Sample records for gene family lessons

  1. The aquaporin gene family of the ectomycorrhizal fungus Laccaria bicolor: lessons for symbiotic functions.


    Dietz, Sandra; von Bülow, Julia; Beitz, Eric; Nehls, Uwe


    Soil humidity and bulk water transport are essential for nutrient mobilization. Ectomycorrhizal fungi, bridging soil and fine roots of woody plants, are capable of modulating both by being integrated into water movement driven by plant transpiration and the nocturnal hydraulic lift. Aquaporins are integral membrane proteins that function as gradient-driven water and/or solute channels. Seven aquaporins were identified in the genome of the ectomycorrhizal basidiomycete Laccaria bicolor and their role in fungal transfer processes was analyzed. Heterologous expression in Xenopus laevis oocytes revealed relevant water permeabilities for three aquaporins. In fungal mycelia, expression of the corresponding genes was high compared with other members of the gene family, indicating the significance of the respective proteins for plasma membrane water permeability. As growth temperature and ectomycorrhiza formation modified gene expression profiles of these water-conducting aquaporins, specific roles in those aspects of fungal physiology are suggested. Two aquaporins, which were highly expressed in ectomycorrhizas, conferred plasma membrane ammonia permeability in yeast. This indicates that these proteins are an integral part of ectomycorrhizal fungus-based plant nitrogen nutrition in symbiosis.

  2. Lessons from Yeast on Emerging Roles of the ATAD2 Protein Family in Gene Regulation and Genome Organization

    PubMed Central

    Cattaneo, Matteo; Morozumi, Yuichi; Perazza, Daniel; Boussouar, Fayçal; Jamshidikia, Mahya; Rousseaux, Sophie; Verdel, André; Khochbin, Saadi


    ATAD2, a remarkably conserved, yet poorly characterized factor is found upregulated and associated with poor prognosis in a variety of independent cancers in human. Studies conducted on the yeast Saccharomyces cerevisiae ATAD2 homologue, Yta7, are now indicating that the members of this family may primarily be regulators of chromatin dynamics and that their action on gene expression could only be one facet of their general activity. In this review, we present an overview of the literature on Yta7 and discuss the possibility of translating these findings into other organisms to further define the involvement of ATAD2 and other members of its family in regulating chromatin structure and function both in normal and pathological situations. PMID:25377252

  3. Lessons from yeast on emerging roles of the ATAD2 protein family in gene regulation and genome organization.


    Cattaneo, Matteo; Morozumi, Yuichi; Perazza, Daniel; Boussouar, Fayçal; Jamshidikia, Mahya; Rousseaux, Sophie; Verdel, André; Khochbin, Saadi


    ATAD2, a remarkably conserved, yet poorly characterized factor is found upregulated and associated with poor prognosis in a variety of independent cancers in human. Studies conducted on the yeast Saccharomyces cerevisiae ATAD2 homologue, Yta7, are now indicating that the members of this family may primarily be regulators of chromatin dynamics and that their action on gene expression could only be one facet of their general activity. In this review, we present an overview of the literature on Yta7 and discuss the possibility of translating these findings into other organisms to further define the involvement of ATAD2 and other members of its family in regulating chromatin structure and function both in normal and pathological situations.

  4. Characterizing gene family evolution

    PubMed Central

    Liberles, David A.


    Gene families are widely used in comparative genomics, molecular evolution, and in systematics. However, they are constructed in different manners, their data analyzed and interpreted differently, with different underlying assumptions, leading to sometimes divergent conclusions. In systematics, concepts like monophyly and the dichotomy between homoplasy and homology have been central to the analysis of phylogenies. We critique the traditional use of such concepts as applied to gene families and give examples of incorrect inferences they may lead to. Operational definitions that have emerged within functional genomics are contrasted with the common formal definitions derived from systematics. Lastly, we question the utility of layers of homology and the meaning of homology at the character state level in the context of sequence evolution. From this, we move forward to present an idealized strategy for characterizing gene family evolution for both systematic and functional purposes, including recent methodological improvements. PMID:19461954

  5. The sulfatase gene family.


    Parenti, G; Meroni, G; Ballabio, A


    During the past few years, molecular analyses have provided important insights into the biochemistry and genetics of the sulfatase family of enzymes, identifying the molecular bases of inherited diseases caused by sulfatase deficiencies. New members of the sulfatase gene family have been identified in man and other species using a genomic approach. These include the gene encoding arylsulfatase E, which is involved in X-linked recessive chondrodysplasia punctata, a disorder of cartilage and bone development. Another important breakthrough has been the discovery of the biochemical basis of multiple sulfatase deficiency, an autosomal recessive disorder characterized by a severe of all sulfatase activities. These discoveries, together with the resolution of the crystallographic structure of sulfatases, have improved our understanding of the function and evolution of this fascinating family of enzymes.

  6. Weak Polygenic Selection Drives the Rapid Adaptation of the Chemosensory System: Lessons from the Upstream Regions of the Major Gene Families

    PubMed Central

    Librado, Pablo; Rozas, Julio


    The animal chemosensory system is involved in essential biological processes, most of them mediated by proteins encoded in multigene families. These multigene families have been fundamental for the adaptation to new environments, significantly contributing to phenotypic variation. This adaptive potential contrasts, however, with the lack of studies at their upstream regions, especially taking into account the evidence linking their transcriptional changes to certain phenotypic effects. Here, we explicitly characterize the contribution of the upstream sequences of the major chemosensory gene families to rapid adaptive processes. For that, we analyze the genome sequences of 158 lines from a population of Drosophila melanogaster that recently colonized North America, and integrate functional and transcriptional data available for this species. We find that both, strong negative and strong positive selection, shape transcriptional evolution at the genome-wide level. The chemosensory upstream regions, however, exhibit a distinctive adaptive landscape, including multiple mutations of small beneficial effect and a reduced number of cis-regulatory elements. Together, our results suggest that the promiscuous and partially redundant transcription and function of the chemosensory genes provide evolutionarily opportunities for rapid adaptive episodes through weak polygenic selection. PMID:27503297

  7. Gene therapy oversight: lessons for nanobiotechnology.


    Wolf, Susan M; Gupta, Rishi; Kohlhepp, Peter


    Oversight of human gene transfer research ("gene therapy") presents an important model with potential application to oversight of nanobiology research on human participants. Gene therapy oversight adds centralized federal review at the National Institutes of Health's Office of Biotechnology Activities and its Recombinant DNA Advisory Committee to standard oversight of human subjects research at the researcher's institution (by the Institutional Review Board and, for some research, the Institutional Biosafety Committee) and at the federal level by the Office for Human Research Protections. The Food and Drug Administration's Center for Biologics Evaluation and Research oversees human gene transfer research in parallel, including approval of protocols and regulation of products. This article traces the evolution of this dual oversight system; describes how the system is already addressing nanobiotechnology in gene transfer: evaluates gene therapy oversight based on public opinion, the literature, and preliminary expert elicitation; and offers lessons of the gene therapy oversight experience for oversight of nanobiotechnology.

  8. Caring for the Family Caregiver: Lessons Learned in Child Health.


    Keilty, Krista; Cohen, Eyal


    Policy to support informal caregivers is a critical health policy issue in Canada. Lessons may be learned from the perspectives and experience in the child health field with applicability for all cared-for persons and their informal caregivers. Familycentred care addresses the centrality of the family caregiver in the design and delivery of health services. A life course approach focuses on key periods of transition and downstream effects facing caregivers over their lifetime. The medical home model where care delivery is more coordinated offers potential direct cost savings for both family caregivers and the healthcare system. Models of pediatric home care that focus on promoting caregiver capacity and integration of unregulated providers show the promise of being acceptable and sustainable solutions to increasing demands for caregiver respite. Finally, a number of assumptions that are somewhat unique to the pediatric caregiver experience are explored and/or challenged. These lessons and assumptions may provide insight for policymakers in the development of systems and supports for all cared-for persons and their caregivers in Canada.

  9. The Insect SNMP Gene Family

    DTIC Science & Technology


    The insect SNMP gene family Richard G. Vogt a,*,1, Natalie E. Miller a, Rachel Litvack a, Richard A. Fandino a, Jackson Sparks a, Jon Staples a...Wallace Beltsville Agricultural Research Center Plant Sciences Institute, Invasive Insect Biocontrol and Behavior Laboratory, Bldg. 007, Rm. 030...keywords: Pheromone Receptors Olfactory Gustatory Chemosensory Gustatory Mosquito Fly a b s t r a c t SNMPs are membrane proteins observed to associate with

  10. Familial aggregation analysis of gene expressions

    PubMed Central

    Rao, Shao-Qi; Xu, Liang-De; Zhang, Guang-Mei; Li, Xia; Li, Lin; Shen, Gong-Qing; Jiang, Yang; Yang, Yue-Ying; Gong, Bin-Sheng; Jiang, Wei; Zhang, Fan; Xiao, Yun; Wang, Qing K


    Traditional studies of familial aggregation are aimed at defining the genetic (and non-genetic) causes of a disease from physiological or clinical traits. However, there has been little attempt to use genome-wide gene expressions, the direct phenotypic measures of genes, as the traits to investigate several extended issues regarding the distributions of familially aggregated genes on chromosomes or in functions. In this study we conducted a genome-wide familial aggregation analysis by using the in vitro cell gene expressions of 3300 human autosome genes (Problem 1 data provided to Genetic Analysis Workshop 15) in order to answer three basic genetics questions. First, we investigated how gene expressions aggregate among different types (degrees) of relative pairs. Second, we conducted a bioinformatics analysis of highly familially aggregated genes to see how they are distributed on chromosomes. Third, we performed a gene ontology enrichment test of familially aggregated genes to find evidence to support their functional consensus. The results indicated that 1) gene expressions did aggregate in families, especially between sibs. Of 3300 human genes analyzed, there were a total of 1105 genes with one or more significant (empirical p < 0.05) familial correlation; 2) there were several genomic hot spots where highly familially aggregated genes (e.g., the chromosome 6 HLA genes cluster) were clustered; 3) as we expected, gene ontology enrichment tests revealed that the 1105 genes were aggregating not only in families but also in functional categories. PMID:18466548

  11. The insect SNMP gene family.


    Vogt, Richard G; Miller, Natalie E; Litvack, Rachel; Fandino, Richard A; Sparks, Jackson; Staples, Jon; Friedman, Robert; Dickens, Joseph C


    SNMPs are membrane proteins observed to associate with chemosensory neurons in insects; in Drosophila melanogaster, SNMP1 has been shown to be essential for the detection of the pheromone cis-vaccenyl acetate (CVA). SNMPs are one of three insect gene clades related to the human fatty acid transporter CD36. We previously characterized the CD36 gene family in 4 insect Orders that effectively cover the Holometabola, or some 80% of known insect species and the 300 million years of evolution since this lineage emerged: Lepidoptera (e.g. Bombyx mori, Antheraea polyphemus, Manduca sexta, Heliothis virescens, Helicoverpa assulta, Helicoverpa armigera, Mamestra brassicae); Diptera (D. melanogaster, Drosophila pseudoobscura, Aedes aegypti, Anopheles gambiae, Culex pipiens quinquefasciatus); Hymenoptera (Apis mellifera); and Coleoptera (Tribolium castaneum). This previous study suggested a complex topography within the SNMP clade including a strongly supported SNMP1 sub-clade plus additional SNMP genes. To further resolve the SNMP clade here, we used cDNA sequences of SNMP1 and SNMP2 from various Lepidoptera species, D. melanogaster and Ae. aegypti, as well as BAC derived genomic sequences from Ae. aegypti as models for proposing corrected sequences of orthologues in the D. pseudoobscura and An. gambiae genomes, and for identifying orthologues in the B. mori and C. pipiens q. genomes. We then used these sequences to analyze the SNMP clade of the insect CD36 gene family, supporting the existence of two well supported sub-clades, SNMP1 and SNMP2, throughout the dipteran and lepidopteran lineages, and plausibly throughout the Holometabola and across a broad evolutionary time scale. We present indirect evidence based on evolutionary selection (dN/dS) that the dipteran SNMPs are expressed as functional proteins. We observed expansions of the SNMP1 sub-clade in C. pipiens q. and T. castaneum suggesting that the SNMP1s may have an expanded functional role in these species.

  12. Lineage-Specific Expansion of IFIT Gene Family: An Insight into Coevolution with IFN Gene Family

    PubMed Central

    Liu, Ying; Zhang, Yi-Bing; Liu, Ting-Kai; Gui, Jian-Fang


    In mammals, IFIT (Interferon [IFN]-induced proteins with Tetratricopeptide Repeat [TPR] motifs) family genes are involved in many cellular and viral processes, which are tightly related to mammalian IFN response. However, little is known about non-mammalian IFIT genes. In the present study, IFIT genes are identified in the genome databases from the jawed vertebrates including the cartilaginous elephant shark but not from non-vertebrates such as lancelet, sea squirt and acorn worm, suggesting that IFIT gene family originates from a vertebrate ancestor about 450 million years ago. IFIT family genes show conserved gene structure and gene arrangements. Phylogenetic analyses reveal that this gene family has expanded through lineage-specific and species-specific gene duplication. Interestingly, IFN gene family seem to share a common ancestor and a similar evolutionary mechanism; the function link of IFIT genes to IFN response is present early since the origin of both gene families, as evidenced by the finding that zebrafish IFIT genes are upregulated by fish IFNs, poly(I:C) and two transcription factors IRF3/IRF7, likely via the IFN-stimulated response elements (ISRE) within the promoters of vertebrate IFIT family genes. These coevolution features creates functional association of both family genes to fulfill a common biological process, which is likely selected by viral infection during evolution of vertebrates. Our results are helpful for understanding of evolution of vertebrate IFN system. PMID:23818968

  13. Metazoan Gene Families from Metazome

    DOE Data Explorer

    Metazome is a joint project of the Department of Energy's Joint Genome Institute and the Center for Integrative Genomics to facilitate comparative genomic studies amongst metazoans. Clusters of orthologous and paralogous genes that represent the modern descendents of ancestral gene sets are constructed at key phylogenetic nodes. These clusters allow easy access to clade specific orthology/paralogy relationships as well as clade specific genes and gene expansions. As of version 2.0.4, Metazome provides access to twenty-four sequenced and annotated metazoan genomes, clustered at nine evolutionarily significant nodes. Where possible, each gene has been annotated with PFAM, KOG, KEGG, and PANTHER assignments, and publicly available annotations from RefSeq, UniProt, Ensembl, and JGI are hyper-linked and searchable. The included organisms (by common name) are: Human, Mouse, Rat, Dog, Opossum, Chicken, Frog, Stickleback, Medaka, Fugu pufferfish; Zebrafish, Seasquirt - savignyi, Seasquirt - intestinalis, Amphioxus, Sea Urchin, Fruitfly, Mosquite, Yellow Fever Mosquito, Silkworm, Red Flour Beetle, Worm, Briggsae Worm, Owl limpet (snail), and Sea anemone. [Copied from Metazome Overview at

  14. Airman and Family Resilience: Lessons from the Scientific Literature

    DTIC Science & Technology


    Force families. Efforts to boost resilience have become an important military response to suicide and other markers of distress and poor health. The...traumatic stress disorder; substance abuse; family dysfunction; and, in extreme cases, even suicide or suicide attempts. With the aim of preventing such...1   Suicide Prevention and Military Interest in Resilience Research

  15. Family reunion--the ZIP/prion gene family.


    Ehsani, Sepehr; Huo, Hairu; Salehzadeh, Ashkan; Pocanschi, Cosmin L; Watts, Joel C; Wille, Holger; Westaway, David; Rogaeva, Ekaterina; St George-Hyslop, Peter H; Schmitt-Ulms, Gerold


    Prion diseases are fatal neurodegenerative diseases of humans and animals which, in addition to sporadic and familial modes of manifestation, can be acquired via an infectious route of propagation. In disease, the prion protein (PrP(C)) undergoes a structural transition to its disease-causing form (PrP(Sc)) with profoundly different physicochemical properties. Surprisingly, despite intense interest in the prion protein, its function in the context of other cellular activities has largely remained elusive. We recently employed quantitative mass spectrometry to characterize the interactome of the prion protein in a murine neuroblastoma cell line (N2a), an established cell model for prion replication. Extensive bioinformatic analyses subsequently established an evolutionary link between the prion gene family and the family of ZIP (Zrt-, Irt-like protein) metal ion transporters. More specifically, sequence alignments, structural threading data and multiple additional pieces of evidence placed a ZIP5/ZIP6/ZIP10-like ancestor gene at the root of the PrP gene family. In this review we examine the biology of prion proteins and ZIP transporters from the viewpoint of a shared phylogenetic origin. We summarize and compare available data that shed light on genetics, function, expression, signaling, post-translational modifications and metal binding preferences of PrP and ZIP family members. Finally, we explore data indicative of retropositional origins of the prion gene founder and discuss a possible function for the prion-like (PL) domain within ZIP transporters. While throughout the article emphasis is placed on ZIP proteins, the intent is to highlight connections between PrP and ZIP transporters and uncover promising directions for future research.

  16. The human crystallin gene families

    PubMed Central


    Crystallins are the abundant, long-lived proteins of the eye lens. The major human crystallins belong to two different superfamilies: the small heat-shock proteins (α-crystallins) and the βγ-crystallins. During evolution, other proteins have sometimes been recruited as crystallins to modify the properties of the lens. In the developing human lens, the enzyme betaine-homocysteine methyltransferase serves such a role. Evolutionary modification has also resulted in loss of expression of some human crystallin genes or of specific splice forms. Crystallin organization is essential for lens transparency and mutations; even minor changes to surface residues can cause cataract and loss of vision. PMID:23199295

  17. Gene-Family Extension Measures and Correlations

    PubMed Central

    Carmi, Gon; Bolshoy, Alexander


    The existence of multiple copies of genes is a well-known phenomenon. A gene family is a set of sufficiently similar genes, formed by gene duplication. In earlier works conducted on a limited number of completely sequenced and annotated genomes it was found that size of gene family and size of genome are positively correlated. Additionally, it was found that several atypical microbes deviated from the observed general trend. In this study, we reexamined these associations on a larger dataset consisting of 1484 prokaryotic genomes and using several ranking approaches. We applied ranking methods in such a way that genomes with lower numbers of gene copies would have lower rank. Until now only simple ranking methods were used; we applied the Kemeny optimal aggregation approach as well. Regression and correlation analysis were utilized in order to accurately quantify and characterize the relationships between measures of paralog indices and genome size. In addition, boxplot analysis was employed as a method for outlier detection. We found that, in general, all paralog indexes positively correlate with an increase of genome size. As expected, different groups of atypical prokaryotic genomes were found for different types of paralog quantities. Mycoplasmataceae and Halobacteria appeared to be among the most interesting candidates for further research of evolution through gene duplication. PMID:27527218

  18. The glutamine synthetase gene family in Populus

    PubMed Central


    Background Glutamine synthetase (GS; EC:, L-glutamate: ammonia ligase ADP-forming) is a key enzyme in ammonium assimilation and metabolism of higher plants. The current work was undertaken to develop a more comprehensive understanding of molecular and biochemical features of GS gene family in poplar, and to characterize the developmental regulation of GS expression in various tissues and at various times during the poplar perennial growth. Results The GS gene family consists of 8 different genes exhibiting all structural and regulatory elements consistent with their roles as functional genes. Our results indicate that the family members are organized in 4 groups of duplicated genes, 3 of which code for cytosolic GS isoforms (GS1) and 1 which codes for the choroplastic GS isoform (GS2). Our analysis shows that Populus trichocarpa is the first plant species in which it was observed the complete GS family duplicated. Detailed expression analyses have revealed specific spatial and seasonal patterns of GS expression in poplar. These data provide insights into the metabolic function of GS isoforms in poplar and pave the way for future functional studies. Conclusions Our data suggest that GS duplicates could have been retained in order to increase the amount of enzyme in a particular cell type. This possibility could contribute to the homeostasis of nitrogen metabolism in functions associated to changes in glutamine-derived metabolic products. The presence of duplicated GS genes in poplar could also contribute to diversification of the enzymatic properties for a particular GS isoform through the assembly of GS polypeptides into homo oligomeric and/or hetero oligomeric holoenzymes in specific cell types. PMID:21867507

  19. Lessons from a remarkable family with dopa-responsive dystonia.

    PubMed Central

    Harwood, G; Hierons, R; Fletcher, N A; Marsden, C D


    A family is described in which dopa-responsive dystonia affected six members and segregated in an autosomal dominant fashion. Patients either presented in childhood with dystonia of the legs, going to develop parkinsonism and pseudo-pyramidal deficits, or in adult life with parkinsonian tremor and rigidity, with pseudo-pyramidal signs. Remarkably, in the three cases with childhood onset the symptoms and signs of the condition were abolished 36 to 52 years later by small doses of levodopa. No long term side effects of levodopa have appeared after 15 years of treatment. PMID:8163996

  20. Evolutionary history of the Asr gene family.


    Frankel, Nicolás; Carrari, Fernando; Hasson, Esteban; Iusem, Norberto D


    The Asr gene family is widespread in higher plants. Most Asr genes are up-regulated under different environmental stress conditions and during fruit ripening. ASR proteins are localized in the nucleus and their likely function is transcriptional regulation. In cultivated tomato, we identified a novel fourth family member, named Asr4, which maps close to its sibling genes Asr1-Asr2-Asr3 and displays an unshared region coding for a domain containing a 13-amino acid repeat. In this work we were able to expand our previous analysis for Asr2 and investigated the coding regions of the four known Asr paralogous genes in seven tomato species from different geographic locations. In addition, we performed a phylogenetic analysis on ASR proteins. The first conclusion drawn from this work is that tomato ASR proteins cluster together in the tree. This observation can be explained by a scenario of concerted evolution or birth and death of genes. Secondly, our study showed that Asr1 is highly conserved at both replacement and synonymous sites within the genus Lycopersicon. ASR1 protein sequence conservation might be associated with its multiple functions in different tissues while the low rate of synonymous substitutions suggests that silent variation in Asr1 is selectively constrained, which is probably related to its high expression levels. Finally, we found that Asr1 activation under water stress is not conserved between Lycopersicon species.

  1. NFAT Gene Family in Inflammation and Cancer

    PubMed Central

    Pan, M.-G.; Xiong, Y.; Chen, F.


    Calcineurin-NFAT signaling is critical for numerous aspects of vertebrate function during and after embryonic development. Initially discovered in T cells, the NFAT gene family, consisting of five members, regulates immune system, inflammatory response, angiogenesis, cardiac valve formation, myocardial development, axonal guidance, skeletal muscle development, bone homeostasis, development and metastasis of cancer, and many other biological processes. In this review we will focus on the NFAT literature relevant to the two closely related pathological systems: inflammation and cancer. PMID:22950383

  2. Family Lessons and Funds of Knowledge: College-Going Paths in Mexican American Families

    ERIC Educational Resources Information Center

    Kiyama, Judy Marquez


    Families are crucial in the development of a college-going culture in the home. This qualitative study illustrates that Mexican American families are no exception. Using a multiple case study design, this study explored the funds of knowledge present in Mexican American families. Findings from this study reveal how daily educational practices,…

  3. The Pax gene family: Highlights from cephalopods

    PubMed Central

    Baratte, Sébastien; Andouche, Aude; Bonnaud-Ponticelli, Laure


    Pax genes play important roles in Metazoan development. Their evolution has been extensively studied but Lophotrochozoa are usually omitted. We addressed the question of Pax paralog diversity in Lophotrochozoa by a thorough review of available databases. The existence of six Pax families (Pax1/9, Pax2/5/8, Pax3/7, Pax4/6, Paxβ, PoxNeuro) was confirmed and the lophotrochozoan Paxβ subfamily was further characterized. Contrary to the pattern reported in chordates, the Pax2/5/8 family is devoid of homeodomain in Lophotrochozoa. Expression patterns of the three main pax classes (pax2/5/8, pax3/7, pax4/6) during Sepia officinalis development showed that Pax roles taken as ancestral and common in metazoans are modified in S. officinalis, most likely due to either the morphological specificities of cephalopods or to their direct development. Some expected expression patterns were missing (e.g. pax6 in the developing retina), and some expressions in unexpected tissues have been found (e.g. pax2/5/8 in dermal tissue and in gills). This study underlines the diversity and functional plasticity of Pax genes and illustrates the difficulty of using probable gene homology as strict indicator of homology between biological structures. PMID:28253300

  4. Rubisco small subunit gene family in cassava.


    Yeo, T W; Mak, Y M; Ho, K K


    Cassava leaves of two different cultivars, Brazil and Buloh, were used to isolate mRNA. The mRNA isolated was successfully used in the construction of cDNA libraries for each of the cultivars. The cDNA libraries were screened for members of ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit gene family and positive clones were sequenced. A total of seven different SSU genes, of which five were from cultivar Brazil and two were from cultivar Buloh, were isolated. Comparison results show that even though all the sequences are highly similar, they can be classified into three subfamilies. Homology between members of the same subfamily is higher than homology between members from the same cultivar.

  5. The tomato cis-prenyltransferase gene family.


    Akhtar, Tariq A; Matsuba, Yuki; Schauvinhold, Ines; Yu, Geng; Lees, Hazel A; Klein, Samuel E; Pichersky, Eran


    cis-prenyltransferases (CPTs) are predicted to be involved in the synthesis of long-chain polyisoprenoids, all with five or more isoprene (C5) units. Recently, we identified a short-chain CPT, neryl diphosphate synthase (NDPS1), in tomato (Solanum lycopersicum). Here, we searched the tomato genome and identified and characterized its entire CPT gene family, which comprises seven members (SlCPT1-7, with NDPS1 designated as SlCPT1). Six of the SlCPT genes encode proteins with N-terminal targeting sequences, which, when fused to GFP, mediated GFP transport to the plastids of Arabidopsis protoplasts. The SlCPT3-GFP fusion protein was localized to the cytosol. Enzymatic characterization of recombinant SlCPT proteins demonstrated that SlCPT6 produces Z,Z-FPP, and SlCPT2 catalyzes the formation of nerylneryl diphosphate while SlCPT4, SlCPT5 and SlCPT7 synthesize longer-chain products (C25-C55). Although no in vitro activity was demonstrated for SlCPT3, its expression in the Saccharomyces cerevisiae dolichol biosynthesis mutant (rer2) complemented the temperature-sensitive growth defect. Transcripts of SlCPT2, SlCPT4, SlCPT5 and SlCPT7 are present at low levels in multiple tissues, SlCPT6 is exclusively expressed in red fruit and roots, and SlCPT1, SlCPT3 and SlCPT7 are highly expressed in trichomes. RNAi-mediated suppression of NDPS1 led to a large decrease in β-phellandrene (which is produced from neryl diphosphate), with greater reductions achieved with the general 35S promoter compared to the trichome-specific MKS1 promoter. Phylogenetic analysis revealed CPT gene families in both eudicots and monocots, and showed that all the short-chain CPT genes from tomato (SlCPT1, SlCPT2 and SlCPT6) are closely linked to terpene synthase gene clusters.

  6. Tumor suppressor genes in familial adenomatous polyposis

    PubMed Central

    Eshghifar, Nahal; Farrokhi, Naser; Naji, Tahereh; Zali, Mohammadreza


    Colorectal cancer (CRC) is mostly due to a series of genetic alterations that are being greatly under the influence of the environmental factors. These changes, mutational or epigenetic modifications at transcriptional forefront and/or post-transcriptional effects via miRNAs, include inactivation and the conversion of proto-oncogene to oncogenes, and/or inactivation of tumor suppressor genes (TSG). Here, a thorough review was carried out on the role of TSGs with the focus on the APC as the master regulator, mutated genes and mal-/dysfunctional pathways that lead to one type of hereditary form of the CRC; namely familial adenomatous polyposis (FAP). This review provides a venue towards defining candidate genes that can be used as new PCR-based markers for early diagnosis of FAP. In addition to diagnosis, defining the modes of genetic alterations will open door towards genome editing to either suppress the disease or reduce its progression during the course of action. PMID:28331559

  7. The Arabidopsis Cyclophilin Gene Family1

    PubMed Central

    Romano, Patrick G.N.; Horton, Peter; Gray, Julie E.


    Database searching has allowed the identification of a number of previously unreported single and multidomain isoform members of the Arabidopsis cyclophilin gene family. In addition to the cyclophilin-like peptidyl-prolyl cis-trans isomerase domain, the latter contain a variety of other domains with characterized functions. Transcriptional analysis showed they are expressed throughout the plant, and different isoforms are present in all parts of the cell including the cytosol, nucleus, mitochondria, secretory pathway, and chloroplast. The abundance and diversity of cyclophilin isoforms suggests that, like their animal counterparts, plant cyclophilins are likely to be important proteins involved in a wide variety of cellular processes. As well as fulfilling the basic role of protein folding, they may also play important roles in mRNA processing, protein degradation, and signal transduction and thus may be crucial during both development and stress responsiveness. PMID:15051864

  8. Modelling the evolution of multi-gene families.


    Nye, Tom M W


    A number of biological processes can lead to genes being copied within the genome of some given species. Duplicate genes of this form are called paralogs and such genes share a high degree sequence similarity as well as often having closely related functions. Some genes have become widely duplicated to form multigene families in which the copies are distributed both within the genomes of individual species and across different species. Statistical modelling of gene duplication and the evolution of multi-gene families currently lags behind well-established models of DNA sequence evolution despite an increasing volume of available data, but the analysis of multi-gene families is important as part of a wider effort to understand evolution at the genomic level. This article reviews existing approaches to modelling multi-gene families and presents various challenges and possibilities for this exciting area of research.

  9. Evolutionary analyses of non-family genes in plants

    SciTech Connect

    Ye, Chuyu; Li, Ting; Yin, Hengfu; Weston, David; Tuskan, Gerald A; Tschaplinski, Timothy J; Yang, Xiaohan


    There are a large number of non-family (NF) genes that do not cluster into families with three or more members per genome. While gene families have been extensively studied, a systematic analysis of NF genes has not been reported. We performed comparative studies on NF genes in 14 plant species. Based on the clustering of protein sequences, we identified ~94 000 NF genes across these species that were divided into five evolutionary groups: Viridiplantae wide, angiosperm specific, monocot specific, dicot specific, and those that were species specific. Our analysis revealed that the NF genes resulted largely from less frequent gene duplications and/or a higher rate of gene loss after segmental duplication relative to genes in both lowcopy- number families (LF; 3 10 copies per genome) and high-copy-number families (HF; >10 copies). Furthermore, we identified functions enriched in the NF gene set as compared with the HF genes. We found that NF genes were involved in essential biological processes shared by all plant lineages (e.g. photosynthesis and translation), as well as gene regulation and stress responses associated with phylogenetic diversification. In particular, our analysis of an Arabidopsis protein protein interaction network revealed that hub proteins with the top 10% most connections were over-represented in the NF set relative to the HF set. This research highlights the roles that NF genes may play in evolutionary and functional genomics research.

  10. Evolutionary analyses of non-family genes in plants

    SciTech Connect

    Ye, Chuyu; Li, Ting; Yin, Hengfu; Weston, David; Tuskan, Gerald A; Tschaplinski, Timothy J; Yang, Xiaohan


    There are a large number of non-family (NF) genes that do not cluster into families with three or more members per genome. While gene families have been extensively studied, a systematic analysis of NF genes has not been reported. We performed comparative studies on NF genes in 14 plant species. Based on the clustering of protein sequences, we identified ~94,000 NF genes across these species that were divided into five evolutionary groups: Viridiplantae-wide, angiosperm-specific, monocot-specific, dicot-specific, and those that were species-specific. Our analysis revealed that the NF genes resulted largely from less frequent gene duplications and/or a higher rate of gene loss after segmental duplication relative to genes in both low-copy-number families (LF; 3 10 copies per genome) and high-copy-number families (HF; >10 copies). Furthermore, we identified functions enriched in the NF gene set as compared with the HF genes. We found that NF genes were involved in essential biological processes shared by all plant lineages (e.g., photosynthesis and translation), as well as gene regulation and stress responses associated with phylogenetic diversification. In particular, our analysis of an Arabidopsis protein-protein interaction network revealed that hub proteins with the top 10% most connections were over-represented in the NF set relative to the HF set. This research highlights the roles that NF genes may play in evolutionary and functional genomics research.

  11. The yeast ubiquitin genes: a family of natural gene fusions.

    PubMed Central

    Ozkaynak, E; Finley, D; Solomon, M J; Varshavsky, A


    Ubiquitin is a 76-residue protein highly conserved among eukaryotes. Conjugation of ubiquitin to intracellular proteins mediates their selective degradation in vivo. We describe a family of four ubiquitin-coding loci in the yeast Saccharomyces cerevisiae. UB11, UB12 and UB13 encode hybrid proteins in which ubiquitin is fused to unrelated ('tail') amino acid sequences. The ubiquitin coding elements of UB11 and UB12 are interrupted at identical positions by non-homologous introns. UB11 and UB12 encode identical 52-residue tails, whereas UB13 encodes a different 76-residue tail. The tail amino acid sequences are highly conserved between yeast and mammals. Each tail contains a putative metal-binding, nucleic acid-binding domain of the form Cys-X2-4-Cys-X2-15-Cys-X2-4-Cys, suggesting that these proteins may function by binding to DNA. The fourth gene, UB14, encodes a polyubiquitin precursor protein containing five ubiquitin repeats in a head-to-tail, spacerless arrangement. All four ubiquitin genes are expressed in exponentially growing cells, while in stationary-phase cells the expression of UB11 and UB12 is repressed. The UB14 gene, which is strongly inducible by starvation, high temperatures and other stresses, contains in its upstream region strong homologies to the consensus 'heat shock box' nucleotide sequence. Elsewhere we show that the essential function of the UB14 gene is to provide ubiquitin to cells under stress. Images Fig. 1. Fig. 7. PMID:3038523

  12. Functional divergence in the Arabidopsis LOB-domain gene family

    PubMed Central

    Mangeon, Amanda; Lin, Wan-ching; Springer, Patricia S.


    The Arabidopsis LOB-domain (LBD) gene family is composed by 43 members divided in two classes based on amino acid conservation within the LOB-domain. The LOB domain is known to be responsible for DNA binding and protein-protein interactions. There is very little functional information available for most genes in the LBD family and many lbd single mutants do not exhibit conspicuous phenotypes. One plausible explanation for the limited loss-of-function phenotypes observed in this family is that LBD genes exhibit significant functional redundancy. Here we discuss an example of one phylogenetic subgroup of the LBD family, in which genes that are closely related based on phylogeny exhibit distinctly different expression patterns and do not have overlapping functions. We discuss the challenges of using phylogenetic analyses to predict redundancy in gene families. PMID:23073009

  13. Complexity of the MSG gene family of Pneumocystis carinii

    PubMed Central

    Keely, Scott P; Stringer, James R


    Background The relationship between the parasitic fungus Pneumocystis carinii and its host, the laboratory rat, presumably involves features that allow the fungus to circumvent attacks by the immune system. It is hypothesized that the major surface glycoprotein (MSG) gene family endows Pneumocystis with the capacity to vary its surface. This gene family is comprised of approximately 80 genes, which each are approximately 3 kb long. Expression of the MSG gene family is regulated by a cis-dependent mechanism that involves a unique telomeric site in the genome called the expression site. Only the MSG gene adjacent to the expression site is represented by messenger RNA. Several P. carinii MSG genes have been sequenced, which showed that genes in the family can encode distinct isoforms of MSG. The vast majority of family members have not been characterized at the sequence level. Results The first 300 basepairs of MSG genes were subjected to analysis herein. Analysis of 581 MSG sequence reads from P. carinii genomic DNA yielded 281 different sequences. However, many of the sequence reads differed from others at only one site, a degree of variation consistent with that expected to be caused by error. Accounting for error reduced the number of truly distinct sequences observed to 158, roughly twice the number expected if the gene family contains 80 members. The size of the gene family was verified by PCR. The excess of distinct sequences appeared to be due to allelic variation. Discounting alleles, there were 73 different MSG genes observed. The 73 genes differed by 19% on average. Variable regions were rich in nucleotide differences that changed the encoded protein. The genes shared three regions in which at least 16 consecutive basepairs were invariant. There were numerous cases where two different genes were identical within a region that was variable among family members as a whole, suggesting recombination among family members. Conclusion A set of sequences that

  14. Applying lessons learned from the USAID family planning graduation experience to the GAVI graduation process.


    Shen, Angela K; Farrell, Marguerite M; Vandenbroucke, Mary F; Fox, Elizabeth; Pablos-Mendez, Ariel


    As low income countries experience economic transition, characterized by rapid economic growth and increased government spending potential in health, they have increased fiscal space to support and sustain more of their own health programmes, decreasing need for donor development assistance. Phase out of external funds should be systematic and efforts towards this end should concentrate on government commitments towards country ownership and self-sustainability. The 2006 US Agency for International Development (USAID) family planning (FP) graduation strategy is one such example of a systematic phase-out approach. Triggers for graduation were based on pre-determined criteria and programme indicators. In 2011 the GAVI Alliance (formerly the Global Alliance for Vaccines and Immunizations) which primarily supports financing of new vaccines, established a graduation policy process. Countries whose gross national income per capita exceeds $1570 incrementally increase their co-financing of new vaccines over a 5-year period until they are no longer eligible to apply for new GAVI funding, although previously awarded support will continue. This article compares and contrasts the USAID and GAVI processes to apply lessons learned from the USAID FP graduation experience to the GAVI process. The findings of the review are 3-fold: (1) FP graduation plans served an important purpose by focusing on strategic needs across six graduation plan foci, facilitating graduation with pre-determined financial and technical benchmarks, (2) USAID sought to assure contraceptive security prior to graduation, phasing out of contraceptive donations first before phasing out from technical assistance in other programme areas and (3) USAID sought to sustain political support to assure financing of products and programmes continue after graduation. Improving sustainability more broadly beyond vaccine financing provides a more comprehensive approach to graduation. The USAID FP experience provides a

  15. Differential expression of the ras gene family in mice.

    PubMed Central

    Leon, J; Guerrero, I; Pellicer, A


    We compared the expression of the ras gene family (H-ras, K-ras, and N-ras) in adult mouse tissues and during development. We found substantial variations in expression among different organs and in the amounts of the different transcripts originating from each gene, especially for the N-ras gene. The expression patterns were consistent with the reported preferential tissue activation of ras genes and suggested different cellular functions for each of the ras genes. Images PMID:3600635

  16. Lessons learned in developing a culturally adapted intervention for African-American families coping with parental cancer.


    Davey, Maureen P; Kissil, Karni; Lynch, Laura; Harmon, La-Rhonda; Hodgson, Nancy


    Prior clinical research supports the effectiveness of cancer support groups for cancer patients and their families, yet African-American families continue to be underrepresented in cancer support groups and in cancer clinical research studies. In order to fill this gap, we developed and evaluated a culturally adapted family support group for African-American families coping with parental cancer. We encountered unexpected challenges in overcoming barriers to recruitment, partnering with oncology providers, and building trust with the African-American community and African-American families coping with parental cancer. We describe actions taken during the two phases of this study and lessons learned along the way about recruiting and engaging African-American families in cancer support group studies, partnering with oncology providers, networking with the African-American community, and the importance of demonstrating cultural sensitivity to overcome the understandable historical legacy of mistrust.

  17. The Expansion of the PRAME Gene Family in Eutheria

    PubMed Central

    Chang, Ti-Cheng; Yang, Yang; Yasue, Hiroshi; Bharti, Arvind K.; Retzel, Ernest F.; Liu, Wan-Sheng


    The PRAME gene family belongs to the group of cancer/testis genes whose expression is restricted primarily to the testis and a variety of cancers. The expansion of this gene family as a result of gene duplication has been observed in primates and rodents. We analyzed the PRAME gene family in Eutheria and discovered a novel Y-linked PRAME gene family in bovine, PRAMEY, which underwent amplification after a lineage-specific, autosome-to-Y transposition. Phylogenetic analyses revealed two major evolutionary clades. Clade I containing the amplified PRAMEYs and the unamplified autosomal homologs in cattle and other eutherians is under stronger functional constraints; whereas, Clade II containing the amplified autosomal PRAMEs is under positive selection. Deep-sequencing analysis indicated that eight of the identified 16 PRAMEY loci are active transcriptionally. Compared to the bovine autosomal PRAME that is expressed predominantly in testis, the PRAMEY gene family is expressed exclusively in testis and is up-regulated during testicular maturation. Furthermore, the sense RNA of PRAMEY is expressed specifically whereas the antisense RNA is expressed predominantly in spermatids. This study revealed that the expansion of the PRAME family occurred in both autosomes and sex chromosomes in a lineage-dependent manner. Differential selection forces have shaped the evolution and function of the PRAME family. The positive selection observed on the autosomal PRAMEs (Clade II) may result in their functional diversification in immunity and reproduction. Conversely, selective constraints have operated on the expanded PRAMEYs to preserve their essential function in spermatogenesis. PMID:21347312

  18. Searching for genes underlying behavior: lessons from circadian rhythms.


    Takahashi, Joseph S; Shimomura, Kazuhiro; Kumar, Vivek


    The success of forward genetic (from phenotype to gene) approaches to uncover genes that drive the molecular mechanism of circadian clocks and control circadian behavior has been unprecedented. Links among genes, cells, neural circuits, and circadian behavior have been uncovered in the Drosophila and mammalian systems, demonstrating the feasibility of finding single genes that have major effects on behavior. Why was this approach so successful in the elucidation of circadian rhythms? This article explores the answers to this question and describes how the methods used successfully for identifying the molecular basis of circadian rhythms can be applied to other behaviors such as anxiety, addiction, and learning and memory.

  19. Gene therapy for muscular dystrophy: lessons learned and path forward.


    Mendell, Jerry R; Rodino-Klapac, Louise; Sahenk, Zarife; Malik, Vinod; Kaspar, Brian K; Walker, Christopher M; Clark, K Reed


    Our Translational Gene Therapy Center has used small molecules for exon skipping and mutation suppression and gene transfer to replace or provide surrogate genes as tools for molecular-based approaches for the treatment of muscular dystrophies. Exon skipping is targeted at the pre-mRNA level allowing one or more exons to be omitted to restore the reading frame. In Duchenne Muscular Dystrophy (DMD), clinical trials have been performed with two different oligomers, a 2'O-methyl-ribo-oligonucleoside-phosphorothioate (2'OMe) and a phosphorodiamidate morpholino (PMO). Both have demonstrated early evidence of efficacy. A second molecular approach involves suppression of stop codons to promote readthrough of the DMD gene. We have been able to establish proof of principle for mutation suppression using the aminoglycoside, gentamicin. A safer, orally administered, alternative agent referred to as Ataluren (PTC124) has been used in clinical trials and is currently under consideration for approval by the FDA. Using a gene therapy approach, we have completed two trials and have initiated a third. For DMD, we used a mini-dystrophin transferred in adeno-associated virus (AAV). In this trial an immune response was seen directed against transgene product, a quite unexpected outcome that will help guide further studies. For limb girdle muscular dystrophy 2D (alpha-sarcoglycan deficiency), the transgene was again transferred using AAV but in this study, a muscle specific creatine kinase promoter controlled gene expression that persisted for six months. A third gene therapy trial has been initiated with transfer of the follistatin gene in AAV directly to the quadriceps muscle. Two diseases with selective quadriceps muscle weakness are undergoing gene transfer including sporadic inclusion body myositis (sIBM) and Becker muscular dystrophy (BMD). Increasing the size and strength of the muscle is the goal of this study. Most importantly, no adverse events have been encountered in any of

  20. [Regulatory functions of Pax gene family in Drosophila development].


    Li, Li; Yang, Yang; Xue, Lei


    The Pax gene family encodes a group of important transcription factors that have been evolutionary conserved from Drosophila to human. Pax genes play pivotal roles in regulating diverse signal transduction pathways and organogenesis during embryonic development through modulating cell proliferation and self-renewal, embryonic precursor cell migration, and the coordination of specific differentiation programs. Ten members of the Pax gene family, which perform crucial regulatory functions during embryonic and postembryonic development, have been identified in Drosophila. In this report, we described the protein structures, expression patterns, and main functions of Drosophila Pax genes.

  1. Expression of ets family genes in hematopoietic-cells.


    Romanospica, V; Suzuki, H; Georgiou, P; Chen, S; Ascione, R; Papas, T; Bhat, N


    We have examined the expression of the ets family of transcription factors in different types of hematopoietic cells. Our results demonstrate that several members of the ets gene family are expressed differentially in hematopoietic cells. During phorbol ester induced differentiation of HL60 cells, ETS2, PEA3, as well as GABPalpha and GABPbeta mRNAs are coordinately induced. During the activation of T-cells, ETS2 proteins are induced; however, the expression of the ETS1 and ERGB gene products are reduced. These results demonstrate that the regulation of ets family of genes is complex and depends on cell type. This observation leads to the conclusion that the regulation of ets target genes, will be dependent, in part, upon the type of ets genes expressed in each particular cell type.

  2. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    NASA Astrophysics Data System (ADS)

    Yanai, Itai; Camacho, Carlos J.; Delisi, Charles


    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications.

  3. Evolutionary History of the Cancer Immunity Antigen MAGE Gene Family

    PubMed Central

    Katsura, Yukako; Satta, Yoko


    The evolutionary mode of a multi-gene family can change over time, depending on the functional differentiation and local genomic environment of family members. In this study, we demonstrate such a change in the melanoma antigen (MAGE) gene family on the mammalian X chromosome. The MAGE gene family is composed of ten subfamilies that can be categorized into two types. Type I genes are of relatively recent origin, and they encode epitopes for human leukocyte antigen (HLA) in cancer cells. Type II genes are relatively ancient and some of their products are known to be involved in apoptosis or cell proliferation. The evolutionary history of the MAGE gene family can be divided into four phases. In phase I, a single-copy state of an ancestral gene and the evolutionarily conserved mode had lasted until the emergence of eutherian mammals. In phase II, eight subfamily ancestors, with the exception for MAGE-C and MAGE-D subfamilies, were formed via retrotransposition independently. This would coincide with a transposition burst of LINE elements at the eutherian radiation. However, MAGE-C was generated by gene duplication of MAGE-A. Phase III is characterized by extensive gene duplication within each subfamily and in particular the formation of palindromes in the MAGE-A subfamily, which occurred in an ancestor of the Catarrhini. Phase IV is characterized by the decay of a palindrome in most Catarrhini, with the exception of humans. Although the palindrome is truncated by frequent deletions in apes and Old World monkeys, it is retained in humans. Here, we argue that this human-specific retention stems from negative selection acting on MAGE-A genes encoding epitopes of cancer cells, which preserves their ability to bind to highly divergent HLA molecules. These findings are interpreted with consideration of the biological factors shaping recent human MAGE-A genes. PMID:21695252

  4. The CBF gene family in apple (malus x domestica Borkh.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Many vascular plants have evolved mechanisms for protecting themselves from freeze damage. One of the key pathways controlling higher plant responses to low temperature involves a family of genes which belong to the AP2 domain class of transcription factors. The promoters of many genes involved in...

  5. Recommended nomenclature for five mammalian carboxylesterase gene families: human, mouse, and rat genes and proteins.


    Holmes, Roger S; Wright, Matthew W; Laulederkind, Stanley J F; Cox, Laura A; Hosokawa, Masakiyo; Imai, Teruko; Ishibashi, Shun; Lehner, Richard; Miyazaki, Masao; Perkins, Everett J; Potter, Phillip M; Redinbo, Matthew R; Robert, Jacques; Satoh, Tetsuo; Yamashita, Tetsuro; Yan, Bingfan; Yokoi, Tsuyoshi; Zechner, Rudolf; Maltais, Lois J


    Mammalian carboxylesterase (CES or Ces) genes encode enzymes that participate in xenobiotic, drug, and lipid metabolism in the body and are members of at least five gene families. Tandem duplications have added more genes for some families, particularly for mouse and rat genomes, which has caused confusion in naming rodent Ces genes. This article describes a new nomenclature system for human, mouse, and rat carboxylesterase genes that identifies homolog gene families and allocates a unique name for each gene. The guidelines of human, mouse, and rat gene nomenclature committees were followed and "CES" (human) and "Ces" (mouse and rat) root symbols were used followed by the family number (e.g., human CES1). Where multiple genes were identified for a family or where a clash occurred with an existing gene name, a letter was added (e.g., human CES4A; mouse and rat Ces1a) that reflected gene relatedness among rodent species (e.g., mouse and rat Ces1a). Pseudogenes were named by adding "P" and a number to the human gene name (e.g., human CES1P1) or by using a new letter followed by ps for mouse and rat Ces pseudogenes (e.g., Ces2d-ps). Gene transcript isoforms were named by adding the GenBank accession ID to the gene symbol (e.g., human CES1_AB119995 or mouse Ces1e_BC019208). This nomenclature improves our understanding of human, mouse, and rat CES/Ces gene families and facilitates research into the structure, function, and evolution of these gene families. It also serves as a model for naming CES genes from other mammalian species.

  6. Mutation in δ-Sg Gene in Familial Dilated Cardiomyopathy

    PubMed Central

    Asadi, Marzieh; Foo, Roger; Salehi, Ahmad Reza; Salehi, Rasoul; Samienasab, Mohammad Reza


    Background: Mutations in different genes including dystrophin-associated glycoprotein complex caused familial dilated cardiomyopathy which is a genetically heterogeneous disease. The δ-SG gene contains nine exons spanning a 433-kb region of genomic DNA. It encodes a 35-kDa, singlepass, and type II transmembrane glycoprotein. Materials and Methods: In this study for the first time in Iran we screened 6 patients of a large family that they had positive family history of MI or sudden death by next generation sequencing method. Results: By employing NGS method we found missense mutation (p.R97Q) of δ-SG gene in 2 of 6 patients. Conclusions: The missense mutation (p.R97Q) in familial DCM patients is reported for the first time in Iranian patients with cardiac disease. Although this mutation is already known in other populations in Iran, it is not reported before.

  7. Complexity, polymorphism, and connectivity of mouse Vk gene families.


    Kofler, R; Duchosal, M A; Dixon, F J


    To define the polymorphism and extent of the mouse immunoglobulin kappa (Igk) gene complex, we have analyzed restriction-enzyme digested genomic DNA from 33 inbred strains of mice with labeled DNA probes corresponding to 16 Vk protein groups (1 of them previously undescribed) and the Jk/Ck region (V, variable; J, joining; C, constant). These probes detected between 1 and 25 distinct restriction enzyme fragments (REF) that appeared in up to eight polymorphic patterns, thus defining eight mouse Igk haplotypes. The investigated portion of the Vk repertoire was estimated to encompass between 60 and 120 discernable Vk gene-containing REFs. In contrast to mouse VH gene families, several Vk gene families defined by these probes appeared to overlap. This observation has implications for Vk gene analyses by nucleic acid hybridization and raises the possibility that the Vk gene complex is a continuum of related sequences.

  8. Characterizations of 9p21 candidate genes in familial melanoma

    SciTech Connect

    Walker, G.J.; Flores, J.F.; Glendening, J.M.


    We have previously collected and characterized 16 melanoma families for the inheritance of a familial melanoma predisposition gene on 9p21. Clear evidence for genetic linkage has been detected in 8 of these families with the 9p21 markers D9S126 and 1FNA, while linkage of the remaining families to this region is less certain. A candidate for the 9p21 familial melanoma gene, the cyclin kinase inhibitor gene p16 (also known as the multiple tumor suppressor 1 (MTS1) gene), has been recently indentified. Notably, a nonsense mutation within the p16 gene has been detected in the lymphoblastoid cell line DNA from a dysplastic nevus syndrome (DNS), or familial melanoma, patient. The p16 gene is also known to be frequently deleted or mutated in a variety of tumor cell lines (including melanoma) and resides within a region that has been defined as harboring the 9p21 melanoma predisposition locus. This region is delineated on the distal side by the marker D9S736 (which resides just distal to the p16 gene) and extends in a proximal direction to the marker D9S171. Overall, the entire distance between these two loci is estimated at 3-5Mb. Preliminary analysis of our two largest 9p21-linked melanoma kindreds (by direct sequencing of PCR products) has not yet revealed mutations within the coding region of the p16 gene. Others have reported that 8/11 unrelated 9p21-linked melanoma families do not appear to carry p16 mutations; thus the possibility exists that p16 is not a melanoma susceptibility gene per se, although it appears to play some role in melanoma tumor progression. Our melanoma kindred DNAs are currently being analyzed by SSCP using primers that amplify exons of other candidate genes from the 9p21 region implicated in familial melanoma. These novel genes reside within a distinct critical region of homozygous loss in melanoma which is located >2 Mb from the p16 gene on 9p21.

  9. Identification of a family of muscarinic acetylcholine receptor genes

    SciTech Connect

    Bonner, T.I.; Buckley, N.J.; Young, A.C.; Brann, M.R.


    Complementary DNAs for three different muscarinic acetylcholine receptors were isolated from a rat cerebral cortex library, and the cloned receptors were expressed in mammalian cells. Analysis of human and rat genomic clones indicates that there are at least four functional muscarinic receptor genes and that these genes lack introns in the coding sequence. This gene family provides a new basis for evaluating the diversity of muscarinic mechanisms in the nervous system.

  10. Identification and Functional Analysis of Light-Responsive Unique Genes and Gene Family Members in Rice

    PubMed Central

    Jung, Ki-Hong; Lee, Jinwon; Dardick, Chris; Seo, Young-Su; Cao, Peijian; Canlas, Patrick; Phetsom, Jirapa; Xu, Xia; Ouyang, Shu; An, Kyungsook; Cho, Yun-Ja; Lee, Geun-Cheol; Lee, Yoosook; An, Gynheung; Ronald, Pamela C.


    Functional redundancy limits detailed analysis of genes in many organisms. Here, we report a method to efficiently overcome this obstacle by combining gene expression data with analysis of gene-indexed mutants. Using a rice NSF45K oligo-microarray to compare 2-week-old light- and dark-grown rice leaf tissue, we identified 365 genes that showed significant 8-fold or greater induction in the light relative to dark conditions. We then screened collections of rice T-DNA insertional mutants to identify rice lines with mutations in the strongly light-induced genes. From this analysis, we identified 74 different lines comprising two independent mutant lines for each of 37 light-induced genes. This list was further refined by mining gene expression data to exclude genes that had potential functional redundancy due to co-expressed family members (12 genes) and genes that had inconsistent light responses across other publicly available microarray datasets (five genes). We next characterized the phenotypes of rice lines carrying mutations in ten of the remaining candidate genes and then carried out co-expression analysis associated with these genes. This analysis effectively provided candidate functions for two genes of previously unknown function and for one gene not directly linked to the tested biochemical pathways. These data demonstrate the efficiency of combining gene family-based expression profiles with analyses of insertional mutants to identify novel genes and their functions, even among members of multi-gene families. PMID:18725934

  11. Evolution of the Sox gene family within the chordate phylum.


    Heenan, Phoebe; Zondag, Lisa; Wilson, Megan J


    The ancient Sox gene family is a group of related transcription factors that perform a number of essential functions during embryonic development. During evolution, this family has undergone considerable expansion, particularly within the vertebrate lineage. In vertebrates SOX proteins are required for the specification, development and/or morphogenesis of most vertebrate innovations. Tunicates and lancelets are evolutionarily positioned as the closest invertebrate relatives to the vertebrate group. By identifying their Sox gene complement we can begin to reconstruct the gene set of the last common chordate ancestor before the split into invertebrates and vertebrate groups. We have identified core SOX family members from the genomes of six invertebrate chordates. Using phylogenetic analysis we determined their evolutionary relationships. We propose that the last common ancestor of chordates had at least seven Sox genes, including the core suite of SoxB, C, D, E and F as well as SoxH.

  12. Contribution of apoptosis-associated signaling pathways to epileptogenesis: lessons from Bcl-2 family knockouts.


    Henshall, David C; Engel, Tobias


    Neuronal cell death is a pathophysiological consequence of many brain insults that trigger epilepsy and has been implicated as a causal factor in epileptogenesis. Seizure-induced neuronal death features excitotoxic necrosis and apoptosis-associated signaling pathways, including activation of multiple members of the Bcl-2 gene family. The availability of mice in which individual Bcl-2 family members have been deleted has provided the means to determine whether they have causal roles in neuronal death and epileptogenesis in vivo. Studies show that multiple members of the Bcl-2 family are activated following status epilepticus and the seizure and damage phenotypes of eight different knockouts of the Bcl-2 family have now been characterized. Loss of certain pro-apoptotic members, including Puma, protected against seizure-induced neuronal death whereas loss of anti-apoptotic Mcl-1 and Bcl-w enhanced hippocampal damage. Notably, loss of two putatively pro-apoptotic members, Bak and Bmf, resulted in more seizure-damage while deletion of Bid had no effect, indicating the role of certain Bcl-2 family proteins in epileptic brain injury is distinct from their contributions following other stressors or in non-CNS tissue. Notably, Puma-deficient mice develop fewer spontaneous seizures after status epilepticus suggesting neuroprotection may preserve functional inhibition, either directly by preserving neuronal networks or indirectly, for example by limiting reactive gliosis and pro-inflammatory responses to neuronal death. Together, these studies support apoptosis-associated molecular mechanisms controlling neuronal death as a component of epileptogenesis which might be targetable to protect against seizure-damage, cognitive deficits and mitigate the severity of syndrome following epilepsy-precipitating injuries to the brain.

