' flanking regions of Crotalinae snakes such as Protobothrops flavoviridis, P. tokarensis, P. elegans, and Ovophis okinavensis, were found and sequenced. The genes consisted of four exons and three introns and coded for 22 or 24 amino acid residues of the signal peptides and 134 amino acid residues of the mature proteins. These IIE PLA2s show high similarity to those from mammals and Colubridae snakes. The high expression level of IIE PLA2s in Crotalinae venom glands suggests that they should work as venomous proteins. The blast analysis indicated that the gene encoding OTUD3, which is ovarian tumor domain-containing protein 3, is located in the 3' downstream of IIE PLA2 gene. Moreover, a group IIA PLA2 gene was found in the 5' upstream of IIE PLA2 gene linked to the OTUD3 gene (OTUD3) in the P. flavoviridis genome. It became evident that the specified arrangement of IIA PLA2 gene, IIE PLA2 gene, and OTUD3 in this order is common in the genomes of humans to snakes. The present finding that the genes encoding various secretory PLA2s form a cluster in the genomes of humans to birds is closely related to the previous finding that six venom PLA2 isozyme genes are densely clustered in the so-called NIS-1 fragment of the P. flavoviridis genome. It is also suggested that venom IIA PLA2 genes may be evolutionarily derived from the IIE PLA2 gene. PMID:25529307

Molecular markers in dysplasia of the larynx: expression of cyclin-dependent kinase inhibitors p21, p27 and p53 tumour suppressor gene in predicting cancer risk.

PubMed

Jeannon, J-P; Soames, J V; Aston, V; Stafford, F W; Wilson, J A

2004-12-01

Premalignant conditions affect the larynx. Dysplasia can progress in severity resulting in cancer depending on many clinical, pathological and molecular factors. The purpose of this study was to examine the expression of the p21 and p27 cyclin-dependent kinase inhibitors and p53 tumour suppressor gene in dysplasia of the larynx. A total of 114 cases of untreated dysplasia were selected from the archives of the University of Newcastle. p21, p27 and p53 immunohistochemistry was performed and the cases followed up. Twenty-eight dysplasias (24%) subsequently developed into cancers. Expression of the molecular factors studied was not associated with cancer progression. p53 expression was associated with smoking (P = 0.005). In contrast, grade of dysplasia was significantly associated with cancer risk (odds ratio 6.7; P = 0.0001). The majority (75%) of cancers were detected within 12 months of dysplasia being diagnosed.

Apoptotic actions of p53 require transcriptional activation of PUMA and do not involve a direct mitochondrial/cytoplasmic site of action in postnatal cortical neurons.

PubMed

Uo, Takuma; Kinoshita, Yoshito; Morrison, Richard S

2007-11-07

Recent studies in non-neuronal cells have shown that the tumor suppressor p53 can promote cell death through a transcription-independent mechanism involving its direct action with a subset of Bcl-2 family member proteins in the cytosol and at the mitochondria. In cultured cortical neurons, however, we could not find evidence supporting a significant contribution of the cytosolic/mitochondrial p53 pathway, and available evidence instead corroborated the requirement for the transcriptional activity of p53. When directly targeted to the cytosol/mitochondria, wild-type p53 lost its apoptosis-inducing activity in neurons but not in non-neuronal cells. The N-terminal p53 fragment (transactivation and proline-rich domains), which induces apoptosis in non-neuronal cells via the cytosolic/mitochondrial pathway, displayed no apoptogenic activity in neurons. In neuronal apoptosis induced by camptothecin or an MDM2 (murine double minute 2) inhibitor, nutlin-3, endogenous p53 protein did not accumulate in the cytosol/mitochondria, and transcriptional inhibition after p53 induction effectively blocked cell death. In addition, overexpression of a dominant-negative form of p53 (R273H) completely suppressed induction of proapoptotic p53 target genes and cell death. PUMA (p53-upregulated modulator of apoptosis) was one such gene induced by camptothecin, and its overexpression was sufficient to induce Bax (Bcl-2-associated X protein)-dependent neuronal death, whereas Noxa was not apoptogenic. These results collectively demonstrate that, in contrast to non-neuronal cells, the apoptotic activity of p53 in postnatal cortical neurons does not rely on its direct action at the cytosol/mitochondria but is exclusively mediated through its transcription-dependent functions. The uniqueness of p53-mediated apoptotic signaling in postnatal cortical neurons was further illustrated by the dispensable function of the proline-rich domain of p53.

Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk.

PubMed

Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B

2013-02-01

Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (p<0.05), reinforcing the importance of S. aureus as a potential foodborne agent. However, the potential risk posed by CoNS in goat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates.

Far-red light-mediated programmable anti-cancer gene delivery in cooperation with photodynamic therapy.

PubMed

Wang, Jinhui; He, Hua; Xu, Xin; Wang, Xiao; Chen, Yongbing; Yin, Lichen

2018-07-01

Effective anti-cancer therapy is hurdled by the complicated extracellular and intracellular barriers, and thus a smart gene vector that can enable programmable gene delivery is highly demanded. Photo-manipulation of gene delivery processes features spatial and temporal precision, while majority of current strategies utilizes short-wavelength UV/visible light with poor tissue penetration or high-power-density near-infrared (NIR) light that would cause undesired heat damage. Herein, an ROS-degradable polycation was designed and co-delivered with a photosensitizer (PS), thus realizing photo-programmable gene delivery using far-red light (661 nm) at low optical power density (down to 5 mW cm -2 ). Thioketal-crosslinked polyethylenimine (TK-PEI) was synthesized to condense p53 gene to form nanocomplexes (NCs), and hyaluronic acid (HA) modified with pheophytin a (Pha) was coated onto NCs to enhance their colloidal stability and enable cancer cell targeting. Short-time (8-min) light irradiation produced non-lethal amount of ROS to disrupt the endosomal membranes and facilitate p53 gene release via degradation of TK-PEI, which collectively enhanced p53 expression levels toward anti-cancer gene therapy. Long-time (30-min) light irradiation at the post-transfection state generated lethal amount of ROS, which cooperatively killed cancer cells to strengthen p53 gene therapy. To the best of our knowledge, this study represents the first example of an "one stone, three birds" approach to realize cooperative anti-cancer gene therapy using low-power-density, long-wavelength visible light as a single stimulus. Copyright © 2018 Elsevier Ltd. All rights reserved.

p53 and metabolism: from mechanism to therapeutics

PubMed Central

Simabuco, Fernando M.; Morale, Mirian G.; Pavan, Isadora C.B.; Morelli, Ana P.; Silva, Fernando R.; Tamura, Rodrigo E.

2018-01-01

The tumor cell changes itself and its microenvironment to adapt to different situations, including action of drugs and other agents targeting tumor control. Therefore, metabolism plays an important role in the activation of survival mechanisms to keep the cell proliferative potential. The Warburg effect directs the cellular metabolism towards an aerobic glycolytic pathway, despite the fact that it generates less adenosine triphosphate than oxidative phosphorylation; because it creates the building blocks necessary for cell proliferation. The transcription factor p53 is the master tumor suppressor; it binds to more than 4,000 sites in the genome and regulates the expression of more than 500 genes. Among these genes are important regulators of metabolism, affecting glucose, lipids and amino acids metabolism, oxidative phosphorylation, reactive oxygen species (ROS) generation and growth factors signaling. Wild-type and mutant p53 may have opposing effects in the expression of these metabolic genes. Therefore, depending on the p53 status of the cell, drugs that target metabolism may have different outcomes and metabolism may modulate drug resistance. Conversely, induction of p53 expression may regulate differently the tumor cell metabolism, inducing senescence, autophagy and apoptosis, which are dependent on the regulation of the PI3K/AKT/mTOR pathway and/or ROS induction. The interplay between p53 and metabolism is essential in the decision of cell fate and for cancer therapeutics. PMID:29805774

Neoplasia of the ampulla of Vater. Ki-ras and p53 mutations.

PubMed Central

Scarpa, A.; Capelli, P.; Zamboni, G.; Oda, T.; Mukai, K.; Bonetti, F.; Martignoni, G.; Iacono, C.; Serio, G.; Hirohashi, S.

1993-01-01

Eleven tumors of the ampulla of Vater (5 stage IV and 2 stage II adenocarcinomas, 1 stage II papillary carcinoma, 1 neuroendocrine carcinoma, and 2 adenomas, one with foci of carcinoma) were examined for Ki-ras and p53 gene mutations by single-strand conformation polymorphism analysis and direct sequencing of polymerase chain reaction-amplified DNA fragments. Ki-ras mutations were found in one adenocarcinoma and in the adenoma with foci of carcinoma, both involving mainly the intraduodenal bile duct component of the ampulla. Seven cases showed p53 gene mutations: four advanced-stage adenocarcinomas, the papillary carcinoma, the neuroendocrine carcinoma, and the adenoma with foci of carcinoma. Nuclear accumulation of p53 protein was immunohistochemically detected in the morphologically high-grade areas of the five cancers harboring a p53 gene missense point mutation. The adenomas, the two frame shift-mutated cancers, and the adenomatous and low-grade cancer areas of mutated carcinomas were immunohistochemically negative. Our data suggest that in ampullary neoplasia 1) p53 mutations are common abnormalities associated with the transformation of adenomas and low-grade cancers into morphologically high-grade carcinomas, and 2) Ki-ras mutations are relatively less frequent and might be restricted to tumors originating from the bile duct component of the ampulla. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:8475992

Cloning and expression of prion protein encoding gene of flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

Zhang, Zhiwen; Sun, Xiuqin; Zhang, Jinxing; Zan, Jindong

2008-02-01

The prion protein (PrP) encoding gene of flounder ( Paralichthys olivaceus) was cloned. It was not interrupted by an intron. This gene has two promoters in its 5' upstream, indicating that its transcription may be intensive, and should have an important function. It was expressed in all 14 tissues tested, demonstrating that it is a house-keeping gene. Its expression in digestion and reproduction systems implies that the possible prions of fish may transfer horizontally.

The impact of trisomy 12, retinoblastoma gene and P53 in prognosis of B-cell chronic lymphocytic leukemia.

PubMed

AbdelSalam, M; El Sissy, A; Samra, M A; Ibrahim, S; El Markaby, D; Gadallah, F

2008-06-01

Routine cytogenetic analysis frequently fails to identify an abnormal clone in B-cell lymphocytic leukaemia (B-CLL) due to poor response to mitogen stimulation. Fluorescence in situ hybridization (FISH) suggest that chromosomal abnormalities occur more frequently, most commonly trisomy 12, retinoblastoma gene deletion (Rb1 gene) and P53 gene deletion. 30 patients with B-CLL were enrolled in the trial from two centers in Cairo, Egypt during the period May 2000 to January 2002. Karyotyping and FISH assessment for possible chromosomal abnormalities (trisomy 12, Rb1 gene and P53 gene) were done at initial diagnosis. Results of cytogenetic abnormalities were correlated with clinical picture and survival. The median age was 57.4 years (range 40-75). Karyotyping technique showed that no metaphase could be detected in 30%, metaphase with normal karyotyping was observed in 63% and cytogenetic abnormalities were detected in two cases (one trisomy 12 and one deletion in chromosome 13). FISH examination of interphase and metaphase nuclei revealed cytogenetic abnormalities in 15 cases (50%), trisomy 12 in 9 (30%), Rb1 gene deletion in 5 (17%) and P53 gene deletion in 3. At diagnosis, patients with trisomy 12 were significantly associated with advanced stage and absolute lymphocyte count of >or=30,000/mm(3). Univariate analysis showed that absolute lymphocyte count >or=30,000/mm(3) (p=0.004) and trisomy 12 (p=0.024) were associated with poor progression free survival. Interphase and metaphase FISH studies improve the cytogenetic diagnosis of chromosomal abnormalities in B-CLL. Lymphocytosis and trisomy 12 may be a good indicator of poor prognosis.