  13. Gene turnover and differential retention in the relaxin/insulin-like gene family in primates.


    Arroyo, José Ignacio; Hoffmann, Federico G; Opazo, Juan C


    The relaxin/insulin-like gene family is related to the insulin gene family, and includes two separate types of peptides: relaxins (RLNs) and insulin-like peptides (INSLs) that perform a variety of physiological roles including testicular descent, growth and differentiation of the mammary glands, trophoblast development, and cell differentiation. In vertebrates, these genes are found on three separate genomic loci, and in mammals, variation in the number and nature of genes in this family is mostly restricted to the Relaxin Family Locus B. For example, this locus contains a single copy of RLN in platypus and opossum, whereas it contains copies of the INSL6, INSL4, RLN2 and RLN1 genes in human and chimp. The main objective of this research is to characterize changes in the size and membership composition of the RLN/INSL gene family in primates, reconstruct the history of the RLN/INSL genes of primates, and test competing evolutionary scenarios regarding the origin of INSL4 and of the duplicated copies of the RLN gene of apes. Our results show that the relaxin/INSL-like gene family of primates has had a more dynamic evolutionary history than previously thought, including several examples of gene duplications and losses which are consistent with the predictions of the birth-and-death model of gene family evolution. In particular, we found that the differential retention of relatively old paralogs played a key role in shaping the gene complement of this family in primates. Two examples of this phenomenon are the origin of the INSL4 gene of catarrhines (the group that includes Old World monkeys and apes), and of the duplicate RLN1 and RLN2 paralogs of apes. In the case of INSL4, comparative genomics and phylogenetic analyses indicate that the origin of this gene, which was thought to represent a catarrhine-specific evolutionary innovation, is as old as the split between carnivores and primates, which took place approximately 97 million years ago. In addition, in the case

  14. The ubiquilin gene family: evolutionary patterns and functional insights

    PubMed Central


    Background Ubiquilins are proteins that function as ubiquitin receptors in eukaryotes. Mutations in two ubiquilin-encoding genes have been linked to the genesis of neurodegenerative diseases. However, ubiquilin functions are still poorly understood. Results In this study, evolutionary and functional data are combined to determine the origin and diversification of the ubiquilin gene family and to characterize novel potential roles of ubiquilins in mammalian species, including humans. The analysis of more than six hundred sequences allowed characterizing ubiquilin diversity in all the main eukaryotic groups. Many organisms (e. g. fungi, many animals) have single ubiquilin genes, but duplications in animal, plant, alveolate and excavate species are described. Seven different ubiquilins have been detected in vertebrates. Two of them, here called UBQLN5 and UBQLN6, had not been hitherto described. Significantly, marsupial and eutherian mammals have the most complex ubiquilin gene families, composed of up to 6 genes. This exceptional mammalian-specific expansion is the result of the recent emergence of four new genes, three of them (UBQLN3, UBQLN5 and UBQLNL) with precise testis-specific expression patterns that indicate roles in the postmeiotic stages of spermatogenesis. A gene with related features has independently arisen in species of the Drosophila genus. Positive selection acting on some mammalian ubiquilins has been detected. Conclusions The ubiquilin gene family is highly conserved in eukaryotes. The infrequent lineage-specific amplifications observed may be linked to the emergence of novel functions in particular tissues. PMID:24674348

  15. BranchClust: a phylogenetic algorithm for selecting gene families

    PubMed Central

    Poptsova, Maria S; Gogarten, J Peter


    Background Automated methods for assembling families of orthologous genes include those based on sequence similarity scores and those based on phylogenetic approaches. The first are easy to automate but usually they do not distinguish between paralogs and orthologs or have restriction on the number of taxa. Phylogenetic methods often are based on reconciliation of a gene tree with a known rooted species tree; a limitation of this approach, especially in case of prokaryotes, is that the species tree is often unknown, and that from the analyses of single gene families the branching order between related organisms frequently is unresolved. Results Here we describe an algorithm for the automated selection of orthologous genes that recognizes orthologous genes from different species in a phylogenetic tree for any number of taxa. The algorithm is capable of distinguishing complete (containing all taxa) and incomplete (not containing all taxa) families and recognizes in- and outparalogs. The BranchClust algorithm is implemented in Perl with the use of the BioPerl module for parsing trees and is freely available at . Conclusion BranchClust outperforms the Reciprocal Best Blast hit method in selecting more sets of putatively orthologous genes. In the test cases examined, the correctness of the selected families and of the identified in- and outparalogs was confirmed by inspection of the pertinent phylogenetic trees. PMID:17425803

  16. Identification and characterization of TIFY family genes in Brachypodium distachyon.


    Zhang, Lihua; You, Jun; Chan, Zhulong


    The TIFY family is a plant-specific gene family encoding proteins characterized by a conserved TIFY domain. This family encodes four subfamilies of proteins, including ZIM-like (ZML), TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. TIFY proteins play important roles in plant development and stress responses. In this study, 21 BdTIFYs were identified in Brachypodium distachyon through genome-wide analysis, including 15 JAZ and 6 ZML genes. Analysis of the distribution of conserved domains showed that there are three additional domains (CCT domain, GATA domain and Jas domain) in the BdTIFY proteins besides the TIFY domain. Phylogenetic analysis indicated that these 21 proteins were classified into two major groups. Expression profile of BdTIFY genes in response to abiotic stresses and phytohormones was analyzed using quantitative real-time RT-PCR. Among 21 BdTIFY genes, 12 of them were induced by JA treatment, and 4 of them were induced by ABA treatment. Most of BdTIFY genes were responsive to one or more abiotic stresses including drought, salinity, low temperature and heat. Especially, BdTIFY5, 9a, 9b, 10c and 11a were significantly up-regulated by multiple abiotic stresses. These results provided important clues for functional analysis of TIFY family genes in B. distachyon.

  17. Evolution of the YABBY gene family in seed plants.


    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L


    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants.

  18. The role of CCN family genes in haematological malignancies.


    Wells, J E; Howlett, M; Cheung, L C; Kees, Ursula R


    Haematological malignancies, although a broad range of specific disease types, continue to show considerable overlap in classification, and patients are treated using similar chemotherapy regimes. In this review we look at the role of the CCN family of matricellular proteins and indicate their role in nine haematological malignancies including both myeloid and lymphoid neoplasms. The potential for further haematological neoplasms with CCN family associations is argued by summarising the demonstrated role of CCN family genes in the differentiation of haematopoietic stem cells (HSC) and mesenchymal stem cells. The expanding field of knowledge encompassing CCN family genes and cancers of the HSC-lineage highlights the importance of extracellular matrix-interactions in both normal physiology and tumorigenesis of the blood, bone marrow and lymph nodes.

  19. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    PubMed Central

    Mendonça-Mattos, Patricia Jeanne de Souza; Harada, Maria Lúcia


    Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i) the selective pressure on the GT6 paralogs genes in primates; (ii) the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii) the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions. PMID:28044107

  20. Exploiting Gene Families for Phylogenomic Analysis of Myzostomid Transcriptome Data

    PubMed Central

    Hartmann, Stefanie; Helm, Conrad; Nickel, Birgit; Meyer, Matthias; Struck, Torsten H.; Tiedemann, Ralph; Selbig, Joachim; Bleidorn, Christoph


    Background In trying to understand the evolutionary relationships of organisms, the current flood of sequence data offers great opportunities, but also reveals new challenges with regard to data quality, the selection of data for subsequent analysis, and the automation of steps that were once done manually for single-gene analyses. Even though genome or transcriptome data is available for representatives of most bilaterian phyla, some enigmatic taxa still have an uncertain position in the animal tree of life. This is especially true for myzostomids, a group of symbiotic (or parasitic) protostomes that are either placed with annelids or flatworms. Methodology Based on similarity criteria, Illumina-based transcriptome sequences of one myzostomid were compared to protein sequences of one additional myzostomid and 29 reference metazoa and clustered into gene families. These families were then used to investigate the phylogenetic position of Myzostomida using different approaches: Alignments of 989 sequence families were concatenated, and the resulting superalignment was analyzed under a Maximum Likelihood criterion. We also used all 1,878 gene trees with at least one myzostomid sequence for a supertree approach: the individual gene trees were computed and then reconciled into a species tree using gene tree parsimony. Conclusions Superalignments require strictly orthologous genes, and both the gene selection and the widely varying amount of data available for different taxa in our dataset may cause anomalous placements and low bootstrap support. In contrast, gene tree parsimony is designed to accommodate multilocus gene families and therefore allows a much more comprehensive data set to be analyzed. Results of this supertree approach showed a well-resolved phylogeny, in which myzostomids were part of the annelid radiation, and major bilaterian taxa were found to be monophyletic. PMID:22276131

  1. Runx Family Genes in Tissue Stem Cell Dynamics.


    Wang, Chelsia Qiuxia; Mok, Michelle Meng Huang; Yokomizo, Tomomasa; Tergaonkar, Vinay; Osato, Motomi


    The Runx family genes play important roles in development and cancer, largely via their regulation of tissue stem cell behavior. Their involvement in two organs, blood and skin, is well documented. This review summarizes currently known Runx functions in the stem cells of these tissues. The fundamental core mechanism(s) mediated by Runx proteins has been sought; however, it appears that there does not exist one single common machinery that governs both tissue stem cells. Instead, Runx family genes employ multiple spatiotemporal mechanisms in regulating individual tissue stem cell populations. Such specific Runx requirements have been unveiled by a series of cell type-, developmental stage- or age-specific gene targeting studies in mice. Observations from these experiments revealed that the regulation of stem cells by Runx family genes turned out to be far more complex than previously thought. For instance, although it has been reported that Runx1 is required for the endothelial-to-hematopoietic cell transition (EHT) but not thereafter, recent studies clearly demonstrated that Runx1 is also needed during the period subsequent to EHT, namely at perinatal stage. In addition, Runx1 ablation in the embryonic skin mesenchyme eventually leads to complete loss of hair follicle stem cells (HFSCs) in the adult epithelium, suggesting that Runx1 facilitates the specification of skin epithelial stem cells in a cell extrinsic manner. Further in-depth investigation into how Runx family genes are involved in stem cell regulation is warranted.

  2. Expansion of transducin subunit gene families in early vertebrate tetraploidizations.


    Lagman, David; Sundström, Görel; Ocampo Daza, Daniel; Abalo, Xesús M; Larhammar, Dan


    Hundreds of gene families expanded in the early vertebrate tetraploidizations including many gene families in the phototransduction cascade. We have investigated the evolution of the heterotrimeric G-proteins of photoreceptors, the transducins, in relation to these events using both phylogenetic analyses and synteny comparisons. Three alpha subunit genes were identified in amniotes and the coelacanth, GNAT1-3; two of these were identified in amphibians and teleost fish, GNAT1 and GNAT2. Most tetrapods have four beta genes, GNB1-4, and teleosts have additional duplicates. Finally, three gamma genes were identified in mammals, GNGT1, GNG11 and GNGT2. Of these, GNGT1 and GNGT2 were found in the other vertebrates. In frog and zebrafish additional duplicates of GNGT2 were identified. Our analyses show all three transducin families expanded during the early vertebrate tetraploidizations and the beta and gamma families gained additional copies in the teleost-specific genome duplication. This suggests that the tetraploidizations contributed to visual specialisations.

  3. Evolution of an expanded mannose receptor gene family.


    Staines, Karen; Hunt, Lawrence G; Young, John R; Butter, Colin


    Sequences of peptides from a protein specifically immunoprecipitated by an antibody, KUL01, that recognises chicken macrophages, identified a homologue of the mammalian mannose receptor, MRC1, which we called MRC1L-B. Inspection of the genomic environment of the chicken gene revealed an array of five paralogous genes, MRC1L-A to MRC1L-E, located between conserved flanking genes found either side of the single MRC1 gene in mammals. Transcripts of all five genes were detected in RNA from a macrophage cell line and other RNAs, whose sequences allowed the precise definition of spliced exons, confirming or correcting existing bioinformatic annotation. The confirmed gene structures were used to locate orthologues of all five genes in the genomes of two other avian species and of the painted turtle, all with intact coding sequences. The lizard genome had only three genes, one orthologue of MRC1L-A and two orthologues of the MRC1L-B antigen gene resulting from a recent duplication. The Xenopus genome, like that of most mammals, had only a single MRC1-like gene at the corresponding locus. MRC1L-A and MRC1L-B genes had similar cytoplasmic regions that may be indicative of similar subcellular migration and functions. Cytoplasmic regions of the other three genes were very divergent, possibly indicating the evolution of a new functional repertoire for this family of molecules, which might include novel interactions with pathogens.

  4. Partnerships at Work: Lessons Learned from Programs and Practices of Families, Professionals and Communities.

    ERIC Educational Resources Information Center

    Bishop, Kathleen Kirk, Ed.; Taylor, Mary Skidmore, Ed.; Arango, Polly, Ed.

    Designed to celebrate family/interprofessional collaborative partnerships, this publication describes high-quality examples of how families and professionals at the family, community, state, and national levels have worked together to create programs and practices that are family-friendly and responsive to what families have said they want and…

  5. Structure and regulation of the Asr gene family in banana.


    Henry, Isabelle M; Carpentier, Sebastien C; Pampurova, Suzana; Van Hoylandt, Anais; Panis, Bart; Swennen, Rony; Remy, Serge


    Abscisic acid, stress, ripening proteins (ASR) are a family of plant-specific small hydrophilic proteins. Studies in various plant species have highlighted their role in increased resistance to abiotic stress, including drought, but their specific function remains unknown. As a first step toward their potential use in crop improvement, we investigated the structure and regulation of the Asr gene family in Musa species (bananas and plantains). We determined that the Musa Asr gene family contained at least four members, all of which exhibited the typical two exons, one intron structure of Asr genes and the "ABA/WDS" (abscisic acid/water deficit stress) domain characteristic of Asr genes. Phylogenetic analyses determined that the Musa Asr genes were closely related to each other, probably as the product of recent duplication events. For two of the four members, two versions corresponding to the two sub-genomes of Musa, acuminata and balbisiana were identified. Gene expression and protein analyses were performed and Asr expression could be detected in meristem cultures, root, pseudostem, leaf and cormus. In meristem cultures, mAsr1 and mAsr3 were induced by osmotic stress and wounding, while mAsr3 and mAsr4 were induced by exposure to ABA. mASR3 exhibited the most variation both in terms of amino acid sequence and expression pattern, making it the most promising candidate for further functional study and use in crop improvement.

  6. The d4 gene family in the human genome

    SciTech Connect

    Chestkov, A.V.; Baka, I.D.; Kost, M.V.


    The d4 domain, a novel zinc finger-like structural motif, was first revealed in the rat neuro-d4 protein. Here we demonstrate that the d4 domain is conserved in evolution and that three related genes form a d4 family in the human genome. The human neuro-d4 is very similar to rat neuro-d4 at both the amino acid and the nucleotide levels. Moreover, the same splice variants have been detected among rat and human neuro-d4 transcripts. This gene has been localized on chromosome 19, and two other genes, members of the d4 family isolated by screening of the human genomic library at low stringency, have been mapped to chromosomes 11 and 14. The gene on chromosome 11 is the homolog of the ubiquitously expressed mouse gene ubi-d4/requiem, which is required for cell death after deprivation of trophic factors. A gene with a conserved d4 domain has been found in the genome of the nematode Caenorhabditis elegans. The conservation of d4 proteins from nematodes to vertebrates suggests that they have a general importance, but a diversity of d4 proteins expressed in vertebrate nervous systems suggests that some family members have special functions. 11 refs., 2 figs.

  7. An evolutionary screen highlights canonical and noncanonical candidate antiviral genes within the primate TRIM gene family.


    Malfavon-Borja, Ray; Sawyer, Sara L; Wu, Lily I; Emerman, Michael; Malik, Harmit S


    Recurrent viral pressure has acted on host-encoded antiviral genes during primate and mammalian evolution. This selective pressure has resulted in dramatic episodes of adaptation in host antiviral genes, often detected via positive selection. These evolutionary signatures of adaptation have the potential to highlight previously unrecognized antiviral genes (also called restriction factors). Although the TRIM multigene family is recognized for encoding several bona fide restriction factors (e.g., TRIM5alpha), most members of this expansive gene family remain uncharacterized. Here, we investigated the TRIM multigene family for signatures of positive selection to identify novel candidate antiviral genes. Our analysis reveals previously undocumented signatures of positive selection in 17 TRIM genes, 10 of which represent novel candidate restriction factors. These include the unusual TRIM52 gene, which has evolved under strong positive selection despite its encoded protein lacking a putative viral recognition (B30.2) domain. We show that TRIM52 arose via gene duplication from the TRIM41 gene. Both TRIM52 and TRIM41 have dramatically expanded RING domains compared with the rest of the TRIM multigene family, yet this domain has evolved under positive selection only in primate TRIM52, suggesting that it represents a novel host-virus interaction interface. Our evolutionary-based screen not only documents positive selection in known TRIM restriction factors but also highlights candidate novel restriction factors, providing insight into the interfaces of host-pathogen interactions mediated by the TRIM multigene family.

  8. Analysis of the Prefoldin Gene Family in 14 Plant Species

    PubMed Central

    Cao, Jun


    Prefoldin is a hexameric molecular chaperone complex present in all eukaryotes and archaea. The evolution of this gene family in plants is unknown. Here, I identified 140 prefoldin genes in 14 plant species. These prefoldin proteins were divided into nine groups through phylogenetic analysis. Highly conserved gene organization and motif distribution exist in each prefoldin group, implying their functional conservation. I also observed the segmental duplication of maize prefoldin gene family. Moreover, a few functional divergence sites were identified within each group pairs. Functional network analyses identified 78 co-expressed genes, and most of them were involved in carrying, binding and kinase activity. Divergent expression profiles of the maize prefoldin genes were further investigated in different tissues and development periods and under auxin and some abiotic stresses. I also found a few cis-elements responding to abiotic stress and phytohormone in the upstream sequences of the maize prefoldin genes. The results provided a foundation for exploring the characterization of the prefoldin genes in plants and will offer insights for additional functional studies. PMID:27014333

  9. Sucrose metabolism gene families and their biological functions

    PubMed Central

    Jiang, Shu-Ye; Chi, Yun-Hua; Wang, Ji-Zhou; Zhou, Jun-Xia; Cheng, Yan-Song; Zhang, Bao-Lan; Ma, Ali; Vanitha, Jeevanandam; Ramachandran, Srinivasan


    Sucrose, as the main product of photosynthesis, plays crucial roles in plant development. Although studies on general metabolism pathway were well documented, less information is available on the genome-wide identification of these genes, their expansion and evolutionary history as well as their biological functions. We focused on four sucrose metabolism related gene families including sucrose synthase, sucrose phosphate synthase, sucrose phosphate phosphatase and UDP-glucose pyrophosphorylase. These gene families exhibited different expansion and evolutionary history as their host genomes experienced differentiated rates of the whole genome duplication, tandem and segmental duplication, or mobile element mediated gene gain and loss. They were evolutionarily conserved under purifying selection among species and expression divergence played important roles for gene survival after expansion. However, we have detected recent positive selection during intra-species divergence. Overexpression of 15 sorghum genes in Arabidopsis revealed their roles in biomass accumulation, flowering time control, seed germination and response to high salinity and sugar stresses. Our studies uncovered the molecular mechanisms of gene expansion and evolution and also provided new insight into the role of positive selection in intra-species divergence. Overexpression data revealed novel biological functions of these genes in flowering time control and seed germination under normal and stress conditions. PMID:26616172

  10. New Genes Originated via Multiple Recombinational Pathways in the β-Globin Gene Family of Rodents

    PubMed Central

    Hoffmann, Federico G.; Opazo, Juan C.; Storz, Jay F.


    Species differences in the size or membership composition of multigene families can be attributed to lineage-specific additions of new genes via duplication, losses of genes via deletion or inactivation, and the creation of chimeric genes via domain shuffling or gene fusion. In principle, it should be possible to infer the recombinational pathways responsible for each of these different types of genomic change by conducting detailed comparative analyses of genomic sequence data. Here, we report an attempt to unravel the complex evolutionary history of the β-globin gene family in a taxonomically diverse set of rodent species. The main objectives were: 1) to characterize the genomic structure of the β-globin gene cluster of rodents; 2) to assign orthologous and paralogous relationships among duplicate copies of β-like globin genes; and 3) to infer the specific recombinational pathways responsible for gene duplications, gene deletions, and the creation of chimeric fusion genes. Results of our comparative genomic analyses revealed that variation in gene family size among rodent species is mainly attributable to the differential gain and loss of later expressed β-globin genes via unequal crossing-over. However, two distinct recombinational mechanisms were implicated in the creation of chimeric fusion genes. In muroid rodents, a chimeric γ/ε fusion gene was created by unequal crossing-over between the embryonic ε- and γ-globin genes. Interestingly, this γ/ε fusion gene was generated in the same fashion as the “anti-Lepore” 5′-δ-(β/δ)-β-3′ duplication mutant in humans (the reciprocal exchange product of the pathological hemoglobin Lepore deletion mutant). By contrast, in the house mouse, Mus musculus, a chimeric β/δ fusion pseudogene was created by a β-globin → δ-globin gene conversion event. Although the γ/ε and β/δ fusion genes share a similar chimeric gene structure, they originated via completely different recombinational pathways. PMID

  11. Evolutionary Dynamics of the wnt Gene Family: A Lophotrochozoan Perspective

    PubMed Central

    Cho, Sung-Jin; Vallès, Yvonne; Giani, Vincent C.; Seaver, Elaine C.; Weisblat, David A.


    The wnt gene family encodes a set of secreted glycoproteins involved in key developmental processes, including cell fate specification and regulation of posterior growth (Cadigan KM, Nusse R. 1997. Wnt signaling: a common theme in animal development. Genes Dev. 11:3286–3305.; Martin BL, Kimelman D. 2009. Wnt signaling and the evolution of embryonic posterior development. Curr Biol. 19:R215–R219.). As for many other gene families, evidence for expansion and/or contraction of the wnt family is available from deuterostomes (e.g., echinoderms and vertebrates [Nusse R, Varmus HE. 1992. Wnt genes. Cell. 69:1073–1087.; Schubert M, Holland LZ, Holland ND, Jacobs DK. 2000. A phylogenetic tree of the Wnt genes based on all available full-length sequences, including five from the cephalochordate amphioxus. Mol Biol Evol. 17:1896–1903.; Croce JC, Wu SY, Byrum C, Xu R, Duloquin L, Wikramanayake AH, Gache C, McClay DR. 2006. A genome-wide survey of the evolutionarily conserved Wnt pathways in the sea urchin Strongylocentrotus purpuratus. Dev Biol. 300:121–131.]) and ecdysozoans (e.g., arthropods and nematodes [Eisenmann DM. 2005. Wnt signaling. WormBook. 1–17.; Bolognesi R, Farzana L, Fischer TD, Brown SJ. 2008. Multiple Wnt genes are required for segmentation in the short-germ embryo of Tribolium castaneum. Curr Biol. 18:1624–1629.]), but little is known from the third major bilaterian group, the lophotrochozoans (e.g., mollusks and annelids [Prud'homme B, Lartillot N, Balavoine G, Adoutte A, Vervoort M. 2002. Phylogenetic analysis of the Wnt gene family. Insights from lophotrochozoan members. Curr Biol. 12:1395.]). To obtain a more comprehensive scenario of the evolutionary dynamics of this gene family, we exhaustively mined wnt gene sequences from the whole genome assemblies of a mollusk (Lottia gigantea) and two annelids (Capitella teleta and Helobdella robusta) and examined them by phylogenetic, genetic linkage, intron–exon structure, and embryonic

  12. Genome-Wide Analysis of Homeobox Gene Family in Legumes: Identification, Gene Duplication and Expression Profiling

    PubMed Central

    Garg, Rohini; Jain, Mukesh


    Homeobox genes encode transcription factors that are known to play a major role in different aspects of plant growth and development. In the present study, we identified homeobox genes belonging to 14 different classes in five legume species, including chickpea, soybean, Medicago, Lotus and pigeonpea. The characteristic differences within homeodomain sequences among various classes of homeobox gene family were quite evident. Genome-wide expression analysis using publicly available datasets (RNA-seq and microarray) indicated that homeobox genes are differentially expressed in various tissues/developmental stages and under stress conditions in different legumes. We validated the differential expression of selected chickpea homeobox genes via quantitative reverse transcription polymerase chain reaction. Genome duplication analysis in soybean indicated that segmental duplication has significantly contributed in the expansion of homeobox gene family. The Ka/Ks ratio of duplicated homeobox genes in soybean showed that several members of this family have undergone purifying selection. Moreover, expression profiling indicated that duplicated genes might have been retained due to sub-functionalization. The genome-wide identification and comprehensive gene expression profiling of homeobox gene family members in legumes will provide opportunities for functional analysis to unravel their exact role in plant growth and development. PMID:25745864

  13. Genome-wide analysis of homeobox gene family in legumes: identification, gene duplication and expression profiling.


    Bhattacharjee, Annapurna; Ghangal, Rajesh; Garg, Rohini; Jain, Mukesh


    Homeobox genes encode transcription factors that are known to play a major role in different aspects of plant growth and development. In the present study, we identified homeobox genes belonging to 14 different classes in five legume species, including chickpea, soybean, Medicago, Lotus and pigeonpea. The characteristic differences within homeodomain sequences among various classes of homeobox gene family were quite evident. Genome-wide expression analysis using publicly available datasets (RNA-seq and microarray) indicated that homeobox genes are differentially expressed in various tissues/developmental stages and under stress conditions in different legumes. We validated the differential expression of selected chickpea homeobox genes via quantitative reverse transcription polymerase chain reaction. Genome duplication analysis in soybean indicated that segmental duplication has significantly contributed in the expansion of homeobox gene family. The Ka/Ks ratio of duplicated homeobox genes in soybean showed that several members of this family have undergone purifying selection. Moreover, expression profiling indicated that duplicated genes might have been retained due to sub-functionalization. The genome-wide identification and comprehensive gene expression profiling of homeobox gene family members in legumes will provide opportunities for functional analysis to unravel their exact role in plant growth and development.

  14. Origin and evolution of laminin gene family diversity.


    Fahey, Bryony; Degnan, Bernard M


    Laminins are a family of multidomain glycoproteins that are important contributors to the structure of metazoan extracellular matrices. To investigate the origin and evolution of the laminin family, we characterized the full complement of laminin-related genes in the genome of the sponge, Amphimedon queenslandica. As a representative of the Demospongiae, a group consistently placed within the earliest diverging branch of animals by molecular phylogenies, Amphimedon is uniquely placed to provide insight into early steps in the evolution of metazoan gene families. Five Amphimedon laminin-related genes possess the conserved molecular features, and most of the domains found in bilaterian laminins, but all display domain architectures distinct from those of the canonical laminin chain types known from model bilaterians. This finding prompted us to perform a comparative genomic analysis of laminins and related genes from a choanoflagellate and diverse metazoans and to conduct phylogenetic analyses using the conserved Laminin N-terminal domain in order to explore the relationships between genes with distinct architectures. Laminin-like genes appear to have originated in the holozoan lineage (choanoflagellates + metazoans + several other unicellular opisthokont taxa), with several laminin domains originating later and appearing only in metazoan (animal) or eumetazoan (placozoans + ctenophores + cnidarians + bilaterians) laminins. Typical bilaterian α, β, and γ laminin chain forms arose in the eumetazoan stem and another chain type that is conserved in Amphimedon, the cnidarian, Nematostella vectensis, and the echinoderm, Strongylocentrotus purpuratus, appears to have been lost independently from the placozoan, Trichoplax adhaerens, and from multiple bilaterians. Phylogenetic analysis did not clearly reconstruct relationships between the distinct laminin chain types (with the exception of the α chains) but did reveal how several members of the netrin family were

  15. The FT/TFL1 gene family in grapevine.


    Carmona, María José; Calonje, Myriam; Martínez-Zapater, José Miguel


    The FT/TFL1 gene family encodes proteins with similarity to phosphatidylethanolamine binding proteins which function as flowering promoters and repressors. We show here that the FT/TFL1 gene family in Vitis vinifera is composed of at least five genes. Sequence comparisons with homologous genes identified in other dicot species group them in three major clades, the FT, MFT and TFL1 subfamilies, the latter including three of the Vitis sequences. Gene expression patterns are in agreement with a role of VvFT and VvMFT as flowering promoters; while VvTFL1A, VvTFL1B and VvTFL1C could be associated with vegetative development and maintenance of meristem indetermination. Overexpression of VvFT in transgenic Arabidopsis plants generates early flowering phenotypes similar to those produced by FT supporting a role for this gene in flowering promotion. Overexpression of VvTFL1A does not affect flowering time but the determination of flower meristems, strongly altering inflorescence structure, which is consistent with the biological roles assigned to similar genes in other species.

  16. CHD7 Gene Polymorphisms and Familial Idiopathic Scoliosis

    PubMed Central

    Tilley, Mera K.; Justice, Cristina M.; Swindle, Kandice; Marosy, Beth; Wilson, Alexander F.; Miller, Nancy H.


    Study Design Model-independent linkage analysis and tests of association were performed for 22 single nucleotide polymorphisms (SNPs) in the CHD7 gene in 244 families of European descent with familial idiopathic scoliosis (FIS). Objective To replicate an association between FIS and the CHD7 gene on 8q12.2 in an independent sample of families of European descent. Summary of Background Data The CHD7 gene on chromosome 8, responsible for the CHARGE syndrome, was previously associated with FIS in an independent study that included 52 families of European descent. Methods Model-independent linkage analysis and intra-familial tests of association were performed on the degree of lateral curvature considered as a qualitative trait (with thresholds of ≥10°, ≥15°, ≥20° and ≥30°) and as a quantitative trait (degree of lateral curvature). Results from the tests of associations from this study and the previous study were combined in a weighted meta-analysis. Results No significant results (P< 0.01) were found for linkage analysis or tests of association between genetic variants of the CHD7 and FIS in this study sample, failing to replicate the findings from the previous study. Furthermore, no significant results (P< 0.01) were found from meta-analysis of the results from the tests of association from this sample and from the previous sample. Conclusion No association between the 22 genotyped SNPs in the CHD7 gene and FIS within this study sample was found, failing to replicate the earlier findings. Further investigation of the CHD7 gene and its potential association to FIS may be required. PMID:23883829

  17. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

    PubMed Central

    Mansur, Mariana; Suárez, Teresa; González, Aldo E.


    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  18. Effects of the Family Environment: Gene-Environment Interaction and Passive Gene-Environment Correlation

    ERIC Educational Resources Information Center

    Price, Thomas S.; Jaffee, Sara R.


    The classical twin study provides a useful resource for testing hypotheses about how the family environment influences children's development, including how genes can influence sensitivity to environmental effects. However, existing statistical models do not account for the possibility that children can inherit exposure to family environments…

  19. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    SciTech Connect

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles


    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  20. Population- and Family-Based Studies Associate the "MTHFR" Gene with Idiopathic Autism in Simplex Families

    ERIC Educational Resources Information Center

    Liu, Xudong; Solehdin, Fatima; Cohen, Ira L.; Gonzalez, Maripaz G.; Jenkins, Edmund C.; Lewis, M. E. Suzanne; Holden, Jeanette J. A.


    Two methylenetetrahydrofolate reductase gene ("MTHFR") functional polymorphisms were studied in 205 North American simplex (SPX) and 307 multiplex (MPX) families having one or more children with an autism spectrum disorder. Case-control comparisons revealed a significantly higher frequency of the low-activity 677T allele, higher prevalence of the…

  1. A Combinatorial Approach to Detecting Gene-Gene and Gene-Environment Interactions in Family Studies

    PubMed Central

    Lou, Xiang-Yang; Chen, Guo-Bo; Yan, Lei; Ma, Jennie Z.; Mangold, Jamie E.; Zhu, Jun; Elston, Robert C.; Li, Ming D.


    Widespread multifactor interactions present a significant challenge in determining risk factors of complex diseases. Several combinatorial approaches, such as the multifactor dimensionality reduction (MDR) method, have emerged as a promising tool for better detecting gene-gene (G × G) and gene-environment (G × E) interactions. We recently developed a general combinatorial approach, namely the generalized multifactor dimensionality reduction (GMDR) method, which can entertain both qualitative and quantitative phenotypes and allows for both discrete and continuous covariates to detect G × G and G × E interactions in a sample of unrelated individuals. In this article, we report the development of an algorithm that can be used to study G × G and G × E interactions for family-based designs, called pedigree-based GMDR (PGMDR). Compared to the available method, our proposed method has several major improvements, including allowing for covariate adjustments and being applicable to arbitrary phenotypes, arbitrary pedigree structures, and arbitrary patterns of missing marker genotypes. Our Monte Carlo simulations provide evidence that the PGMDR method is superior in performance to identify epistatic loci compared to the MDR-pedigree disequilibrium test (PDT). Finally, we applied our proposed approach to a genetic data set on tobacco dependence and found a significant interaction between two taste receptor genes (i.e., TAS2R16 and TAS2R38) in affecting nicotine dependence. PMID:18834969

  2. The genetics of alcoholism: identifying specific genes through family studies.


    Edenberg, Howard J; Foroud, Tatiana


    Alcoholism is a complex disorder with both genetic and environmental risk factors. Studies in humans have begun to elucidate the genetic underpinnings of the risk for alcoholism. Here we briefly review strategies for identifying individual genes in which variations affect the risk for alcoholism and related phenotypes, in the context of one large study that has successfully identified such genes. The Collaborative Study on the Genetics of Alcoholism (COGA) is a family-based study that has collected detailed phenotypic data on individuals in families with multiple alcoholic members. A genome-wide linkage approach led to the identification of chromosomal regions containing genes that influenced alcoholism risk and related phenotypes. Subsequently, single nucleotide polymorphisms (SNPs) were genotyped in positional candidate genes located within the linked chromosomal regions, and analyzed for association with these phenotypes. Using this sequential approach, COGA has detected association with GABRA2, CHRM2 and ADH4; these associations have all been replicated by other researchers. COGA has detected association to additional genes including GABRG3, TAS2R16, SNCA, OPRK1 and PDYN, results that are awaiting confirmation. These successes demonstrate that genes contributing to the risk for alcoholism can be reliably identified using human subjects.

  3. Plant Ion Channels: Gene Families, Physiology, and Functional Genomics Analyses

    PubMed Central

    Ward, John M.; Mäser, Pascal; Schroeder, Julian I.


    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization-and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide–gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport. PMID:18842100

  4. GJB2 gene mutations causing familial hereditary deafness in Turkey.


    Bayazit, Yildirim A; Cable, Benjamin B; Cataloluk, Osman; Kara, Cengiz; Chamberlin, Parker; Smith, Richard J H; Kanlikama, Muzaffer; Ozer, Enver; Cakmak, Ecir Ali; Mumbuc, Semih; Arslan, Ahmet


    Mutations in Connexin 26 (Cx26) play an important role in autosomal non-syndromic hereditary hearing loss. In this study, our objective was to find out the significance of Cx26 mutations in Turkish families who had hereditary deafness. Fourteen families who had at least two prelingually deaf children per family were included in the study. One affected child from each of the 14 families was selected for single-stranded conformational polymorphism SSCP analysis. Three PCR reactions were used for each subject to amplify the entire Cx26 coding region with overlap. PCR products were sequenced on an Applied Biosystems (ABI) model 3700 automated sequencer. Six of the 14 representative family members (42.9%) demonstrated shifts on SSCP and were subsequently sequenced for Exons 1 and 2 of GJB2 and were tested for the 432 kb upstream deletion. No mutations were found in Exon 1 and no 432 kb deletions were noted. Three different GJB2 mutations were found in Exon 2 of the probands, which were 35delG, 299-300delAT, and 487G > A (M163V). GJB2 mutations were detected in 21.4% of the families. Two patients were homozygous for 35delG and 299-300delAT mutations, and were given a diagnosis of DFNB1 deafness (14.3%). Two different polymorphisms, 457G > A (V153I) and 380G > AG (R127H) were also found. In conclusion, although GJB2 mutations were detected in 21.4% of the families tested, only 14.3% of subject representatives were homozygous and therefore deafness caused by Cx26 mutation segregated with DFNB1. Thus, contribution of GJB2 mutations appears less significant in familial deafness. This necessitates further assessment for the other known gene regions as well as a search for new genetic factors in familial type of genetic deafness.

  5. A new family of poecilostomatoid copepods (Strepidae fam. nov.) associated with the sun coral, Tubastraea coccinea Lesson, 1829 in Taiwan.


    Cheng, Yu-Rong; Liu, Shang-Yin Vanson; Dai, Chang-Feng


    Both sexes of Strepus elongatus gen. et sp. nov. are described based on specimens obtained from the coral host, Tubastraea coccinea Lesson, 1829, collected from shallow water reefs in Taiwan. The new species belongs to a new family of the copepod order Poecilostomatoida and displays the following morphological characteristics: (1) poecilostome type of well developed piercing mandibles, (2) absence of an oral cone, (3) highly transformed body, (4) 4-segmented antennules, (5) 2-segmented maxilliped, (6) caudal rami with only two setae, and (7) complete loss of legs 1-5 in the female, but legs 1-2 being represented by a free segment bearing two terminal setae in the male. In addition, the phylogenetic analysis based on 18S ribosomal RNA sequence data showed that S. elongatus clustered with a Sabelliphilus-Anchimolgus clade (Sabelliphilidae + Xarifiidae + Rhynchomolgidae + Anchimolgidae), and that the average genetic distance between S. elongatus gen. et sp. nov. and representatives of the six most closely related families (0.064) was higher than the average distances among those families (0.028). Therefore, based on both morphological and molecular data, a new family Strepidae fam. nov. is proposed to accommodate its only known species, S. elongatus gen. et sp. nov.

  6. Early evolution of the LIM homeobox gene family

    SciTech Connect

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S


    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  7. Mutation Analysis of HTRA2 Gene in Chinese Familial Essential Tremor and Familial Parkinson's Disease.


    He, Ya-Chao; Huang, Pei; Li, Qiong-Qiong; Sun, Qian; Li, Dun-Hui; Wang, Tian; Shen, Jun-Yi; Du, Juan-Juan; Cui, Shi-Shuang; Gao, Chao; Fu, Rao; Chen, Sheng-Di


    Background. HTRA2 has already been nominated as PARK13 which may cause Parkinson's disease, though there are still discrepancies among these results. Recently, Gulsuner et al.'s study found that HTRA2 p.G399S is responsible for hereditary essential tremor and homozygotes of this allele develop Parkinson's disease by examining a six-generation family segregating essential tremor and essential tremor coexisting with Parkinson's disease. We performed this study to validate the condition of HTRA2 gene in Chinese familial essential tremor and familial Parkinson's disease patients, especially essential tremor. Methods. We directly sequenced all eight exons, exon-intron boundaries, and part of the introns in 101 familial essential tremor patients, 105 familial Parkinson's disease patients, and 100 healthy controls. Results. No exonic variant was identified, while one exon-intron boundary variant (rs2241028) and one intron variant (rs2241027) were detected, both with no clinical significance and uncertain function. There was no difference in allele, genotype, and haplotype between groups. Conclusions. HTRA2 exonic variant might be rare among Chinese Parkinson's disease and essential tremor patients with family history, and HTRA2 may not be the cause of familial Parkinson's disease and essential tremor in China.

  8. Mutation Analysis of HTRA2 Gene in Chinese Familial Essential Tremor and Familial Parkinson's Disease

    PubMed Central

    Li, Qiong-Qiong; Fu, Rao


    Background. HTRA2 has already been nominated as PARK13 which may cause Parkinson's disease, though there are still discrepancies among these results. Recently, Gulsuner et al.'s study found that HTRA2 p.G399S is responsible for hereditary essential tremor and homozygotes of this allele develop Parkinson's disease by examining a six-generation family segregating essential tremor and essential tremor coexisting with Parkinson's disease. We performed this study to validate the condition of HTRA2 gene in Chinese familial essential tremor and familial Parkinson's disease patients, especially essential tremor. Methods. We directly sequenced all eight exons, exon-intron boundaries, and part of the introns in 101 familial essential tremor patients, 105 familial Parkinson's disease patients, and 100 healthy controls. Results. No exonic variant was identified, while one exon-intron boundary variant (rs2241028) and one intron variant (rs2241027) were detected, both with no clinical significance and uncertain function. There was no difference in allele, genotype, and haplotype between groups. Conclusions. HTRA2 exonic variant might be rare among Chinese Parkinson's disease and essential tremor patients with family history, and HTRA2 may not be the cause of familial Parkinson's disease and essential tremor in China. PMID:28243480

  9. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families.


    Vyas, Valmik K; Barrasa, M Inmaculada; Fink, Gerald R

    Candida albicans is a pathogenic yeast that causes mucosal and systematic infections with high mortality. The absence of facile molecular genetics has been a major impediment to analysis of pathogenesis. The lack of meiosis coupled with the absence of plasmids makes genetic engineering cumbersome, especially for essential functions and gene families. We describe a C. albicans CRISPR system that overcomes many of the obstacles to genetic engineering in this organism. The high frequency with which CRISPR-induced mutations can be directed to target genes enables easy isolation of homozygous gene knockouts, even without selection. Moreover, the system permits the creation of strains with mutations in multiple genes, gene families, and genes that encode essential functions. This CRISPR system is also effective in a fresh clinical isolate of undetermined ploidy. Our method transforms the ability to manipulate the genome of Candida and provides a new window into the biology of this pathogen.

  10. MORC Family ATPases Required for Heterochromatin Condensation and Gene Silencing#

    PubMed Central

    Moissiard, Guillaume; Cokus, Shawn J.; Cary, Joshua; Feng, Suhua; Billi, Allison C.; Stroud, Hume; Husmann, Dylan; Zhan, Ye; Lajoie, Bryan R.; McCord, Rachel Patton; Hale, Christopher J.; Feng, Wei; Michaels, Scott D.; Frand, Alison R.; Pellegrini, Matteo; Dekker, Job; Kim, John K.; Jacobsen, Steve


    Transposable elements (TEs) and DNA repeats are commonly targeted by DNA and histone methylation to achieve epigenetic gene silencing. We isolated mutations in two Arabidopsis genes, AtMORC1 and AtMORC6, which cause de-repression of DNA-methylated genes and TEs, but no losses of DNA or histone methylation. AtMORC1 and AtMORC6 are members of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. The atmorc1 and atmorc6 mutants show decondensation of pericentromeric heterochromatin, increased interaction of pericentromeric regions with the rest of the genome, and transcriptional defects that are largely restricted to loci residing in pericentromeric regions. Knockdown of the single MORC homolog in Caenorhabditis elegans also impairs transgene silencing. We propose that the MORC ATPases are conserved regulators of gene silencing in eukaryotes. PMID:22555433

  11. Massive expansion of the calpain gene family in unicellular eukaryotes

    PubMed Central


    Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes. PMID:23020305

  12. Chromosomal evolution of the PKD1 gene family in primates

    PubMed Central


    Background The autosomal dominant polycystic kidney disease (ADPKD) is mostly caused by mutations in the PKD1 (polycystic kidney disease 1) gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative transposition of the PKD1 gene and

  13. NDP gene mutations in 14 French families with Norrie disease.


    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul


    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype.

  14. The Maize PIN Gene Family of Auxin Transporters.


    Forestan, Cristian; Farinati, Silvia; Varotto, Serena


    Auxin is a key regulator of plant development and its differential distribution in plant tissues, established by a polar cell to cell transport, can trigger a wide range of developmental processes. A few members of the two families of auxin efflux transport proteins, PIN-formed (PIN) and P-glycoprotein (ABCB/PGP), have so far been characterized in maize. Nine new Zea mays auxin efflux carriers PIN family members and two maize PIN-like genes have now been identified. Four members of PIN1 (named ZmPIN1a-d) cluster, one gene homologous to AtPIN2 (ZmPIN2), three orthologs of PIN5 (ZmPIN5a-c), one gene paired with AtPIN8 (ZmPIN8), and three monocot-specific PINs (ZmPIN9, ZmPIN10a, and ZmPIN10b) were cloned and the phylogenetic relationships between early-land plants, monocots, and eudicots PIN proteins investigated, including the new maize PIN proteins. Tissue-specific expression patterns of the 12 maize PIN genes, 2 PIN-like genes and ZmABCB1, an ABCB auxin efflux carrier, were analyzed together with protein localization and auxin accumulation patterns in normal conditions and in response to drug applications. ZmPIN gene transcripts have overlapping expression domains in the root apex, during male and female inflorescence differentiation and kernel development. However, some PIN family members have specific tissue localization: ZmPIN1d transcript marks the L1 layer of the shoot apical meristem and inflorescence meristem during the flowering transition and the monocot-specific ZmPIN9 is expressed in the root endodermis and pericycle. The phylogenetic and gene structure analyses together with the expression pattern of the ZmPIN gene family indicate that subfunctionalization of some maize PINs can be associated to the differentiation and development of monocot-specific organs and tissues and might have occurred after the divergence between dicots and monocots.

  15. The Maize PIN Gene Family of Auxin Transporters

    PubMed Central

    Forestan, Cristian; Farinati, Silvia; Varotto, Serena


    Auxin is a key regulator of plant development and its differential distribution in plant tissues, established by a polar cell to cell transport, can trigger a wide range of developmental processes. A few members of the two families of auxin efflux transport proteins, PIN-formed (PIN) and P-glycoprotein (ABCB/PGP), have so far been characterized in maize. Nine new Zea mays auxin efflux carriers PIN family members and two maize PIN-like genes have now been identified. Four members of PIN1 (named ZmPIN1a–d) cluster, one gene homologous to AtPIN2 (ZmPIN2), three orthologs of PIN5 (ZmPIN5a–c), one gene paired with AtPIN8 (ZmPIN8), and three monocot-specific PINs (ZmPIN9, ZmPIN10a, and ZmPIN10b) were cloned and the phylogenetic relationships between early-land plants, monocots, and eudicots PIN proteins investigated, including the new maize PIN proteins. Tissue-specific expression patterns of the 12 maize PIN genes, 2 PIN-like genes and ZmABCB1, an ABCB auxin efflux carrier, were analyzed together with protein localization and auxin accumulation patterns in normal conditions and in response to drug applications. ZmPIN gene transcripts have overlapping expression domains in the root apex, during male and female inflorescence differentiation and kernel development. However, some PIN family members have specific tissue localization: ZmPIN1d transcript marks the L1 layer of the shoot apical meristem and inflorescence meristem during the flowering transition and the monocot-specific ZmPIN9 is expressed in the root endodermis and pericycle. The phylogenetic and gene structure analyses together with the expression pattern of the ZmPIN gene family indicate that subfunctionalization of some maize PINs can be associated to the differentiation and development of monocot-specific organs and tissues and might have occurred after the divergence between dicots and monocots. PMID:22639639

  16. Finding the missing honey bee genes: lessons learned from a genome upgrade

    PubMed Central


    Background The first generation of genome sequence assemblies and annotations have had a significant impact upon our understanding of the biology of the sequenced species, the phylogenetic relationships among species, the study of populations within and across species, and have informed the biology of humans. As only a few Metazoan genomes are approaching finished quality (human, mouse, fly and worm), there is room for improvement of most genome assemblies. The honey bee (Apis mellifera) genome, published in 2006, was noted for its bimodal GC content distribution that affected the quality of the assembly in some regions and for fewer genes in the initial gene set (OGSv1.0) compared to what would be expected based on other sequenced insect genomes. Results Here, we report an improved honey bee genome assembly (Amel_4.5) with a new gene annotation set (OGSv3.2), and show that the honey bee genome contains a number of genes similar to that of other insect genomes, contrary to what was suggested in OGSv1.0. The new genome assembly is more contiguous and complete and the new gene set includes ~5000 more protein-coding genes, 50% more than previously reported. About 1/6 of the additional genes were due to improvements to the assembly, and the remaining were inferred based on new RNAseq and protein data. Conclusions Lessons learned from this genome upgrade have important implications for future genome sequencing projects. Furthermore, the improvements significantly enhance genomic resources for the honey bee, a key model for social behavior and essential to global ecology through pollination. PMID:24479613

  17. Language Maintenance in a Multilingual Family: Informal Heritage Language Lessons in Parent-Child Interactions

    ERIC Educational Resources Information Center

    Kheirkhah, Mina; Cekaite, Asta


    The present study explores language socialization patterns in a Persian-Kurdish family in Sweden and examines how "one-parent, one-language" family language policies are instantiated and negotiated in parent-child interactions. The data consist of video-recordings and ethnographic observations of family interactions, as well as…

  18. Clock-associated genes in Arabidopsis: a family affair.

    PubMed Central

    Somers, D E


    The identification of components of the plant circadian clock has been advanced recently with the success of two forward genetics approaches. The ZEITLUPE and TOC1 loci were cloned and each was found to be part of two separate, larger gene families with intriguing domain structures. The ZTL family of proteins contains a subclass of the PAS domain coupled to an F box and kelch motifs, suggesting that they play a role in a novel light-regulated ubiquitination mechanism. TOC1 shares similarity to the receiver domain of the well-known two-component phosphorelay signalling systems, combined with a strong similarity to a region of the CONSTANS transcription factor, which is involved in controlling flowering time. When added to the repertoire of previously identified clock-associated genes, it is clear that both similarities and differences with other circadian systems will emerge in the coming years. PMID:11710981

  19. Epigenetic balance of gene expression by Polycomb and COMPASS families.


    Piunti, Andrea; Shilatifard, Ali


    Epigenetic regulation of gene expression in metazoans is central for establishing cellular diversity, and its deregulation can result in pathological conditions. Although transcription factors are essential for implementing gene expression programs, they do not function in isolation and require the recruitment of various chromatin-modifying and -remodeling machineries. A classic example of developmental chromatin regulation is the balanced activities of the Polycomb group (PcG) proteins within the PRC1 and PRC2 complexes, and the Trithorax group (TrxG) proteins within the COMPASS family, which are highly mutated in a large number of human diseases. In this review, we will discuss the latest findings regarding the properties of the PcG and COMPASS families and the insight they provide into the epigenetic control of transcription under physiological and pathological settings.

  20. Variation in the RAD51 gene and familial breast cancer

    PubMed Central

    Lose, Felicity; Lovelock, Paul; Chenevix-Trench, Georgia; Mann, Graham J; Pupo, Gulietta M; Spurdle, Amanda B


    Introduction Human RAD51 is a homologue of the Escherichia coli RecA protein and is known to function in recombinational repair of double-stranded DNA breaks. Mutations in the lower eukaryotic homologues of RAD51 result in a deficiency in the repair of double-stranded DNA breaks. Loss of RAD51 function would therefore be expected to result in an elevated mutation rate, leading to accumulation of DNA damage and, hence, to increased cancer risk. RAD51 interacts directly or indirectly with a number of proteins implicated in breast cancer, such as BRCA1 and BRCA2. Similar to BRCA1 mice, RAD51-/- mice are embryonic lethal. The RAD51 gene region has been shown to exhibit loss of heterozygosity in breast tumours, and deregulated RAD51 expression in breast cancer patients has also been reported. Few studies have investigated the role of coding region variation in the RAD51 gene in familial breast cancer, with only one coding region variant – exon 6 c.449G>A (p.R150Q) – reported to date. Methods All nine coding exons of the RAD51 gene were analysed for variation in 46 well-characterised, BRCA1/2-negative breast cancer families using denaturing high-performance liquid chromatography. Genotyping of the exon 6 p.R150Q variant was performed in an additional 66 families. Additionally, lymphoblastoid cell lines from breast cancer patients were subjected to single nucleotide primer extension analysis to assess RAD51 expression. Results No coding region variation was found, and all intronic variation detected was either found in unaffected controls or was unlikely to have functional consequences. Single nucleotide primer extension analysis did not reveal any allele-specific changes in RAD51 expression in all lymphoblastoid cell lines tested. Conclusion Our study indicates that RAD51 is not a major familial breast cancer predisposition gene. PMID:16762046

  1. A Child's Guide to Surviving in a Troubled Family. Breakthrough Strategies To Teach and Counsel Troubled Youth: Social Skills, School Skills, Coping Skills Lesson Series.

    ERIC Educational Resources Information Center

    Wells, Ruth Herman

    This document is one of eight in a series of guides designed to help teach and counsel troubled youth. It differs from the others in the series in that it was written specifically for children who are struggling with serious family problems such as substance abuse, sexual abuse, domestic violence, and mental illness. The first of the 20 lessons in…

  2. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    NASA Technical Reports Server (NTRS)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.


    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  3. The carboxylesterase/cholinesterase gene family in invertebrate deuterostomes.


    Johnson, Glynis; Moore, Samuel W


    Carboxylesterase/cholinesterase family members are responsible for controlling the nerve impulse, detoxification and various developmental functions, and are a major target of pesticides and chemical warfare agents. Comparative structural analysis of these enzymes is thus important. The invertebrate deuterostomes (phyla Echinodermata and Hemichordata and subphyla Urochordata and Cephalochordata) lie in the transition zone between invertebrates and vertebrates, and are thus of interest to the study of evolution. Here we have investigated the carboxylesterase/cholinesterase gene family in the sequenced genomes of Strongylocentrotus purpuratus (Echinodermata), Saccoglossus kowalevskii (Hemichordata), Ciona intestinalis (Urochordata) and Branchiostoma floridae (Cephalochordata), using sequence analysis of the catalytic apparatus and oligomerisation domains, and phylogenetic analysis. All four genomes show blurring of structural boundaries between cholinesterases and carboxylesterases, with many intermediate enzymes. Non-enzymatic proteins are well represented. The Saccoglossus and Branchiostoma genomes show evidence of extensive gene duplication and retention. There is also evidence of domain shuffling, resulting in multidomain proteins consisting either of multiple carboxylesterase domains, or of carboxylesterase/cholinesterase domains linked to other domains, including RING finger, chitin-binding, immunoglobulin, fibronectin type 3, CUB, cysteine-rich-Frizzled, caspase activation and 7tm-1, amongst others. Such gene duplication and domain shuffling in the carboxylesterase/cholinesterase family appears to be unique to the invertebrate deuterostomes, and we hypothesise that these factors may have contributed to the evolution of the morphological complexity, particularly of the nervous system and neural crest, of the vertebrates.

  4. Tomato ABSCISIC ACID STRESS RIPENING (ASR) gene family revisited.


    Golan, Ido; Dominguez, Pia Guadalupe; Konrad, Zvia; Shkolnik-Inbar, Doron; Carrari, Fernando; Bar-Zvi, Dudy


    Tomato ABSCISIC ACID RIPENING 1 (ASR1) was the first cloned plant ASR gene. ASR orthologs were then cloned from a large number of monocot, dicot and gymnosperm plants, where they are mostly involved in response to abiotic (drought and salinity) stress and fruit ripening. The tomato genome encodes five ASR genes: ASR1, 2, 3 and 5 encode low-molecular-weight proteins (ca. 110 amino acid residues each), whereas ASR4 encodes a 297-residue polypeptide. Information on the expression of the tomato ASR gene family is scarce. We used quantitative RT-PCR to assay the expression of this gene family in plant development and in response to salt and osmotic stresses. ASR1 and ASR4 were the main expressed genes in all tested organs and conditions, whereas ASR2 and ASR3/5 expression was two to three orders of magnitude lower (with the exception of cotyledons). ASR1 is expressed in all plant tissues tested whereas ASR4 expression is limited to photosynthetic organs and stamens. Essentially, ASR1 accounted for most of ASR gene expression in roots, stems and fruits at all developmental stages, whereas ASR4 was the major gene expressed in cotyledons and young and fully developed leaves. Both ASR1 and ASR4 were expressed in flower organs, with ASR1 expression dominating in stamens and pistils, ASR4 in sepals and petals. Steady-state levels of ASR1 and ASR4 were upregulated in plant vegetative organs following exposure to salt stress, osmotic stress or the plant abiotic stress hormone abscisic acid (ABA). Tomato plants overexpressing ASR1 displayed enhanced survival rates under conditions of water stress, whereas ASR1-antisense plants displayed marginal hypersensitivity to water withholding.

  5. Lessons Learned from Whole Exome Sequencing in Multiplex Families Affected by a Complex Genetic Disorder, Intracranial Aneurysm

    PubMed Central

    Farlow, Janice L.; Lin, Hai; Sauerbeck, Laura; Lai, Dongbing; Koller, Daniel L.; Pugh, Elizabeth; Hetrick, Kurt; Ling, Hua; Kleinloog, Rachel; van der Vlies, Pieter; Deelen, Patrick; Swertz, Morris A.; Verweij, Bon H.; Regli, Luca; Rinkel, Gabriel J. E.; Ruigrok, Ynte M.; Doheny, Kimberly; Liu, Yunlong; Broderick, Joseph; Foroud, Tatiana


    Genetic risk factors for intracranial aneurysm (IA) are not yet fully understood. Genomewide association studies have been successful at identifying common variants; however, the role of rare variation in IA susceptibility has not been fully explored. In this study, we report the use of whole exome sequencing (WES) in seven densely-affected families (45 individuals) recruited as part of the Familial Intracranial Aneurysm study. WES variants were prioritized by functional prediction, frequency, predicted pathogenicity, and segregation within families. Using these criteria, 68 variants in 68 genes were prioritized across the seven families. Of the genes that were expressed in IA tissue, one gene (TMEM132B) was differentially expressed in aneurysmal samples (n=44) as compared to control samples (n=16) (false discovery rate adjusted p-value=0.023). We demonstrate that sequencing of densely affected families permits exploration of the role of rare variants in a relatively common disease such as IA, although there are important study design considerations for applying sequencing to complex disorders. In this study, we explore methods of WES variant prioritization, including the incorporation of unaffected individuals, multipoint linkage analysis, biological pathway information, and transcriptome profiling. Further studies are needed to validate and characterize the set of variants and genes identified in this study. PMID:25803036

  6. Lessons learned from whole exome sequencing in multiplex families affected by a complex genetic disorder, intracranial aneurysm.


    Farlow, Janice L; Lin, Hai; Sauerbeck, Laura; Lai, Dongbing; Koller, Daniel L; Pugh, Elizabeth; Hetrick, Kurt; Ling, Hua; Kleinloog, Rachel; van der Vlies, Pieter; Deelen, Patrick; Swertz, Morris A; Verweij, Bon H; Regli, Luca; Rinkel, Gabriel J E; Ruigrok, Ynte M; Doheny, Kimberly; Liu, Yunlong; Broderick, Joseph; Foroud, Tatiana


    Genetic risk factors for intracranial aneurysm (IA) are not yet fully understood. Genomewide association studies have been successful at identifying common variants; however, the role of rare variation in IA susceptibility has not been fully explored. In this study, we report the use of whole exome sequencing (WES) in seven densely-affected families (45 individuals) recruited as part of the Familial Intracranial Aneurysm study. WES variants were prioritized by functional prediction, frequency, predicted pathogenicity, and segregation within families. Using these criteria, 68 variants in 68 genes were prioritized across the seven families. Of the genes that were expressed in IA tissue, one gene (TMEM132B) was differentially expressed in aneurysmal samples (n=44) as compared to control samples (n=16) (false discovery rate adjusted p-value=0.023). We demonstrate that sequencing of densely affected families permits exploration of the role of rare variants in a relatively common disease such as IA, although there are important study design considerations for applying sequencing to complex disorders. In this study, we explore methods of WES variant prioritization, including the incorporation of unaffected individuals, multipoint linkage analysis, biological pathway information, and transcriptome profiling. Further studies are needed to validate and characterize the set of variants and genes identified in this study.

  7. Organization of the human lipoprotein lipase gene and evolution of the lipase gene family.

    PubMed Central

    Kirchgessner, T G; Chuat, J C; Heinzmann, C; Etienne, J; Guilhot, S; Svenson, K; Ameis, D; Pilon, C; d'Auriol, L; Andalibi, A


    The human lipoprotein lipase gene was cloned and characterized. It is composed of 10 exons spanning approximately equal to 30 kilobases. The first exon encodes the 5'-untranslated region, the signal peptide plus the first two amino acids of the mature protein. The next eight exons encode the remaining 446 amino acids, and the tenth exon encodes the long 3'-untranslated region of 1948 nucleotides. The lipoprotein lipase transcription start site and the sequence of the 5'-flanking region were also determined. We compared the organization of genes for lipoprotein lipase, hepatic lipase, pancreatic lipase, and Drosophila yolk protein 1, which are members of a family of related genes. A model for the evolution of the lipase gene family is presented that involves multiple rounds of gene duplication plus exon-shuffling and intron-loss events. Images PMID:2602366

  8. The Evolution of Novelty in Conserved Gene Families

    PubMed Central

    Markov, Gabriel V.; Sommer, Ralf J.