Cellular Stress and p53-Associated Apoptosis by Juniperus communis L. Berry Extract Treatment in the Human SH-SY5Y Neuroblastoma Cells.

PubMed

Lantto, Tiina A; Laakso, Into; Dorman, H J Damien; Mauriala, Timo; Hiltunen, Raimo; Kõks, Sulev; Raasmaja, Atso

2016-07-13

Plant phenolics have shown to activate apoptotic cell death in different tumourigenic cell lines. In this study, we evaluated the effects of juniper berry extract (Juniperus communis L.) on p53 protein, gene expression and DNA fragmentation in human neuroblastoma SH-SY5Y cells. In addition, we analyzed the phenolic composition of the extract. We found that juniper berry extract activated cellular relocalization of p53 and DNA fragmentation-dependent cell death. Differentially expressed genes between treated and non-treated cells were evaluated with the cDNA-RDA (representational difference analysis) method at the early time point of apoptotic process when p53 started to be activated and no caspase activity was detected. Twenty one overexpressed genes related to cellular stress, protein synthesis, cell survival and death were detected. Interestingly, they included endoplasmic reticulum (ER) stress inducer and sensor HSPA5 and other ER stress-related genes CALM2 and YKT6 indicating that ER stress response was involved in juniper berry extract mediated cell death. In composition analysis, we identified and quantified low concentrations of fifteen phenolic compounds. The main groups of them were flavones, flavonols, phenolic acids, flavanol and biflavonoid including glycosides of quercetin, apigenin, isoscutellarein and hypolaetin. It is suggested that juniper berry extract induced the p53-associated apoptosis through the potentiation and synergism by several phenolic compounds.

Cloning and sequencing of a gene encoding a glutamate and aspartate carrier of Escherichia coli K-12.

PubMed Central

Wallace, B; Yang, Y J; Hong, J S; Lum, D

1990-01-01

A gene encoding a carrier protein for glutamate and aspartate was cloned into Escherichia coli K-12 strain BK9MDG by using the high-copy-number plasmid pBR322. The gene (designated gltP) is probably identical to a gene recently cloned from E. coli B (Y. Deguchi, I. Yamato, and Y. Anraku, J. Bacteriol. 171:1314-1319). A 1.6-kilobase DNA fragment containing gltP was subcloned into the expression plasmids pT7-5 and pT7-6, and its product was identified by a phage T7 RNA polymerase-T7 promoter coupled system (S. Tabor and C. C. Richardson, Proc. Natl. Acad. Sci. USA 82:1074-1078) as a polypeptide with an apparent mass of 38 kilodaltons. A portion of the gltP polypeptide was associated with the cytoplasmic membrane. The nucleotide sequence of the 1.6-kilobase fragment was determined. It contained an open reading frame capable of encoding a highly hydrophobic polypeptide of 395 amino acids, containing four possible transmembrane segments. Uptake of glutamate and aspartate was increased 5.5- and 4.5-fold, respectively, in strains containing gltP plasmids. Glutamate uptake was insensitive to the concentration of Na+ and was inhibited by L-cysteate and beta-hydroxyaspartate. These results suggest that gltP is a structural gene for a carrier protein of the Na(+)-independent, binding-protein-independent glutamate-aspartate transport system. Images PMID:1971622

Immunohistochemical status of p53, MDM2, bcl2, bax, and ER in invasive ductal breast carcinoma in Tunisian patients.

PubMed

Baccouche, Sami; Daoud, Jamel; Frikha, Mounir; Mokdad-Gargouri, Raja; Gargouri, Ali; Jlidi, Rachid

2003-12-01

TP53 gene alterations have been associated with sporadic breast cancer. To assess the role of p53 in invasive ductal carcinoma (IDC) of the breast among Tunisian patients, p53 protein status was studied by immuno-histochemical analysis. The p53 protein was expressed in 41 of 70 (58%) tumors. Study of the status of its target gene expression showed that MDM2 was overexpressed in 43 tumors (61%), bcl2 in 29 (41%), and bax in only 9 (12%). Estrogen receptor (ER) was detected in 38 tumor tissues (54%). The accumulated p53 was significantly associated with MDM2-positive, bcl2-negative, and ER-negative tumors (P = 0.024, P = 0.000027, and P = 0.000008, respectively), whereas with bax the correlaton was not significant. Bcl2 immunostaining displayed a positive correlation with ER (P = 0.001). A significantly higher fraction of p53-positive cells was observed in ER-negative SBRII-SBRIII tumors than in ER-positive SBRI-SBRII tumors (P = 0.000066). bcl2-positive tumors were significantly correlated with ER-positive/SBRI-SBRII tumors (P = 0.007), but negatively correlated with p53/bax (P = 0000004). MDM2 immunostaining displayed the same phenotype as p53 in the correlation with bcl2 and ER (P = 0.003), strengthened by significant associations between MDM2-positive/p53-positive and bcl2-negative or ER-negative, respectively (P = 0.00005 and P = 0.000001, respectively). MDM2-positive cells were significantly correlated with the p53-positive/bax-negative phenotype (P = 0.04). These results suggest that p53 accumulated in these tumor tissues is associated with bad prognostic markers (ER-negative, SBRIII) of IDC. MDM2 overexpression might be responsible for the accumulated p53 value in IDC. Regulation of the apoptotic process is involved in IDC; bcl2 is associated with a good prognostic marker (ER-positive and SBRI-II), whereas the regulation of bax is complex and does not necessarily correlate with the overexpression of p53.

Gene 2 of the sigma rhabdovirus genome encodes the P protein, and gene 3 encodes a protein related to the reverse transcriptase of retroelements.

PubMed

Landès-Devauchelle, C; Bras, F; Dezélée, S; Teninges, D

1995-11-10

The nucleotide sequence of the genes 2 and 3 of the Drosophila rhabdovirus sigma was determined from cDNAs to viral genome and poly(A)+ mRNAs. Gene 2 comprises 1032 nucleotides and contains a long ORF encoding a molecular weight 35,208 polypeptide present in infected cells and in virions which migrates in SDS-PAGE as a doublet of M(r) about 60 kDa. The distribution of acidic charges as well as the electrophoretic properties of the protein are characteristic of the rhabdovirus P proteins. Gene 3 comprises 923 nucleotides and contains a long ORF capable of coding a polypeptide of 298 amino acids of MW 33,790. The putative protein (PP3) is similar in size to a minor component of the virions. Computer analysis shows that the sequence of PP3 contains three motifs related to the conserved motifs of reverse transcriptases.

The 2p21 deletion syndrome: characterization of the transcription content.

PubMed

Parvari, Ruti; Gonen, Yael; Alshafee, Ismael; Buriakovsky, Sophia; Regev, Kfir; Hershkovitz, Eli

2005-08-01

The vast majority of small-deletion syndromes are caused by haploinsufficiency of one or several genes and are transmitted as dominant traits. We have previously identified a homozygous deletion of 179,311 bp on chromosome 2p21 as the cause of a unique syndrome, inherited in a recessive mode, consisting of cystinuria, neonatal seizures, hypotonia, severe somatic and developmental delay, facial dysmorphism, and reduced activity of all the respiratory chain enzymatic complexes that are encoded in the mitochondria. We now present the transcription content of this region: Multiple splicing variants of the genes protein phosphatase 1B (formerly 2C) magnesium-dependent, beta isoform (PPM1B), SLC3A1, and KIAA0436 (approved gene symbol PREPL) were identified and their patterns of expression analyzed. The spliced variants are predicted to have additional functions compared to the known variants and their patterns of expression fit the tissues affected by the syndrome. The first exon of an additional gene (C2orf34) is encoded in the deleted region and the gene is not expressed in the patients. In addition several transcripts with very short open reading frames are also encoded in the deletion. The identification of all transcripts encoded in the region deleted in the patients is the first step in the study of the genotype-phenotype correlation of the 2p21 patients.

The complete mitochondrial genome of Glaucidium brodiei (Strigiformes: Strigidae).

PubMed

Sun, Xiaonan; Zhou, Wenliang; Sun, Zhonglou; Qian, Lifu; Zhang, Yanan; Pan, Tao; Zhang, Baowei

2016-07-01

In this paper, the complete mitochondrial genome of Glaucidium brodiei is sequenced and reported for the first time. The mitochondrial genome is a circular molecule of 17,318 bp in length, consisting of 13 protein-coding genes (PCGs), 22 transfer RNA genes, 2 ribosomal RNA genes and a control region. Overall base composition of the complete mitochondrial DNA is A (29.9%), G (14.1%), C (32.1%) and T (23.9%), the percentage of A and T (53.8%) is slightly higher than G and C (46.2%). All the genes in G. brodiei are distributed on the H-strand, except for the ND6 subunit gene and nine tRNA genes, which are encoded on the L-strand.

Multiple primary tumors of the upper aerodigestive tract: is there a role for constitutional mutations in the p53 gene?

PubMed

Gallo, O; Sardi, I; Pepe, G; Franchi, A; Attanasio, M; Giusti, B; Bocciolini, C; Abbate, R

1999-07-19

Head-and-neck cancer (HNC) patients have a high risk of developing second primary tumors of the upper aerodigestive tract, the main cause of death. Although the roles of tobacco and diet in multiple head-and-neck carcinogenesis have been thoroughly investigated, little is known about individual genetic susceptibility factors involved in this process. Genomic instability, reflecting the propensity and the susceptibility of the genome to acquire multiple alterations, could be considered a driving force behind multiple carcinogenesis. Mutation of the p53 tumor-suppressor gene has been proposed to play an important role in this process. Therefore, we evaluated the incidence of inherited p53 germ-line alteration(s) in a population of 24 consecutive HNC patients and their first-degree relatives affected by multiple malignancies as well as the occurrence of p53 somatic acquired mutation(s) in 16 cancers, including first and second primaries from 5 HNCs of the same group. Mutations in exons 4-11 of the p53 gene were investigated using SSCP-PCR analysis and DNA sequencing. Analysis was extended to the peripheral blood and cancer biopsies available from first-degree relatives of cancer-prone families with p53 germ-line mutations. p53 germ-line mutations were identified in the peripheral blood and corresponding cancers of 3 HNC patients who had multiple malignancies. The only missense mutation detected was mapped in exon 6; it is a GTG to GAG substitution with an amino acid change from Val to Glu at codon 197. The remaining 2 p53 germ-line mutations were single-nucleotide substitutions without amino acid change in exon 6 (codon 213, CGA to CGG) and in exon 8 (codon 295, CCT to CCC), respectively. These mutations were found in HNC patients with a family history of cancer. Abnormal expression of wild-type p53 protein in normal and pathological tissues from patients with the same sense single-nucleotide substitutions was detected by immuno-histochemistry.