    One of the major aims of contemporary evolutionary biology is the understanding of the current pattern of biological diversity. This involves, first, the description of character distribution at various nodes of the phylogenetic tree of life and, second, the functional explanation of such changes. The analysis of character distribution is a powerful tool at both the morphological and molecular levels. Recent high-throughput sequencing approaches provide new opportunities to study the genetic architecture of organisms at the genome-wide level. In eukaryotes, one overarching finding is the absence of simple correlations of gene count and biological complexity. Instead, the domain architecture of proteins is becoming a central focus for large-scale evolutionary innovations. Here, we review examples of the evolution of novelty in conserved gene families in insects and nematodes. We highlight how in the absence of whole-genome duplications molecular novelty can arise, how members of gene families have diversified at distinct mechanistic levels, and how gene expression can be maintained in the context of multiple innovations in regulatory mechanisms. PMID:22779028

  9. Evolution of the tyrosinase gene family in bivalve molluscs: independent expansion of the mantle gene repertoire.


    Aguilera, Felipe; McDougall, Carmel; Degnan, Bernard M


    Tyrosinase is a copper-containing enzyme that mediates the hydroxylation of monophenols and oxidation of o-diphenols to o-quinones. This enzyme is involved in a variety of biological processes, including pigment production, innate immunity, wound healing, and exoskeleton fabrication and hardening (e.g. arthropod skeleton and mollusc shell). Here we show that the tyrosinase gene family has undergone large expansions in pearl oysters (Pinctada spp.) and the Pacific oyster (Crassostrea gigas). Phylogenetic analysis reveals that pearl oysters possess at least four tyrosinase genes that are not present in the Pacific oyster. Likewise, C. gigas has multiple tyrosinase genes that are not orthologous to the Pinctada genes, indicating that this gene family has expanded independently in these bivalve lineages. Many of the tyrosinase genes in these bivalves are expressed at relatively high levels in the mantle, the organ responsible for shell fabrication. Detailed comparisons of tyrosinase gene expression in different regions of the mantle in two closely related pearl oysters, P. maxima and P. margaritifera, reveals that recently evolved orthologous tyrosinase genes can have markedly different expression profiles. The expansion of tyrosinase genes in these oysters and their co-option into the mantle's gene regulatory network is consistent with mollusc shell formation being underpinned by a rapidly evolving transcriptome.

  10. PRODH gene is associated with executive function in schizophrenic families.


    Li, Tao; Ma, Xiaohong; Hu, Xun; Wang, Yingcheng; Yan, Chengying; Meng, Huaqing; Liu, Xiehe; Toulopoulou, Timothea; Murray, Robin M; Collier, David A


    The aim of this study was to investigate the relationship between polymorphisms in the PRODH and COMT genes and selected neurocognitive functions. Six SNPs in PRODH and two SNPs in COMT were genotyped in 167 first-episode schizophrenic families who had been assessed by a set of 14 neuropsychological tests. Neuropsychological measures were selected as quantitative traits for association analysis. The haplotype of SNPs PRODH 1945T/C and PRODH 1852G/A was associated with impaired performance on the Tower of Hanoi, a problem-solving task mainly reflecting planning capacity. There was no significant evidence for association with any other neuropsychological traits for other SNPs or haplotypes of paired SNPs in the two genes. This study takes previous findings of association between PRODH and schizophrenia further by associating variation within the gene with performance on a neurocognitive trait characteristic of the illness. It fails to confirm previous reports of an association between COMT and cognitive function.

  11. Biofuel Potential of Plants Transformed Genetically with NAC Family Genes

    PubMed Central

    Singh, Sadhana; Grover, Atul; Nasim, M.


    NAC genes contribute to enhance survivability of plants under conditions of environmental stress and in secondary growth of the plants, thereby building biomass. Thus, genetic transformation of plants using NAC genes provides a possibility to tailor biofuel plants. Over-expression studies have indicated that NAC family genes can provide tolerance to various biotic and abiotic stresses, either by physiological or biochemical changes at the cellular level, or by affecting visible morphological and anatomical changes, for example, by development of lateral roots in a number of plants. Over-expression of these genes also work as triggers for development of secondary cell walls. In our laboratory, we have observed a NAC gene from Lepidium latifolium contributing to both enhanced biomass as well as cold stress tolerance of model plants tobacco. Thus, we have reviewed all the developments of genetic engineering using NAC genes which could enhance the traits required for biofuel plants, either by enhancing the stress tolerance or by enhancing the biomass of the plants. PMID:26858739

  12. Gene Turnover in the Avian Globin Gene Families and Evolutionary Changes in Hemoglobin Isoform Expression

    PubMed Central

    Opazo, Juan C.; Hoffmann, Federico G.; Natarajan, Chandrasekhar; Witt, Christopher C.; Berenbrink, Michael; Storz, Jay F.


    The apparent stasis in the evolution of avian chromosomes suggests that birds may have experienced relatively low rates of gene gain and loss in multigene families. To investigate this possibility and to explore the phenotypic consequences of variation in gene copy number, we examined evolutionary changes in the families of genes that encode the α- and β-type subunits of hemoglobin (Hb), the tetrameric α2β2 protein responsible for blood-O2 transport. A comparative genomic analysis of 52 bird species revealed that the size and membership composition of the α- and β-globin gene families have remained remarkably constant during approximately 100 My of avian evolution. Most interspecific variation in gene content is attributable to multiple independent inactivations of the αD-globin gene, which encodes the α-chain subunit of a functionally distinct Hb isoform (HbD) that is expressed in both embryonic and definitive erythrocytes. Due to consistent differences in O2-binding properties between HbD and the major adult-expressed Hb isoform, HbA (which incorporates products of the αA-globin gene), recurrent losses of αD-globin contribute to among-species variation in blood-O2 affinity. Analysis of HbA/HbD expression levels in the red blood cells of 122 bird species revealed high variability among lineages and strong phylogenetic signal. In comparison with the homologous gene clusters in mammals, the low retention rate for lineage-specific gene duplicates in the avian globin gene clusters suggests that the developmental regulation of Hb synthesis in birds may be more highly conserved, with orthologous genes having similar stage-specific expression profiles and similar functional properties in disparate taxa. PMID:25502940

  13. Gene turnover in the avian globin gene families and evolutionary changes in hemoglobin isoform expression.


    Opazo, Juan C; Hoffmann, Federico G; Natarajan, Chandrasekhar; Witt, Christopher C; Berenbrink, Michael; Storz, Jay F


    The apparent stasis in the evolution of avian chromosomes suggests that birds may have experienced relatively low rates of gene gain and loss in multigene families. To investigate this possibility and to explore the phenotypic consequences of variation in gene copy number, we examined evolutionary changes in the families of genes that encode the α- and β-type subunits of hemoglobin (Hb), the tetrameric α2β2 protein responsible for blood-O2 transport. A comparative genomic analysis of 52 bird species revealed that the size and membership composition of the α- and β-globin gene families have remained remarkably constant during approximately 100 My of avian evolution. Most interspecific variation in gene content is attributable to multiple independent inactivations of the α(D)-globin gene, which encodes the α-chain subunit of a functionally distinct Hb isoform (HbD) that is expressed in both embryonic and definitive erythrocytes. Due to consistent differences in O2-binding properties between HbD and the major adult-expressed Hb isoform, HbA (which incorporates products of the α(A)-globin gene), recurrent losses of α(D)-globin contribute to among-species variation in blood-O2 affinity. Analysis of HbA/HbD expression levels in the red blood cells of 122 bird species revealed high variability among lineages and strong phylogenetic signal. In comparison with the homologous gene clusters in mammals, the low retention rate for lineage-specific gene duplicates in the avian globin gene clusters suggests that the developmental regulation of Hb synthesis in birds may be more highly conserved, with orthologous genes having similar stage-specific expression profiles and similar functional properties in disparate taxa.

  14. Child Care under the Family Support Act: Early Lessons from the States.

    ERIC Educational Resources Information Center

    Children's Defense Fund, Washington, DC.

    A Children's Defense Fund (CDF) survey indicates that many AFDC families are being forced to place their children in low-quality and potentially dangerous child care. Family Support Act (FSA) childcare typically lacks basic health and safety and precautions, fails to provide sufficient assistance to support quality childcare and preschool…

  15. Internal and External Adaptation in Army Families: Lessons from Operations Desert Shield and Desert Storm

    ERIC Educational Resources Information Center

    Pittman, Joe F.; Kerpelman, Jennifer L.; McFadyen, Jennifer M.


    This study examined 1,064 Army families reunited after a member's deployment for Operation Desert Shield and Operation Desert Storm. Postdeployment outcomes were conceptualized in terms of the "fit" between the family and the demands of Army life, especially the stress of deployment. A structural model was used to test the hypothesized effects of…

  16. Building Bridges. Lessons Learned in Family-Centered Interprofessional Collaboration: Year Two.

    ERIC Educational Resources Information Center

    Hawaii Medication Association, Honolulu.

    Hawaii's Health and Education Collaboration Project (HEC) is intended to develop a personnel preparation model that promotes working relationships among trained collaborative providers and keeps families pivotal to the process. This monograph reports on the progress of this family-professional partnership initiative. Following the preface, the…

  17. Engaging Military Fathers in a Reflective Parenting Program: Lessons from Strong Families Strong Forces

    ERIC Educational Resources Information Center

    DeVoe, Ellen R.; Paris, Ruth


    Through Strong Families Strong Forces, a reflective parenting program for military families with young children, we were privileged to work with contemporary military fathers who served in the post-9/11 conflicts in Afghanistan and Iraq. Due to this work, the authors gained valuable insight into the complexity of fathering during wartime, the…

  18. Family Focused Therapy for Bipolar Adolescents: Lessons from a Difficult Treatment Case

    ERIC Educational Resources Information Center

    George, Elizabeth L.; Taylor, Dawn O.; Goldstein, Benjamin I.; Miklowitz, David J.


    This paper examines obstacles and challenges encountered in the manualized Family Focused Therapy-A of an adolescent with bipolar disorder. We begin by describing adolescent bipolar disorder and some of the many complications that frequently accompany it. We summarize Family Focused Therapy (FFT-A), an empirically validated treatment approach for…

  19. The Implementation of Families First NSW: Process Lessons from the First Four Years

    ERIC Educational Resources Information Center

    Fisher, Karen; Thomson, Cathy; Valentine, Kylie


    Families First is a NSW Government strategy that aims to improve the effectiveness of early intervention services supporting families and communities to care for children. Its implementation is the joint responsibility of the five NSW Human Services agencies: the NSW departments of Community Services (DoCS); Ageing, Disability and Home Care…

  20. The ABCs of Family Mealtimes: Observational Lessons for Promoting Healthy Outcomes for Children with Persistent Asthma

    ERIC Educational Resources Information Center

    Fiese, Barbara H.; Winter, Marcia A.; Botti, Joanna C.


    Family mealtimes have the potential to promote healthy child development. This observational study of 200 family mealtimes examined the relation between child health in a group of children (ages 5 to 12) with persistent asthma and 3 dimensions of mealtime interaction: Action, Behavior Control, and Communication. Percent time spent in Action and…

  1. Supporting Latino Families: Lessons from Exemplary Programs. Volumes I and II.

    ERIC Educational Resources Information Center

    Shartrand, Angela

    This report highlights 11 family support programs that are serving one of the fastest growing groups in the United States--the Latino population. The programs described in this report differ from each other in terms of their structures and the types of families and communities served. They represent a range of geographic areas and vary in terms of…

  2. The Home Visit as a Teaching Event: Lessons from Eight Even Start Family Literacy Sites.

    ERIC Educational Resources Information Center

    Roth, Jeffrey

    Family literacy programs have arisen in an attempt to break the cycle of intergenerational poverty and illiteracy. Numerous federally-supported family literacy programs have recognized the importance of instructing parents and children in a home setting. The legislation of Even Start seeks to integrate parenting education, adult basic education,…

  3. Lessons from the Field: Participatory Action Research in a Family Research Project.

    ERIC Educational Resources Information Center

    Robison, Dorothy; Krauss, Marty Wyngaarden


    This paper describes development of a study that includes participatory action research, specifically the establishment of a family advisory committee. The study involved a survey of Massachusetts families of children with disabilities. Suggestions for establishing and integrating the committee into the research enterprise are offered, as are…

  4. Molecular genetics of the aip gene in familial pituitary tumorigenesis.


    Tahir, Asil; Chahal, Harvinder S; Korbonits, Márta


    Pituitary adenomas usually occur as sporadic tumors, but familial cases are now increasingly identified. As opposed to multiple endocrine neoplasia type 1 and Carney complex, in familial isolated pituitary adenoma (FIPA) syndrome no other disease is associated with the familial occurrence of pituitary adenomas. It is an autosomal dominant disease with incomplete variable penetrance. Approximately 20% of patients with FIPA harbour germline mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene located on 11q13. Patients with AIP mutations have an overwhelming predominance of somatotroph and lactotroph adenomas, which often present in childhood or young adulthood. AIP, originally identified as a molecular co-chaperone of several nuclear receptors, is thought to act as a tumor suppressor gene; overexpression of wild-type, but not mutant AIP, reduces cell proliferation while knockdown of AIP stimulates it. AIP is shown to bind various proteins, including the aryl hydrocarbon receptor, Hsp90, phosphodiesterases, survivin, RET and the glucocorticoid receptor, but currently it is not clear which interaction has the leading role in pituitary tumorigenesis. This chapter summarizes the available clinical and molecular data regarding the role of AIP in the pituitary gland.

  5. Evolutionary History of Chordate PAX Genes: Dynamics of Change in a Complex Gene Family

    PubMed Central

    Paixão-Côrtes, Vanessa Rodrigues; Salzano, Francisco Mauro; Bortolini, Maria Cátira


    Paired box (PAX) genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory. PMID:24023886

  6. FoxO gene family evolution in vertebrates

    PubMed Central

    Wang, Minghui; Zhang, Xiangzhe; Zhao, Hongbo; Wang, Qishan; Pan, Yuchun


    Background Forkhead box, class O (FoxO) belongs to the large family of forkhead transcription factors that are characterized by a conserved forkhead box DNA-binding domain. To date, the FoxO group has four mammalian members: FoxO1, FoxO3a, FoxO4 and FoxO6, which are orthologs of DAF16, an insulin-responsive transcription factor involved in regulating longevity of worms and flies. The degree of homology between these four members is high, especially in the forkhead domain, which contains the DNA-binding interface. Yet, mouse FoxO knockouts have revealed that each FoxO gene has its unique role in the physiological process. Whether the functional divergences are primarily due to adaptive selection pressure or relaxed selective constraint remains an open question. As such, this study aims to address the evolutionary mode of FoxO, which may lead to the functional divergence. Results Sequence similarity searches have performed in genome and scaffold data to identify homologues of FoxO in vertebrates. Phylogenetic analysis was used to characterize the family evolutionary history by identifying two duplications early in vertebrate evolution. To determine the mode of evolution in vertebrates, we performed a rigorous statistical analysis with FoxO gene sequences, including relative rate ratio tests, branch-specific dN/dS ratio tests, site-specific dN/dS ratio tests, branch-site dN/dS ratio tests and clade level amino acid conservation/variation patterns analysis. Our results suggest that FoxO is constrained by strong purifying selection except four sites in FoxO6, which have undergone positive Darwinian selection. The functional divergence in this family is best explained by either relaxed purifying selection or positive selection. Conclusion We present a phylogeny describing the evolutionary history of the FoxO gene family and show that the genes have evolved through duplications followed by purifying selection except for four sites in FoxO6 fixed by positive selection lie

  7. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.


    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A


    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis.

  8. The ANKH gene and familial calcium pyrophosphate dihydrate deposition disease.


    Netter, Patrick; Bardin, Thomas; Bianchi, Arnaud; Richette, Pascal; Loeuille, Damien


    Familial calcium pyrophosphate dihydrate deposition (CPPD) disease is a chronic condition in which CPPD microcrystals deposit in the joint fluid, cartilage, and periarticular tissues. Two forms of familial CPPD disease have been identified: CCAL1 and CCAL2. The CCAL1 locus is located on the long arm of chromosome 8 and is associated with CPPD and severe osteoarthritis. The CCAL2 locus has been mapped to the short arm of chromosome 5 and identified in families from the Alsace region of France and the United Kingdom. The ANKH protein is involved in pyrophosphate metabolism and, more specifically, in pyrophosphate transport from the intracellular to the extracellular compartment. Numerous ANKH gene mutations cause familial CCAL2; they enhance ANKH protein activity, thereby elevating extracellular pyrophosphate levels and promoting the formation of pyrophosphate crystals, which produce the manifestations of the disease. Recent studies show that growth factors and cytokines can modify the expression of the normal ANKH protein. These results suggest a role for ANKH in sporadic CPPD disease and in CPPD associated with degenerative disease.

  9. Multiple Inter-Kingdom Horizontal Gene Transfers in the Evolution of the Phosphoenolpyruvate Carboxylase Gene Family

    PubMed Central

    Wang, Wen; Su, Bing


    Pepcase is a gene encoding phosphoenolpyruvate carboxylase that exists in bacteria, archaea and plants,playing an important role in plant metabolism and development. Most plants have two or more pepcase genes belonging to two gene sub-families, while only one gene exists in other organisms. Previous research categorized one plant pepcase gene as plant-type pepcase (PTPC) while the other as bacteria-type pepcase (BTPC) because of its similarity with the pepcase gene found in bacteria. Phylogenetic reconstruction showed that PTPC is the ancestral lineage of plant pepcase, and that all bacteria, protistpepcase and BTPC in plants are derived from a lineage of pepcase closely related with PTPC in algae. However, their phylogeny contradicts the species tree and traditional chronology of organism evolution. Because the diversification of bacteria occurred much earlier than the origin of plants, presumably all bacterialpepcase derived from the ancestral PTPC of algal plants after divergingfrom the ancestor of vascular plant PTPC. To solve this contradiction, we reconstructed the phylogeny of pepcase gene family. Our result showed that both PTPC and BTPC are derived from an ancestral lineage of gamma-proteobacteriapepcases, possibly via an ancient inter-kingdom horizontal gene transfer (HGT) from bacteria to the eukaryotic common ancestor of plants, protists and cellular slime mold. Our phylogenetic analysis also found 48other pepcase genes originated from inter-kingdom HGTs. These results imply that inter-kingdom HGTs played important roles in the evolution of the pepcase gene family and furthermore that HGTsare a more frequent evolutionary event than previouslythought. PMID:23251445

  10. Family Size Evolution in Drosophila Chemosensory Gene Families: A Comparative Analysis with a Critical Appraisal of Methods

    PubMed Central

    Almeida, Francisca C.; Sánchez-Gracia, Alejandro; Campos, Jose Luis; Rozas, Julio


    Gene turnover rates and the evolution of gene family sizes are important aspects of genome evolution. Here, we use curated sequence data of the major chemosensory gene families from Drosophila—the gustatory receptor, odorant receptor, ionotropic receptor, and odorant-binding protein families—to conduct a comparative analysis among families, exploring different methods to estimate gene birth and death rates, including an ad hoc simulation study. Remarkably, we found that the state-of-the-art methods may produce very different rate estimates, which may lead to disparate conclusions regarding the evolution of chemosensory gene family sizes in Drosophila. Among biological factors, we found that a peculiarity of D. sechellia’s gene turnover rates was a major source of bias in global estimates, whereas gene conversion had negligible effects for the families analyzed herein. Turnover rates vary considerably among families, subfamilies, and ortholog groups although all analyzed families were quite dynamic in terms of gene turnover. Computer simulations showed that the methods that use ortholog group information appear to be the most accurate for the Drosophila chemosensory families. Most importantly, these results reveal the potential of rate heterogeneity among lineages to severely bias some turnover rate estimation methods and the need of further evaluating the performance of these methods in a more diverse sampling of gene families and phylogenetic contexts. Using branch-specific codon substitution models, we find further evidence of positive selection in recently duplicated genes, which attests to a nonneutral aspect of the gene birth-and-death process. PMID:24951565

  11. Management of asymptomatic gene carriers of transthyretin familial amyloid polyneuropathy

    PubMed Central

    Barroso, Fabio; González‐Duarte, Alejandra; Conceição, Isabel; Obici, Laura; Keohane, Denis; Amass, Leslie


    ABSTRACT Transthyretin familial amyloid polyneuropathy (TTR‐FAP) is a rare, severe, and irreversible, adult‐onset, hereditary disorder caused by autosomal‐dominant mutations in the TTR gene that increase the intrinsic propensity of transthyretin protein to misfold and deposit systemically as insoluble amyloid fibrils in nerve tissues, the heart, and other organs. TTR‐FAP is characterized by relentless, progressively debilitating polyneuropathy, and leads to death, on average, within 10 years of symptom onset without treatment. With increased availability of disease‐modifying treatment options for a wider spectrum of patients with TTR‐FAP, timely detection of the disease may offer substantial clinical benefits. This review discusses mutation‐specific predictive genetic testing in first‐degree relatives of index patients diagnosed with TTR‐FAP and the structured clinical follow‐up of asymptomatic gene carriers for prompt diagnosis and early therapeutic intervention before accumulation of substantial damage. Muscle Nerve 54: 353–360, 2016 PMID:27273296

  12. Management of asymptomatic gene carriers of transthyretin familial amyloid polyneuropathy.


    Schmidt, Hartmut H-J; Barroso, Fabio; González-Duarte, Alejandra; Conceição, Isabel; Obici, Laura; Keohane, Denis; Amass, Leslie


    Transthyretin familial amyloid polyneuropathy (TTR-FAP) is a rare, severe, and irreversible, adult-onset, hereditary disorder caused by autosomal-dominant mutations in the TTR gene that increase the intrinsic propensity of transthyretin protein to misfold and deposit systemically as insoluble amyloid fibrils in nerve tissues, the heart, and other organs. TTR-FAP is characterized by relentless, progressively debilitating polyneuropathy, and leads to death, on average, within 10 years of symptom onset without treatment. With increased availability of disease-modifying treatment options for a wider spectrum of patients with TTR-FAP, timely detection of the disease may offer substantial clinical benefits. This review discusses mutation-specific predictive genetic testing in first-degree relatives of index patients diagnosed with TTR-FAP and the structured clinical follow-up of asymptomatic gene carriers for prompt diagnosis and early therapeutic intervention before accumulation of substantial damage. Muscle Nerve 54: 353-360, 2016.

  13. Identification and analysis of the metacaspase gene family in tomato.


    Liu, Hui; Liu, Jian; Wei, Yongxuan


    Metacaspases play critical roles in developmentally regulated and environmentally induced programmed cell death in plants. In this study, we systematically identified and analyzed metacaspase gene family in tomato (Solanum lycopersicum). The results illustrated that tomato possesses eight metacaspase genes (SlMC1-8) located on chromosomes 1, 3, 5, 9, and 10. SlMC1-6 belonged to type I metacaspases and had 5 exon/4 intron structures. SlMC7 and 8 were type II metacaspases and had 2 and 3 exons, respectively. Expression analysis revealed distinct expression patterns of SlMCs in various tomato tissues. Cis-regulatory element prediction showed that there were many hormone- and stress-related cis-regulatory elements in SlMCs promoter regions. Quantitative real-time PCR analysis further demonstrated that most of the SlMCs were regulated by drought, cold, salt, methyl viologen, and ethephon treatments. This study provides insights into the characteristics of SlMC genes and laid the foundation for further functional analysis of these genes in tomato.

  14. Challenges of service-dog ownership for families with autistic children: lessons for veterinary practitioners.


    Burrows, Kristen E; Adams, Cindy L


    The purpose of this paper is to describe the challenges of service-dog ownership for families with autistic children. Through a qualitative interview process, this study has found that the integration of a service dog into a home environment is a highly dynamic and interactive process with numerous benefits and challenges. Public-access issues, learning to interpret dog behavior, the time constraints of increased social interactions, and the time of year the dog is placed into the family are important components affecting parental satisfaction. Parent, family, and child challenges included the dog being extra work, finding added time to maintain training, financing care for the dog, and the impact on family dynamics. These factors and challenges were appraised in order to understand the impact that they could have on the perceived success of the placement, parental satisfaction, and the dog itself. Despite the effects and consequences of these challenges, the parents overwhelmingly reported that having a service dog to keep their child safe and to provide companionship was well worth the many inconveniences of service-dog ownership. Most importantly, attention needs to be drawn to these challenges to promote the safety of both the child and the dog, minimize stress on the family, and encourage veterinary support of these highly dynamic relationships.

  15. Babesia bovis expresses Bbo-6cys-E, a member of a novel gene family that is homologous to the 6-cys family of Plasmodium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A novel Babesia bovis gene family encoding proteins with similarities to the Plasmodium 6cys protein family was identified by TBLASTN searches of the Babesia bovis genome using the sequence of the P. falciparum PFS230 protein as query, and was termed Bbo-6cys gene family. The Bbo-cys6 gene family co...

  16. Application of Whole Exome Sequencing in Six Families with an Initial Diagnosis of Autosomal Dominant Retinitis Pigmentosa: Lessons Learned.


    Almoguera, Berta; Li, Jiankang; Fernandez-San Jose, Patricia; Liu, Yichuan; March, Michael; Pellegrino, Renata; Golhar, Ryan; Corton, Marta; Blanco-Kelly, Fiona; López-Molina, Maria Isabel; García-Sandoval, Blanca; Guo, Yiran; Tian, Lifeng; Liu, Xuanzhu; Guan, Liping; Zhang, Jianguo; Keating, Brendan; Xu, Xun; Hakonarson, Hakon; Ayuso, Carmen


    This study aimed to identify the genetics underlying dominant forms of inherited retinal dystrophies using whole exome sequencing (WES) in six families extensively screened for known mutations or genes. Thirty-eight individuals were subjected to WES. Causative variants were searched among single nucleotide variants (SNVs) and insertion/deletion variants (indels) and whenever no potential candidate emerged, copy number variant (CNV) analysis was performed. Variants or regions harboring a candidate variant were prioritized and segregation of the variant with the disease was further assessed using Sanger sequencing in case of SNVs and indels, and quantitative PCR (qPCR) for CNVs. SNV and indel analysis led to the identification of a previously reported mutation in PRPH2. Two additional mutations linked to different forms of retinal dystrophies were identified in two families: a known frameshift deletion in RPGR, a gene responsible for X-linked retinitis pigmentosa and p.Ser163Arg in C1QTNF5 associated with Late-Onset Retinal Degeneration. A novel heterozygous deletion spanning the entire region of PRPF31 was also identified in the affected members of a fourth family, which was confirmed with qPCR. This study allowed the identification of the genetic cause of the retinal dystrophy and the establishment of a correct diagnosis in four families, including a large heterozygous deletion in PRPF31, typically considered one of the pitfalls of this method. Since all findings in this study are restricted to known genes, we propose that targeted sequencing using gene-panel is an optimal first approach for the genetic screening and that once known genetic causes are ruled out, WES might be used to uncover new genes involved in inherited retinal dystrophies.

  17. Application of Whole Exome Sequencing in Six Families with an Initial Diagnosis of Autosomal Dominant Retinitis Pigmentosa: Lessons Learned

    PubMed Central

    Fernandez-San Jose, Patricia; Liu, Yichuan; March, Michael; Pellegrino, Renata; Golhar, Ryan; Corton, Marta; Blanco-Kelly, Fiona; López-Molina, Maria Isabel; García-Sandoval, Blanca; Guo, Yiran; Tian, Lifeng; Liu, Xuanzhu; Guan, Liping; Zhang, Jianguo; Keating, Brendan; Xu, Xun


    This study aimed to identify the genetics underlying dominant forms of inherited retinal dystrophies using whole exome sequencing (WES) in six families extensively screened for known mutations or genes. Thirty-eight individuals were subjected to WES. Causative variants were searched among single nucleotide variants (SNVs) and insertion/deletion variants (indels) and whenever no potential candidate emerged, copy number variant (CNV) analysis was performed. Variants or regions harboring a candidate variant were prioritized and segregation of the variant with the disease was further assessed using Sanger sequencing in case of SNVs and indels, and quantitative PCR (qPCR) for CNVs. SNV and indel analysis led to the identification of a previously reported mutation in PRPH2. Two additional mutations linked to different forms of retinal dystrophies were identified in two families: a known frameshift deletion in RPGR, a gene responsible for X-linked retinitis pigmentosa and p.Ser163Arg in C1QTNF5 associated with Late-Onset Retinal Degeneration. A novel heterozygous deletion spanning the entire region of PRPF31 was also identified in the affected members of a fourth family, which was confirmed with qPCR. This study allowed the identification of the genetic cause of the retinal dystrophy and the establishment of a correct diagnosis in four families, including a large heterozygous deletion in PRPF31, typically considered one of the pitfalls of this method. Since all findings in this study are restricted to known genes, we propose that targeted sequencing using gene-panel is an optimal first approach for the genetic screening and that once known genetic causes are ruled out, WES might be used to uncover new genes involved in inherited retinal dystrophies. PMID:26197217

  18. Identification, Phylogeny, and Transcript of Chitinase Family Genes in Sugarcane

    PubMed Central

    Su, Yachun; Xu, Liping; Wang, Shanshan; Wang, Zhuqing; Yang, Yuting; Chen, Yun; Que, Youxiong


    Chitinases are pathogensis-related proteins, which play an important role in plant defense mechanisms. The role of the sugarcane chitinase family genes remains unclear due to the highly heterozygous and aneuploidy chromosome genetic background of sugarcane. Ten differentially expressed chitinase genes (belonging to class I~VII) were obtained from RNA-seq analysis of both incompatible and compatible sugarcane genotypes during Sporisorium scitamineum challenge. Their structural properties and expression patterns were analyzed. Seven chitinases (ScChiI1, ScChiI2, ScChiI3, ScChiIII1, ScChiIII2, ScChiIV1 and ScChiVI1) showed more positive with early response and maintained increased transcripts in the incompatible interaction than those in the compatible one. Three (ScChiII1, ScChiV1 and ScChiVII1) seemed to have no significant difference in expression patterns between incompatible and compatible interactions. The ten chitinases were expressed differentially in response to hormone treatment as well as having distinct tissue specificity. ScChiI1, ScChiIV1 and ScChiVII1 were induced by various abiotic stresses (NaCl, CuCl2, PEG and 4 °C) and their involvement in plant immunity was demonstrated by over-expression in Nicotiana benthamiana. The results suggest that sugarcane chitinase family exhibit differential responses to biotic and abiotic stress, providing new insights into their function. PMID:26035173

  19. Genomics and evolution of the TRIM gene family.


    Meroni, Germana


    The TRIM family comprises proteins characterized by the presence of thetripartite motifthat is composed of a RING domain, one or two B-box domains and a Coiled-coil region. These proteins are implicated in a plethora of cellular processes such as apoptosis, cell cycle regulation, muscular physiology and innate immune response. Consistently, their alteration results in several pathological conditions emphasizing their medical relevance. The TRIM members domain structure underscores a common biochemical function as E3 ligases within the ubiquitylation cascade, which is then translated into diverse biological processes. The TRIM proteins represent one of the largest families in mammals counting in human almost 70 members. TRIM proteins are metazoan-specific and have been now identified in several species although the great increase in their number was generated in vertebrate species. The important expansion of the number of TRIM genes underlie the success of the tripartite module in ubiquitylation process. Furthermore, their massive diversification among species was achieved through fast evolution of the TRIM genes implicated in pathogen response.

  20. Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.


    Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G


    The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion.

  1. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.


    Karn, Robert C; Laukaitis, Christina M


    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  2. School-Family Relationship and School Success: Some Lessons from a Teacher Education Program.

    ERIC Educational Resources Information Center

    Reali, Aline Maria de Medeiros Rodrigues; Tancredi, Regina Maria Simoes Puccinelli

    This paper examines three projects conducted by researchers from Brazil's Federal University of Sao Carlos and teachers from low-income, public elementary schools. The study investigated an inservice teacher education effort designed to strengthen family-school relationships. The projects were designed to generate knowledge about teachers'…

  3. Integrating Family Support Services into Schools: Lessons from the Elev8 Initiative. Chapin Hall Issue Brief

    ERIC Educational Resources Information Center

    D'Angelo, Angela Valdovinos; Rich, Lauren; Kwiatt, Jaclyn


    A commonly held belief is that children whose families are struggling with poverty--and the housing, health, safety, and other concerns that often go with it--cannot focus on learning unless their nonacademic needs are met. This belief is supported by research showing that the children of poor parents who receive income supplements and other…

  4. International Perspectives on Work-Family Policies: Lessons from the World's Most Competitive Economies

    ERIC Educational Resources Information Center

    Earle, Alison; Mokomane, Zitha; Heymann, Jody


    The United States does not guarantee families a wide range of supportive workplace policies such as paid maternity and paternity leave or paid leave to care for sick children. Proposals to provide such benefits are invariably met with the complaint that the costs would reduce employment and undermine the international competitiveness of American…

  5. Breaking the Patriarchal Vision of Social Science: Lessons from a Family Therapy Model.

    ERIC Educational Resources Information Center

    McNamee, Sheila

    The Milan model of systemic family therapy, developed in Italy and based on G. Bateson's cybernetic epistemology, can help meet the goals of a feminist/systemic epistemology in research by accepting data in its "traditional" form yet also connecting it to the act of researching, itself, thereby merging a feminist perspective with the…

  6. The Intersection of Catholic Social Teaching, Internationalization, and Marriage and Family Therapy: Lessons from the Borderlands

    ERIC Educational Resources Information Center

    Estrada, Ana Ulloa


    This article explores the relevance and challenge of Catholic Social Teaching (CST) and internationalization to the Marriage and Family Therapy (MFT) program at the University of San Diego. These issues are discussed in the context of a graduate level course on human diversity that culminated in a 1-day cultural immersion and service learning trip…

  7. "Object Lesson": Using Family Heirlooms to Engage Students in Art History

    ERIC Educational Resources Information Center

    Rose, Marice


    This first written assignment of the semester for the author's undergraduate introductory art history class--an essay where students describe and reflect upon the significance of a family heirloom--is instrumental in meeting class objectives. The author's objectives in this class are for students: (1) to broaden their conception of what art is…

  8. Barriers to Physician Identification and Treatment of Family Violence: Lessons from Five Communities.

    ERIC Educational Resources Information Center

    Cohen, Stu; And Others


    A study involving over 480 interviews in five diverse communities (Atlanta, Georgia; Duluth, Minnesota; Providence, Rhode Island; Riverside, California; Roswell, New Mexico) identified barriers facing physicians and other health care providers in identifying, treating, and referring victims of family violence, and illuminated the relationships of…

  9. Recent Developments in Gene Therapy for Homozygous Familial Hypercholesterolemia.


    Ajufo, Ezim; Cuchel, Marina


    Homozygous familial hypercholesterolemia (HoFH) is a life-threatening Mendelian disorder with a mean life expectancy of 33 years despite maximally tolerated standard lipid-lowering therapies. This disease is an ideal candidate for gene therapy, and in the last few years, a number of exciting developments have brought this approach closer to the clinic than ever before. In this review, we discuss in detail the most advanced of these developments, a recombinant adeno-associated virus (AAV) vector carrying a low-density lipoprotein receptor (LDLR) transgene which has recently entered phase 1/2a testing. We also review ongoing development of approaches to enhance transgene expression, improve the efficiency of hepatocyte transduction, and minimize the AAV capsid-specific adaptive immune response. We include a summary of key gene therapy approaches for HoFH in pre-clinical development, including RNA silencing of the gene encoding HMG-CoA reductase (HMGCR) and induced pluripotent stem cell transplant therapy.

  10. Gene expression patterns of invertase gene families and modulation of the inhibitor gene in tomato sucrose metabolism.


    Zhang, Y L; Zhang, A H; Jiang, J


    Patterns of gene expression in the different types of sucrose metabolism in the tomato are highly variable and heritable. This genetic variation causes considerable functional differences. We examined the patterns of expression of invertase (Inv) gene families and an invertase inhibitor (INH) gene involved in elongating roots, hypocotyls, and fruit of the tomato (Lycopersicon esculentum cv. Micro-Tom and L. chmielewskii) through a real-time quantitative PCR analysis. We found that the Lin6 gene plays an important role in the vegetative growth stage. Lin5 and Lin7 did not express in Micro-Tom, but did express in L. chmielewskii. Overall relative expression levels of sucrose Inv gene families were significantly lower in L. chmielewskii during the reproductive growth stage than in Micro-Tom, being up to hundreds of times lower. It was not expressed in the dissepiment in L. chmielewskii. We suggest that differences in sucrose accumulation in tomato fruit is mainly due to differentially expressed invertase gene families at the later fruit growth stages.

  11. Living with students: Lessons learned while pursuing tenure, administration, and raising a family.


    Humphrey, Michael; Callahan, Janet; Harrison, Geoff


    An emerging promising practice in many universities has been the development of faculty-in-residence programs, in which university faculty members and their family moved into university student residences, sharing common living spaces with students. This case study is centered on two faculty-in-residence living in university residence halls. One was an assistant professor pursuing tenure while raising a young child, while the second was a tenured full professor and associate dean raising two teens. This case study offers the post-experience conclusions of these two faculty-in-residence individuals, noting the benefits and challenges each experienced while living -and working closely with these students outside of the university classroom, all while striving for an optimal balance in managing professional and familial obligations.

  12. Barriers to physician identification and treatment of family violence: lessons from five communities.


    Cohen, S; De Vos, E; Newberger, E


    Since the Surgeon General's Workshop on Violence and Public Health (Leesburg, Virginia, October 27-29, 1985), a substantial literature has developed about the limitations of the health care response to family violence. Many contributions have reflected experiences in limited numbers of practice settings (e.g., a single emergency department or hospital). Until 1990, however, there had been no community-based studies. The Robert Wood Johnson Foundation asked a multidisciplinary team from Education Development Center, Inc. and Children's Hospital (Boston) to investigate the health care responses to family violence in five diverse communities. This qualitative study, comprising more than 480 interviews, provided a vivid picture of the barriers facing physicians and other health care providers in identifying, treating, and referring victims of family violence. It also illuminated the relations of the health care systems in these communities with other key sectors, including agencies and the judiciary. The key findings from the five-city study remain relevant because (1) it is the only large-scale, multi-community-based assessment of the barriers facing physicians; (2) it identified, or in some cases confirmed, both institutional and educational barriers limiting the effectiveness of even the most committed physicians; (3) it identified, or in some cases confirmed, specific areas of knowledge, attitudes, and skills development that should be incorporated in medical education; and (4) its conclusions continue to be reflected in subsequent contributions to the literature. In each of these ways, therefore, it informs the other articles in this supplement.

  13. Differential loss of ancestral gene families as a source of genomic divergence in animals.

    PubMed Central

    Hughes, Austin L; Friedman, Robert


    A phylogenetic approach was used to reconstruct the pattern of an apparent loss of 2106 ancestral gene families in four animal genomes (Caenorhabditis elegans, Drosophila melanogaster, human and fugu). Substantially higher rates of loss of ancestral gene families were found in the invertebrates than in the vertebrates. These results indicate that the differential loss of ancestral gene families can be a significant factor in the evolutionary diversification of organisms. PMID:15101434

  14. Comparative phylogenomic analyses of teleost fish Hox gene clusters: lessons from the cichlid fish Astatotilapia burtoni

    PubMed Central

    Hoegg, Simone; Boore, Jeffrey L; Kuehl, Jennifer V; Meyer, Axel


    Background Teleost fish have seven paralogous clusters of Hox genes stemming from two complete genome duplications early in vertebrate evolution, and an additional genome duplication during the evolution of ray-finned fish, followed by the secondary loss of one cluster. Gene duplications on the one hand, and the evolution of regulatory sequences on the other, are thought to be among the most important mechanisms for the evolution of new gene functions. Cichlid fish, the largest family of vertebrates with about 2500 species, are famous examples of speciation and morphological diversity. Since this diversity could be based on regulatory changes, we chose to study the coding as well as putative regulatory regions of their Hox clusters within a comparative genomic framework. Results We sequenced and characterized all seven Hox clusters of Astatotilapia burtoni, a haplochromine cichlid fish. Comparative analyses with data from other teleost fish such as zebrafish, two species of pufferfish, stickleback and medaka were performed. We traced losses of genes and microRNAs of Hox clusters, the medaka lineage seems to have lost more microRNAs than the other fish lineages. We found that each teleost genome studied so far has a unique set of Hox genes. The hoxb7a gene was lost independently several times during teleost evolution, the most recent event being within the radiation of East African cichlid fish. The conserved non-coding sequences (CNS) encompass a surprisingly large part of the clusters, especially in the HoxAa, HoxCa, and HoxDa clusters. Across all clusters, we observe a trend towards an increased content of CNS towards the anterior end. Conclusion The gene content of Hox clusters in teleost fishes is more variable than expected, with each species studied so far having a different set. Although the highest loss rate of Hox genes occurred immediately after whole genome duplications, our analyses showed that gene loss continued and is still ongoing in all teleost

  15. Dissimilar evolutionary histories of two resistance gene families in the genus Solanum.


    Segura, Diana María; Masuelli, Ricardo Williams; Sanchez-Puerta, M Virginia


    Genomic analyses have shown that most genes in eukaryotic lineages belong to families. Gene families vary in terms of number of members, nucleotide similarity, gene integrity, expression, and function. Often, the members of gene families are arranged in clusters, which contribute to maintaining similarity among gene copies and also to generate duplicates through replication errors. Gene families offer us an opportunity to examine the forces involved in the evolution of the genomes and to study recombination events and genomic rearrangements. In this work, we focused on the evolution of two plant resistance gene families, Sw5 and Mi-1, and analyzed the completely sequenced nuclear genomes of potato and tomato. We first noticed that the potato genome carries larger resistance gene families than tomato, but all gene copies are pseudogenes. Second, phylogenetic analyses indicated that Sw5 and Mi-1 gene families had dissimilar evolutionary histories. In contrast to Sw5, Mi-1 homologues suffered repeated gene conversion events among the gene copies, particularly in the tomato genome.

  16. Gene recruitment--a common mechanism in the evolution of transfer RNA gene families.


    Wang, Xiujuan; Lavrov, Dennis V


    The evolution of alloacceptor transfer RNAs (tRNAs) has been traditionally thought to occur vertically and reflect the evolution of the genetic code. Yet there have been several indications that a tRNA gene could evolve horizontally, from a copy of an alloacceptor tRNA gene in the same genome. Earlier, we provided the first unambiguous evidence for the occurrence of such "tRNA gene recruitment" in nature--in the mitochondrial (mt) genome of the demosponge Axinella corrugata. Yet the extent and the pattern of this process in the evolution of tRNA gene families remained unclear. Here we analyzed tRNA genes from 21 mt genomes of demosponges as well as nuclear genomes of rhesus macaque, chimpanzee and human. We found four new cases of alloacceptor tRNA gene recruitment in mt genomes and eleven cases in the nuclear genomes. In most of these cases we observed a single nucleotide substitution at the middle position of the anticodon, which resulted in the change of not only the tRNA's amino-acid identity but also the class of the amino-acyl tRNA synthetases (aaRSs) involved in amino-acylation. We hypothesize that the switch to a different class of aaRSs may have prevented the conflict between anticodon and amino-acid identities of recruited tRNAs. Overall our results suggest that gene recruitment is a common phenomenon in tRNA multigene family evolution and should be taken into consideration when tRNA evolutionary history is reconstructed.

  17. The Family of Crumbs Genes and Human Disease

    PubMed Central

    Slavotinek, Anne M.


    The family of vertebrate Crumbs proteins, homologous to Drosophila Crumbs (Crb), share large extracellular domains with epidermal growth factor-like repeats and laminin-globular domains, a single transmembrane domain, and a short intracellular C-terminus containing a single membrane proximal 4.1/ezrin/radixin/moesin-binding domain and PSD-95/Discs large/ZO-1-binding motifs. There are 3 Crb genes in humans - Crumbs homolog-1 (CRB1), Crumbs homolog-2 (CRB2), and Crumbs homolog-3 (CRB3). Bilallelic loss-of-function mutations in CRB1 cause visual impairment, with Leber's congenital amaurosis and retinitis pigmentosa, whereas CRB2 mutations are associated with raised maternal serum and amniotic fluid alpha feto-protein levels, ventriculomegaly/hydrocephalus, and renal disease, ranging from focal segmental glomerulosclerosis to congenital Finnish nephrosis. CRB3 has not yet been associated with human disease. In this review, we summarize the phenotypic findings associated with deleterious sequence variants in CRB1 and CRB2. We discuss the mutational spectrum, animal models of loss of function for both genes and speculate on the likely mechanisms of disease. PMID:27867342

  18. Gene family encoding the major toxins of lethal Amanita mushrooms.


    Hallen, Heather E; Luo, Hong; Scott-Craig, John S; Walton, Jonathan D


    Amatoxins, the lethal constituents of poisonous mushrooms in the genus Amanita, are bicyclic octapeptides. Two genes in A. bisporigera, AMA1 and PHA1, directly encode alpha-amanitin, an amatoxin, and the related bicyclic heptapeptide phallacidin, a phallotoxin, indicating that these compounds are synthesized on ribosomes and not by nonribosomal peptide synthetases. alpha-Amanitin and phallacidin are synthesized as proproteins of 35 and 34 amino acids, respectively, from which they are predicted to be cleaved by a prolyl oligopeptidase. AMA1 and PHA1 are present in other toxic species of Amanita section Phalloidae but are absent from nontoxic species in other sections. The genomes of A. bisporigera and A. phalloides contain multiple sequences related to AMA1 and PHA1. The predicted protein products of this family of genes are characterized by a hypervariable "toxin" region capable of encoding a wide variety of peptides of 7-10 amino acids flanked by conserved sequences. Our results suggest that these fungi have a broad capacity to synthesize cyclic peptides on ribosomes.

  19. Cloning and characterisation of JAZ gene family in Hevea brasiliensis.


    Hong, H; Xiao, H; Yuan, H; Zhai, J; Huang, X


    Mechanical wounding or treatment with exogenous jasmonates (JA) induces differentiation of the laticifer in Hevea brasiliensis. JA is a key signal for latex biosynthesis and wounding response in the rubber tree. Identification of JAZ (jasmonate ZIM-domain) family of proteins that repress JA responses has facilitated rapid progress in understanding how this lipid-derived hormone controls gene expression and related physiological processes in plants. In this work, the full-length cDNAs of six JAZ genes were cloned from H. brasiliensis (termed HbJAZ). These HbJAZ have different lengths and sequence diversity, but all of them contain Jas and ZIM domains, and two of them contain an ERF-associated amphiphilic repression (EAR) motif in the N-terminal. Real-time RT-PCR analyses revealed that HbJAZ have different expression patterns and tissue specificity. Four HbJAZ were up-regulated, one was down-regulated, while two were less effected by rubber tapping treatment, suggesting that they might play distinct roles in the wounding response. A yeast two-hybrid assay revealed that HbJAZ proteins interact with each other to form homologous or heterogeneous dimer complexes, indicating that the HbJAZ proteins may expand their function through diverse JAZ-JAZ interactions. This work lays a foundation for identification of the JA signalling pathway and molecular mechanisms of latex biosynthesis in rubber trees.

  20. A Comprehensive Family-Based Replication Study of Schizophrenia Genes

    PubMed Central

    Aberg, Karolina A.; Liu, Youfang; Bukszár, Jozsef; McClay, Joseph L.; Khachane, Amit N.; Andreassen, Ole A.; Blackwood, Douglas; Corvin, Aiden; Djurovic, Srdjan; Gurling, Hugh; Ophoff, Roel; Pato, Carlos N.; Pato, Michele T.; Riley, Brien; Webb, Todd; Kendler, Kenneth; O’Donovan, Mick; Craddock, Nick; Kirov, George; Owen, Mike; Rujescu, Dan; St Clair, David; Werge, Thomas; Hultman, Christina M.; Delisi, Lynn E.; Sullivan, Patrick; van den Oord, Edwin J.


    Importance Schizophrenia (SCZ) is a devastating psychiatric condition. Identifying the specific genetic variants and pathways that increase susceptibility to SCZ is critical to improve disease understanding and address the urgent need for new drug targets. Objective To identify SCZ susceptibility genes. Design We integrated results from a meta-analysis of 18 genome-wide association studies (GWAS) involving 1 085 772 single-nucleotide polymorphisms (SNPs) and 6 databases that showed significant informativeness for SCZ. The 9380 most promising SNPs were then specifically genotyped in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. Setting Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. Patients We included 11 185 cases and 10 768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. Main Outcomes and Measures Case-control status for SCZ. Results Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs with replication values of P<.01, the proportion of SNPs that had the same direction of effects as in the GWAS meta-analysis was 89% in the combined ancestry group (sign test, P<2.20×10−16) and 93% in subjects of European ancestry only (P<2.20×10−16). Our results supported the major histocompatibility complex region showing a 3.7-fold overall enrichment of replication values of P<.01 in subjects from European ancestry. We replicated SNPs in TCF4 (P=2.53×10−10) and NOTCH4 (P=3.16×10−7) that are among the most robust SCZ findings. More novel findings included POM121L2 (P=3.51×10−7), AS3MT (P=9.01×10−7), CNNM2 (P=6.07×10−7), and NT5C2 (P=4.09×10−7). To explore the many small effects, we performed pathway analyses. The most significant pathways involved neuronal function

  1. Evolution of the multifaceted eukaryotic akirin gene family

    PubMed Central

    Macqueen, Daniel J; Johnston, Ian A


    Background Akirins are nuclear proteins that form part of an innate immune response pathway conserved in Drosophila and mice. This studies aim was to characterise the evolution of akirin gene structure and protein function in the eukaryotes. Results akirin genes are present throughout the metazoa and arose before the separation of animal, plant and fungi lineages. Using comprehensive phylogenetic analysis, coupled with comparisons of conserved synteny and genomic organisation, we show that the intron-exon structure of metazoan akirin genes was established prior to the bilateria and that a single proto-orthologue duplicated in the vertebrates, before the gnathostome-agnathan separation, producing akirin1 and akirin2. Phylogenetic analyses of seven vertebrate gene families with members in chromosomal proximity to both akirin1 and akirin2 were compatible with a common duplication event affecting the genomic neighbourhood of the akirin proto-orthologue. A further duplication of akirins occurred in the teleost lineage and was followed by lineage-specific patterns of paralogue loss. Remarkably, akirins have been independently characterised by five research groups under different aliases and a comparison of the available literature revealed diverse functions, generally in regulating gene expression. For example, akirin was characterised in arthropods as subolesin, an important growth factor and in Drosophila as bhringi, which has an essential myogenic role. In vertebrates, akirin1 was named mighty in mice and was shown to regulate myogenesis, whereas akirin2 was characterised as FBI1 in rats and promoted carcinogenesis, acting as a transcriptional repressor when bound to a 14-3-3 protein. Both vertebrate Akirins have evolved under comparably strict constraints of purifying selection, although a likelihood ratio test predicted that functional divergence has occurred between paralogues. Bayesian and maximum likelihood tests identified amino-acid positions where the rate of

  2. Characterization of the multicopper oxidase gene family in Anopheles gambiae

    PubMed Central

    Gorman, Maureen J.; Dittmer, Neal T.; Marshall, Jeremy L.; Kanost, Michael R.


    The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including diphenols, and several oxidases with specific substrates such as iron, copper or ascorbic acid. We have identified five putative MCO genes in the genome of Anopheles gambiae and have cloned cDNAs encompassing the full coding region for each gene. MCO1 mRNA was detected in all developmental stages and in all of the larval and adult tissues tested. We observed an increase in MCO1 transcript abundance in the midguts and Malphighian tubules of adult females following a blood meal and in adult abdominal carcasses in response to an immune challenge. Two alternatively spliced isoforms of MCO2 mRNA were identified. The A isoform of MCO2 was previously detected in larval and pupal cuticle where it probably catalyzes sclerotization reactions (He et al., 2007). The B isoform was transcriptionally upregulated in ovaries in response to a blood meal. MCO3 mRNA was detected in the adult midgut, Malpighian tubules, and male reproductive tissues; like MCO1, it was upregulated in response to an immune challenge or a blood meal. MCO4 and MCO5 were observed primarily in eggs and in the abdominal carcass of larvae. A phylogenetic analysis of insect MCO genes identified putative orthologs of MCO1 and MCO2 in all of the insect genomes tested, whereas MCO3, MCO4 and MCO5 were found only in the two mosquito species analyzed. MCO2 orthologs have especially high sequence similarity, suggesting that they are under strong purifying selection; the A isoforms are more conserved than the B isoforms. The mosquito specific group shares a common ancestor with MCO2. This initial study of mosquito MCOs suggests that MCO2 may be required for egg development or eggshell tanning in addition to cuticle tanning, while MCO1 and MCO3 may be involved in metal metabolism or immunity. PMID:18675911

  3. International perspectives on work-family policies: lessons from the world's most competitive economies.


    Earle, Alison; Mokomane, Zitha; Heymann, Jody


    The United States does not guarantee families a wide range of supportive workplace policies such as paid maternity and paternity leave or paid leave to care for sick children. Proposals to provide such benefits are invariably met with the complaint that the costs would reduce employment and undermine the international competitiveness of American businesses. In this article, Alison Earle, Zitha Mokomane, and Jody Heymann explore whether paid leave and other work-family policies that support children's development exist in countries that are economically competitive and have low unemployment rates. Their data show that the answer is yes. Using indicators of competitiveness gathered by the World Economic Forum, the authors identify fifteen countries, including the United States, that have been among the top twenty countries in competitiveness rankings for at least eight of ten years. To this group they add China and India, both rising competitors in the global economy. They find that every one of these countries, except the United States, guarantees some form of paid leave for new mothers as well as annual leave. And all but Switzerland and the United States guarantee paid leave for new fathers. The authors perform a similar exercise to identify thirteen advanced countries with consistently low unemployment rates, again including the United States. The majority of these countries provide paid leave for new mothers, paid leave for new fathers, paid leave to care for children's health care needs, breast-feeding breaks, paid vacation leave, and a weekly day of rest. Of these, the United States guarantees only breast-feeding breaks (part of the recently passed health care legislation). The authors' global examination of the most competitive economies as well as the economies with low unemployment rates makes clear that ensuring that all parents are available to care for their children's healthy development does not preclude a country from being highly competitive

  4. MicroSyn: a user friendly tool for detection of microsynteny in a gene family

    SciTech Connect

    Cai, Bin; Yang, Xiaohan; Tuskan, Gerald A; Cheng, Zong-Ming


    Background: The traditional phylogeny analysis within gene family is mainly based on DNA or amino acid sequence homologies. However, these phylogenetic tree analyses are not suitable for those non-traditional gene families like microRNA with very short sequences. For the normal protein-coding gene families, low bootstrap values are frequently encountered in some nodes, suggesting low confidence or likely inappropriateness of placement of those members in those nodes. Results: We introduce MicroSyn software as a means of detecting microsynteny in adjacent genomic regions surrounding genes in gene families. MicroSyn searches for conserved, flanking colinear homologous gene pairs between two genomic fragments to determine the relationship between two members in a gene family. The colinearity of homologous pairs is controlled by a statistical distance function. As a result, gene duplication history can be inferred from the output independent of gene sequences. MicroSyn was designed for both experienced and non-expert users with a user-friendly graphical-user interface. MicroSyn is available from: cn/microsyn/. Conclusions: Case studies of the microRNA167 genes in plants and Xyloglucan ndotransglycosylase/Hydrolase family in Populus trichocarpa were presented to show the utility of the software. The easy using of MicroSyn in these examples suggests that the software is an additional valuable means to address the problem intrinsic in the computational methods and sequence qualities themselves in gene family analysis.

  5. Genome-wide identification and expression profiling of ankyrin-repeat gene family in maize.


    Jiang, Haiyang; Wu, Qingqing; Jin, Jing; Sheng, Lei; Yan, Hanwei; Cheng, Beijiu; Zhu, Suwen


    Members of the ankyrin repeats (ANK) gene family encode ANK domain that are common in diverse organisms and play important roles in cell growth and development, such as cell-cell signal transduction and cell cycle regulation. Recently, genome-wide identification and evolutionary analyses of the ANK gene family have been carried out in Arabidopsis and rice. However, little is known regarding the ANK genes in the entire maize genome. In this study, we described the identification and structural characterization of 71 ANK genes in maize (ZmANK). Then, comprehensive bioinformatics analyses of ZmANK genes family were performed including phylogenetic, domain and motif analysis, chromosomal localization, intron/exon structural patterns, gene duplications and expression profiling. Domain composition analyses showed that ZmANK genes formed ten subfamilies. Five tandem duplications and 14 segmental duplications were identified in ZmANK genes. Furthermore, we took comparative analysis of the total ANK gene family in Arabidopsis, rice and maize, ZmANKs were more closely paired with OsANKs than with AtANKs. At last, expression profile analyses were performed. Forty-one members of ZmANK genes held EST sequences records. Semi-quantitative expression and microarray data analysis of these 41 ZmANK genes demonstrated that ZmANK genes exhibit a various expression pattern, suggesting that functional diversification of ZmANK genes family. The results will present significant insights to explore ANK genes expression and function in future studies in maize.

  6. Divergence pattern of animal gene families and relationship with the Cambrian explosion.


    Miyata, T; Suga, H


    There are many gene families that are specific to multicellular animals. These have either diverged from ancestral genes that are shared with fungi and/or plants or evolved from an ancestral gene unique to animals. The evolution of gene families involved in cell-cell communication and developmental control has been studied to establish whether the number of member genes increased dramatically immediately prior to or in concert with the Cambrian explosion. A molecular phylogeny-based analysis of several animal-specific gene families has revealed that gene diversification by duplication occurred during two active periods interrupted by a long intervening quiescent period. Intriguingly, the Cambrian explosion is situated in the silent period, indicating that there is no direct link between the first burst of gene diversification and the Cambrian explosion itself. The importance of gene recruitment as a possible molecular mechanism for morphological diversity, and its possible role for the Cambrian explosion, are discussed.

  7. Characterization of the p16 gene in the mouse: Evidence for a large gene family

    SciTech Connect

    Fountain, J.W.; Giendening, J.M.; Flores, J.F.


    The p16 gene product is an inhibitor of the cyclin-dependent kinase 4 (CDK4)/cyclin D complex. When uninhibited, the CDK4/cyclin D complex participates in the phosphorylation of the retinoblastoma (RB) protein and renders it inactive. Upon inactivation of the RB protein, transition from the G{sub 1} to the S phase of mitosis occurs and results in cellular proliferation. Thus, p16 is presumed to act as a negative regulator of cell growth by preventing the phosphorylation, and thereby subsequent inactivation, of RB by CDK4/cyclin D. Recently, the p16 gene (also known as the multiple tumor suppressor 1 (MTS1) gene) has been mapped to chromosome 9p21 and found to be deleted or mutated in a number of tumor cell lines. These findings support the role of p16 as a growth inhibitor or tumor suppressor gene and suggest that the mutation of this gene may have global implications in carcinogenesis. We have chosen to test the functional significance of p16 mutations in vivo through the generation of a mouse mutant for p16. In preparation for this undertaking, eight apparently independent (as judged by restriction enzyme digestion and differential hybridization) mouse genomic embryonic stem cell clones have been identified using exon 2 from the human p16 gene as a probe. The identification of these multiple nonoverlapping clones was not entirely surprising since the reduced stringency hybridization of a zoo blot with the same probe also revealed 10-15 positive EcoRI fragments in all species tested, including human, monkey, cow, dog, cat, rabbit, hamster, mouse, chicken and D. melanogaster. Taken together, these findings suggest that the p16 gene is a member of a large gene family. The location of these genomic clones, as well as their potential expression in the mouse, is currently under investigation.

  8. Bcl-2-related protein family gene expression during oligodendroglial differentiation.


    Itoh, Takayuki; Itoh, Aki; Pleasure, David


    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  9. Molecular characterization of edestin gene family in Cannabis sativa L.


    Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata


    Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs.

  10. Gene conversions in the growth hormone gene family of primates: stronger homogenizing effects in the Hominidae lineage.


    Petronella, Nicholas; Drouin, Guy


    In humans, the growth hormone/chorionic somatomammotropin gene family is composed of five highly similar genes. We characterized the gene conversions that occurred between the growth hormone genes of 11 primate species. We detected 48 conversions using GENECONV and others were only detected using phylogenetic analyses. Gene conversions were detected in all species analyzed, their average size (±standard deviation) is 197.8±230.4 nucleotides, the size of the conversions is correlated with sequence similarity and converted regions are significantly more GC-rich than non-converted regions. Gene conversions have a stronger homogenizing effect in Hominidae genes than in other primate species. They are also less frequent in conserved gene regions and towards functionally important genes. This suggests that the high degree of sequence similarity observed between the growth hormone genes of primate species is a consequence of frequent gene conversions in gene regions which are under little selective constraints.

  11. [The MDR3 gene mutation: a rare cause of progressive familial intrahepatic cholestasis (PFIC)].


    Maisonnette, F; Abita, T; Barriere, E; Pichon, N; Vincensini, J F; Descottes, B


    A 47-year old man complained about persistant pain and cholestasis 12-years after a cholescystectomy. In his family, all his brothers and sisters had cholecystectomy. Genetic explorations revealed a MDR3 gene mutation. All symptoms disappeared with a treatment by ursodesoxycholic acid. MDR3 gene mutation is to be researched in all cases of familial cholestasis.

  12. Diversity and linkage of genes in the self-incompatibility gene family in Arabidopsis lyrata.

    PubMed Central

    Charlesworth, Deborah; Mable, Barbara K; Schierup, Mikkel H; Bartolomé, Carolina; Awadalla, Philip


    We report studies of seven members of the S-domain gene family in Arabidopsis lyrata, a member of the Brassicaceae that has a sporophytic self-incompatibility (SI) system. Orthologs for five loci are identifiable in the self-compatible relative A. thaliana. Like the Brassica stigmatic incompatibility protein locus (SRK), some of these genes have kinase domains. We show that several of these genes are unlinked to the putative A. lyrata SRK, Aly13. These genes have much lower nonsynonymous and synonymous polymorphism than Aly13 in the S-domains within natural populations, and differentiation between populations is higher, consistent with balancing selection at the Aly13 locus. One gene (Aly8) is linked to Aly13 and has high diversity. No departures from neutrality were detected for any of the loci. Comparing different loci within A. lyrata, sites corresponding to hypervariable regions in the Brassica S-loci (SLG and SRK) and in comparable regions of Aly13 have greater replacement site divergence than the rest of the S-domain. This suggests that the high polymorphism in these regions of incompatibility loci is due to balancing selection acting on sites within or near these regions, combined with low selective constraints. PMID:12930757

  13. The Phaseolus vulgaris ZIP gene family: identification, characterization, mapping, and gene expression

    PubMed Central

    Astudillo, Carolina; Fernandez, Andrea C.; Blair, Matthew W.; Cichy, Karen A.


    Zinc is an essential mineral for humans and plants and is involved in many physiological and biochemical processes. In humans, Zn deficiency has been associated with retarded growth and reduction of immune response. In plants, Zn is an essential component of more than 300 enzymes including RNA polymerase, alkaline phosphatase, alcohol dehydrogenase, Cu/Zn superoxidase dismutase, and carbonic anhydrase. The accumulation of Zn in plants involves many genes and characterization of the role of these genes will be useful in biofortification. Here we report the identification and phlyogenetic and sequence characterization of the 23 members of the ZIP (ZRT, IRT like protein) family of metal transporters and three transcription factors of the bZIP family in Phaseolus vulgaris L. Expression patterns of seven of these genes were characterized in two bean genotypes (G19833 and DOR364) under two Zn treatments. Tissue analyzed included roots and leaves at vegetative and flowering stages, and pods at 20 days after flowering. Four of the genes, PvZIP12, PvZIP13, PvZIP16, and Pv bZIP1, showed differential expression based on tissue, Zn treatment, and/or genotype. PvZIP12 and PvZIP13 were both more highly expressed in G19833 than DOR364. PvZIP12 was most highly expressed in vegetative leaves under the Zn (−) treatment. PvZIP16 was highly expressed in leaf tissue, especially leaf tissue at flowering stage grown in the Zn (−) treatment. Pv bZIP1 was most highly expressed in leaf and pod tissue. The 23 PvZIP genes and three bZIP genes were mapped on the DOR364 × G19833 linkage map. PvZIP12, PvZIP13, and PvZIP18, Pv bZIP2, and Pv bZIP3 were located near QTLs for Zn accumulation in the seed. Based on the expression and mapping results, PvZIP12 is a good candidate gene for increasing seed Zn concentration and increase understanding of the role of ZIP genes in metal uptake, distribution, and accumulation of zinc in P. vulgaris. PMID:23908661

  14. Evolutionary diversification of the vertebrate transferrin multi-gene family.


    Hughes, Austin L; Friedman, Robert


    In a phylogenetic analysis of vertebrate transferrins (TFs), six major clades (subfamilies) were identified: (a) S, the mammalian serotransferrins; (b) ICA, the mammalian inhibitor of carbonic anhydrase (ICA) homologs; (c) L, the mammalian lactoferrins; (d) O, the ovotransferrins of birds and reptiles; (e) M, the melanotransferrins of bony fishes, amphibians, reptiles, birds, and mammals; and (f) M-like, a newly identified TF subfamily found in bony fishes, amphibians, reptiles, and birds. A phylogenetic tree based on the joint alignment of N-lobes and C-lobes supported the hypothesis that three separate events of internal duplication occurred in vertebrate TFs: (a) in the common ancestor of the M subfamily, (b) in the common ancestor of the M-like subfamily, and (c) in the common ancestor of other vertebrate TFs. The S, ICA, and L subfamilies were found only in placental mammals, and the phylogenetic analysis supported the hypothesis that these three subfamilies arose by gene duplication after the divergence of placental mammals from marsupials. The M-like subfamily was unusual in several respects, including the presence of a uniquely high proportion of clade-specific conserved residues, including distinctive but conserved residues in the sites homologous to those functioning in carbonate binding of human serotransferrin. The M-like family also showed an unusually high proportion of cationic residues in the positively charged region corresponding to human lactoferrampin, suggesting a distinctive role of this region in the M-like subfamily, perhaps in antimicrobial defense.

  15. Evolutionary Diversification of the Vertebrate Transferrin Multi-gene Family

    PubMed Central

    Hughes, Austin L.; Friedman, Robert


    In a phylogenetic analysis of vertebrate transferrins (TFs), six major clades (subfamilies) were identified: (1) S, the mammalian serotransferrins; (2) ICA, the mammalian inhibitor of carbonic anhydrase (ICA) homologs; (3) L, the mammalian lactoferrins; (4) O, the ovotransferrins of birds and reptiles; (4) M, the melanotransferrins of bony fishes, amphibians, reptiles, birds, and mammals; and (5) M-like, a newly identified TF subfamily found in bony fishes, amphibians, reptiles, and birds. A phylogenetic tree based on the joint alignment of N-lobes and C-lobes supported the hypothesis that three separate events of internal duplication occurred in vertebrate TFs: (1) in the common ancestor of the M subfamily; (2) in the common ancestor of the M-like subfamily; and (3) in the common ancestor of other vertebrate TFs. The S, ICA, and L subfamilies were found only in placental mammals, and the phylogenetic analysis supported the hypothesis that these three subfamilies arose by gene duplication after the divergence of placental mammals from marsupials. The M-like subfamily was unusual in several respects, including the presence of a uniquely high proportion of clade-specific conserved residues, including distinctive but conserved residues in the sites homologous to those functioning in carbonate binding of human serotransferrin. The M-like family also showed a unusually high proportion of cationic residues in the positively charged region corresponding to human lactoferrampin, suggesting a distinctive role of this region in the M-like subfamily, perhaps in antimicrobial defense. PMID:25142446

  16. Genome-wide analysis reveals diverged patterns of codon bias, gene expression, and rates of sequence evolution in picea gene families.


    De La Torre, Amanda R; Lin, Yao-Cheng; Van de Peer, Yves; Ingvarsson, Pär K


    The recent sequencing of several gymnosperm genomes has greatly facilitated studying the evolution of their genes and gene families. In this study, we examine the evidence for expression-mediated selection in the first two fully sequenced representatives of the gymnosperm plant clade (Picea abies and Picea glauca). We use genome-wide estimates of gene expression (>50,000 expressed genes) to study the relationship between gene expression, codon bias, rates of sequence divergence, protein length, and gene duplication. We found that gene expression is correlated with rates of sequence divergence and codon bias, suggesting that natural selection is acting on Picea protein-coding genes for translational efficiency. Gene expression, rates of sequence divergence, and codon bias are correlated with the size of gene families, with large multicopy gene families having, on average, a lower expression level and breadth, lower codon bias, and higher rates of sequence divergence than single-copy gene families. Tissue-specific patterns of gene expression were more common in large gene families with large gene expression divergence than in single-copy families. Recent family expansions combined with large gene expression variation in paralogs and increased rates of sequence evolution suggest that some Picea gene families are rapidly evolving to cope with biotic and abiotic stress. Our study highlights the importance of gene expression and natural selection in shaping the evolution of protein-coding genes in Picea species, and sets the ground for further studies investigating the evolution of individual gene families in gymnosperms.

  17. Ortho2ExpressMatrix—a web server that interprets cross-species gene expression data by gene family information

    PubMed Central


    Background The study of gene families is pivotal for the understanding of gene evolution across different organisms and such phylogenetic background is often used to infer biochemical functions of genes. Modern high-throughput experiments offer the possibility to analyze the entire transcriptome of an organism; however, it is often difficult to deduct functional information from that data. Results To improve functional interpretation of gene expression we introduce Ortho2ExpressMatrix, a novel tool that integrates complex gene family information, computed from sequence similarity, with comparative gene expression profiles of two pre-selected biological objects: gene families are displayed with two-dimensional matrices. Parameters of the tool are object type (two organisms, two individuals, two tissues, etc.), type of computational gene family inference, experimental meta-data, microarray platform, gene annotation level and genome build. Family information in Ortho2ExpressMatrix bases on computationally different protein family approaches such as EnsemblCompara, InParanoid, SYSTERS and Ensembl Family. Currently, respective all-against-all associations are available for five species: human, mouse, worm, fruit fly and yeast. Additionally, microRNA expression can be examined with respect to miRBase or TargetScan families. The visualization, which is typical for Ortho2ExpressMatrix, is performed as matrix view that displays functional traits of genes (differential expression) as well as sequence similarity of protein family members (BLAST e-values) in colour codes. Such translations are intended to facilitate the user's perception of the research object. Conclusions Ortho2ExpressMatrix integrates gene family information with genome-wide expression data in order to enhance functional interpretation of high-throughput analyses on diseases, environmental factors, or genetic modification or compound treatment experiments. The tool explores differential gene expression in

  18. A Systematic Computational Analysis of Biosynthetic Gene Cluster Evolution: Lessons for Engineering Biosynthesis

    PubMed Central

    Sali, Andrej; Takano, Eriko; Fischbach, Michael A.


    Bacterial secondary metabolites are widely used as antibiotics, anticancer drugs, insecticides and food additives. Attempts to engineer their biosynthetic gene clusters (BGCs) to produce unnatural metabolites with improved properties are often frustrated by the unpredictability and complexity of the enzymes that synthesize these molecules, suggesting that genetic changes within BGCs are limited by specific constraints. Here, by performing a systematic computational analysis of BGC evolution, we derive evidence for three findings that shed light on the ways in which, despite these constraints, nature successfully invents new molecules: 1) BGCs for complex molecules often evolve through the successive merger of smaller sub-clusters, which function as independent evolutionary entities. 2) An important subset of polyketide synthases and nonribosomal peptide synthetases evolve by concerted evolution, which generates sets of sequence-homogenized domains that may hold promise for engineering efforts since they exhibit a high degree of functional interoperability, 3) Individual BGC families evolve in distinct ways, suggesting that design strategies should take into account family-specific functional constraints. These findings suggest novel strategies for using synthetic biology to rationally engineer biosynthetic pathways. PMID:25474254

  19. Genome-wide identification and analysis of the MADS-box gene family in apple.


    Tian, Yi; Dong, Qinglong; Ji, Zhirui; Chi, Fumei; Cong, Peihua; Zhou, Zongshan


    The MADS-box gene family is one of the most widely studied families in plants and has diverse developmental roles in flower pattern formation, gametophyte cell division and fruit differentiation. Although the genome-wide analysis of this family has been performed in some species, little is known regarding MADS-box genes in apple (Malus domestica). In this study, 146 MADS-box genes were identified in the apple genome and were phylogenetically clustered into six subgroups (MIKC(c), MIKC*, Mα, Mβ, Mγ and Mδ) with the MADS-box genes from Arabidopsis and rice. The predicted apple MADS-box genes were distributed across all 17 chromosomes at different densities. Additionally, the MADS-box domain, exon length, gene structure and motif compositions of the apple MADS-box genes were analysed. Moreover, the expression of all of the apple MADS-box genes was analysed in the root, stem, leaf, flower tissues and five stages of fruit development. All of the apple MADS-box genes, with the exception of some genes in each group, were expressed in at least one of the tissues tested, which indicates that the MADS-box genes are involved in various aspects of the physiological and developmental processes of the apple. To the best of our knowledge, this report describes the first genome-wide analysis of the apple MADS-box gene family, and the results should provide valuable information for understanding the classification, cloning and putative functions of this family.

  20. Tandem zinc-finger gene families in mammals: insights and unanswered questions.


    Shannon, M; Kim, J; Ashworth, L; Branscomb, E; Stubbs, L


    Evidence for the remarkable conservation of mammalian genomes, in both content and organization of resident genes, is rapidly emerging from comparative mapping studies. The frequent occurrence of familial gene clustering, presumably reflecting a history of tandem in situ duplications starting from a single ancestral gene, is also apparent from these analyses. Genes encoding Kruppel-type zinc-finger (ZNF) proteins, including those containing Kruppel-associated box (KRAB) motifs, are particularly prone to such clustered organization. Existing data suggest that genes in KRAB-ZNF gene clusters have diverged in sequence and expression patterns, possibly yielding families of proteins with distinct, yet related, functions. Comparative mapping studies indicate that at least some of the genes within these clusters in mammals were elaborated prior to the divergence of mammalian orders and, subsequently, have been conserved. These data suggest a possible role for these tandem KRAB-ZNF gene families in mammalian evolution.

  1. Structural, functional, and evolutionary analysis of the unusually large stilbene synthase gene family in grapevine.


    Parage, Claire; Tavares, Raquel; Réty, Stéphane; Baltenweck-Guyot, Raymonde; Poutaraud, Anne; Renault, Lauriane; Heintz, Dimitri; Lugan, Raphaël; Marais, Gabriel A B; Aubourg, Sébastien; Hugueney, Philippe


    Stilbenes are a small family of phenylpropanoids produced in a number of unrelated plant species, including grapevine (Vitis vinifera). In addition to their participation in defense mechanisms in plants, stilbenes, such as resveratrol, display important pharmacological properties and are postulated to be involved in the health benefits associated with a moderate consumption of red wine. Stilbene synthases (STSs), which catalyze the biosynthesis of the stilbene backbone, seem to have evolved from chalcone synthases (CHSs) several times independently in stilbene-producing plants. STS genes usually form small families of two to five closely related paralogs. By contrast, the sequence of grapevine reference genome (cv PN40024) has revealed an unusually large STS gene family. Here, we combine molecular evolution and structural and functional analyses to investigate further the high number of STS genes in grapevine. Our reannotation of the STS and CHS gene families yielded 48 STS genes, including at least 32 potentially functional ones. Functional characterization of nine genes representing most of the STS gene family diversity clearly indicated that these genes do encode for proteins with STS activity. Evolutionary analysis of the STS gene family revealed that both STS and CHS evolution are dominated by purifying selection, with no evidence for strong selection for new functions among STS genes. However, we found a few sites under different selection pressures in CHS and STS sequences, whose potential functional consequences are discussed using a structural model of a typical STS from grapevine that we developed.

  2. A novel heterozygous missense mutation in uromodulin gene in an Indian family with familial juvenile hyperuricemic nephropathy

    PubMed Central

    Saxena, D.; Srivastava, P.; Phadke, S. R.


    Familial juvenile hyperuricemic nephropathy (FJHN), characterized by early-onset hyperuricemia, reduced fractional excretion of uric acid, and chronic renal failure is caused due to mutation in uromodulin (UMOD) gene. We identified a novel mutation in a family with multiple members affected with FJHN. Ten coding exons of UMOD gene in three family members with clinical and biochemical features of FJHN and one unaffected family member were sequenced, and sequence variants were analyzed for the pathogenicity by bioinformatics studies. A heterozygous novel missense mutation (c. 949 T >G) in exon 5 leading to the replacement of cysteine by glycine at position 317 was identified in all three affected family members. This mutation has not been reported earlier in Human Gene Mutation Database, Human Genome Variation, Clinvar, and 1000 Genome. The mutation lies in the cysteine-rich 2 domain of the protein, and the affected residue is evolutionary conserved in other species. To our knowledge, this is the first report of the identification of UMOD mutation in an Indian family. PMID:27795632

  3. Out of the Water: Origin and Diversification of the LBD Gene Family.


    Chanderbali, Andre S; He, Fengmei; Soltis, Pamela S; Soltis, Douglas E


    LBD (lateral organ boundaries domain) genes are essential to the developmental programs of many fundamental plant organs and function in some of the basic metabolic pathways of plants. However, our historical perspective on the roles of LBD genes during plant evolution has, heretofore, been fragmentary. Here, we show that the LBD gene family underwent an initial radiation that established five gene lineages in the ancestral genome of most charophyte algae and land plants. By inference, the LBD gene family originated after the emergence of the green plants (Viridiplantae), but prior to the diversification of most extant streptophytes. After this initial radiation, we find limited instances of gene family diversification in land plants until successive rounds of expansion in the ancestors of seed plants and flowering plants. The most dynamic phases of LBD gene evolution, therefore, trace to the aquatic ancestors of embryophytes followed by relatively recent lineage-specific expansions on land.

  4. Out of the Water: Origin and Diversification of the LBD Gene Family

    PubMed Central

    Chanderbali, Andre S.; He, Fengmei; Soltis, Pamela S.; Soltis, Douglas E.


    LBD (LATERAL ORGAN BOUNDARIES DOMAIN) genes are essential to the developmental programs of many fundamental plant organs and function in some of the basic metabolic pathways of plants. However, our historical perspective on the roles of LBD genes during plant evolution has, heretofore, been fragmentary. Here, we show that the LBD gene family underwent an initial radiation that established five gene lineages in the ancestral genome of most charophyte algae and land plants. By inference, the LBD gene family originated after the emergence of the green plants (Viridiplantae), but prior to the diversification of most extant streptophytes. After this initial radiation, we find limited instances of gene family diversification in land plants until successive rounds of expansion in the ancestors of seed plants and flowering plants. The most dynamic phases of LBD gene evolution, therefore, trace to the aquatic ancestors of embryophytes followed by relatively recent lineage-specific expansions on land. PMID:25839188

  5. Genomic organization of the mouse T-cell receptor beta-chain gene family.

    PubMed Central

    Lai, E; Barth, R K; Hood, L


    We have combined three different methods, deletion mapping of T-cell lines, field-inversion gel electrophoresis, and the restriction mapping of a cosmid clone, to construct a physical map of the murine T-cell receptor beta-chain gene family. We have mapped 19 variable (V beta) gene segments and the two clusters of diversity (D beta) and joining (J beta) gene segments and constant (C beta) genes. These members of the beta-chain gene family span approximately equal to 450 kilobases of DNA, excluding one potential gap in the DNA fragment alignments. Images PMID:3035555

  6. Different evolutionary histories of two cation/proton exchanger gene families in plants

    PubMed Central


    Background Gene duplication events have been proposed to be involved in the adaptation of plants to stress conditions; precisely how is unclear. To address this question, we studied the evolution of two families of antiporters. Cation/proton exchangers are important for normal cell function and in plants, Na+,K+/H+ antiporters have also been implicated in salt tolerance. Two well-known plant cation/proton antiporters are NHX1 and SOS1, which perform Na+ and K+ compartmentalization into the vacuole and Na+ efflux from the cell, respectively. However, our knowledge about the evolution of NHX and SOS1 stress responsive gene families is still limited. Results In this study we performed a comprehensive molecular evolutionary analysis of the NHX and SOS1 families. Using available sequences from a total of 33 plant species, we estimated gene family phylogenies and gene duplication histories, as well as examined heterogeneous selection pressure on amino acid sites. Our results show that, while the NHX family expanded and specialized, the SOS1 family remained a low copy gene family that appears to have undergone neofunctionalization during its evolutionary history. Additionally, we found that both families are under purifying selection although SOS1 is less constrained. Conclusions We propose that the different evolution histories are related with the proteins’ function and localization, and that the NHX and SOS1 families are examples of two different evolutionary paths through which duplication events may result in adaptive evolution of stress tolerance. PMID:23822194

  7. Identification and distribution of the NBS-LRR gene family in the cassava genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plant resistance genes (R genes) exist in large families and usually contain both a nucleotide-binding site domain and a leucine-rich repeat domain, denoted NBS-LRR. The genome sequence of cassava (Manihot esculenta) is a valuable resource for analyzing the genomic organization of resistance genes i...

  8. Evolution of the chitin synthase gene family correlates with fungal morphogenesis and adaption to ecological niches

    PubMed Central

    Liu, Ran; Xu, Chuan; Zhang, Qiangqiang; Wang, Shiyi; Fang, Weiguo


    The fungal kingdom potentially has the most complex chitin synthase (CHS) gene family, but evolution of the fungal CHS gene family and its diversification to fulfill multiple functions remain to be elucidated. Here, we identified the full complement of CHSs from 231 fungal species. Using the largest dataset to date, we characterized the evolution of the fungal CHS gene family using phylogenetic and domain structure analysis. Gene duplication, domain recombination and accretion are major mechanisms underlying the diversification of the fungal CHS gene family, producing at least 7 CHS classes. Contraction of the CHS gene family is morphology-specific, with significant loss in unicellular fungi, whereas family expansion is lineage-specific with obvious expansion in early-diverging fungi. ClassV and ClassVII CHSs with the same domain structure were produced by the recruitment of domains PF00063 and PF08766 and subsequent duplications. Comparative analysis of their functions in multiple fungal species shows that the emergence of ClassV and ClassVII CHSs is important for the morphogenesis of filamentous fungi, development of pathogenicity in pathogenic fungi, and heat stress tolerance in Pezizomycotina fungi. This work reveals the evolution of the fungal CHS gene family, and its correlation with fungal morphogenesis and adaptation to ecological niches. PMID:28300148

  9. Genomewide analysis of the lateral organ boundaries domain gene family in Vitis vinifera.


    Cao, Hui; Liu, Cai-Yun; Liu, Chun-Xiang; Zhao, Yue-Ling; Xu, Rui-Rui


    In plants, the transcription factor families have been implicated in many important biological processes. These processes include morphogenesis, signal transduction and environmental stress responses. Proteins containing the lateral organ boundaries domain (LBD), which encodes a zinc finger-like domain are only found in plants. This finding indicates that this unique gene family regulates only plant-specific biological processes. LBD genes play crucial roles in the growth and development of plants such as Arabidopsis, Oryza sativa, Zea mays, poplar, apple and tomato. However, relatively little is known about the LBD genes in grape (Vitis vinifera). In this study, we identified 40 LBD genes in the grape genome. A complete overview of the chromosomal locations, phylogenetic relationships, structures and expression profiles of this gene family during development in grape is presented here. Phylogenetic analysis showed that the LBD genes could be divided into classes I and II, together with LBDs from Arabidopsis. We mapped the 40 LBD genes on the grape chromosomes (chr1-chr19) and found that 37 of the predicted grape LBD genes were distributed in different densities across 12 chromosomes. Grape LBDs were found to share a similar intron/exon structure and gene length within the same class. The expression profiles of grape LBD genes at different developmental stages were analysed using microarray data. Results showed that 21 grape LBD genes may be involved in grape developmental processes, including preveraison, veraison and ripening. Finally, we analysed the expression patterns of six LBD genes through quantitative real-time polymerase chain reation analysis. The six LBD genes showed differential expression patterns among the three representative grape tissues, and five of these genes were found to be involved in responses to mannitol, sodium chloride, heat stress and low temperature treatments. To our knowledge, this is the first study to analyse the LBD gene family in

  10. Extensive and continuous duplication facilitates rapid evolution and diversification of gene families.


    Chang, Dan; Duda, Thomas F


    The origin of novel gene functions through gene duplication, mutation, and natural selection represents one of the mechanisms by which organisms diversify and one of the possible paths leading to adaptation. Nonetheless, the extent, role, and consequences of duplications in the origins of ecological adaptations, especially in the context of species interactions, remain unclear. To explore the evolution of a gene family that is likely linked to species associations, we investigated the evolutionary history of the A-superfamily of conotoxin genes of predatory marine cone snails (Conus species). Members of this gene family are expressed in the venoms of Conus species and are presumably involved in predator-prey associations because of their utility in prey capture. We recovered sequences of this gene family from genomic DNA of four closely related species of Conus and reconstructed the evolutionary history of these genes. Our study is the first to directly recover conotoxin genes from Conus genomes to investigate the evolution of conotoxin gene families. Our results revealed a phenomenon of rapid and continuous gene turnover that is coupled with heightened rates of evolution. This continuous duplication pattern has not been observed previously, and the rate of gene turnover is at least two times higher than estimates from other multigene families. Conotoxin genes are among the most rapidly evolving protein-coding genes in metazoans, a phenomenon that may be facilitated by extensive gene duplications and have driven changes in conotoxin functions through neofunctionalization. Together these mechanisms led to dramatically divergent arrangements of A-superfamily conotoxin genes among closely related species of Conus. Our findings suggest that extensive and continuous gene duplication facilitates rapid evolution and drastic divergence in venom compositions among species, processes that may be associated with evolutionary responses to predator-prey interactions.

  11. Inferring Hypotheses on Functional Relationships of Genes: Analysis of the Arabidopsis thaliana Subtilase Gene Family

    PubMed Central

    Büssis, Dirk; Stintzi, Annick; Schaller, Andreas; Kopka, Joachim; Altmann, Thomas


    The gene family of subtilisin-like serine proteases (subtilases) in Arabidopsis thaliana comprises 56 members, divided into six distinct subfamilies. Whereas the members of five subfamilies are similar to pyrolysins, two genes share stronger similarity to animal kexins. Mutant screens confirmed 144 T-DNA insertion lines with knockouts for 55 out of the 56 subtilases. Apart from SDD1, none of the confirmed homozygous mutants revealed any obvious visible phenotypic alteration during growth under standard conditions. Apart from this specific case, forward genetics gave us no hints about the function of the individual 54 non-characterized subtilase genes. Therefore, the main objective of our work was to overcome the shortcomings of the forward genetic approach and to infer alternative experimental approaches by using an integrative bioinformatics and biological approach. Computational analyses based on transcriptional co-expression and co-response pattern revealed at least two expression networks, suggesting that functional redundancy may exist among subtilases with limited similarity. Furthermore, two hubs were identified, which may be involved in signalling or may represent higher-order regulatory factors involved in responses to environmental cues. A particular enrichment of co-regulated genes with metabolic functions was observed for four subtilases possibly representing late responsive elements of environmental stress. The kexin homologs show stronger associations with genes of transcriptional regulation context. Based on the analyses presented here and in accordance with previously characterized subtilases, we propose three main functions of subtilases: involvement in (i) control of development, (ii) protein turnover, and (iii) action as downstream components of signalling cascades. Supplemental material is available in the Plant Subtilase Database (PSDB) ( , as well as from the CSB.DB (http

  12. Methuselah/Methuselah-like G protein-coupled receptors constitute an ancient metazoan gene family

    PubMed Central

    de Mendoza, Alexandre; Jones, Jeffery W.; Friedrich, Markus


    Inconsistent conclusions have been drawn regarding the phylogenetic age of the Methuselah/Methuselah-like (Mth/Mthl) gene family of G protein-coupled receptors, the founding member of which regulates development and lifespan in Drosophila. Here we report the results from a targeted homolog search of 39 holozoan genomes and phylogenetic analysis of the conserved seven transmembrane domain. Our findings reveal that the Mth/Mthl gene family is ancient, has experienced numerous extinction and expansion events during metazoan evolution, and acquired the current definition of the Methuselah ectodomain during its exceptional expansion in arthropods. In addition, our findings identify Mthl1, Mthl5, Mthl14, and Mthl15 as the oldest Mth/Mthl gene family paralogs in Drosophila. Future studies of these genes have the potential to define ancestral functions of the Mth/Mthl gene family. PMID:26915348

  13. Evolution of the RH gene family in vertebrates revealed by brown hagfish (Eptatretus atami) genome sequences.


    Suzuki, Akinori; Komata, Hidero; Iwashita, Shogo; Seto, Shotaro; Ikeya, Hironobu; Tabata, Mitsutoshi; Kitano, Takashi


    In vertebrates, there are four major genes in the RH (Rhesus) gene family, RH, RHAG, RHBG, and RHCG. These genes are thought to have been formed by the two rounds of whole-genome duplication (2R-WGD) in the common ancestor of all vertebrates. In our previous work, where we analyzed details of the gene duplications process of this gene family, three nucleotide sequences belonging to this family were identified in Far Eastern brook lamprey (Lethenteron reissneri), and the phylogenetic positions of the genes were determined. Lampreys, along with hagfishes, are cyclostomata (jawless fishes), which is a sister group of gnathostomata (jawed vertebrates). Although those results suggested that one gene was orthologous to the gnathostome RHCG genes, we did not identify clear orthologues for other genes. In this study, therefore, we identified three novel cDNA sequences that belong to the RH gene family using de novo transcriptome analysis of another cyclostome: the brown hagfish (Eptatretus atami). We also determined the nucleotide sequences for the RHBG and RHCG genes in a red stingray (Dasyatis akajei), which belongs to the cartilaginous fishes. The phylogenetic tree showed that two brown hagfish genes, which were probably duplicated in the cyclostome lineage, formed a cluster with the gnathostome RHAG genes, whereas another brown hagfish gene formed a cluster with the gnathostome RHCG genes. We estimated that the RH genes had a higher evolutionary rate than the RHAG, RHBG, and RHCG genes. Interestingly, in the RHBG genes, only the bird lineage showed a higher rate of nonsynonymous substitutions. It is likely that this higher rate was caused by a state of relaxed functional constraints rather than positive selection nor by pseudogenization.

  14. Massive Expansion of Ubiquitination-Related Gene Families within the Chlamydiae

    PubMed Central

    Domman, Daryl; Collingro, Astrid; Lagkouvardos, Ilias; Gehre, Lena; Weinmaier, Thomas; Rattei, Thomas; Subtil, Agathe; Horn, Matthias


    Gene loss, gain, and transfer play an important role in shaping the genomes of all organisms; however, the interplay of these processes in isolated populations, such as in obligate intracellular bacteria, is less understood. Despite a general trend towards genome reduction in these microbes, our phylogenomic analysis of the phylum Chlamydiae revealed that within the family Parachlamydiaceae, gene family expansions have had pronounced effects on gene content. We discovered that the largest gene families within the phylum are the result of rapid gene birth-and-death evolution. These large gene families are comprised of members harboring eukaryotic-like ubiquitination-related domains, such as F-box and BTB-box domains, marking the largest reservoir of these proteins found among bacteria. A heterologous type III secretion system assay suggests that these proteins function as effectors manipulating the host cell. The large disparity in copy number of members in these families between closely related organisms suggests that nonadaptive processes might contribute to the evolution of these gene families. Gene birth-and-death evolution in concert with genomic drift might represent a previously undescribed mechanism by which isolated bacterial populations diversify. PMID:25069652

  15. Cloning of novel rice blast resistance genes from two rapidly evolving NBS-LRR gene families in rice.


    Guo, Changjiang; Sun, Xiaoguang; Chen, Xiao; Yang, Sihai; Li, Jing; Wang, Long; Zhang, Xiaohui


    Most rice blast resistance genes (R-genes) encode proteins with nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. Our previous study has shown that more rice blast R-genes can be cloned in rapidly evolving NBS-LRR gene families. In the present study, two rapidly evolving R-gene families in rice were selected for cloning a subset of genes from their paralogs in three resistant rice lines. A total of eight functional blast R-genes were identified among nine NBS-LRR genes, and some of these showed resistance to three or more blast strains. Evolutionary analysis indicated that high nucleotide diversity of coding regions served as important parameters in the determination of gene resistance. We also observed that amino-acid variants (nonsynonymous mutations, insertions, or deletions) in essential motifs of the NBS domain contribute to the blast resistance capacity of NBS-LRR genes. These results suggested that the NBS regions might also play an important role in resistance specificity determination. On the other hand, different splicing patterns of introns were commonly observed in R-genes. The results of the present study contribute to improving the effectiveness of R-gene identification by using evolutionary analysis method and acquisition of novel blast resistance genes.

  16. Isolation of novel human and mouse genes of the recA/RAD51 recombination-repair gene family.

    PubMed Central

    Cartwright, R; Dunn, A M; Simpson, P J; Tambini, C E; Thacker, J


    Genes from the recA/RAD51 family play essential roles in homologous recombination in all organisms. Using sequence homologies from eukaryotic members of this family we have identified fragments of two additional mammalian genes with homology to RAD51. Cloning the full-length cDNAs for both human and mouse genes showed that the sequences are highly conserved, and that the predicted proteins have characteristic features of this gene family. One of the novel genes (R51H2) occurs in two forms in human cDNA, differing extensively at the 3' end, probably due to an unusual form of alternative splicing. The new genes (R51H2 and R51H3) were mapped to human chromosomes 14q23-24 and 17q1.2, respectively. Expression studies showed that R51H2 is expressed at lower levels than R51H3 , but that expression of both genes occurs at elevated levels in the testis compared with other tissues. The combination of gene structure conservation and the transcript expression patterns suggests that these new members of the recA/RAD51 family may also function in homologous recombination-repair pathways. PMID:9512535

  17. The ankyrin repeat gene family in rice: genome-wide identification, classification and expression profiling.


    Huang, Jianyan; Zhao, Xiaobo; Yu, Huihui; Ouyang, Yidan; Wang, Lei; Zhang, Qifa


    Ankyrin repeat (ANK) containing proteins comprise a large protein family. Although many members of this family have been implicated in plant growth, development and signal transduction, only a few ANK genes have been reported in rice. In this study, we analyzed the structures, phylogenetic relationship, genome localizations and expression profiles of 175 ankyrin repeat genes identified in rice (OsANK). Domain composition analysis suggested OsANK proteins can be classified into ten subfamilies. Chromosomal localizations of OsANK genes indicated nine segmental duplication events involving 17 genes and 65 OsANK genes were involved in tandem duplications. The expression profiles of 158 OsANK genes were analyzed in 24 tissues covering the whole life cycle of two rice genotypes, Minghui 63 and Zhenshan 97. Sixteen genes showed preferential expression in given tissues compared to all the other tissues in Minghui 63 and Zhenshan 97. Nine genes were preferentially expressed in stamen of 1 day before flowering, suggesting that these genes may play important roles in pollination and fertilization. Expression data of OsANK genes were also obtained with tissues of seedlings subjected to three phytohormone (NAA, GA3 and KT) and light/dark treatments. Eighteen genes showed differential expression with at least one phytohormone treatment while under light/dark treatments, 13 OsANK genes showed differential expression. Our data provided a very useful reference for cloning and functional analysis of members of this gene family in rice.

  18. Holding blame at bay? ‘Gene talk' in family members' accounts of schizophrenia aetiology

    PubMed Central

    Callard, Felicity; Rose, Diana; Hanif, Emma-Louise; Quigley, Jody; Greenwood, Kathryn; Wykes, Til


    We provide the first detailed analysis of how, for what purposes and with what consequences people related to someone with a diagnosis of schizophrenia use ‘gene talk'. The article analyses findings from a qualitative interview study conducted in London and involving 19 participants (mostly women). We transcribed the interviews verbatim and analysed them using grounded theory methods. We analyse how and for what purposes participants mobilized ‘gene talk' in their affectively freighted encounter with an unknown interviewer. Gene talk served to (re)position blame and guilt, and was simultaneously used imaginatively to forge family history narratives. Family members used ‘gene talk' to recruit forebears with no psychiatric diagnosis into a family history of mental illness, and presented the origins of the diagnosed family member's schizophrenia as lying temporally before, and hence beyond the agency of the immediate family. Gene talk was also used in attempts to dislodge the distressing figure of the schizophrenia-inducing mother. ‘Gene talk', however, ultimately displaced, rather than resolved, the (self-)blame of many family members, particularly mothers. Our article challenges the commonly expressed view that genetic accounts will absolve family members' sense of (self-)blame in relation to their relative's/relatives' diagnosis. PMID:23227107

  19. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.


    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan


    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  20. Familial isolated pituitary adenoma caused by a Aip gene mutation not described before in a family context.


    García-Arnés, J A; González-Molero, I; Oriola, J; Mazuecos, N; Luque, R; Castaño, J; Arraez, M A


    The cause of familial isolated pituitary adenomas (FIPA) remains unknown in a high percentage of cases, but the AIP gene plays an important role in the etiology. The aim of the study is to describe a family with FIPA syndrome and the results of genomic studies. A 16-year-old man had a giant prolactinoma resistant tomedical treatment with delayed growth and pubertal development. His mother had been previously diagnosed with a nonfunctioning pituitary macroadenoma. Transsphenoidal endoscopic resection was performed and a genetic study revealed a heterozygous mutation in exon 6: 974G>A (p.Arg325Gln). Because the AIP gene is a tumor suppressor gene, we searched for loss of heterozygosity within the AIP gene by amplifying exon 6 from tumor tissue of the patient. In the electropherogram, only the A allele was amplified (hemizygous state), indicating loss of the normal allele. We report a Spanish family with FIPA in whom a mutation in the AIP gene previously unreported in a familiar context was identified.

  1. Genome-wide analysis of the GRAS gene family in Chinese cabbage (Brassica rapa ssp. pekinensis).


    Song, Xiao-Ming; Liu, Tong-Kun; Duan, Wei-Ke; Ma, Qing-Hua; Ren, Jun; Wang, Zhen; Li, Ying; Hou, Xi-Lin


    The GRAS gene family is one of the most important families of transcriptional regulators. In this study, 48 GRAS genes are identified from Chinese cabbage, and they are classified into eight groups according to the classification of Arabidopsis. The characterization, classification, gene structure and phylogenetic construction of GRAS proteins are performed. Distribution mapping shows that GRAS proteins are nonrandomly localized in 10 chromosomes. Fifty-five orthologous gene pairs are shared by Chinese cabbage and Arabidopsis, and interaction networks of these orthologous genes are constructed. The expansion of GRAS genes in Chinese cabbage results from genome triplication. Among the 17 species examined, 14 higher plants carry the GRAS genes, whereas two lower plants and one fungi species do not. Furthermore, the expression patterns of GRAS genes exhibit differences in three tissues based on RNA-seq data. Taken together, this comprehensive analysis will provide rich resources for studying GRAS protein functions in Chinese cabbage.

  2. Saltatory evolution of the ectodermal neural cortex gene family at the vertebrate origin.


    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro


    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates.

  3. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    PubMed Central

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro


    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  4. Global identification and expression analysis of stress-responsive genes of the Argonaute family in apple.


    Xu, Ruirui; Liu, Caiyun; Li, Ning; Zhang, Shizhong


    Argonaute (AGO) proteins, which are found in yeast, animals, and plants, are the core molecules of the RNA-induced silencing complex. These proteins play important roles in plant growth, development, and responses to biotic stresses. The complete analysis and classification of the AGO gene family have been recently reported in different plants. Nevertheless, systematic analysis and expression profiling of these genes have not been performed in apple (Malus domestica). Approximately 15 AGO genes were identified in the apple genome. The phylogenetic tree, chromosome location, conserved protein motifs, gene structure, and expression of the AGO gene family in apple were analyzed for gene prediction. All AGO genes were phylogenetically clustered into four groups (i.e., AGO1, AGO4, MEL1/AGO5, and ZIPPY/AGO7) with the AGO genes of Arabidopsis. These groups of the AGO gene family were statistically analyzed and compared among 31 plant species. The predicted apple AGO genes are distributed across nine chromosomes at different densities and include three segment duplications. Expression studies indicated that 15 AGO genes exhibit different expression patterns in at least one of the tissues tested. Additionally, analysis of gene expression levels indicated that the genes are mostly involved in responses to NaCl, PEG, heat, and low-temperature stresses. Hence, several candidate AGO genes are involved in different aspects of physiological and developmental processes and may play an important role in abiotic stress responses in apple. To the best of our knowledge, this study is the first to report a comprehensive analysis of the apple AGO gene family. Our results provide useful information to understand the classification and putative functions of these proteins, especially for gene members that may play important roles in abiotic stress responses in M. hupehensis.

  5. CRDB: Database of Chemosensory Receptor Gene Families in Vertebrate

    PubMed Central

    Wu, Xiaoli; Zhong, Yang


    Chemosensory receptors (CR) are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of ‘birth-and-death’ evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates. PMID:22393364

  6. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).


    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui


    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  7. Locus for a human hereditary cataract is closely linked to the. gamma. -crystallin gene family

    SciTech Connect

    Lubsen, N.H.; Renwick, J.H.; Tsui, L.C.; Breitman, M.L.; Schoenmakers, J.G.G.


    Within the human ..gamma..-crystallin gene cluster polymorphic Taq I sites are present. These give rise to three sets of allelic fragments from the ..gamma..-crystallin genes. Together these restriction fragment length polymorphisms define eight possible haplotypes, three of which (Q, R, and S) were found in the Dutch and English population. A fourth haplotype (P) was detected within a family in which a hereditary Coppock-like cataract of the embryonic lens nucleus occurs in heterozygotes. Haplotype P was found only in family members who suffered from cataract, and all family members who suffered from cataract had haplotype P. The absolute correlation between the presence of haplotype P and cataract within this family shows that the ..gamma..-crystallin gene cluster and the locus for the Coppock-like cataract are closely linked. This linkage provides genetic evidence that the primary cause of a cataract in humans could possibly be a lesion in a crystallin gene.

  8. Gene duplication event in family 12 glycosyl hydrolase from Phytophthora spp.


    Costanzo, Stefano; Ospina-Giraldo, M D; Deahl, K L; Baker, C J; Jones, Richard W


    A total of 18 paralogs of xyloglucan-specific endoglucanases (EGLs) from the glycosyl hydrolase family 12 were identified and characterized in Phytophthora sojae and Phytophthora ramorum. These genes encode predicted extracellular enzymes, with sizes ranging from 189 to 435 amino acid residues, that would be capable of hydrolyzing the xyloglucan component of the host cell wall. In two cases, four and six functional copies of these genes were found in tight succession within a region of 5 and 18 kb, respectively. The overall gene copy number and relative organization appeared well conserved between P. sojae and P. ramorum, with apparent synteny in this region of their respective genomes. Phylogenetic analyses of Phytophthora endoglucanases of family 12 and other known members of EGL 12, revealed a close relatedness with a fairly conserved gene sub-family containing, among others, sequences from the fungi Emericella desertorum and Aspergillus aculeatus. This is the first report of family 12 EGLs present in plant pathogenic eukaryotes.

  9. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.


    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P


    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  10. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    PubMed Central

    Schiffer, Philipp H.; Gravemeyer, Jan; Rauscher, Martina; Wiehe, Thomas


    Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly) deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR)-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction. PMID:27509525

  11. Developmental expression of the N-myc downstream regulated gene (Ndrg) family during Xenopus tropicalis embryogenesis.


    Zhong, Chao; Zhou, Yan-Kuan; Yang, Shan-Shan; Zhao, Jun-Fang; Zhu, Xiao-Long; Chen, Hen-Huang; Chen, Pei-Chao; Huang, Li-Quan; Huang, Xiao


    The N-myc downstream regulated gene (Ndrg) family consists of four main members Ndrg1, 2, 3, and 4. The Ndrg genes are involved in many vital biological events including development. However, comprehensive expression patterns of this gene family during vertebrate embryogenesis remain largely unknown. Here, we analyzed the Ndrg family from the evolutionary perspective and examined the expression patterns of the Ndrg genes during Xenopus tropicalis embryogenesis. Different Ndrg family members of vertebrates are separated into different homology clusters which can be further classified into two groups and each Ndrg family member is well conserved during evolution. The temporal and spatial expression patterns of Ndrg1, 2, 3 and 4 are different during early Xenopus tropicalis development. Ndrg1, 2 and 4 are maternally expressed genes while Ndrg3 is a zygotically expressed gene. The Ndrg genes are differentially expressed in the developing central nervous system, the developing sensory organs, and the developing excretory organs. Moreover, they also show other specific expression domains. Our results indicate that the Ndrg genes exhibit specific expression patterns and may play different roles during vertebrate embryogenesis.

  12. Mouse T-cell receptor variable gene segment families

    SciTech Connect

    Arden, B.; Kabelitz, D.; Clark, S.P.; Mak, T.W.


    All mouse T-cell receptor {alpha}/{delta}, {beta}, and {gamma} variable (Tcra/d-, b-, and g-V) gene segments were aligned to compare the sequences with one another, to group them into subfamilies, and to derive a name which complies with the standard nomenclature. it was necessary to change the names of some V gene segments because they conflicted with those of other segments. The traditional classification into subfamilies was re-evaluated using a much larger pool of sequences. In the mouse, most V gene segments can be grouped into subfamilies of closely related genes with significantly less similarity between different subfamilies. 118 refs., 11 figs., 4 tabs.

  13. MS/MS networking guided analysis of molecule and gene cluster families.


    Nguyen, Don Duy; Wu, Cheng-Hsuan; Moree, Wilna J; Lamsa, Anne; Medema, Marnix H; Zhao, Xiling; Gavilan, Ronnie G; Aparicio, Marystella; Atencio, Librada; Jackson, Chanaye; Ballesteros, Javier; Sanchez, Joel; Watrous, Jeramie D; Phelan, Vanessa V; van de Wiel, Corine; Kersten, Roland D; Mehnaz, Samina; De Mot, René; Shank, Elizabeth A; Charusanti, Pep; Nagarajan, Harish; Duggan, Brendan M; Moore, Bradley S; Bandeira, Nuno; Palsson, Bernhard Ø; Pogliano, Kit; Gutiérrez, Marcelino; Dorrestein, Pieter C


    The ability to correlate the production of specialized metabolites to the genetic capacity of the organism that produces such molecules has become an invaluable tool in aiding the discovery of biotechnologically applicable molecules. Here, we accomplish this task by matching molecular families with gene cluster families, making these correlations to 60 microbes at one time instead of connecting one molecule to one organism at a time, such as how it is traditionally done. We can correlate these families through the use of nanospray desorption electrospray ionization MS/MS, an ambient pressure MS technique, in conjunction with MS/MS networking and peptidogenomics. We matched the molecular families of peptide natural products produced by 42 bacilli and 18 pseudomonads through the generation of amino acid sequence tags from MS/MS data of specific clusters found in the MS/MS network. These sequence tags were then linked to biosynthetic gene clusters in publicly accessible genomes, providing us with the ability to link particular molecules with the genes that produced them. As an example of its use, this approach was applied to two unsequenced Pseudoalteromonas species, leading to the discovery of the gene cluster for a molecular family, the bromoalterochromides, in the previously sequenced strain P. piscicida JCM 20779(T). The approach itself is not limited to 60 related strains, because spectral networking can be readily adopted to look at molecular family-gene cluster families of hundreds or more diverse organisms in one single MS/MS network.

  14. Mutation analysis in F9 gene of 17 families with haemophilia B from Iran.


    Enayat, M S; Karimi, M; Chana, G; Farjadian, S; Theophilus, B D M; Hill, F G H


    Seventeen haemophilia B families from Iran were investigated to determine the causative mutation. All the essential regions of the F9 gene were initially screened by conformational sensitive gel electrophoresis and exons with band shift were sequenced. Seven of the 15 mutations identified in these families were novel mutations. The mutations were authenticated in nine families as other affected members or heterozygous female carriers were available for verification.

  15. Cognitive Functioning in Affected Sibling Pairs with ADHD: Familial Clustering and Dopamine Genes

    ERIC Educational Resources Information Center

    Loo, Sandra K.; Rich, Erika Carpenter; Ishii, Janeen; McGough, James; McCracken, James; Nelson, Stanley; Smalley, Susan L.


    Background: This paper examines familiality and candidate gene associations of cognitive measures as potential endophenotypes in attention-deficit/hyperactivity disorder (ADHD). Methods: The sample consists of 540 participants, aged 6 to 18, who were diagnosed with ADHD from 251 families recruited for a larger genetic study of ADHD. All members of…

  16. Genome-wide analysis of the MADS-box gene family in Brachypodium distachyon.


    Wei, Bo; Zhang, Rong-Zhi; Guo, Juan-Juan; Liu, Dan-Mei; Li, Ai-Li; Fan, Ren-Chun; Mao, Long; Zhang, Xiang-Qi


    MADS-box genes are important transcription factors for plant development, especially floral organogenesis. Brachypodium distachyon is a model for biofuel plants and temperate grasses such as wheat and barley, but a comprehensive analysis of MADS-box family proteins in Brachypodium is still missing. We report here a genome-wide analysis of the MADS-box gene family in Brachypodium distachyon. We identified 57 MADS-box genes and classified them into 32 MIKC(c)-type, 7 MIKC*-type, 9 Mα, 7 Mβ and 2 Mγ MADS-box genes according to their phylogenetic relationships to the Arabidopsis and rice MADS-box genes. Detailed gene structure and motif distribution were then studied. Investigation of their chromosomal localizations revealed that Brachypodium MADS-box genes distributed evenly across five chromosomes. In addition, five pairs of type II MADS-box genes were found on synteny blocks derived from whole genome duplication blocks. We then performed a systematic expression analysis of Brachypodium MADS-box genes in various tissues, particular floral organs. Further detection under salt, drought, and low-temperature conditions showed that some MADS-box genes may also be involved in abiotic stress responses, including type I genes. Comparative studies of MADS-box genes among Brachypodium, rice and Arabidopsis showed that Brachypodium had fewer gene duplication events. Taken together, this work provides useful data for further functional studies of MADS-box genes in Brachypodium distachyon.

  17. Mutational analysis of PKD1 gene in a Chinese family with autosomal dominant polycystic kidney disease

    PubMed Central

    Liu, Jingyan; Li, Lanrong; Liu, Qingmin


    Autosomal dominant polycystic kidney disease (ADPKD) is a hereditary disease and common renal disease. Mutations of PKD genes are responsible for this disease. We analyzed a large Chinese family with ADPKD using Sanger sequencing to identify the mutation responsible for this disease. The family comprised 27 individuals including 10 ADPKD patients. These ADPKD patients had severe renal disease and most of them died very young. We analyzed 6 survival patients gene and found they all had C10529T mutation in exon 35 of PKD1 gene. We did not found gene mutation in any unaffected relatives or 300 unrelated controls. These findings suggested that the C10529T mutation in PKD1 gene might be the pathogenic mutation responsible for the disease in this family. PMID:26722532

  18. Genome-wide analysis of Aux/IAA and ARF gene families in Populus trichocarpa

    SciTech Connect

    Kalluri, Udaya C; DiFazio, Stephen P; Brunner, A.; Tuskan, Gerald A


    Auxin/Indole-3-Acetic Acid (Aux/IAA) and Auxin Response Factor (ARF) transcription factors are key regulators of auxin responses in plants. A total of 35 Aux/IAA and 39 ARF genes were identified in the Populus genome. Comparative phylogenetic analysis revealed that the subgroups PoptrARF2, 6, 9 and 16 and PoptrIAA3, 16, 27 and 29 have differentially expanded in Populus relative to Arabidopsis. Activator ARFs were found to be two fold-overrepresented in the Populus genome. PoptrIAA and PoptrARF gene families appear to have expanded due to high segmental and low tandem duplication events. Furthermore, expression studies showed that genes in the expanded PoptrIAA3 subgroup display differential expression. The gene-family analysis reported here will be useful in conducting future functional genomics studies to understand how the molecular roles of these large gene families translate into a diversity of biologically meaningful auxin effects.

  19. Mutational analysis of PKD1 gene in a Chinese family with autosomal dominant polycystic kidney disease.


    Liu, Jingyan; Li, Lanrong; Liu, Qingmin


    Autosomal dominant polycystic kidney disease (ADPKD) is a hereditary disease and common renal disease. Mutations of PKD genes are responsible for this disease. We analyzed a large Chinese family with ADPKD using Sanger sequencing to identify the mutation responsible for this disease. The family comprised 27 individuals including 10 ADPKD patients. These ADPKD patients had severe renal disease and most of them died very young. We analyzed 6 survival patients gene and found they all had C10529T mutation in exon 35 of PKD1 gene. We did not found gene mutation in any unaffected relatives or 300 unrelated controls. These findings suggested that the C10529T mutation in PKD1 gene might be the pathogenic mutation responsible for the disease in this family.

  20. Molecular Evolution and Expression Divergence of the Aconitase (ACO) Gene Family in Land Plants

    PubMed Central

    Wang, Yi-Ming; Yang, Qi; Liu, Yan-Jing; Yang, Hai-Ling


    Aconitase (ACO) is a key enzyme that catalyzes the isomerization of citrate to isocitrate in the tricarboxylic acid (TCA) and glyoxylate cycles. The function of ACOs has been well studied in model plants, such as Arabidopsis. In contrast, the evolutionary patterns of the ACO family in land plants are poorly understood. In this study, we systematically examined the molecular evolution and expression divergence of the ACO gene family in 12 land plant species. Thirty-six ACO genes were identified from the 12 land plant species representing the four major land plant lineages: Bryophytes, lycophytes, gymnosperms, and angiosperms. All of these ACOs belong to the cytosolic isoform. Three gene duplication events contributed to the expansion of the ACO family in angiosperms. The ancestor of angiosperms may have contained only one ACO gene. One gene duplication event split angiosperm ACOs into two distinct clades. Two clades showed a divergence in selective pressure and gene expression patterns. The cis-acting elements that function in light responsiveness were most abundant in the promoter region of the ACO genes, indicating that plant ACO genes might participate in light regulatory pathways. Our findings provide comprehensive insights into the ACO gene family in land plants. PMID:28018410

  1. Genome-wide identification, characterization, and expression analysis of the MLO gene family in Cucumis sativus.


    Zhou, S J; Jing, Z; Shi, J L


    Mildew resistance locus o (MLO) is a plant-specific seven-transmembrane (TM) gene family. Several studies have revealed that certain members of the MLO gene family mediate powdery mildew susceptibility in three plant species, namely, Arabidopsis, barley, and tomato. The sequenced cucumber genome provides an opportunity to conduct a comprehensive overview of the MLO gene family. Fourteen genes (designated CsMLO01 through CsMLO14) have been identified within the Cucumis sativus genome by using an in silico cloning method with the MLO amino acid sequences of Arabidopsis thaliana and rice as probes. Sequence alignment revealed that numerous features of the gene family, such as TMs, a calmodulin-binding domain, peptide domains I and II, and 30 important amino acid residues for MLO function, are well conserved. Phylogenetic analysis of the MLO genes from cucumber and other plant species reveals seven different clades (I through VII). Three of these clades comprised MLO genes from A. thaliana, rice, maize, and cucumber, suggesting that these genes may have evolved after the divergence of monocots and dicots. In silico mapping showed that these CsMLOs were located on chromosomes 1, 2, 3, 4, 5, and 6 without any obvious clustering, except CsMLO01. To our knowledge, this paper is the first comprehensive report on MLO genes in C. sativus. These findings will facilitate the functional characterization of the MLOs related to powdery mildew susceptibility and assist in the development of disease resistance in cucumber.

  2. Structure of the omega-gliadin gene family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The '-gliadins are one of the classes of wheat seed storage proteins, but are the least characterized. In this report, an analysis is made of all available '-gliadin DNA sequences including '-gliadins genes within a large genomic clone, previously reported gene sequences, and ESTs identified from th...

  3. Gene-Environment Interplay, Family Relationships, and Child Adjustment

    ERIC Educational Resources Information Center

    Horwitz, Briana N.; Neiderhiser, Jenae M.


    This paper reviews behavioral genetic research from the past decade that has moved beyond simply studying the independent influences of genes and environments. The studies considered in this review have instead focused on understanding gene-environment interplay, including genotype-environment correlation (rGE) and genotype x environment…

  4. Characterization and Functional Analysis of PEBP Family Genes in Upland Cotton (Gossypium hirsutum L.)

    PubMed Central

    Wang, Congcong; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Song, Meizhen; Fan, Shuli; Yu, Shuxun


    Upland cotton (Gossypium hirsutum L.) is a naturally occurring photoperiod-sensitive perennial plant species. However, sensitivity to the day length was lost during domestication. The phosphatidylethanolamine-binding protein (PEBP) gene family, of which three subclades have been identified in angiosperms, functions to promote and suppress flowering in photoperiod pathway. Recent evidence indicates that PEBP family genes play an important role in generating mobile flowering signals. We isolated homologues of the PEBP gene family in upland cotton and examined their regulation and function. Nine PEBP-like genes were cloned and phylogenetic analysis indicated the genes belonged to four subclades (FT, MFT, TFL1 and PEBP). Cotton PEBP-like genes showed distinct expression patterns in relation to different cotton genotypes, photoperiod responsive and cultivar maturity. The GhFT gene expression of a semi-wild race of upland cotton were strongly induced under short day condition, whereas the GhPEBP2 gene expression was induced under long days. We also elucidated that GhFT but not GhPEBP2 interacted with FD-like bZIP transcription factor GhFD and promote flowering under both long- and short-day conditions. The present result indicated that GhPEBP-like genes may perform different functions. This work corroborates the involvement of PEBP-like genes in photoperiod response and regulation of flowering time in different cotton genotypes, and contributes to an improved understanding of the function of PEBP-like genes in cotton. PMID:27552108

  5. Familial migraine: Exclusion of the susceptibility gene from the reported locus of familial hemiplegic migraine on 19p

    SciTech Connect

    Hovatta, I.; Peltonen, L.; Kallela, M.; Faerkkilae, M.


    Genetic isolates are highly useful in analyses of the molecular background of complex diseases since the enrichment of a limited number of predisposing genes can be predicted in representative families or in specific geographical regions. It has been suggested that the pathophysiology and etiology of familial hemiplegic migraine (FHM) and typical migraine with aura are most probably the same. Recent assignment of FHM locus to chromosome 19p in two French families makes it now possible to test this hypothesis. We report here linkage data on four families with multiple cases of migraine disorder originating from the genetically isolated population of Finland. We were interested to discover whether the migraine in these families would also show linkage to the markers on 19p. We could exclude a region of 50 cM, flanking the reported FHM locus, as a site of migraine locus in our four families. It seems evident that locus heterogeneity exists between different diagnostic classes of migraine spectrum of diseases and also between different ethnic groups. 10 refs., 2 figs., 1 tab.