A novel bifunctional endo-/exo-type cellulase from an anaerobic ruminal bacterium.

PubMed

Ko, Kyong-Cheol; Han, Yunjon; Choi, Jong Hyun; Kim, Geun-Joong; Lee, Seung-Goo; Song, Jae Jun

2011-03-01

An anaerobic microorganism termed AN-C16-KBRB was isolated from the bovine rumen and demonstrated cellulolytic activity on a NB agar plate containing azo-carboxymethyl cellulose. The 16S rRNA gene of the strain was 98% similar to that of Clostridiaceae bacterium SK082 (AB298754) as the highest homology. A novel celEdx16 gene encoding a bifunctional endo-/exocellulase (CelEdx16) was cloned by the shotgun method from AN-C16-KBRB, and the enzyme was characterized. The celEdx16 gene had an open reading frame of 1,104-base pairs, which encoded 367 amino acids to yield a protein of molecular mass 40.4 kDa. The amino acid sequence was 53% identical to that of an endoglucanase from Clostridium thermocellum. CelEdx16 was overexpressed in Escherichia coli and purified using Ni-NTA affinity chromatography. The specific endocellulase and exocellulase activities of CelEdx16 were 15.9 and 3.6 x 10⁻² U mg⁻¹, respectively. The Michaelis-Menten constant (K (m) values) and the maximal reaction velocities (V(max) values) of CelEdx16 were 47.1 μM and 9.6 x 10⁻³ μmole min⁻¹ when endocellulase activity was measured and 106.3 μM and 2.1 x 10⁻⁵ μmol min⁻¹ when exocellulase activity was assessed. CelEdx16 was optimally active at pH 5.0 and 40 °C.

Profile of the genes expressed in the human peripheral retina, macula, and retinal pigment epithelium determined through serial analysis of gene expression (SAGE)

PubMed Central

Sharon, Dror; Blackshaw, Seth; Cepko, Constance L.; Dryja, Thaddeus P.

2002-01-01

We used the serial analysis of gene expression (SAGE) technique to catalogue and measure the relative levels of expression of the genes expressed in the human peripheral retina, macula, and retinal pigment epithelium (RPE) from one or both of two humans, aged 88 and 44 years. The cone photoreceptor contribution to all transcription in the retina was found to be similar in the macula versus the retinal periphery, whereas the rod contribution was greater in the periphery versus the macula. Genes encoding structural proteins for axons were found to be expressed at higher levels in the macula versus the retinal periphery, probably reflecting the large proportion of ganglion cells in the central retina. In comparison with the younger eye, the peripheral retina of the older eye had a substantially higher proportion of mRNAs from genes encoding proteins involved in iron metabolism or protection against oxidative damage and a substantially lower proportion of mRNAs from genes encoding proteins involved in rod phototransduction. These differences may reflect the difference in age between the two donors or merely interindividual variation. The RPE library had numerous previously unencountered tags, suggesting that this cell type has a large, idiosyncratic repertoire of expressed genes. Comparison of these libraries with 100 reported nonocular SAGE libraries revealed 89 retina-specific or enriched genes expressed at substantial levels, of which 14 are known to cause a retinal disease and 53 are RPE-specific genes. We expect that these libraries will serve as a resource for understanding the relative expression levels of genes in the retina and the RPE and for identifying additional disease genes. PMID:11756676

TNF-α modulates genome-wide redistribution of ΔNp63α/TAp73 and NF-κB cREL interactive binding on TP53 and AP-1 motifs to promote an oncogenic gene program in squamous cancer.

PubMed

Si, H; Lu, H; Yang, X; Mattox, A; Jang, M; Bian, Y; Sano, E; Viadiu, H; Yan, B; Yau, C; Ng, S; Lee, S K; Romano, R-A; Davis, S; Walker, R L; Xiao, W; Sun, H; Wei, L; Sinha, S; Benz, C C; Stuart, J M; Meltzer, P S; Van Waes, C; Chen, Z

2016-11-03

The Cancer Genome Atlas (TCGA) network study of 12 cancer types (PanCancer 12) revealed frequent mutation of TP53, and amplification and expression of related TP63 isoform ΔNp63 in squamous cancers. Further, aberrant expression of inflammatory genes and TP53/p63/p73 targets were detected in the PanCancer 12 project, reminiscent of gene programs comodulated by cREL/ΔNp63/TAp73 transcription factors we uncovered in head and neck squamous cell carcinomas (HNSCCs). However, how inflammatory gene signatures and cREL/p63/p73 targets are comodulated genome wide is unclear. Here, we examined how the inflammatory factor tumor necrosis factor-α (TNF-α) broadly modulates redistribution of cREL with ΔNp63α/TAp73 complexes and signatures genome wide in the HNSCC model UM-SCC46 using chromatin immunoprecipitation sequencing (ChIP-seq). TNF-α enhanced genome-wide co-occupancy of cREL with ΔNp63α on TP53/p63 sites, while unexpectedly promoting redistribution of TAp73 from TP53 to activator protein-1 (AP-1) sites. cREL, ΔNp63α and TAp73 binding and oligomerization on NF-κB-, TP53- or AP-1-specific sequences were independently validated by ChIP-qPCR (quantitative PCR), oligonucleotide-binding assays and analytical ultracentrifugation. Function of the binding activity was confirmed using TP53-, AP-1- and NF-κB-specific REs or p21, SERPINE1 and IL-6 promoter luciferase reporter activities. Concurrently, TNF-α regulated a broad gene network with cobinding activities for cREL, ΔNp63α and TAp73 observed upon array profiling and reverse transcription-PCR. Overlapping target gene signatures were observed in squamous cancer subsets and in inflamed skin of transgenic mice overexpressing ΔNp63α. Furthermore, multiple target genes identified in this study were linked to TP63 and TP73 activity and increased gene expression in large squamous cancer samples from PanCancer 12 TCGA by CircleMap. PARADIGM inferred pathway analysis revealed the network connection of TP63 and NF-κB complexes through an AP-1 hub, further supporting our findings. Thus, inflammatory cytokine TNF-α mediates genome-wide redistribution of the cREL/p63/p73, and AP-1 interactome, to diminish TAp73 tumor suppressor function and reciprocally activate NF-κB and AP-1 gene programs implicated in malignancy.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

PubMed

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

PubMed

Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

2012-01-01

The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM.

Targeting p53 via JNK Pathway: A Novel Role of RITA for Apoptotic Signaling in Multiple Myeloma

PubMed Central

Saha, Manujendra N.; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D.; Qiu, Lugui; Chang, Hong

2012-01-01

The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM. PMID:22276160

Recombinational inactivation of the gene encoding nitrate reductase in Aspergillus parasiticus.

PubMed Central

Wu, T S; Linz, J E

1993-01-01

Functional disruption of the gene encoding nitrate reductase (niaD) in Aspergillus parasiticus was conducted by two strategies, one-step gene replacement and the integrative disruption. Plasmid pPN-1, in which an internal DNA fragment of the niaD gene was replaced by a functional gene encoding orotidine monophosphate decarboxylase (pyrG), was constructed. Plasmid pPN-1 was introduced in linear form into A. parasiticus CS10 (ver-1 wh-1 pyrG) by transformation. Approximately 25% of the uridine prototrophic transformants (pyrG+) were chlorate resistant (Chlr), demonstrating their inability to utilize nitrate as a sole nitrogen source. The genetic block in nitrate utilization was confirmed to occur in the niaD gene by the absence of growth of the A. parasiticus CS10 transformants on medium containing nitrate as the sole nitrogen source and the ability to grow on several alternative nitrogen sources. Southern hybridization analysis of Chlr transformants demonstrated that the resident niaD locus was replaced by the nonfunctional allele in pPN-1. To generate an integrative disruption vector (pSKPYRG), an internal fragment of the niaD gene was subcloned into a plasmid containing the pyrG gene as a selectable marker. Circular pSKPYRG was transformed into A. parasiticus CS10. Chlr pyrG+ transformants were screened for nitrate utilization and by Southern hybridization analysis. Integrative disruption of the genomic niaD gene occurred in less than 2% of the transformants. Three gene replacement disruption transformants and two integrative disruption transformants were tested for mitotic stability after growth under nonselective conditions. All five transformants were found to stably retain the Chlr phenotype after growth on nonselective medium.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8215371

Limited Dissemination of Extended-Spectrum β-Lactamase- and Plasmid-Encoded AmpC-Producing Escherichia coli from Food and Farm Animals, Sweden.

PubMed

Börjesson, Stefan; Ny, Sofia; Egervärn, Maria; Bergström, Jakob; Rosengren, Åsa; Englund, Stina; Löfmark, Sonja; Byfors, Sara

2016-04-01

Extended-spectrum β-lactamase (ESBL)- and plasmid-encoded ampC (pAmpC)-producing Enterobacteriaceae might spread from farm animals to humans through food. However, most studies have been limited in number of isolates tested and areas studied. We examined genetic relatedness of 716 isolates from 4,854 samples collected from humans, farm animals, and foods in Sweden to determine whether foods and farm animals might act as reservoirs and dissemination routes for ESBL/pAmpC-producing Escherichia coli. Results showed that clonal spread to humans appears unlikely. However, we found limited dissemination of genes encoding ESBL/pAmpC and plasmids carrying these genes from foods and farm animals to healthy humans and patients. Poultry and chicken meat might be a reservoir and dissemination route to humans. Although we found no evidence of clonal spread of ESBL/pAmpC-producing E. coli from farm animals or foods to humans, ESBL/pAmpC-producing E. coli with identical genes and plasmids were present in farm animals, foods, and humans.

WDR36 and P53 Gene Variants and Susceptibility to Primary Open-Angle Glaucoma: Analysis of Gene-Gene Interactions

PubMed Central

Blanco-Marchite, Cristina; Sánchez-Sánchez, Francisco; López-Garrido, María-Pilar; Iñigez-de-Onzoño, Mercedes; López-Martínez, Francisco; López-Sánchez, Enrique; Alvarez, Lydia; Rodríguez-Calvo, Pedro-Pablo; Méndez-Hernández, Carmen; Fernández-Vega, Luis; García-Sánchez, Julián; Coca-Prados, Miguel; García-Feijoo, Julián

2011-01-01

Purpose. To investigate the role of WDR36 and P53 sequence variations in POAG susceptibility. Methods. The authors performed a case-control genetic association study in 268 unrelated Spanish patients (POAG1) and 380 control subjects matched for sex, age, and ethnicity. WDR36 sequence variations were screened by either direct DNA sequencing or denaturing high-performance liquid chromatography. P53 polymorphisms p.R72P and c.97–147ins16bp were analyzed by single-nucleotide polymorphism (SNP) genotyping and PCR, respectively. Positive SNP and haplotype associations were reanalyzed in a second sample of 211 patients and in combined cases (n = 479). Results. The authors identified almost 50 WDR36 sequence variations, of which approximately two-thirds were rare and one-third were polymorphisms. Approximately half the variants were novel. Eight patients (2.9%) carried rare mutations that were not identified in the control group (P = 0.001). Six Tag SNPs were expected to be structured in three common haplotypes. Haplotype H2 was consistently associated with the disease (P = 0.0024 in combined cases). According to a dominant model, genotypes containing allele P of the P53 p.R72P SNP slightly increased glaucoma risk. Glaucoma susceptibility associated with different WDR36 genotypes also increased significantly in combination with the P53 RP risk genotype, indicating the existence of a genetic interaction. For instance, the OR of the H2 diplotype estimated for POAG1 and combined cases rose approximately 1.6 times in the two-locus genotype H2/RP. Conclusions. Rare WDR36 variants and the P53 p.R72P polymorphism behaved as moderate glaucoma risk factors in Spanish patients. The authors provide evidence for a genetic interaction between WDR36 and P53 variants in POAG susceptibility, although this finding must be confirmed in other populations. PMID:21931130

The master regulator PhoP coordinates phosphate and nitrogen metabolism, respiration, cell differentiation and antibiotic biosynthesis: comparison in Streptomyces coelicolor and Streptomyces avermitilis.