  6. A new member of the plasma protease inhibitor gene family.

    PubMed Central

    Ragg, H


    A 2.1-kb cDNA clone representing a new member of the protease inhibitor family was isolated from a human liver cDNA library. The inhibitor, named human Leuserpin 2 (hLS2), comprises 480 amino acids and contains a leucine residue at its putative reactive center. HLS2 is about 25-28% homologous to three human members of the plasma protease inhibitor family: antithrombin III, alpha 1-antitrypsin and alpha 1-antichymotrypsin. A comparison with published partial amino acid sequences shows that hLS2 is closely related to the thrombin inhibitor heparin cofactor II. Images PMID:3003690

  7. Duplication of OsHAP family genes and their association with heading date in rice.


    Li, Qiuping; Yan, Wenhao; Chen, Huaxia; Tan, Cong; Han, Zhongmin; Yao, Wen; Li, Guangwei; Yuan, Mengqi; Xing, Yongzhong


    Heterotrimeric Heme Activator Protein (HAP) family genes are involved in the regulation of flowering in plants. It is not clear how many HAP genes regulate heading date in rice. In this study, we identified 35 HAP genes, including seven newly identified genes, and performed gene duplication and candidate gene-based association analyses. Analyses showed that segmental duplication and tandem duplication are the main mechanisms of HAP gene duplication. Expression profiling and functional identification indicated that duplication probably diversifies the functions of HAP genes. A nucleotide diversity analysis revealed that 13 HAP genes underwent selection. A candidate gene-based association analysis detected four HAP genes related to heading date. An investigation of transgenic plants or mutants of 23 HAP genes confirmed that overexpression of at least four genes delayed heading date under long-day conditions, including the previously cloned Ghd8/OsHAP3H. Our results indicate that the large number of HAP genes in rice was mainly produced by gene duplication, and a few HAP genes function to regulate heading date. Selection of HAP genes is probably caused by their diverse functions rather than regulation of heading.

  8. Evolutionary Dynamics of the Interferon-Induced Transmembrane Gene Family in Vertebrates

    PubMed Central

    Zhang, Zhao; Liu, Jun; Li, Meng; Yang, Hui; Zhang, Chiyu


    Vertebrate interferon-induced transmembrane (IFITM) genes have been demonstrated to have extensive and diverse functions, playing important roles in the evolution of vertebrates. Despite observance of their functionality, the evolutionary dynamics of this gene family are complex and currently unknown. Here, we performed detailed evolutionary analyses to unravel the evolutionary history of the vertebrate IFITM family. A total of 174 IFITM orthologous genes and 112 pseudogenes were identified from 27 vertebrate genome sequences. The vertebrate IFITM family can be divided into immunity-related IFITM (IR-IFITM), IFITM5 and IFITM10 sub-families in phylogeny, implying origins from three different progenitors. In general, vertebrate IFITM genes are located in two loci, one containing the IFITM10 gene, and the other locus containing IFITM5 and various numbers of IR-IFITM genes. Conservation of evolutionary synteny was observed in these IFITM genes. Significant functional divergence was detected among the three IFITM sub-families. No gene duplication or positive selection was found in IFITM5 sub-family, implying the functional conservation of IFITM5 in vertebrate evolution, which is involved in bone formation. No IFITM5 locus was identified in the marmoset genome, suggesting a potential association with the tiny size of this monkey. The IFITM10 sub-family was divided into two groups: aquatic and terrestrial types. Functional divergence was detected between the two groups, and five IFITM10-like genes from frog were dispersed into the two groups. Both gene duplication and positive selection were observed in aquatic vertebrate IFITM10-like genes, indicating that IFITM10 might be associated with the adaptation to aquatic environments. A large number of lineage- and species-specific gene duplications were observed in IR-IFITM sub-family and positive selection was detected in IR-IFITM of primates and rodents. Because primates have experienced a long history of viral infection

  9. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    PubMed Central

    Futas, Jan; Horin, Petr


    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  10. Natural killer cell receptor genes in the family Equidae: not only Ly49.


    Futas, Jan; Horin, Petr


    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  11. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    PubMed Central

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping


    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  12. Variation in the nucleotide sequence of a prolamin gene family in wild rice.


    Barbier, P; Ishihama, A


    Variation in the DNA sequence of the 10 kDa prolamin gene family within the wild rice species Oryza rufipogon was probed using the direct sequencing of PCR-amplified genes. A comparison of the nucleotide and deduced amino-acid sequences of eight Asian strains of O. rufipogon and one strain of the related African species O. longistaminata is presented.

  13. Genome-wide identification and phylogenetic analysis of the SBP-box gene family in melons.


    Ma, Y; Guo, J W; Bade, R; Men, Z H; Hasi, A


    The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants, including green algae, moss, silver birch, snapdragon, Arabidopsis, rice, and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in melon. Using the highly conserved sequence of the Arabidopsis thaliana SBP-box domain protein as a probe of information sequence, the genome-wide protein database of melon was explored to obtain 13 SBP-box protein sequences, which were further divided into 4 groups, based on phylogenetic analysis. A further analysis centered on the melon SBP-box genetic family's phylogenetic evolution, sequence similarities, gene structure, and miR156 target sequence was also conducted. Analysis of all the expression patterns of melon SBP-box family genes showed that the SBP-box genes were detected in 7 kinds of tissue, and fruit had the highest expression level. CmSBP11 tends to present its specific expression in melon fruit and root. CmSBP09 expression was the highest in flower. Overall, the molecular evolution and expression pattern of the melon SBP-box gene family, revealed by these results, suggest its function differentiation that followed gene duplication.

  14. Cloning and expression analysis of novel Aux/IAA family genes in Gossypium hirsutum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Members of the auxin/indole-3-acetic acid (Aux/IAA) gene family encode proteins to mediate the responses of auxin gene expression and to regulate various aspects of plant morphological development. In this paper, we report the identification of nine cDNAs that contain complete open reading frame (OR...

  15. Comparative Genome-Wide Analysis of the Malate Dehydrogenase Gene Families in Cotton

    PubMed Central

    Imran, Muhammad; Tang, Kai; Liu, Jin-Yuan


    Malate dehydrogenases (MDHs) play crucial roles in the physiological processes of plant growth and development. In this study, 13 and 25 MDH genes were identified from Gossypium raimondii and Gossypium hirsutum, respectively. Using these and 13 previously reported Gossypium arboretum MDH genes, a comparative molecular analysis between identified MDH genes from G. raimondii, G. hirsutum, and G. arboretum was performed. Based on multiple sequence alignments, cotton MDHs were divided into five subgroups: mitochondrial MDH, peroxisomal MDH, plastidial MDH, chloroplastic MDH and cytoplasmic MDH. Almost all of the MDHs within the same subgroup shared similar gene structure, amino acid sequence, and conserved motifs in their functional domains. An analysis of chromosomal localization suggested that segmental duplication played a major role in the expansion of cotton MDH gene families. Additionally, a selective pressure analysis indicated that purifying selection acted as a vital force in the evolution of MDH gene families in cotton. Meanwhile, an expression analysis showed the distinct expression profiles of GhMDHs in different vegetative tissues and at different fiber developmental stages, suggesting the functional diversification of these genes in cotton growth and fiber development. Finally, a promoter analysis indicated redundant but typical cis-regulatory elements for the potential functions and stress activity of many MDH genes. This study provides fundamental information for a better understanding of cotton MDH gene families and aids in functional analyses of the MDH genes in cotton fiber development. PMID:27829020

  16. Evolution of the insect desaturase gene family with an emphasis on social Hymenoptera.


    Helmkampf, Martin; Cash, Elizabeth; Gadau, Jürgen


    Desaturase genes are essential for biological processes, including lipid metabolism, cell signaling, and membrane fluidity regulation. Insect desaturases are particularly interesting for their role in chemical communication, and potential contribution to speciation, symbioses, and sociality. Here, we describe the acyl-CoA desaturase gene families of 15 insects, with a focus on social Hymenoptera. Phylogenetic reconstruction revealed that the insect desaturases represent an ancient gene family characterized by eight subfamilies that differ strongly in their degree of conservation and frequency of gene gain and loss. Analyses of genomic organization showed that five of these subfamilies are represented in a highly microsyntenic region conserved across holometabolous insect taxa, indicating an ancestral expansion during early insect evolution. In three subfamilies, ants exhibit particularly large expansions of genes. Despite these expansions, however, selection analyses showed that desaturase genes in all insect lineages are predominantly undergoing strong purifying selection. Finally, for three expanded subfamilies, we show that ants exhibit variation in gene expression between species, and more importantly, between sexes and castes within species. This suggests functional differentiation of these genes and a role in the regulation of reproductive division of labor in ants. The dynamic pattern of gene gain and loss of acyl-CoA desaturases in ants may reflect changes in response to ecological diversification and an increased demand for chemical signal variability. This may provide an example of how gene family expansions can contribute to lineage-specific adaptations through structural and regulatory changes acting in concert to produce new adaptive phenotypes.

  17. The Classical Arabinogalactan Protein Gene Family of Arabidopsis

    PubMed Central

    Schultz, Carolyn J.; Johnson, Kim L.; Currie, Graeme; Bacic, Antony


    Arabinogalactan proteins (AGPs) are extracellular proteoglycans implicated in plant growth and development. We searched for classical AGPs in Arabidopsis by identifying expressed sequence tags based on the conserved domain structure of the predicted protein backbone. To confirm that these genes encoded bona fide AGPs, we purified native AGPs and then deglycosylated and deblocked them for N-terminal protein sequencing. In total, we identified 15 genes encoding the protein backbones of classical AGPs, including genes for AG peptides—AGPs with very short backbones (10 to 13 amino acid residues). Seven of the AGPs were verified as AGPs by protein sequencing. A gene encoding a putative cell adhesion molecule with AGP-like domains was also identified. This work provides a firm foundation for beginning functional analysis by using a genetic approach. PMID:11006345

  18. Interferon induced IFIT family genes in host antiviral defense

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IF stimulated ...

  19. The Wall-associated Kinase gene family in rice genomes.


    de Oliveira, Luiz Felipe Valter; Christoff, Ana Paula; de Lima, Júlio Cesar; de Ross, Bruno Comparsi Feijó; Sachetto-Martins, Gilberto; Margis-Pinheiro, Marcia; Margis, Rogerio


    The environment is a dynamic system in which life forms adapt. Wall-Associated Kinases (WAK) are a subfamily of receptor-like kinases associated with the cell wall. These genes have been suggested as sensors of the extracellular environment and triggers of intracellular signals. They belong to the ePK superfamily with or without a conserved arginine before the catalytic subdomain VIB, which characterizes RD and non-RD WAKs. WAK is a large subfamily in rice. We performed an extensive comparison of WAK genes from A. thaliana (AtWAK), O. sativa japonica and indica subspecies (OsWAK). Phylogenetic studies and WAK domain characterization allowed for the identification of two distinct groups of WAK genes in Arabidopsis and rice. One group corresponds to a cluster containing only OsWAKs that most likely expanded after the monocot-dicot separation, which evolved into a non-RD kinase class. The other group comprises classical RD-kinases with both AtWAK and OsWAK representatives. Clusterization analysis using extracellular and kinase domains demonstrated putative functional redundancy for some genes, but also highlighted genes that could recognize similar extracellular stimuli and activate different cascades. The gene expression pattern of WAKs in response to cold suggests differences in the regulation of the OsWAK genes in the indica and japonica subspecies. Our results also confirm the hypothesis of functional diversification between A. thaliana and O. sativa WAK genes. Furthermore, we propose that plant WAKs constitute two evolutionarily related but independent subfamilies: WAK-RD and WAK-nonRD. Recognition of this structural division will further provide insights to understanding WAK functions and regulations.

  20. Atypical Protein Phosphatase 2A Gene Families Do Not Expand via Paleopolyploidization1[OPEN

    PubMed Central


    Protein phosphatase 2A (PP2A) presents unique opportunities for analyzing molecular mechanisms of functional divergence between gene family members. The canonical PP2A holoenzyme regulates multiple eukaryotic signaling pathways by dephosphorylating target proteins and contains a catalytic (C) subunit, a structural/scaffolding (A) subunit, and a regulatory (B) subunit. Genes encoding PP2A subunits have expanded into multigene families in both flowering plants and mammals, and the extent to which different isoform functions may overlap is not clearly understood. To gain insight into the diversification of PP2A subunits, we used phylogenetic analyses to reconstruct the evolutionary histories of PP2A gene families in Arabidopsis (Arabidopsis thaliana). Genes encoding PP2A subunits in mammals represent ancient lineages that expanded early in vertebrate evolution, while flowering plant PP2A subunit lineages evolved much more recently. Despite this temporal difference, our data indicate that the expansion of PP2A subunit gene families in both flowering plants and animals was driven by whole-genome duplications followed by nonrandom gene loss. Selection analysis suggests that the expansion of one B subunit gene family (B56/PPP2R5) was driven by functional diversification rather than by the maintenance of gene dosage. We also observed reduced expansion rates in three distinct B subunit subclades. One of these subclades plays a highly conserved role in cell division, while the distribution of a second subclade suggests a specialized function in supporting beneficial microbial associations. Thus, while whole-genome duplications have driven the expansion and diversification of most PP2A gene families, members of functionally specialized subclades quickly revert to singleton status after duplication events. PMID:28034953

  1. Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases

    PubMed Central

    Shiu, Shin-Han; Bleecker, Anthony B.


    Plant receptor-like kinases (RLKs) are proteins with a predicted signal sequence, single transmembrane region, and cytoplasmic kinase domain. Receptor-like kinases belong to a large gene family with at least 610 members that represent nearly 2.5% of Arabidopsis protein coding genes. We have categorized members of this family into subfamilies based on both the identity of the extracellular domains and the phylogenetic relationships between the kinase domains of subfamily members. Surprisingly, this structurally defined group of genes is monophyletic with respect to kinase domains when compared with the other eukaryotic kinase families. In an extended analysis, animal receptor kinases, Raf kinases, plant RLKs, and animal receptor tyrosine kinases form a well supported group sharing a common origin within the superfamily of serine/threonine/tyrosine kinases. Among animal kinase sequences, Drosophila Pelle and related cytoplasmic kinases fall within the plant RLK clade, which we now define as the RLK/Pelle family. A survey of expressed sequence tag records for land plants reveals that mosses, ferns, conifers, and flowering plants have similar percentages of expressed sequence tags representing RLK/Pelle homologs, suggesting that the size of this gene family may have been close to the present-day level before the diversification of land plant lineages. The distribution pattern of four RLK subfamilies on Arabidopsis chromosomes indicates that the expansion of this gene family is partly a consequence of duplication and reshuffling of the Arabidopsis genome and of the generation of tandem repeats. PMID:11526204

  2. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.


    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  3. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    PubMed Central

    Møller, Rikke S.; Larsen, Line H.G.; Johannesen, Katrine M.; Talvik, Inga; Talvik, Tiina; Vaher, Ulvi; Miranda, Maria J.; Farooq, Muhammad; Nielsen, Jens E.K.; Svendsen, Lene Lavard; Kjelgaard, Ditte B.; Linnet, Karen M.; Hao, Qin; Uldall, Peter; Frangu, Mimoza; Tommerup, Niels; Baig, Shahid M.; Abdullah, Uzma; Born, Alfred P.; Gellert, Pia; Nikanorova, Marina; Olofsson, Kern; Jepsen, Birgit; Marjanovic, Dragan; Al-Zehhawi, Lana I.K.; Peñalva, Sofia J.; Krag-Olsen, Bente; Brusgaard, Klaus; Hjalgrim, Helle; Rubboli, Guido; Pal, Deb K.; Dahl, Hans A.


    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis of a wide spectrum of epilepsies with age of onset spanning from the neonatal period to adulthood. A gene panel targeting 46 epilepsy genes was used on a cohort of 216 patients consecutively referred for panel testing. The patients had a range of different epilepsies from benign neonatal seizures to epileptic encephalopathies (EEs). Potentially causative variants were evaluated by literature and database searches, submitted to bioinformatic prediction algorithms, and validated by Sanger sequencing. If possible, parents were included for segregation analysis. We identified a presumed disease-causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared to 17% among patients with generalized epilepsies and 16% in patients with focal or multifocal epilepsies. By the use of a gene panel consisting of 46 epilepsy genes, we were able to find a disease-causing genetic variation in 23% of the analyzed patients. The highest yield was found among patients with neonatal-onset epilepsies and EEs. PMID:27781031

  4. "External Conditions Affecting a Harmonious Family": Lessons Learned from a School-Based Parent Education Programme in Hong Kong

    ERIC Educational Resources Information Center

    Luk-Fong, Pattie Yuk Yee


    This article documents a parent education presentation on "External conditions affecting a harmonious family" within a school-based parent education programme in Hong Kong. The presentation adopted an eco-systems approach for understanding families and argued for the need to include the external conditions for a harmonious family as an…

  5. Implementing a Conditional Cash Transfer Program in Two American Cities: Early Lessons from Family Rewards 2.0

    ERIC Educational Resources Information Center

    Dechausay, Nadine; Miller, Cynthia; Quiroz-Becerra, Victoria


    In 2007, New York City launched the first test of a conditional cash transfer program in the United States. Called Family Rewards, the program sought to break the intergenerational cycle of poverty by offering cash assistance to poor families to reduce immediate hardship, but conditioned this assistance on families' efforts to improve their…

  6. Identification of a new, unorthodox member of the MAGE gene family.


    Põld, M; Zhou, J; Chen, G L; Hall, J M; Vescio, R A; Berenson, J R


    Several tumor-associated antigen families, such as MAGE, GAGE/PAGE, PRAME, BAGE, and LAGE/NY-ESO-1, exist. These antigens are of particular interest in tumor immunology, because their expression, with exception of testis and fetal tissues, seems to be restricted to tumor cells only. We have identified a novel member of the MAGE gene family, MAGED1. Northern hybridization and RT-PCR demonstrated that the expression level of MAGED1 in different normal adult tissues is comparable to that in testis and fetal liver. Thus, MAGED1 does not possess an expression pattern characteristic of previously identified MAGE family genes, suggesting that the biology of the MAGE-family genes is more complex than previously thought. Chromosome mapping linked MAGED1 to marker AFM119xd6 (DXS1039) on chromosome Xp11.23.

  7. The SOD Gene Family in Tomato: Identification, Phylogenetic Relationships, and Expression Patterns.


    Feng, Kun; Yu, Jiahong; Cheng, Yuan; Ruan, Meiying; Wang, Rongqing; Ye, Qingjing; Zhou, Guozhi; Li, Zhimiao; Yao, Zhuping; Yang, Yuejian; Zheng, Qingsong; Wan, Hongjian


    Superoxide dismutases (SODs) are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS) caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L.) is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  8. The SOD Gene Family in Tomato: Identification, Phylogenetic Relationships, and Expression Patterns

    PubMed Central

    Feng, Kun; Yu, Jiahong; Cheng, Yuan; Ruan, Meiying; Wang, Rongqing; Ye, Qingjing; Zhou, Guozhi; Li, Zhimiao; Yao, Zhuping; Yang, Yuejian; Zheng, Qingsong; Wan, Hongjian


    Superoxide dismutases (SODs) are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS) caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L.) is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants. PMID:27625661

  9. Characterization of three members of the ACC synthase gene family in Solanum tuberosum L.


    Destéfano-Beltrán, L J; van Caeneghem, W; Gielen, J; Richard, L; van Montagu, M; van der Straeten, D


    Two genomic clones corresponding to three members of the 1-aminocyclopropane-1-carboxylic acid (ACC) synthase gene family in potato (Solanum tuberosum L.) have been isolated and sequenced. Two highly homologous genes, ST-ACS1A and ST-ACS1B, transcribed in opposite directions were found in an 8.9 kb region. Their coding sequences are interrupted by two introns at identical positions. Their closest relative in tomato is the LE-ACS3 gene. The third gene in potato, ST-ACS2, was found in a 4 kb region and shows a gene structure similar to that of the tomato LE-ACS4 gene and to the mung bean VR-ACS4 and VR-ACS5 genes. Based on its lack of significant homology to the tomato gene family and its closeness to the VR-ACS4 and VR-ACS5 genes, we propose that LE-ACS7 represents an additional isoform in the tomato genome. Moreover, in a phylogenetic comparison of known ACC synthases, the ST-ACS2 isoform was grouped in a separate lineage together with the mung bean VR-ACS4 and VR-ACS5, and the moth orchid DS-ACS1A and DS-ACS1B gene products. Expression of the three potato genes was studied by reverse transcription-polymerase chain reaction on total RNA. The twin genes are positively regulated by indole-3-acetic acid in hypocotyls and expression is modulated by wounding in the leaves. The third gene is responsive to ethylene and wounding mainly in tubers. The roles of these three genes and of other members of the ACC synthase gene family in vegetative processes of potato such as tuberization, dormancy, and sprouting have yet to be determined.

  10. High Gene Family Turnover Rates and Gene Space Adaptation in the Compact Genome of the Carnivorous Plant Utricularia gibba.


    Carretero-Paulet, Lorenzo; Librado, Pablo; Chang, Tien-Hao; Ibarra-Laclette, Enrique; Herrera-Estrella, Luis; Rozas, Julio; Albert, Victor A


    Utricularia gibba is an aquatic carnivorous plant with highly specialized morphology, featuring fibrous floating networks of branches and leaf-like organs, no recognizable roots, and bladder traps that capture and digest prey. We recently described the compressed genome of U. gibba as sufficient to control the development and reproduction of a complex organism. We hypothesized intense deletion pressure as a mechanism whereby most noncoding DNA was deleted, despite evidence for three independent whole-genome duplications (WGDs). Here, we explore the impact of intense genome fractionation in the evolutionary dynamics of U. gibba's functional gene space. We analyze U. gibba gene family turnover by modeling gene gain/death rates under a maximum-likelihood statistical framework. In accord with our deletion pressure hypothesis, we show that the U. gibba gene death rate is significantly higher than those of four other eudicot species. Interestingly, the gene gain rate is also significantly higher, likely reflecting the occurrence of multiple WGDs and possibly also small-scale genome duplications. Gene ontology enrichment analyses of U. gibba-specific two-gene orthogroups, multigene orthogroups, and singletons highlight functions that may represent adaptations in an aquatic carnivorous plant. We further discuss two homeodomain transcription factor gene families (WOX and HDG/HDZIP-IV) showing conspicuous differential expansions and contractions in U. gibba. Our results 1) reconcile the compactness of the U. gibba genome with its accommodation of a typical number of genes for a plant genome, and 2) highlight the role of high gene family turnover in the evolutionary diversification of U. gibba's functional gene space and adaptations to its unique lifestyle and highly specialized body plan.

  11. The ZIC gene family encodes multi-functional proteins essential for patterning and morphogenesis.


    Houtmeyers, Rob; Souopgui, Jacob; Tejpar, Sabine; Arkell, Ruth


    The zinc finger of the cerebellum gene (ZIC) discovered in Drosophila melanogaster (odd-paired) has five homologs in Xenopus, chicken, mice, and humans, and seven in zebrafish. This pattern of gene copy expansion is accompanied by a divergence in gene and protein structure, suggesting that Zic family members share some, but not all, functions. ZIC genes are implicated in neuroectodermal development and neural crest cell induction. All share conserved regions encoding zinc finger domains, however their heterogeneity and specification remain unexplained. In this review, the evolution, structure, and expression patterns of the ZIC homologs are described; specific functions attributable to individual family members are supported. A review of data from functional studies in Xenopus and murine models suggest that ZIC genes encode multifunctional proteins operating in a context-specific manner to drive critical events during embryogenesis. The identification of ZIC mutations in congenital syndromes highlights the relevance of these genes in human development.

  12. Polymorphism and selection in the major histocompatibility complex DRA and DQA genes in the family Equidae.


    Janova, Eva; Matiasovic, Jan; Vahala, Jiri; Vodicka, Roman; Van Dyk, Enette; Horin, Petr


    The major histocompatibility complex genes coding for antigen binding and presenting molecules are the most polymorphic genes in the vertebrate genome. We studied the DRA and DQA gene polymorphism of the family Equidae. In addition to 11 previously reported DRA and 24 DQA alleles, six new DRA sequences and 13 new DQA alleles were identified in the genus Equus. Phylogenetic analysis of both DRA and DQA sequences provided evidence for trans-species polymorphism in the family Equidae. The phylogenetic trees differed from species relationships defined by standard taxonomy of Equidae and from trees based on mitochondrial or neutral gene sequence data. Analysis of selection showed differences between the less variable DRA and more variable DQA genes. DRA alleles were more often shared by more species. The DQA sequences analysed showed strong amongst-species positive selection; the selected amino acid positions mostly corresponded to selected positions in rodent and human DQA genes.

  13. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).


    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui


    In higher plants, sucrose synthase (Sus, EC is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  14. From manual curation to visualization of gene families and networks across Solanaceae plant species.


    Pujar, Anuradha; Menda, Naama; Bombarely, Aureliano; Edwards, Jeremy D; Strickler, Susan R; Mueller, Lukas A


    High-quality manual annotation methods and practices need to be scaled to the increased rate of genomic data production. Curation based on gene families and gene networks is one approach that can significantly increase both curation efficiency and quality. The Sol Genomics Network (SGN; is a comparative genomics platform, with genetic, genomic and phenotypic information of the Solanaceae family and its closely related species that incorporates a community-based gene and phenotype curation system. In this article, we describe a manual curation system for gene families aimed at facilitating curation, querying and visualization of gene interaction patterns underlying complex biological processes, including an interface for efficiently capturing information from experiments with large data sets reported in the literature. Well-annotated multigene families are useful for further exploration of genome organization and gene evolution across species. As an example, we illustrate the system with the multigene transcription factor families, WRKY and Small Auxin Up-regulated RNA (SAUR), which both play important roles in responding to abiotic stresses in plants. Database URL:

  15. Duplications and losses in gene families of rust pathogens highlight putative effectors

    PubMed Central

    Pendleton, Amanda L.; Smith, Katherine E.; Feau, Nicolas; Martin, Francis M.; Grigoriev, Igor V.; Hamelin, Richard; Nelson, C. Dana; Burleigh, J. Gordon; Davis, John M.


    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity. PMID:25018762

  16. Conservation and diversity of gene families explored using the CODEHOP strategy in higher plants

    PubMed Central

    Morant, Marc; Hehn, Alain; Werck-Reichhart, Danièle


    Background Availability of genomewide information on an increasing but still limited number of plants offers the possibility of identifying orthologues, or related genes, in species with major economical impact and complex genomes. In this paper we exploit the recently described CODEHOP primer design and PCR strategy for targeted isolation of homologues in large gene families. Results The method was tested with two different objectives. The first was to analyze the evolution of the CYP98 family of cytochrome P450 genes involved in 3-hydroxylation of phenolic compounds and lignification in a broad range of plant species. The second was to isolate an orthologue of the sorghum glucosyl transferase UGT85B1 and to determine the complexity of the UGT85 family in wheat. P450s of the CYP98 family or closely related sequences were found in all vascular plants. No related sequence was found in moss. Neither extensive duplication of the CYP98 genes nor an orthologue of UGT85B1 were found in wheat. The UGT85A subfamily was however found to be highly variable in wheat. Conclusions Our data are in agreement with the implication of CYP98s in lignification and the evolution of 3-hydroxylation of lignin precursors with vascular plants. High conservation of the CYP98 family strongly argues in favour of an essential function in plant development. Conversely, high duplication and diversification of the UGT85A gene family in wheat suggests its involvement in adaptative response and provides a valuable pool of genes for biotechnological applications. This work demonstrates the high potential of the CODEHOP strategy for the exploration of large gene families in plants. PMID:12153706

  17. Identification and expression of nor efflux family genes in Staphylococcus epidermidis that act against gatifloxacin.


    Juárez-Verdayes, Marco A; Parra-Ortega, Berenice; Hernández-Rodríguez, César; Betanzos-Cabrera, Gabriel; Rodríguez-Martínez, Sandra; Cancino-Diaz, Mario E; Cancino-Diaz, Juan C


    NorA, NorB, and NorC are efflux proteins in the Nor family that regulate the secretion of fluoroquinolones, and MgrA/NorR is a transcription factor of the Nor family. Overexpression of Nor family proteins provides fluoroquinolone resistance in Staphylococcus aureus. However, in coagulase-negative staphylococci (CNS), members of the Nor family had not been identified. In this work, the presence of Nor family proteins in Staphylococcus spp. and the expression of Nor family in gatifloxacin resistant S. epidermidis strains obtained from ocular infections (OI) were identified and analyzed. S. epidermidis strains from OIs (n = 44) and healthy skin (HS; n = 52) were isolated. The nor family genes were identified in CNS using PCR, sequencing and phylogenetic approaches. Nor family expression was determined by RT-PCR. NorA efflux activity was determined using the automated ethidium bromide method. In-silico analysis showed that norA, mgrA/norR, and "norB-like" and "norC-like" (norB/norC) genes are present in CNS. The nor family genes were distributed and constitutively expressed in all S. epidermidis strains studied. In one gatifloxacin resistant strain isolated from the endophthalmitis, treatment with gatifloxacin induced overexpression of the norA gene and resulted in high activity of NorA efflux. These results indicate that the Nor family of proteins is present in CNS, and the NorA efflux mechanism for gatifloxacin response occurs in at least one strain of S. epidermidis, contributing to gatifloxacin resistance.

  18. Comparative genome analysis of lignin biosynthesis gene families across the plant kingdom

    PubMed Central


    Background As a major component of plant cell wall, lignin plays important roles in mechanical support, water transport, and stress responses. As the main cause for the recalcitrance of plant cell wall, lignin modification has been a major task for bioenergy feedstock improvement. The study of the evolution and function of lignin biosynthesis genes thus has two-fold implications. First, the lignin biosynthesis pathway provides an excellent model to study the coordinative evolution of a biochemical pathway in plants. Second, understanding the function and evolution of lignin biosynthesis genes will guide us to develop better strategies for bioenergy feedstock improvement. Results We analyzed lignin biosynthesis genes from fourteen plant species and one symbiotic fungal species. Comprehensive comparative genome analysis was carried out to study the distribution, relatedness, and family expansion of the lignin biosynthesis genes across the plant kingdom. In addition, we also analyzed the comparative synteny map between rice and sorghum to study the evolution of lignin biosynthesis genes within the Poaceae family and the chromosome evolution between the two species. Comprehensive lignin biosynthesis gene expression analysis was performed in rice, poplar and Arabidopsis. The representative data from rice indicates that different fates of gene duplications exist for lignin biosynthesis genes. In addition, we also carried out the biomass composition analysis of nine Arabidopsis mutants with both MBMS analysis and traditional wet chemistry methods. The results were analyzed together with the genomics analysis. Conclusion The research revealed that, among the species analyzed, the complete lignin biosynthesis pathway first appeared in moss; the pathway is absent in green algae. The expansion of lignin biosynthesis gene families correlates with substrate diversity. In addition, we found that the expansion of the gene families mostly occurred after the divergence of monocots

  19. The ABC’s of Family Mealtimes: Observational Lessons for Promoting Healthy Outcomes for Children with Persistent Asthma

    PubMed Central

    Fiese, Barbara H.; Winter, Marcia A.; Botti, Joanna C.


    Shared family mealtimes have been identified as potential promoters of healthy child development. This observational study of 200 family mealtimes examined the relation between child health indicators in a group of children with persistent asthma and three dimensions of mealtime interaction: Action, Behavior Control, and Communication. Mealtimes lasted, on average, 18 minutes with a range of 2 to 47. Percent of time spent in Action and Positive Communication varied by asthma symptom severity and child quality of life as well as family socio-demographic variables (maternal education, child ethnicity, family structure). Stepwise regression analyses revealed that controlling for maternal education and overall general family functioning, positive communication during family mealtimes predicted child quality of life. Significant interactions between demographic variables and behavior control suggested that higher levels of behavior control affected child quality of life in the context of lower maternal education. Guidance is offered for practitioners and policymakers toward promoting healthy family mealtimes as a public health priority. PMID:21291433

  20. Evidence for Retrogene Origins of the Prion Gene Family

    PubMed Central

    Ehsani, Sepehr; Tao, Renzhu; Pocanschi, Cosmin L.; Ren, Hezhen; Harrison, Paul M.; Schmitt-Ulms, Gerold


    The evolutionary origin of prion genes, only known to exist in the vertebrate lineage, had remained elusive until recently. Following a lead from interactome investigations of the murine prion protein, our previous bioinformatic analyses revealed the evolutionary descent of prion genes from an ancestral ZIP metal ion transporter. However, the molecular mechanism of evolution remained unexplored. Here we present a computational investigation of this question based on sequence, intron-exon, synteny and pseudogene analyses. Our data suggest that during the emergence of metazoa, a cysteine-flanked core domain was modularly inserted, or arose de novo, in a preexisting ZIP ancestor gene to generate a prion-like ectodomain in a subbranch of ZIP genes. Approximately a half-billion years later, a genomic insertion of a spliced transcript coding for such a prion-like ZIP ectodomain may have created the prion founder gene. We document that similar genomic insertions involving ZIP transcripts, and probably relying on retropositional elements, have indeed occurred more than once throughout evolution. PMID:22046361

  1. Human T-cell receptor variable gene segment families

    SciTech Connect

    Arden, B.; Kabelitz, D.; Clark, S.P.; Mak, T.W.


    Multiple DNA and protein sequence alignments have been constructed for the human T-cell receptor {alpha}/{delta}, {beta}, and {gamma} (TCRA/D, B, and G) variable (V) gene segments. The traditional classification into subfamilies was confirmed using a much larger pool of sequences. For each sequence, a name was derived which complies with the standard nomenclature. The traditional numbering of V gene segments in the order of their discovery was continued and changed when in conflict with names of other segments. By discriminating between alleles at the same locus versus genes from different loci, we were able to reduce the number of more than 150 different TCRBV sequences in the database to a repertoire of only 47 functional TCRBV gene segments. An extension of this analysis to the over 100 TCRAV sequences results in a predicted repertoire of 42 functional TCRAV gene segments. Our alignment revealed two residues that distinguish between the highly homologous V{delta} and V{alpha}, one at a site that in V{sub H} contacts the constant region, the other at the interface between immunoglobulin V{sub H} and V{sub L}. This site may be responsible for restricted pairing between certain V{delta} and V{gamma} chains. On the other hand, V{beta} and V{gamma} appear to be related by the fact that their CDR2 length is increased by four residues as compared with that of V{alpha}/{delta} peptides. 150 refs., 12 figs., 5 tabs.

  2. Tandem repeat distribution of gene transcripts in three plant families

    PubMed Central


    Tandem repeats (microsatellites or SSRs) are molecular markers with great potential for plant genetic studies. Modern strategies include the transfer of these markers among widely studied and orphan species. In silico analyses allow for studying distribution patterns of microsatellites and predicting which motifs would be more amenable to interspecies transfer. Transcribed sequences (Unigene) from ten species of three plant families were surveyed for the occurrence of micro and minisatellites. Transcripts from different species displayed different rates of tandem repeat occurrence, ranging from 1.47% to 11.28%. Both similar and different patterns were found within and among plant families. The results also indicate a lack of association between genome size and tandem repeat fractions in expressed regions. The conservation of motifs among species and its implication on genome evolution and dynamics are discussed. PMID:21637460

  3. The Vertebrate RCAN Gene Family: Novel Insights into Evolution, Structure and Regulation

    PubMed Central

    Serrano-Candelas, Eva; Farré, Domènec; Aranguren-Ibáñez, Álvaro; Martínez-Høyer, Sergio; Pérez-Riba, Mercè


    Recently there has been much interest in the Regulators of Calcineurin (RCAN) proteins which are important endogenous modulators of the calcineurin-NFATc signalling pathway. They have been shown to have a crucial role in cellular programmes such as the immune response, muscle fibre remodelling and memory, but also in pathological processes such as cardiac hypertrophy and neurodegenerative diseases. In vertebrates, the RCAN family form a functional subfamily of three members RCAN1, RCAN2 and RCAN3 whereas only one RCAN is present in the rest of Eukarya. In addition, RCAN genes have been shown to collocate with RUNX and CLIC genes in ACD clusters (ACD21, ACD6 and ACD1). How the RCAN genes and their clustering in ACDs evolved is still unknown. After analysing RCAN gene family evolution using bioinformatic tools, we propose that the three RCAN vertebrate genes within the ACD clusters, which evolved from single copy genes present in invertebrates and lower eukaryotes, are the result of two rounds of whole genome duplication, followed by a segmental duplication. This evolutionary scenario involves the loss or gain of some RCAN genes during evolution. In addition, we have analysed RCAN gene structure and identified the existence of several characteristic features that can be involved in RCAN evolution and gene expression regulation. These included: several transposable elements, CpG islands in the 5′ region of the genes, the existence of antisense transcripts (NAT) associated with the three human genes, and considerable evidence for bidirectional promoters that regulate RCAN gene expression. Furthermore, we show that the CpG island associated with the RCAN3 gene promoter is unmethylated and transcriptionally active. All these results provide timely new insights into the molecular mechanisms underlying RCAN function and a more in depth knowledge of this gene family whose members are obvious candidates for the development of future therapies. PMID:24465593

  4. The banana E2 gene family: Genomic identification, characterization, expression profiling analysis.


    Dong, Chen; Hu, Huigang; Jue, Dengwei; Zhao, Qiufang; Chen, Hongliang; Xie, Jianghui; Jia, Liqiang


    The E2 is at the center of a cascade of Ub1 transfers, and it links activation of the Ub1 by E1 to its eventual E3-catalyzed attachment to substrate. Although the genome-wide analysis of this family has been performed in some species, little is known about analysis of E2 genes in banana. In this study, 74 E2 genes of banana were identified and phylogenetically clustered into thirteen subgroups. The predicted banana E2 genes were distributed across all 11 chromosomes at different densities. Additionally, the E2 domain, gene structure and motif compositions were analyzed. The expression of all of the banana E2 genes was analyzed in the root, stem, leaf, flower organs, five stages of fruit development and under abiotic stresses. All of the banana E2 genes, with the exception of few genes in each group, were expressed in at least one of the organs and fruit developments, which indicated that the E2 genes might involve in various aspects of the physiological and developmental processes of the banana. Quantitative RT-PCR (qRT-PCR) analysis identified that 45 E2s under drought and 33 E2s under salt were induced. To the best of our knowledge, this report describes the first genome-wide analysis of the banana E2 gene family, and the results should provide valuable information for understanding the classification, cloning and putative functions of this family.

  5. Analysis of the arabidopsis REM gene family predicts functions during flower development

    PubMed Central

    Mantegazza, Otho; Gregis, Veronica; Mendes, Marta Adelina; Morandini, Piero; Alves-Ferreira, Márcio; Patreze, Camila M.; Nardeli, Sarah M.; Kater, Martin M.; Colombo, Lucia


    Background and Aims The REM (Reproductive Meristem) gene family of Arabidopsis thaliana is part of the B3 DNA-binding domain superfamily. Despite the fact that several groups have worked on the REM genes for many years, little is known about the function of this transcription factor family. This study aims to identify a set of REM genes involved in flower development and to characterize their function. Methods In order to provide an overview of the REM gene family, a detailed expression analysis for all REM genes of A. thaliana was performed and combined with a meta-analysis of ChIP-sequencing and microarray experiments. Key Results Two sets of phylogenetically closely related REM genes, namely REM23, REM24 and REM25, and REM34, REM35 and REM36, were identified as possibly being involved in the early stages of flower development. Single- and double-mutant combinations were analysed for these genes, and no phenotypic effects were detected during flower development. Conclusions The data suggest that the REM34, REM35 and REM36 group is the most interesting one, as REM34 is co-expressed with the floral meristem identity (FMI) genes, they are bound by AP1, SVP, AP3 and PI, and they are expressed in the floral meristem and during the earliest stages of flower development. However, it appears that high levels of functional redundancy may conceal the exact function of these transcription factor genes. PMID:25002525

  6. Characterization of the laminin gene family and evolution in zebrafish.


    Sztal, Tamar; Berger, Silke; Currie, Peter D; Hall, Thomas E


    Laminins are essential components of all basement membranes and are fundamental to tissue development and homeostasis. Humans possess at least 16 different heterotrimeric laminin complexes formed through different combinations of alpha, beta, and gamma chains. Individual chains appear to exhibit unique expression patterns, leading to the notion that overlap between expression domains governs the constitution of complexes found within particular tissues. However, the spatial and temporal expression of laminin genes has not been comprehensively analyzed in any vertebrate model to date. Here, we describe the tissue-specific expression patterns of all laminin genes in the zebrafish, throughout embryonic development and into the "post-juvenile" period, which is representative of the adult body form. In addition, we present phylogenetic and microsynteny analyses, which demonstrate that the majority of our zebrafish sequences are orthologous to human laminin genes. Together, these data represent a fundamental resource for the study of vertebrate laminins.

  7. Fifteen million years of evolution in the Oryza genus shows extensive gene family expansion.


    Jacquemin, Julie; Ammiraju, Jetty S S; Haberer, Georg; Billheimer, Dean D; Yu, Yeisoo; Liu, Liana C; Rivera, Luis F; Mayer, Klaus; Chen, Mingsheng; Wing, Rod A


    In analyzing gene families in the whole-genome sequences available for O. sativa (AA), O. glaberrima (AA), and O. brachyantha (FF), we observed large size expansions in the AA genomes compared to FF genomes for the super-families F-box and NB-ARC, and five additional families: the Aspartic proteases, BTB/POZ proteins (BTB), Glutaredoxins, Trypsin α-amylase inhibitor proteins, and Zf-Dof proteins. Their evolutionary dynamic was investigated to understand how and why such important size variations are observed between these closely related species. We show that expansions resulted from both amplification, largely by tandem duplications, and contraction by gene losses. For the F-box and NB-ARC gene families, the genes conserved in all species were under strong purifying selection while expanded orthologous genes were under more relaxed purifying selection. In F-box, NB-ARC, and BTB, the expanded groups were enriched in genes with little evidence of expression, in comparison with conserved groups. We also detected 87 loci under positive selection in the expanded groups. These results show that most of the duplicated copies in the expanded groups evolve neutrally after duplication because of functional redundancy but a fraction of these genes were preserved following neofunctionalization. Hence, the lineage-specific expansions observed between Oryza species were partly driven by directional selection.

  8. Genome-Wide Identification of the Invertase Gene Family in Populus.


    Chen, Zhong; Gao, Kai; Su, Xiaoxing; Rao, Pian; An, Xinmin


    Invertase plays a crucial role in carbohydrate partitioning and plant development as it catalyses the irreversible hydrolysis of sucrose into glucose and fructose. The invertase family in plants is composed of two sub-families: acid invertases, which are targeted to the cell wall and vacuole; and neutral/alkaline invertases, which function in the cytosol. In this study, 5 cell wall invertase genes (PtCWINV1-5), 3 vacuolar invertase genes (PtVINV1-3) and 16 neutral/alkaline invertase genes (PtNINV1-16) were identified in the Populus genome and found to be distributed on 14 chromosomes. A comprehensive analysis of poplar invertase genes was performed, including structures, chromosome location, phylogeny, evolutionary pattern and expression profiles. Phylogenetic analysis indicated that the two sub-families were both divided into two clades. Segmental duplication is contributed to neutral/alkaline sub-family expansion. Furthermore, the Populus invertase genes displayed differential expression in roots, stems, leaves, leaf buds and in response to salt/cold stress and pathogen infection. In addition, the analysis of enzyme activity and sugar content revealed that invertase genes play key roles in the sucrose metabolism of various tissues and organs in poplar. This work lays the foundation for future functional analysis of the invertase genes in Populus and other woody perennials.

  9. Genome-Wide Identification of the Invertase Gene Family in Populus

    PubMed Central

    Su, Xiaoxing; Rao, Pian; An, Xinmin


    Invertase plays a crucial role in carbohydrate partitioning and plant development as it catalyses the irreversible hydrolysis of sucrose into glucose and fructose. The invertase family in plants is composed of two sub-families: acid invertases, which are targeted to the cell wall and vacuole; and neutral/alkaline invertases, which function in the cytosol. In this study, 5 cell wall invertase genes (PtCWINV1-5), 3 vacuolar invertase genes (PtVINV1-3) and 16 neutral/alkaline invertase genes (PtNINV1-16) were identified in the Populus genome and found to be distributed on 14 chromosomes. A comprehensive analysis of poplar invertase genes was performed, including structures, chromosome location, phylogeny, evolutionary pattern and expression profiles. Phylogenetic analysis indicated that the two sub-families were both divided into two clades. Segmental duplication is contributed to neutral/alkaline sub-family expansion. Furthermore, the Populus invertase genes displayed differential expression in roots, stems, leaves, leaf buds and in response to salt/cold stress and pathogen infection. In addition, the analysis of enzyme activity and sugar content revealed that invertase genes play key roles in the sucrose metabolism of various tissues and organs in poplar. This work lays the foundation for future functional analysis of the invertase genes in Populus and other woody perennials. PMID:26393355

  10. Mimiviridae: clusters of orthologous genes, reconstruction of gene repertoire evolution and proposed expansion of the giant virus family

    PubMed Central


    Background The family Mimiviridae belongs to the large monophyletic group of Nucleo-Cytoplasmic Large DNA Viruses (NCLDV; proposed order Megavirales) and encompasses giant viruses infecting amoeba and probably other unicellular eukaryotes. The recent discovery of the Cafeteria roenbergensis virus (CroV), a distant relative of the prototype mimiviruses, led to a substantial expansion of the genetic variance within the family Mimiviridae. In the light of these findings, a reassessment of the relationships between the mimiviruses and other NCLDV and reconstruction of the evolution of giant virus genomes emerge as interesting and timely goals. Results Database searches for the protein sequences encoded in the genomes of several viruses originally classified as members of the family Phycodnaviridae, in particular Organic Lake phycodnaviruses and Phaeocystis globosa viruses (OLPG), revealed a greater number of highly similar homologs in members of the Mimiviridae than in phycodnaviruses. We constructed a collection of 898 Clusters of Orthologous Genes for the putative expanded family Mimiviridae (MimiCOGs) and used these clusters for a comprehensive phylogenetic analysis of the genes that are conserved in most of the NCLDV. The topologies of the phylogenetic trees for these conserved viral genes strongly support the monophyly of the OLPG and the mimiviruses. The same tree topology was obtained by analysis of the phyletic patterns of conserved viral genes. We further employed the mimiCOGs to obtain a maximum likelihood reconstruction of the history of genes losses and gains among the giant viruses. The results reveal massive gene gain in the mimivirus branch and modest gene gain in the OLPG branch. Conclusions These phylogenomic results reported here suggest a substantial expansion of the family Mimiviridae. The proposed expanded family encompasses a greater diversity of viruses including a group of viruses with much smaller genomes than those of the original members of

  11. Eleven ancestral gene families lost in mammals and vertebrates while otherwise universally conserved in animals

    PubMed Central

    Danchin, Etienne GJ; Gouret, Philippe; Pontarotti, Pierre


    Background Gene losses played a role which may have been as important as gene and genome duplications and rearrangements, in modelling today species' genomes from a common ancestral set of genes. The set and diversity of protein-coding genes in a species has direct output at the functional level. While gene losses have been reported in all the major lineages of the metazoan tree of life, none have proposed a focus on specific losses in the vertebrates and mammals lineages. In contrast, genes lost in protostomes (i.e. arthropods and nematodes) but still present in vertebrates have been reported and extensively detailed. This probable over-anthropocentric way of comparing genomes does not consider as an important phenomena, gene losses in species that are usually described as "higher". However reporting universally conserved genes throughout evolution that have recently been lost in vertebrates and mammals could reveal interesting features about the evolution of our genome, particularly if these losses can be related to losses of capability. Results We report 11 gene families conserved throughout eukaryotes from yeasts (such as Saccharomyces cerevisiae) to bilaterian animals (such as Drosophila melanogaster or Caenorhabditis elegans). This evolutionarily wide conservation suggests they were present in the last common ancestors of fungi and metazoan animals. None of these 11 gene families are found in human nor mouse genomes, and their absence generally extends to all vertebrates. A total of 8 out of these 11 gene families have orthologs in plants, suggesting they were present in the Last Eukaryotic Common Ancestor (LECA). We investigated known functional information for these 11 gene families. This allowed us to correlate some of the lost gene families to loss of capabilities. Conclusion Mammalian and vertebrate genomes lost evolutionary conserved ancestral genes that are probably otherwise not dispensable in eukaryotes. Hence, the human genome, which is generally

  12. Systematic analysis and identification of stress-responsive genes of the NAC gene family in Brachypodium distachyon.


    You, Jun; Zhang, Lihua; Song, Bo; Qi, Xiaoquan; Chan, Zhulong


    Plant-specific NAC proteins are one of the largest families of transcription factors in plants, and members of this family have been characterized with roles in the regulation of diverse biological processes, including development and stress responses. In the present study, we identified 101 putative NAC domain-encoding genes (BdNACs) through systematic sequence analysis in Brachypodium distachyon, a new model plant of family Poaceae. BdNAC proteins were phylogenetically clustered into 13 groups, and each group possesses similar motif compositions. Phylogenetic analysis using known stress-related NACs from Arabidopsis and rice as query sequences identified 18 BdNACs as putative stress-responsive genes. In silico promoter analysis showed that almost all BdNAC genes contain putative stress-related cis-elements in their promoter regions. Expression profile of BdNAC genes in response to abiotic stresses and phytohormones was analyzed by quantitative real-time RT-PCR. Several putative stress-responsive BdNAC genes, including BdNAC003 and BdNAC044 which is ortholog of known stress-responsive rice gene SNAC1 and SNAC2, respectively, were highly regulated by multiple abiotic stresses and stress-related phytohormone treatments. Taken together, our results presented here would be helpful in laying the foundation for understanding of the complex mechanisms of NAC mediated abiotic stress signaling transduction pathways in B. distachyon.

  13. The phylogeny and evolutionary history of the Lesion Simulating Disease (LSD) gene family in Viridiplantae.


    Cabreira, Caroline; Cagliari, Alexandro; Bücker-Neto, Lauro; Margis-Pinheiro, Márcia; de Freitas, Loreta B; Bodanese-Zanettini, Maria Helena


    The Lesion Simulating Disease (LSD) genes encode a family of zinc finger proteins that play a role in programmed cell death (PCD) and other biological processes, such as plant growth and photosynthesis. In the present study, we report the reconstruction of the evolutionary history of the LSD gene family in Viridiplantae. Phylogenetic analysis revealed that the monocot and eudicot genes were distributed along the phylogeny, indicating that the expansion of the family occurred prior to the diversification between these clades. Sequences encoding proteins that present one, two, or three LSD domains formed separate groups. The secondary structure of these different LSD proteins presented a similar composition, with the β-sheets being their main component. The evolution by gene duplication was identified only to the genes that contain three LSD domains, which generated proteins with equal structure. Moreover, genes encoding proteins with one or two LSD domains evolved as single-copy genes and did not result from loss or gain in LSD domains. These results were corroborated by synteny analysis among regions containing paralogous/orthologous genes in Glycine max and Populus trichocarpa. The Ka/Ks ratio between paralogous/orthologous genes revealed that a subfunctionalization process possibly could be occurring with the LSD genes, explaining the involvement of LSD members in different biological processes, in addition to the negative regulation of PCD. This study presents important novelty in the evolutionary history of the LSD family and provides a basis for future research on individual LSD genes and their involvement in important pathway networks in plants.

  14. Evolutionary analysis of the jacalin-related lectin family genes in 11 fishes.


    Cao, Jun; Lv, Yueqing


    Jacalin-related lectins are a type of carbohydrate-binding proteins, which are distributed across a wide variety of organisms and involved in some important biological processes. The evolution of this gene family in fishes is unknown. Here, 47 putative jacalin genes in 11 fish species were identified and divided into 4 groups through phylogenetic analysis. Conserved gene organization and motif distribution existed in each group, suggesting their functional conservation. Some fishes have eleven jacalin genes, while others have only one or zero gene in their genomes, suggesting dynamic changes in the number of jacalin genes during the evolution of fishes. Intragenic recombination played a key role in the evolution of jacalin genes. Synteny analyses of jacalin genes in some fishes implied conserved and dynamic evolution characteristics of this gene family and related genome segments. Moreover, a few functional divergence sites were identified within each group pairs. Divergent expression profiles of the zebra fish jacalin genes were further investigated in different stresses. The results provided a foundation for exploring the characterization of the jacalin genes in fishes and will offer insights for additional functional studies.

  15. Genome-wide identification of the TIFY gene family in three cultivated Gossypium species and the expression of JAZ genes

    PubMed Central

    Sun, Quan; Wang, Guanghao; Zhang, Xiao; Zhang, Xiangrui; Qiao, Peng; Long, Lu; Yuan, Youlu; Cai, Yingfan


    TIFY proteins are plant-specific proteins containing TIFY, JAZ, PPD and ZML subfamilies. A total of 50, 54 and 28 members of the TIFY gene family in three cultivated cotton species—Gossypium hirsutum, Gossypium barbadense and Gossypium arboretum—were identified, respectively. The results of phylogenetic analysis showed that these TIFY genes were divided into eight clusters. The different clusters of gene family members often have similar gene structures, including the number of exons. The results of quantitative reverse transcription polymerase chain reaction (qRT-PCR) showed that different JAZ genes displayed distinct expression patterns in the leaves of upland cotton under treatment with Gibberellin (GA), methyl jasmonate (MeJA), Jasmonic acid (JA) and abscisic acid (ABA). Different groups of JAZ genes exhibited different expression patterns in cotton leaves infected with Verticillium dahliae. The results of the comparative analysis of TIFY genes in the three cultivated species will be useful for understanding the involvement of these genes in development and stress resistance in cotton. PMID:28186193

  16. Organisation and structural evolution of the rice glutathione S-transferase gene family.


    Soranzo, N; Sari Gorla, M; Mizzi, L; De Toma, G; Frova, C


    Glutathione S-transferases (GSTs) comprise a large family of key defence enzymes against xenobiotic toxicity. Here we describe the comprehensive characterisation of this important multigene family in the model monocot species rice [ Oryza sativa(L.)]. Furthermore, we investigate the molecular evolution of the family based on the analysis of (1) the patterns of within-genome duplication, and (2) the phylogenetic relationships and evolutionary divergence among rice, Arabidopsis, maize and soybean GSTs. By in-silico screening of the EST and genome divisions of the Genbank/EMBL/DDBJ database we have isolated 59 putative genes and two pseudogenes, making this the largest plant GST family characterised to date. Of these, 38 (62%) are represented by genomic and EST sequences and 23 (38%) are known only from their genomic sequences. A preliminary survey of EST collections shows a large degree of variability in gene expression between different tissues and environmental conditions, with a small number of genes (13) accounting for 80% of all ESTs. Rice GSTs are organised in four main phylogenetic classes, with 91% of all rice genes belonging to the two plant-specific classes Tau (40 genes) and Phi (16 genes). Pairwise identity scores range between 17 and 98% for proteins of the same class, and 7 and 21% for interclass comparisons. Rapid evolution by gene duplication is suggested by the discovery of two large clusters of 7 and 23 closely related genes on chromosomes 1 and 10, respectively. A comparison of the complete GST families in two monocot and two dicot species suggests a monophyletic origin for all Theta and Zeta GSTs, and no more than three common ancestors for all Phi and Tau genes.

  17. Genome-wide analysis of the MADS-box gene family in Brassica rapa (Chinese cabbage).


    Duan, Weike; Song, Xiaoming; Liu, Tongkun; Huang, Zhinan; Ren, Jun; Hou, Xilin; Li, Ying


    The MADS-box gene family is an ancient and well-studied transcription factor family that functions in almost every developmental process in plants. There are a number of reports about the MADS-box family in different plant species, but systematic analysis of the MADS-box transcription factor family in Brassica rapa (Chinese cabbage) is still lacking. In this study, 160 MADS-box transcription factors were identified from the entire Chinese cabbage genome and compared with the MADS-box factors from 21 other representative plant species. A detailed list of MADS proteins from these 22 species was sorted. Phylogenetic analysis of the BrMADS genes, together with their Arabidopsis and rice counterparts, showed that the BrMADS genes were categorised into type I (Mα, Mβ, Mγ) and type II (MIKC(C), MIKC*) groups, and the MIKC(C) proteins were further divided into 13 subfamilies. The Chinese cabbage type II group has 95 members, which is twice as much as the Arabidopsis type II group, indicating that the Chinese cabbage type II genes have been retained more frequently than the type I genes. Finally, RNA-seq transcriptome data and quantitative real-time PCR analysis revealed that BrMADS genes are expressed in a tissue-specific manner similar to Arabidopsis. Interestingly, a number of BrMIKC genes showed responses to different abiotic stress treatments, suggesting a function for some of the genes in these processes as well. Taken together, the characterization of the B. rapa MADS-box family presented here, will certainly help in the selection of appropriate candidate genes and further facilitate functional studies in Chinese cabbage.

  18. The zebrafish progranulin gene family and antisense transcripts

    PubMed Central

    Cadieux, Benoît; Chitramuthu, Babykumari P; Baranowski, David; Bennett, Hugh PJ


    Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor) that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn) genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial compartments of various organs

  19. Multi-gene panel testing for hereditary cancer susceptibility in a rural Familial Cancer Program.


    Hermel, David J; McKinnon, Wendy C; Wood, Marie E; Greenblatt, Marc S


    This study explores our Familial Cancer Program's experience implementing multi-gene panel testing in a largely rural patient population. We conducted a retrospective review of patients undergoing panel testing between May 2011 and August 2015. Our goal was to evaluate factors that might be predictors of identifying variants (pathogenic or uncertain significance) and to assess clinical management changes due to testing. We utilized a structured family history tool to determine the significance of patient's family histories with respect to identification of genetic variants. A total of 227 patients underwent panel testing at our center and 67 patients (29.5 %) had variants identified, with 8 (3.5 %) having multiple variants. Overall, 44 patients (19.4 %) had a variant of uncertain significance (VUS) and 28 patients (12.3 %) had a pathogenic variant detected, with 10 (4.4 %) having pathogenic variants in highly penetrant genes. We found no statistical difference in patient familial and personal cancer history, age, rural status, Ashkenazi Jewish ancestry, insurance coverage and prior single-gene testing among those with pathogenic, VUS and negative panel testing results. There were no predictors of pathogenic variants on regression analysis. Panel testing changed cancer screening and management guidelines from that expected based on family history alone in 13.2 % of patients. Ultimately, cancer panel testing does yield critical information not identified by traditional single gene testing but maximal utility through a broad range of personal and family histories requires improved interpretation of variants.

  20. The GLI-Kruppel family of human genes

    SciTech Connect

    Ruppert, J.M.; Kinzler, K.W.; Wong, A.J.; Bigner, S.H.; Kao, F.T.; Law, M.L.; Seuanez, H.N.; O'Brien, S.J.; Vogelstein, B.