PubMed

Martín, Juan F; Rodríguez-García, Antonio; Liras, Paloma

2017-05-01

Phosphate limitation is important for production of antibiotics and other secondary metabolites in Streptomyces. Phosphate control is mediated by the two-component system PhoR-PhoP. Following phosphate depletion, PhoP stimulates expression of genes involved in scavenging, transport and mobilization of phosphate, and represses the utilization of nitrogen sources. PhoP reduces expression of genes for aerobic respiration and activates nitrate respiration genes. PhoP activates genes for teichuronic acid formation and reduces expression of genes for phosphate-rich teichoic acid biosynthesis. In Streptomyces coelicolor, PhoP repressed several differentiation and pleiotropic regulatory genes, which affects development and indirectly antibiotic biosynthesis. A new bioinformatics analysis of the putative PhoP-binding sequences in Streptomyces avermitilis was made. Many sequences in S. avermitilis genome showed high weight values and were classified according to the available genetic information. These genes encode phosphate scavenging proteins, phosphate transporters and nitrogen metabolism genes. Among of the genes highlighted in the new studies was aveR, located in the avermectin gene cluster, encoding a LAL-type regulator, and afsS, which is regulated by PhoP and AfsR. The sequence logo for S. avermitilis PHO boxes is similar to that of S. coelicolor, with differences in the weight value for specific nucleotides in the sequence.

Cisplatin-Induced Renal Injury is Independently Mediated by OCT2 and p53

PubMed Central

Sprowl, Sprowl; Lancaster, Cynthia S.; Pabla, Navjotsingh; Hermann, Edwin; Kosloske, Ashley M.; Gibson, Alice A.; Li, Lie; Zeeh, Dorothea; Schlatter, Eberhard; Janke, Laura J.; Ciarimboli, Giuliano; Sparreboom, Alex

2014-01-01

Purpose Tubular secretion of cisplatin is abolished in mice deficient for the organic cation transporters Oct1 and Oct2 [Oct1/2(−/−) mice], and these animals are protected from severe cisplatin-induced kidney damage. Since tubular necrosis is not completely absent in Oct1/2(−/−) mice, we hypothesized that alternate pathways are involved in the observed injury. Experimental Design Studies were done in wildtype, Oct1/2(−/−), or p53-deficient animals, all on an FVB background, receiving i.p. cisplatin at 15 mg/kg. The cisplatin metabolites were analyzed using mass spectrometry, and gene expression was assessed using Affymetrix microarrays and RT-PCR arrays. Results KEGG pathway analyses on kidneys from mice exposed to cisplatin revealed that most significantly altered genes were associated with the p53 signaling network, including Cdnk1a and Mdm2, in both wildtype (P=2.40×10–11) and Oct1/2(−/−) mice (P=1.92×10-8). This was confirmed by demonstrating that homozygosity for a p53-null allele partially reduced renal tubular damage, while loss of p53 in Oct1/2(−/−) mice [p53(−/−)/Oct1/2(−/−)] completely abolished nephrotoxicity. We found that pifithrin-α, an inhibitor of p53-dependent transcriptional activation, inhibits Oct2 and can mimic the lack of nephrotoxicity observed in p53(−/−)/Oct1/2(−/−) mice. Conclusions These findings indicate that (i) the p53 pathway plays a crucial role in the kidney in response to cisplatin treatment and (ii) clinical exploration of OCT2 inhibitors may not lead to complete nephroprotection unless the p53 pathway is simultaneously antagonized. PMID:24916697

Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage

PubMed Central

Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.

2018-01-01

Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

Gamma-ray irradiation promotes premature meiosis of spontaneously differentiating testis–ova in the testis of p53-deficient medaka (Oryzias latipes)

PubMed Central

Yasuda, T; Oda, S; Li, Z; Kimori, Y; Kamei, Y; Ishikawa, T; Todo, T; Mitani, H

2012-01-01

In this study, the roles of p53 in impaired spermatogenic male germ cells of p53-deficient medaka were investigated by analyzing histological changes, and gene expressions of 42Sp50, Oct 4 and vitellogenin (VTG2) by RT-PCR or in situ hybridization in the testes. We found that a small number of oocyte-like cells (testis–ova) differentiated spontaneously in the cysts of type A and early type B spermatogonia in the p53-deficient testes, in contrast to the wild-type (wt) testes in which testis–ova were never found. Furthermore, ionizing radiation (IR) irradiation increased the number of testis–ova in p53-deficient testes, increased testis–ova size and proceeded up to the zygotene or pachytene stages of premature meiosis within 14 days after irradiation. However, 28 days after irradiation, almost all the testis–ova were eliminated presumably by p53-independent apoptosis, and spermatogenesis was restored completely. In the wt testis, IR never induced testis–ova differentiation. This is the first study to demonstrate the pivotal role of the p53 gene in the elimination of spontaneous testis–ova in testes, and that p53 is not indispensable for the restoration of spermatogenesis in the impaired testes in which cell cycle regulation is disturbed by IR irradiation. PMID:23034330

p53 activation by Ni(II) is a HIF-1α independent response causing caspases 9/3-mediated apoptosis in human lung cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, Victor C.; Morse, Jessica L.; Zhitkovich, Anatoly, E-mail: anatoly_zhitkovich@brown.edu

2013-06-15

Hypoxia mimic nickel(II) is a human respiratory carcinogen with a suspected epigenetic mode of action. We examined whether Ni(II) elicits a toxicologically significant activation of the tumor suppressor p53, which is typically associated with genotoxic responses. We found that treatments of H460 human lung epithelial cells with NiCl{sub 2} caused activating phosphorylation at p53-Ser15, accumulation of p53 protein and depletion of its inhibitor MDM4 (HDMX). Confirming the activation of p53, its knockdown suppressed the ability of Ni(II) to upregulate MDM2 and p21 (CDKN1A). Unlike DNA damage, induction of GADD45A by Ni(II) was p53-independent. Ni(II) also increased p53-Ser15 phosphorylation and p21more » expression in normal human lung fibroblasts. Although Ni(II)-induced stabilization of HIF-1α occurred earlier, it had no effect on p53 accumulation and Ser15 phosphorylation. Ni(II)-treated H460 cells showed no evidence of necrosis and their apoptosis and clonogenic death were suppressed by p53 knockdown. The apoptotic role of p53 involved a transcription-dependent program triggering the initiator caspase 9 and its downstream executioner caspase 3. Two most prominently upregulated proapoptotic genes by Ni(II) were PUMA and NOXA but only PUMA induction required p53. Knockdown of p53 also led to derepression of antiapoptotic MCL1 in Ni(II)-treated cells. Overall, our results indicate that p53 plays a major role in apoptotic death of human lung cells by Ni(II). Chronic exposure to Ni(II) may promote selection of resistant cells with inactivated p53, providing an explanation for the origin of p53 mutations by this epigenetic carcinogen. - Highlights: • Ni(II) is a strong activator of the transcription factor p53. • Apoptosis is a principal form of death by Ni(II) in human lung epithelial cells. • Ni(II)-activated p53 triggers caspases 9/3-mediated apoptotic program. • NOXA and PUMA are two main proapoptotic genes induced by Ni(II). • HIF-1α and p53 are independent stress responses to hypoxia-mimicking Ni(II)« less

Genomic analysis of wig-1 pathways.

PubMed

Sedaghat, Yalda; Mazur, Curt; Sabripour, Mahyar; Hung, Gene; Monia, Brett P

2012-01-01

Wig-1 is a transcription factor regulated by p53 that can interact with hnRNP A2/B1, RNA Helicase A, and dsRNAs, which plays an important role in RNA and protein stabilization. in vitro studies have shown that wig-1 binds p53 mRNA and stabilizes it by protecting it from deadenylation. Furthermore, p53 has been implicated as a causal factor in neurodegenerative diseases based in part on its selective regulatory function on gene expression, including genes which, in turn, also possess regulatory functions on gene expression. In this study we focused on the wig-1 transcription factor as a downstream p53 regulated gene and characterized the effects of wig-1 down regulation on gene expression in mouse liver and brain. Antisense oligonucleotides (ASOs) were identified that specifically target mouse wig-1 mRNA and produce a dose-dependent reduction in wig-1 mRNA levels in cell culture. These wig-1 ASOs produced marked reductions in wig-1 levels in liver following intraperitoneal administration and in brain tissue following ASO administration through a single striatal bolus injection in FVB and BACHD mice. Wig-1 suppression was well tolerated and resulted in the reduction of mutant Htt protein levels in BACHD mouse brain but had no effect on normal Htt protein levels nor p53 mRNA or protein levels. Expression microarray analysis was employed to determine the effects of wig-1 suppression on genome-wide expression in mouse liver and brain. Reduction of wig-1 caused both down regulation and up regulation of several genes, and a number of wig-1 regulated genes were identified that potentially links wig-1 various signaling pathways and diseases. Antisense oligonucleotides can effectively reduce wig-1 levels in mouse liver and brain, which results in specific changes in gene expression for pathways relevant to both the nervous system and cancer.

Genomic Analysis of wig-1 Pathways

PubMed Central

Sedaghat, Yalda; Mazur, Curt; Sabripour, Mahyar; Hung, Gene; Monia, Brett P.

2012-01-01

Background Wig-1 is a transcription factor regulated by p53 that can interact with hnRNP A2/B1, RNA Helicase A, and dsRNAs, which plays an important role in RNA and protein stabilization. in vitro studies have shown that wig-1 binds p53 mRNA and stabilizes it by protecting it from deadenylation. Furthermore, p53 has been implicated as a causal factor in neurodegenerative diseases based in part on its selective regulatory function on gene expression, including genes which, in turn, also possess regulatory functions on gene expression. In this study we focused on the wig-1 transcription factor as a downstream p53 regulated gene and characterized the effects of wig-1 down regulation on gene expression in mouse liver and brain. Methods and Results Antisense oligonucleotides (ASOs) were identified that specifically target mouse wig-1 mRNA and produce a dose-dependent reduction in wig-1 mRNA levels in cell culture. These wig-1 ASOs produced marked reductions in wig-1 levels in liver following intraperitoneal administration and in brain tissue following ASO administration through a single striatal bolus injection in FVB and BACHD mice. Wig-1 suppression was well tolerated and resulted in the reduction of mutant Htt protein levels in BACHD mouse brain but had no effect on normal Htt protein levels nor p53 mRNA or protein levels. Expression microarray analysis was employed to determine the effects of wig-1 suppression on genome-wide expression in mouse liver and brain. Reduction of wig-1 caused both down regulation and up regulation of several genes, and a number of wig-1 regulated genes were identified that potentially links wig-1 various signaling pathways and diseases. Conclusion Antisense oligonucleotides can effectively reduce wig-1 levels in mouse liver and brain, which results in specific changes in gene expression for pathways relevant to both the nervous system and cancer. PMID:22347364

IP-10, p53, and Foxp3 Expression in Hepatocytes of Chronic Hepatitis B Patients with Cirrhosis and Hepatocellular Carcinoma.

PubMed

Shahera, Umme; Munshi, Saifullah; Jahan, Munira; Nessa, Afzalun; Alam, Shahinul; Tabassum, Shahina

2016-01-01

Elucidating differences in gene expression may be useful in understanding the molecular pathogenesis and for developing specific markers for the outcome of hepatitis B virus (HBV) infection. In the present study, expressions of host gene interferon gamma-inducible protein (IP-10), p53, and Foxp3 were studied in hepatocytes of patients with chronic HBV infection to determine a possible link between selected host gene expression and the outcome of HBV infection. The study was conducted in 60 patients with chronic HBV infection and they were divided into four groups: HBV-positive cirrhosis (n = 15), HBV-negative cirrhosis (n = 15), HBV-positive hepatocellular carcinoma (HCC) (n = 15) and HBV-negative HCC (n = 15). Total messenger ribonucleic acid (mRNA) extraction was done followed by complementary deoxyribonucleic acid (cDNA) synthesis, and finally gene expression was performed using real-time polymerase chain reaction (PCR) technique. IP-10 and p53 gene expressions were lower in HBV-positive cirrhosis, and Foxp3 gene expression was upregulated in HBV-positive cirrhosis in comparison to HBV-negative cirrhosis. The expressions of all the three genes were upregulated among HBV-positive HCC in comparison to HBV-negative HCC. The expression of IP-10, p53, and Foxp3 genes was upregulated in HBV-positive HCC in comparison to HBV-positive cirrhosis. This study indicates that there are variations in the expression of the selected genes among cirrhosis and HCC patients with or without HBV. All the three selected genes were more or less upregulated in HBV-positive HCC patients, but only Foxp3 expression was upregulated in HBV-positive cirrhosis. These three particular genes may have a role in the molecular pathogenesis and clinical outcome of HBV-positive cirrhosis and HCC patients. These aspects need further evaluation by studies with larger numbers of cirrhosis and HCC patients. Shahera U, Munshi S, Jahan M, Nessa A, Alam S, Tabassum S. IP-10, p53, and Foxp3 Expression in Hepatocytes of Chronic Hepatitis B Patients with Cirrhosis and Hepatocellular Carcinoma. Euroasian J Hepato-Gastroenterol 2016;6(2):149-153.

Poly(beta-amino ester) nanoparticle-delivery of p53 has activity against small cell lung cancer in vitro and in vivo

PubMed Central

Kamat, Chandrashekhar D.; Shmueli, Ron B.; Connis, Nick; Rudin, Charles M.; Green, Jordan J.; Hann, Christine L.

2013-01-01

Small cell lung cancer (SCLC) is an aggressive disease with one of the highest case-fatality rates among cancer. The recommended therapy for SCLC has not changed significantly over the past 30 years; new therapeutic approaches are a critical need. TP53 is mutated in the majority of SCLC cases and its loss is required in transgenic mouse models of the disease. We synthesized an array of biodegradable poly(beta-amino ester) (PBAE) polymers which self-assemble with DNA and assayed for transfection efficiency in the p53-mutant H446 SCLC cell line using high-throughput methodologies. Two of the top candidates were selected for further characterization and TP53 delivery in vitro and in vivo. Nanoparticle delivery of TP53 resulted in expression of exogenous p53, induction of p21, induction of apoptosis and accumulation of cells in sub-G1 consistent with functional p53 activity. Intratumoral injection of subcutaneous H446 xenografts with polymers carrying TP53 caused marked tumor growth inhibition. This is the first demonstration of TP53 gene therapy in SCLC using non-viral polymeric nanoparticles. This technology may have general applicability as a novel anti-cancer strategy based on restoration of tumor suppressor gene function. PMID:23364678

Adenovirus-mediated p53 gene delivery inhibits 9L glioma growth in rats.

PubMed

Badie, B; Drazan, K E; Kramar, M H; Shaked, A; Black, K L

1995-06-01

Adenoviral vectors have recently been shown to effectively deliver genes into a variety of tissues. Since these vectors have some advantages over the more extensively investigated retroviruses, we studied the effect of two replication-defective adenovectors bearing human wild type tumor suppressor gene p53 (Adp53) and Escherichia coli beta-galactosidase gene (AdLacZ) on 9L glioma cells. Successful in vitro gene transfer was shown by DNA polymerase chain reaction (PCR), and expression was confirmed by reverse transcriptase RNA PCR and Western blot analyses. Transduction of 9L cells with the Adp53 inhibited cell growth and induced phenotypic changes consistent with cell death at low titers, while AdLacZ caused cytopathic changes only at high titers. Stereotactic injection of AdLacZ (10(7) plaque forming units) into tumor bed stained 25 to 30% of tumor cells at the site of vector delivery. Injection of Adp53 (10(7) plaque forming units), but not AdLacZ (controls), into established 4-day old 9L glioma brain tumors decreased tumor volume by 40% after 14 days. As a step toward gene therapy of brain tumors using replication-defective adenoviruses, these data support the use of tumor suppressor gene transfer for in vivo treatment of whole animal brain tumor models.

Establishment of a new human pre-B acute lymphoblastic leukemia cell line (KMO-90) with 1;19 translocation carrying p53 gene alterations.

PubMed

Sotomatsu, M; Hayashi, Y; Kawamura, M; Yugami, S; Shitara, T

1993-10-01

A new human pre-B acute lymphoblastic leukemia cell line (KMO-90) was established from the bone marrow sample of a 12-year-old girl with acute lymphoblastic leukemia (ALL) carrying 1;19 chromosome translocation. KMO-90 cells expressed HLA-DR, CD10, CD19, and CD22 antigens. These cells had also cytoplasmic immunoglobulin lacking surface immunoglobulin, indicating that these had a pre-B phenotype. Chromosome analysis of this cell line showed 48, XX, +8, +19, t(1;19)(q23;p13). Southern blot analysis showed the same sized rearrangements of the E2A gene in KMO-90 cells as those in the original leukemic cells. By means of reverse transcriptase-polymerase chain reaction analysis, we detected E2A/PBX1 fusion transcripts in KMO-90 cells. KMO-90 is useful when studying the role of the 1;19 translocation in the etiology of pre-B ALL. Furthermore, we studied alterations of the p53 gene in this cell line by polymerase chain reaction, single-strand conformation polymorphism analysis. KMO-90 cells were identified to have a point mutation at codon 177 (CCC-->TCC) of the p53 gene, suggesting that alterations of the p53 gene may have an important role in the establishment of this cell line.

Overexpression and optimization of glutamate decarboxylase in Lactobacillus plantarum Taj-Apis362 for high gamma-aminobutyric acid production.

PubMed

Tajabadi, Naser; Baradaran, Ali; Ebrahimpour, Afshin; Rahim, Raha A; Bakar, Fatimah A; Manap, Mohd Yazid A; Mohammed, Abdulkarim S; Saari, Nazamid

2015-07-01

Gamma-aminobutyric acid (GABA) is an important bioactive compound biosynthesized by microorganisms through decarboxylation of glutamate by glutamate decarboxylase (GAD). In this study, a full-length GAD gene was obtained by cloning the template deoxyribonucleic acid to pTZ57R/T vector. The open reading frame of the GAD gene showed the cloned gene was composed of 1410 nucleotides and encoded a 469 amino acids protein. To improve the GABA-production, the GAD gene was cloned into pMG36e-LbGAD, and then expressed in Lactobacillus plantarum Taj-Apis362 cells. The overexpression was confirmed by SDS-PAGE and GAD activity, showing a 53 KDa protein with the enzyme activity increased by sevenfold compared with the original GAD activity. The optimal fermentation conditions for GABA production established using response surface methodology were at glutamic acid concentration of 497.973 mM, temperature 36°C, pH 5.31 and time 60 h. Under the conditions, maximum GABA concentration obtained (11.09 mM) was comparable with the predicted value by the model at 11.23 mM. To our knowledge, this is the first report of successful cloning (clone-back) and overexpression of the LbGAD gene from L. plantarum to L. plantarum cells. The recombinant Lactobacillus could be used as a starter culture for direct incorporation into a food system during fermentation for production of GABA-rich products. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of streptococcus pneumontae

DOEpatents

Lacks, Sanford A.

1990-01-01

Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252.

Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of Streptococcus pneumontae

DOEpatents

Lacks, S.A.

1990-10-02

Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252. 9 figs.

Suppression of gain-of-function mutant p53 with metabolic inhibitors reduces tumor growth in vivo

PubMed Central

Jung, Chae Lim; Mun, Hyemin; Jo, Se-Young; Oh, Ju-Hee; Lee, ChuHee; Choi, Eun-Kyung; Jang, Se Jin; Suh, Young-Ah

2016-01-01

Mutation of p53 occasionally results in a gain of function, which promotes tumor growth. We asked whether destabilizing the gain-of-function protein would kill tumor cells. Downregulation of the gene reduced cell proliferation in p53-mutant cells, but not in p53-null cells, indicating that the former depended on the mutant protein for survival. Moreover, phenformin and 2-deoxyglucose suppressed cell growth and simultaneously destabilized mutant p53. The AMPK pathway, MAPK pathway, chaperone proteins and ubiquitination all contributed to this process. Interestingly, phenformin and 2-deoxyglucose also reduced tumor growth in syngeneic mice harboring the p53 mutation. Thus, destabilizing mutant p53 protein in order to kill cells exhibiting “oncogene addiction” could be a promising strategy for combatting p53 mutant tumors. PMID:27765910

Suppression of gain-of-function mutant p53 with metabolic inhibitors reduces tumor growth in vivo.

PubMed

Jung, Chae Lim; Mun, Hyemin; Jo, Se-Young; Oh, Ju-Hee; Lee, ChuHee; Choi, Eun-Kyung; Jang, Se Jin; Suh, Young-Ah

2016-11-22

Mutation of p53 occasionally results in a gain of function, which promotes tumor growth. We asked whether destabilizing the gain-of-function protein would kill tumor cells. Downregulation of the gene reduced cell proliferation in p53-mutant cells, but not in p53-null cells, indicating that the former depended on the mutant protein for survival. Moreover, phenformin and 2-deoxyglucose suppressed cell growth and simultaneously destabilized mutant p53. The AMPK pathway, MAPK pathway, chaperone proteins and ubiquitination all contributed to this process. Interestingly, phenformin and 2-deoxyglucose also reduced tumor growth in syngeneic mice harboring the p53 mutation. Thus, destabilizing mutant p53 protein in order to kill cells exhibiting "oncogene addiction" could be a promising strategy for combatting p53 mutant tumors.