    Previous characterization of GLI, a gene found to be amplified and expressed in a subset of human brain tumors, revealed the presence of five tandem fingers related to those of Kruppel (Kr), a Drosophila segmentation gene of the gap class. The authors have used the GLI cDNA as a molecular probe to isolate related sequences from the human genome. Partial characterization of six related loci, including sequence determination, expression studies, and chromosome localization, revealed that each locus could encode a separate finger protein. The predicted proteins all had similar H-C links, i.e., a conserved stretch of 9 amino acids connecting the C-terminal histidine of one finger to the N-terminal cysteine of the next. On the basis of amino acid sequence and intron-exon organization, the genes could be placed into one of two subgroups: the GLI subgroup (with the consensus finger amino acid sequence (Y/F)XCX/sub 3/GCX/sub 3/(F/Y)X/sub 5/LX/sub 2/HX/sub 3-4/H(T/X)GEKP) or the Kr subgroup (with the consensus finger amino acid sequence (Y/F)XCX/sub 2/CX/sub 3/FX/sub 5/LX/sub 2/HXRXHTGEKP). Unlike GLI or Kr, most of the newly isolated genes were expressed in many adult tissues. The predicted proteins probably control the expression of other genes and, by analogy with Kr and GLI, may be important in human development, tissue-specific differentiation, or neoplasia.

  1. Cross-species gene-family fluctuations reveal the dynamics of horizontal transfers.


    Grilli, Jacopo; Romano, Mariacristina; Bassetti, Federico; Cosentino Lagomarsino, Marco


    Prokaryotes vary their protein repertoire mainly through horizontal transfer and gene loss. To elucidate the links between these processes and the cross-species gene-family statistics, we perform a large-scale data analysis of the cross-species variability of gene-family abundance (the number of members of the family found on a given genome). We find that abundance fluctuations are related to the rate of horizontal transfers. This is rationalized by a minimal theoretical model, which predicts this link. The families that are not captured by the model show abundance profiles that are markedly peaked around a mean value, possibly because of specific abundance selection. Based on these results, we define an abundance variability index that captures a family's evolutionary behavior (and thus some of its relevant functional properties) purely based on its cross-species abundance fluctuations. Analysis and model, combined, show a quantitative link between cross-species family abundance statistics and horizontal transfer dynamics, which can be used to analyze genome 'flux'. Groups of families with different values of the abundance variability index correspond to genome sub-parts having different plasticity in terms of the level of horizontal exchange allowed by natural selection.

  2. Unique Loss of the PYHIN Gene Family in Bats Amongst Mammals: Implications for Inflammasome Sensing

    PubMed Central

    Ahn, Matae; Cui, Jie; Irving, Aaron T.; Wang, Lin-Fa


    Recent genomic analysis of two bat species (Pteropus alecto and Myotis davidii) revealed the absence of the PYHIN gene family. This family is recognized as important immune sensors of intracellular self and foreign DNA and activators of the inflammasome and/or interferon pathways. Further assessment of a wider range of bat genomes was necessary to determine if this is a universal pattern for this large mammalian group. Here we expanded genomic analysis of this gene family to include ten bat species. We confirmed the complete loss of this gene family, with only a truncated AIM2 remaining in one species (Pteronotus parnellii). Divergence of the PYHIN gene loci between the bat lineages infers different loss-of-function histories during bat evolution. While all other major groups of placental mammals have at least one gene member, only bats have lost the entire family. This removal of inflammasome DNA sensors may indicate an important adaptation that is flight-induced and related, at least in part, to pathogen-host co-existence. PMID:26906452

  3. A family of Turandot-related genes in the humoral stress response of Drosophila.


    Ekengren, S; Hultmark, D


    The Drosophila Turandot A (TotA) gene was recently shown to encode a stress-induced humoral factor which gives increased resistance to the lethal effects of high temperature. Here we show that TotA belongs to a family of eight Tot genes distributed at three different sites in the Drosophila genome. All Tot genes are induced under stressful conditions such as bacterial infection, heat shock, paraquat feeding or exposure to ultraviolet light, suggesting that all members of this family play a role in Drosophila stress tolerance. The induction of the Tot genes differs in important respects from the heat shock response, such as the strong but delayed response to bacterial infection seen for several of the genes.

  4. Sessile snails, dynamic genomes: gene rearrangements within the mitochondrial genome of a family of caenogastropod molluscs

    PubMed Central


    Background Widespread sampling of vertebrates, which comprise the majority of published animal mitochondrial genomes, has led to the view that mitochondrial gene rearrangements are relatively rare, and that gene orders are typically stable across major taxonomic groups. In contrast, more limited sampling within the Phylum Mollusca has revealed an unusually high number of gene order arrangements. Here we provide evidence that the lability of the molluscan mitochondrial genome extends to the family level by describing extensive gene order changes that have occurred within the Vermetidae, a family of sessile marine gastropods that radiated from a basal caenogastropod stock during the Cenozoic Era. Results Major mitochondrial gene rearrangements have occurred within this family at a scale unexpected for such an evolutionarily young group and unprecedented for any caenogastropod examined to date. We determined the complete mitochondrial genomes of four species (Dendropoma maximum, D. gregarium, Eualetes tulipa, and Thylacodes squamigerus) and the partial mitochondrial genomes of two others (Vermetus erectus and Thylaeodus sp.). Each of the six vermetid gastropods assayed possessed a unique gene order. In addition to the typical mitochondrial genome complement of 37 genes, additional tRNA genes were evident in D. gregarium (trnK) and Thylacodes squamigerus (trnV, trnLUUR). Three pseudogenes and additional tRNAs found within the genome of Thylacodes squamigerus provide evidence of a past duplication event in this taxon. Likewise, high sequence similarities between isoaccepting leucine tRNAs in Thylacodes, Eualetes, and Thylaeodus suggest that tRNA remolding has been rife within this family. While vermetids exhibit gene arrangements diagnostic of this family, they also share arrangements with littorinimorph caenogastropods, with which they have been linked based on sperm morphology and primary sequence-based phylogenies. Conclusions We have uncovered major changes in gene

  5. From motherhood penalties to husband premia: the new challenge for gender equality and family policy, lessons from Norway.


    Petersen, Trond; Penner, Andrew M; Høgsnes, Geir


    Given the key role that processes occurring in the family play in creating gender inequality, the family is a central focus of policies aimed at creating greater gender equality. We examine how family status affects the gender wage gap using longitudinal matched employer-employee data from Norway, 1979-96, a period with extensive expansion of family policies. The motherhood penalty dropped dramatically from 1979 to 1996. Among men the premia for marriage and fatherhood remained constant. In 1979, the gender wage gap was primarily due to the motherhood penalty, but by 1996 husband premia were more important than motherhood penalties.

  6. Real-Time Evolution of a Subtelomeric Gene Family in Candida albicans

    PubMed Central

    Anderson, Matthew Z.; Wigen, Lauren J.; Burrack, Laura S.; Berman, Judith


    Subtelomeric regions of the genome are notable for high rates of sequence evolution and rapid gene turnover. Evidence of subtelomeric evolution has relied heavily on comparisons of historical evolutionary patterns to infer trends and frequencies of these events. Here, we describe evolution of the subtelomeric TLO gene family in Candida albicans during laboratory passaging for over 4000 generations. C. albicans is a commensal and opportunistic pathogen of humans and the TLO gene family encodes a subunit of the Mediator complex that regulates transcription and affects a range of virulence factors. We identified 16 distinct subtelomeric recombination events that altered the TLO repertoire. Ectopic recombination between subtelomeres on different chromosome ends occurred approximately once per 5000 generations and was often followed by loss of heterozygosity, resulting in the complete loss of one TLO gene sequence with expansion of another. In one case, recombination within TLO genes produced a novel TLO gene sequence. TLO copy number changes were biased, with some TLOs preferentially being copied to novel chromosome arms and other TLO genes being frequently lost. The majority of these nonreciprocal recombination events occurred either within the 3′ end of the TLO coding sequence or within a conserved 50-bp sequence element centromere-proximal to TLO coding sequence. Thus, subtelomeric recombination is a rapid mechanism of generating genotypic diversity through alterations in the number and sequence of related gene family members. PMID:25956943

  7. Multispecies Analysis of Expression Pattern Diversification in the Recently Expanded Insect Ly6 Gene Family

    PubMed Central

    Tanaka, Kohtaro; Hazbun, Alexis; Hijazi, Assia; Vreede, Barbara; Sucena, Élio


    Gene families often consist of members with diverse expression domains reflecting their functions in a wide variety of tissues. However, how the expression of individual members, and thus their tissue-specific functions, diversified during the course of gene family expansion is not well understood. In this study, we approached this question through the analysis of the duplication history and transcriptional evolution of a rapidly expanding subfamily of insect Ly6 genes. We analyzed different insect genomes and identified seven Ly6 genes that have originated from a single ancestor through sequential duplication within the higher Diptera. We then determined how the original embryonic expression pattern of the founding gene diversified by characterizing its tissue-specific expression in the beetle Tribolium castaneum, the butterfly Bicyclus anynana, and the mosquito Anopheles stephensi and those of its duplicates in three higher dipteran species, representing various stages of the duplication history (Megaselia abdita, Ceratitis capitata, and Drosophila melanogaster). Our results revealed that frequent neofunctionalization episodes contributed to the increased expression breadth of this subfamily and that these events occurred after duplication and speciation events at comparable frequencies. In addition, at each duplication node, we consistently found asymmetric expression divergence. One paralog inherited most of the tissue-specificities of the founder gene, whereas the other paralog evolved drastically reduced expression domains. Our approach attests to the power of combining a well-established duplication history with a comprehensive coverage of representative species in acquiring unequivocal information about the dynamics of gene expression evolution in gene families. PMID:25743545

  8. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.


    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing


    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression.

  9. Dichotomy in the NRT Gene Families of Dicots and Grass Species

    PubMed Central

    Plett, Darren; Toubia, John; Garnett, Trevor; Tester, Mark; Kaiser, Brent N.; Baumann, Ute


    A large proportion of the nitrate (NO3−) acquired by plants from soil is actively transported via members of the NRT families of NO3− transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2) family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH) approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium). We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO3− transporters and NO3− transport in grass crop species. PMID:21151904

  10. Clade classification of monolignol biosynthesis gene family members reveals target genes to decrease lignin in Lolium perenne.


    van Parijs, F R D; Ruttink, T; Boerjan, W; Haesaert, G; Byrne, S L; Asp, T; Roldán-Ruiz, I; Muylle, H


    In monocots, lignin content has a strong impact on the digestibility of the cell wall fraction. Engineering lignin biosynthesis requires a profound knowledge of the role of paralogues in the multigene families that constitute the monolignol biosynthesis pathway. We applied a bioinformatics approach for genome-wide identification of candidate genes in Lolium perenne that are likely to be involved in the biosynthesis of monolignols. More specifically, we performed functional subtyping of phylogenetic clades in four multigene families: 4CL, COMT, CAD and CCR. Essential residues were considered for functional clade delineation within these families. This classification was complemented with previously published experimental evidence on gene expression, gene function and enzymatic activity in closely related crops and model species. This allowed us to assign functions to novel identified L. perenne genes, and to assess functional redundancy among paralogues. We found that two 4CL paralogues, two COMT paralogues, three CCR paralogues and one CAD gene are prime targets for genetic studies to engineer developmentally regulated lignin in this species. Based on the delineation of sequence conservation between paralogues and a first analysis of allelic diversity, we discuss possibilities to further study the roles of these paralogues in lignin biosynthesis, including expression analysis, reverse genetics and forward genetics, such as association mapping. We propose criteria to prioritise paralogues within multigene families and certain SNPs within these genes for developing genotyping assays or increasing power in association mapping studies. Although L. perenne was the target of the analyses presented here, this functional subtyping of phylogenetic clades represents a valuable tool for studies investigating monolignol biosynthesis genes in other monocot species.

  11. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).


    Deokar, Amit A; Tar'an, Bunyamin


    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea (Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis-acting regulatory elements revealed enrichment of cis-elements involved in circadian control, light response, defense and stress responsiveness

  12. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.)

    PubMed Central

    Deokar, Amit A.; Tar'an, Bunyamin


    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea (Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis-acting regulatory elements revealed enrichment of cis-elements involved in circadian control, light response, defense and stress responsiveness

  13. Characterization of resistance gene analogues (RGAs) in Apple (Malus 6domestica Borkh.) and their evolutionary history of the Rosaceae family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The family of resistance gene analogues (RGAs) with a nucleotide-binding site (NBS) domain accounts for the largest number of disease resistance genes and is one of the largest gene families in plants. We have identified 868 RGAs in the genome of the apple (Malus × domestica Borkh.) cultivar ‘Golden...

  14. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).


    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L


    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  15. Adaptation to drought in two wild tomato species: the evolution of the Asr gene family.


    Fischer, Iris; Camus-Kulandaivelu, Létizia; Allal, François; Stephan, Wolfgang


    Wild tomato species are a valuable system in which to study local adaptation to drought: they grow in diverse environments ranging from mesic to extremely arid conditions. Here, we investigate the evolution of members of the Asr (ABA/water stress/ripening induced) gene family, which have been reported to be involved in the water stress response. We analysed molecular variation in the Asr gene family in populations of two closely related species, Solanum chilense and Solanum peruvianum. We concluded that Asr1 has evolved under strong purifying selection. In contrast to previous reports, we did not detect evidence for positive selection at Asr2. However, Asr4 shows patterns consistent with local adaptation in an S. chilense population that lives in an extremely dry environment. We also discovered a new member of the gene family, Asr5. Our results show that the Asr genes constitute a dynamic gene family and provide an excellent example of tandemly arrayed genes that are of importance in adaptation. Taking the potential distribution of the species into account, it appears that S. peruvianum can cope with a great variety of environmental conditions without undergoing local adaptation, whereas S. chilense undergoes local adaptation more frequently.

  16. Challenges and solutions for gene identification in the presence of familial locus heterogeneity

    PubMed Central

    Rehman, Atteeq U; Santos-Cortez, Regie Lyn P; Drummond, Meghan C; Shahzad, Mohsin; Lee, Kwanghyuk; Morell, Robert J; Ansar, Muhammad; Jan, Abid; Wang, Xin; Aziz, Abdul; Riazuddin, Saima; Smith, Joshua D; Wang, Gao T; Ahmed, Zubair M; Gul, Khitab; Shearer, A Eliot; Smith, Richard J H; Shendure, Jay; Bamshad, Michael J; Nickerson, Deborah A; Hinnant, John; Khan, Shaheen N; Fisher, Rachel A; Ahmad, Wasim; Friderici, Karen H; Riazuddin, Sheikh; Friedman, Thomas B; Wilch, Ellen S; Leal, Suzanne M


    Next-generation sequencing (NGS) of exomes and genomes has accelerated the identification of genes involved in Mendelian phenotypes. However, many NGS studies fall short of identifying causal variants, with estimates for success rates as low as 25% for uncovering the pathological variant underlying disease etiology. An important reason for such failures is familial locus heterogeneity, where within a single pedigree causal variants in two or more genes underlie Mendelian trait etiology. As examples of intra- and inter-sibship familial locus heterogeneity, we present 10 consanguineous Pakistani families segregating hearing impairment due to homozygous variants in two different hearing impairment genes and a European-American pedigree in which hearing impairment is caused by four variants in three different genes. We have identified 41 additional pedigrees with syndromic and nonsyndromic hearing impairment for which a single previously reported hearing impairment gene has been identified but only segregates with the phenotype in a subset of affected pedigree members. We estimate that locus heterogeneity occurs in 15.3% (95% confidence interval: 11.9%, 19.9%) of the families in our collection. We demonstrate novel approaches to apply linkage analysis and homozygosity mapping (for autosomal recessive consanguineous pedigrees), which can be used to detect locus heterogeneity using either NGS or SNP array data. Results from linkage analysis and homozygosity mapping can also be used to group sibships or individuals most likely to be segregating the same causal variants and thereby increase the success rate of gene identification. PMID:25491636

  17. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    SciTech Connect

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L.


    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  18. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.


    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei


    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  19. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).


    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang


    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes.

  20. Genome-Wide Analysis of the NADK Gene Family in Plants

    PubMed Central

    Li, Wen-Yan; Wang, Xiang; Li, Ri; Li, Wen-Qiang; Chen, Kun-Ming


    Background NAD(H) kinase (NADK) is the key enzyme that catalyzes de novo synthesis of NADP(H) from NAD(H) for NADP(H)-based metabolic pathways. In plants, NADKs form functional subfamilies. Studies of these families in Arabidopsis thaliana indicate that they have undergone considerable evolutionary selection; however, the detailed evolutionary history and functions of the various NADKs in plants are not clearly understood. Principal Findings We performed a comparative genomic analysis that identified 74 NADK gene homologs from 24 species representing the eight major plant lineages within the supergroup Plantae: glaucophytes, rhodophytes, chlorophytes, bryophytes, lycophytes, gymnosperms, monocots and eudicots. Phylogenetic and structural analysis classified these NADK genes into four well-conserved subfamilies with considerable variety in the domain organization and gene structure among subfamily members. In addition to the typical NAD_kinase domain, additional domains, such as adenylate kinase, dual-specificity phosphatase, and protein tyrosine phosphatase catalytic domains, were found in subfamily II. Interestingly, NADKs in subfamily III exhibited low sequence similarity (∼30%) in the kinase domain within the subfamily and with the other subfamilies. These observations suggest that gene fusion and exon shuffling may have occurred after gene duplication, leading to specific domain organization seen in subfamilies II and III, respectively. Further analysis of the exon/intron structures showed that single intron loss and gain had occurred, yielding the diversified gene structures, during the process of structural evolution of NADK family genes. Finally, both available global microarray data analysis and qRT-RCR experiments revealed that the NADK genes in Arabidopsis and Oryza sativa show different expression patterns in different developmental stages and under several different abiotic/biotic stresses and hormone treatments, underscoring the functional diversity

  1. OAS Gene Family Expression Is Associated with HIV-Related Neurocognitive Disorders.


    Sanfilippo, C; Pinzone, M R; Cambria, D; Longo, A; Palumbo, M; Di Marco, R; Condorelli, F; Nunnari, G; Malaguarnera, L; Di Rosa, M


    HIV-associated neurocognitive disorders are common in HIV-infected individuals, even in the combination antiretroviral therapy (c-ART) era. Several mechanisms are involved in neuronal damage, including chronic inflammation immune activation. Mammalian 2'-5'-oligoadenylate synthetase (OAS) genes are produced in response to interferon (IFN), mainly by monocytes, and exert their antiviral functions by activation of RNase L that degrades viral and cellular RNAs. In this study, we aimed at exploring OAS gene family RNA expression in simian immunodeficiency virus encephalitis (SIVE), in HIV-associated neurocognitive disorders (HAND), and in HIV-associate dementia (HAD). We analyzed three microarray datasets obtained from the NCBI in order to assess the expression levels of OAS gene family network in brain biopsies of macaques with SIVE vs uninfected animals, as well as post-mortem brain of individuals with HAND (on or off ART) vs uninfected controls and three brain regions of HIV-infected individuals with both neurocognitive impairment (HAD) and encephalitis (HIVE). All OAS genes were upregulated both in SIVE and in HAND. OAS expression was significantly higher in high-viremic individuals; increased expression levels persisted in cART subjects when compared to healthy controls. OAS gene network analysis showed that several genes belonging to the type I IFN pathway, especially CXCL10 and IFIT3, were similarly upregulated in SIVE/HAND. Furthermore, we identified a significant upregulation of OAS gene family RNA expression in basal ganglia, white matter, and frontal cortex of HIV-1, HAD, and HAD/HIVE patients compared to healthy subjects. OAS gene family expression is increased in brain sections from individuals with HAND, HAD, and HIVE as well as macaques with SIVE. OAS family expression is likely to be induced by IFN as a consequence of viral replication in the CNS. Its long-term upregulation may contribute to the chronic inflammatory status and neurocognitive impairment

  2. Genome-wide identification and analysis of the MADS-box gene family in sesame.


    Wei, Xin; Wang, Linhai; Yu, Jingyin; Zhang, Yanxin; Li, Donghua; Zhang, Xiurong


    MADS-box genes encode transcription factors that play crucial roles in plant growth and development. Sesame (Sesamum indicum L.) is an oil crop that contributes to the daily oil and protein requirements of almost half of the world's population; therefore, a genome-wide analysis of the MADS-box gene family is needed. Fifty-seven MADS-box genes were identified from 14 linkage groups of the sesame genome. Analysis of phylogenetic relationships with Arabidopsis thaliana, Utricularia gibba and Solanum lycopersicum MADS-box genes was performed. Sesame MADS-box genes were clustered into four groups: 28 MIKC(c)-type, 5 MIKC(⁎)-type, 14 Mα-type and 10 Mγ-type. Gene structure analysis revealed from 1 to 22 exons of sesame MADS-box genes. The number of exons in type II MADS-box genes greatly exceeded the number in type I genes. Motif distribution analysis of sesame MADS-box genes also indicated that type II MADS-box genes contained more motifs than type I genes. These results suggested that type II sesame MADS-box genes had more complex structures. By analyzing expression profiles of MADS-box genes in seven sesame transcriptomes, we determined that MIKC(C)-type MADS-box genes played significant roles in sesame flower and seed development. Although most MADS-box genes in the same clade showed similar expression features, some gene functions were diversified from the orthologous Arabidopsis genes. This research will contribute to uncovering the role of MADS-box genes in sesame development.

  3. Mapping the environmental fitness landscape: Lessons from a noisy synthetic gene circuit

    NASA Astrophysics Data System (ADS)

    Balazsi, Gabor


    Gene expression actualizes the organismal phenotypes encoded within the genome in an environment-dependent manner. Among all encoded phenotypes, cell population growth rate (cell population fitness) is perhaps the most important, since it determines how well-adapted a genotype is in various environments. Currently it remains unclear how a cell population's growth rate and its subpopulation fractions in specific environments emerge from the stochastic molecular-level kinetics of gene networks and the division rates of single cells. To address this question we developed and quantitatively characterized synthetic a gene circuit controlling the expression of a bifunctional antibiotic resistance gene in Saccharomyces cerevisiae. We found that knowing the cell division rates and nongenetic (cellular) memory of gene expression states were necessary for predicting the overall fitness of cell populations in specific antibiotic- and inducer-containing environments. We validated these predictions experimentally and identified environmental conditions that determined a ``sweet spot'' of drug resistance.

  4. Child Care Aware: A Guide to Promoting Professional Development in Family Child Care. Lessons Learned from Child Care Aware Sites.

    ERIC Educational Resources Information Center

    Dombro, Amy Laura

    This guide is designed to help educators and community leaders plan and implement professional development initiatives for family child care providers at the community level, and is based on Dayton Hudson Corporation's 1992 Child Care Aware (CCA) campaign to educate child care consumers about quality family child care. Part 1 provides an overview…

  5. Novel mutation of the NOTCH3 gene in a Polish family with CADASIL.


    Buczek, Julia; Błażejewska-Hyżorek, Beata; Cudna, Agnieszka; Lusawa, Małgorzata; Lewandowska, Eliza; Kurkowska-Jastrzębska, Iwona; Członkowska, Anna


    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is an inherited small blood vessels disease caused by mutations in the gene encoding the neurogenic locus notch homolog protein 3 (NOTCH 3). We present a Polish family with a previously unreported novel mutation in exon 12 c.1851C>C/G of the NOTCH3 gene and varying disease expression. One of the two family members with the confirmed mutation presented with all the main CADASIL symptoms; while, his affected father was nearly asymptomatic. Both family members had epilepsy, coronary artery disease, and abdominal aorta aneurysm. Our observation confirms there is phenotypic variability in CADASIL not only between, but also within, families carrying the same mutation.

  6. Phylogenetic conservation and physical mapping of members of the H6 homeobox gene family.


    Stadler, H S; Murray, J C; Leysens, N J; Goodfellow, P J; Solursh, M


    Homeobox genes represent a class of transcription factors that play key roles in the regulation of embryogenesis and development. Here we report the identification of a homeobox-containing gene family that is highly conserved at both the nucleotide and amino acid levels in a diverse number of species. These species encompass both vertebrate and invertebrate phylogenies, ranging from Homo sapiens to Drosophila melanogaster. In humans, at least two homeobox sequences from this family were identified representing a previously reported member of this family as well as a novel homeobox sequence that we physically mapped to the 10q25.2-q26.3 region of human Chromosome (Chr) 10. Multiple members of this family were also detected in three additional vertebrate species including Equus caballus (horse), Gallus gallus (Chicken), and Mus musculus (mouse), whereas only single members were detected in Tripneustes gratilla (sea urchin), Petromyzon marinus (lamprey), Salmo salar (salmon), Ovis aries (sheep), and D. melanogaster (fruit fly).

  7. A nonsense mutation in the LDL receptor gene leads to familial hypercholesterolemia in the Druze sect

    SciTech Connect

    Landsberger, D.; Meiner, V.; Reshef, A.; Leitersdorf, E. ); Levy, Yishai ); Westhytzen, D.R. van der; Coetzee, G.A. )


    Familial hypercholesterolemia (FH) is an autosomal dominant disease caused by mutations in the LDL receptor gene. Here the authors characterize and LDL receptor mutation that is associated with a distinct haplotype and causes FH in the Druze, a small Middle Eastern Islamic sect with a high degree of inbreeding. The mutation was found in FH families from two distinct Druze villages from the Golan Heights (northern Israel). It was not found either in another Druze FH family residing in a different geographical area nor in eight Arab and four Jewish FH heterozygote index cases whose hypercholesterolemia cosegregates with an identical LDL receptor gene haplotype. The mutation, a single-base substitution, results in a termination codon in exon 4 of the LDL receptor gene that encodes for the fourth repeat of the binding domain of the mature receptor. It can be diagnosed by allele-specific oligonucleotide hybridization of PCR-amplified DNA from FH patients.

  8. Cross-Family Transcription Factor Interactions: An Additional Layer of Gene Regulation.


    Bemer, Marian; van Dijk, Aalt D J; Immink, Richard G H; Angenent, Gerco C


    Specific and dynamic gene expression strongly depends on transcription factor (TF) activity and most plant TFs function in a combinatorial fashion. They can bind to DNA and control the expression of the corresponding gene in an additive fashion or cooperate by physical interactions, forming larger protein complexes. The importance of protein-protein interactions between members of a particular plant TF family has long been recognised; however, a significant number of interfamily TF interactions has recently been reported. The biological implications and the molecular mechanisms involved in cross-family interactions have now started to be elucidated and the examples illustrate potential roles in the bridging of biological processes. Hence, cross-family TF interactions expand the molecular toolbox for plants with additional mechanisms to control and fine-tune robust gene expression patterns and to adapt to their continuously changing environment.

  9. Gene therapy for eye as regenerative medicine? Lessons from RPE65 gene therapy for Leber's Congenital Amaurosis.


    Rakoczy, Elizabeth P; Narfström, Kristina


    Recombinant virus mediated gene therapy of Leber's Congenital Amaurosis has provided a wide range of data on the utility of gene replacement therapy for recessive diseases. Studies to date demonstrate that gene therapy in the eye is safe and can result in long-term recovery of visual function, but they also highlight that further research is required to identify optimum intervention time-points, target populations and the compatibility of associate therapies. This article is part of a directed issue entitled: Regenerative Medicine: the challenge of translation.

  10. The ABC transporter gene family of Daphnia pulex

    PubMed Central

    Sturm, Armin; Cunningham, Phil; Dean, Michael


    Background The large gene superfamily of ABC (ATP-binding cassette) transporters encodes membrane proteins involved in trafficking processes across biological membranes and further essential cell biological functions. ABC transporters are evolutionary ancient and involved in the biochemical defence against toxicants. We report here a genome-wide survey of ABC proteins of Daphnia pulex, providing for the first time information on ABC proteins in crustacea, a primarily aquatic arthropod subphylum of high ecological and economical importance. Results We identified 64 ABC proteins in the Daphnia genome, which possesses members of all current ABC subfamilies A to H. To unravel phylogenetic relationships, ABC proteins of Daphnia were compared to those from yeast, worm, fruit fly and human. A high conservation of Daphnia of ABC transporters was observed for proteins involved in fundamental cellular processes, including the mitochondrial half transporters of the ABCB subfamily, which function in iron metabolism and transport of Fe/S protein precursors, and the members of subfamilies ABCD, ABCE and ABCF, which have roles in very long chain fatty acid transport, initiation of gene transcription and protein translation, respectively. A number of Daphnia proteins showed one-to-one orthologous relationships to Drosophila ABC proteins including the sulfonyl urea receptor (SUR), the ecdysone transporter ET23, and the eye pigment precursor transporter scarlet. As the fruit fly, Daphnia lacked homologues to the TAP protein, which plays a role in antigene processing, and the cystic fibrosis transmembrane conductance regulator (CFTR), which functions as a chloride channel. Daphnia showed two proteins homologous to MDR (multidrug resistance) P-glycoproteins (ABCB subfamily) and six proteins homologous to MRPs (multidrug resistance-associated proteins) (ABCC subfamily). However, lineage specific gene duplications in the ABCB and ABCC subfamilies complicated the inference of function. A

  11. Cloning and characterization of a second member of the mouse mdr gene family.

    PubMed Central

    Gros, P; Raymond, M; Bell, J; Housman, D


    The mammalian mdr gene family comprises a small number of closely related genes. Previously, we have shown that one member, mdr1, has the capacity to convey multidrug resistance to drug-sensitive recipient cells in a gene transfer protocol. However, the functional characteristics of other members of this gene family have not been examined. In this report, we characterize a second member of the mdr gene family which we designated mdr2. We determined the nucleotide sequence corresponding to the complete coding region of this mdr2 transcript. The predicted amino acid sequence of this protein (1,276 amino acids) showed that it is a membrane glycoprotein highly homologous to mdr1 (85%), strongly suggesting that both genes originate from a common ancestor. Regions of divergence between mdr1 and mdr2 proteins are concentrated in two discrete segments of the predicted polypeptides, each approximately 100 residues in length. The mdr2 protein appears to be formed by the duplication of a structural unit which encodes three putative transmembrane loops and a predicted nucleotide-binding fold and is highly homologous to bacterial transport proteins such as hlyB. This strong homology suggests that mdr2 also participates in an energy-dependent membrane transport process. However, the direct relationship, if any, of this new member of the mdr family to multidrug resistance remains to be established. Knowledge of the complete nucleotide sequence and predicted amino acid sequence of the mdr2 gene product will enable the preparation of gene-specific probes and antibodies necessary to study the functional role of this gene in multidrug resistance and normal physiological processes. PMID:3405218

  12. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    PubMed Central


    Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs), symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs) has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication), by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in adaptation to host targets. PMID

  13. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    PubMed Central

    Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang


    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired. PMID:25961030

  14. Distinct patterns of expression of the RB gene family in mouse and human retina.


    Spencer, Clarellen; Pajovic, Sanja; Devlin, Hollie; Dinh, Quynh-Dao; Corson, Timothy W; Gallie, Brenda L


    Although RB1 function is disrupted in the majority of human cancers, an undefined cell of developing human retina is uniquely sensitive to cancer induction when the RB1 tumor suppressor gene is lost. Murine retinoblastoma is initiated only when two of the RB family of genes, RB1 and p107 or p130, are inactivated. Although whole embryonic retina shows RB family gene expression by several techniques, when E14 developing retina was depleted of the earliest differentiating cells, ganglion cells, the remaining proliferating murine embryonic retinal progenitor cells clearly did not express RB1 or p130, while the longer splice form of p107 was expressed. Each retinal cell type expressed some member of the RB family at some stage of differentiation. Rod photoreceptors stained for the RB1 protein product, pRB, and p107 in only a brief window of postnatal murine development, with no detectable staining for any of the RB family proteins in adult human and mouse rod photoreceptors. Adult mouse and human Muller glia, ganglion and rare horizontal cells, and adult human, but not adult mouse, cone photoreceptors stained for pRB. The RB gene family is dynamically and variably expressed through retinal development in specific retinal cells.

  15. Evolutionary History of Cathepsin L (L-like) Family Genes in Vertebrates

    PubMed Central

    Zhou, Jin; Zhang, Yao-Yang; Li, Qing-Yun; Cai, Zhong-Hua


    Cathepsin L family, an important cysteine protease found in lysosomes, is categorized into cathepsins B, F, H, K, L, S, and W in vertebrates. This categorization is based on their sequence alignment and traditional functional classification, but the evolutionary relationship of family members is unclear. This study determined the evolutionary relationship of cathepsin L family genes in vertebrates through phylogenetic construction. Results showed that cathepsins F, H, S and K, and L and V were chronologically diverged. Tandem-repeat duplication was found to occur in the evolutionary history of cathepsin L family. Cathepsin L in zebrafish, cathepsins S and K in xenopus, and cathepsin L in mice and rats underwent evident tandem-repeat events. Positive selection was detected in cathepsin L-like members in mice and rats, and amino acid sites under positive selection pressure were calculated. Most of these sites appeared at the connection of secondary structures, suggesting that the sites may slightly change spatial structure. Severe positive selection was also observed in cathepsin V (L2) of primates, indicating that this enzyme had some special functions. Our work provided a brief evolutionary history of cathepsin L family and differentiated cathepsins S and K from cathepsin L based on vertebrate appearance. Positive selection was the specific cause of differentiation of cathepsin L family genes, confirming that gene function variation after expansion events was related to interactions with the environment and adaptability. PMID:26221069

  16. Evolutionary History of Cathepsin L (L-like) Family Genes in Vertebrates.


    Zhou, Jin; Zhang, Yao-Yang; Li, Qing-Yun; Cai, Zhong-Hua


    Cathepsin L family, an important cysteine protease found in lysosomes, is categorized into cathepsins B, F, H, K, L, S, and W in vertebrates. This categorization is based on their sequence alignment and traditional functional classification, but the evolutionary relationship of family members is unclear. This study determined the evolutionary relationship of cathepsin L family genes in vertebrates through phylogenetic construction. Results showed that cathepsins F, H, S and K, and L and V were chronologically diverged. Tandem-repeat duplication was found to occur in the evolutionary history of cathepsin L family. Cathepsin L in zebrafish, cathepsins S and K in xenopus, and cathepsin L in mice and rats underwent evident tandem-repeat events. Positive selection was detected in cathepsin L-like members in mice and rats, and amino acid sites under positive selection pressure were calculated. Most of these sites appeared at the connection of secondary structures, suggesting that the sites may slightly change spatial structure. Severe positive selection was also observed in cathepsin V (L2) of primates, indicating that this enzyme had some special functions. Our work provided a brief evolutionary history of cathepsin L family and differentiated cathepsins S and K from cathepsin L based on vertebrate appearance. Positive selection was the specific cause of differentiation of cathepsin L family genes, confirming that gene function variation after expansion events was related to interactions with the environment and adaptability.

  17. Different RET gene mutation-induced multiple endocrine neoplasia type 2A in 3 Chinese families

    PubMed Central

    Liu, Qiuli; Tong, Dali; Yuan, Wenqiang; Liu, Gaolei; Yuan, Gang; Lan, Weihua; Zhang, Dianzheng; Zhang, Jun; Huang, Zaoming; Zhang, Yao; Jiang, Jun


    Abstract Backgroud: Multiple endocrine neoplasia type 2A (MEN2A) is a condition with inherited autosomal dominant mutations in RET (rearranged during transfection) gene that predisposes the carrier to extremely high risk of medullary thyroid cancer (MTC) and other MEN2A-associated tumors such as parathyroid cancer and/or pheochromocytoma. Little is reported about MEN2A syndrome in the Chinese population. Methods: All members of the 3 families along with specific probands of MEN2A were analyzed for their clinical, laboratory, and genetic characteristics. Exome sequencing was performed on the 3 probands, and specific mutation in RET was further screened on each of the family members. Results: Different mutations in the RET gene were identified: C634S in Family 1, C611Y in Family 2, and C634Y in Family 3. Proband 1 mainly showed pheochromocytoma with MTC, both medullary thyroid carcinoma and pheochromocytoma were seen in proband 2, and proband 3 showed medullary thyroid carcinoma. Conclusion: The genetic evaluation is strongly recommended for patients with a positive family history, early onset of age, or multiple sites of masses. If the results verified the mutations of RET gene, thyroidectomy should be undertaken as the guide for better prognosis. PMID:28099363

  18. Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium


    Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.; ...


    The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterizemore » the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species (G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes (FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes (FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level in three species, showing relatively ancient establishment of the gene family prior

  19. Genome-Wide Identification, Evolution and Expression Analysis of mTERF Gene Family in Maize

    PubMed Central

    Zhao, Yanxin; Cai, Manjun; Zhang, Xiaobo; Li, Yurong; Zhang, Jianhua; Zhao, Hailiang; Kong, Fei; Zheng, Yonglian; Qiu, Fazhan


    Plant mitochondrial transcription termination factor (mTERF) genes comprise a large family with important roles in regulating organelle gene expression. In this study, a comprehensive database search yielded 31 potential mTERF genes in maize (Zea mays L.) and most of them were targeted to mitochondria or chloroplasts. Maize mTERF were divided into nine main groups based on phylogenetic analysis, and group IX represented the mitochondria and species-specific clade that diverged from other groups. Tandem and segmental duplication both contributed to the expansion of the mTERF gene family in the maize genome. Comprehensive expression analysis of these genes, using microarray data and RNA-seq data, revealed that these genes exhibit a variety of expression patterns. Environmental stimulus experiments revealed differential up or down-regulation expression of maize mTERF genes in seedlings exposed to light/dark, salts and plant hormones, respectively, suggesting various important roles of maize mTERF genes in light acclimation and stress-related responses. These results will be useful for elucidating the roles of mTERF genes in the growth, development and stress response of maize. PMID:24718683

  20. Genome-wide identification and characterization of the Dof gene family in Medicago truncatula.


    Shu, Y J; Song, L L; Zhang, J; Liu, Y; Guo, C H


    The DNA-binding one zinc finger (Dof) family is a classic plant-specific zinc-finger transcription factor family, which is involved in many important processes, including seed maturation and germination, plant growth and development, and light responses. Investigation of the Medicago truncatula genome revealed 42 putative Dof genes, each of which holds one Dof domain. These genes were classified into four groups based on phylogenetic analysis, which are similar to the groups reported for Arabidopsis and rice. Based on genome duplication analysis, it was found that the MtDof genes were distributed on all chromosomes and had expanded through tandem gene duplication and segmental duplication events. Two main duplication regions were identified, one from tandem duplication and another from segmental duplication. By analyzing high-throughput sequencing data from M. truncatula, we found that most of the MtDof genes showed specific expression patterns in different tissues. According to cis-regulatory element analysis, these MtDof genes are regulated by different cis-acting motifs, which are important for the functional divergence of the MtDof genes in different processes. Thus, using genome-wide identification, evolution, and expression pattern analysis of the Dof genes in M. truncatula, our study provides valuable information for understanding the potential function of the Dof genes in regulating the growth and development of M. truncatula.

  1. Expression Pattern of ERF Gene Family under Multiple Abiotic Stresses in Populus simonii × P. nigra.


    Yao, Wenjing; Zhang, Xuemei; Zhou, Boru; Zhao, Kai; Li, Renhua; Jiang, Tingbo


    Identification of gene expression patterns of key genes across multiple abiotic stresses is critical for mechanistic understanding of stress resistance in plant. In the present study, we identified differentially expressed genes (DEGs) in di-haploid Populus simonii × P. nigra under respective stresses of NaCl, KCl, CdCl2, and PEG. On the basis of RNA-Seq, we detected 247 DEGs that are shared by the four stresses in wild type poplar, and mRNA abundance of the DEGs were validated in transgenic poplar overexpressing ERF76 gene by RNA-Seq and RT-qPCR. Results from gene ontology analysis indicated that these genes are enriched in significant pathways, such as phenylpropanoid biosynthesis, phenylalanine metabolism, starch and sucrose metabolism, and plant hormone signal transduction. Ethylene response factor (ERF) gene family plays significant role in plant abiotic stress responses. We also investigated expression pattern of ERF gene family under the four stresses. The ERFs and DEGs share similar expression pattern across the four stresses. The transgenic poplar is superior to WT in morphologic, physiological and biochemical traits, which demonstrated the ERF76 gene plays a significant role in stress resistance. These studies will give a rise in understanding the stress response mechanisms in poplar.

  2. Expression Pattern of ERF Gene Family under Multiple Abiotic Stresses in Populus simonii × P. nigra

    PubMed Central

    Yao, Wenjing; Zhang, Xuemei; Zhou, Boru; Zhao, Kai; Li, Renhua; Jiang, Tingbo


    Identification of gene expression patterns of key genes across multiple abiotic stresses is critical for mechanistic understanding of stress resistance in plant. In the present study, we identified differentially expressed genes (DEGs) in di-haploid Populus simonii × P. nigra under respective stresses of NaCl, KCl, CdCl2, and PEG. On the basis of RNA-Seq, we detected 247 DEGs that are shared by the four stresses in wild type poplar, and mRNA abundance of the DEGs were validated in transgenic poplar overexpressing ERF76 gene by RNA-Seq and RT-qPCR. Results from gene ontology analysis indicated that these genes are enriched in significant pathways, such as phenylpropanoid biosynthesis, phenylalanine metabolism, starch and sucrose metabolism, and plant hormone signal transduction. Ethylene response factor (ERF) gene family plays significant role in plant abiotic stress responses. We also investigated expression pattern of ERF gene family under the four stresses. The ERFs and DEGs share similar expression pattern across the four stresses. The transgenic poplar is superior to WT in morphologic, physiological and biochemical traits, which demonstrated the ERF76 gene plays a significant role in stress resistance. These studies will give a rise in understanding the stress response mechanisms in poplar. PMID:28265277

  3. Genome-wide analysis of WOX gene family in rice, sorghum, maize, Arabidopsis and poplar.


    Zhang, Xin; Zong, Jie; Liu, Jianhua; Yin, Jinyuan; Zhang, Dabing


    WUSCHEL-related homeobox (WOX) genes form a large gene family specifically expressed in plants. They are known to play important roles in regulating the development of plant tissues and organs by determining cell fate. Recent available whole genome sequences allow us to do more comprehensive phylogenetic analysis of the WOX genes in plants. In the present study, we identified 11 and 21 WOXs from sorghum (Sorghum bicolor) and maize (Zea mays), respectively. The 72 WOX genes from rice (Oryza sativa), sorghum, maize, Arabidopsis (Arabidopsis thaliana) and poplar (Populus trichocarpa) were grouped into three well supported clades with nine subgroups according to the amino acid sequences of their homodomains. Their phylogenetic relationship was also supported by the observation of the motifs outside the homodomain. We observed the variation of duplication events among the nine sub-groups between monocots and eudicots, for instance, more gene duplication events of WOXs within subgroup A for monocots, while, less for dicots in this subgroup. Furthermore, we observed the conserved intron/exon structural patterns of WOX genes in rice, sorghum and Arabidopsis. In addition, WUS (Wuschel)-box and EAR (the ERF-associated amphiphilic repression)-like motif were observed to be conserved among several WOX subgroups in these five plants. Comparative analysis of expression patterns of WOX genes in rice and Arabidopsis suggest that the WOX genes play conserved and various roles in plants. This work provides insights into the evolution of the WOX gene family and is useful for future research.

  4. Isolation, structural analysis, and expression characteristics of the maize TIFY gene family.


    Zhang, Zhongbao; Li, Xianglong; Yu, Rong; Han, Meng; Wu, Zhongyi


    TIFY, previously known as ZIM, comprises a plant-specific family annotated as transcription factors that might play important roles in stress response. Despite TIFY proteins have been reported in Arabidopsis and rice, a comprehensive and systematic survey of ZmTIFY genes has not yet been conducted. To investigate the functions of ZmTIFY genes in this family, we isolated and characterized 30 ZmTIFY (1 TIFY, 3 ZML, and 26 JAZ) genes in an analysis of the maize (Zea mays L.) genome in this study. The 30 ZmTIFY genes were distributed over eight chromosomes. Multiple alignment and motif display results indicated that all ZmTIFY proteins share two conserved TIFY and Jas domains. Phylogenetic analysis revealed that the ZmTIFY family could be divided into two groups. Putative cis-elements, involved in abiotic stress response, phytohormones, pollen grain, and seed development, were detected in the promoters of maize TIFY genes. Microarray data showed that the ZmTIFY genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results indicated that ZmTIFY4, 5, 8, 26, and 28 were induced, while ZmTIFY16, 13, 24, 27, 18, and 30 were suppressed, by drought stress in the maize inbred lines Han21 and Ye478. ZmTIFY1, 19, and 28 were upregulated after infection by three pathogens, whereas ZmTIFY4, 13, 21, 23, 24, and 26 were suppressed. These results indicate that the ZmTIFY family may have vital roles in response to abiotic and biotic stresses. The data presented in this work provide vital clues for further investigating the functions of the genes in the ZmTIFY family.

  5. Molecular analysis of the PAX6 gene for aniridia and congenital cataracts in Tunisian families

    PubMed Central

    Chograni, Manèl; Derouiche, Kaouther; Chaabouni, Myriam; Lariani, Imen; Bouhamed, Habiba Chaabouni


    The aim of this study was to identify the genetic defect that is responsible for aniridia and congenital cataracts in two Tunisian families. Sequencing of the PAX6 gene in family F1 detected a novel c.265C>T transition in exon 6. In family F2, the previously described c.718C>T mutation in PAX6 was detected in the four affected members. This study adds new mutation to those previously reported in PAX6, providing further evidence for the genetic and phenotypic heterogeneity in individuals with aniridia ocular malformations. PMID:27081502

  6. Rapid Expansion and Functional Divergence of Subtelomeric Gene Families in Yeasts

    PubMed Central

    Brown, Chris A.; Murray, Andrew W.; Verstrepen, Kevin J.


    Summary Background Subtelomeres, regions proximal to telomeres, exhibit characteristics unique to eukaryotic genomes. Genes residing in these loci are subject to epigenetic regulation and elevated rates of both meiotic and mitotic recombination. However, most genome sequences do not contain assembled subtelomeric sequences, and, as a result, subtelomeres are often overlooked in comparative genomics. Results We study the evolution and functional divergence of subtelomeric gene families in the yeast lineage. Our computational results show that subtelomeric families are evolving and expanding much faster than families that do not contain subtelomeric genes. Focusing on three related subtelomeric MAL gene families involved in disaccharide metabolism that show typical patterns of rapid expansion and evolution, we show experimentally how frequent duplication events followed by functional divergence yields novel alleles that allow metabolism of different carbohydrates. Conclusions Taken together, our computational and experimental analyses show that the extraordinary instability of eukaryotic subtelomeres supports rapid adaptation to novel niches by promoting gene recombination and duplication followed by functional divergence of the alleles. PMID:20471265

  7. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.


    Juranić, Martina; Dresselhaus, Thomas


    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  8. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses

    PubMed Central

    Juranić, Martina; Dresselhaus, Thomas


    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1–3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses. PMID:24614623

  9. Functional divergence of the glutathione S-transferase supergene family in Physcomitrella patens reveals complex patterns of large gene family evolution in land plants.


    Liu, Yan-Jing; Han, Xue-Min; Ren, Lin-Ling; Yang, Hai-Ling; Zeng, Qing-Yin


    Plant glutathione S-transferases (GSTs) are multifunctional proteins encoded by a large gene family that play major roles in the detoxification of xenobiotics and oxidative stress metabolism. To date, studies on the GST gene family have focused mainly on vascular plants (particularly agricultural plants). In contrast, little information is available on the molecular characteristics of this large gene family in nonvascular plants. In addition, the evolutionary patterns of this family in land plants remain unclear. In this study, we identified 37 GST genes from the whole genome of the moss Physcomitrella patens, a nonvascular representative of early land plants. The 37 P. patens GSTs were divided into 10 classes, including two new classes (hemerythrin and iota). However, no tau GSTs were identified, which represent the largest class among vascular plants. P. patens GST gene family members showed extensive functional divergence in their gene structures, gene expression responses to abiotic stressors, enzymatic characteristics, and the subcellular locations of the encoded proteins. A joint phylogenetic analysis of GSTs from P. patens and other higher vascular plants showed that different class GSTs had distinct duplication patterns during the evolution of land plants. By examining multiple characteristics, this study revealed complex patterns of evolutionary divergence among the GST gene family in land plants.

  10. Evolutionary analysis of multidrug resistance genes in fungi - impact of gene duplication and family conservation.


    Gossani, Cristiani; Bellieny-Rabelo, Daniel; Venancio, Thiago M


    Although the emergence of bacterial drug resistance is of great concern to the scientific community, few studies have evaluated this phenomenon systematically in fungi by using genome-wide datasets. In the present study, we assembled a large compendium of Saccharomyces cerevisiae chemical genetic data to study the evolution of multidrug resistance genes (MDRs) in the fungal lineage. We found that MDRs typically emerge in widely conserved families, most of which containing homologs from pathogenic fungi, such as Candida albicans and Coccidioides immitis, which could favor the evolution of drug resistance in those species. By integrating data from chemical genetics with protein family conservation, genetic and protein interactions, we found that gene families rarely have more than one MDR, indicating that paralogs evolve asymmetrically with regard to multidrug resistance roles. Furthermore, MDRs have more genetic and protein interaction partners than non-MDRs, supporting their participation in complex biochemical systems underlying the tolerance to multiple bioactive molecules. MDRs share more chemical genetic interactions with other MDRs than with non-MDRs, regardless of their evolutionary affinity. These results suggest the existence of an intricate system involved in the global drug tolerance phenotypes. Finally, MDRs are more likely to be hit repeatedly by mutations in laboratory evolution experiments, indicating that they have great adaptive potential. The results presented here not only reveal the main genomic features underlying the evolution of MDRs, but also shed light on the gene families from which drug resistance is more likely to emerge in fungi.

  11. Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

    PubMed Central

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu


    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes. PMID:23755192

  12. Genome-Wide Identification, Characterization and Expression Analysis of the TCP Gene Family in Prunus mume.


    Zhou, Yuzhen; Xu, Zongda; Zhao, Kai; Yang, Weiru; Cheng, Tangren; Wang, Jia; Zhang, Qixiang


    TCP proteins, belonging to a plant-specific transcription factors family, are known to have great functions in plant development, especially flower and leaf development. However, there is little information about this gene family in Prunus mume, which is widely cultivated in China as an ornamental and fruit tree. Here a genome-wide analysis of TCP genes was performed to explore their evolution in P. mume. Nineteen PmTCPs were identified and three of them contained putative miR319 target sites. Phylogenetic and comprehensive bioinformatics analyses of these genes revealed that different types of TCP genes had undergone different evolutionary processes and the genes in the same clade had similar chromosomal location, gene structure, and conserved domains. Expression analysis of these PmTCPs indicated that there were diverse expression patterns among different clades. Most TCP genes were predominantly expressed in flower, leaf, and stem, and showed high expression levels in the different stages of flower bud differentiation, especially in petal formation stage and gametophyte development. Genes in TCP-P subfamily had main roles in both flower development and gametophyte development. The CIN genes in double petal cultivars might have key roles in the formation of petal, while they were correlated with gametophyte development in the single petal cultivar. The CYC/TB1 type genes were highly detected in the formation of petal and pistil. The less-complex flower types of P. mume might result from the fact that there were only two CYC type genes present in P. mume and a lack of CYC2 genes to control the identity of flower types. These results lay the foundation for further study on the functions of TCP genes during flower development.

  13. Genome-Wide Identification, Characterization and Expression Analysis of the TCP Gene Family in Prunus mume

    PubMed Central

    Zhou, Yuzhen; Xu, Zongda; Zhao, Kai; Yang, Weiru; Cheng, Tangren; Wang, Jia; Zhang, Qixiang


    TCP proteins, belonging to a plant-specific transcription factors family, are known to have great functions in plant development, especially flower and leaf development. However, there is little information about this gene family in Prunus mume, which is widely cultivated in China as an ornamental and fruit tree. Here a genome-wide analysis of TCP genes was performed to explore their evolution in P. mume. Nineteen PmTCPs were identified and three of them contained putative miR319 target sites. Phylogenetic and comprehensive bioinformatics analyses of these genes revealed that different types of TCP genes had undergone different evolutionary processes and the genes in the same clade had similar chromosomal location, gene structure, and conserved domains. Expression analysis of these PmTCPs indicated that there were diverse expression patterns among different clades. Most TCP genes were predominantly expressed in flower, leaf, and stem, and showed high expression levels in the different stages of flower bud differentiation, especially in petal formation stage and gametophyte development. Genes in TCP-P subfamily had main roles in both flower development and gametophyte development. The CIN genes in double petal cultivars might have key roles in the formation of petal, while they were correlated with gametophyte development in the single petal cultivar. The CYC/TB1 type genes were highly detected in the formation of petal and pistil. The less-complex flower types of P. mume might result from the fact that there were only two CYC type genes present in P. mume and a lack of CYC2 genes to control the identity of flower types. These results lay the foundation for further study on the functions of TCP genes during flower development. PMID:27630648

  14. Pyrin gene and mutants thereof, which cause familial Mediterranean fever


    Kastner, Daniel L.; Aksentijevichh, Ivona; Centola, Michael; Deng, Zuoming; Sood, Ramen; Collins, Francis S.; Blake, Trevor; Liu, P. Paul; Fischel-Ghodsian, Nathan; Gumucio, Deborah L.; Richards, Robert I.; Ricke, Darrell O.; Doggett, Norman A.; Pras, Mordechai


    The invention provides the nucleic acid sequence encoding the protein associated with familial Mediterranean fever (FMF). The cDNA sequence is designated as MEFV. The invention is also directed towards fragments of the DNA sequence, as well as the corresponding sequence for the RNA transcript and fragments thereof. Another aspect of the invention provides the amino acid sequence for a protein (pyrin) associated with FMF. The invention is directed towards both the full length amino acid sequence, fusion proteins containing the amino acid sequence and fragments thereof. The invention is also directed towards mutants of the nucleic acid and amino acid sequences associated with FMF. In particular, the invention discloses three missense mutations, clustered in within about 40 to 50 amino acids, in the highly conserved rfp (B30.2) domain at the C-terminal of the protein. These mutants include M6801, M694V, K695R, and V726A. Additionally, the invention includes methods for diagnosing a patient at risk for having FMF and kits therefor.

  15. Severe Gardner Syndrome in Families with Mutations Restricted to a Specific Region of the APC Gene

    PubMed Central

    Davies, D. Rhodri; Armstrong, John G.; Thakker, Nalin; Horner, Keith; Guy, Simon P.; Clancy, Tara; Sloan, Phil; Blair, Val; Dodd, Chris; Warnes, Tom W.; Harris, Rodney; Evans, D. Gareth R.


    Familial adenomatous polyposis (FAP) is associated with a number of extraintestinal manifestations, which include osteomas, epidermoid cysts, and desmoid tumors, often referred to as “Gardner syndrome.” Recent studies have suggested that some of the phenotypic features of FAP are dependent on the position of the mutation within the APC gene. In particular, the correlation between congenital hypertrophy of the retinal pigment epithelium (CHRPE) and APC genotype indicates that affected families may be divided into distinct groups. We have investigated the association between the dento-osseous features of GS on dental panoramic radiographs (DPRs) and APC genotype in a regional cohort of FAP families. DPRs were performed on 84 affected individuals from 36 families, and the dento-osseous features of FAP were quantified by a weighted scoring system. Significant DPR abnormalities were present in 69% of affected individuals. The APC gene mutation was identified in 27 of these families, and for statistical analysis these were subdivided into three groups. Group 1 comprised 18 affected individuals from seven families with mutations 5' of exon 9; these families (except one) did not express CHRPE. Groups 2 comprised 38 individuals from 16 families with mutations between exon 9 and codon 1444, all of whom expressed CHRPE. Group 3 comprised 11 individuals from four families with mutations 3' of codon 1444, none of whom expressed CHRPE. Families with mutations 3' of codon 1444 had significantly more lesions on DPRs (P < .001) and appeared to have a higher incidence of desmoid tumors. These results suggest that the severity of some of the features of Gardner syndrome may correlate with genotype in FAP. ImagesFigure 2 PMID:7485167

  16. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis

    PubMed Central

    Ye, Qiaolin; Yin, Tongming


    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I–III), with five subgroups (IIa–IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon–intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution

  17. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.


    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M


    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  18. Expansion, diversification, and expression of T-box family genes in Porifera.


    Holstien, Kay; Rivera, Ajna; Windsor, Pam; Ding, Siyu; Leys, Sally P; Hill, Malcolm; Hill, April


    Sponges are among the earliest diverging lineage within the metazoan phyla. Although their adult morphology is distinctive, at several stages of development, they possess characteristics found in more complex animals. The T-box family of transcription factors is an evolutionarily ancient gene family known to be involved in the development of structures derived from all germ layers in the bilaterian animals. There is an incomplete understanding of the role that T-box transcription factors play in normal sponge development or whether developmental pathways using the T-box family share similarities between parazoan and eumetazoan animals. To address these questions, we present data that identify several important T-box genes in marine and freshwater sponges, place these genes in a phylogenetic context, and reveal patterns in how these genes are expressed in developing sponges. Phylogenetic analyses demonstrate that sponges have members of at least two of the five T-box subfamilies (Brachyury and Tbx2/3/4/5) and that the T-box genes expanded and diverged in the poriferan lineage. Our analysis of signature residues in the sponge T-box genes calls into question whether "true" Brachyury genes are found in the Porifera. Expression for a subset of the T-box genes was elucidated in larvae from the marine demosponge, Halichondria bowerbanki. Our results show that sponges regulate the timing and specificity of gene expression for T-box orthologs across larval developmental stages. In situ hybridization reveals distinct, yet sometimes overlapping expression of particular T-box genes in free-swimming larvae. Our results provide a comparative framework from which we can gain insights into the evolution of developmentally important pathways.

  19. Importance of explanation before and after forensic autopsy to the bereaved family: lessons from a questionnaire study.


    Ito, Takako; Nobutomo, Koichi; Fujimiya, Tatsuya; Yoshida, Ken-ichi


    To investigate how bereaved families felt about the explanation received before and after forensic autopsies, the authors conducted a cross-sectional survey of the bereaved families whose next of kin underwent a forensic autopsy at the two Departments of Forensic Medicine and a few bereaved families of crime victims. Of 403 questionnaires sent, 126 families responded. Among 81.5% of the respondents who received an explanation from policemen before the autopsy, 78.8% felt that the quality of the explanation was poor or improper. In Japan, the law has restricted disclosure of information from a forensic autopsy. Despite legal restrictions, 82% wanted to hear from the person who conducted the autopsy. However, police explained the results of autopsy to 65.2% of respondents. Among the families whose frustration and anger increased after autopsy, 86.4% had not been satisfied with the explanation before the autopsy. Additionally, 57.7% had not been informed on the autopsy findings at the time of the questionnaire when more than 2 years had passed after the autopsy. These results reminded us of the importance of an explanation before and shortly after a forensic autopsy for a better understanding and acceptance by bereaved families.

  20. Mutations in the hairless gene underlie APL in three families of Pakistani origin

    PubMed Central

    Kraemer, Liv; Wajid, Muhammad; Shimomura, Yutaka; Christiano, Angela M.