Association of mRNA expression of TP53 and the TP53 codon 72 Arg/Pro gene polymorphism with colorectal cancer risk in Asian population: a bioinformatics analysis and meta-analysis.

PubMed

Dong, Zhiyong; Zheng, Longzhi; Liu, Weimin; Wang, Cunchuan

2018-01-01

The relationship between TP53 codon 72 Pro/Arg gene polymorphism and colorectal cancer risk in Asians is still controversial, and this bioinformatics analysis and meta-analysis was performed to assess the associations. The association studies were identified from PubMed, and eligible reports were included. RevMan 5.3.1 software, Oncolnc, cBioPortal, and Oncomine online tools were used for statistical analysis. A random/fixed effects model was used in meta-analysis. The data were reported as risk ratios or mean differences with corresponding 95% CI. We confirmed that TP53 was associated with colorectal cancer, the alteration frequency of TP53 was 53% mutation and 7% deep deletion, and TP53 mRNA expression was different in different types of colorectal cancer based on The Cancer Genome Atlas database. Then, 18 studies were included that examine the association of TP53 codon 72 gene polymorphism with colorectal cancer risk in Asians. The meta-analysis indicated that TP53 Pro allele and Pro/Pro genotype were associated with colorectal cancer risk in Asian population, but Arg/Arg genotype was not (Pro allele: odds ratios [OR]=1.20, 95% CI: 1.06 to 1.35, P =0.003; Pro/Pro genotype: OR=1.39, 95% CI: 1.15 to 1.69, P =0.0007; Arg/Arg genotype: OR=0.86, 95% CI: 0.74 to 1.00, P =0.05). Interestingly, in the meta-analysis of the controls from the population-based studies, we found that TP53 codon 72 Pro/Arg gene polymorphism was associated with colorectal cancer risk (Pro allele: OR=1.33, 95% CI: 1.15 to 1.55, P =0.0002; Pro/Pro genotype: OR=1.61, 95% CI: 1.28 to 2.02, P <0.0001; Arg/Arg genotype: OR=0.77, 95% CI: 0.63 to 0.93, P =0.009). TP53 was associated with colorectal cancer, but the different value levels of mRNA expression were not associated with survival rate of colon and rectal cancer. TP53 Pro allele and Pro/Pro genotype were associated with colorectal cancer risk in Asians.

Association of mRNA expression of TP53 and the TP53 codon 72 Arg/Pro gene polymorphism with colorectal cancer risk in Asian population: a bioinformatics analysis and meta-analysis

PubMed Central

Liu, Weimin; Wang, Cunchuan

2018-01-01

Background The relationship between TP53 codon 72 Pro/Arg gene polymorphism and colorectal cancer risk in Asians is still controversial, and this bioinformatics analysis and meta-analysis was performed to assess the associations. Methods The association studies were identified from PubMed, and eligible reports were included. RevMan 5.3.1 software, Oncolnc, cBioPortal, and Oncomine online tools were used for statistical analysis. A random/fixed effects model was used in meta-analysis. The data were reported as risk ratios or mean differences with corresponding 95% CI. Results We confirmed that TP53 was associated with colorectal cancer, the alteration frequency of TP53 was 53% mutation and 7% deep deletion, and TP53 mRNA expression was different in different types of colorectal cancer based on The Cancer Genome Atlas database. Then, 18 studies were included that examine the association of TP53 codon 72 gene polymorphism with colorectal cancer risk in Asians. The meta-analysis indicated that TP53 Pro allele and Pro/Pro genotype were associated with colorectal cancer risk in Asian population, but Arg/Arg genotype was not (Pro allele: odds ratios [OR]=1.20, 95% CI: 1.06 to 1.35, P=0.003; Pro/Pro genotype: OR=1.39, 95% CI: 1.15 to 1.69, P=0.0007; Arg/Arg genotype: OR=0.86, 95% CI: 0.74 to 1.00, P=0.05). Interestingly, in the meta-analysis of the controls from the population-based studies, we found that TP53 codon 72 Pro/Arg gene polymorphism was associated with colorectal cancer risk (Pro allele: OR=1.33, 95% CI: 1.15 to 1.55, P=0.0002; Pro/Pro genotype: OR=1.61, 95% CI: 1.28 to 2.02, P<0.0001; Arg/Arg genotype: OR=0.77, 95% CI: 0.63 to 0.93, P=0.009). Conclusion TP53 was associated with colorectal cancer, but the different value levels of mRNA expression were not associated with survival rate of colon and rectal cancer. TP53 Pro allele and Pro/Pro genotype were associated with colorectal cancer risk in Asians. PMID:29872345

Identification and characterization of the gltK gene encoding a membrane-associated glucose transport protein of pseudomonas aeruginosa.

PubMed

Adewoye, L O; Worobec, E A

2000-08-08

The Pseudomonas aeruginosa oprB gene encodes the carbohydrate-selective OprB porin, which translocates substrate molecules across the outer membrane to the periplasmic glucose-binding protein. We identified and cloned two open reading frames (ORFs) flanking the oprB gene but are not in operonic arrangement with the oprB gene. The downstream ORF encodes a putative polypeptide homologous to members of a family of transcriptional repressors, whereas the oprB gene is preceded by an ORF encoding a putative product, which exhibits strong homology to several carbohydrate transport ATP-binding cassette (ABC) proteins. The genomic copy of the upstream ORF was mutagenized by homologous recombination. Analysis of the deletion mutant in comparison with the wild type revealed a significant reduction in [14C] glucose transport activity in the mutant strain, suggesting that this ORF likely encodes the inner membrane component of the glucose ABC transporter. It is thus designated gltK gene to reflect its homology to the Pseudomona fluorescens mtlK and its involvement in the high-affinity glucose transport system. Multiple alignment analysis revealed that the P. aeruginosa gltK gene product is a member of the MalK subfamily of ABC proteins.

Promoter hypermethylation of the DNA repair gene O(6)-methylguanine-DNA methyltransferase is associated with the presence of G:C to A:T transition mutations in p53 in human colorectal tumorigenesis.

PubMed

Esteller, M; Risques, R A; Toyota, M; Capella, G; Moreno, V; Peinado, M A; Baylin, S B; Herman, J G

2001-06-15

Defects in DNA repair may be responsible for the genesis of mutations in key genes in cancer cells. The tumor suppressor gene p53 is commonly mutated in human cancer by missense point mutations, most of them G:C to A:T transitions. A recognized cause for this type of change is spontaneous deamination of the methylcytosine. However, the persistence of a premutagenic O(6)-methylguanine can also be invoked. This last lesion is removed in the normal cell by the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT). In many tumor types, epigenetic silencing of MGMT by promoter hypermethylation has been demonstrated and linked to the appearance of G to A mutations in the K-ras oncogene in colorectal tumors. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of p53 mutations, we studied 314 colorectal tumors for MGMT promoter hypermethylation and p53 mutational spectrum. Inactivation of MGMT by aberrant methylation was associated with the appearance of G:C to A:T transition mutations at p53 (Fischer's exact test, two-tailed; P = 0.01). Overall, MGMT methylated tumors displayed p53 transition mutations in 43 of 126 (34%) cases, whereas MGMT unmethylated tumors only showed G:C to A:T changes in 37 of 188 (19%) tumors. A more striking association was found in G:C to A:T transitions in non-CpG dinucleotides; 71% (12 of 17) of the total non-CpG transition mutations in p53 were observed in MGMT aberrantly methylated tumors (Fischer's exact test, two-tailed; P = 0.008). Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to G:C to A:T transition mutations in p53.

The first genome-level transcriptome of the wood-degrading fungus Phanerochaete chrysosporium grown on red oak.

PubMed

Sato, Shin; Feltus, F Alex; Iyer, Prashanti; Tien, Ming

2009-06-01

As part of an effort to determine all the gene products involved in wood degradation, we have performed massively parallel pyrosequencing on an expression library from the white rot fungus Phanerochaete chrysosporium grown in shallow stationary cultures with red oak as the carbon source. Approximately 48,000 high quality sequence tags (246 bp average length) were generated. 53% of the sequence tags aligned to 4,262 P. chrysosporium gene models, and an additional 18.5% of the tags reliably aligned to the P. chrysosporium genome providing evidence for 961 putative novel fragmented gene models. Due to their role in lignocellulose degradation, the secreted proteins were focused upon. Our results show that the four enzymes required for cellulose degradation: endocellulase, exocellulase CBHI, exocellulase CBHII, and beta-glucosidase are all produced. For hemicellulose degradation, not all known enzymes were produced, but endoxylanases, acetyl xylan esterases and mannosidases were detected. For lignin degradation, the role of peroxidases has been questioned; however, our results show that lignin peroxidase is highly expressed along with the H(2)O(2) generating enzyme, alcohol oxidase. The transcriptome snapshot reveals that H(2)O(2) generation and utilization are central in wood degradation. Our results also reveal new transcripts that encode extracellular proteins with no known function.

Utilization of Virus ϕCh1 Elements To Establish a Shuttle Vector System for Halo(alkali)philic Archaea via Transformation of Natrialba magadii

PubMed Central

Mayrhofer-Iro, M.; Ladurner, A.; Meissner, C.; Derntl, C.; Reiter, M.; Haider, F.; Dimmel, K.; Rössler, N.; Klein, R.; Baranyi, U.; Scholz, H.

2013-01-01

In the study described here, we successfully developed a transformation system for halo(alkali)philic members of the Archaea. This transformation system comprises a series of Natrialba magadii/Escherichia coli shuttle vectors based on a modified method to transform halophilic members of the Archaea and genomic elements of the N. magadii virus ϕCh1. The shuttle vector pRo-5, based on the repH-containing region of ϕCh1, stably replicated in E. coli and N. magadii and in several halophilic and haloalkaliphilic members of the Archaea not transformable so far. The ϕCh1 operon ORF53/ORF54 (repH) was essential for pRo-5 replication and was thus identified as the minimal replication origin. The plasmid allowed homologous and heterologous gene expression, as exemplified by the expression of ϕCh1 ORF3452, which encodes a structural protein, and the reporter gene bgaH of Haloferax lucentense in N. magadii. The new transformation/vector system will facilitate genetic studies within N. magadii and other haloalkaliphilic archaea and will allow the detailed characterization of the gene functions of N. magadii virus ϕCh1 in their extreme environments. PMID:23416999

PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

ERIC Educational Resources Information Center

Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

2009-01-01

Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

Transcriptional and post-transcriptional regulation of the ionizing radiation response by ATM and p53

PubMed Central

Venkata Narayanan, Ishwarya; Paulsen, Michelle T.; Bedi, Karan; Berg, Nathan; Ljungman, Emily A.; Francia, Sofia; Veloso, Artur; Magnuson, Brian; di Fagagna, Fabrizio d’Adda; Wilson, Thomas E.; Ljungman, Mats

2017-01-01

In response to ionizing radiation (IR), cells activate a DNA damage response (DDR) pathway to re-program gene expression. Previous studies using total cellular RNA analyses have shown that the stress kinase ATM and the transcription factor p53 are integral components required for induction of IR-induced gene expression. These studies did not distinguish between changes in RNA synthesis and RNA turnover and did not address the role of enhancer elements in DDR-mediated transcriptional regulation. To determine the contribution of synthesis and degradation of RNA and monitor the activity of enhancer elements following exposure to IR, we used the recently developed Bru-seq, BruChase-seq and BruUV-seq techniques. Our results show that ATM and p53 regulate both RNA synthesis and stability as well as enhancer element activity following exposure to IR. Importantly, many genes in the p53-signaling pathway were coordinately up-regulated by both increased synthesis and RNA stability while down-regulated genes were suppressed either by reduced synthesis or stability. Our study is the first of its kind that independently assessed the effects of ionizing radiation on transcription and post-transcriptional regulation in normal human cells. PMID:28256581

A murC gene in Porphyromonas gingivalis 381.

PubMed

Ansai, T; Yamashita, Y; Awano, S; Shibata, Y; Wachi, M; Nagai, K; Takehara, T

1995-09-01

The gene encoding a 51 kDa polypeptide of Porphyromonas gingivalis 381 was isolated by immunoblotting using an antiserum raised against P. gingivalis alkaline phosphatase. DNA sequence analysis of a 2.5 kb DNA fragment containing a gene encoding the 51 kDa protein revealed one complete and two incomplete ORFs. Database searches using the FASTA program revealed significant homology between the P. gingivalis 51 kDa protein and the MurC protein of Escherichia coli, which functions in peptidoglycan synthesis. The cloned 51 kDa protein encoded a functional product that complemented an E. coli murC mutant. Moreover, the ORF just upstream of murC coded for a protein that was 31% homologous with the E. coli MurG protein. The ORF just downstream of murC coded for a protein that was 17% homologous with the Streptococcus pneumoniae penicillin-binding protein 2B (PBP2B), which functions in peptidoglycan synthesis and is responsible for antibiotic resistance. These results suggest that P. gingivalis contains a homologue of the E. coli peptidoglycan synthesis gene murC and indicate the possibility of a cluster of genes responsible for cell division and cell growth, as in the E. coli mra region.

Molecular cloning and characterization of the spaB gene of Streptococcus sobrinus.

PubMed

Holt, R G; Perry, S E

1990-07-01

A gene of Streptococcus sobrinus 6715 (serotype g) designated spaB and encoding a surface protein antigen was isolated from a cosmid gene bank. A 5.4 kb HindIII/AvaI DNA fragment containing the gene was inserted into plasmid pBR322 to yield plasmid pXI404. Analysis of plasmid-encoded gene products showed that the 5.4 kb fragment of pXI404 encoded a 195 kDa protein. Southern blot experiments revealed that the 5.4 kb chromosomal insert DNA had sequence similarity with genomic DNA of S. sobrinus 6715, S. sobrinus B13 (serotype d) and Streptococcus cricetus HS6 (serotype a). The recombinant SpaB protein (rSpaB) was purified and monospecific antiserum was prepared. With immunological techniques and the anti-rSpaB serum, we have shown: (1) that the rSpaB protein has physico-chemical and antigenic identity with the S. sobrinus SpaB protein, (2) the presence of cross-reactive proteins in the extracellular protein of serotypes a and d of the mutans group of streptococci and (3) that the SpaB protein is expressed on the surface of mutans streptococcal serotypes a, d and g.

Inflammatory stimuli induce inhibitory S-nitrosylation of the deacetylase SIRT1 to increase acetylation and activation of p53 and p65

PubMed Central

Shinozaki, Shohei; Chang, Kyungho; Sakai, Michihiro; Shimizu, Nobuyuki; Yamada, Marina; Tanaka, Tomokazu; Nakazawa, Harumasa; Ichinose, Fumito; Yamada, Yoshitsugu; Ishigami, Akihito; Ito, Hideki; Ouchi, Yasuyoshi; Starr, Marlene E.; Saito, Hiroshi; Shimokado, Kentaro; Stamler, Jonathan S.; Kaneki, Masao

2015-01-01

Inflammation increases the abundance of inducible nitric oxide synthase (iNOS), leading to enhanced production of nitric oxide (NO), which can modify proteins by S-nitrosylation. Enhanced NO production increases the activities of the transcription factors p53 and nuclear factor κB (NF-κB) in several models of disease-associated inflammation. S-Nitrosylation inhibits the activity of the protein deacetylase SIRT1. SIRT1 limits apoptosis and inflammation by deacetylating p53 and p65 (also known as RelA), a subunit of NF-κB. We showed in multiple cultured mammalian cell lines that NO donors or inflammatory stimuli induced S-nitrosylation of SIRT1 within CXXC motifs, which inhibited SIRT1 by disrupting its ability to bind zinc. Inhibition of SIRT1 reduced deacetylation and promoted activation of p53 and p65, leading to apoptosis and increased expression of proinflammatory genes. In rodent models of systemic inflammation, Parkinson’s disease, or aging-related muscular atrophy, S-nitrosylation of SIRT1 correlated with increased acetylation of p53 and p65 and activation of p53 and NF-κB target genes, suggesting that S-nitrosylation of SIRT1 may represent a proinflammatory switch common to many diseases and aging. PMID:25389371

Polymorphisms in HTR2A and DRD4 Predispose to Smoking and Smoking Quantity.

PubMed

Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Noé Díaz, Valeri; García Gómez, Leonor; Elvira Fabián, Karina; García Carmona, Salvador; López-Flores, Luis A; Ambrocio-Ortiz, Enrique; Contreras Romero, Rocío; Alcantar-Ayala, Noé; Sansores, Raúl H; Falfán-Valencia, Ramcés

2017-01-01

Genes encoding the receptors involved in the dopaminergic and serotonergic pathways are potential candidates in the mechanisms of nicotine addiction. To identify genetic variants in the promoter regions and exons of the DRD4 and HTR2A genes associated with tobacco smoking and the degree of nicotine addiction in Mexican mestizos. The study included 438 non-smokers (NS) and 1,157 current smokers, ranked based on their consumption of cigarettes per day (cpd): 574 heavy smokers (HS, >20 cpd) and 583 light smokers (LS, 1-10 cpd). Genotyping was performed for 4 and 8 single nucleotide polymorphisms (SNPs) in the DRD4 and HTR2A genes, respectively. The C allele of rs1800955 in DRD4 was found to be associated with cigarette smoking in the HS vs. NS and LS vs. NS comparisons (p = 2.34E-03 and p = 1.13E-03, respectively); the association was maintained in the homozygous CC genotype (p = 5.00E-04 and p = 2.00E-04, respectively). The T allele of rs6313 in HTR2A was significantly associated with cigarette smoking and a greater degree of nicotine addiction (p = 4.77E-03, OR = 1.55); the association was maintained in the homozygous genotype (TT) (p = 4.90E-03, OR = 1.96). The A allele of rs6313 was associated with cigarette smoking in the HS vs. NS comparison (p = 1.53E-02, OR = 1.36); the risk was nearly doubled in the homozygous AA genotype (p = 1.30E-03, OR = 1.83) compared with the heterozygous GA genotype (OR = 1.38). Among Mexican mestizos, the C allele of rs1800955 in the DRD4 gene and the A allele of rs6311 in the HTR2A gene are associated with cigarette smoking, whereas the T allele of rs6313 in HTR2A is associated with cigarette smoking and the degree of nicotine addiction.

Assessment of the DNA damaging potential of environmental chemicals using a quantitative high-throughput screening approach to measure p53 activation.

PubMed

Witt, Kristine L; Hsieh, Jui-Hua; Smith-Roe, Stephanie L; Xia, Menghang; Huang, Ruili; Zhao, Jinghua; Auerbach, Scott S; Hur, Junguk; Tice, Raymond R

2017-08-01

Genotoxicity potential is a critical component of any comprehensive toxicological profile. Compounds that induce DNA or chromosomal damage often activate p53, a transcription factor essential to cell cycle regulation. Thus, within the US Tox21 Program, we screened a library of ∼10,000 (∼8,300 unique) environmental compounds and drugs for activation of the p53-signaling pathway using a quantitative high-throughput screening assay employing HCT-116 cells (p53 +/+ ) containing a stably integrated β-lactamase reporter gene under control of the p53 response element (p53RE). Cells were exposed (-S9) for 16 hr at 15 concentrations (generally 1.2 nM to 92 μM) three times, independently. Excluding compounds that failed analytical chemistry analysis or were suspected of inducing assay interference, 365 (4.7%) of 7,849 unique compounds were concluded to activate p53. As part of an in-depth characterization of our results, we first compared them with results from traditional in vitro genotoxicity assays (bacterial mutation, chromosomal aberration); ∼15% of known, direct-acting genotoxicants in our library activated the p53RE. Mining the Comparative Toxicogenomics Database revealed that these p53 actives were significantly associated with increased expression of p53 downstream genes involved in DNA damage responses. Furthermore, 53 chemical substructures associated with genotoxicity were enriched in certain classes of p53 actives, for example, anthracyclines (antineoplastics) and vinca alkaloids (tubulin disruptors). Interestingly, the tubulin disruptors manifested unusual nonmonotonic concentration response curves suggesting activity through a unique p53 regulatory mechanism. Through the analysis of our results, we aim to define a role for this assay as one component of a comprehensive toxicological characterization of large compound libraries. Environ. Mol. Mutagen. 58:494-507, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Aberrant p15, p16, p53, and DAPK Gene Methylation in Myelomagenesis: Clinical and Prognostic Implications.

PubMed

Geraldes, Catarina; Gonçalves, Ana Cristina; Cortesão, Emília; Pereira, Marta Isabel; Roque, Adriana; Paiva, Artur; Ribeiro, Letícia; Nascimento-Costa, José Manuel; Sarmento-Ribeiro, Ana Bela

2016-12-01

Aberrant DNA methylation is considered a crucial mechanism in the pathogenesis of monoclonal gammopathies. We aimed to investigate the contribution of hypermethylation of 4 tumor suppressor genes to the multistep process of myelomagenesis. The methylation status of p15, p16, p53, and DAPK genes was evaluated in bone marrow samples from 94 patients at diagnosis: monoclonal gammopathy of uncertain significance (MGUS) (n = 48), smoldering multiple myeloma (SMM) (n = 8) and symptomatic multiple myeloma (MM) (n = 38), and from 8 healthy controls by methylation-specific polymerase chain reaction analysis. Overall, 63% of patients with MM and 39% of patients with MGUS presented at least 1 hypermethylated gene (P < .05). No aberrant methylation was detected in normal bone marrow. The frequency of methylation for individual genes in patients with MGUS, SMM, and MM was p15, 15%, 50%, 21%; p16, 15%, 13%, 32%; p53, 2%, 12,5%, 5%, and DAPK, 19%, 25%, 39%, respectively (P < .05). No correlation was found between aberrant methylation and immunophenotypic markers, cytogenetic features, progression-free survival, and overall survival in patients with MM. The current study supports a relevant role for p15, p16, and DAPK hypermethylation in the genesis of the plasma cell neoplasm. DAPK hypermethylation also might be an important step in the progression from MGUS to MM. Copyright © 2016 Elsevier Inc. All rights reserved.