    Summary Background Atrichia with papular lesions (APL) (OMIM#209500) is a rare autosomal recessively inherited form of irreversible alopecia characterized by papular lesions of keratin-filled cysts on various regions of the body. Males and females are equally affected and present with a distinct pattern of total hair loss on scalp, axilla and body. It begins shortly after birth with the development of hair loss, and patients are normally devoid of eyelashes and eyebrows. Mutations in the hairless (HR) gene have been previously shown to be responsible for APL. Objective In this study, we studied the molecular basis of APL in three unrelated families of Pakistani origin. Method Molecular analysis of the HR genes was performed on genomic DNA from probands and family members. Results DNA sequencing of the HR gene in family A revealed a novel homozygous 2 bp deletion in exon 6 leading to a frameshift and a downstream premature termination codon in exon 8 (1782-83delAG). In family B, we identified a novel homozygous deletion of a G nucleotide at the exon 15–intron 15 boundary, termed 3097delG. Family C carries a previously reported missense mutation consisting of an A-to-G transition at nucleotide 276 resulting in the mutation N970S in exon 14. Conclusion Two mutations identified in this study are novel mutations in the HR gene and extend the body of evidence implicating the hairless gene family in the pathogenesis of human skin disorders. The one previously reported mutation suggests it may represent a recurrent mutation, or alternatively, an allele that is widely dispersed around the world. PMID:18164595

  1. The genome and transcriptome of the zoonotic hookworm Ancylostoma ceylanicum identify infection-specific gene families.


    Schwarz, Erich M; Hu, Yan; Antoshechkin, Igor; Miller, Melanie M; Sternberg, Paul W; Aroian, Raffi V


    Hookworms infect over 400 million people, stunting and impoverishing them. Sequencing hookworm genomes and finding which genes they express during infection should help in devising new drugs or vaccines against hookworms. Unlike other hookworms, Ancylostoma ceylanicum infects both humans and other mammals, providing a laboratory model for hookworm disease. We determined an A. ceylanicum genome sequence of 313 Mb, with transcriptomic data throughout infection showing expression of 30,738 genes. Approximately 900 genes were upregulated during early infection in vivo, including ASPRs, a cryptic subfamily of activation-associated secreted proteins (ASPs). Genes downregulated during early infection included ion channels and G protein-coupled receptors; this downregulation was observed in both parasitic and free-living nematodes. Later, at the onset of heavy blood feeding, C-lectin genes were upregulated along with genes for secreted clade V proteins (SCVPs), encoding a previously undescribed protein family. These findings provide new drug and vaccine targets and should help elucidate hookworm pathogenesis.

  2. Characterization of the 11S globulin gene family in the castor plant Ricinus communis L.


    Chileh, Tarik; Esteban-García, Belén; Alonso, Diego López; García-Maroto, Federico


    The 11S globulin (legumin) gene family has been characterized in the castor plant Ricinus communis L. Phylogenetic analysis reveals the presence of two diverged subfamilies (RcLEG1 and RcLEG2) comprising a total of nine genes and two putative pseudogenes. The expression of castor legumin genes has been studied, indicating that it is seed specific and developmentally regulated, with a maximum at the stage when cellular endosperm reaches its full expansion (around 40-45 DAP). However, conspicuous differences are appreciated in the expression timing of individual genes. A characterization of the 5'-proximal regulatory regions for two genes, RcLEG1-1 and RcLEG2-1, representative of the two legumin subfamilies, has also been performed by fusion to the GUS reporter gene. The results obtained from heterologous expression in tobacco and transient expression in castor, indicating seed-specific regulation, support the possible utility of these promoters for biotechnological purposes.

  3. Identification and expression pattern of the chemosensory protein gene family in the silkworm, Bombyx mori.


    Gong, Da-Ping; Zhang, Hui-Jie; Zhao, Ping; Lin, Ying; Xia, Qing-You; Xiang, Zhong-Huai


    Insect chemosensory proteins (CSPs) as well as odorant-binding proteins (OBPs) have been supposed to transport hydrophobic chemicals to receptors on sensory neurons. Compared with OBPs, CSPs are expressed more broadly in various insect tissues. We performed a genome-wide analysis of the candidate CSP gene family in the silkworm. A total of 20 candidate CSPs, including 3 gene fragments and 2 pseudogenes, were characterized based on their conserved cysteine residues and their similarity to CSPs in other insects. Some of these genes were clustered in the silkworm genome. The gene expression pattern of these candidates was investigated using RT-PCR and microarray, and the results showed that these genes were expressed primarily in mature larvae and the adult moth, suggesting silkworm CSPs may be involved in development. The majority of silkworm CSP genes are expressed broadly in tissues including the antennae, head, thorax, legs, wings, epithelium, testes, ovaries, pheromone glands, wing disks, and compound eyes.

  4. Embryonic Expression of the Chicken Krüppel-like (KLF) Transcription Factor Gene Family

    PubMed Central

    Antin, Parker B.; Pier, Maricela; Sesepasara, Terry; Yatskievych, Tatiana A; Darnell, Diana K.


    The Krüppel-like transcription factors are zinc finger proteins that activate and suppress target gene transcription. Although KLF factors have been implicated in regulating many developmental processes, a comprehensive gene expression analysis has not been reported. Here we present the chicken KLF gene family and expression during the first five days of embryonic development. Fourteen chicken KLF genes or expressed sequences have been previously identified. Through synteny analysis and cDNA mapping we have identified the KLF9 gene and determined that the gene presently named KLF1 is the true ortholog of KLF17 in other species. In situ hybridization expression analyses show that in general KLFs are broadly expressed in multiple cell and tissue types. Expression of KLFs 3, 7, 8, and 9, is widespread at all stages examined. KLFs 2, 4, 5, 6, 10, 11, 15 and 17 show more restricted patterns that suggest multiple functions during early stages of embryonic development. PMID:20503383

  5. Clinical development of gene therapy: results and lessons from recent successes.


    Kumar, Sandeep Rp; Markusic, David M; Biswas, Moanaro; High, Katherine A; Herzog, Roland W


    Therapeutic gene transfer holds the promise of providing lasting therapies and even cures for diseases that were previously untreatable or for which only temporary or suboptimal treatments were available. For some time, clinical gene therapy was characterized by some impressive but rare examples of successes and also several setbacks. However, effective and long-lasting treatments are now being reported from gene therapy trials at an increasing pace. Positive outcomes have been documented for a wide range of genetic diseases (including hematological, immunological, ocular, and neurodegenerative and metabolic disorders) and several types of cancer. Examples include restoration of vision in blind patients, eradication of blood cancers for which all other treatments had failed, correction of hemoglobinopathies and coagulation factor deficiencies, and restoration of the immune system in children born with primary immune deficiency. To date, about 2,000 clinical trials for various diseases have occurred or are in progress, and many more are in the pipeline. Multiple clinical studies reported successful treatments of pediatric patients. Design of gene therapy vectors and their clinical development are advancing rapidly. This article reviews some of the major successes in clinical gene therapy of recent years.

  6. Clinical development of gene therapy: results and lessons from recent successes

    PubMed Central

    Kumar, Sandeep RP; Markusic, David M; Biswas, Moanaro; High, Katherine A; Herzog, Roland W


    Therapeutic gene transfer holds the promise of providing lasting therapies and even cures for diseases that were previously untreatable or for which only temporary or suboptimal treatments were available. For some time, clinical gene therapy was characterized by some impressive but rare examples of successes and also several setbacks. However, effective and long-lasting treatments are now being reported from gene therapy trials at an increasing pace. Positive outcomes have been documented for a wide range of genetic diseases (including hematological, immunological, ocular, and neurodegenerative and metabolic disorders) and several types of cancer. Examples include restoration of vision in blind patients, eradication of blood cancers for which all other treatments had failed, correction of hemoglobinopathies and coagulation factor deficiencies, and restoration of the immune system in children born with primary immune deficiency. To date, about 2,000 clinical trials for various diseases have occurred or are in progress, and many more are in the pipeline. Multiple clinical studies reported successful treatments of pediatric patients. Design of gene therapy vectors and their clinical development are advancing rapidly. This article reviews some of the major successes in clinical gene therapy of recent years. PMID:27257611

  7. [Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].


    Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe


    Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

  8. Evolution of the cutinase gene family: evidence for lateral gene transfer of a candidate Phytophthora virulence factor.


    Belbahri, Lassaad; Calmin, Gautier; Mauch, Felix; Andersson, Jan O


    Lateral gene transfer (LGT) can facilitate the acquisition of new functions in recipient lineages, which may enable them to colonize new environments. Several recent publications have shown that gene transfer between prokaryotes and eukaryotes occurs with appreciable frequency. Here we present a study of interdomain gene transfer of cutinases -- well documented virulence factors in fungi -- between eukaryotic plant pathogens Phytophthora species and prokaryotic bacterial lineages. Two putative cutinase genes were cloned from Phytophthora brassicae and Northern blotting experiments showed that these genes are expressed early during the infection of the host Arabidopsis thaliana and induced during cyst germination of the pathogen. Analysis of the gene organisation of this gene family in Phytophthora ramorum and P. sojae showed three and ten copies in tight succession within a region of 5 and 25 kb, respectively, probably indicating a recent expansion in Phytophthora lineages by gene duplications. Bioinformatic analyses identified orthologues only in three genera of Actinobacteria, and in two distantly related eukaryotic groups: oomycetes and fungi. Together with phylogenetic analyses this limited distribution of the gene in the tree of life strongly support a scenario where cutinase genes originated after the origin of land plants in a microbial lineage living in proximity of plants and subsequently were transferred between distantly related plant-degrading microbes. More precisely, a cutinase gene was likely acquired by an ancestor of P. brassicae, P. sojae, P. infestans and P. ramorum, possibly from an actinobacterial source, suggesting that gene transfer might be an important mechanism in the evolution of their virulence. These findings could indeed provide an interesting model system to study acquisition of virulence factors in these important plant pathogens.

  9. SVM-based generalized multifactor dimensionality reduction approaches for detecting gene-gene interactions in family studies.


    Fang, Yao-Hwei; Chiu, Yen-Feng


    Gene-gene interaction plays an important role in the etiology of complex diseases, which may exist without a genetic main effect. Most current statistical approaches, however, focus on assessing an interaction effect in the presence of the gene's main effects. It would be very helpful to develop methods that can detect not only the gene's main effects but also gene-gene interaction effects regardless of the existence of the gene's main effects while adjusting for confounding factors. In addition, when a disease variant is rare or when the sample size is quite limited, the statistical asymptotic properties are not applicable; therefore, approaches based on a reasonable and applicable computational framework would be practical and frequently applied. In this study, we have developed an extended support vector machine (SVM) method and an SVM-based pedigree-based generalized multifactor dimensionality reduction (PGMDR) method to study interactions in the presence or absence of main effects of genes with an adjustment for covariates using limited samples of families. A new test statistic is proposed for classifying the affected and the unaffected in the SVM-based PGMDR approach to improve performance in detecting gene-gene interactions. Simulation studies under various scenarios have been performed to compare the performances of the proposed and the original methods. The proposed and original approaches have been applied to a real data example for illustration and comparison. Both the simulation and real data studies show that the proposed SVM and SVM-based PGMDR methods have great prediction accuracies, consistencies, and power in detecting gene-gene interactions.

  10. Function and cancer genomics of FAT family genes

    PubMed Central



    FAT1, FAT2, FAT3 and FAT4 are human homologs of Drosophila Fat, which is involved in tumor suppression and planar cell polarity (PCP). FAT1 and FAT4 undergo the first proteolytic cleavage by Furin and are predicted to undergo the second cleavage by γ-secretase to release intracellular domain (ICD). Ena/VAPS-binding to FAT1 induces actin polymerization at lamellipodia and filopodia to promote cell migration, while Scribble-binding to FAT1 induces phosphorylation and functional inhibition of YAP1 to suppress cell growth. FAT1 is repressed in oral cancer owing to homozygous deletion or epigenetic silencing and is preferentially downregulated in invasive breast cancer. On the other hand, FAT1 is upregulated in leukemia and prognosis of preB-ALL patients with FAT1 upregulation is poor. FAT4 directly interacts with MPDZ/MUPP1 to recruit membrane-associated guanylate kinase MPP5/PALS1. FAT4 is involved in the maintenance of PCP and inhibition of cell proliferation. FAT4 mRNA is repressed in breast cancer and lung cancer due to promoter hypermethylation. FAT4 gene is recurrently mutated in several types of human cancers, such as melanoma, pancreatic cancer, gastric cancer and hepatocellular carcinoma. FAT1 and FAT4 suppress tumor growth via activation of Hippo signaling, whereas FAT1 promotes tumor migration via induction of actin polymerization. FAT1 is tumor suppressive or oncogenic in a context-dependent manner, while FAT4 is tumor suppressive. Copy number aberration, translocation and point mutation of FAT1, FAT2, FAT3, FAT4, FRMD1, FRMD6, NF2, WWC1, WWC2, SAV1, STK3, STK4, MOB1A, MOB1B, LATS1, LATS2, YAP1 and WWTR1/TAZ genes should be comprehensively investigated in various types of human cancers to elucidate the mutation landscape of the FAT-Hippo signaling cascades. Because YAP1 and WWTR1 are located at the crossroads of adhesion, GPCR, RTK and stem-cell signaling network, cancer genomics of the FAT signaling cascades could be applied for diagnostics, prognostics

  11. A novel homozygous mutation in the solute carrier family 12 member 3 gene in a Chinese family with Gitelman syndrome

    PubMed Central

    Zhang, Y.; Zhang, F.; Chen, D.; Lü, Q.; Tang, L.; Yang, C.; Lei, M.; Tong, N.


    Loss of function of mutated solute carrier family 12 member 3 (SLC12A3) gene is the most frequent etiology for Gitelman syndrome (GS), which is mainly manifested by hypokalemia, hypomagnesemia and hypocalciuria. We report the genetic characteristics of one suspicious Chinese GS pedigree by gene sequencing. Complete sequencing analysis of the SLC12A3 gene revealed that both the proband and his elder sister had a novel homozygous SLC12A3 mutation: c.2099T>C and p.Leu700Pro. Moreover, the SLC12A3 genes of his mother and daughter encoded the same mutated heterozygote. It was noted that in this pedigree, only the proband complained about recurrent episodes of bilateral lower limb weakness over 8 years, while his elder sister, mother and daughter did not present symptoms. The inconsistent clinical features of this pedigree implied that besides diverse phenotypes possibly originated from the same genotype, gender difference may also dominate the variant GS phenotypes. Further genetic and proteomic research are needed to investigate the precise mechanisms of GS, including the study of specific ethnicities. PMID:27783806

  12. Genome-wide identification and analysis of FK506-binding protein family gene family in strawberry (Fragaria × ananassa).


    Leng, Xiangpeng; Liu, Dan; Zhao, Mizhen; Sun, Xin; Li, Yu; Mu, Qian; Zhu, Xudong; Li, Pengyu; Fang, Jinggui


    The FK506 binding proteins (FKBPs) are abundant and ubiquitous proteins belonging to the large peptidyl-prolylcis-trans isomerase superfamily. FKBPs are known to be involved in many biological processes including hormone signaling, plant growth, and stress responses through a chaperone or an isomerization of proline residues during protein folding. The availability of complete strawberry genome sequences allowed the identification of 23 FKBP genes by HMMER and blast analysis. Chromosome scaffold locations of these FKBP genes in the strawberry genome were determined and the protein domain and motif organization of FaFKBPs analyzed. The phylogenetic relationships between strawberry FKBPs were also assessed. The expression profiles of FaFKBPs genes results revealed that most FaFKBPs were expressed in all tissues, while a few FaFKBPs were specifically expressed in some of the tissues. These data not only contribute to some better understanding of the complex regulation of the strawberry FKBP gene family, but also provide valuable information for further research in strawberry functional genomics.

  13. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    SciTech Connect

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin


    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  14. Hunting human disease genes: lessons from the past, challenges for the future.


    Brunham, Liam R; Hayden, Michael R


    The concept that a specific alteration in an individual's DNA can result in disease is central to our notion of molecular medicine. The molecular basis of more than 3,500 Mendelian disorders has now been identified. In contrast, the identification of genes for common disease has been much more challenging. We discuss historical and contemporary approaches to disease gene identification, focusing on novel opportunities such as the use of population extremes and the identification of rare variants. While our ability to sequence DNA has advanced dramatically, assigning function to a given sequence change remains a major challenge, highlighting the need for both bioinformatics and functional approaches to appropriately interpret these data. We review progress in mapping and identifying human disease genes and discuss future challenges and opportunities for the field.

  15. Endometrial Gene Expression in Early Pregnancy: Lessons From Human Ectopic Pregnancy

    PubMed Central

    Savaris, Ricardo F.; Hamilton, Amy E.; Lessey, Bruce A.; Giudice, Linda C.


    Human endometrium undergoes modifications in preparation for embryonic implantation. This study investigated in vivo the endocrine effects of pregnancy on the endometrium, using the model of ectopic pregnancy. Endometrial biopsies from 9 subjects with ectopic pregnancy (Preg) were compared with 8 and 6 samples of mid and late secretory endometrium, respectively. After hybridizing with Affymetrix HGU133 Plus 2 chips, data were analyzed using GeneSpring GX and Ingenuity Pathways Analysis. From 54 675 genes, 3021 genes were significantly differentiated when mid-secretory endometrium was compared with the Preg (Volcano plot; P < .05, ≥2-fold change). The complement and coagulation cascade, phospholid degradation, glycosphingolipid biosynthesis (globoseries), retinol metabolism, antigen presentation pathway, glycosphingolipid biosynthesis, and O-glycan biosynthesis were main significant canonical pathways found in Preg samples. Validation was done with reverse transcriptase polymerase chain reaction. In conclusion, the ectopic embryo has a significant impact, by an endocrine mechanism, on endometrium, when compared with the window of implantation. PMID:18591649

  16. Comparative analysis of genome-wide Mlo gene family in Cajanus cajan and Phaseolus vulgaris.


    Deshmukh, Reena; Singh, V K; Singh, B D


    The Mlo gene was discovered in barley because the mutant 'mlo' allele conferred broad-spectrum, non-race-specific resistance to powdery mildew caused by Blumeria graminis f. sp. hordei. The Mlo genes also play important roles in growth and development of plants, and in responses to biotic and abiotic stresses. The Mlo gene family has been characterized in several crop species, but only a single legume species, soybean (Glycine max L.), has been investigated so far. The present report describes in silico identification of 18 CcMlo and 20 PvMlo genes in the important legume crops Cajanus cajan (L.) Millsp. and Phaseolus vulgaris L., respectively. In silico analysis of gene organization, protein properties and conserved domains revealed that the C. cajan and P. vulgaris Mlo gene paralogs are more divergent from each other than from their orthologous pairs. The comparative phylogenetic analysis classified CcMlo and PvMlo genes into three major clades. A comparative analysis of CcMlo and PvMlo proteins with the G. max Mlo proteins indicated close association of one CcMlo, one PvMlo with two GmMlo genes, indicating that there was no further expansion of the Mlo gene family after the separation of these species. Thus, most of the diploid species of eudicots might be expected to contain 15-20 Mlo genes. The genes CcMlo12 and 14, and PvMlo11 and 12 are predicted to participate in powdery mildew resistance. If this prediction were verified, these genes could be targeted by TILLING or CRISPR to isolate powdery mildew resistant mutants.

  17. Genomewide survey and characterization of metacaspase gene family in rice (Oryza sativa).


    Wang, Likai; Zhang, Hua


    Metacaspases (MCs), which are cysteine-dependent proteases found in plants, fungi, and protozoa, may be involved in programmed cell death processes, being distant relatives of metazoan caspases. In this study, we analysed the structures, phylogenetic relationship, genome localizations, expression patterns and domestic selections of eight MC genes identified in rice (OsMC). Alignment analysis of the corresponding protein sequences suggested OsMC proteins can be classified into two subtypes. The expression profiles of eight OsMC genes were analysed in 27 tissues covering the whole life cycle of rice. There are four OsMC genes uniquely expressed in mature tissues, indicating that these genes might play certain roles in senescence. Under abiotic and biotic stresses, four OsMC genes were expressed with treatments of one or more of Magnaporthe oryzae (M. oryzae) infected, pest damaged, cold stress and drought stress, indicating they might be involved in plant defense. In addition, gene trees and genetic diversity (π) were performed to measure whether candidate genes were selected during rice domestication. The results suggested that all the type I genes could not be domestication genes. However, two of five type II OsMC genes showed strong evidence for selective sweep, suggesting that these genes might be involved in cultivated rice domestication. These results provide a foundation for future functional genomic studies of this family in rice.

  18. Comprehensive identification and expression analysis of Hsp90s gene family in Solanum lycopersicum.


    Zai, W S; Miao, L X; Xiong, Z L; Zhang, H L; Ma, Y R; Li, Y L; Chen, Y B; Ye, S G


    Heat shock protein 90 (Hsp90) is a protein produced by plants in response to adverse environmental stresses. In this study, we identified and analyzed Hsp90 gene family members using a bioinformatic method based on genomic data from tomato (Solanum lycopersicum L.). The results illustrated that tomato contains at least 7 Hsp90 genes distributed on 6 chromosomes; protein lengths ranged from 267-794 amino acids. Intron numbers ranged from 2-19 in the genes. The phylogenetic tree revealed that Hsp90 genes in tomato (Solanum lycopersicum L.), rice (Oryza sativa L.), and Arabidopsis (Arabidopsis thaliana L.) could be divided into 5 groups, which included 3 pairs of orthologous genes and 4 pairs of paralogous genes. Expression analysis of RNA-sequence data showed that the Hsp90-1 gene was specifically expressed in mature fruits, while Hsp90-5 and Hsp90-6 showed opposite expression patterns in various tissues of cultivated and wild tomatoes. The expression levels of the Hsp90-1, Hsp90-2, and Hsp90- 3 genes in various tissues of cultivated tomatoes were high, while both the expression levels of genes Hsp90-3 and Hsp90-4 were low. Additionally, quantitative real-time polymerase chain reaction showed that these genes were involved in the responses to yellow leaf curl virus in tomato plant leaves. Our results provide a foundation for identifying the function of the Hsp90 gene in tomato.

  19. Avirulence gene mapping in the Hessian fly (Mayetiola destructor) reveals a protein phosphatase 2C effector gene family.


    Zhao, Chaoyang; Shukle, Richard; Navarro-Escalante, Lucio; Chen, Mingshun; Richards, Stephen; Stuart, Jeffrey J


    The genetic tractability of the Hessian fly (HF, Mayetiola destructor) provides an opportunity to investigate the mechanisms insects use to induce plant gall formation. Here we demonstrate that capacity using the newly sequenced HF genome by identifying the gene (vH24) that elicits effector-triggered immunity in wheat (Triticum spp.) seedlings carrying HF resistance gene H24. vH24 was mapped within a 230-kb genomic fragment near the telomere of HF chromosome X1. That fragment contains only 21 putative genes. The best candidate vH24 gene in this region encodes a protein containing a secretion signal and a type-2 serine/threonine protein phosphatase (PP2C) domain. This gene has an H24-virulence associated insertion in its promoter that appears to silence transcription of the gene in H24-virulent larvae. Candidate vH24 is a member of a small family of genes that encode secretion signals and PP2C domains. It belongs to the fraction of genes in the HF genome previously predicted to encode effector proteins. Because PP2C proteins are not normally secreted, our results suggest that these are PP2C effectors that HF larvae inject into wheat cells to redirect, or interfere, with wheat signal transduction pathways.

  20. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene

    PubMed Central

    Moncayo-Arlandi, Javier; Allegue, Catarina; Iglesias, Anna; Mangas, Alipio; Brugada, Ramon


    Background Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations. Methods and Results Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64) in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased), 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment. Conclusions We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures. PMID:27391596

  1. Analysis of the KRT9 gene in a Mexican family with epidermolytic palmoplantar keratoderma.


    Lopez-Valdez, Jaime; Rivera-Vega, Maria Refugio; Gonzalez-Huerta, Luz Maria; Cazarin, Jorge; Cuevas-Covarrubias, Sergio


    Epidermolytic palmoplantar keratoderma (EPPK), an autosomal-dominant genodermatosis, is the most frequently occurring hereditary palmoplantar keratoderma. EPPK is characterized by hyperkeratosis of the palms and soles. Approximately 90% of patients present with mutations in the KRT9 gene, which encodes for keratin 9. Many of these mutations are located within the highly conserved coil 1A region of the alpha-helical rod domain of keratin 9, an important domain for keratin heterodimerization. The objective was to assess the clinical and molecular characteristics of a Mexican family with EPPK. The clinical characteristics of members of this family were analyzed. The KRT9 gene of affected members was polymerase chain reaction amplified from genomic DNA and sequenced. All affected members of the family had hyperkeratosis of the palms and soles with knuckle pads. The R163W mutation in the KRT9 gene was present in all affected individuals who were tested. Although R163W is the most frequent KRT9 mutation in patients with EPPK, only two families have been reported with knuckle pads associated with this mutation. Our findings indicate that knuckle pads can be associated with EPPK and the R163W mutation in a family with a genetic background different from that described here.

  2. Gene Family Expansions in Aphids Maintained by Endosymbiotic and Nonsymbiotic Traits

    PubMed Central

    Duncan, Rebecca P.; Feng, Honglin; Nguyen, Douglas M.; Wilson, Alex C. C.


    Facilitating the evolution of new gene functions, gene duplication is a major mechanism driving evolutionary innovation. Gene family expansions relevant to host/symbiont interactions are increasingly being discovered in eukaryotes that host endosymbiotic microbes. Such discoveries entice speculation that gene duplication facilitates the evolution of novel, endosymbiotic relationships. Here, using a comparative transcriptomic approach combined with differential gene expression analysis, we investigate the importance of endosymbiosis in retention of amino acid transporter paralogs in aphid genomes. To pinpoint the timing of amino acid transporter duplications we inferred gene phylogenies for five aphid species and three outgroups. We found that while some duplications arose in the aphid common ancestor concurrent with endosymbiont acquisition, others predate aphid divergence from related insects without intracellular symbionts, and still others appeared during aphid diversification. Interestingly, several aphid-specific paralogs have conserved enriched expression in bacteriocytes, the insect cells that host primary symbionts. Conserved bacteriocyte enrichment suggests that the transporters were recruited to the aphid/endosymbiont interface in the aphid common ancestor, consistent with a role for gene duplication in facilitating the evolution of endosymbiosis in aphids. In contrast, the temporal variability of amino acid transporter duplication indicates that endosymbiosis is not the only trait driving selection for retention of amino acid transporter paralogs in sap-feeding insects. This study cautions against simplistic interpretations of the role of gene family expansion in the evolution of novel host/symbiont interactions by further highlighting that multiple complex factors maintain gene family paralogs in the genomes of eukaryotes that host endosymbiotic microbes. PMID:26878871

  3. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava

    PubMed Central

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian


    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava. PMID:26904033

  4. Gene Family Expansions in Aphids Maintained by Endosymbiotic and Nonsymbiotic Traits.


    Duncan, Rebecca P; Feng, Honglin; Nguyen, Douglas M; Wilson, Alex C C


    Facilitating the evolution of new gene functions, gene duplication is a major mechanism driving evolutionary innovation. Gene family expansions relevant to host/symbiont interactions are increasingly being discovered in eukaryotes that host endosymbiotic microbes. Such discoveries entice speculation that gene duplication facilitates the evolution of novel, endosymbiotic relationships. Here, using a comparative transcriptomic approach combined with differential gene expression analysis, we investigate the importance of endosymbiosis in retention of amino acid transporter paralogs in aphid genomes. To pinpoint the timing of amino acid transporter duplications we inferred gene phylogenies for five aphid species and three outgroups. We found that while some duplications arose in the aphid common ancestor concurrent with endosymbiont acquisition, others predate aphid divergence from related insects without intracellular symbionts, and still others appeared during aphid diversification. Interestingly, several aphid-specific paralogs have conserved enriched expression in bacteriocytes, the insect cells that host primary symbionts. Conserved bacteriocyte enrichment suggests that the transporters were recruited to the aphid/endosymbiont interface in the aphid common ancestor, consistent with a role for gene duplication in facilitating the evolution of endosymbiosis in aphids. In contrast, the temporal variability of amino acid transporter duplication indicates that endosymbiosis is not the only trait driving selection for retention of amino acid transporter paralogs in sap-feeding insects. This study cautions against simplistic interpretations of the role of gene family expansion in the evolution of novel host/symbiont interactions by further highlighting that multiple complex factors maintain gene family paralogs in the genomes of eukaryotes that host endosymbiotic microbes.

  5. History of a prolific family: the Hes/Hey-related genes of the annelid Platynereis

    PubMed Central


    Background The Hes superfamily or Hes/Hey-related genes encompass a variety of metazoan-specific bHLH genes, with somewhat fuzzy phylogenetic relationships. Hes superfamily members are involved in a variety of major developmental mechanisms in metazoans, notably in neurogenesis and segmentation processes, in which they often act as direct effector genes of the Notch signaling pathway. Results We have investigated the molecular and functional evolution of the Hes superfamily in metazoans using the lophotrochozoan Platynereis dumerilii as model. Our phylogenetic analyses of more than 200 Metazoan Hes/Hey-related genes revealed the presence of five families, three of them (Hes, Hey and Helt) being pan-metazoan. Those families were likely composed of a unique representative in the last common metazoan ancestor. The evolution of the Hes family was shaped by many independent lineage specific tandem duplication events. The expression patterns of 13 of the 15 Hes/Hey-related genes in Platynereis indicate a broad functional diversification. Nevertheless, a majority of these genes are involved in two crucial developmental processes in annelids: neurogenesis and segmentation, resembling functions highlighted in other animal models. Conclusions Combining phylogenetic and expression data, our study suggests an unusual evolutionary history for the Hes superfamily. An ancestral multifunctional annelid Hes gene may have undergone multiples rounds of duplication-degeneration-complementation processes in the lineage leading to Platynereis, each gene copies ensuring their maintenance in the genome by subfunctionalisation. Similar but independent waves of duplications are at the origin of the multiplicity of Hes genes in other metazoan lineages. PMID:25250171

  6. Caspases in plants: metacaspase gene family in plant stress responses.


    Fagundes, David; Bohn, Bianca; Cabreira, Caroline; Leipelt, Fábio; Dias, Nathalia; Bodanese-Zanettini, Maria H; Cagliari, Alexandro


    Programmed cell death (PCD) is an ordered cell suicide that removes unwanted or damaged cells, playing a role in defense to environmental stresses and pathogen invasion. PCD is component of the life cycle of plants, occurring throughout development from embryogenesis to the death. Metacaspases are cysteine proteases present in plants, fungi, and protists. In certain plant-pathogen interactions, the PCD seems to be mediated by metacaspases. We adopted a comparative genomic approach to identify genes coding for the metacaspases in Viridiplantae. We observed that the metacaspase was divided into types I and II, based on their protein structure. The type I has a metacaspase domain at the C-terminus region, presenting or not a zinc finger motif in the N-terminus region and a prodomain rich in proline. Metacaspase type II does not feature the prodomain and the zinc finger, but has a linker between caspase-like catalytic domains of 20 kDa (p20) and 10 kDa (p10). A high conservation was observed in the zinc finger domain (type I proteins) and in p20 and p10 subunits (types I and II proteins). The phylogeny showed that the metacaspases are divided into three principal groups: type I with and without zinc finger domain and type II metacaspases. The algae and moss are presented as outgroup, suggesting that these three classes of metacaspases originated in the early stages of Viridiplantae, being the absence of the zinc finger domain the ancient condition. The study of metacaspase can clarify their assignment and involvement in plant PCD mechanisms.

  7. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.


    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S


    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.Molecular Psychiatry advance online publication, 26 July 2016; doi:10.1038/mp.2016.109.

  8. Genome structure drives patterns of gene family evolution in ciliates, a case study using Chilodonella uncinata (Protista, Ciliophora, Phyllopharyngea).


    Gao, Feng; Song, Weibo; Katz, Laura A


    In most lineages, diversity among gene family members results from gene duplication followed by sequence divergence. Because of the genome rearrangements during the development of somatic nuclei, gene family evolution in ciliates involves more complex processes. Previous work on the ciliate Chilodonella uncinata revealed that macronuclear β-tubulin gene family members are generated by alternative processing, in which germline regions are alternatively used in multiple macronuclear chromosomes. To further study genome evolution in this ciliate, we analyzed its transcriptome and found that (1) alternative processing is extensive among gene families; and (2) such gene families are likely to be C. uncinata specific. We characterized additional macronuclear and micronuclear copies of one candidate alternatively processed gene family-a protein kinase domain containing protein (PKc)-from two C. uncinata strains. Analysis of the PKc sequences reveals that (1) multiple PKc gene family members in the macronucleus share some identical regions flanked by divergent regions; and (2) the shared identical regions are processed from a single micronuclear chromosome. We discuss analogous processes in lineages across the eukaryotic tree of life to provide further insights on the impact of genome structure on gene family evolution in eukaryotes.

  9. Identification and expression analysis of BMP signaling inhibitors genes of the DAN family in amphioxus.


    Le Petillon, Yann; Oulion, Silvan; Escande, Marie-Line; Escriva, Hector; Bertrand, Stephanie


    Bone morphogenetic proteins (BMPs) are members of the Transforming Growth Factor-β (TGF-β) family implicated in many developmental processes in metazoans such as embryo axes specification. Their wide variety of actions is in part controlled by inhibitors that impede the interaction of BMPs with their specific receptors. Here, we focused our attention on the Differential screening-selected gene Aberrative in Neuroblastoma (DAN) family of inhibitors. Although they are well-characterized in vertebrates, few data are available for this family in other metazoan species. In order to understand the evolution of potential developmental roles of these inhibitors in chordates, we identified the members of this family in the cephalochordate amphioxus, and characterized their expression patterns during embryonic development. Our data suggest that the function of Cerberus/Dand5 subfamily genes is conserved among chordates, whereas Gremlin1/2 and NBL1 subfamily genes seem to have acquired divergent expression patterns in each chordate lineage. On the other hand, the expression of Gremlin in the amphioxus neural plate border during early neurulation strengthens the hypothesis of a conserved neural plate border gene network in chordates.

  10. Characterization and expression of the beta-N-acetylglucosaminidase gene family of Tribolium castaneum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enzymes belonging to the Beta-N-acetylglucosaminidase (NAG) family cleave chitin oligosaccharides produced by the action of chitinases on chitin into the constituent N-acetylglucosamine monomer. Four genes encoding putative NAGs in the red flour beetle, Tribolium castaneum, namely TcNAG1, TcFDL, Tc...

  11. LASS6, an additional member of the longevity assurance gene family.


    Weinmann, Arndt; Galle, Peter R; Teufel, Andreas


    Longevity assurance genes (LAGs) represent a subgroup of the homeobox gene family. Five mammalian homologs have been reported, and the corresponding proteins have previously been investigated with respect to their key role in ceramide synthesis. However, members of the LAG family have been shown to be involved in cell growth regulation and cancer differentiation. In an effort to characterize additional members of the LAG family, we have screened the latest releases of genomic databases and report on the bioinformatic characterization of yet another member, LAG1 longevity assurance homolog 6 (LASS6). Like other LAG family members, the LASS6 protein contained a homeodomain and LAG1 domain. In phylogenetic analyses, it displayed highest homology to LASS5. The corresponding gene was localized to human chromosome 2q24.3, spanning a rather large genomic region of 318 kb. Orthologous sequences in mouse and zebrafish suggested a conservation of LASS6 in vertebrates as the protein and corresponding genomic sequences were highly conserved. LASS6 expression was analyzed in silico, and the gene was shown to be broadly expressed in a wide range of tissues. Furthermore, available microarray data suggested a role in cancer differentiation and early embryonic development.

  12. Identification and characterization of thrombospondin-4, a new member of the thrombospondin gene family

    PubMed Central


    A new member of the thrombospondin gene family, designated thrombospondin-4, has been identified in the Xenopus laevis genome. The predicted amino acid sequence indicates that the protein is similar to the other members of this gene family in the structure of the type 3 repeats and the COOH-terminal domain. Thrombospondin-4 contains four type 2 repeats and lacks the type 1 repeats that are found in thrombospondin-1 and 2. The amino-terminal domain of thrombospondin-4 has no significant homology with the other members of the thrombospondin gene family or with other proteins in the database. RNAse protection analysis establishes that the initial expression of Xenopus thrombospondin-4 is observed during neurulation. Levels of mRNA expression increase twofold during tailbud stages but decrease by the feeding tadpole stage. The size of the thrombospondin-4 message is 3.3 Kb and 3.4 Kb in the frog and human, respectively. Northern blot analysis of human tissues reveals high levels of thrombospondin-4 expression in heart and skeletal muscle, low levels in brain, lung and pancreas and undetectable levels in the placenta, liver and kidney. These data establish the existence of a new member of the thrombospondin gene family that may participate in the genesis and function of cardiac and skeletal muscle. PMID:8432726

  13. Mutational analysis of the androgen receptor gene in two Chinese families with complete androgen insensitivity syndrome.


    Wang, Song; Xu, Haikun; An, Wei; Zhu, Dechun; Li, Dejun


    Androgens are essential for normal male sex differentiation and are responsible for the normal development of male secondary sexual characteristics at puberty. The physiological effects of androgens are mediated by the androgen receptor (AR). Mutations in the AR gene are the most common cause of androgen insensitivity syndrome. The present study undertook a genetic analysis of the AR gene in two unrelated families affected by complete androgen insensitivity syndrome (CAIS) in China. In family 1, a previously reported nonsense mutation (G-to-A; p.W751X) was identified in exon 5 of the AR gene. In addition, a novel missense mutation was detected in exon 6 of the AR gene from family 2; this mutation resulted in a predicted amino acid change from phenylalanine to serine at codon 804 (T-to-C; p.F804S) in the ligand-binding domain (LBD) of AR. Computer simulation of the structural changes generated by the p.F804S substitution revealed marked conformational alterations in the hydrophobic core responsible for the stability and function of the AR-LBD. In conclusion, the present study identified two mutations from two unrelated Chinese families affected by CAIS. The novel mutation (p.F804S) may provide insights into the molecular mechanism underlying CAIS. Furthermore, it expands on the number of mutational hot spots in the international AR mutation database, which may be useful in the future for prenatal diagnosis and genetic counseling.


    EPA Science Inventory

    Creeping bentgrass (CBG) expressing an engineered gene for resistance to glyphosate herbicide is one of the first genetically modified (GM) perennial crops to undergo regulatory review for commercial release by the US Department of Agriculture Animal Plant Health and Inspection S...

  15. Lessons from the canine Oxtr gene: populations, variants and functional aspects.


    Bence, M; Marx, P; Szantai, E; Kubinyi, E; Ronai, Z; Banlaki, Z


    Oxytocin receptor (OXTR) acts as a key behavioral modulator of the central nervous system, affecting social behavior, stress, affiliation and cognitive functions. Variants of the Oxtr gene are known to influence behavior both in animals and humans; however, canine Oxtr polymorphisms are less characterized in terms of possible relevance to function, selection criteria in breeding and domestication. In this report, we provide a detailed characterization of common variants of the canine Oxtr gene. In particular (1) novel polymorphisms were identified by direct sequencing of wolf and dog samples, (2) allelic distributions and pairwise linkage disequilibrium patterns of several canine populations were compared, (3) neighbor joining (NJ) tree based on common single nucleotide polymorphisms (SNPs) was constructed, (4) mRNA expression features were assessed, (5) a novel splice variant was detected and (6) in vitro functional assays were performed. Results indicate marked differences regarding Oxtr variations between purebred dogs of different breeds, free-ranging dog populations, wolf subspecies and golden jackals. This, together with existence of explicitly dog-specific alleles and data obtained from the NJ tree implies that Oxtr could indeed have been a target gene during domestication and selection for human preferred aspects of temperament and social behavior. This assumption is further supported by the present observations on gene expression patterns within the brain and luciferase reporter experiments, providing a molecular level link between certain canine Oxtr polymorphisms and differences in nervous system function and behavior.

  16. Gene structure, chromosomal localization, and expression pattern of Capn12, a new member of the calpain large subunit gene family.


    Dear, T N; Meier, N T; Hunn, M; Boehm, T


    We report the identification of mouse Capn12, a new member of the calpain large subunit gene family. It possesses potential protease and calcium-binding domains, features typical of the classical calpains. In situ hybridization and Northern blot analysis demonstrate that during the anagen phase of the hair cycle the cortex of the hair follicle is the major expression site of Capn12. The gene was sequenced in its entirety and consists of 21 exons spanning 13 kb with an exon-intron structure typical of the calpain gene family. The last exon of the mouse Actn4 gene overlaps the 3' end of Capn12 but in the opposite orientation. This overlap between the two genes is conserved in the human genome. Three versions of the Capn12 mRNA transcript were identified. They occur as a result of alternative splicing, and two of these encode a protein lacking the C-terminal calmodulin-like domain. Radiation hybrid mapping localized Capn12 to mouse chromosome 7, closely linked to a marker positioned at 10.4 cM. Refined mapping of Capn5, also previously localized to chromosome 7, indicated that it was not closely linked to Capn12, mapping tightly linked to a marker positioned at 48.5 cM.

  17. Genomic sequence and organization of two members of a human lectin gene family

    SciTech Connect

    Gitt, M.A.; Barondes, S.H. )


    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family.

  18. The Rh protein family: gene evolution, membrane biology, and disease association.


    Huang, Cheng-Han; Ye, Mao


    The Rh (Rhesus) genes encode a family of conserved proteins that share a structural fold of 12 transmembrane helices with members of the major facilitator superfamily. Interest in this family has arisen from the discovery of Rh factor's involvement in hemolytic disease in the fetus and newborn, and of its homologs widely expressed in epithelial tissues. The Rh factor and Rh-associated glycoprotein (RhAG), with epithelial cousins RhBG and RhCG, form four subgroups conferring upon vertebrates a genealogical commonality. The past decade has heralded significant advances in understanding the phylogenetics, allelic diversity, crystal structure, and biological function of Rh proteins. This review describes recent progress on this family and the molecular insights gleaned from its gene evolution, membrane biology, and disease association. The focus is on its long evolutionary history and surprising structural conservation from prokaryotes to humans, pointing to the importance of its functional role, related to but distinct from ammonium transport proteins.

  19. Lessons learned from family-centred models of treatment for children living with HIV: current approaches and future directions

    PubMed Central


    Background Despite strong global interest in family-centred HIV care models, no reviews exist that detail the current approaches to family-centred care and their impact on the health of children with HIV. A systematic review of family-centred HIV care programmes was conducted in order to describe both programme components and paediatric cohort characteristics. Methods We searched online databases, including PubMed and the International AIDS Society abstract database, using systematic criteria. Data were extracted regarding programme setting, staffing, services available and enrolment methods, as well as cohort demographics and paediatric outcomes. Results The search yielded 25 publications and abstracts describing 22 separate cohorts. These contained between 43 and 657 children, and varied widely in terms of staffing, services provided, enrolment methods and cohort demographics. Data on clinical outcomes was limited, but generally positive. Excellent adherence, retention in care, and low mortality and/or loss to follow up were documented. Conclusions The family-centred model of care addresses many needs of infected patients and other household members. Major reported obstacles involved recruiting one or more types of family members into care, early diagnosis and treatment of infected children, preventing mortality during children's first six months of highly active antiretroviral therapy, and staffing and infrastructural limitations. Recommendations include: developing interventions to enrol hard-to-reach populations; identifying high-risk patients at treatment initiation and providing specialized care; and designing and implementing evidence-based care packages. Increased research on family-centred care, and better documentation of interventions and outcomes is also critical. PMID:20573285

  20. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    SciTech Connect

    Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.


    Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten

  1. Convergent gene loss following gene and genome duplications creates single-copy families in flowering plants.


    De Smet, Riet; Adams, Keith L; Vandepoele, Klaas; Van Montagu, Marc C E; Maere, Steven; Van de Peer, Yves


    The importance of gene gain through duplication has long been appreciated. In contrast, the importance of gene loss has only recently attracted attention. Indeed, studies in organisms ranging from plants to worms and humans suggest that duplication of some genes might be better tolerated than that of others. Here we have undertaken a large-scale study to investigate the existence of duplication-resistant genes in the sequenced genomes of 20 flowering plants. We demonstrate that there is a large set of genes that is convergently restored to single-copy status following multiple genome-wide and smaller scale duplication events. We rule out the possibility that such a pattern could be explained by random gene loss only and therefore propose that there is selection pressure to preserve such genes as singletons. This is further substantiated by the observation that angiosperm single-copy genes do not comprise a random fraction of the genome, but instead are often involved in essential housekeeping functions that are highly conserved across all eukaryotes. Furthermore, single-copy genes are generally expressed more highly and in more tissues than non-single-copy genes, and they exhibit higher sequence conservation. Finally, we propose different hypotheses to explain their resistance against duplication.

  2. Genome-wide analysis of SAUR gene family in Solanaceae species.


    Wu, Jian; Liu, Songyu; He, Yanjun; Guan, Xiaoyan; Zhu, Xiangfei; Cheng, Lin; Wang, Jie; Lu, Gang


    The plant hormone auxin plays a vital role in regulating many aspects of plant growth and development. Small auxin up-regulated RNAs (SAURs) are primary auxin response genes hypothesized to be involved in auxin signaling pathway, but their functions remain unclear. Here, a genome-wide search for SAUR gene homologues in Solanaceae species identified 99 and 134 members of SAUR gene family from tomato and potato, respectively. Phylogenetic analysis indicated that the SAUR proteins from Arabidopsis, rice, sorghum, tomato and potato were divided into four major groups with 16 subgroups. Among them, 25 histidine-rich SAURs genes with metal-binding characteristics were found in Arabidopsis, sorghum and Solanaceae species, but not in rice. Using tomato as a model, a comprehensive overview of SAUR gene family is presented, including the gene structures, phylogeny and chromosome locations. Quantitative real-time PCR analysis indicated that 11 randomly selected SlSAUR genes in tomato could be expressed at least in one of the tomato organs/tissues tested. However, different SlSAUR genes displayed distinctive expression levels. SlSAUR16 and SlSAUR71 exhibited highly tissue-specific expression patterns. Almost all of the detected SlSAURs showed an accumulating pattern of mRNA along tomato flower and fruit development. Some of them displayed differential response to exogenous IAA treatment. The abiotic (cold, salt and drought) stresses significantly modified transcript levels of SlSAURs genes. Most of them were down-regulated in response to abiotic stresses (drought, heat and salinity), but SlSAUR58, as a histidine-rich SAUR gene, was up-regulated after salt treatment, indicating that it may play a specific role in the salt signaling transduction pathway. Our comparative analysis provides some basic genomic information for the SAUR genes in the Solanaceae species and will pave the way for deciphering their function during plant development.

  3. Genome-Wide Analysis and Characterization of Aux/IAA Family Genes in Brassica rapa

    PubMed Central

    Rameneni, Jana Jeevan; Li, Xiaonan; Sivanandhan, Ganesan; Choi, Su Ryun; Pang, Wenxing; Im, Subin; Lim, Yong Pyo


    Auxins are the key players in plant growth development involving leaf formation, phototropism, root, fruit and embryo development. Auxin/Indole-3-Acetic Acid (Aux/IAA) are early auxin response genes noted as transcriptional repressors in plant auxin signaling. However, many studies focus on Aux/ARF gene families and much less is known about the Aux/IAA gene family in Brassica rapa (B. rapa). Here we performed a comprehensive genome-wide analysis and identified 55 Aux/IAA genes in B. rapa using four conserved motifs of Aux/IAA family (PF02309). Chromosomal mapping of the B. rapa Aux/IAA (BrIAA) genes facilitated understanding cluster rearrangement of the crucifer building blocks in the genome. Phylogenetic analysis of BrIAA with Arabidopsis thaliana, Oryza sativa and Zea mays identified 51 sister pairs including 15 same species (BrIAA—BrIAA) and 36 cross species (BrIAA—AtIAA) IAA genes. Among the 55 BrIAA genes, expression of 43 and 45 genes were verified using Genebank B. rapa ESTs and in home developed microarray data from mature leaves of Chiifu and RcBr lines. Despite their huge morphological difference, tissue specific expression analysis of BrIAA genes between the parental lines Chiifu and RcBr showed that the genes followed a similar pattern of expression during leaf development and a different pattern during bud, flower and siliqua development stages. The response of the BrIAA genes to abiotic and auxin stress at different time intervals revealed their involvement in stress response. Single Nucleotide Polymorphisms between IAA genes of reference genome Chiifu and RcBr were focused and identified. Our study examines the scope of conservation and divergence of Aux/IAA genes and their structures in B. rapa. Analyzing the expression and structural variation between two parental lines will significantly contribute to functional genomics of Brassica crops and we belive our study would provide a foundation in understanding the Aux/IAA genes in B. rapa. PMID

  4. Genome-Wide Analysis and Characterization of Aux/IAA Family Genes in Brassica rapa.


    Paul, Parameswari; Dhandapani, Vignesh; Rameneni, Jana Jeevan; Li, Xiaonan; Sivanandhan, Ganesan; Choi, Su Ryun; Pang, Wenxing; Im, Subin; Lim, Yong Pyo


    Auxins are the key players in plant growth development involving leaf formation, phototropism, root, fruit and embryo development. Auxin/Indole-3-Acetic Acid (Aux/IAA) are early auxin response genes noted as transcriptional repressors in plant auxin signaling. However, many studies focus on Aux/ARF gene families and much less is known about the Aux/IAA gene family in Brassica rapa (B. rapa). Here we performed a comprehensive genome-wide analysis and identified 55 Aux/IAA genes in B. rapa using four conserved motifs of Aux/IAA family (PF02309). Chromosomal mapping of the B. rapa Aux/IAA (BrIAA) genes facilitated understanding cluster rearrangement of the crucifer building blocks in the genome. Phylogenetic analysis of BrIAA with Arabidopsis thaliana, Oryza sativa and Zea mays identified 51 sister pairs including 15 same species (BrIAA-BrIAA) and 36 cross species (BrIAA-AtIAA) IAA genes. Among the 55 BrIAA genes, expression of 43 and 45 genes were verified using Genebank B. rapa ESTs and in home developed microarray data from mature leaves of Chiifu and RcBr lines. Despite their huge morphological difference, tissue specific expression analysis of BrIAA genes between the parental lines Chiifu and RcBr showed that the genes followed a similar pattern of expression during leaf development and a different pattern during bud, flower and siliqua development stages. The response of the BrIAA genes to abiotic and auxin stress at different time intervals revealed their involvement in stress response. Single Nucleotide Polymorphisms between IAA genes of reference genome Chiifu and RcBr were focused and identified. Our study examines the scope of conservation and divergence of Aux/IAA genes and their structures in B. rapa. Analyzing the expression and structural variation between two parental lines will significantly contribute to functional genomics of Brassica crops and we belive our study would provide a foundation in understanding the Aux/IAA genes in B. rapa.

  5. Identification and expression analysis of WRKY family genes under biotic and abiotic stresses in Brassica rapa.


    Kayum, Md Abdul; Jung, Hee-Jeong; Park, Jong-In; Ahmed, Nasar Uddin; Saha, Gopal; Yang, Tae-Jin; Nou, Ill-Sup


    WRKY proteins constitute one of the largest transcription factor families in higher plants, and they are involved in multiple biological processes such as plant development, metabolism, and responses to biotic and abiotic stresses. Genes of this family have been well documented in response to many abiotic and biotic stresses in many plant species, but not yet against Pectobacterium carotovorum subsp. carotovorum and Fusarium oxysporum f.sp. conglutinans in any of the plants. Moreover, potentiality of a specific gene may vary depending on stress conditions and genotypes. To identify stress resistance-related potential WRKY genes of Brassica rapa, we analyzed their expressions against above-mentioned pathogens and cold, salt, and drought stresses in B. rapa. Stress resistance-related functions of all Brassica rapa WRKY (BrWRKY) genes were firstly analyzed through homology study with existing biotic and abiotic stress resistance-related WRKY genes of other plant species and found a high degree of homology. We then identified all BrWRKY genes in a Br135K microarray dataset, which was created by applying low-temperature stresses to two contrasting Chinese cabbage doubled haploid (DH) lines, Chiifu and Kenshin, and selected 41 BrWRKY genes with high and differential transcript abundance levels. These selected genes were further investigated under cold, salt, and drought stresses as well as after infection with P. carotovorum subsp. carotovorum and F. oxysporum f.sp. conglutinans in B. rapa. The selected genes showed an organ-specific expression, and 22 BrWRKY genes were differentially expressed in Chiifu compared to Kenshin under cold and drought stresses. Six BrWRKY genes were more responsive in Kenshin compared to Chiffu under salt stress. In addition, eight BrWRKY genes showed differential expression after P. carotovorum subsp. carotovorum infection and five genes after F. oxysporum f.sp. conglutinans infection in B. rapa. Thus, the differentially expressed Br

  6. Cloning and characterization of SOX5, a new member of the human SOX gene family

    SciTech Connect

    Wunderle, V.M.; Critcher, R.; Goodfellow, P.N.; Ashworth, A.


    The mammalian Y-linked testis determining gene, SRY, encodes a protein with a DNA binding motif known as the HMG box. A large family of genes sharing a high similarity with the SRY HMG box and named Sox (Sry-related HMG box) in mouse and SOX in human has been identified from various organisms. We have cloned SOX5, a new member of the human SOX gene family. SOX5 cDNAs isolated from a human adult testis cDNA library show a high similarity with the mouse Sox5 transcript over a large region identical in all the human cDNAs. However, comparison of the 5{prime} unique sequences of the cDNAs suggests that the SOX5 gene is subject to alternative splicing. Genomic analysis identified a SOX5 pseudogene located on 8q21.1, whereas the SOX5 gene itself, which contains a minimum of five introns, maps to 12p12.1. In contrast to the mouse gene, the human SOX5 gene is expressed in a variety of human tissues, and different size transcripts are observed in adult testis and fetal brain. 19 refs., 5 figs.

  7. Cloning and characterization of two members of the vertebrate Dlx gene family.

    PubMed Central

    Simeone, A; Acampora, D; Pannese, M; D'Esposito, M; Stornaiuolo, A; Gulisano, M; Mallamaci, A; Kastury, K; Druck, T; Huebner, K


    A number of vertebrate genes of the Dlx gene family have been cloned in mouse, frog, and zebrafish. These genes contain a homeobox related to that of Distalless, a gene expressed in the developing head and limbs of Drosophila embryos. We cloned and studied the expression of two members of this family, which we named Dlx5 and Dlx6, in human and mouse. The two human genes, DLX5 and DLX6, are closely linked in an inverted convergent configuration in a region of chromosome 7, at 7q22. Similarly, the two human genes DLX1 and DLX2 are closely linked in a convergent configuration at 2q32, near the HOXD (previously HOX4) locus. In situ hybridization experiments in mouse embryos revealed expression of Dlx5 and Dlx6 mRNA in restricted regions of ventral diencephalon and basal telencephalon, with a distribution very similar to that reported for Dlx1 and Dlx2 mRNA. A surprising feature of Dlx5 and Dlx6 is that they are also expressed in all skeletal structures of midgestation embryos after the first cartilage formation. The expression pattern of these genes, together with their chromosome localization, may provide useful cues for the study of congenital disorders in which there is a combination of craniofacial and limb defects. Images PMID:7907794

  8. Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).


    Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W


    GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.

  9. Positive selection in the SLC11A1 gene in the family Equidae.


    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr


    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  10. Dynein light chain family genes in 15 plant species: Identification, evolution and expression profiles.


    Cao, Jun; Li, Xiangyang; Lv, Yueqing


    Dynein light chain (DLC) is one important component of the dynein complexes, which have been proved involving in a variety of cellular functions. However, higher plants lack all other components of the complexes except DLCs, suggesting that in plants, the DLC protein does not carry out the same function as it in animals. Therefore, the function of this family in plants is mysterious. In this study, we investigated the DLC gene family in 15 plant species and analyzed their expression profiles. In total, 128 DLC genes were identified from the 15 studied plant species and were divided into eight groups by their phylogenetic relation. Highly conserved gene structure and motif arrangement was discovered within each group, indicating their functional correlation. Genetic variation and recombination events were also detected in DLC genes. Through selection analyses, we also identified some significant site-specific constraints in most of the DLC paralogs. In addition, DLC genes presented various expression profiles in different development stages, or under different abiotic stresses or phytohormone treatments. This may be associated with a variety of cis-elements responding to stress and phytohormone in the upstream sequences of the DLC genes. Functional network analysis exhibited 123 physical or functional interactions. The results provide a foundation for exploring the characterization of the DLC genes in plants and offer insights for additional functional studies.

  11. Systematic identification of gene family regulators in mouse and human embryonic stem cells

    PubMed Central

    Aaronson, Yair; Livyatan, Ilana; Gokhman, David; Meshorer, Eran


    Pluripotent self-renewing embryonic stem cells (ESCs) have been the focus of a growing number of high-throughput experiments, revealing the genome-wide locations of hundreds of transcription factors and histone modifications. While most of these datasets were used in a specific context, all datasets combined offer a comprehensive view of chromatin characteristics and regulatory elements that govern cell states. Here, using hundreds of datasets in ESCs, we generated colocalization maps of chromatin proteins and modifications, and built a discovery pipeline for regulatory proteins of gene families. By comparing genome-wide binding data with over-expression and knockdown analysis of hundreds of genes, we discovered that the pluripotency-related factor NR5A2 separates mitochondrial from cytosolic ribosomal genes, regulating their expression. We further show that genes with a common chromatin profile are enriched for distinct Gene Ontology (GO) categories. Our approach can be generalized to reveal common regulators of any gene group; discover novel gene families, and identify common genomic elements based on shared chromatin features. PMID:27084933

  12. The synapsin gene family in basal chordates: evolutionary perspectives in metazoans

    PubMed Central


    Background Synapsins are neuronal phosphoproteins involved in several functions correlated with both neurotransmitter release and synaptogenesis. The comprehension of the basal role of the synapsin family is hampered in vertebrates by the existence of multiple synapsin genes. Therefore, studying homologous genes in basal chordates, devoid of genome duplication, could help to achieve a better understanding of the complex functions of these proteins. Results In this study we report the cloning and characterization of the Ciona intestinalis and amphioxus Branchiostoma floridae synapsin transcripts and the definition of their gene structure using available C. intestinalis and B. floridae genomic sequences. We demonstrate the occurrence, in both model organisms, of a single member of the synapsin gene family. Full-length synapsin genes were identified in the recently sequenced genomes of phylogenetically diverse metazoans. Comparative genome analysis reveals extensive conservation of the SYN locus in several metazoans. Moreover, developmental expression studies underline that synapsin is a neuronal-specific marker in basal chordates and is expressed in several cell types of PNS and in many, if not all, CNS neurons. Conclusion Our study demonstrates that synapsin genes are metazoan genes present in a single copy per genome, except for vertebrates. Moreover, we hypothesize that, during the evolution of synapsin proteins, new domains are added at different stages probably to cope up with the increased complexity in the nervous system organization. Finally, we demonstrate that protochordate synapsin is restricted to the post-mitotic phase of CNS development and thereby is a good marker of postmitotic neurons. PMID:20113475

  13. Expression of Pax gene family members in the anthozoan cnidarian, Nematostella vectensis.


    Matus, David Q; Pang, Kevin; Daly, Meg; Martindale, Mark Q


    Pax genes are a family of homeodomain transcription factors that have been isolated from protostomes (e.g., eight in Drosophilia) and deuterostomes (e.g., nine in vertebrates) as well as outside the Bilateria, from sponges, a placozoan, and several classes of cnidarians. The genome of an anthozoan cnidarian, the starlet sea anemone, Nematostella vectensis, has been surveyed by both degenerate polymerase chain reaction and in silico for the presence of Pax genes. N. vectensis possesses seven Pax genes, which are orthologous to cnidarian Pax genes (A,B,C, and D) previously identified in another anthozoan, a coral, Acropora millepora. Phylogenetic analyses including data from nonchordate deuterostomes indicates that there were five Pax gene classes in the protostome-deuterostome ancestor, but only three in the cnidarian-bilaterian ancestor, with PaxD class genes lost in medusozoan cnidarians. Pax genes play diverse roles in bilaterians, including eye formation (e.g., Pax6), segmentation (e.g., Pax3/7 class genes), and neural patterning (e.g., Pox-neuro, Pax2/5/8). We show the first expression data for members of all four Pax classes in a single species of cnidarian. N. vectensis Pax genes are expressed in both a cell-type and region-specific manner during embryogenesis, and likely play a role in patterning specific components of the cnidarian ectodermal nerve net. The results of these patterns are discussed with respect to Pax gene evolution in the Bilateria.

  14. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls

    NASA Astrophysics Data System (ADS)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T. V.; Alyethodi, Rafeeque R.; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B.


    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly ( P < 0.05) higher during the thermal stress. Pearson correlation coefficient analysis revealed that the expression of ATPase Β1, ATPase B2, and ATPase B3 is highly correlated ( P < 0.01) with HSP70, representing that the change in the expression pattern of these genes is positive and synergistic. These may provide a foundation for understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in cattle.

  15. Crosstalk between microRNA-122 and FOX family genes in HepG2 cells.


    Kumar, Subodh; Batra, Ankita; Kanthaje, Shruthi; Ghosh, Sujata; Chakraborti, Anuradha


    MicroRNA-122 (miR-122) is liver specific and plays an important role in physiology as well as diseases including hepatocellular carcinoma (HCC). Downregulation of miR-122 in HCC modulates apoptosis. Similarly, the putative targets of miR-122, the forkhead box (FOX) family genes also play an important role in the regulation of apoptosis. Hence, an interplay between miR-122 and FOX family genes has been explored in this study. Initially, an augmentation of apoptosis was noticed in HepG2 cells after transfection with miR-122. Further, the predicted miR-122 targets, the FOX family genes ( FOXM1b, FOXP1, and FOXO4) were selected via in silico analysis based on their role in apoptosis. We checked the expression of all these genes at transcript level after the transfection of miR-122 and found that the relative expression of FOXP1 and FOXM1b was significantly downregulated (p < 0.005) and that of FOXO4 was upregulated (p < 0.005). Thus, the finding indicates deregulation of these FOX genes as a result of miR-122 augmentation might be involved in the modulation of apoptosis.

  16. Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

    PubMed Central

    Diao, Wei-Ping; Snyder, John C.; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge


    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper. PMID:26941768

  17. Evolutionary history of the reprimo tumor suppressor gene family in vertebrates with a description of a new reprimo gene lineage.


    Wichmann, Ignacio A; Zavala, Kattina; Hoffmann, Federico G; Vandewege, Michael W; Corvalán, Alejandro H; Amigo, Julio D; Owen, Gareth I; Opazo, Juan C


    Genes related to human diseases should be natural targets for evolutionary studies, since they could provide clues regarding the genetic bases of pathologies and potential treatments. Here we studied the evolution of the reprimo gene family, a group of tumor-suppressor genes that are implicated in p53-mediated cell cycle arrest. These genes, especially the reprimo duplicate located on human chromosome 2, have been associated with epigenetic modifications correlated with transcriptional silencing and cancer progression. We demonstrate the presence of a third reprimo lineage that, together with the reprimo and reprimo-like genes, appears to have been differentially retained during the evolutionary history of vertebrates. We present evidence that these reprimo lineages originated early in vertebrate evolution and expanded as a result of the two rounds of whole genome duplications that occurred in the last common ancestor of vertebrates. The reprimo gene has been lost in birds, and the third reprimo gene lineage has been retained in only a few distantly related species, such as coelacanth and gar. Expression analyses revealed that the reprimo paralogs are mainly expressed in the nervous system. Different vertebrate lineages have retained different reprimo paralogs, and even in species that have retained multiple copies, only one of them is heavily expressed.

  18. Gene expression of a gene family in maize based on noncollinear haplotypes

    PubMed Central

    Song, Rentao; Messing, Joachim


    Genomic regions of nearly every species diverged into different haplotypes, mostly based on point mutations, small deletions, and insertions that do not affect the collinearity of genes within a species. However, the same genomic interval containing the z1C gene cluster of two inbred lines of Zea mays significantly lost their gene collinearity and also differed in the regulation of each remaining gene set. Furthermore, when inbreds were reciprocally crossed, hybrids exhibited an unexpected shift of expression patterns so that “overdominance” instead of “dominance complementation” of allelic and nonallelic gene expression occurred. The same interval also differed in length (360 vs. 263 kb). Segmental rearrangements led to sequence changes, which were further enhanced by the insertion of different transposable elements. Changes in gene order affected not only z1C genes but also three unrelated genes. However, the orthologous interval between two subspecies of rice (not rice cultivars) was conserved in length and gene order, whereas changes between two maize inbreds were as drastic as changes between maize and sorghum. Given that chromosomes could conceivably consist of intervals of haplotypes that are highly diverged, one could envision endless breeding opportunities because of their linear arrangement along a chromosome and their expression potential in hybrid combinations (“binary” systems). The implication of such a hypothesis for heterosis is discussed. PMID:12853580

  19. Home-School Networking To Support Constructivist Learning in a Rural Elementary School: Lessons from Families, Schools, and Researchers.

    ERIC Educational Resources Information Center

    Ehrich, Roger W.; McCreary, Faith; Reaux, Ray; Rowland, Keith; Ramsey, Amy

    The U.S. Department of Education is supporting a 3-year program involving Virginia Tech's computer department and a rural public elementary school. The project seeks to determine whether immersive access to networked computing by students and their families has measurable effects on long-term student achievement. A fifth-grade classroom was…

  20. Analysis of POFUT1 Gene Mutation in a Chinese Family with Dowling-Degos Disease

    PubMed Central

    Chen, Mingfei; Li, Yi; Liu, Hong; Fu, Xi'an; Yu, Yiongxiang; Yu, Gongqi; Wang, Chuan; Bao, Fangfang; Liany, Herty; Wang, Zhenzhen; Shi, Zhongxiang; Zhang, Dizhan; Zhou, Guizhi; Liu, Jianjun; Zhang, Furen


    Dowling-Degos disease (DDD) is an autosomal dominant genodermatosis characterized by reticular pigmented anomaly mainly affecting flexures. Though KRT5 has been identified to be the causal gene of DDD, the heterogeneity of this disease was displayed: for example, POFUT1 and POGLUT1 were recently identified and confirmed to be additional pathogenic genes of DDD. To identify other DDD causative genes, we performed genome-wide linkage and exome sequencing analyses in a multiplex Chinese DDD family, in which the KRT5 mutation was absent. Only a novel 1-bp deletion (c.246+5delG) in POFUT1 was found. No other novel mutation or this deletion was detected in POFUT1 in a second DDD family and a sporadic DDD case by Sanger Sequencing. The result shows the genetic-heterogeneity and complexity of DDD and will contribute to the further understanding of DDD genotype/phenotype correlations and to the pathogenesis of this disease. PMID:25157627

  1. Analysis of POFUT1 gene mutation in a Chinese family with Dowling-Degos disease.


    Chen, Mingfei; Li, Yi; Liu, Hong; Fu, Xi'an; Yu, Yiongxiang; Yu, Gongqi; Wang, Chuan; Bao, Fangfang; Liany, Herty; Wang, Zhenzhen; Shi, Zhongxiang; Zhang, Dizhan; Zhou, Guizhi; Liu, Jianjun; Zhang, Furen


    Dowling-Degos disease (DDD) is an autosomal dominant genodermatosis characterized by reticular pigmented anomaly mainly affecting flexures. Though KRT5 has been identified to be the causal gene of DDD, the heterogeneity of this disease was displayed: for example, POFUT1 and POGLUT1 were recently identified and confirmed to be additional pathogenic genes of DDD. To identify other DDD causative genes, we performed genome-wide linkage and exome sequencing analyses in a multiplex Chinese DDD family, in which the KRT5 mutation was absent. Only a novel 1-bp deletion (c.246+5delG) in POFUT1 was found. No other novel mutation or this deletion was detected in POFUT1 in a second DDD family and a sporadic DDD case by Sanger Sequencing. The result shows the genetic-heterogeneity and complexity of DDD and will contribute to the further understanding of DDD genotype/phenotype correlations and to the pathogenesis of this disease.

  2. Rapid expansion of the protein disulfide isomerase gene family facilitates the folding of venom peptides

    PubMed Central

    Safavi-Hemami, Helena; Li, Qing; Jackson, Ronneshia L.; Song, Albert S.; Boomsma, Wouter; Bandyopadhyay, Pradip K.; Gruber, Christian W.; Purcell, Anthony W.; Yandell, Mark; Olivera, Baldomero M.


    Formation of correct disulfide bonds in the endoplasmic reticulum is a crucial step for folding proteins destined for secretion. Protein disulfide isomerases (PDIs) play a central role in this process. We report a previously unidentified, hypervariable family of PDIs that represents the most diverse gene family of oxidoreductases described in a single genus to date. These enzymes are highly expressed specifically in the venom glands of predatory cone snails, animals that synthesize a remarkably diverse set of cysteine-rich peptide toxins (conotoxins). Enzymes in this PDI family, termed conotoxin-specific PDIs, significantly and differentially accelerate the kinetics of disulfide-bond formation of several conotoxins. Our results are consistent with a unique biological scenario associated with protein folding: The diversification of a family of foldases can be correlated with the rapid evolution of an unprecedented diversity of disulfide-rich structural domains expressed by venomous marine snails in the superfamily Conoidea. PMID:26957604

  3. Gene for familial psoriasis susceptibility mapped to the distal end of human chromosome 17q

    SciTech Connect

    Tomfohrde, J.; Barnes, R.; Bowcock, A.; Fernandez-Vina, M.A.; Stastny, P.; Silverman, A.; Young, M.; Lory, D.; Morris, L.; Menter, A.


    A gene involved in psoriasis susceptibility was localized to the distal region of human chromosomes 17q as a result of a genome-wide linkage analysis with polymorphic microsatellites and eight multiply affected psoriasis kindreds. In the family which showed the strongest evidence for linkage, the recombination fraction between a psoriasis susceptibility locus and D17S784 was 0.04 with a maximum two-point lod score of 5.33. There was also evidence for genetic heterogeneity and although none of the linked families showed any association with HLA-Cw6, two unlinked families showed weak levels of association. This study demonstrates that is some families, psoriasis susceptibility is due to variation at a single major genetic locus other than the human lymphocyte antigen locus. 28 refs., 2 figs., 1 tab.

  4. Molecular analysis of the Duchenne muscular dystrophy gene in Spanish individuals: Deletion detection and familial diagnosis

    SciTech Connect

    Patino, A.; Garcia-Delgado, M.; Narbona, J.


    Deletion studies were performed in 26 Duchenne muscular dystrophy (DMD) patients through amplification of nine different exons by multiplex polymerase chain reaction (PCR). DNA from paraffin-embedded muscle biopsies was analyzed in 12 of the 26 patients studied. Optimization of this technique is of great utility because it enables analysis of material stored in pathology archives. PCR deletion detection, useful in DMD-affected boys, is problematic in determining the carrier state in female relatives. For this reason, to perform familial linkage diagnosis, we made use of a dinucleotide repeat polymorphism (STRP, or short tandem repeat polymorphism) located in intron 49 of the gene. We designed a new pair of primers that enabled the detection of 22 different alleles in relatives in the 14 DMD families studied. The use of this marker allowed familial diagnosis in 11 of the 14 DMD families and detection of de novo deletions in 3 of the probands. 8 refs., 5 figs., 2 tabs.

  5. A family of expressed antifreeze protein genes from the moth, Choristoneura fumiferana.


    Doucet, Daniel; Tyshenko, Michael G; Davies, Peter L; Walker, Virginia K


    The freeze-intolerant insect, Choristoneura fumiferana (spruce budworm), produces multiple antifreeze protein (AFP) isoforms for protection during the overwintering stage. We now report the cloning of AFP genes from insects; Afp-Lu1 encodes a approximately 9-kDa AFP isoform, and Afp-Iu1 encodes a approximately 12-kDa AFP isoform. Both CfAFP genes have similar structures with a single 3- to 3.6-kb intron interrupting the coding region. The second exon of an additional CfAFP gene, 2.7a, encoding a new approximately 9-kDa isoform, was found 3.7 kb upstream of Afp-Lu1 and demonstrates that some AFP family members are linked in tandem. This gene appears to encode an AFP with 68-76% identity to previously isolated CfAFPs. With its eight Cys residues necessary for disulfide bonding and five perfectly conserved 'Thr button' (Thr-Xaa-Thr) ice-binding motifs, it can be modeled as a functional AFP. Southern blot analysis shows that there are approximately 17 genes in this AFP family, with each of the isoforms represented by two to five gene copies. Transcript accumulation from Afp-Lu1 and Afp-Iu1 (or closely related genes) was maximal during the overwintering stage, while 2.7a transcripts were only detected in first instars, larvae that are normally found only in the summer. Contrary to expectations, this differential expression demonstrates that CfAFP gene family transcripts are primarily regulated during development, rather than by seasonally low temperatures.

  6. The Eucalyptus grandis NBS-LRR Gene Family: Physical Clustering and Expression Hotspots

    PubMed Central

    Christie, Nanette; Tobias, Peri A.; Naidoo, Sanushka; Külheim, Carsten


    Eucalyptus grandis is a commercially important hardwood species and is known to be susceptible to a number of pests and pathogens. Determining mechanisms of defense is therefore a research priority. The published genome for E. grandis has aided the identification of one important class of resistance (R) genes that incorporate nucleotide binding sites and leucine-rich repeat domains (NBS-LRR). Using an iterative search process we identified NBS-LRR gene models within the E. grandis genome. We characterized the gene models and identified their genomic arrangement. The gene expression patterns were examined in E. grandis clones, challenged with a fungal pathogen (Chrysoporthe austroafricana) and insect pest (Leptocybe invasa). One thousand two hundred and fifteen putative NBS-LRR coding sequences were located which aligned into two large classes, Toll or interleukin-1 receptor (TIR) and coiled-coil (CC) based on NB-ARC domains. NBS-LRR gene-rich regions were identified with 76% organized in clusters of three or more genes. A further 272 putative incomplete resistance genes were also identified. We determined that E. grandis has a higher ratio of TIR to CC classed genes compared to other woody plant species as well as a smaller percentage of single NBS-LRR genes. Transcriptome profiles indicated expression hotspots, within physical clusters, including expression of many incomplete genes. The clustering of putative NBS-LRR genes correlates with differential expression responses in resistant and susceptible plants indicating functional relevance for the physical arrangement of this gene family. This analysis of the repertoire and expression of E. grandis putative NBS-LRR genes provides an important resource for the identification of novel and functional R-genes; a key objective for strategies to enhance resilience. PMID:26793216

  7. Engineering ligand-responsive gene control elements: Lessons learned from natural riboswitches

    PubMed Central

    Link, Kristian H.; Breaker, Ronald R.


    In the past two decades, remarkable advances have been made in the development of technologies used to engineer new aptamers and ribozymes. This has encouraged interest among researchers who seek to create new types of gene control systems that can be made to respond specifically to small molecule signals. Validation that RNA molecules can exhibit the characteristics needed to serve as precision genetic switches has come from the discovery of numerous classes of natural ligand-sensing RNAs called riboswitches. While a great deal of progress has been made towards engineering useful designer riboswitches, considerable advances are needed before the performance characteristics of these RNAs match those of protein systems that have been co-opted to regulate gene expression. In this review, we will evaluate the potential for engineered RNAs to regulate gene expression and lay out possible paths to designer riboswitches based upon currently available technologies. Furthermore, we will discuss some technical advances that would empower RNA engineers who seek to make routine the production of designer riboswitches that can function in eukaryotes. PMID:19587710

  8. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

    PubMed Central


    Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters), has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3), one polyol (VvPMT5) and one sucrose (VvSUC27) transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2) and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2) genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5), in roots (VvHT2) or in mature leaves (VvHT5). Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and revealed that sugar

  9. Genome-wide analysis and identification of KT/HAK/KUP potassium transporter gene family in peach (Prunus persica).


    Song, Z Z; Ma, R J; Yu, M L


    The KT/HAK/KUP family members encoding high-affinity potassium (K(+)) transporters mediate K(+) transport across the plasma membranes of plant cells to maintain plant normal growth and metabolic activities. In this paper, we identified 16 potassium transporter genes in the peach (Prunus persica) using the Hidden Markov model scanning strategy and searching the peach genome database. Utilizing the Arabidopsis KT/HAK/KUP family as a reference, phylogenetic analysis indicates that the KT/HAK/KUP family in the peach can be classified into 3 groups. Genomic localization indicated that 16 KT/HAK/KUP family genes were well distributed on 7 scaffolds. Gene structure analysis showed that the KT/HAK/KUP family genes have 6-9 introns. In addition, all of the KT/HAK/KUP family members were hydrophobic proteins; they exhibited similar secondary structure patterns and homologous tertiary structures. Putative cis-elements involved in abiotic stress adaption, Ca(2+) response, light and circadian rhythm regulation, and seed development were observed in the promoters of the KT/HAK/KUP family genes. Subcellular localization prediction indicated that the KT/HAK/KUP members were mainly located in the plasma membrane. Expression levels of the KT/HAK/ KUP family genes were much higher in the fruit and flower than those in the other 7 tissues examined, indicating that the KT/HAK/KUP family genes may have important roles in K(+) uptake and transport, which mainly contribute to flower formation and fruit development in the peach.

  10. Gene- and cell-based bio-artificial pacemaker: what basic and translational lessons have we learned?


    Li, R A


    Normal rhythms originate in the sino-atrial node, a specialized cardiac tissue consisting of only a few thousands of nodal pacemaker cells. Malfunction of pacemaker cells due to diseases or aging leads to rhythm generation disorders (for example, bradycardias and sick-sinus syndrome (SSS)), which often necessitate the implantation of electronic pacemakers. Although effective, electronic devices are associated with such shortcomings as limited battery life, permanent implantation of leads, lead dislodging, the lack of autonomic responses and so on. Here, various gene- and cell-based approaches, with a particular emphasis placed on the use of pluripotent stem cells and the hyperpolarization-activated cyclic nucleotide-gated-encoded pacemaker gene family, that have been pursued in the past decade to reconstruct bio-artificial pacemakers as alternatives will be discussed in relation to the basic biological insights and translational regenerative potential.

  11. Apple contains receptor-like genes homologous to the Cladosporium fulvum resistance gene family of tomato with a cluster of genes cosegregating with Vf apple scab resistance.


    Vinatzer, B A; Patocchi, A; Gianfranceschi, L; Tartarini, S; Zhang, H B; Gessler, C; Sansavini, S


    Scab caused by the fungal pathogen Venturia inaequalis is the most common disease of cultivated apple (Malus x domestica Borkh.). Monogenic resistance against scab is found in some small-fruited wild Malus species and has been used in apple breeding for scab resistance. Vf resistance of Malus floribunda 821 is the most widely used scab resistance source. Because breeding a high-quality cultivar in perennial fruit trees takes dozens of years, cloning disease resistance genes and using them in the transformation of high-quality apple varieties would be advantageous. We report the identification of a cluster of receptor-like genes with homology to the Cladosporium fulvum (Cf) resistance gene family of tomato on bacterial artificial chromosome clones derived from the Vf scab resistance locus. Three members of the cluster were sequenced completely. Similar to the Cf gene family of tomato, the deduced amino acid sequences coded by these genes contain an extracellular leucine-rich repeat domain and a transmembrane domain. The transcription of three members of the cluster was determined by reverse transcriptionpolymerase chain reaction to be constitutive, and the transcription and translation start of one member was verified by 5' rapid amplification of cDNA ends. We discuss the parallels between Cf resistance of tomato and Vf resistance of apple and the possibility that one of the members of the gene cluster is the Vf gene. Cf homologs from other regions of the apple genome also were identified and are likely to present other scab resistance genes.

  12. Uroporphyrinogen decarboxylase: Complete human gene sequence and molecular study of three families with hepatoerythropoietic porphyria

    SciTech Connect

    Moran-Jimenez, M.J.; Ged, C.; Verneuil, H. de


    A deficiency in uroporphyrinogen decarboxylase (UROD) enzyme activity, the fifth enzyme of the heme biosynthetic pathway, is found in patients with sporadic porphyria cutanea tarda (s-PCT), familial porphyria cutanea tarda (f-PCT), and hepatoerythropoietic porphyria (HEP). Subnormal UROD activity is due to mutations of the UROD gene in both f-PCT and HEP, but no mutations have been found in s-PCT. Genetic analysis has determined that f-PCT is transmitted as an autosomal dominant trait. In contrast, HEP, a severe form of cutaneous porphyria, is transmitted as an autosomal recessive trait. HEP is characterized by a profound deficiency of UROD activity, and the disease is usually manifest in childhood. In this study, a strategy was designed to identify alleles responsible for the HEP phenotype in three unrelated families. Mutations of UROD were identified by direct sequencing of four amplified fragments that contained the entire coding sequence of the UROD gene. Two new missense mutations were observed at the homoallelic state: P62L (proline-to-leucine substitution at codon 62) in a Portuguese family and Y311C (tyrosine-to-cysteine substitution at codon 311) in an Italian family. A third mutation, G281E, was observed in a Spanish family. This mutation has been previously described in three families from Spain and one from Tunisia. In the Spanish family described in this report, a paternal uncle of the proband developed clinically overt PCT as an adult and proved to be heterozygous for the G281E mutation. Mutant cDNAs corresponding to the P62L and Y311C changes detected in these families were created by site-directed mutagenesis. Recombinant proteins proved to have subnormal enzyme activity, and the Y311C mutant was thermolabile. 24 refs., 7 figs., 4 tabs.

  13. Importance of gene duplication in the evolution of genomic imprinting revealed by molecular evolutionary analysis of the type I MADS-box gene family in Arabidopsis species.


    Yoshida, Takanori; Kawabe, Akira


    The pattern of molecular evolution of imprinted genes is controversial and the entire picture is still to be unveiled. Recently, a relationship between the formation of imprinted genes and gene duplication was reported in genome-wide survey of imprinted genes in Arabidopsis thaliana. Because gene duplications influence the molecular evolution of the duplicated gene family, it is necessary to investigate both the pattern of molecular evolution and the possible relationship between gene duplication and genomic imprinting for a better understanding of evolutionary aspects of imprinted genes. In this study, we investigated the evolutionary changes of type I MADS-box genes that include imprinted genes by using relative species of Arabidopsis thaliana (two subspecies of A. lyrata and three subspecies of A. halleri). A duplicated gene family enables us to compare DNA sequences between imprinted genes and its homologs. We found an increased number of gene duplications within species in clades containing the imprinted genes, further supporting the hypothesis that local gene duplication is one of the driving forces for the formation of imprinted genes. Moreover, data obtained by phylogenetic analysis suggested "rapid evolution" of not only imprinted genes but also its closely related orthologous genes, which implies the effect of gene duplication on molecular evolution of imprinted genes.

  14. Evolution of the PEBP gene family in plants: functional diversification in seed plant evolution.


    Karlgren, Anna; Gyllenstrand, Niclas; Källman, Thomas; Sundström, Jens F; Moore, David; Lascoux, Martin; Lagercrantz, Ulf


    The phosphatidyl ethanolamine-binding protein (PEBP) gene family is present in all eukaryote kingdoms, with three subfamilies identified in angiosperms (FLOWERING LOCUS T [FT], MOTHER OF FT AND TFL1 [MFT], and TERMINAL FLOWER1 [TFL1] like). In angiosperms, PEBP genes have been shown to function both as promoters and suppressors of flowering and to control plant architecture. In this study, we focus on previously uncharacterized PEBP genes from gymnosperms. Extensive database searches suggest that gymnosperms possess only two types of PEBP genes, MFT-like and a group that occupies an intermediate phylogenetic position between the FT-like and TFL1-like (FT/TFL1-like). Overexpression of Picea abies PEBP genes in Arabidopsis (Arabidopsis thaliana) suggests that the FT/TFL1-like genes (PaFTL1 and PaFTL2) code for proteins with a TFL1-like function. However, PaFTL1 and PaFTL2 also show highly divergent expression patterns. While the expression of PaFTL2 is correlated with annual growth rhythm and mainly confined to needles and vegetative and reproductive buds, the expression of PaFTL1 is largely restricted to microsporophylls of male cones. The P. abies MFT-like genes (PaMFT1 and PaMFT2) show a predominant expression during embryo development, a pattern that is also found for many MFT-like genes from angiosperms. P. abies PEBP gene expression is primarily detected in tissues undergoing physiological changes related to growth arrest and dormancy. A first duplication event resulting in two families of plant PEBP genes (MFT-like and FT/TFL1-like) seems to coincide with the evolution of seed plants, in which independent control of bud and seed dormancy was required, and the second duplication resulting in the FT-like and TFL1-like clades probably coincided with the evolution of angiosperms.

  15. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.


    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee


    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products.

  16. Evolutionarily Dynamic, but Robust, Targeting of Resistance Genes by the miR482/2118 Gene Family in the Solanaceae.


    de Vries, Sophie; Kloesges, Thorsten; Rose, Laura E


    Plants are exposed to pathogens around the clock. A common resistance response in plants upon pathogen detection is localized cell death. Given the irreversible nature of this response, multiple layers of negative regulation are present to prevent the untimely or misexpression of resistance genes. One layer of negative regulation is provided by a recently discovered microRNA (miRNA) gene family, miR482/2118. This family targets the transcripts of resistance genes in plants. We investigated the evolutionary history and specificity of this miRNA gene family within the Solanaceae. This plant family includes many important crop species, providing a set of well-defined resistance gene repertoires. Across 14 species from the Solanaceae, we identified eight distinct miR482/2118 gene family members. Our studies show conservation of miRNA type and number in the group of wild tomatoes and, to a lesser extent, throughout the Solanaceae. The eight orthologous miRNA gene clusters evolved under different evolutionary constraints, allowing for individual subfunctionalization of the miRNAs. Despite differences in the predicted targeting behavior of each miRNA, the miRNA-R-gene network is robust due to its high degree of interconnectivity and redundant targeting. Our data suggest that the miR482/2118 gene family acts as an evolutionary buffer for R-gene sequence diversity.

  17. Runx Family Genes in a Cartilaginous Fish, the Elephant Shark (Callorhinchus milii)

    PubMed Central

    Nah, Giselle Sek Suan; Lim, Zhi Wei; Tay, Boon-Hui; Osato, Motomi; Venkatesh, Byrappa


    The Runx family genes encode transcription factors that play key roles in hematopoiesis, skeletogenesis and neurogenesis and are often implicated in diseases. We describe here the cloning and characterization of Runx1, Runx2, Runx3 and Runxb genes in the elephant shark (Callorhinchus milii), a member of Chondrichthyes, the oldest living group of jawed vertebrates. Through the use of alternative promoters and/or alternative splicing, each of the elephant shark Runx genes expresses multiple isoforms similar to their orthologs in human and other bony vertebrates. The expression profiles of elephant shark Runx genes are similar to those of mammalian Runx genes. The syntenic blocks of genes at the elephant shark Runx gene loci are highly conserved in human, but represented by shorter conserved blocks in zebrafish indicating a higher degree of rearrangements in this teleost fish. Analysis of promoter regions revealed conservation of binding sites for transcription factors, including two tandem binding sites for Runx that are totally conserved in the distal promoter regions of elephant shark Runx1-3. Several conserved noncoding elements (CNEs), which are putative cis-regulatory elements, and miRNA binding sites were identified in the elephant shark and human Runx gene loci. Some of these CNEs and miRNA binding sites are absent in teleost fishes such as zebrafish and fugu. In summary, our analysis reveals that the genomic organization and expression profiles of Runx genes were already complex in the common ancestor of jawed vertebrates. PMID:24699678

  18. Genome-Wide Identification and Characterization of WRKY Gene Family in Peanut

    PubMed Central

    Song, Hui; Wang, Pengfei; Lin, Jer-Young; Zhao, Chuanzhi; Bi, Yuping; Wang, Xingjun


    WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA) and jasmonic acid (JA) treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement. PMID:27200012

  19. Expression analysis of LIM gene family in poplar, toward an updated phylogenetic classification

    PubMed Central


    Background Plant LIM domain proteins may act as transcriptional activators of lignin biosynthesis and/or as actin binding and bundling proteins. Plant LIM genes have evolved in phylogenetic subgroups differing in their expression profiles: in the whole plant or specifically in pollen. However, several poplar PtLIM genes belong to uncharacterized monophyletic subgroups and the expression patterns of the LIM gene family in a woody plant have not been studied. Findings In this work, the expression pattern of the twelve duplicated poplar PtLIM genes has been investigated by semi quantitative RT-PCR in different vegetative and reproductive tissues. As in other plant species, poplar PtLIM genes were widely expressed in the tree or in particular tissues. Especially, PtXLIM1a, PtXLIM1b and PtWLIM1b genes were preferentially expressed in the secondary xylem, suggesting a specific function in wood formation. Moreover, the expression of these genes and of the PtPLIM2a gene was increased in tension wood. Western-blot analysis confirmed the preferential expression of PtXLIM1a protein during xylem differentiation and tension wood formation. Genes classified within the pollen specific PLIM2 and PLIM2-like subgroups were all strongly expressed in pollen but also in cottony hairs. Interestingly, pairs of duplicated PtLIM genes exhibited different expression patterns indicating subfunctionalisations in specific tissues. Conclusions The strong expression of several LIM genes in cottony hairs and germinating pollen, as well as in xylem fibers suggests an involvement of plant LIM domain proteins in the control of cell expansion. Comparisons of expression profiles of poplar LIM genes with the published functions of closely related plant LIM genes suggest conserved functions in the areas of lignin biosynthesis, pollen tube growth and mechanical stress response. Based on these results, we propose a novel nomenclature of poplar LIM domain proteins. PMID:22339987

  20. Gene Structures, Evolution, Classification and Expression Profiles of the Aquaporin Gene Family in Castor Bean (Ricinus communis L.).


    Zou, Zhi; Gong, Jun; Huang, Qixing; Mo, Yeyong; Yang, Lifu; Xie, Guishui


    Aquaporins (AQPs) are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae), an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs), 9 tonoplast intrinsic proteins (TIPs), 8 NOD26-like intrinsic proteins (NIPs), 6 X intrinsic proteins (XIPs) and 4 small basic intrinsic proteins (SIPs) on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R) selectivity filter, Froger's positions and specificity-determining positions (SDPs) showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.

  1. Genome-wide identification and comparison of legume MLO gene family.


    Rispail, Nicolas; Rubiales, Diego


    MLO proteins are highly conserved proteins with seven trans-membrane domains. Specific MLO genes have been linked to plant disease susceptibility. Others are involved in plant reproduction and in root thigmomorphogenesis. Functions of the remaining MLOs are still unknown. Here we performed a genome-wide survey of the MLO family in eight legume species from different clades of the Papillionoideae sub-family. A total of 118 MLO sequences were identified and characterized. Their deduced protein sequences shared the characteristics of MLO proteins. The total number of MLO genes per legume species varied from 13 to 20 depending on the species. Legume MLOs were evenly distributed over their genomes and tended to localize within syntenic blocks conserved across legume genomes. Phylogenetic analysis indicated that these sequences clustered in seven well-defined clades. Comparison of MLO protein sequences revealed 34 clade-specific motifs in the variable regions of the proteins. Comparative analyses of the MLO family between legume species also uncovered several evolutionary differences between the tropical legume species from the Phaseoloid clades and the other legume species. Altogether, this study provides interesting new features on the evolution of the MLO family. It also provides valuable clues to identify additional MLO genes from non-sequenced species.

  2. Genome-wide identification and comparison of legume MLO gene family

    PubMed Central

    Rispail, Nicolas; Rubiales, Diego


    MLO proteins are highly conserved proteins with seven trans-membrane domains. Specific MLO genes have been linked to plant disease susceptibility. Others are involved in plant reproduction and in root thigmomorphogenesis. Functions of the remaining MLOs are still unknown. Here we performed a genome-wide survey of the MLO family in eight legume species from different clades of the Papillionoideae sub-family. A total of 118 MLO sequences were identified and characterized. Their deduced protein sequences shared the characteristics of MLO proteins. The total number of MLO genes per legume species varied from 13 to 20 depending on the species. Legume MLOs were evenly distributed over their genomes and tended to localize within syntenic blocks conserved across legume genomes. Phylogenetic analysis indicated that these sequences clustered in seven well-defined clades. Comparison of MLO protein sequences revealed 34 clade-specific motifs in the variable regions of the proteins. Comparative analyses of the MLO family between legume species also uncovered several evolutionary differences between the tropical legume species from the Phaseoloid clades and the other legume species. Altogether, this study provides interesting new features on the evolution of the MLO family. It also provides valuable clues to identify additional MLO genes from non-sequenced species. PMID:27596925

  3. Genome-wide gene-environment interactions on quantitative traits using family data.


    Sitlani, Colleen M; Dupuis, Josée; Rice, Kenneth M; Sun, Fangui; Pitsillides, Achilleas N; Cupples, L Adrienne; Psaty, Bruce M


    Gene-environment interactions may provide a mechanism for targeting interventions to those individuals who would gain the most benefit from them. Searching for interactions agnostically on a genome-wide scale requires large sample sizes, often achieved through collaboration among multiple studies in a consortium. Family studies can contribute to consortia, but to do so they must account for correlation within families by using specialized analytic methods. In this paper, we investigate the performance of methods that account for within-family correlation, in the context of gene-environment interactions with binary exposures and quantitative outcomes. We simulate both cross-sectional and longitudinal measurements, and analyze the simulated data taking family structure into account, via generalized estimating equations (GEE) and linear mixed-effects models. With sufficient exposure prevalence and correct model specification, all methods perform well. However, when models are misspecified, mixed modeling approaches have seriously inflated type I error rates. GEE methods with robust variance estimates are less sensitive to model misspecification; however, when exposures are infrequent, GEE methods require modifications to preserve type I error rate. We illustrate the practical use of these methods by evaluating gene-drug interactions on fasting glucose levels in data from the Framingham Heart Study, a cohort that includes related individuals.

  4. Launching a family-centered, neighborhood-based human services system: lessons from working the hallways and street corners.


    Armstrong, K L


    The author describes Contra Costa County's efforts to implement Healthy Families 2000, the County's vision of neighborhood-based, family-centered, comprehensive integrated services in two of the county's unincorporated areas, North Richmond and Bay Point. Contra Costa County is one of six bay area counties, northeast of San Francisco. It has nearly 800,000 residents and is home to some of the wealthiest communities in the state as well as some of the poorest neighborhoods. This article provides a systematic review of the process and a discussion of the operating practices and principles guiding Contra Costa's significant effort to change its service delivery approach, anticipating that this experience might be helpful to others as they develop a neighborhood-based human services partnership with community leaders and residents.

  5. Are there symplastic connections between the endosperm and embryo in some angiosperms?--a lesson from the Crassulaceae family.


    Kozieradzka-Kiszkurno, Małgorzata; Płachno, Bartosz Jan


    It is believed that there is symplastic isolation between the embryo (new sporophyte) and the endosperm (maternal-parental origin tissue, which nourishes the embryo) in angiosperms. However, in embryological literature there are rare examples in which plasmodesmata between the embryo suspensor and endosperm cells have been recorded (three species from Fabaceae). This study was undertaken in order to test the hypothesis that plasmodesmata between the embryo suspensor and the endosperm are not so rare but also occur in other angiosperm families; in order to check this, we used the Crassulaceae family because embryogenesis in Crassulaceae has been studied extensively at an ultrastructure level recently and also we tread members of this family as model for suspensor physiology and function studies. These plasmodesmata even occurred between the basal cell of the two-celled proembryo and endosperm cells. The plasmodesmata were simple at this stage of development. During the development of the embryo proper and the suspensor, the structure of plasmodesmata changes. They were branched and connected with electron-dense material. Our results suggest that in Crassulaceae with plasmodesmata between the endosperm and suspensor, symplastic connectivity at this cell-cell boundary is still reduced or blocked at a very early stage of embryo development (before the globular stage). The occurrence of plasmodesmata between the embryo suspensor and endosperm cells suggests possible symplastic transport between these different organs, at least at a very early stage of embryo development. However, whether this transport actually occurs needs to be proven experimentally. A broader analysis of plants from various families would show whether the occurrence of plasmodesmata between the embryo suspensor and the endosperm are typical embryological characteristics and if this is useful in discussions about angiosperm systematic and evolution.

  6. Lessons from the past: familial aggregation analysis of fatal pandemic influenza (Spanish flu) in Iceland in 1918.


    Gottfredsson, Magnús; Halldórsson, Bjarni V; Jónsson, Stefán; Kristjánsson, Már; Kristjánsson, Kristleifur; Kristinsson, Karl G; Löve, Arthur; Blöndal, Thorsteinn; Viboud, Cécile; Thorvaldsson, Sverrir; Helgason, Agnar; Gulcher, Jeffrey R; Stefánsson, Kári; Jónsdóttir, Ingileif


    The pandemic influenza of 1918 (Spanish flu) killed 21-50 million people globally, including in Iceland, where the characteristics and spread of the epidemic were well documented. It has been postulated that genetic host factors may have contributed to this high mortality. We identified 455 individuals who died of the Spanish flu in Iceland during a 6-week period during the winter of 1918, representing >92% of all fatal domestic cases mentioned by historical accounts. The highest case fatality proportion was 2.8%, and peak excess mortality was 162/100,000/week. Fatality proportions were highest among infants, young adults, and the elderly. A genealogical database was used to study relatedness and relative risk (RR) of the fatal influenza victims and relatives of their unaffected mates. The significance of these RR computations was assessed by drawing samples randomly from the genealogical database matched for age, sex, and geographical distribution. Familial aggregation of fatalities was seen, with RRs for death ranging from 3.75 for first-degree relatives (P < 0.0001) to 1.82 (P = 0.005), 1.12 (P = 0.252), and 1.47 (P = 0.0001) for second- to fourth-degree relatives of fatal influenza victims, respectively. The RRs within the families of unaffected mates of fatal influenza victims were 2.95 (P < 0.0001), 1.27 (P = 0.267), 1.35 (P = 0.04), and 1.42 (P = 0.001), for first- to fourth-degree relatives, respectively. In conclusion, the risk of death from the Spanish flu was similar within families of patients who succumbed to the illness and within families of their mates who survived. Our data do not provide conclusive evidence for the role of genetic factors in susceptibility to the Spanish flu.

  7. Adaptive evolution in the Arabidopsis MADS-box gene family inferred from its complete resolved phylogeny

    PubMed Central

    Martínez-Castilla, León Patricio; Alvarez-Buylla, Elena R.


    Gene duplication is a substrate of evolution. However, the relative importance of positive selection versus relaxation of constraints in the functional divergence of gene copies is still under debate. Plant MADS-box genes encode transcriptional regulators key in various aspects of development and have undergone extensive duplications to form a large family. We recovered 104 MADS sequences from the Arabidopsis genome. Bayesian phylogenetic trees recover type II lineage as a monophyletic group and resolve a branching sequence of monophyletic groups within this lineage. The type I lineage is comprised of several divergent groups. However, contrasting gene structure and patterns of chromosomal distribution between type I and II sequences suggest that they had different evolutionary histories and support the placement of the root of the gene family between these two groups. Site-specific and site-branch analyses of positive Darwinian selection (PDS) suggest that different selection regimes could have affected the evolution of these lineages. We found evidence for PDS along the branch leading to flowering time genes that have a direct impact on plant fitness. Sites with high probabilities of having been under PDS were found in the MADS and K domains, suggesting that these played important roles in the acquisition of novel functions during MADS-box diversification. Detected sites are targets for further experimental analyses. We argue that adaptive changes in MADS-domain protein sequences have been important for their functional divergence, suggesting that changes within coding regions of transcriptional regulators have influenced phenotypic evolution of plants. PMID:14597714

  8. Positive selection of a gene family during the emergence of humans and African apes.


    Johnson, M E; Viggiano, L; Bailey, J A; Abdul-Rauf, M; Goodwin, G; Rocchi, M; Eichler, E E


    Gene duplication followed by adaptive evolution is one of the primary forces for the emergence of new gene function. Here we describe the recent proliferation, transposition and selection of a 20-kilobase (kb) duplicated segment throughout 15 Mb of the short arm of human chromosome 16. The dispersal of this segment was accompanied by considerable variation in chromosomal-map location and copy number among hominoid species. In humans, we identified a gene family (morpheus) within the duplicated segment. Comparison of putative protein-encoding exons revealed the most extreme case of positive selection among hominoids. The major episode of enhanced amino-acid replacement occurred after the separation of human and great-ape lineages from the orangutan. Positive selection continued to alter amino-acid composition after the divergence of human and chimpanzee lineages. The rapidity and bias for amino-acid-altering nucleotide changes suggest adaptive evolution of the morpheus gene family during the emergence of humans and African apes. Moreover, some genes emerge and evolve very rapidly, generating copies that bear little similarity to their ancestral precursors. Consequently, a small fraction of human genes may not possess discernible orthologues within the genomes of model organisms.

  9. [Genome-wide identification and expression analysis of the WRKY gene family in peach].


    Yanbing, Gu; Zhirui, Ji; Fumei, Chi; Zhuang, Qiao; Chengnan, Xu; Junxiang, Zhang; Zongshan, Zhou; Qinglong, Dong


    The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.

  10. Lateral Gene Transfer of Family A DNA Polymerases between Thermophilic Viruses, Aquificae, and Apicomplexa

    PubMed Central

    Schoenfeld, Thomas W.; Murugapiran, Senthil K.; Dodsworth, Jeremy A.; Floyd, Sally; Lodes, Michael; Mead, David A.; Hedlund, Brian P.


    Bioinformatics and functional screens identified a group of Family A-type DNA Polymerase (polA) genes encoded by viruses inhabiting circumneutral and alkaline hot springs in Yellowstone National Park and the US Great Basin. The proteins encoded by these viral polA genes (PolAs) shared no significant sequence similarity with any known viral proteins but were remarkably similar to PolAs encoded by two of three families of the bacterial phylum Aquificae and by several apicoplast-targeted PolA-like proteins found in the eukaryotic phylum Apicomplexa, which includes the obligate parasites Plasmodium, Babesia, and Toxoplasma. The viral gene products share signature elements previously associated only with Aquificae and Apicomplexa PolA-like proteins and were similar to proteins encoded by prophage elements of a variety of otherwise unrelated Bacteria, each of which additionally encoded a prototypical bacterial PolA. Unique among known viral DNA polymerases, the viral PolA proteins of this study share with the Apicomplexa proteins large amino-terminal domains with putative helicase/primase elements but low primary sequence similarity. The genomic context and distribution, phylogeny, and biochemistry of these PolA proteins suggest that thermophilic viruses transferred polA genes to the Apicomplexa, likely through secondary endosymbiosis of a virus-infected proto-apicoplast, and to the common ancestor of two of three Aquificae families, where they displaced the orthologous cellular polA gene. On the basis of biochemical activity, gene structure, and sequence similarity, we speculate that the xenologous viral-type polA genes may have functions associated with diversity-generating recombination in both Bacteria and Apicomplexa. PMID:23608703

  11. Molecular characterization and expression profiling of the protein disulfide isomerase gene family in Brachypodium distachyon L.


    Zhu, Chong; Luo, Nana; He, Miao; Chen, Guanxing; Zhu, Jiantang; Yin, Guangjun; Li, Xiaohui; Hu, Yingkao; Li, Jiarui; Yan, Yueming


    Protein disulfide isomerases (PDI) are involved in catalyzing protein disulfide bonding and isomerization in the endoplasmic reticulum and functions as a chaperone to inhibit the aggregation of misfolded proteins. Brachypodium distachyon is a widely used model plant for temperate grass species such as wheat and barley. In this work, we report the first molecular characterization, phylogenies, and expression profiles of PDI and PDI-like (PDIL) genes in B. distachyon in different tissues under various abiotic stresses. Eleven PDI and PDIL genes in the B. distachyon genome by in silico identification were evenly distributed across all five chromosomes. The plant PDI family has three conserved motifs that are involved in catalyzing protein disulfide bonding and isomerization, but a different exon/intron structural organization showed a high degree of structural differentiation. Two pairs of genes (BdPDIL4-1 and BdPDIL4-2; BdPDIL7-1 and BdPDIL7-2) contained segmental duplications, indicating each pair originated from one progenitor. Promoter analysis showed that Brachypodium PDI family members contained important cis-acting regulatory elements involved in seed storage protein synthesis and diverse stress response. All Brachypodium PDI genes investigated were ubiquitously expressed in different organs, but differentiation in expression levels among different genes and organs was clear. BdPDIL1-1 and BdPDIL5-1 were expressed abundantly in developing grains, suggesting that they have important roles in synthesis and accumulation of seed storage proteins. Diverse treatments (drought, salt, ABA, and H2O2) induced up- and down-regulated expression of Brachypodium PDI genes in seedling leaves. Interestingly, BdPDIL1-1 displayed significantly up-regulated expression following all abiotic stress treatments, indicating that it could be involved in multiple stress responses. Our results provide new insights into the structural and functional characteristics of the plant PDI gene

  12. Large genomic deletions inactivate the BRCA2 gene in breast cancer families

    PubMed Central

    Agata, S; Dalla, P; Callegaro, M; Scaini, M; Menin, C; Ghiotto, C; Nicoletto, O; Zavagno, G; Chieco-Bianchi, L; D'Andrea, E; Montagna, M


    Background: BRCA1 and BRCA2 are the two major genes responsible for the breast and ovarian cancers that cluster in families with a genetically determined predisposition. However, regardless of the mutation detection method employed, the percentage of families without identifiable alterations of these genes exceeds 50%, even when applying stringent criteria for family selection. A small but significant increase in mutation detection rate has resulted from the discovery of large genomic alterations in BRCA1. A few studies have addressed the question of whether BRCA2 might be inactivated by the same kinds of alteration, but most were either done on a relatively small number of samples or employed cumbersome mutation detection methods of variable sensitivity. Objective: To analyse 121 highly selected families using the recently available BRCA2 multiplex ligation dependent probe amplification (MLPA) technique. Results: Three different large genomic deletions were identified and confirmed by analysis of the mutant transcript and genomic characterisation of the breakpoints. Conclusions: Contrary to initial suggestions, the presence of BRCA2 genomic rearrangements is worth investigating in high risk breast or ovarian cancer families. PMID:16199546

  13. Identification of a rhodopsin gene mutation in a large family with autosomal dominant retinitis pigmentosa.


    Yu, Xinping; Shi, Wei; Cheng, Lulu; Wang, Yanfang; Chen, Ding; Hu, Xuting; Xu, Jinling; Xu, Limin; Wu, Yaming; Qu, Jia; Gu, Feng


    Retinitis pigmentosa (RP) is a genetically highly heterogeneous retinal disease and one of the leading causes of blindness in the world. Next-generation sequencing technology has enormous potential for determining the genetic etiology of RP. We sought to identify the underlying genetic defect in a 35-year-old male from an autosomal-dominant RP family with 14 affected individuals. By capturing next-generation sequencing (CNGS) of 144 genes associated with retinal diseases, we identified eight novel DNA variants; however, none of them cosegregated for all the members of the family. Further analysis of the CNGS data led to identification of a recurrent missense mutation (c.403C > T, p.R135W) in the rhodopsin (RHO) gene, which cosegregated with all affected individuals in the family and was not observed in any of the unaffected family members. The p.R135W mutation has a reference single nucleotide polymorphism (SNP) ID (rs104893775), and it appears to be responsible for the disease in this large family. This study highlights the importance of examining NGS data with reference SNP IDs. Thus, our study is important for data analysis of NGS-based clinical genetic diagnoses.

  14. Structure and Organization of the Engraulidae Family U2 snRNA: An Evolutionary Model Gene?


    Chairi, Hicham; Gonzalez, Laureana Rebordinos


    The U2 snRNA multigene family has been analyzed in four species of the Engraulidae family--Engraulis encrasicolus, Engraulis mordax, Engraulis ringens, and Engraulis japonicas--with the object of understanding more about the structure of this multigene family in these pelagic species and studying their phylogenetic relationships. The results showed that the cluster of this gene family in the Engraulis genus is formed by the U2-U5 snRNA with highly conserved sequences of mini- and micro-satellites, such as (CTGT)n, embedded downstream of the transcription unit; findings indicate that this gene family evolved following the concerted model. The phylogenetic analysis of the non-transcribed spacer of cluster U2-U5 snDNA in the 4 species showed that the sequences of the species E. encrasicolus and E. japonicus are closely related; these two are genetically close to E. mordax and slightly more distant from E. ringens. The data obtained by molecular analysis of U2-U5 snDNA and their secondary structure, with the presence of the micro-satellite (CTGT)n and mini-satellites, show clearly that the species E. encrasicolus and E. japonicus are closely related and would be older than E. mordax and E. ringens.

  15. Gene Family Evolution Reflects Adaptation to Soil Environmental Stressors in the Genome of the Collembolan Orchesella cincta

    PubMed Central

    Faddeeva-Vakhrusheva, Anna; Derks, Martijn F. L.; Anvar, Seyed Yahya; Agamennone, Valeria; Suring, Wouter; Smit, Sandra; van Straalen, Nico M.; Roelofs, Dick


    Collembola (springtails) are detritivorous hexapods that inhabit the soil and its litter layer. The ecology of the springtail Orchesella cincta is extensively studied in the context of adaptation to anthropogenically disturbed areas. Here, we present a draft genome of an O. cincta reference strain with an estimated size of 286.8 Mbp, containing 20,249 genes. In total, 446 gene families are expanded and 1,169 gene families evolved specific to this lineage. Besides these gene families involved in general biological processes, we observe gene clusters participating in xenobiotic biotransformation. Furthermore, we identified 253 cases of horizontal gene transfer (HGT). Although the largest percentage of them originated from bacteria (37.5%), we observe an unusually high percentage (30.4%) of such genes of fungal origin. The majority of foreign genes are involved in carbohydrate metabolism and cellulose degradation. Moreover, some foreign genes (e.g., bacillopeptidases) expanded after HGT. We hypothesize that horizontally transferred genes could be advantageous for food processing in a soil environment that is full of decaying organic material. Finally, we identified several lineage-specific genes, expanded gene families, and horizontally transferred genes, associated with altered gene expression as a consequence of genetic adaptation to metal stress. This suggests that these genome features may be preadaptations allowing natural selection to act on. In conclusion, this genome study provides a solid foundation for further analysis of evolutionary mechanisms of adaptation to environmental stressors. PMID:27289101

  16. Gene Family Evolution Reflects Adaptation to Soil Environmental Stressors in the Genome of the Collembolan Orchesella cincta.


    Faddeeva-Vakhrusheva, Anna; Derks, Martijn F L; Anvar, Seyed Yahya; Agamennone, Valeria; Suring, Wouter; Smit, Sandra; van Straalen, Nico M; Roelofs, Dick


    Collembola (springtails) are detritivorous hexapods that inhabit the soil and its litter layer. The ecology of the springtail Orchesella cincta is extensively studied in the context of adaptation to anthropogenically disturbed areas. Here, we present a draft genome of an O. cincta reference strain with an estimated size of 286.8 Mbp, containing 20,249 genes. In total, 446 gene families are expanded and 1,169 gene families evolved specific to this lineage. Besides these gene families involved in general biological processes, we observe gene clusters participating in xenobiotic biotransformation. Furthermore, we identified 253 cases of horizontal gene transfer (HGT). Although the largest percentage of them originated from bacteria (37.5%), we observe an unusually high percentage (30.4%) of such genes of fungal origin. The majority of foreign genes are involved in carbohydrate metabolism and cellulose degradation. Moreover, some foreign genes (e.g., bacillopeptidases) expanded after HGT. We hypothesize that horizontally transferred genes could be advantageous for food processing in a soil environment that is full of decaying organic material. Finally, we identified several lineage-specific genes, expanded gene families, and horizontally transferred genes, associated with altered gene expression as a consequence of genetic adaptation to metal stress. This suggests that these genome features may be preadaptations allowing natural selection to act on. In conclusion, this genome study provides a solid foundation for further analysis of evolutionary mechanisms of adaptation to environmental stressors.

  17. Identification of pathways, gene networks and paralogous gene families in Daphnia pulex responding to exposure to the toxic cyanobacterium Microcystis aeruginosa

    PubMed Central

    Asselman, Jana; De Coninck, Dieter IM; Glaholt, Stephen; Colbourne, John K; Janssen, Colin R; Shaw, Joseph R; De Schamphelaere, Karel AC


    Although cyanobacteria produce a wide range of natural toxins that impact aquatic organisms, food webs and water quality, the mechanisms of toxicity are still insufficiently understood. Here, we implemented a whole-genome expression microarray to identify pathways, gene networks and paralogous gene families responsive to Microcystis stress in Daphnia pulex. Therefore, neonates of a sensitive isolate were given a diet contaminated with Microcystis to contrast with those given a control diet for sixteen days. The microarray revealed 2247 differentially expressed (DE) genes (7.6% of the array) in response to Microcystis, of which 17% are lineage specific( i.e., these genes have no detectable homology to any other gene in currently available databases) and 49% are gene duplicates (paralogs). We identified four pathways/gene networks and eight paralogous gene families affected by Microcystis. Differential regulation of the ribosome, including 3 paralogous gene families encoding 40S, 60S and mitochondrial ribosomal proteins, suggests an impact of Microcystis on protein synthesis of D. pulex. In addition, differential regulation of the oxidative phosphorylation pathway (including the NADH ubquinone oxidoreductase gene family) and the trypsin paralogous gene family (a major component of the digestive system in D. pulex) could explain why fitness is reduced based on energy budget considerations. PMID:22799445

  18. Sequencing of TGF-β pathway genes in familial cases of intracranial aneurysm

    PubMed Central

    Santiago-Sim, Teresa; Mathew-Joseph, Sumy; Pannu, Hariyadarshi; Milewicz, Dianna M.; Seidman, Christine E.; Seidman, J.G.; Kim, Dong H.


    Background and Purpose Familial aggregation of intracranial aneurysms (IA) strongly suggests a genetic contribution to pathogenesis. However, genetic risk factors have yet to be defined. For families affected by aortic aneurysms, specific gene variants have been identified, many affecting the receptors to transforming growth factor-beta (TGF-β). In recent work, we found that aortic and intracranial aneurysms may share a common genetic basis in some families. We hypothesized, therefore, that mutations in TGF-β receptors might also play a role in IA pathogenesis. Methods To identify genetic variants in TGF-β and its receptors, TGFB1, TGFBR1, TGFBR2, ACVR1, TGFBR3 and ENG were directly sequenced in 44 unrelated patients with familial IA. Novel variants were confirmed by restriction digestion analyses, and allele frequencies were analyzed in cases versus individuals without known intracranial disease. Similarly, allele frequencies of a subset of known SNPs in each gene were also analyzed for association with IA. Results No mutations were found in TGFB1, TGFBR1, TGFBR2 or ACVR1. Novel variants identified in ENG (p.A60E) and TGFBR3 (p.W112R) were not detected in at least 892 reference chromosomes. ENG p.A60E showed significant association with familial IA in case-control studies (P = 0.0080). No association with IA could be found for any of the known polymorphisms tested. Conclusions Mutations in TGF-β receptor genes are not a major cause of IA. However, we identified rare variants in ENG and TGFBR3 that may be important for IA pathogenesis in a subset of families. PMID:19299629

  19. Structural, Functional, and Evolutionary Analysis of the Unusually Large Stilbene Synthase Gene Family in Grapevine1[W

    PubMed Central

    Parage, Claire; Tavares, Raquel; Réty, Stéphane; Baltenweck-Guyot, Raymonde; Poutaraud, Anne; Renault, Lauriane; Heintz, Dimitri; Lugan, Raphaël; Marais, Gabriel A.B.; Aubourg, Sébastien; Hugueney, Philippe


    Stilbenes are a small family of phenylpropanoids produced in a number of unrelated plant species, including grapevine (Vitis vinifera). In addition to their participation in defense mechanisms in plants, stilbenes, such as resveratrol, display important pharmacological properties and are postulated to be involved in the health benefits associated with a moderate consumption of red wine. Stilbene synthases (STSs), which catalyze the biosynthesis of the stilbene backbone, seem to have evolved from chalcone synthases (CHSs) several times independently in stilbene-producing plants. STS genes usually form small families of two to five closely related paralogs. By contrast, the sequence of grapevine reference genome (cv PN40024) has revealed an unusually large STS gene family. Here, we combine molecular evolution and structural and functional analyses to investigate further the high number of STS genes in grapevine. Our reannotation of the STS and CHS gene families yielded 48 STS genes, including at least 32 potentially functional ones. Functional characterization of nine genes representing most of the STS gene family diversity clearly indicated that these genes do encode for proteins with STS activity. Evolutionary analysis of the STS gene family revealed that both STS and CHS evolution are dominated by purifying selection, with no evidence for strong selection for new functions among STS genes. However, we found a few sites under different selection pressures in CHS and STS sequences, whose potential functional consequences are discussed using a structural model of a typical STS from grapevine that we developed. PMID:22961129

  20. Unequal rates of Y chromosome gene divergence during speciation of the family Ursidae.


    Nakagome, Shigeki; Pecon-Slattery, Jill; Masuda, Ryuichi


    Evolution of the bear family Ursidae is well investigated in terms of morphological, paleontological, and genetic features. However, several phylogenetic ambiguities occur within the subfamily Ursinae (the family Ursidae excluding the giant panda and spectacled bear), which may correlate with behavioral traits of female philopatry and male-biased dispersal which form the basis of the observed matriarchal population structure in these species. In the process of bear evolution, we investigate the premise that such behavioral traits may be reflected in patterns of variation among genes with different modes of inheritance: matrilineal mitochondrial DNA (mtDNA), patrilineal Y chromosome, biparentally inherited autosomes, and the X chromosome. In the present study, we sequenced 3 Y-linked genes (3,453 bp) and 4 X-linked genes (4,960 bp) and reanalyzed previously published sequences from autosome genes (2,347 bp) in ursid species to investigate differences in evolutionary rates associated with patterns of inheritance. The results describe topological incongruence between sex-linked genes and autosome genes and between nuclear DNA and mtDNA. In more ancestral branches within the bear phylogeny, Y-linked genes evolved faster than autosome and X-linked genes, consistent with expectations based on male-driven evolution. However, this pattern changes among branches leading to each species within the lineage of Ursinae whereby the evolutionary rates of Y-linked genes have fewer than expected substitutions. This inconsistency between more recent nodes of the bear phylogeny with more ancestral nodes may reflect the influences of sex-biased dispersal as well as molecular evolutionary characteristics of the Y chromosome, and stochastic events in species natural history, and phylogeography unique to ursine bears.