Prevention of carcinoma of cervix with human papillomavirus vaccine.

PubMed

Gavarasana, S; Kalasapudi, R S; Rao, T D; Thirumala, S

2000-01-01

Carcinoma of cervix is the most common cancer found among the women of India. Though cervical cytology screening was effective in preventing carcinoma of cervix in developed nations, it is considered unsuitable in developing countries. Recent research has established an etiological link between human papillomavirus infection and carcinoma of cervix. In this review, an attempt is made to answer the question, 'whether carcinoma of cervix can be prevented with human papillomavirus vaccine?' Literature search using Pubmed and Medline was carried out and relevant articles were reviewed. There is ample experimental evidence to show that DNA of human papillomavirus integrates with cervical cell genome. Viral genes E6 and E7 of HPV type 16 and 18 inactivate p53 function and Rb gene, thus immortalize the cervical epithelial cells. Recombinant vaccines blocked the function of E6 and E7 genes preventing development of papillomas in animals. Vaccination with HPV-VLPs encoding for genes of E6 and E7 neutralizes HPV integrated genome of malignant cells of uterine cervix. Based on experimental evidence, it is possible to prevent carcinoma of cervix with human papillomavirus vaccine, Further research is necessary to identify a effective and safe HPV vaccine, routes of administration and characteristics of potential beneficiaries.

Eradication of Large Solid Tumors by Gene Therapy with a T-Cell Receptor Targeting a Single Cancer-Specific Point Mutation.

PubMed

Leisegang, Matthias; Engels, Boris; Schreiber, Karin; Yew, Poh Yin; Kiyotani, Kazuma; Idel, Christian; Arina, Ainhoa; Duraiswamy, Jaikumar; Weichselbaum, Ralph R; Uckert, Wolfgang; Nakamura, Yusuke; Schreiber, Hans

2016-06-01

Cancers usually contain multiple unique tumor-specific antigens produced by single amino acid substitutions (AAS) and encoded by somatic nonsynonymous single nucleotide substitutions. We determined whether adoptively transferred T cells can reject large, well-established solid tumors when engineered to express a single type of T-cell receptor (TCR) that is specific for a single AAS. By exome and RNA sequencing of an UV-induced tumor, we identified an AAS in p68 (mp68), a co-activator of p53. This AAS seemed to be an ideal tumor-specific neoepitope because it is encoded by a trunk mutation in the primary autochthonous cancer and binds with highest affinity to the MHC. A high-avidity mp68-specific TCR was used to genetically engineer T cells as well as to generate TCR-transgenic mice for adoptive therapy. When the neoepitope was expressed at high levels and by all cancer cells, their direct recognition sufficed to destroy intratumor vessels and eradicate large, long-established solid tumors. When the neoepitope was targeted as autochthonous antigen, T cells caused cancer regression followed by escape of antigen-negative variants. Escape could be thwarted by expressing the antigen at increased levels in all cancer cells or by combining T-cell therapy with local irradiation. Therapeutic efficacies of TCR-transduced and TCR-transgenic T cells were similar. Gene therapy with a single TCR targeting a single AAS can eradicate large established cancer, but a uniform expression and/or sufficient levels of the targeted neoepitope or additional therapy are required to overcome tumor escape. Clin Cancer Res; 22(11); 2734-43. ©2015 AACRSee related commentary by Liu, p. 2602. ©2015 American Association for Cancer Research.

Prevention of the neurocristopathy Treacher Collins syndrome through inhibition of p53 function

PubMed Central

Jones, Natalie C; Lynn, Megan L; Gaudenz, Karin; Sakai, Daisuke; Aoto, Kazushi; Rey, Jean-Phillipe; Glynn, Earl F; Ellington, Lacey; Du, Chunying; Dixon, Jill; Dixon, Michael J; Trainor, Paul A

2010-01-01

Treacher Collins syndrome (TCS) is a congenital disorder of craniofacial development arising from mutations in TCOF1, which encodes the nucleolar phosphoprotein Treacle. Haploinsufficiency of Tcof1 perturbs mature ribosome biogenesis, resulting in stabilization of p53 and the cyclin G1–mediated cell-cycle arrest that underpins the specificity of neuroepithelial apoptosis and neural crest cell hypoplasia characteristic of TCS. Here we show that inhibition of p53 prevents cyclin G1–driven apoptotic elimination of neural crest cells while rescuing the craniofacial abnormalities associated with mutations in Tcof1 and extending life span. These improvements, however, occur independently of the effects on ribosome biogenesis; thus suggesting that it is p53-dependent neuroepithelial apoptosis that is the primary mechanism underlying the pathogenesis of TCS. Our work further implies that neuroepithelial and neural crest cells are particularly sensitive to cellular stress during embryogenesis and that suppression of p53 function provides an attractive avenue for possible clinical prevention of TCS craniofacial birth defects and possibly those of other neurocristopathies. PMID:18246078

Growth of Bacillus methanolicus in 2 M methanol at 50 °C: the effect of high methanol concentration on gene regulation of enzymes involved in formaldehyde detoxification by the ribulose monophosphate pathway.

PubMed

Bozdag, Ahmet; Komives, Claire; Flickinger, Michael C

2015-07-01

Bacillus methanolicus MGA3 is a Gram-positive aerobic methylotroph growing optimally at 50-53°C. Methylotrophy in B. methanolicus is encoded on pBM19 and by two chromosomal copies of the methanol dehydrogenase (mdh), hexulose phosphate synthase (hps) and phosphohexuloisomerase (phi) genes. However, there are no published studies on the regulation of methylotrophy or the dominant mechanism of detoxification of intracellular formaldehyde in response to high methanol concentration. The µ max of B. methanolicus MGA3 was assessed on methanol, mannitol and glucose. B. methanolicus achieved a µ max at 25 mM initial methanol of 0.65 ± 0.007 h(-1), which decreased to 0.231 ± 0.004 h(-1) at 2 M initial methanol. Slow growth was also observed with initial methanol concentrations of >2 M. The µ max on mannitol and glucose are 0.532 ± 0.002 and 0.336 ± 0.003 h(-1), respectively. Spiking cultures with additional methanol (100 mM) did not disturb the growth rate of methanol-grown cells, whereas, a 50 mM methanol spike halted the growth in mannitol. Surprisingly, growth in methanol was inhibited by 1 mM formaldehyde, while mannitol-grown cells tolerated 2 mM. Moreover, mannitol-grown cells removed formaldehyde faster than methanol-grown cells. Further, we show that methanol oxidation in B. methanolicus MGA3 is mainly carried out by the pBM19-encoded mdh. Formaldehyde and formate addition down-regulate the mdh and hps genes in methanol-grown cells. Similarly, they down-regulate mdh genes in mannitol-grown cells, but up-regulate hps. Phosphofructokinase (pfk) is up-regulated in both methanol and mannitol-grown cells, which suggests that pfk may be a possible synthetic methylotrophy target to reduce formaldehyde growth toxicity at high methanol concentrations.

Two novel families of plasmids from hyperthermophilic archaea encoding new families of replication proteins

PubMed Central

Soler, Nicolas; Marguet, Evelyne; Cortez, Diego; Desnoues, Nicole; Keller, Jenny; van Tilbeurgh, Herman; Sezonov, Guennadi; Forterre, Patrick

2010-01-01

Thermococcales (phylum Euryarchaeota) are model organisms for physiological and molecular studies of hyperthermophiles. Here we describe three new plasmids from Thermococcales that could provide new tools and model systems for genetic and molecular studies in Archaea. The plasmids pTN2 from Thermococcus nautilus sp. 30-1 and pP12-1 from Pyrococcus sp. 12-1 belong to the same family. They have similar size (∼12 kb) and share six genes, including homologues of genes encoded by the virus PAV1 from Pyrococcus abyssi. The plasmid pT26-2 from Thermococcus sp. 26-2 (21.5 kb), that corresponds to another plasmid family, encodes many proteins having homologues in virus-like elements integrated in several genomes of Thermococcales and Methanococcales. Our analyses confirm that viruses and plasmids are evolutionary related and co-evolve with their hosts. Whereas all plasmids previously isolated from Thermococcales replicate by the rolling circle mechanism, the three plasmids described here probably replicate by the theta mechanism. The plasmids pTN2 and pP12-1 encode a putative helicase of the SFI superfamily and a new family of DNA polymerase, whose activity was demonstrated in vitro, whereas pT26-2 encodes a putative new type of helicase. This strengthens the idea that plasmids and viruses are a reservoir of novel protein families involved in DNA replication. PMID:20403814

Posttranslational Protein Modifications in Type 1 Diabetes - Genetic Studies with PCMT1, the Repair Enzyme Protein Isoaspartate Methyltransferase (PIMT) Encoding Gene

PubMed Central

Wägner, Ana M.; Cloos, Paul; Bergholdt, Regine; Eising, Stefanie; Brorsson, Caroline; Stalhut, Martin; Christgau, Stephan; Nerup, Jørn; Pociot, Flemming

2008-01-01

BACKGROUND: Posttranslational protein modifications have been implicated in the development of autoimmunity. Protein L-isoaspartate (D-aspartate) O-methyltransferase (PIMT) repairs modified proteins and is encoded by PCMT1, located in a region linked to type 1 diabetes (T1D), namely IDDM5. AIM: To evaluate the association between genetic variations in the PCMT1 gene and T1D. METHODS: Firstly, PCMT1 was sequenced in 26 patients with T1D (linked to IDDM5) and 10 control subjects. The variations found in PCMT1 were then tested (alone and interacting with a functional polymorphism in SUMO4 and with HLA) for association with T1D in 253 families (using transmission disequilibrium test). In a third step, the association of the functional variation in PCMT1 (rs4816) with T1D was analyzed in 778 T1D patients and 749 controls (using chi-square test). In vitro promoter activity was assessed by transfecting INS-1E cells with PCMT1 promoter constructs and a reporter gene, with or without cytokine stimulation. RESULTS: Four polymorphisms in complete linkage disequilibrium were identified in PCMT1 (5' to the gene (rs11155676), exon 5 (rs4816) and exon 8 (rs7818 and rs4552)). In the whole cohort of 253 families, the allele associated with increased PIMT enzyme activity (rs4816, allele A) was less frequently transmitted to the affected than to the non-affected offspring (46% vs. 53%, p = 0.099). This finding was even more evident in the subset of families where the proband had high-risk SUMO4 (p = 0.069) or low-risk HLA (p = 0.086). Surprisingly, in the case-control study with 778 cases and 749 controls, an inverse trend was found (40.36% of patients and 36.98% of controls had the allele, p = 0.055). PCMT1 promoter activity increased with cytokine stimulation, but no differences were detected between the constructs adjacent to rs11155676. CONCLUSION: PCMT1 was virtually associated with T1D in groups defined by other risk genes (SUMO4 and HLA). A general association in a not further defined sample of T1D patients was not evident. Verification in a larger population is needed. PMID:19290383